#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
NRAP	4892	broad.mit.edu	37	10	115374632	115374632	+	Missense_Mutation	SNP	T	T	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr10:115374632T>A	ENST00000359988.3	-	28	3396	c.3152A>T	c.(3151-3153)cAa>cTa	p.Q1051L	NRAP_ENST00000369358.4_Missense_Mutation_p.Q1059L|NRAP_ENST00000360478.3_Missense_Mutation_p.Q1016L|NRAP_ENST00000369360.3_Missense_Mutation_p.Q1024L	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CTTTGCTGCTTGGAATGGAAG	0.468																																						ENST00000359988.3	0.950000	0.260000	7.500000e-01	3.800000e-01	0.540000	0.569605	0.540000	0.510000																										0				95						c.(3151-3153)cAa>cTa		nebulin-related anchoring protein							169.0	148.0	155.0					10																	115374632		2203	4300	6503	SO:0001583	missense	4892	0	0					g.chr10:115374632T>A		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3152A>T	chr10.hg19:g.115374632T>A	ENSP00000353078:p.Gln1051Leu	0					NRAP_ENST00000369360.3_Missense_Mutation_p.Q1024L|NRAP_ENST00000369358.4_Missense_Mutation_p.Q1059L|NRAP_ENST00000360478.3_Missense_Mutation_p.Q1016L	p.Q1051L	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2	0	0	0	1.941532				28	3396	-		Colorectal(252;0.0233)|Breast(234;0.188)		Missense_Mutation	SNP	ENST00000359988.3	0	1	hg19	c.3152A>T	CCDS7579.1	0	.	.	.	.	.	.	.	.	.	.	T	18.25	3.582432	0.65992	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.66	4.52	0.55395	5.66	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	L	0.53249	1.67	0.42674	D	0.993527	D;D;P	0.89917	1.0;1.0;0.743	D;D;P	0.91635	0.999;0.999;0.798	T	0.54984	-0.8211	10	0.40728	T	0.16	.	11.6035	0.51017	0.0:0.0697:0.0:0.9303	.	1051;1016;1051	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	L	1059;1024;1051;1016	ENSP00000358365:Q1059L;ENSP00000358367:Q1024L;ENSP00000353078:Q1051L;ENSP00000353666:Q1016L	ENSP00000353078:Q1051L	Q	-	2	0	0	NRAP	115364622	115364622	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.562000	0.60816	0.972000	0.38314	0.533000	0.62120	CAA	0.067358		TCGA-US-A774-01A-21D-A32N-08	0.468	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	0	0	1	2	2	2	2	0	0	0	0	44	44	44	44	1	2	-8.941687	1	0.100000	NM_006175		0	8	8	0	279	276	0		1			0	0	44	0	0	0.989183	0	0	0	0	0	0	8	279
DCLRE1C	64421	broad.mit.edu	37	10	14976718	14976718	+	Missense_Mutation	SNP	T	T	C			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr10:14976718T>C	ENST00000378278.2	-	7	558	c.521A>G	c.(520-522)tAc>tGc	p.Y174C	DCLRE1C_ENST00000396817.2_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378289.4_Missense_Mutation_p.Y174C|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.Y59C|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.Y59C|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.Y59C			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	174					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TGGAATTTGGTAAAATCTTGG	0.398								Non-homologous end-joining																														ENST00000378278.2	1.000000	0.770000	1	9.000000e-01	0.990000	0.966302	0.990000	1.000000																										0				17						c.(520-522)tAc>tGc	Non-homologous end-joining	DNA cross-link repair 1C							145.0	139.0	141.0					10																	14976718		2203	4300	6503	SO:0001583	missense	64421	0	0					g.chr10:14976718T>C	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.521A>G	chr10.hg19:g.14976718T>C	ENSP00000367527:p.Tyr174Cys	0					DCLRE1C_ENST00000378254.1_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378289.4_Missense_Mutation_p.Y174C|DCLRE1C_ENST00000378246.2_Missense_Mutation_p.Y59C|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.Y59C|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.Y54C|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.Y59C	p.Y174C			0	0	0	1.941532	Q96SD1	DCR1C_HUMAN		7	558	-			D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	ENST00000378278.2	1	1	hg19	c.521A>G	CCDS31149.1	1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.328605	0.60743	.	.	ENSG00000152457	ENST00000378289;ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000418843;ENST00000378241	T;T;T;T;T;T;T;T;T;T;T;T	0.80393	-1.23;-0.76;-0.77;-0.77;-0.77;-0.76;-0.76;-0.76;-1.34;-0.76;-1.37;-0.76	4.85	3.7	0.42460	4.85	3.7	0.42460	Beta-lactamase-like (1);	0.055752	0.85682	D	0.000000	D	0.85600	0.5734	M	0.64997	1.995	0.48830	D	0.999716	P;D;P	0.69078	0.893;0.997;0.937	P;D;P	0.63033	0.753;0.91;0.762	D	0.85634	0.1272	10	0.72032	D	0.01	.	11.1815	0.48631	0.1379:0.0:0.0:0.8621	.	174;59;174	Q96SD1-4;Q96SD1-3;Q96SD1	.;.;DCR1C_HUMAN	C	174;54;59;59;59;54;54;54;174;54;28;54	ENSP00000367538:Y174C;ENSP00000400529:Y54C;ENSP00000367492:Y59C;ENSP00000350349:Y59C;ENSP00000367496:Y59C;ENSP00000380030:Y54C;ENSP00000367503:Y54C;ENSP00000367502:Y54C;ENSP00000367527:Y174C;ENSP00000367506:Y54C;ENSP00000391428:Y28C;ENSP00000367487:Y54C	ENSP00000350349:Y59C	Y	-	2	0	0	DCLRE1C	15016724	15016724	1.000000	0.71417	0.989000	0.46669	0.750000	0.42670	4.892000	0.63193	0.785000	0.33685	-0.309000	0.09137	TAC	0.067358		TCGA-US-A774-01A-21D-A32N-08	0.398	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	1	0	1	2	2	2	2	0	0	0	0	121	121	121	117	1	2	-20.000000	1	0.100000	NM_022487		0	40	40	0	675	663	0		1	1		0	0	121	0	0	1.000000	1.687906e-01	0	4	0	9	0	40	675
GPR158	57512	broad.mit.edu	37	10	25510077	25510077	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr10:25510077C>A	ENST00000376351.3	+	2	1358	c.999C>A	c.(997-999)aaC>aaA	p.N333K		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	333					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GCCACCTCAACAATTCAGAGG	0.363																																						ENST00000376351.3	1.000000	0.580000	1	7.700000e-01	0.980000	0.911967	0.980000	1.000000																										0				119						c.(997-999)aaC>aaA		G protein-coupled receptor 158							89.0	89.0	89.0					10																	25510077		2203	4300	6503	SO:0001583	missense	57512	0	0					g.chr10:25510077C>A	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.999C>A	chr10.hg19:g.25510077C>A	ENSP00000365529:p.Asn333Lys	0						p.N333K	NM_020752.2	NP_065803.2	0	0	0	1.941532	Q5T848	GP158_HUMAN		2	1358	+			Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	1	1	hg19	c.999C>A	CCDS31166.1	1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.842654	0.51057	.	.	ENSG00000151025	ENST00000376351	T	0.59906	0.23	5.37	3.51	0.40186	5.37	3.51	0.40186	.	0.157867	0.42053	D	0.000778	T	0.66877	0.2834	L	0.49640	1.575	0.39032	D	0.959954	D	0.67145	0.996	D	0.65684	0.937	T	0.65845	-0.6069	10	0.46703	T	0.11	.	11.8361	0.52325	0.0:0.7809:0.0:0.2191	.	333	Q5T848	GP158_HUMAN	K	333	ENSP00000365529:N333K	ENSP00000365529:N333K	N	+	3	2	2	GPR158	25550083	25550083	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	1.005000	0.29834	0.266000	0.21894	-1.119000	0.02030	AAC	0.067358		TCGA-US-A774-01A-21D-A32N-08	0.363	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	1	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	2	-16.020890	1	0.100000	XM_166110		0	13	13	0	220	214	0		1			0	0	38	0	0	0.999498	0	0	0	0	0	0	13	220
RBP3	5949	broad.mit.edu	37	10	48387849	48387849	+	Missense_Mutation	SNP	C	C	T	rs149031179		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr10:48387849C>T	ENST00000224600.4	-	1	3142	c.3029G>A	c.(3028-3030)cGc>cAc	p.R1010H	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1010	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)	p.R1010H(1)		central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TCCAGGAATGCGGTCCTTGGC	0.597																																						ENST00000224600.4	0.350000	0.070000	2.700000e-01	1.100000e-01	0.180000	0.197180	0.180000	0.170000																										1	Substitution - Missense(1)	p.R1010H(1)	prostate(1)	59						c.(3028-3030)cGc>cAc		retinol binding protein 3, interstitial	Vitamin A(DB00162)						97.0	105.0	102.0					10																	48387849		2203	4300	6503	SO:0001583	missense	5949	2	121412	39				g.chr10:48387849C>T	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3029G>A	chr10.hg19:g.48387849C>T	ENSP00000224600:p.Arg1010His	0					AL731561.2_ENST00000581861.1_RNA	p.R1010H	NM_002900.2	NP_002891.1	0	0	0	1.941532	P10745	RET3_HUMAN		1	3142	-			Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	0	1	hg19	c.3029G>A	CCDS7218.1	0	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850487	0.32699	.	.	ENSG00000107618	ENST00000224600	T	0.64260	-0.09	5.28	3.4	0.38934	5.28	3.4	0.38934	.	0.253639	0.45867	N	0.000323	T	0.55909	0.1950	L	0.59436	1.845	0.29650	N	0.844067	B	0.13145	0.007	B	0.08055	0.003	T	0.53753	-0.8394	10	0.42905	T	0.14	-8.7331	10.976	0.47467	0.0:0.8467:0.0:0.1533	.	1010	P10745	RET3_HUMAN	H	1010	ENSP00000224600:R1010H	ENSP00000224600:R1010H	R	-	2	0	0	RBP3	48007855	48007855	0.997000	0.39634	0.992000	0.48379	0.990000	0.78478	0.507000	0.22675	0.593000	0.29745	0.655000	0.94253	CGC	0.067358		TCGA-US-A774-01A-21D-A32N-08	0.597	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	0	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	2	-1.834889	0	0.100000	NM_002900		0	6	6	0	663	654	0		1			0	0	102	0	0	0.963421	0	0	0	0	0	0	6	663
DHX32	55760	broad.mit.edu	37	10	127540897	127540897	+	Missense_Mutation	SNP	G	G	A	rs143704757	byFrequency	TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr10:127540897G>A	ENST00000284690.3	-	6	1806	c.1316C>T	c.(1315-1317)gCg>gTg	p.A439V	BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000284688.6_Missense_Mutation_p.A358V|DHX32_ENST00000368721.1_Missense_Mutation_p.A63V	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	439						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GCCTAGGCCCGCAATGTCTAT	0.498																																						ENST00000284690.3	0.840000	0.160000	6.400000e-01	2.700000e-01	0.430000	0.462546	0.430000	0.390000																										0				29						c.(1315-1317)gCg>gTg		DEAH (Asp-Glu-Ala-His) box polypeptide 32		G	,VAL/ALA	0,4406		0,0,2203	153.0	141.0	145.0		,1316	5.7	1.0	10	dbSNP_134	145	4,8596	3.7+/-12.6	0,4,4296	yes	intron,missense	DHX32,BCCIP	NM_016567.3,NM_018180.2	,64	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	,probably-damaging	,439/744	127540897	4,13002	2203	4300	6503	SO:0001583	missense	55760	55	121410	48				g.chr10:127540897G>A		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1316C>T	chr10.hg19:g.127540897G>A	ENSP00000284690:p.Ala439Val	0					DHX32_ENST00000368721.1_Missense_Mutation_p.A63V|BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000284688.6_Missense_Mutation_p.A358V	p.A439V	NM_018180.2	NP_060650.2	0	0	0	1.941532	Q7L7V1	DHX32_HUMAN		6	1806	-		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	ENST00000284690.3	0	1	hg19	c.1316C>T	CCDS7652.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.067881	0.93950	0.0	4.65E-4	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	T;T;T	0.18016	2.24;3.99;3.72	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.056069	0.64402	D	0.000001	T	0.39517	0.1081	L	0.52364	1.645	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.939;0.996	T	0.06162	-1.0842	10	0.87932	D	0	-28.254	18.885	0.92372	0.0:0.0:1.0:0.0	.	358;439	Q7L7V1-2;Q7L7V1	.;DHX32_HUMAN	V	63;439;358	ENSP00000357710:A63V;ENSP00000284690:A439V;ENSP00000284688:A358V	ENSP00000284688:A358V	A	-	2	0	0	DHX32	127530887	127530887	1.000000	0.71417	0.978000	0.43139	0.977000	0.68977	7.429000	0.80309	2.691000	0.91804	0.655000	0.94253	GCG	0.067358		TCGA-US-A774-01A-21D-A32N-08	0.498	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2	0	0	1	2	2	2	2	0	0	0	0	49	49	49	47	1	2	-2.966195	1	0.100000	NM_018180		0	5	5	0	228	226	0		1	0		0	0	49	0	0	0.936793	4.789757e-01	0	0	0	66	0	5	228
TTC17	55761	broad.mit.edu	37	11	43429013	43429013	+	Silent	SNP	A	A	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr11:43429013A>T	ENST00000039989.4	+	15	1964	c.1950A>T	c.(1948-1950)ccA>ccT	p.P650P	TTC17_ENST00000526774.1_3'UTR|TTC17_ENST00000299240.6_Silent_p.P650P	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	650					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						ATTTAGCTCCACTTCAATACC	0.438																																						ENST00000039989.4	1.000000	0.760000	1	9.900000e-01	0.990000	0.980553	0.990000	1.000000																										0				53						c.(1948-1950)ccA>ccT		tetratricopeptide repeat domain 17							127.0	107.0	114.0					11																	43429013		2203	4300	6503	SO:0001819	synonymous_variant	55761	0	0					g.chr11:43429013A>T	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.1950A>T	chr11.hg19:g.43429013A>T		0					TTC17_ENST00000299240.6_Silent_p.P650P|TTC17_ENST00000526774.1_3'UTR	p.P650P	NM_018259.5	NP_060729.2	1	2	3	2.025367	Q96AE7	TTC17_HUMAN		15	1964	+			G3XAB3|Q8NEC0	Silent	SNP	ENST00000039989.4	1	1	hg19	c.1950A>T	CCDS31466.1	1																																																																																								0.111111		TCGA-US-A774-01A-21D-A32N-08	0.438	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	2	-18.576330	1	0.100000	NM_018259		0	15	15	0	227	223	1		1	1		0	0	32	0	0	0.999867	9.281515e-01	0	12	0	59	0	15	227
OR5D14	219436	broad.mit.edu	37	11	55563840	55563840	+	Missense_Mutation	SNP	G	G	A	rs183124098	byFrequency	TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr11:55563840G>A	ENST00000335605.1	+	1	809	c.809G>A	c.(808-810)cGg>cAg	p.R270Q		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				AAAAACTCTCGGCAAACAGTC	0.478													N|||	2	0.000399361	0.0	0.0014	5008	,	,		17122	0.001		0.0	False		,,,				2504	0.0					ENST00000335605.1	1.000000	0.110000	1	2.100000e-01	0.370000	0.475706	0.370000	0.290000																										0				48						c.(808-810)cGg>cAg		olfactory receptor, family 5, subfamily D, member 14							74.0	68.0	70.0					11																	55563840		2200	4296	6496	SO:0001583	missense	219436	2	121404	44				g.chr11:55563840G>A	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.809G>A	chr11.hg19:g.55563840G>A	ENSP00000334456:p.Arg270Gln	0						p.R270Q	NM_001004735.1	NP_001004735.1	1	2	3	2.025367	Q8NGL3	OR5DE_HUMAN		1	809	+		all_epithelial(135;0.196)	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	0	1	hg19	c.809G>A	CCDS31508.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	g	6.790	0.514742	0.12944	.	.	ENSG00000186113	ENST00000335605	T	0.00107	8.72	5.08	-1.69	0.08186	5.08	-1.69	0.08186	GPCR, rhodopsin-like superfamily (1);	0.373489	0.18403	N	0.142284	T	0.00073	0.0002	N	0.04063	-0.285	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25847	-1.0120	10	0.59425	D	0.04	-0.0228	5.3998	0.16288	0.3914:0.0:0.4431:0.1655	.	270	Q8NGL3	OR5DE_HUMAN	Q	270	ENSP00000334456:R270Q	ENSP00000334456:R270Q	R	+	2	0	0	OR5D14	55320416	55320416	0.000000	0.05858	0.000000	0.03702	0.593000	0.36681	-2.267000	0.01170	-0.577000	0.05967	-0.829000	0.03081	CGG	0.111111		TCGA-US-A774-01A-21D-A32N-08	0.478	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	2	-2.917380	1	0.100000	NM_001004735		0	4	4	0	266	261	0		1			0	0	45	0	0	0.885731	0	0	0	0	0	0	4	266
RBMXL2	27288	broad.mit.edu	37	11	7111053	7111053	+	Silent	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr11:7111053G>A	ENST00000306904.5	+	1	889	c.702G>A	c.(700-702)tcG>tcA	p.S234S		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	234	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TTGCCCCCTCGCCCGGAGAGT	0.687																																						ENST00000306904.5	1.000000	0.780000	1	9.900000e-01	0.990000	0.985356	0.990000	1.000000																										0				15						c.(700-702)tcG>tcA		RNA binding motif protein, X-linked-like 2							17.0	19.0	18.0					11																	7111053		2189	4272	6461	SO:0001819	synonymous_variant	27288	0	0					g.chr11:7111053G>A	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.702G>A	chr11.hg19:g.7111053G>A		0						p.S234S	NM_014469.4	NP_055284.3	1	2	3	2.025367	O75526	RMXL2_HUMAN		1	889	+			Q6PEZ2|Q9NQU0	Silent	SNP	ENST00000306904.5	0	1	hg19	c.702G>A	CCDS7777.1	1																																																																																								0.111111		TCGA-US-A774-01A-21D-A32N-08	0.687	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384552.1	0	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	2	-16.904900	1	0.100000	NM_014469		0	12	11	0	164	162	0		1	0		0	0	25	0	0	0.999134	0	0	1	0	0	0	12	164
DRAP1	10589	broad.mit.edu	37	11	65687891	65687891	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr11:65687891A>G	ENST00000312515.2	+	4	532	c.287A>G	c.(286-288)gAc>gGc	p.D96G	C11orf68_ENST00000438576.2_5'Flank|DRAP1_ENST00000532933.1_Missense_Mutation_p.D76G|C11orf68_ENST00000530188.1_5'Flank|DRAP1_ENST00000376991.2_Missense_Mutation_p.D96G|C11orf68_ENST00000449692.3_5'Flank|DRAP1_ENST00000527119.1_Missense_Mutation_p.D52G	NM_006442.3	NP_006433.2	Q14919	NC2A_HUMAN	DR1-associated protein 1 (negative cofactor 2 alpha)	96					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(1)	5				READ - Rectum adenocarcinoma(159;0.166)		ATGCAGGGGGACGGGGAAGAC	0.637																																						ENST00000312515.2	1.000000	0.070000	1	1.300000e-01	0.200000	0.337206	0.200000	0.180000																										0				5						c.(286-288)gAc>gGc		DR1-associated protein 1 (negative cofactor 2 alpha)							72.0	79.0	76.0					11																	65687891		2201	4296	6497	SO:0001583	missense	10589	0	0					g.chr11:65687891A>G	U41843	CCDS8123.1	11q13	2010-09-29			ENSG00000175550	ENSG00000175550			3019	protein-coding gene	gene with protein product	"""negative cofactor 2 alpha"", ""DR1-associated corepressor"""	602289				8608938	Standard	NM_006442		Approved	NC2-alpha	uc001ogj.2	Q14919	OTTHUMG00000166723	ENST00000312515.2:c.287A>G	chr11.hg19:g.65687891A>G	ENSP00000307850:p.Asp96Gly	0					C11orf68_ENST00000530188.1_5'Flank|DRAP1_ENST00000376991.2_Missense_Mutation_p.D96G|C11orf68_ENST00000438576.2_5'Flank|DRAP1_ENST00000532933.1_Missense_Mutation_p.D76G|C11orf68_ENST00000449692.3_5'Flank|DRAP1_ENST00000527119.1_Missense_Mutation_p.D52G	p.D96G	NM_006442.3	NP_006433.2	1	2	3	2.021243	Q14919	NC2A_HUMAN		4	532	+			Q13448	Missense_Mutation	SNP	ENST00000312515.2	0	1	hg19	c.287A>G	CCDS8123.1	0	.	.	.	.	.	.	.	.	.	.	A	15.43	2.831383	0.50845	.	.	ENSG00000175550	ENST00000312515;ENST00000525501;ENST00000376991;ENST00000527119;ENST00000532933	.	.	.	4.33	4.33	0.51752	4.33	4.33	0.51752	Histone-fold (1);	0.062082	0.64402	D	0.000008	T	0.48786	0.1519	L	0.48642	1.525	0.58432	D	0.999999	B	0.34015	0.435	B	0.32393	0.145	T	0.51332	-0.8719	9	0.44086	T	0.13	-6.8611	11.7748	0.51979	1.0:0.0:0.0:0.0	.	96	Q14919	NC2A_HUMAN	G	96;57;96;52;76	.	ENSP00000307850:D96G	D	+	2	0	0	DRAP1	65444467	65444467	1.000000	0.71417	0.926000	0.36857	0.587000	0.36485	8.228000	0.89789	1.744000	0.51775	0.533000	0.62120	GAC	0.110232		TCGA-US-A774-01A-21D-A32N-08	0.637	DRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391197.2	0	0	1	2	2	2	2	0	0	0	0	131	131	131	128	1	2	-2.433144	0	0.100000	NM_006442		0	6	6	0	683	668	0		1	0		0	0	131	0	0	0.962619	9.116880e-01	0	1	0	494	0	6	683
PANX1	24145	broad.mit.edu	37	11	93913034	93913034	+	Missense_Mutation	SNP	G	G	A	rs189649511		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr11:93913034G>A	ENST00000227638.3	+	4	1197	c.812G>A	c.(811-813)gGc>gAc	p.G271D	PANX1_ENST00000436171.2_Missense_Mutation_p.G271D	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	271					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	ATTGCCGTGGGCATCTTCCAG	0.502																																						ENST00000227638.3	1.000000	0.060000	1	1.100000e-01	0.180000	0.316886	0.180000	0.160000																										0				20						c.(811-813)gGc>gAc		pannexin 1	Probenecid(DB01032)						315.0	270.0	285.0					11																	93913034		2201	4298	6499	SO:0001583	missense	24145	0	0					g.chr11:93913034G>A	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.812G>A	chr11.hg19:g.93913034G>A	ENSP00000227638:p.Gly271Asp	0					PANX1_ENST00000436171.2_Missense_Mutation_p.G271D	p.G271D	NM_015368.3	NP_056183.2	1	2	3	2.021243	Q96RD7	PANX1_HUMAN		4	1197	+		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	0	1	hg19	c.812G>A	CCDS8296.1	0	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102161	0.76983	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.19669	2.13;2.13	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.52273	0.1724	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.49341	-0.8950	10	0.52906	T	0.07	-36.6712	19.9882	0.97356	0.0:0.0:1.0:0.0	.	271;271	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	D	271	ENSP00000227638:G271D;ENSP00000411461:G271D	ENSP00000227638:G271D	G	+	2	0	0	PANX1	93552682	93552682	1.000000	0.71417	0.906000	0.35671	0.256000	0.26092	7.453000	0.80700	2.824000	0.97209	0.655000	0.94253	GGC	0.110232		TCGA-US-A774-01A-21D-A32N-08	0.502	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	0	0	1	2	2	2	2	0	0	0	0	142	142	142	142	1	2	-2.209557	0	0.100000	NM_015368		0	6	6	0	779	766	0		1	0		0	0	142	0	0	0.963198	1.605851e-01	0	0	0	79	0	6	779
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.440000	1	7.400000e-01	0.990000	0.911241	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	2	3	2.068484	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.120664		TCGA-US-A774-01A-21D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1	2	2	2	2	0	0	0	0	15	15	15	15	1	2	-4.379355	1	0.100000	NM_033360		322	5	5	7702	96	95	0	1	1	1	1	0	0	15	322	1	0.937533	5.997426e-01	9.979955e-01	6	17	31	255	5	96
DNM1L	10059	broad.mit.edu	37	12	32884346	32884346	+	Silent	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr12:32884346G>A	ENST00000549701.1	+	11	1331	c.1257G>A	c.(1255-1257)cgG>cgA	p.R419R	YARS2_ENST00000551673.1_Intron|DNM1L_ENST00000547312.1_Silent_p.R419R|DNM1L_ENST00000553257.1_Silent_p.R432R|DNM1L_ENST00000452533.2_Silent_p.R419R|DNM1L_ENST00000414834.2_Silent_p.R216R|DNM1L_ENST00000358214.5_Silent_p.R432R|DNM1L_ENST00000266481.6_Silent_p.R419R|DNM1L_ENST00000381000.4_Silent_p.R432R			O00429	DNM1L_HUMAN	dynamin 1-like	419	Middle domain.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TGGTGAAGCGGCAAATCAAAC	0.418																																						ENST00000549701.1	0.430000	0.080000	3.200000e-01	1.300000e-01	0.210000	0.235653	0.210000	0.200000																										0				23						c.(1255-1257)cgG>cgA		dynamin 1-like							111.0	115.0	113.0					12																	32884346		2203	4300	6503	SO:0001819	synonymous_variant	10059	1	121412	32				g.chr12:32884346G>A	AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.1257G>A	chr12.hg19:g.32884346G>A		0					DNM1L_ENST00000414834.2_Silent_p.R216R|DNM1L_ENST00000547312.1_Silent_p.R419R|DNM1L_ENST00000358214.5_Silent_p.R432R|DNM1L_ENST00000381000.4_Silent_p.R432R|YARS2_ENST00000551673.1_Intron|DNM1L_ENST00000266481.6_Silent_p.R419R|DNM1L_ENST00000553257.1_Silent_p.R432R|DNM1L_ENST00000452533.2_Silent_p.R419R	p.R419R			0	1	1	1.952839	O00429	DNM1L_HUMAN		11	1331	+	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	Silent	SNP	ENST00000549701.1	0	1	hg19	c.1257G>A	CCDS8729.1	0																																																																																								0.071207		TCGA-US-A774-01A-21D-A32N-08	0.418	DNM1L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404124.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	68	1	2	-2.038814	0	0.100000	NM_012062		0	5	5	0	473	465	0		1	0		0	0	68	0	0	0.935037	1.605074e-01	0	0	0	55	0	5	473
DDX23	9416	broad.mit.edu	37	12	49224974	49224974	+	Missense_Mutation	SNP	G	G	C			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr12:49224974G>C	ENST00000308025.3	-	16	2269	c.2190C>G	c.(2188-2190)atC>atG	p.I730M		NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	730	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						ACACATCTTGGATGTCAATAC	0.468																																						ENST00000308025.3	0.310000	0.060000	2.400000e-01	1.000000e-01	0.160000	0.176572	0.160000	0.150000																										0				36						c.(2188-2190)atC>atG		DEAD (Asp-Glu-Ala-Asp) box polypeptide 23							165.0	150.0	155.0					12																	49224974		2203	4300	6503	SO:0001583	missense	9416	0	0					g.chr12:49224974G>C	AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.2190C>G	chr12.hg19:g.49224974G>C	ENSP00000310723:p.Ile730Met	0						p.I730M	NM_004818.2	NP_004809.2	0	1	1	1.952839	Q9BUQ8	DDX23_HUMAN		16	2269	-			B2R600|B4DH15|O43188	Missense_Mutation	SNP	ENST00000308025.3	0	1	hg19	c.2190C>G	CCDS8770.1	0	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471899	0.63737	.	.	ENSG00000174243	ENST00000308025	T	0.78816	-1.21	5.75	0.262	0.15597	5.75	0.262	0.15597	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.87803	0.6269	M	0.90595	3.13	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.87059	0.2152	10	0.87932	D	0	-13.0005	10.1741	0.42929	0.4713:0.0:0.5287:0.0	.	730	Q9BUQ8	DDX23_HUMAN	M	730	ENSP00000310723:I730M	ENSP00000310723:I730M	I	-	3	3	3	DDX23	47511241	47511241	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	1.010000	0.29898	0.103000	0.17682	0.655000	0.94253	ATC	0.071207		TCGA-US-A774-01A-21D-A32N-08	0.468	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2	0	0	1	2	18	4	2	1	1	1	1	144	144	144	141	1	2	-2.632509	1	0.100000	NM_004818		0	6	6	0	747	738	0		0	0		1	0	144	0	0	0.009904	1.097687e-02	0	1	0	80	0	6	747
ARF3	377	broad.mit.edu	37	12	49334797	49334797	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr12:49334797C>T	ENST00000256682.4	-	2	416	c.82G>A	c.(82-84)Gca>Aca	p.A28T	RP11-302B13.5_ENST00000398092.4_Missense_Mutation_p.A28T|ARF3_ENST00000541959.1_Missense_Mutation_p.A28T|AC073610.5_ENST00000537495.1_5'Flank|ARF3_ENST00000447318.2_Missense_Mutation_p.A28T|ARF3_ENST00000541967.1_5'Flank	NM_001659.2	NP_001650.1	P61204	ARF3_HUMAN	ADP-ribosylation factor 3	28					GTP catabolic process (GO:0006184)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|skin(1)	4						GTCTTTCCTGCGGCATCCAGG	0.527																																					Pancreas(189;1862 2134 4419 30933 49364)	ENST00000256682.4	0.340000	0.080000	2.700000e-01	1.300000e-01	0.190000	0.203698	0.190000	0.180000																										0				4						c.(82-84)Gca>Aca		ADP-ribosylation factor 3							251.0	212.0	225.0					12																	49334797		2203	4300	6503	SO:0001583	missense	377	0	0					g.chr12:49334797C>T	M74491	CCDS8774.1	12q13.12	2013-01-22			ENSG00000134287	ENSG00000134287		"""ADP-ribosylation factors"""	654	protein-coding gene	gene with protein product	"""small GTP binding protein"""	103190				8661066	Standard	NM_001659		Approved		uc001rsr.2	P61204	OTTHUMG00000168080	ENST00000256682.4:c.82G>A	chr12.hg19:g.49334797C>T	ENSP00000256682:p.Ala28Thr	0					AC073610.5_ENST00000537495.1_5'Flank|ARF3_ENST00000541959.1_Missense_Mutation_p.A28T|ARF3_ENST00000541967.1_5'Flank|ARF3_ENST00000447318.2_Missense_Mutation_p.A28T|RP11-302B13.5_ENST00000398092.4_Missense_Mutation_p.A28T	p.A28T	NM_001659.2	NP_001650.1	0	1	1	1.952839	P61204	ARF3_HUMAN		2	416	-			A8K6G8|B7ZB63|P16587	Missense_Mutation	SNP	ENST00000256682.4	0	1	hg19	c.82G>A	CCDS8774.1	0	.	.	.	.	.	.	.	.	.	.	C	24.8	4.567213	0.86439	.	.	ENSG00000134287	ENST00000398092;ENST00000256682;ENST00000447318;ENST00000541959;ENST00000541236;ENST00000539611;ENST00000545855	T;T;D;T;T;T;T	0.84070	-0.77;-0.77;-1.8;-0.77;-0.77;-0.77;-0.77	4.96	4.96	0.65561	4.96	4.96	0.65561	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.94437	0.8210	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.75484	0.888;0.986	D	0.96383	0.9283	10	0.87932	D	0	.	17.3435	0.87304	0.0:1.0:0.0:0.0	.	28;28	B7ZB63;P61204	.;ARF3_HUMAN	T	28	ENSP00000438507:A28T;ENSP00000256682:A28T;ENSP00000395370:A28T;ENSP00000438510:A28T;ENSP00000438063:A28T;ENSP00000437374:A28T;ENSP00000446353:A28T	ENSP00000256682:A28T	A	-	1	0	0	ARF3	47621064	47621064	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	6.049000	0.71053	2.476000	0.83614	0.561000	0.74099	GCA	0.071207		TCGA-US-A774-01A-21D-A32N-08	0.527	ARF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258242.2	0	0	1	2	20	10	2	1	1	1	1	139	139	139	138	1	2	-1.929469	0	0.100000	NM_001659		0	8	10	0	833	813	0		0	0		1	0	139	0	0	0.014683	1.362271e-02	0	1	0	334	0	8	833
TRHDE	29953	broad.mit.edu	37	12	72667194	72667194	+	Silent	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr12:72667194G>A	ENST00000261180.4	+	1	732	c.636G>A	c.(634-636)ccG>ccA	p.P212P	TRHDE-AS1_ENST00000426250.3_RNA|TRHDE-AS1_ENST00000550334.1_RNA|TRHDE-AS1_ENST00000435350.1_RNA	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	212					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TCCTCTACCCGCAAACCCAGG	0.567																																						ENST00000261180.4	0.500000	0.100000	3.800000e-01	1.700000e-01	0.260000	0.281776	0.260000	0.250000																										0				79						c.(634-636)ccG>ccA		thyrotropin-releasing hormone degrading enzyme							60.0	59.0	60.0					12																	72667194		2203	4300	6503	SO:0001819	synonymous_variant	29953	0	0					g.chr12:72667194G>A	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.636G>A	chr12.hg19:g.72667194G>A		0					TRHDE-AS1_ENST00000550334.1_RNA|TRHDE-AS1_ENST00000426250.3_RNA|TRHDE-AS1_ENST00000435350.1_RNA	p.P212P	NM_013381.2	NP_037513.1	0	1	1	1.952839	Q9UKU6	TRHDE_HUMAN		1	732	+			A5PL19|Q6UWJ4	Silent	SNP	ENST00000261180.4	0	1	hg19	c.636G>A	CCDS9004.1	0																																																																																								0.071207		TCGA-US-A774-01A-21D-A32N-08	0.567	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	0	0	1	2	18	2	2	1	1	1	1	87	87	87	87	1	2	-2.489759	0	0.100000	NM_013381		0	6	6	0	460	454	0		0	0		1	0	87	0	0	0.009493	3.636207e-03	0	0	0	6	0	6	460
TNFRSF19	55504	broad.mit.edu	37	13	24242948	24242948	+	Silent	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr13:24242948C>T	ENST00000382258.4	+	9	1161	c.957C>T	c.(955-957)aaC>aaT	p.N319N	TNFRSF19_ENST00000248484.4_Silent_p.N319N|TNFRSF19_ENST00000403372.2_Silent_p.N187N|TNFRSF19_ENST00000382263.3_Silent_p.N319N	NM_018647.3	NP_061117.2	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily, member 19	319					apoptotic process (GO:0006915)|hair follicle development (GO:0001942)|JNK cascade (GO:0007254)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)	tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	22		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		GTGGTGACAACATCTCTTTTT	0.478																																						ENST00000382258.4	1.000000	0.730000	1	8.800000e-01	0.990000	0.959416	0.990000	1.000000																										0				22						c.(955-957)aaC>aaT		tumor necrosis factor receptor superfamily, member 19							168.0	158.0	161.0					13																	24242948		2203	4300	6503	SO:0001819	synonymous_variant	55504	0	0					g.chr13:24242948C>T	AB040434	CCDS9301.1, CCDS9302.1, CCDS55893.1	13q12.11-q12.3	2008-07-18			ENSG00000127863	ENSG00000127863		"""Tumor necrosis factor receptor superfamily"""	11915	protein-coding gene	gene with protein product	"""toxicity and JNK inducer"""	606122				10764796, 10809768	Standard	NM_018647		Approved	TAJ-alpha, TROY, TAJ, TRADE	uc001uov.2	Q9NS68	OTTHUMG00000016568	ENST00000382258.4:c.957C>T	chr13.hg19:g.24242948C>T		0					TNFRSF19_ENST00000403372.2_Silent_p.N187N|TNFRSF19_ENST00000248484.4_Silent_p.N319N|TNFRSF19_ENST00000382263.3_Silent_p.N319N	p.N319N	NM_018647.3	NP_061117.2	1	2	3	2.023831	Q9NS68	TNR19_HUMAN		9	1161	+		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)	A8KA09|A8KA26|B1AM40|B1AM41|B4E2I6|Q9BXZ9|Q9BY00|Q9NZV2	Silent	SNP	ENST00000382258.4	1	1	hg19	c.957C>T	CCDS9302.1	1																																																																																								0.110672		TCGA-US-A774-01A-21D-A32N-08	0.478	TNFRSF19-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044156.2	1	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	2	-6.023837	1	0.100000	NM_018647		0	33	33	0	617	609	0		1	0		0	0	115	0	0	1.000000	3.932415e-01	0	0	0	26	0	33	617
KCNH5	27133	broad.mit.edu	37	14	63511901	63511901	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr14:63511901G>A	ENST00000322893.7	-	1	272	c.4C>T	c.(4-6)Ccg>Tcg	p.P2S	KCNH5_ENST00000420622.2_Missense_Mutation_p.P2S|KCNH5_ENST00000394964.2_Intron|KCNH5_ENST00000394968.1_Intron	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	2					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTGCCCCCCGGCATCCTGGGT	0.602																																						ENST00000322893.7	1.000000	0.160000	1	2.700000e-01	0.450000	0.530844	0.450000	0.360000																										0				99						c.(4-6)Ccg>Tcg		potassium voltage-gated channel, subfamily H (eag-related), member 5							53.0	47.0	49.0					14																	63511901		2203	4300	6503	SO:0001583	missense	27133	0	0					g.chr14:63511901G>A	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.4C>T	chr14.hg19:g.63511901G>A	ENSP00000321427:p.Pro2Ser	0					KCNH5_ENST00000420622.2_Missense_Mutation_p.P2S|KCNH5_ENST00000394968.1_Intron|KCNH5_ENST00000394964.2_Intron	p.P2S	NM_139318.3	NP_647479.2	1	2	3	2.020912	Q8NCM2	KCNH5_HUMAN		1	272	-			C9JP98	Missense_Mutation	SNP	ENST00000322893.7	0	1	hg19	c.4C>T	CCDS9756.1	0	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743568	0.69418	.	.	ENSG00000140015	ENST00000322893;ENST00000420622	D;D	0.98876	-5.2;-5.06	5.23	5.23	0.72850	5.23	5.23	0.72850	.	0.052087	0.85682	D	0.000000	D	0.98248	0.9420	M	0.72118	2.19	0.80722	D	1	P;P	0.37548	0.538;0.599	P;B	0.44359	0.447;0.103	D	0.99806	1.1038	10	0.87932	D	0	.	16.6453	0.85175	0.0:0.0:1.0:0.0	.	2;2	Q8NCM2-2;Q8NCM2	.;KCNH5_HUMAN	S	2	ENSP00000321427:P2S;ENSP00000395439:P2S	ENSP00000321427:P2S	P	-	1	0	0	KCNH5	62581654	62581654	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	8.118000	0.89577	2.611000	0.88343	0.563000	0.77884	CCG	0.110232		TCGA-US-A774-01A-21D-A32N-08	0.602	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	0	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	2	-4.052912	1	0.100000	NM_139318		0	5	6	0	263	258	0		1			0	0	54	0	0	0.935626	0	0	0	0	0	0	5	263
ZP2	7783	broad.mit.edu	37	16	21209136	21209136	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr16:21209136G>T	ENST00000574002.1	-	19	2528	c.2046C>A	c.(2044-2046)agC>agA	p.S682R	ZP2_ENST00000574091.1_Missense_Mutation_p.S673R|AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000219593.4_Missense_Mutation_p.S682R			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	682					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TCTCCCCACTGCTCCCACTTG	0.468																																						ENST00000574002.1	1.000000	0.850000	1	9.900000e-01	0.990000	0.989387	0.990000	1.000000																										0				41						c.(2044-2046)agC>agA		zona pellucida glycoprotein 2 (sperm receptor)							196.0	160.0	172.0					16																	21209136		2200	4300	6500	SO:0001583	missense	7783	0	0					g.chr16:21209136G>T	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.2046C>A	chr16.hg19:g.21209136G>T	ENSP00000460971:p.Ser682Arg	0					AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Missense_Mutation_p.S673R|ZP2_ENST00000219593.4_Missense_Mutation_p.S682R	p.S682R			1	2	3	2.028586	Q05996	ZP2_HUMAN		19	2528	-			B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	1	1	hg19	c.2046C>A	CCDS10596.1	1	.	.	.	.	.	.	.	.	.	.	G	9.670	1.146585	0.21288	.	.	ENSG00000103310	ENST00000219593	T	0.76060	-0.99	4.26	-5.44	0.02624	4.26	-5.44	0.02624	.	17.585600	0.00496	N	0.000144	T	0.50888	0.1642	N	0.08118	0	0.09310	N	1	B;B	0.29432	0.244;0.148	B;B	0.26969	0.075;0.035	T	0.42716	-0.9435	10	0.30854	T	0.27	25.2756	6.89	0.24224	0.7005:0.0:0.1658:0.1337	.	673;682	Q4VAP1;Q05996	.;ZP2_HUMAN	R	682	ENSP00000219593:S682R	ENSP00000219593:S682R	S	-	3	2	2	ZP2	21116637	21116637	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.272000	0.08560	-1.035000	0.03291	0.563000	0.77884	AGC	0.111988		TCGA-US-A774-01A-21D-A32N-08	0.468	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2	1	0	1	2	2	2	2	0	0	0	0	100	100	100	97	1	2	-6.583259	1	0.100000			0	35	35	0	565	548	0		1			0	0	100	0	0	1.000000	0	0	0	0	0	0	35	565
PRKCB	5579	broad.mit.edu	37	16	24104167	24104167	+	Silent	SNP	C	C	T	rs543897172		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr16:24104167C>T	ENST00000321728.7	+	6	760	c.585C>T	c.(583-585)taC>taT	p.Y195Y	PRKCB_ENST00000482000.1_3'UTR|PRKCB_ENST00000303531.7_Silent_p.Y195Y	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	195	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	CAGATCCCTACGTAAAACTGA	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		22602	0.0		0.0	False		,,,				2504	0.001					ENST00000321728.7	1.000000	0.920000	1	9.900000e-01	0.990000	0.995662	0.990000	1.000000																										0				9						c.(583-585)taC>taT		protein kinase C, beta	Tamoxifen(DB00675)|Vitamin E(DB00163)						171.0	149.0	156.0					16																	24104167		2197	4300	6497	SO:0001819	synonymous_variant	5579	3	121412	38				g.chr16:24104167C>T	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.585C>T	chr16.hg19:g.24104167C>T		0					PRKCB_ENST00000482000.1_3'UTR|PRKCB_ENST00000303531.7_Silent_p.Y195Y	p.Y195Y	NM_212535.2	NP_997700.1	1	2	3	2.028586	P05771	KPCB_HUMAN		6	760	+			C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	ENST00000321728.7	1	1	hg19	c.585C>T	CCDS10618.1	1																																																																																								0.111988		TCGA-US-A774-01A-21D-A32N-08	0.408	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	1	0	1	2	2	2	2	0	0	0	0	93	93	93	92	1	2	-7.910216	1	0.100000	NM_212535		0	33	33	0	485	481	0		1	0		0	0	93	0	0	1.000000	4.000390e-01	0	0	0	21	0	33	485
CAPNS2	84290	broad.mit.edu	37	16	55601209	55601209	+	Missense_Mutation	SNP	G	G	A	rs540136871		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr16:55601209G>A	ENST00000457326.2	+	1	626	c.541G>A	c.(541-543)Gca>Aca	p.A181T	LPCAT2_ENST00000565056.1_Intron|LPCAT2_ENST00000262134.5_Intron	NM_032330.1	NP_115706.1	Q96L46	CPNS2_HUMAN	calpain, small subunit 2	181	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|large_intestine(1)|lung(3)|prostate(2)	7						TCTGCAGGCCGCAGGCTTCCA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		19779	0.0		0.001	False		,,,				2504	0.0					ENST00000457326.2	1.000000	0.100000	1	1.600000e-01	0.260000	0.393061	0.260000	0.220000																										0				7						c.(541-543)Gca>Aca		calpain, small subunit 2							97.0	98.0	98.0					16																	55601209		1879	4112	5991	SO:0001583	missense	84290	2	120832	39				g.chr16:55601209G>A	AY052551	CCDS54010.1	16q12.2	2013-01-10						"""EF-hand domain containing"""	16371	protein-coding gene	gene with protein product						11853546	Standard	NM_032330		Approved	MGC12536, MGC14804	uc002eid.1	Q96L46		ENST00000457326.2:c.541G>A	chr16.hg19:g.55601209G>A	ENSP00000400882:p.Ala181Thr	0					LPCAT2_ENST00000565056.1_Intron|LPCAT2_ENST00000262134.5_Intron	p.A181T	NM_032330.1	NP_115706.1	1	2	3	2.028586	Q96L46	CPNS2_HUMAN		1	626	+			Q9BPV4	Missense_Mutation	SNP	ENST00000457326.2	0	1	hg19	c.541G>A	CCDS54010.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.472549	0.96274	.	.	ENSG00000256812	ENST00000457326	T	0.47869	0.83	5.98	5.98	0.97165	5.98	5.98	0.97165	EF-hand-like domain (1);	.	.	.	.	T	0.77103	0.4081	M	0.91038	3.17	0.58432	D	0.999999	D	0.89917	1.0	D	0.74023	0.982	T	0.80799	-0.1221	9	0.72032	D	0.01	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	181	Q96L46	CPNS2_HUMAN	T	181	ENSP00000400882:A181T	ENSP00000400882:A181T	A	+	1	0	0	CAPNS2	54158710	54158710	1.000000	0.71417	0.986000	0.45419	0.931000	0.56810	8.752000	0.91632	2.835000	0.97688	0.650000	0.86243	GCA	0.111988		TCGA-US-A774-01A-21D-A32N-08	0.463	CAPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396391.1	0	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	2	-1.961768	0	0.100000	NM_032330		0	6	6	0	548	541	0		1			0	0	90	0	0	0.963736	0	0	0	0	0	0	6	548
COG8	84342	broad.mit.edu	37	16	69368827	69368827	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr16:69368827C>T	ENST00000306875.4	-	3	1124	c.1010G>A	c.(1009-1011)gGc>gAc	p.G337D	RP11-343C2.12_ENST00000562949.1_5'Flank|COG8_ENST00000562081.1_Missense_Mutation_p.G337D	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	337					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						GCCGCCTATGCCCCGGTAAAG	0.582																																						ENST00000306875.4	1.000000	0.090000	1	1.600000e-01	0.280000	0.407223	0.280000	0.220000																										0				9						c.(1009-1011)gGc>gAc		component of oligomeric golgi complex 8							56.0	55.0	56.0					16																	69368827		2198	4300	6498	SO:0001583	missense	84342	2	121412	35				g.chr16:69368827C>T	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1010G>A	chr16.hg19:g.69368827C>T	ENSP00000305459:p.Gly337Asp	0					RP11-343C2.12_ENST00000562949.1_5'Flank|COG8_ENST00000562081.1_Missense_Mutation_p.G337D	p.G337D	NM_032382.4	NP_115758.3	1	2	3	2.028586	Q96MW5	COG8_HUMAN		3	1124	-			Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	ENST00000306875.4	0	1	hg19	c.1010G>A	CCDS10876.1	0	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255165	0.80135	.	.	ENSG00000213380	ENST00000306875	T	0.43688	0.94	5.93	5.93	0.95920	5.93	5.93	0.95920	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.44953	0.1318	L	0.48935	1.535	0.80722	D	1	B;B	0.34103	0.437;0.437	B;B	0.41174	0.349;0.349	T	0.15578	-1.0432	10	0.12430	T	0.62	-3.5502	20.3363	0.98740	0.0:1.0:0.0:0.0	.	364;337	B4DYU2;Q96MW5	.;COG8_HUMAN	D	337	ENSP00000305459:G337D	ENSP00000305459:G337D	G	-	2	0	0	COG8	67926328	67926328	1.000000	0.71417	0.556000	0.28293	0.972000	0.66771	7.441000	0.80485	2.814000	0.96858	0.563000	0.77884	GGC	0.111988		TCGA-US-A774-01A-21D-A32N-08	0.582	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	0	0	1	2	2	2	2	0	0	0	0	77	77	77	75	1	2	-3.123785	1	0.100000	NM_032382		0	5	5	0	437	434	0		1	0		0	0	77	0	0	0.936752	2.685186e-01	0	0	0	75	0	5	437
NCOR1	9611	broad.mit.edu	37	17	15935762	15935762	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr17:15935762G>A	ENST00000268712.3	-	46	7428	c.7171C>T	c.(7171-7173)Cgg>Tgg	p.R2391W	NCOR1_ENST00000395851.1_Missense_Mutation_p.R2288W|NCOR1_ENST00000395857.3_Missense_Mutation_p.R975W	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2391	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.R2391W(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTGAGCATCCGCATAGTCAGA	0.468																																						ENST00000268712.3	0.510000	0.090000	3.800000e-01	1.600000e-01	0.250000	0.276486	0.250000	0.230000																										1	Substitution - Missense(1)	p.R2391W(1)	prostate(1)	107						c.(7171-7173)Cgg>Tgg		nuclear receptor corepressor 1							117.0	106.0	110.0					17																	15935762		2203	4300	6503	SO:0001583	missense	9611	0	0					g.chr17:15935762G>A	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.7171C>T	chr17.hg19:g.15935762G>A	ENSP00000268712:p.Arg2391Trp	0					NCOR1_ENST00000395857.3_Missense_Mutation_p.R975W|NCOR1_ENST00000395851.1_Missense_Mutation_p.R2288W	p.R2391W	NM_006311.3	NP_006302.2	0	0	0	1.902779	O75376	NCOR1_HUMAN		46	7428	-			B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	0	1	hg19	c.7171C>T	CCDS11175.1	0	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778640	0.70107	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.62364	0.03;0.64;0.15	5.96	3.9	0.45041	5.96	3.9	0.45041	.	0.048575	0.85682	D	0.000000	T	0.75510	0.3859	M	0.72894	2.215	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;P;D;D;D	0.79108	0.947;0.893;0.992;0.987;0.976	T	0.76418	-0.2966	10	0.87932	D	0	-9.7742	10.6076	0.45402	0.0:0.1166:0.4874:0.3961	.	2294;2391;2288;910;404	E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;NCOR1_HUMAN;.;.;.	W	2391;2288;2294;975	ENSP00000268712:R2391W;ENSP00000379192:R2288W;ENSP00000379198:R975W	ENSP00000268712:R2391W	R	-	1	2	2	NCOR1	15876487	15876487	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.109000	0.50345	0.780000	0.33566	-0.181000	0.13052	CGG	0.046610		TCGA-US-A774-01A-21D-A32N-08	0.468	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	0	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	2	-2.245554	0	0.100000	NM_006311		0	5	5	0	381	372	0		1	0		0	0	64	0	0	0.933980	4.295551e-01	0	0	0	97	0	5	381
TLK2	11011	broad.mit.edu	37	17	60689888	60689888	+	Missense_Mutation	SNP	T	T	G			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr17:60689888T>G	ENST00000326270.9	+	23	2549	c.2281T>G	c.(2281-2283)Tca>Gca	p.S761A	TLK2_ENST00000346027.5_Missense_Mutation_p.S739A|TLK2_ENST00000542523.1_Missense_Mutation_p.S707A|TLK2_ENST00000582809.1_Missense_Mutation_p.S590A|TLK2_ENST00000343388.7_Missense_Mutation_p.S707A	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	761					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TGCTATTGCATCAACCTCTGG	0.507																																						ENST00000326270.9	1.000000	0.540000	1	7.400000e-01	0.990000	0.904513	0.990000	1.000000																										0				39						c.(2281-2283)Tca>Gca		tousled-like kinase 2							75.0	63.0	67.0					17																	60689888		2203	4300	6503	SO:0001583	missense	11011	0	0					g.chr17:60689888T>G	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.2281T>G	chr17.hg19:g.60689888T>G	ENSP00000316512:p.Ser761Ala	0					TLK2_ENST00000346027.5_Missense_Mutation_p.S739A|TLK2_ENST00000542523.1_Missense_Mutation_p.S707A|TLK2_ENST00000343388.7_Missense_Mutation_p.S707A|TLK2_ENST00000582809.1_Missense_Mutation_p.S590A	p.S761A	NM_001284333.1	NP_001271262.1	1	2	3	2.025896	Q86UE8	TLK2_HUMAN		23	2549	+			D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	1	1	hg19	c.2281T>G		1	.	.	.	.	.	.	.	.	.	.	T	5.315	0.243429	0.10077	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.65549	-0.13;-0.16;-0.14;-0.16	5.83	5.83	0.93111	5.83	5.83	0.93111	Protein kinase-like domain (1);	0.055808	0.85682	D	0.000000	T	0.54886	0.1886	N	0.08118	0	0.80722	D	1	P;P;P;P	0.47910	0.841;0.902;0.902;0.841	P;P;P;P	0.60236	0.746;0.871;0.871;0.746	T	0.53535	-0.8425	10	0.02654	T	1	.	15.3837	0.74681	0.0:0.0:0.0:1.0	.	761;707;739;739	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	A	739;707;761;707	ENSP00000275780:S739A;ENSP00000340800:S707A;ENSP00000316512:S761A;ENSP00000442311:S707A	ENSP00000316512:S761A	S	+	1	0	0	TLK2	58043620	58043620	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.231000	0.72958	0.459000	0.35465	TCA	0.111111		TCGA-US-A774-01A-21D-A32N-08	0.507	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	0	0	1	2	2	2	2	0	0	0	0	49	49	49	60	1	2	-15.149380	1	0.100000	NM_006852		0	13	13	0	269	260	1		1	1		0	0	49	0	0	0.999463	8.182978e-01	0	8	0	59	0	13	269
CACNG1	786	broad.mit.edu	37	17	65051326	65051326	+	Nonsense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr17:65051326C>T	ENST00000226021.3	+	3	483	c.412C>T	c.(412-414)Cga>Tga	p.R138*		NM_000727.3	NP_000718.1	Q06432	CCG1_HUMAN	calcium channel, voltage-dependent, gamma subunit 1	138					muscle contraction (GO:0006936)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transport (GO:0006810)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)	8	all_cancers(12;1.04e-10)|Breast(2;1.45e-16)|all_epithelial(3;4.81e-12)				Diltiazem(DB00343)|Fluspirilene(DB04842)|Ibutilide(DB00308)|Lercanidipine(DB00528)|Magnesium Sulfate(DB00653)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CTATCTGCTGCGACCCGCGTC	0.637																																						ENST00000226021.3	1.000000	0.170000	1	2.800000e-01	0.450000	0.536807	0.450000	0.380000																										0				8						c.(412-414)Cga>Tga		calcium channel, voltage-dependent, gamma subunit 1	Diltiazem(DB00343)|Fluspirilene(DB04842)|Ibutilide(DB00308)|Lercanidipine(DB00528)|Magnesium Sulfate(DB00653)|Nitrendipine(DB01054)|Spironolactone(DB00421)						108.0	85.0	93.0					17																	65051326		2203	4300	6503	SO:0001587	stop_gained	786	2	121412	30				g.chr17:65051326C>T	L07738	CCDS11668.1	17q24	2008-05-02				ENSG00000108878		"""Calcium channel subunits"""	1405	protein-coding gene	gene with protein product		114209		CACNLG		8395940	Standard	NM_000727		Approved		uc002jfu.3	Q06432		ENST00000226021.3:c.412C>T	chr17.hg19:g.65051326C>T	ENSP00000226021:p.Arg138*	0						p.R138*	NM_000727.3	NP_000718.1	1	2	3	2.025896	Q06432	CCG1_HUMAN		3	483	+	all_cancers(12;1.04e-10)|Breast(2;1.45e-16)|all_epithelial(3;4.81e-12)		B2R9N3|Q14D59	Nonsense_Mutation	SNP	ENST00000226021.3	0	1	hg19	c.412C>T	CCDS11668.1	0	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459665	0.43736	.	.	ENSG00000108878	ENST00000226021	.	.	.	5.14	0.225	0.15325	5.14	0.225	0.15325	.	0.072524	0.56097	D	0.000037	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	14.2269	0.65866	0.5757:0.4243:0.0:0.0	.	.	.	.	X	138	.	ENSP00000226021:R138X	R	+	1	2	2	CACNG1	62481788	62481788	1.000000	0.71417	0.992000	0.48379	0.137000	0.21094	2.256000	0.43231	-0.214000	0.10078	0.462000	0.41574	CGA	0.111111		TCGA-US-A774-01A-21D-A32N-08	0.637	CACNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447039.1	0	0	1	2	2	2	2	0	0	0	0	45	45	45	44	1	2	-3.298613	1	0.100000			0	6	6	0	309	306	0		1			0	0	45	0	0	0.964318	0	0	0	0	0	0	6	309
TP53	7157	broad.mit.edu	37	17	7578404	7578404	+	Missense_Mutation	SNP	A	A	C			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr17:7578404A>C	ENST00000269305.4	-	5	715	c.526T>G	c.(526-528)Tgc>Ggc	p.C176G	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.C176G|TP53_ENST00000413465.2_Missense_Mutation_p.C176G|TP53_ENST00000445888.2_Missense_Mutation_p.C176G|TP53_ENST00000455263.2_Missense_Mutation_p.C176G|TP53_ENST00000359597.4_Missense_Mutation_p.C176G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176S(10)|p.C176R(8)|p.0?(8)|p.C176fs*71(7)|p.C176G(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C176fs*5(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.C44G(1)|p.R42fs*24(1)|p.C176fs*72(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.C83G(1)|p.C176fs*6(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGGGGGCAGCGCCTCACA	0.647		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.850000	0.340000	7.600000e-01	4.600000e-01	0.600000	0.613543	0.600000	0.610000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		80	Substitution - Missense(26)|Deletion - Frameshift(25)|Deletion - In frame(13)|Whole gene deletion(8)|Insertion - Frameshift(5)|Complex - deletion inframe(3)	p.C176S(10)|p.C176R(8)|p.0?(8)|p.C176fs*71(7)|p.C176G(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C176fs*5(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.C44G(1)|p.R42fs*24(1)|p.C176fs*72(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.C83G(1)|p.C176fs*6(1)|p.R174fs*3(1)	breast(18)|haematopoietic_and_lymphoid_tissue(13)|oesophagus(10)|upper_aerodigestive_tract(8)|large_intestine(8)|stomach(4)|lung(4)|liver(4)|bone(4)|central_nervous_system(3)|ovary(2)|biliary_tract(1)|prostate(1)	24185						c.(526-528)Tgc>Ggc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						49.0	49.0	49.0					17																	7578404		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578404A>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.526T>G	chr17.hg19:g.7578404A>C	ENSP00000269305:p.Cys176Gly	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.C176G|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.C176G|TP53_ENST00000420246.2_Missense_Mutation_p.C176G|TP53_ENST00000359597.4_Missense_Mutation_p.C176G|TP53_ENST00000413465.2_Missense_Mutation_p.C176G	p.C176G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	0	0	1.902779	P04637	P53_HUMAN		5	715	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.526T>G	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	A	26.3	4.725152	0.89298	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61	5.59	5.59	0.84812	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.71674	0.998;0.971;0.983;0.996;0.995;0.977;0.994	D;D;D;D;D;D;D	0.87578	0.998;0.977;0.982;0.998;0.988;0.973;0.996	D	0.96412	0.9305	10	0.87932	D	0	-18.1821	14.037	0.64651	1.0:0.0:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176G;ENSP00000352610:C176G;ENSP00000269305:C176G;ENSP00000398846:C176G;ENSP00000391127:C176G;ENSP00000391478:C176G;ENSP00000425104:C44G;ENSP00000423862:C83G	ENSP00000269305:C176G	C	-	1	0	0	TP53	7519129	7519129	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.287000	0.95975	2.263000	0.75096	0.533000	0.62120	TGC	0.046610		TCGA-US-A774-01A-21D-A32N-08	0.647	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	2	-12.527010	1	0.100000	NM_000546		0	12	11	0	342	339	1		1	1	1	0	0	75	797	0	0.999077	7.727135e-01	9.999677e-01	20	41	62	528	12	342
ZACN	353174	broad.mit.edu	37	17	74077738	74077738	+	Missense_Mutation	SNP	G	G	A	rs201259366		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr17:74077738G>A	ENST00000334586.5	+	7	865	c.782G>A	c.(781-783)cGc>cAc	p.R261H	EXOC7_ENST00000607838.1_3'UTR|EXOC7_ENST00000589210.1_3'UTR|EXOC7_ENST00000332065.5_3'UTR|EXOC7_ENST00000591724.1_Intron	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	261	Leu-rich.				ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						GCCATTGAGCGCATAGGCTAC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		18545	0.0		0.001	False		,,,				2504	0.0					ENST00000334586.5	1.000000	0.070000	1	1.200000e-01	0.190000	0.337402	0.190000	0.160000																										0				11						c.(781-783)cGc>cAc		zinc activated ligand-gated ion channel							123.0	114.0	117.0					17																	74077738		2203	4300	6503	SO:0001583	missense	353174	1	121412	33				g.chr17:74077738G>A	AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.782G>A	chr17.hg19:g.74077738G>A	ENSP00000334854:p.Arg261His	0					EXOC7_ENST00000332065.5_3'UTR|EXOC7_ENST00000589210.1_3'UTR|EXOC7_ENST00000591724.1_Intron|EXOC7_ENST00000607838.1_3'UTR	p.R261H	NM_180990.3	NP_851321.2	1	2	3	2.025896	Q401N2	ZACN_HUMAN		7	865	+			Q2TB29|Q6ZWK3|Q86YW4	Missense_Mutation	SNP	ENST00000334586.5	0	1	hg19	c.782G>A	CCDS11740.2	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	9.702	1.154853	0.21371	.	.	ENSG00000186919	ENST00000334586	D	0.88431	-2.38	4.64	2.61	0.31194	4.64	2.61	0.31194	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.154450	0.43110	N	0.000602	D	0.83755	0.5323	M	0.78285	2.405	0.20196	N	0.999922	P	0.42518	0.782	B	0.28232	0.087	T	0.77517	-0.2558	10	0.87932	D	0	-15.7124	6.8633	0.24079	0.0924:0.0:0.7344:0.1732	.	261	Q401N2	ZACN_HUMAN	H	261	ENSP00000334854:R261H	ENSP00000334854:R261H	R	+	2	0	0	ZACN	71589333	71589333	0.751000	0.28327	0.017000	0.16124	0.217000	0.24651	1.805000	0.38883	0.557000	0.29117	0.505000	0.49811	CGC	0.111111		TCGA-US-A774-01A-21D-A32N-08	0.622	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2	0	0	1	2	18	7	2	1	1	1	1	145	145	145	142	1	2	-1.756173	0	0.100000	NM_180990		0	6	6	0	720	714	0		0	0		1	0	145	0	0	0.010129	8.076705e-03	0	0	0	190	0	6	720
BAIAP2	10458	broad.mit.edu	37	17	79078379	79078379	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr17:79078379C>T	ENST00000321300.6	+	10	1225	c.1132C>T	c.(1132-1134)Cgg>Tgg	p.R378W	BAIAP2_ENST00000575712.1_Missense_Mutation_p.R378W|BAIAP2_ENST00000435091.3_Missense_Mutation_p.R378W|BAIAP2_ENST00000392411.3_Missense_Mutation_p.R300W|BAIAP2_ENST00000321280.7_Missense_Mutation_p.R378W|BAIAP2_ENST00000428708.2_Missense_Mutation_p.R378W|BAIAP2_ENST00000416299.2_Missense_Mutation_p.R241W|BAIAP2_ENST00000575245.1_Missense_Mutation_p.R411W	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	378	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TGGCCGTATGCGGGTGAAGGC	0.642																																						ENST00000321300.6	1.000000	0.110000	1	1.900000e-01	0.320000	0.433598	0.320000	0.260000																										0				18						c.(1132-1134)Cgg>Tgg		BAI1-associated protein 2							50.0	48.0	49.0					17																	79078379		2202	4299	6501	SO:0001583	missense	10458	0	0					g.chr17:79078379C>T	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1132C>T	chr17.hg19:g.79078379C>T	ENSP00000316338:p.Arg378Trp	0					BAIAP2_ENST00000428708.2_Missense_Mutation_p.R378W|BAIAP2_ENST00000575712.1_Missense_Mutation_p.R378W|BAIAP2_ENST00000392411.3_Missense_Mutation_p.R300W|BAIAP2_ENST00000575245.1_Missense_Mutation_p.R411W|BAIAP2_ENST00000416299.2_Missense_Mutation_p.R241W|BAIAP2_ENST00000435091.3_Missense_Mutation_p.R378W|BAIAP2_ENST00000321280.7_Missense_Mutation_p.R378W	p.R378W	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	1	2	3	2.025896	Q9UQB8	BAIP2_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)	10	1225	+	all_neural(118;0.101)		O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	ENST00000321300.6	0	1	hg19	c.1132C>T	CCDS11775.1	0	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889006	0.72524	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411;ENST00000416299	T;T;T;T;T;T	0.37411	1.64;1.66;1.21;1.21;1.65;1.2	4.79	2.58	0.30949	4.79	2.58	0.30949	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.65780	0.2724	M	0.91920	3.255	0.58432	D	0.999998	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.999;1.0;0.999;0.999;0.999	T	0.75651	-0.3244	10	0.87932	D	0	-18.6775	13.6331	0.62206	0.3669:0.6331:0.0:0.0	.	241;300;379;378;378;378;378;379;378	B4DWA1;F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;.;BAIP2_HUMAN;.;.;.;.;.	W	378;378;378;378;300;241	ENSP00000316338:R378W;ENSP00000401022:R378W;ENSP00000413069:R378W;ENSP00000315685:R378W;ENSP00000376211:R300W;ENSP00000391837:R241W	ENSP00000315685:R378W	R	+	1	2	2	BAIAP2	76692974	76692974	0.985000	0.35326	1.000000	0.80357	0.889000	0.51656	0.882000	0.28186	1.110000	0.41699	0.484000	0.47621	CGG	0.111111		TCGA-US-A774-01A-21D-A32N-08	0.642	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1	0	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	2	-2.736431	1	0.100000			0	5	5	0	377	376	0		1	0		0	0	76	0	0	0.937072	6.497834e-01	0	0	0	157	0	5	377
RYR1	6261	broad.mit.edu	37	19	38948830	38948830	+	Missense_Mutation	SNP	G	G	A	rs144845360		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr19:38948830G>A	ENST00000359596.3	+	18	2065	c.2065G>A	c.(2065-2067)Gag>Aag	p.E689K	RYR1_ENST00000360985.3_Missense_Mutation_p.E689K|RYR1_ENST00000355481.4_Missense_Mutation_p.E689K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	689	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGCCCTCACCGAGGGCTACAC	0.627																																						ENST00000359596.3	0.890000	0.330000	7.300000e-01	4.400000e-01	0.570000	0.595411	0.570000	0.560000																										0				285						c.(2065-2067)Gag>Aag		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	G	LYS/GLU,LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	54.0	51.0	52.0		2065,2065	5.0	1.0	19	dbSNP_134	52	0,8600		0,0,4300	no	missense,missense	RYR1	NM_000540.2,NM_001042723.1	56,56	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging	689/5039,689/5034	38948830	2,13004	2203	4300	6503	SO:0001583	missense	6261	2	121408	39				g.chr19:38948830G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2065G>A	chr19.hg19:g.38948830G>A	ENSP00000352608:p.Glu689Lys	0					RYR1_ENST00000360985.3_Missense_Mutation_p.E689K|RYR1_ENST00000355481.4_Missense_Mutation_p.E689K	p.E689K			0	1	1	1.988827	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	18	2065	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	1	1	hg19	c.2065G>A	CCDS33011.1	0	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593369	0.66219	4.54E-4	0.0	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.73258	-0.73;-0.73;-0.73	5.02	5.02	0.67125	5.02	5.02	0.67125	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000002	T	0.76499	0.3996	L	0.46947	1.48	0.38142	D	0.938482	D;P	0.89917	1.0;0.796	D;P	0.66497	0.944;0.459	T	0.73531	-0.3953	10	0.21540	T	0.41	.	14.2501	0.66013	0.0:0.0:0.8505:0.1495	.	689;689	P21817-2;P21817	.;RYR1_HUMAN	K	689	ENSP00000352608:E689K;ENSP00000347667:E689K;ENSP00000354254:E689K	ENSP00000347667:E689K	E	+	1	0	0	RYR1	43640670	43640670	1.000000	0.71417	0.967000	0.41034	0.989000	0.77384	4.716000	0.61916	2.623000	0.88846	0.549000	0.68633	GAG	0.091826		TCGA-US-A774-01A-21D-A32N-08	0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	2	-3.267917	1	0.100000			0	15	15	0	505	499	0		1			0	0	88	0	0	0.999863	0	0	0	0	0	0	15	505
PSG6	5675	broad.mit.edu	37	19	43411250	43411250	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr19:43411250G>A	ENST00000292125.2	-	5	1108	c.1064C>T	c.(1063-1065)gCg>gTg	p.A355V	PSG6_ENST00000187910.2_Missense_Mutation_p.A355V|PSG6_ENST00000402603.4_Missense_Mutation_p.A262V	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	355	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GTTAGAGTCCGCAAAGCAGGA	0.448																																						ENST00000292125.2	1.000000	0.050000	1	9.000000e-02	0.140000	0.332326	0.140000	0.130000																										0				44						c.(1063-1065)gCg>gTg		pregnancy specific beta-1-glycoprotein 6							185.0	196.0	192.0					19																	43411250		2201	4299	6500	SO:0001583	missense	5675	3	121350	44				g.chr19:43411250G>A		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.1064C>T	chr19.hg19:g.43411250G>A	ENSP00000292125:p.Ala355Val	0					PSG6_ENST00000187910.2_Missense_Mutation_p.A355V|PSG6_ENST00000402603.4_Missense_Mutation_p.A262V	p.A355V	NM_002782.4	NP_002773.1	1	2	3	2.068315	Q00889	PSG6_HUMAN		5	1108	-		Prostate(69;0.00899)	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	0	1	hg19	c.1064C>T	CCDS12613.1	0	.	.	.	.	.	.	.	.	.	.	N	9.184	1.024244	0.19433	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125	T;T;T	0.14144	2.53;2.53;2.53	1.54	1.54	0.23209	1.54	1.54	0.23209	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.13500	0.0327	L	0.50847	1.595	0.09310	N	0.999998	B;B;B	0.34372	0.132;0.292;0.451	B;B;B	0.36244	0.184;0.22;0.185	T	0.20840	-1.0263	9	0.59425	D	0.04	.	6.5495	0.22425	0.0:0.0:1.0:0.0	.	355;355;262	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	V	355;262;355	ENSP00000187910:A355V;ENSP00000385736:A262V;ENSP00000292125:A355V	ENSP00000187910:A355V	A	-	2	0	0	PSG6	48103090	48103090	0.001000	0.12720	0.002000	0.10522	0.014000	0.08584	0.729000	0.26028	0.854000	0.35336	0.134000	0.15878	GCG	0.127484		TCGA-US-A774-01A-21D-A32N-08	0.448	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	0	0	1	2	20	2	2	1	1	1	1	209	209	209	204	1	2	-1.719683	0	0.100000	NM_002782		0	7	4	0	1180	1170	0		0			1	0	209	0	0	0.008507	0	0	0	0	0	0	7	1180
CFD	1675	broad.mit.edu	37	19	861750	861750	+	Missense_Mutation	SNP	C	C	T	rs139666945	byFrequency	TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr19:861750C>T	ENST00000327726.6	+	4	646	c.409C>T	c.(409-411)Cgc>Tgc	p.R137C	CFD_ENST00000592860.1_Missense_Mutation_p.R144C	NM_001928.2	NP_001919.2	P00746	CFAD_HUMAN	complement factor D (adipsin)	137	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)						Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCTGGCAGCGCGTGGACCG	0.731																																						ENST00000327726.6	1.000000	0.460000	1	7.100000e-01	0.990000	0.891599	0.990000	1.000000																										0										c.(409-411)Cgc>Tgc		complement factor D (adipsin)		C	CYS/ARG	6,4322		0,6,2158	15.0	14.0	14.0		409	1.6	0.5	19	dbSNP_134	14	0,8542		0,0,4271	no	missense	CFD	NM_001928.2	180	0,6,6429	TT,TC,CC		0.0,0.1386,0.0466	probably-damaging	137/254	861750	6,12864	2164	4271	6435	SO:0001583	missense	1675	5	119336	33				g.chr19:861750C>T	M84526	CCDS12046.1	19p13.3	2014-09-17	2006-02-10	2006-02-10		ENSG00000197766		"""Complement system"""	2771	protein-coding gene	gene with protein product		134350	"""D component of complement (adipsin)"", ""properdin factor D"""	DF, PFD		1374388	Standard	NM_001928		Approved	ADN	uc002lqc.3	P00746		ENST00000327726.6:c.409C>T	chr19.hg19:g.861750C>T	ENSP00000332139:p.Arg137Cys	0					CFD_ENST00000592860.1_Missense_Mutation_p.R144C	p.R137C	NM_001928.2	NP_001919.2	0	0	0	1.960974	P00746	CFAD_HUMAN		4	646	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	B4DV76|Q5U5S1|Q86VJ5|Q8N4E0|Q8WZB4	Missense_Mutation	SNP	ENST00000327726.6	0	1	hg19	c.409C>T	CCDS12046.1	1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.316929	0.40996	0.001386	0.0	ENSG00000197766	ENST00000327726	D	0.88896	-2.44	4.06	1.59	0.23543	4.06	1.59	0.23543	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.527246	0.13683	U	0.370035	D	0.88966	0.6581	L	0.41492	1.28	0.42835	D	0.994032	D;D	0.89917	1.0;0.999	P;P	0.62089	0.898;0.885	D	0.86253	0.1650	10	0.66056	D	0.02	.	6.682	0.23125	0.277:0.6274:0.0:0.0956	.	144;137	A6XNE2;P00746	.;CFAD_HUMAN	C	137	ENSP00000332139:R137C	ENSP00000332139:R137C	R	+	1	0	0	CFD	812750	812750	0.070000	0.21116	0.477000	0.27303	0.114000	0.19823	0.194000	0.17135	0.805000	0.34159	0.313000	0.20887	CGC	0.075975		TCGA-US-A774-01A-21D-A32N-08	0.731	CFD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457891.2	1	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	2	-10.136160	1	0.100000	NM_001928		0	6	5	0	96	96	0		1	1		0	0	27	0	0	0.965416	9.815166e-01	0	4	0	118	0	6	96
MUC16	94025	broad.mit.edu	37	19	9090831	9090831	+	Silent	SNP	A	A	G			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr19:9090831A>G	ENST00000397910.4	-	1	1187	c.984T>C	c.(982-984)ccT>ccC	p.P328P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	328	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCATGGAAAAAGGGATAGCTG	0.522																																						ENST00000397910.4	0.510000	0.080000	3.700000e-01	1.400000e-01	0.240000	0.264331	0.240000	0.210000																										0				590						c.(982-984)ccT>ccC		mucin 16, cell surface associated							96.0	95.0	96.0					19																	9090831		2041	4195	6236	SO:0001819	synonymous_variant	94025	0	0					g.chr19:9090831A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.984T>C	chr19.hg19:g.9090831A>G		0						p.P328P	NM_024690.2	NP_078966.2	0	0	0	1.951218	Q8WXI7	MUC16_HUMAN		1	1187	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.984T>C	CCDS54212.1	0																																																																																								0.071207		TCGA-US-A774-01A-21D-A32N-08	0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	16	2	2	1	1	1	1	75	75	75	74	1	2	-2.328547	0	0.100000	NM_024690		0	4	4	0	347	341	0		0			1	0	75	0	0	0.004691	0	0	0	0	0	0	4	347
PRKCG	5582	broad.mit.edu	37	19	54392899	54392899	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr19:54392899G>A	ENST00000263431.3	+	4	575	c.293G>A	c.(292-294)cGg>cAg	p.R98Q	PRKCG_ENST00000542049.1_Intron|PRKCG_ENST00000540413.1_Missense_Mutation_p.R98Q|PRKCG_ENST00000536044.1_Missense_Mutation_p.R98Q	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	98					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CAGGACCCCCGGAACAAACAC	0.602																																						ENST00000263431.3	1.000000	0.370000	1	5.400000e-01	0.800000	0.786227	0.800000	1.000000																										0				10						c.(292-294)cGg>cAg		protein kinase C, gamma	Tamoxifen(DB00675)						57.0	50.0	52.0					19																	54392899		2203	4300	6503	SO:0001583	missense	5582	0	0					g.chr19:54392899G>A	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.293G>A	chr19.hg19:g.54392899G>A	ENSP00000263431:p.Arg98Gln	0					PRKCG_ENST00000542049.1_Intron|PRKCG_ENST00000536044.1_Missense_Mutation_p.R98Q|PRKCG_ENST00000540413.1_Missense_Mutation_p.R98Q	p.R98Q	NM_002739.3	NP_002730.1	1	2	3	2.035163	P05129	KPCG_HUMAN		4	575	+	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)		B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	1	1	hg19	c.293G>A	CCDS12867.1	0	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574096	0.65765	.	.	ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000419486	D;D;D	0.84370	-1.84;-1.84;-1.84	4.54	4.54	0.55810	4.54	4.54	0.55810	.	.	.	.	.	D	0.82499	0.5050	M	0.74881	2.28	0.80722	D	1	P;B;P;P	0.43701	0.769;0.425;0.815;0.679	B;B;B;B	0.33121	0.149;0.066;0.111;0.158	D	0.84896	0.0839	9	0.45353	T	0.12	.	15.2147	0.73254	0.0:0.0:1.0:0.0	.	98;98;98;98	F5H5C4;B7Z870;B7Z3W6;P05129	.;.;.;KPCG_HUMAN	Q	98;98;98;121	ENSP00000440541:R98Q;ENSP00000443493:R98Q;ENSP00000263431:R98Q	ENSP00000263431:R98Q	R	+	2	0	0	PRKCG	59084711	59084711	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.634000	0.61325	2.260000	0.74910	0.644000	0.83932	CGG	0.113300		TCGA-US-A774-01A-21D-A32N-08	0.602	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	0	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	2	-3.204568	1	0.100000	NM_002739		0	9	9	0	250	247	0		1			0	0	36	0	0	0.994143	0	0	0	0	0	0	9	250
HRNR	388697	broad.mit.edu	37	1	152191731	152191731	+	Missense_Mutation	SNP	C	C	T	rs374297870		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:152191731C>T	ENST00000368801.2	-	3	2449	c.2374G>A	c.(2374-2376)Ggc>Agc	p.G792S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	792					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCGTGTTGGCCGTGGCTGGAG	0.602																																						ENST00000368801.2	1.000000	0.410000	1	5.700000e-01	0.810000	0.796754	0.810000	1.000000																										0				192						c.(2374-2376)Ggc>Agc		hornerin							69.0	73.0	72.0					1																	152191731		2203	4300	6503	SO:0001583	missense	388697	0	0					g.chr1:152191731C>T	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2374G>A	chr1.hg19:g.152191731C>T	ENSP00000357791:p.Gly792Ser	0					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	p.G792S	NM_001009931.1	NP_001009931.1	1	2	3	2.023670	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	2449	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	1	1	hg19	c.2374G>A	CCDS30859.1	0	.	.	.	.	.	.	.	.	.	.	C	7.079	0.569916	0.13560	.	.	ENSG00000197915	ENST00000368801	T	0.05382	3.45	2.54	0.333	0.15943	2.54	0.333	0.15943	.	.	.	.	.	T	0.01092	0.0036	L	0.36672	1.1	0.09310	N	1	P	0.41978	0.767	B	0.31245	0.126	T	0.48031	-0.9070	9	0.23891	T	0.37	.	4.4579	0.11652	0.0:0.5922:0.0:0.4078	.	792	Q86YZ3	HORN_HUMAN	S	792	ENSP00000357791:G792S	ENSP00000357791:G792S	G	-	1	0	0	HRNR	150458355	150458355	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.666000	0.05280	-0.051000	0.13334	0.456000	0.33151	GGC	0.110672		TCGA-US-A774-01A-21D-A32N-08	0.602	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	84	1	2	-3.115879	1	0.100000	XM_373868		0	11	10	0	292	289	0		1			0	0	85	0	0	0.998292	0	0	0	0	0	0	11	292
KCNN3	3782	broad.mit.edu	37	1	154841843	154841843	+	Nonsense_Mutation	SNP	C	C	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:154841843C>A	ENST00000271915.4	-	1	913	c.598G>T	c.(598-600)Gag>Tag	p.E200*	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	205					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GTCTCGGCCTCGATGAGGTTC	0.637																																						ENST00000271915.4	1.000000	0.150000	1	2.300000e-01	0.360000	0.461030	0.360000	0.300000																										0				28						c.(598-600)Gag>Tag		potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	Miconazole(DB01110)|Procaine(DB00721)						45.0	47.0	46.0					1																	154841843		2203	4300	6503	SO:0001587	stop_gained	3782	1	121412	30				g.chr1:154841843C>A	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.598G>T	chr1.hg19:g.154841843C>A	ENSP00000271915:p.Glu200*	0					KCNN3_ENST00000358505.2_5'Flank	p.E200*	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	1	2	3	2.023670	Q9UGI6	KCNN3_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00819)	1	913	-	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		B1ANX0|O43517|Q86VF9|Q8WXG7	Nonsense_Mutation	SNP	ENST00000271915.4	0	1	hg19	c.598G>T	CCDS30880.1	0	.	.	.	.	.	.	.	.	.	.	C	40	8.086447	0.98646	.	.	ENSG00000143603	ENST00000271915	.	.	.	4.75	4.75	0.60458	4.75	4.75	0.60458	.	0.000000	0.44285	D	0.000468	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-19.4109	15.2796	0.73770	0.0:1.0:0.0:0.0	.	.	.	.	X	200	.	ENSP00000271915:E200X	E	-	1	0	0	KCNN3	153108467	153108467	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.750000	0.68712	2.461000	0.83175	0.561000	0.74099	GAG	0.110672		TCGA-US-A774-01A-21D-A32N-08	0.637	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	0	0	1	2	2	2	2	0	0	0	0	95	95	95	94	1	2	-3.303133	1	0.100000	NM_002249		0	7	7	0	449	443	0		1	0		0	0	95	0	0	0.979839	0	0	0	0	1	0	7	449
HMCN1	83872	broad.mit.edu	37	1	186024700	186024700	+	Silent	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:186024700C>T	ENST00000271588.4	+	45	7267	c.7038C>T	c.(7036-7038)caC>caT	p.H2346H	HMCN1_ENST00000367492.2_Silent_p.H2346H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2346	Ig-like C2-type 21.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATGAAGGTCACATCCTTCAGC	0.453																																						ENST00000271588.4	1.000000	0.630000	1	8.100000e-01	0.990000	0.932240	0.990000	1.000000																										0				308						c.(7036-7038)caC>caT		hemicentin 1							151.0	129.0	137.0					1																	186024700		2203	4300	6503	SO:0001819	synonymous_variant	83872	0	0					g.chr1:186024700C>T	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7038C>T	chr1.hg19:g.186024700C>T		0					HMCN1_ENST00000367492.2_Silent_p.H2346H	p.H2346H	NM_031935.2	NP_114141.2	1	2	3	2.021750	Q96RW7	HMCN1_HUMAN		45	7267	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	1	1	hg19	c.7038C>T	CCDS30956.1	1																																																																																								0.110232		TCGA-US-A774-01A-21D-A32N-08	0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	1	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	2	-5.060802	1	0.100000	NM_031935		0	20	20	0	392	388	0		1	0		0	0	60	0	0	0.999995	2.689017e-03	0	0	0	2	0	20	392
HHIPL2	79802	broad.mit.edu	37	1	222696153	222696153	+	Silent	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:222696153G>A	ENST00000343410.6	-	9	2023	c.1965C>T	c.(1963-1965)ggC>ggT	p.G655G	HHIPL2_ENST00000473144.1_5'UTR	NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	655					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		CCTGGGCTGGGCCAGAAGCTA	0.458																																						ENST00000343410.6	1.000000	0.060000	1	1.100000e-01	0.170000	0.313788	0.170000	0.150000																										0				59						c.(1963-1965)ggC>ggT		HHIP-like 2							109.0	114.0	112.0					1																	222696153		2203	4300	6503	SO:0001819	synonymous_variant	79802	0	0					g.chr1:222696153G>A	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1965C>T	chr1.hg19:g.222696153G>A		0					HHIPL2_ENST00000473144.1_5'UTR	p.G655G	NM_024746.3	NP_079022.2	1	2	3	2.021750	Q6UWX4	HIPL2_HUMAN		9	2023	-			Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	ENST00000343410.6	0	1	hg19	c.1965C>T	CCDS1530.2	0																																																																																								0.110232		TCGA-US-A774-01A-21D-A32N-08	0.458	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	0	0	1	2	2	2	2	0	0	0	0	158	158	158	157	1	2	-1.877766	0	0.100000	NM_024746		0	6	6	0	796	793	0		1			0	0	158	0	0	0.964639	0	0	0	0	0	0	6	796
CAMTA1	23261	broad.mit.edu	37	1	7724800	7724800	+	Silent	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:7724800C>T	ENST00000303635.7	+	9	2400	c.2193C>T	c.(2191-2193)ggC>ggT	p.G731G	CAMTA1_ENST00000439411.2_Silent_p.G731G	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	731					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GAAGCGCCGGCGGCGTCCCCA	0.672			T	WWTR1	epitheliod hemangioendothelioma																																	ENST00000303635.7	1.000000	0.440000	1	5.800000e-01	0.770000	0.782958	0.770000	1.000000				Dom	yes			Dom	yes		1	1p36.31-p36.23	1p36.31-p36.23	611501	T	calmodulin binding transcription activator 1				M	M	WWTR1		epitheliod hemangioendothelioma		0				85						c.(2191-2193)ggC>ggT		calmodulin binding transcription activator 1							45.0	56.0	52.0					1																	7724800		2203	4300	6503	SO:0001819	synonymous_variant	23261	2	121394	31				g.chr1:7724800C>T	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2193C>T	chr1.hg19:g.7724800C>T		0					CAMTA1_ENST00000439411.2_Silent_p.G731G	p.G731G	NM_015215.2	NP_056030.1	1	2	3	2.027742	Q9Y6Y1	CMTA1_HUMAN		9	2400	+	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	1	1	hg19	c.2193C>T	CCDS30576.1	0																																																																																								0.111550		TCGA-US-A774-01A-21D-A32N-08	0.672	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	0	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	2	-3.750184	1	0.100000	NM_015215		0	16	16	0	438	435	0		1			0	0	78	0	0	0.999932	0	0	0	0	0	0	16	438
MACF1	23499	broad.mit.edu	37	1	39818849	39818849	+	Nonsense_Mutation	SNP	C	C	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:39818849C>A	ENST00000372915.3	+	43	11472	c.11385C>A	c.(11383-11385)taC>taA	p.Y3795*	MACF1_ENST00000539005.1_Nonsense_Mutation_p.Y1728*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.Y3827*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.Y2230*|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000361689.2_Nonsense_Mutation_p.Y1728*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.Y1728*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.Y3790*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.Y1728*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3795					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTGATGGTTACATGGGGGTGA	0.502																																						ENST00000372915.3	1.000000	0.160000	8.200000e-01	2.700000e-01	0.440000	0.514302	0.440000	0.380000																										0				203						c.(11383-11385)taC>taA		microtubule-actin crosslinking factor 1							115.0	108.0	110.0					1																	39818849		2203	4300	6503	SO:0001587	stop_gained	23499	0	0					g.chr1:39818849C>A	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.11385C>A	chr1.hg19:g.39818849C>A	ENSP00000362006:p.Tyr3795*	0					MACF1_ENST00000564288.1_Nonsense_Mutation_p.Y3790*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.Y2230*|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000361689.2_Nonsense_Mutation_p.Y1728*|MACF1_ENST00000539005.1_Nonsense_Mutation_p.Y1728*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.Y3827*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.Y1728*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.Y1728*	p.Y3795*			1	2	3	2.009777	Q9UPN3	MACF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)	43	11472	+	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	ENST00000372915.3	0	1	hg19	c.11385C>A		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.139508|6.139508	0.97320|0.97320	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000530262;ENST00000289893	.|.	.|.	.|.	5.35|5.35	0.971|0.971	0.19698|0.19698	5.35|5.35	0.971|0.971	0.19698|0.19698	.|.	.|0.687238	.|0.13641	.|N	.|0.372941	T|.	0.08670|.	0.0215|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34976|.	-0.9807|.	4|.	.|0.02654	.|T	.|1	.|.	1.9822|1.9822	0.03429|0.03429	0.1365:0.489:0.1333:0.2412|0.1365:0.489:0.1333:0.2412	.|.	.|.	.|.	.|.	N|X	862|1728;3795;1728;1728;1728;1877;2230	.|.	.|ENSP00000289893:Y2230X	H|Y	+|+	1|3	0|2	0|2	MACF1|MACF1	39591436|39591436	39591436|39591436	0.000000|0.000000	0.05858|0.05858	0.084000|0.084000	0.20598|0.20598	0.980000|0.980000	0.70556|0.70556	-0.256000|-0.256000	0.08757|0.08757	0.597000|0.597000	0.29811|0.29811	0.555000|0.555000	0.69702|0.69702	CAT|TAC	0.107586		TCGA-US-A774-01A-21D-A32N-08	0.502	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	0	0	0	2	2	2	2	0	0	0	0	27	27	27	26	1	2	-4.032619	1	0.100000	NM_033044		0	5	4	0	259	256	0		1	0	0	0	0	27	586	0	0.935597	1.146582e-01	9.858136e-01	0	0	25	428	5	259
PTCH2	8643	broad.mit.edu	37	1	45307637	45307637	+	Silent	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:45307637G>A	ENST00000372192.3	-	2	277	c.147C>T	c.(145-147)tgC>tgT	p.C49C	PTCH2_ENST00000447098.2_Silent_p.C49C	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	49					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)	p.C49C(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					TCTGGATCCCGCATCCCAGAG	0.557									Basal Cell Nevus syndrome																													ENST00000372192.3	1.000000	0.090000	4.100000e-01	1.500000e-01	0.230000	0.333799	0.230000	0.210000																										1	Substitution - coding silent(1)	p.C49C(1)	lung(1)	50						c.(145-147)tgC>tgT		patched 2							113.0	112.0	112.0					1																	45307637		2203	4300	6503	SO:0001819	synonymous_variant	8643	3	121412	39	Basal Cell Nevus syndrome	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	g.chr1:45307637G>A	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.147C>T	chr1.hg19:g.45307637G>A		0					PTCH2_ENST00000447098.2_Silent_p.C49C	p.C49C	NM_003738.4	NP_003729.3	1	2	3	2.009777	Q9Y6C5	PTC2_HUMAN		2	277	-	Acute lymphoblastic leukemia(166;0.155)		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Silent	SNP	ENST00000372192.3	0	1	hg19	c.147C>T	CCDS516.1	0																																																																																								0.107586		TCGA-US-A774-01A-21D-A32N-08	0.557	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	0	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	2	-1.942492	0	0.100000	NM_003738		0	7	7	0	678	676	0		1	0		0	0	103	0	0	0.980469	1.518885e-04	0	0	0	2	0	7	678
LPAR3	23566	broad.mit.edu	37	1	85331338	85331338	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:85331338C>T	ENST00000440886.1	-	1	504	c.466G>A	c.(466-468)Gcc>Acc	p.A156T	LPAR3_ENST00000491034.1_Intron|LPAR3_ENST00000370611.3_Missense_Mutation_p.A156T			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	156					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)	p.A156T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						ATAAAAATGGCGATGGCCCAG	0.542																																						ENST00000440886.1	1.000000	0.090000	3.600000e-01	1.400000e-01	0.210000	0.314903	0.210000	0.190000																										1	Substitution - Missense(1)	p.A156T(1)	kidney(1)	24						c.(466-468)Gcc>Acc		lysophosphatidic acid receptor 3							141.0	147.0	145.0					1																	85331338		2203	4300	6503	SO:0001583	missense	23566	3	121412	40				g.chr1:85331338C>T	AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.466G>A	chr1.hg19:g.85331338C>T	ENSP00000395389:p.Ala156Thr	0					LPAR3_ENST00000370611.3_Missense_Mutation_p.A156T|LPAR3_ENST00000491034.1_Intron	p.A156T			1	2	3	2.009777	Q9UBY5	LPAR3_HUMAN		1	504	-			A0AVA3	Missense_Mutation	SNP	ENST00000440886.1	0	1	hg19	c.466G>A	CCDS700.1	0	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512109	0.64522	.	.	ENSG00000171517	ENST00000440886;ENST00000370611	T;T	0.41758	0.99;0.99	5.32	5.32	0.75619	5.32	5.32	0.75619	GPCR, rhodopsin-like superfamily (1);	0.050820	0.85682	D	0.000000	T	0.57344	0.2047	M	0.86740	2.835	0.49798	D	0.999824	D	0.63046	0.992	P	0.53490	0.727	T	0.67703	-0.5602	10	0.87932	D	0	.	19.0389	0.92991	0.0:1.0:0.0:0.0	.	156	Q9UBY5	LPAR3_HUMAN	T	156	ENSP00000395389:A156T;ENSP00000359643:A156T	ENSP00000359643:A156T	A	-	1	0	0	LPAR3	85103926	85103926	1.000000	0.71417	0.995000	0.50966	0.363000	0.29612	6.295000	0.72744	2.501000	0.84356	0.655000	0.94253	GCC	0.107586		TCGA-US-A774-01A-21D-A32N-08	0.542	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	0	0	1	2	18	2	2	1	1	1	1	163	163	163	162	1	2	-1.947664	0	0.100000	NM_012152		0	8	8	0	845	841	0		0	0		1	0	163	0	0	0.035459	0	0	0	0	1	0	8	845
PLD5	200150	broad.mit.edu	37	1	242451663	242451663	+	Splice_Site	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr1:242451663C>T	ENST00000536534.2	-	3	737		c.e3+1		PLD5_ENST00000442594.2_Splice_Site|PLD5_ENST00000427495.1_Splice_Site			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5							integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			ATGTAGCTTACCTGACATGCT	0.413																																						ENST00000536534.2	1.000000	0.640000	1	8.000000e-01	0.990000	0.928419	0.990000	1.000000																										0				55						c.e3+1		phospholipase D family, member 5							164.0	142.0	150.0					1																	242451663		2203	4300	6503	SO:0001630	splice_region_variant	200150	0	0					g.chr1:242451663C>T	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.495+1G>A	chr1.hg19:g.242451663C>T		0					PLD5_ENST00000427495.1_Splice_Site|PLD5_ENST00000442594.2_Splice_Site				1	2	3	2.021750	Q8N7P1	PLD5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0329)	3	737	-	Melanoma(84;0.242)		A1KXV0|B7Z324|Q494U9|Q8NB22	Splice_Site	SNP	ENST00000536534.2	1	1	hg19		CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307958	0.60305	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534;ENST00000459864	.	.	.	4.33	4.33	0.51752	4.33	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9007	0.63802	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	PLD5	240518286	240518286	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.399000	0.66314	2.134000	0.65973	0.591000	0.81541	.	0.110232		TCGA-US-A774-01A-21D-A32N-08	0.413	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	1	0	1	2	2	2	2	0	0	0	0	87	87	87	91	1	2	-5.218896	1	0.100000	NM_152666	Intron	0	23	23	0	460	443	0		1			0	0	87	0	0	0.999999	0	0	0	0	0	0	23	460
BAGE2	85319	broad.mit.edu	37	21	11097591	11097591	+	RNA	SNP	G	G	A	rs555671325		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr21:11097591G>A	ENST00000470054.1	-	0	278							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		caccacaggggactcctcctt	0.542																																						ENST00000470054.1			0	0																														0												B melanoma antigen family, member 2							65.0	84.0	77.0					21																	11097591		1442	2602	4044			85319	1	118292	31				g.chr21:11097591G>A	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		chr21.hg19:g.11097591G>A															Q86Y30	BAGE2_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	0	278	-			A8K925|Q08ER0	RNA	SNP	ENST00000470054.1	0	1	hg19																																																																																													TCGA-US-A774-01A-21D-A32N-08	0.542	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	0	0	1	2	19	2	2	1	1	1	1	68	68	68	72	1	2	-19.949720	1	0.100000	NM_182482		0	22	15	0	512	389	0		0			1	0	68	0	0	0.388484	0	0	0	0	0	0	22	512
KRTAP10-5	386680	broad.mit.edu	37	21	45999888	45999888	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr21:45999888G>A	ENST00000400372.1	-	1	593	c.568C>T	c.(568-570)Ccc>Tcc	p.P190S	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	190	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						GAGCAGACGGGCACACAGCAG	0.622																																						ENST00000400372.1	0.240000	0.050000	1.900000e-01	8.000000e-02	0.130000	0.140840	0.130000	0.130000																										0				14						c.(568-570)Ccc>Tcc		keratin associated protein 10-5							185.0	191.0	189.0					21																	45999888		2203	4300	6503	SO:0001583	missense	386680	0	0					g.chr21:45999888G>A	AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.568C>T	chr21.hg19:g.45999888G>A	ENSP00000383223:p.Pro190Ser	0					TSPEAR_ENST00000323084.4_Intron	p.P190S	NM_198694.2	NP_941967.2	0	1	1	1.998143	P60370	KR105_HUMAN		1	593	-			Q0VAR7|Q0VAR8|Q70LJ3	Missense_Mutation	SNP	ENST00000400372.1	0	1	hg19	c.568C>T	CCDS42958.1	0	.	.	.	.	.	.	.	.	.	.	g	6.527	0.465563	0.12402	.	.	ENSG00000241123	ENST00000400372	T	0.01279	5.06	2.02	1.07	0.20283	2.02	1.07	0.20283	.	.	.	.	.	T	0.04815	0.0130	L	0.53249	1.67	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.38394	-0.9663	9	0.45353	T	0.12	.	7.3404	0.26633	0.0:0.0:0.737:0.263	.	190	P60370	KR105_HUMAN	S	190	ENSP00000383223:P190S	ENSP00000383223:P190S	P	-	1	0	0	KRTAP10-5	44824316	44824316	0.002000	0.14202	0.001000	0.08648	0.036000	0.12997	0.039000	0.13884	0.163000	0.19507	0.305000	0.20034	CCC	0.094112		TCGA-US-A774-01A-21D-A32N-08	0.622	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128042.1	0	0	1	2	2	2	2	0	0	0	0	259	259	259	261	1	2	-2.021180	0	0.100000			0	8	7	0	1250	1219	0		1			0	0	259	0	0	0.988168	0	0	0	0	0	0	8	1250
MYO18B	84700	broad.mit.edu	37	22	26422752	26422752	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr22:26422752G>A	ENST00000407587.2	+	43	6984	c.6815G>A	c.(6814-6816)gGc>gAc	p.G2272D	MYO18B_ENST00000536101.1_Missense_Mutation_p.G2271D|MYO18B_ENST00000335473.7_Missense_Mutation_p.G2271D			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2271						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TCCACGCTGGGCCTAGAGGAC	0.647																																						ENST00000407587.2	1.000000	0.850000	1	9.900000e-01	0.990000	0.991258	0.990000	1.000000																										0				146						c.(6814-6816)gGc>gAc		myosin XVIIIB							16.0	19.0	18.0					22																	26422752		1892	4098	5990	SO:0001583	missense	84700	0	0					g.chr22:26422752G>A	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6815G>A	chr22.hg19:g.26422752G>A	ENSP00000386096:p.Gly2272Asp	0					MYO18B_ENST00000335473.7_Missense_Mutation_p.G2271D|MYO18B_ENST00000536101.1_Missense_Mutation_p.G2271D	p.G2272D			1	2	3	2.013639	Q8IUG5	MY18B_HUMAN		43	6984	+			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	0	1	hg19	c.6815G>A		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.01|16.01	2.999971|2.999971	0.54147|0.54147	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000543971|ENST00000536101;ENST00000335473;ENST00000407587	.|D;D;D	.|0.92299	.|-2.99;-2.99;-3.01	4.67|4.67	3.25|3.25	0.37280|0.37280	4.67|4.67	3.25|3.25	0.37280|0.37280	.|.	.|0.544752	.|0.15001	.|N	.|0.286133	D|D	0.88317|0.88317	0.6404|0.6404	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	.|P;P;P;P;P	.|0.49783	.|0.835;0.883;0.883;0.9;0.928	.|P;B;B;P;P	.|0.44990	.|0.466;0.274;0.274;0.466;0.463	T|T	0.79137|0.79137	-0.1927|-0.1927	5|10	.|0.37606	.|T	.|0.19	.|.	4.4138|4.4138	0.11447|0.11447	0.1586:0.0:0.6468:0.1947|0.1586:0.0:0.6468:0.1947	.|.	.|1784;2273;2271;2272;2271	.|Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.|.;.;MY18B_HUMAN;.;.	T|D	221|2271;2271;2272	.|ENSP00000441229:G2271D;ENSP00000334563:G2271D;ENSP00000386096:G2272D	.|ENSP00000334563:G2271D	A|G	+|+	1|2	0|0	0|0	MYO18B|MYO18B	24752752|24752752	24752752|24752752	0.879000|0.879000	0.30193|0.30193	0.986000|0.986000	0.45419|0.45419	0.910000|0.910000	0.53928|0.53928	1.586000|1.586000	0.36611|0.36611	0.602000|0.602000	0.29896|0.29896	0.313000|0.313000	0.20887|0.20887	GCC|GGC	0.108470		TCGA-US-A774-01A-21D-A32N-08	0.647	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	2	-12.364340	1	0.100000	NM_032608		0	6	6	0	49	49	1		1			0	0	16	0	0	0.967893	0	0	0	0	0	0	6	49
SEZ6L	23544	broad.mit.edu	37	22	26693012	26693012	+	Silent	SNP	C	C	T	rs371203903		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr22:26693012C>T	ENST00000248933.6	+	4	1223	c.1128C>T	c.(1126-1128)gaC>gaT	p.D376D	SEZ6L_ENST00000529632.2_Silent_p.D376D|SEZ6L_ENST00000404234.3_Silent_p.D376D|SEZ6L_ENST00000360929.3_Silent_p.D376D|SEZ6L_ENST00000402979.1_Silent_p.D149D|SEZ6L_ENST00000403121.1_Silent_p.D149D|SEZ6L_ENST00000343706.4_Silent_p.D376D			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	376	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.D376D(2)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCTTCCAGGACGACGGCCTTG	0.577																																						ENST00000248933.6	1.000000	0.190000	1	3.200000e-01	0.520000	0.582528	0.520000	1.000000																										2	Substitution - coding silent(2)	p.D376D(2)	large_intestine(1)|endometrium(1)	80						c.(1126-1128)gaC>gaT		seizure related 6 homolog (mouse)-like		C	,,,,,	0,4406		0,0,2203	49.0	43.0	45.0		1128,1128,1128,1128,1128,1128	-10.5	0.0	22		45	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEZ6L	NM_001184773.1,NM_001184774.1,NM_001184775.1,NM_001184776.1,NM_001184777.1,NM_021115.4	,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,	376/1024,376/1014,376/1012,376/950,376/949,376/1025	26693012	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23544	6	121412	33				g.chr22:26693012C>T	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1128C>T	chr22.hg19:g.26693012C>T		0					SEZ6L_ENST00000403121.1_Silent_p.D149D|SEZ6L_ENST00000360929.3_Silent_p.D376D|SEZ6L_ENST00000404234.3_Silent_p.D376D|SEZ6L_ENST00000343706.4_Silent_p.D376D|SEZ6L_ENST00000529632.2_Silent_p.D376D|SEZ6L_ENST00000402979.1_Silent_p.D149D	p.D376D			1	2	3	2.013639	Q9BYH1	SE6L1_HUMAN		4	1223	+			A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	ENST00000248933.6	0	1	hg19	c.1128C>T	CCDS13833.1	0																																																																																								0.108470		TCGA-US-A774-01A-21D-A32N-08	0.577	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3	0	0	1	2	2	2	2	0	0	0	0	27	27	27	27	1	2	-6.542302	1	0.100000			0	5	5	0	220	214	0		1	0		0	0	27	0	0	0.933710	4.645534e-03	0	0	0	4	0	5	220
LCT	3938	broad.mit.edu	37	2	136575286	136575286	+	Silent	SNP	G	G	A	rs370939537		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:136575286G>A	ENST00000264162.2	-	6	1342	c.1332C>T	c.(1330-1332)tgC>tgT	p.C444C	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	444	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CCCGGAGGCCGCAAAGCAGGG	0.647																																						ENST00000264162.2	1.000000	0.080000	5.200000e-01	1.400000e-01	0.240000	0.354278	0.240000	0.200000																										0				124						c.(1330-1332)tgC>tgT		lactase	Vitamin C(DB00126)	G		0,4406		0,0,2203	69.0	65.0	66.0		1332	-11.5	0.0	2		66	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LCT	NM_002299.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		444/1928	136575286	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3938	7	121412	40				g.chr2:136575286G>A	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1332C>T	chr2.hg19:g.136575286G>A		0					AC011893.3_ENST00000437007.1_RNA	p.C444C	NM_002299.2	NP_002290.2	1	2	3	2.015746	P09848	LPH_HUMAN		6	1342	-			Q4ZG58	Silent	SNP	ENST00000264162.2	0	1	hg19	c.1332C>T	CCDS2178.1	0																																																																																								0.108911		TCGA-US-A774-01A-21D-A32N-08	0.647	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	0	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	2	-2.320242	0	0.100000	NM_002299		0	5	5	0	492	489	0		1			0	0	91	0	0	0.936835	0	0	0	0	0	0	5	492
TPO	7173	broad.mit.edu	37	2	1480921	1480921	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:1480921G>A	ENST00000345913.4	+	8	974	c.883G>A	c.(883-885)Gcc>Acc	p.A295T	TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.A295T|TPO_ENST00000329066.4_Missense_Mutation_p.A295T|TPO_ENST00000382201.3_Missense_Mutation_p.A295T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.A295T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	295					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CTCTTCGGCCGCCTGCGGCAC	0.706																																						ENST00000345913.4	1.000000	0.910000	1	9.900000e-01	0.990000	0.994513	0.990000	1.000000																										0				95						c.(883-885)Gcc>Acc		thyroid peroxidase	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)						12.0	14.0	13.0					2																	1480921		2192	4275	6467	SO:0001583	missense	7173	1	120874	26				g.chr2:1480921G>A		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.883G>A	chr2.hg19:g.1480921G>A	ENSP00000318820:p.Ala295Thr	0					TPO_ENST00000382198.1_Intron|TPO_ENST00000329066.4_Missense_Mutation_p.A295T|TPO_ENST00000382201.3_Missense_Mutation_p.A295T|TPO_ENST00000337415.3_Missense_Mutation_p.A295T|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.A295T	p.A295T	NM_000547.5	NP_000538.3	1	2	3	2.027266	P07202	PERT_HUMAN		8	974	+	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	1	1	hg19	c.883G>A	CCDS1643.1	1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521755	0.44866	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	4.99	4.11	0.48088	4.99	4.11	0.48088	.	0.223965	0.45606	D	0.000357	T	0.68696	0.3029	M	0.62154	1.92	0.80722	D	1	P;P;P	0.52692	0.955;0.885;0.906	P;B;P	0.47891	0.543;0.311;0.56	T	0.70174	-0.4944	10	0.45353	T	0.12	-20.3944	13.6977	0.62589	0.0756:0.0:0.9244:0.0	.	295;295;295	P07202-4;P07202-2;P07202	.;.;PERT_HUMAN	T	295;295;295;295;295;224	ENSP00000337263:A295T;ENSP00000318820:A295T;ENSP00000263886:A295T;ENSP00000329869:A295T;ENSP00000371636:A295T;ENSP00000405788:A224T	ENSP00000329869:A295T	A	+	1	0	0	TPO	1459928	1459928	0.326000	0.24669	0.607000	0.28956	0.013000	0.08279	3.117000	0.50407	1.089000	0.41292	0.460000	0.39030	GCC	0.111550		TCGA-US-A774-01A-21D-A32N-08	0.706	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	2	-15.499060	1	0.100000	NM_000547		0	10	10	0	106	102	0		1			0	0	34	0	0	0.996763	0	0	0	0	0	0	10	106
MCM6	4175	broad.mit.edu	37	2	136615535	136615535	+	Missense_Mutation	SNP	G	G	A	rs138808270		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:136615535G>A	ENST00000264156.2	-	10	1462	c.1402C>T	c.(1402-1404)Cgg>Tgg	p.R468W	MCM6_ENST00000492091.1_Intron	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	468	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		ACTTGATCCCGCACGTCCATC	0.428																																					Ovarian(196;141 2104 8848 24991 25939)	ENST00000264156.2	1.000000	0.070000	3.900000e-01	1.200000e-01	0.190000	0.311491	0.190000	0.160000																										0				29						c.(1402-1404)Cgg>Tgg		minichromosome maintenance complex component 6		G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	277.0	226.0	243.0		1402	2.6	1.0	2	dbSNP_134	243	0,8600		0,0,4300	no	missense	MCM6	NM_005915.4	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	468/822	136615535	1,13005	2203	4300	6503	SO:0001583	missense	4175	1	121412	38				g.chr2:136615535G>A		CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1402C>T	chr2.hg19:g.136615535G>A	ENSP00000264156:p.Arg468Trp	0					MCM6_ENST00000492091.1_Intron	p.R468W	NM_005915.5	NP_005906.2	1	2	3	2.015746	Q14566	MCM6_HUMAN		10	1462	-			B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	0	1	hg19	c.1402C>T	CCDS2179.1	0	.	.	.	.	.	.	.	.	.	.	G	19.87	3.906911	0.72868	2.27E-4	0.0	ENSG00000076003	ENST00000264156	T	0.07021	3.23	5.68	2.57	0.30868	5.68	2.57	0.30868	.	0.090508	0.64402	D	0.000001	T	0.23926	0.0579	M	0.73598	2.24	0.54753	D	0.999987	D	0.76494	0.999	D	0.70227	0.968	T	0.00722	-1.1594	10	0.87932	D	0	-9.4893	9.1095	0.36718	0.0764:0.0:0.5305:0.3931	.	468	Q14566	MCM6_HUMAN	W	468	ENSP00000264156:R468W	ENSP00000264156:R468W	R	-	1	2	2	MCM6	136332005	136332005	1.000000	0.71417	0.975000	0.42487	0.965000	0.64279	2.518000	0.45537	0.738000	0.32606	0.561000	0.74099	CGG	0.108911		TCGA-US-A774-01A-21D-A32N-08	0.428	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1	0	0	1	2	2	2	2	0	0	0	0	122	122	122	118	1	2	-1.905136	0	0.100000	NM_005915		0	6	6	0	734	724	0		1	0		0	0	122	0	0	0.963408	1.491005e-01	0	0	0	70	0	6	734
ACVR2A	92	broad.mit.edu	37	2	148657443	148657443	+	Nonsense_Mutation	SNP	C	C	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:148657443C>A	ENST00000241416.7	+	4	1140	c.504C>A	c.(502-504)taC>taA	p.Y168*	AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000404590.1_Nonsense_Mutation_p.Y168*|ACVR2A_ENST00000535787.1_Nonsense_Mutation_p.Y60*	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	168					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		AGATGGCCTACCCTCCTGTAC	0.388																																						ENST00000241416.7	1.000000	0.470000	1	6.100000e-01	0.780000	0.792233	0.780000	1.000000																										0				45						c.(502-504)taC>taA		activin A receptor, type IIA							198.0	179.0	186.0					2																	148657443		2203	4300	6503	SO:0001587	stop_gained	92	0	0					g.chr2:148657443C>A		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.504C>A	chr2.hg19:g.148657443C>A	ENSP00000241416:p.Tyr168*	0					ACVR2A_ENST00000404590.1_Nonsense_Mutation_p.Y168*|AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000535787.1_Nonsense_Mutation_p.Y60*	p.Y168*	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	1	2	3	2.015746	P27037	AVR2A_HUMAN		4	1140	+			B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Nonsense_Mutation	SNP	ENST00000241416.7	0	1	hg19	c.504C>A	CCDS33301.1	0	.	.	.	.	.	.	.	.	.	.	C	39	7.653516	0.98412	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	.	.	.	5.22	0.915	0.19366	5.22	0.915	0.19366	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6266	0.33892	0.0:0.4945:0.0:0.5055	.	.	.	.	X	168;60;168	.	ENSP00000241416:Y168X	Y	+	3	2	2	ACVR2A	148373913	148373913	0.989000	0.36119	1.000000	0.80357	0.991000	0.79684	0.268000	0.18571	0.174000	0.19809	0.585000	0.79938	TAC	0.108911		TCGA-US-A774-01A-21D-A32N-08	0.388	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	0	0	0	2	2	2	5	0	0	0	0	119	119	119	118	1	2	-3.561369	1	0.100000	NM_001616		0	20	20	0	526	521	0		1	1	1	0	1	119	757	0	0.999995	4.246537e-01	9.996427e-01	2	20	36	535	20	526
ACVR2A	92	broad.mit.edu	37	2	148657447	148657447	+	Missense_Mutation	SNP	C	C	G			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:148657447C>G	ENST00000241416.7	+	4	1144	c.508C>G	c.(508-510)Cct>Gct	p.P170A	AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000404590.1_Missense_Mutation_p.P170A|ACVR2A_ENST00000535787.1_Missense_Mutation_p.P62A	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	170					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		GGCCTACCCTCCTGTACTTGT	0.383																																						ENST00000241416.7	1.000000	0.460000	1	5.900000e-01	0.760000	0.779410	0.760000	1.000000																										0				45						c.(508-510)Cct>Gct		activin A receptor, type IIA							193.0	175.0	181.0					2																	148657447		2203	4300	6503	SO:0001583	missense	92	0	0					g.chr2:148657447C>G		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.508C>G	chr2.hg19:g.148657447C>G	ENSP00000241416:p.Pro170Ala	0					ACVR2A_ENST00000404590.1_Missense_Mutation_p.P170A|AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000535787.1_Missense_Mutation_p.P62A	p.P170A	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	1	2	3	2.015746	P27037	AVR2A_HUMAN		4	1144	+			B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	1	1	hg19	c.508C>G	CCDS33301.1	0	.	.	.	.	.	.	.	.	.	.	C	9.819	1.185208	0.21870	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	D;D;D	0.83506	-1.73;-1.64;-1.73	5.22	5.22	0.72569	5.22	5.22	0.72569	Protein kinase-like domain (1);	0.047266	0.85682	D	0.000000	T	0.73877	0.3643	L	0.31294	0.92	0.58432	D	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.67960	-0.5535	10	0.11182	T	0.66	.	17.333	0.87271	0.0:1.0:0.0:0.0	.	170	P27037	AVR2A_HUMAN	A	170;62;170	ENSP00000241416:P170A;ENSP00000439988:P62A;ENSP00000384338:P170A	ENSP00000241416:P170A	P	+	1	0	0	ACVR2A	148373917	148373917	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.550000	0.60733	2.608000	0.88229	0.585000	0.79938	CCT	0.108911		TCGA-US-A774-01A-21D-A32N-08	0.383	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	0	0	0	2	2	2	2	0	0	0	0	113	113	113	112	1	2	-3.382659	1	0.100000	NM_001616		0	19	19	0	512	508	0		1	1	1	0	0	113	742	0	0.999990	3.897117e-01	9.999932e-01	2	20	34	527	19	512
DPP4	1803	broad.mit.edu	37	2	162875264	162875264	+	Silent	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:162875264C>T	ENST00000360534.3	-	16	1955	c.1395G>A	c.(1393-1395)gcG>gcA	p.A465A	DPP4_ENST00000491591.1_5'Flank	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	465					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A465A(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	GATAATACTTCGCCTCTTTAC	0.473																																						ENST00000360534.3	1.000000	0.520000	1	6.900000e-01	0.910000	0.868360	0.910000	1.000000																										2	Substitution - coding silent(2)	p.A465A(2)	large_intestine(2)	48						c.(1393-1395)gcG>gcA		dipeptidyl-peptidase 4	Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)						128.0	116.0	120.0					2																	162875264		2203	4300	6503	SO:0001819	synonymous_variant	1803	0	0					g.chr2:162875264C>T	M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1395G>A	chr2.hg19:g.162875264C>T		0					DPP4_ENST00000491591.1_5'Flank	p.A465A	NM_001935.3	NP_001926.2	1	2	3	2.015746	P27487	DPP4_HUMAN		16	1955	-			Q53TN1	Silent	SNP	ENST00000360534.3	1	1	hg19	c.1395G>A	CCDS2216.1	1																																																																																								0.108911		TCGA-US-A774-01A-21D-A32N-08	0.473	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	2	-3.089797	1	0.100000			0	15	15	0	338	338	1		1	1		0	0	67	0	0	0.999880	5.297326e-01	0	8	0	32	0	15	338
CEBPZ	10153	broad.mit.edu	37	2	37456107	37456107	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:37456107C>T	ENST00000234170.5	-	2	374	c.229G>A	c.(229-231)Gat>Aat	p.D77N	NDUFAF7_ENST00000002125.4_5'Flank|NDUFAF7_ENST00000336237.6_5'Flank	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	77					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TGAAGGTCATCGATTGCTCCT	0.358																																						ENST00000234170.5	1.000000	0.460000	1	6.800000e-01	0.990000	0.880696	0.990000	1.000000																										0				28						c.(229-231)Gat>Aat		CCAAT/enhancer binding protein (C/EBP), zeta							78.0	70.0	73.0					2																	37456107		2202	4300	6502	SO:0001583	missense	10153	0	0					g.chr2:37456107C>T	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.229G>A	chr2.hg19:g.37456107C>T	ENSP00000234170:p.Asp77Asn	0					NDUFAF7_ENST00000336237.6_5'Flank|NDUFAF7_ENST00000002125.4_5'Flank	p.D77N	NM_005760.2	NP_005751.2	1	2	3	2.015746	Q03701	CEBPZ_HUMAN		2	374	-		all_hematologic(82;0.21)	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	0	1	hg19	c.229G>A	CCDS1787.1	1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.588983	0.66105	.	.	ENSG00000115816	ENST00000234170;ENST00000545744;ENST00000446769	T;T	0.02369	4.32;4.32	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.11024	0.0269	L	0.36672	1.1	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.01988	-1.1234	10	0.87932	D	0	.	19.7248	0.96160	0.0:1.0:0.0:0.0	.	77	Q03701	CEBPZ_HUMAN	N	77;77;28	ENSP00000234170:D77N;ENSP00000391881:D28N	ENSP00000234170:D77N	D	-	1	0	0	CEBPZ	37309611	37309611	1.000000	0.71417	0.987000	0.45799	0.218000	0.24690	7.273000	0.78527	2.642000	0.89623	0.655000	0.94253	GAT	0.108911		TCGA-US-A774-01A-21D-A32N-08	0.358	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	2	-3.690909	1	0.100000	NM_005760		0	8	8	0	169	162	1		1	1		0	0	20	0	0	0.988060	6.351920e-01	0	9	0	36	0	8	169
PCGF1	84759	broad.mit.edu	37	2	74733907	74733907	+	Missense_Mutation	SNP	G	G	A	rs370641896		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:74733907G>A	ENST00000233630.6	-	3	1215	c.304C>T	c.(304-306)Cgg>Tgg	p.R102W	LBX2-AS1_ENST00000603175.1_RNA|LBX2-AS1_ENST00000548978.2_RNA|PCGF1_ENST00000480844.2_5'UTR	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	102	Required for repressor activity.				histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						TGCATGACCCGGTCCAGTTTG	0.502																																						ENST00000233630.6	1.000000	0.110000	6.200000e-01	1.900000e-01	0.300000	0.404502	0.300000	0.260000																										0				12						c.(304-306)Cgg>Tgg		polycomb group ring finger 1		G	TRP/ARG	0,4406		0,0,2203	146.0	129.0	135.0		304	4.8	1.0	2		135	1,8599	1.2+/-3.3	0,1,4299	no	missense	PCGF1	NM_032673.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	102/260	74733907	1,13005	2203	4300	6503	SO:0001583	missense	84759	0	0					g.chr2:74733907G>A	AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.304C>T	chr2.hg19:g.74733907G>A	ENSP00000233630:p.Arg102Trp	0					PCGF1_ENST00000480844.2_5'UTR|LBX2-AS1_ENST00000603175.1_RNA|LBX2-AS1_ENST00000548978.2_RNA	p.R102W	NM_032673.2	NP_116062.2	1	2	3	2.015746	Q9BSM1	PCGF1_HUMAN		3	1215	-			Q7Z506	Missense_Mutation	SNP	ENST00000233630.6	0	1	hg19	c.304C>T	CCDS1946.2	0	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337545	0.81911	0.0	1.16E-4	ENSG00000115289	ENST00000233630	T	0.18502	2.21	5.69	4.82	0.62117	5.69	4.82	0.62117	Zinc finger, RING/FYVE/PHD-type (1);	0.144062	0.47455	D	0.000222	T	0.43100	0.1232	M	0.82823	2.61	0.49483	D	0.999795	D	0.89917	1.0	D	0.83275	0.996	T	0.43956	-0.9359	10	0.87932	D	0	-14.6772	10.3893	0.44158	0.0894:0.0:0.9106:0.0	.	102	Q9BSM1	PCGF1_HUMAN	W	102	ENSP00000233630:R102W	ENSP00000233630:R102W	R	-	1	2	2	PCGF1	74587415	74587415	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.207000	0.51106	1.413000	0.46997	0.655000	0.94253	CGG	0.108911		TCGA-US-A774-01A-21D-A32N-08	0.502	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252216.1	0	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	2	-2.540384	1	0.100000	NM_032673		0	6	6	0	458	452	0		1	0		0	0	74	0	0	0.963764	4.041833e-01	0	0	0	95	0	6	458
ITGA4	3676	broad.mit.edu	37	2	182358062	182358062	+	Silent	SNP	C	C	T	rs202012822		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr2:182358062C>T	ENST00000397033.2	+	11	1594	c.1164C>T	c.(1162-1164)atC>atT	p.I388I		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	388					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	ATGTTGCTATCGGAGCTCCAC	0.353													C|||	1	0.000199681	0.0	0.0	5008	,	,		17881	0.0		0.0	False		,,,				2504	0.001					ENST00000397033.2	1.000000	0.220000	9.300000e-01	3.300000e-01	0.500000	0.563271	0.500000	0.440000																										0				58						c.(1162-1164)atC>atT		integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	Natalizumab(DB00108)|Tinzaparin(DB06822)						97.0	90.0	92.0					2																	182358062		1849	4095	5944	SO:0001819	synonymous_variant	3676	3	120802	36				g.chr2:182358062C>T		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.1164C>T	chr2.hg19:g.182358062C>T		0						p.I388I	NM_000885.4	NP_000876.3	1	2	3	2.015746	P13612	ITA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0593)	11	1594	+			D3DPG4|Q7Z4L6	Silent	SNP	ENST00000397033.2	1	1	hg19	c.1164C>T	CCDS42788.1	0																																																																																								0.108911		TCGA-US-A774-01A-21D-A32N-08	0.353	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1	0	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	2	-2.732104	1	0.100000			0	8	7	0	356	349	0		1	0		0	0	64	0	0	0.988567	9.747562e-02	0	0	0	21	0	8	356
CCDC80	151887	broad.mit.edu	37	3	112357638	112357638	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr3:112357638G>A	ENST00000206423.3	-	2	2068	c.1115C>T	c.(1114-1116)gCt>gTt	p.A372V	CCDC80_ENST00000439685.2_Missense_Mutation_p.A372V|CCDC80_ENST00000475181.1_5'Flank	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	372	Thr-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						AGGTCTTGCAGCAACTGTTAC	0.642																																						ENST00000206423.3	0.490000	0.090000	3.700000e-01	1.500000e-01	0.240000	0.266677	0.240000	0.220000																										0				51						c.(1114-1116)gCt>gTt		coiled-coil domain containing 80							81.0	71.0	75.0					3																	112357638		2203	4300	6503	SO:0001583	missense	151887	0	0					g.chr3:112357638G>A	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1115C>T	chr3.hg19:g.112357638G>A	ENSP00000206423:p.Ala372Val	0					CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.A372V	p.A372V	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	0	0	0	1.974767	Q76M96	CCD80_HUMAN		2	2068	-			D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	0	1	hg19	c.1115C>T	CCDS2968.1	0	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814389	0.70912	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.49139	0.79;0.79	4.89	4.89	0.63831	4.89	4.89	0.63831	.	0.110597	0.64402	D	0.000007	T	0.36936	0.0985	L	0.27053	0.805	0.80722	D	1	B;P;B	0.41393	0.419;0.748;0.295	B;B;B	0.37650	0.187;0.255;0.091	T	0.16100	-1.0414	10	0.30078	T	0.28	-7.3048	18.2349	0.89946	0.0:0.0:1.0:0.0	.	383;372;372	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	V	372	ENSP00000206423:A372V;ENSP00000411814:A372V	ENSP00000206423:A372V	A	-	2	0	0	CCDC80	113840328	113840328	0.994000	0.37717	0.108000	0.21378	0.034000	0.12701	5.501000	0.66950	2.535000	0.85469	0.555000	0.69702	GCT	0.082569		TCGA-US-A774-01A-21D-A32N-08	0.642	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	0	0	1	2	19	19	2	1	1	1	1	73	73	73	72	1	2	-3.306992	1	0.100000	NM_199511		0	5	5	0	423	404	0		0	0		1	0	73	0	0	0.002046	2.291097e-03	0	0	0	415	0	5	423
B3GNT5	84002	broad.mit.edu	37	3	182988349	182988349	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr3:182988349G>A	ENST00000326505.3	+	2	1293	c.763G>A	c.(763-765)Gga>Aga	p.G255R	B3GNT5_ENST00000465010.1_Missense_Mutation_p.G255R|MCF2L2_ENST00000328913.3_Intron|MCF2L2_ENST00000473233.1_Intron|MCF2L2_ENST00000447025.2_Intron|B3GNT5_ENST00000460419.1_Missense_Mutation_p.G255R	NM_032047.4	NP_114436.1	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5	255					cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycolipid biosynthetic process (GO:0009247)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity (GO:0008457)|galactosyltransferase activity (GO:0008378)|lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase activity (GO:0047256)|lipopolysaccharide N-acetylglucosaminyltransferase activity (GO:0008917)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CTACACAGCCGGAGCTGCCTA	0.473																																						ENST00000326505.3	1.000000	0.120000	1	2.200000e-01	0.390000	0.498858	0.390000	0.300000																										0				8						c.(763-765)Gga>Aga		UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5							62.0	56.0	58.0					3																	182988349		2203	4300	6503	SO:0001583	missense	84002	2	121412	35				g.chr3:182988349G>A	AB045278	CCDS3244.1	3q28	2013-02-21			ENSG00000176597	ENSG00000176597	2.4.1.206	"""Beta 3-glycosyltransferases"""	15684	protein-coding gene	gene with protein product	"""lactosylceramide 1,3-N-acetyl-beta-D-glucosaminyltransferase"""	615333				11283017	Standard	XM_005247824		Approved	B3GN-T5, beta3Gn-T5	uc003flk.3	Q9BYG0	OTTHUMG00000158436	ENST00000326505.3:c.763G>A	chr3.hg19:g.182988349G>A	ENSP00000316173:p.Gly255Arg	1					MCF2L2_ENST00000328913.3_Intron|MCF2L2_ENST00000473233.1_Intron|MCF2L2_ENST00000447025.2_Intron|B3GNT5_ENST00000460419.1_Missense_Mutation_p.G255R|B3GNT5_ENST00000465010.1_Missense_Mutation_p.G255R	p.G255R	NM_032047.4	NP_114436.1	1	2	3	2.109877	Q9BYG0	B3GN5_HUMAN	all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)	2	1293	+	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		D3DNS5|Q59FE3|Q7L9Z5|Q8WWP9	Missense_Mutation	SNP	ENST00000326505.3	0	1	hg19	c.763G>A	CCDS3244.1	0	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767063	0.49574	.	.	ENSG00000176597	ENST00000326505;ENST00000460419;ENST00000465010	T;T;T	0.68181	-0.31;-0.31;-0.31	5.91	5.04	0.67666	5.91	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.86871	0.6037	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90542	0.4503	10	0.62326	D	0.03	.	15.1217	0.72450	0.0677:0.0:0.9323:0.0	.	255	Q9BYG0	B3GN5_HUMAN	R	255	ENSP00000316173:G255R;ENSP00000420778:G255R;ENSP00000417868:G255R	ENSP00000316173:G255R	G	+	1	0	0	B3GNT5	184471043	184471043	1.000000	0.71417	0.075000	0.20258	0.107000	0.19398	9.869000	0.99810	1.514000	0.48869	-0.145000	0.13849	GGA	0.130855		TCGA-US-A774-01A-21D-A32N-08	0.473	B3GNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351009.1	0	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	2	-3.671909	1	0.100000	NM_032047		0	4	4	0	263	259	0		1	0		0	0	54	0	0	0.887506	1.375242e-01	0	0	0	34	0	4	263
SCN11A	11280	broad.mit.edu	37	3	38913712	38913712	+	Missense_Mutation	SNP	C	C	T	rs367743263		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr3:38913712C>T	ENST00000302328.3	-	20	3665	c.3467G>A	c.(3466-3468)cGt>cAt	p.R1156H	SCN11A_ENST00000456224.3_Missense_Mutation_p.R1118H|SCN11A_ENST00000444237.2_Missense_Mutation_p.R1156H|SCN11A_ENST00000450244.1_Missense_Mutation_p.R1156H	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1156					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGACAGCGCACGAAGAGGCCT	0.463																																						ENST00000302328.3	0.410000	0.100000	3.200000e-01	1.500000e-01	0.220000	0.243457	0.220000	0.220000																										0				119						c.(3466-3468)cGt>cAt		sodium channel, voltage-gated, type XI, alpha subunit	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	C	HIS/ARG	0,4406		0,0,2203	160.0	156.0	157.0		3467	5.5	0.0	3		157	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCN11A	NM_014139.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1156/1792	38913712	1,13005	2203	4300	6503	SO:0001583	missense	11280	6	121412	41				g.chr3:38913712C>T	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3467G>A	chr3.hg19:g.38913712C>T	ENSP00000307599:p.Arg1156His	0					SCN11A_ENST00000456224.3_Missense_Mutation_p.R1118H|SCN11A_ENST00000450244.1_Missense_Mutation_p.R1156H|SCN11A_ENST00000444237.2_Missense_Mutation_p.R1156H	p.R1156H	NM_014139.2	NP_054858.2	0	0	0	1.974767	Q9UI33	SCNBA_HUMAN		20	3665	-			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	0	1	hg19	c.3467G>A	CCDS33737.1	0	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691614	0.68271	0.0	1.16E-4	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94	5.54	5.54	0.83059	5.54	5.54	0.83059	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99369	0.9778	H	0.96833	3.89	0.40458	D	0.980215	D	0.89917	1.0	D	0.97110	1.0	D	0.98977	1.0803	10	0.87932	D	0	.	18.0499	0.89344	0.0:1.0:0.0:0.0	.	1156	Q9UI33	SCNBA_HUMAN	H	1156;1156;1118;1156	ENSP00000307599:R1156H;ENSP00000400945:R1156H;ENSP00000416757:R1118H;ENSP00000408028:R1156H	ENSP00000307599:R1156H	R	-	2	0	0	SCN11A	38888716	38888716	0.860000	0.29831	0.044000	0.18714	0.102000	0.19082	7.729000	0.84864	2.596000	0.87737	0.561000	0.74099	CGT	0.082569		TCGA-US-A774-01A-21D-A32N-08	0.463	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	0	0	1	2	2	2	2	0	0	0	0	109	109	109	107	1	2	-2.642222	1	0.100000	NM_014139		0	8	8	0	704	696	0		1	0		0	0	109	0	0	0.988911	0	0	0	0	1	0	8	704
RBM6	10180	broad.mit.edu	37	3	50095912	50095912	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr3:50095912A>G	ENST00000266022.4	+	10	2306	c.2047A>G	c.(2047-2049)Act>Gct	p.T683A	RBM6_ENST00000442092.1_Missense_Mutation_p.T161A|RBM6_ENST00000422955.1_Missense_Mutation_p.T161A|RBM6_ENST00000443081.1_Missense_Mutation_p.T551A|RBM6_ENST00000539992.1_Missense_Mutation_p.T25A|RBM6_ENST00000441115.1_3'UTR	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	683					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		TGTCCGCCTTACTACTGCCAA	0.498																																						ENST00000266022.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999511	0.990000	1.000000																										0				33						c.(2047-2049)Act>Gct		RNA binding motif protein 6							193.0	181.0	185.0					3																	50095912		2203	4300	6503	SO:0001583	missense	10180	0	0					g.chr3:50095912A>G	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2047A>G	chr3.hg19:g.50095912A>G	ENSP00000266022:p.Thr683Ala	0					RBM6_ENST00000442092.1_Missense_Mutation_p.T161A|RBM6_ENST00000539992.1_Missense_Mutation_p.T25A|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000422955.1_Missense_Mutation_p.T161A|RBM6_ENST00000443081.1_Missense_Mutation_p.T551A	p.T683A	NM_005777.2	NP_005768.1	0	0	0	1.974767	P78332	RBM6_HUMAN		10	2306	+			O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	1	1	hg19	c.2047A>G	CCDS2809.1	1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.420772	0.42918	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000539992;ENST00000422955	T;T;T;T;T	0.40476	1.27;1.27;1.27;1.03;1.27	5.71	4.51	0.55191	5.71	4.51	0.55191	Nucleotide-binding, alpha-beta plait (1);	0.465551	0.23487	N	0.047660	T	0.16938	0.0407	N	0.03608	-0.345	0.22199	N	0.9993	B;B	0.26935	0.139;0.164	B;B	0.28465	0.042;0.09	T	0.12889	-1.0530	9	.	.	.	-3.4384	4.6373	0.12530	0.625:0.0:0.0942:0.2808	.	551;683	E9PGM9;P78332	.;RBM6_HUMAN	A	161;683;551;25;161	ENSP00000393530:T161A;ENSP00000266022:T683A;ENSP00000396466:T551A;ENSP00000443165:T25A;ENSP00000392939:T161A	.	T	+	1	0	0	RBM6	50070916	50070916	0.920000	0.31207	0.993000	0.49108	0.997000	0.91878	2.437000	0.44828	2.189000	0.69895	0.529000	0.55759	ACT	0.082569		TCGA-US-A774-01A-21D-A32N-08	0.498	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	1	0	1	2	2	2	2	0	0	0	0	136	136	136	134	1	2	-20.000000	1	0.100000	NM_005777		0	48	48	0	611	612	1		1	1		0	0	136	0	0	1.000000	9.917471e-01	0	21	0	74	0	48	611
STAB1	23166	broad.mit.edu	37	3	52548769	52548769	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr3:52548769G>A	ENST00000321725.6	+	35	3807	c.3731G>A	c.(3730-3732)cGc>cAc	p.R1244H		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1244	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCCCCTGGCCGCTCGCTGATT	0.662																																						ENST00000321725.6	0.480000	0.100000	3.600000e-01	1.600000e-01	0.250000	0.269090	0.250000	0.230000																										0				76						c.(3730-3732)cGc>cAc		stabilin 1							60.0	65.0	63.0					3																	52548769		2203	4300	6503	SO:0001583	missense	23166	1	121406	33				g.chr3:52548769G>A	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3731G>A	chr3.hg19:g.52548769G>A	ENSP00000312946:p.Arg1244His	0						p.R1244H	NM_015136.2	NP_055951.2	0	0	0	1.974767	Q9NY15	STAB1_HUMAN		35	3807	+			A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	0	1	hg19	c.3731G>A	CCDS33768.1	0	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551298	0.45383	.	.	ENSG00000010327	ENST00000321725	D	0.84944	-1.92	5.72	3.94	0.45596	5.72	3.94	0.45596	FAS1 domain (3);	0.314687	0.33631	N	0.004717	T	0.69043	0.3067	N	0.22421	0.69	0.09310	N	1	P	0.45634	0.863	B	0.31016	0.123	T	0.62358	-0.6871	10	0.48119	T	0.1	-9.0658	8.7596	0.34667	0.162:0.0:0.838:0.0	.	1244	Q9NY15	STAB1_HUMAN	H	1244	ENSP00000312946:R1244H	ENSP00000312946:R1244H	R	+	2	0	0	STAB1	52523809	52523809	0.560000	0.26570	0.393000	0.26258	0.829000	0.46940	1.856000	0.39389	0.780000	0.33566	0.561000	0.74099	CGC	0.082569		TCGA-US-A774-01A-21D-A32N-08	0.662	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	0	0	1	2	2	2	2	0	0	0	0	89	89	89	87	1	2	-3.066380	1	0.100000	NM_015136		0	6	6	0	491	484	0		1	0		0	0	89	0	0	0.963606	8.291077e-02	0	0	0	33	0	6	491
LPP	4026	broad.mit.edu	37	3	188592235	188592235	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr3:188592235G>T	ENST00000312675.4	+	11	2053	c.1807G>T	c.(1807-1809)Gtg>Ttg	p.V603L	LPP_ENST00000543006.1_Missense_Mutation_p.V603L	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	603	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		CCGCATCAGGGTGTTGACCGC	0.512			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																	ENST00000312675.4	1.000000	0.540000	1	7.000000e-01	0.920000	0.877981	0.920000	1.000000				Dom	yes			Dom	yes		3	3q28	3q28	4026	T	LIM domain containing preferred translocation partner in lipoma				"""L, M"""	L, M	HMGA2, MLL, C12orf9		lipoma, leukemia	HMGA2/LPP(161)	0				10						c.(1807-1809)Gtg>Ttg		LIM domain containing preferred translocation partner in lipoma							119.0	108.0	112.0					3																	188592235		2203	4300	6503	SO:0001583	missense	4026	0	0					g.chr3:188592235G>T	AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.1807G>T	chr3.hg19:g.188592235G>T	ENSP00000318089:p.Val603Leu	1					LPP_ENST00000543006.1_Missense_Mutation_p.V603L	p.V603L	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	1	2	3	2.109877	Q93052	LPP_HUMAN		11	2053	+	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	ENST00000312675.4	1	1	hg19	c.1807G>T	CCDS3291.1	1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384829	0.61956	.	.	ENSG00000145012	ENST00000312675;ENST00000543006	T;T	0.54675	0.56;0.56	5.79	4.92	0.64577	5.79	4.92	0.64577	Zinc finger, LIM-type (1);	0.173178	0.51477	D	0.000096	T	0.41971	0.1182	L	0.29908	0.895	0.33682	D	0.612234	B;B	0.25955	0.003;0.138	B;B	0.25987	0.003;0.065	T	0.53012	-0.8498	10	0.37606	T	0.19	.	13.6926	0.62556	0.0737:0.0:0.9263:0.0	.	456;603	B7Z8W0;Q93052	.;LPP_HUMAN	L	603	ENSP00000318089:V603L;ENSP00000438891:V603L	ENSP00000318089:V603L	V	+	1	0	0	LPP	190074929	190074929	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	8.025000	0.88777	1.444000	0.47605	0.655000	0.94253	GTG	0.130855		TCGA-US-A774-01A-21D-A32N-08	0.512	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344030.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	2	-4.369263	1	0.100000	NM_005578		0	18	18	0	418	414	0		1	0		0	0	59	0	0	0.999981	3.111652e-01	0	1	0	25	0	18	418
BDH2	56898	broad.mit.edu	37	4	104000881	104000881	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr4:104000881A>G	ENST00000296424.4	-	10	836	c.716T>C	c.(715-717)aTt>aCt	p.I239T	SLC9B2_ENST00000339611.4_5'Flank|SLC9B2_ENST00000503230.1_5'Flank|SLC9B2_ENST00000394785.3_5'Flank	NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	239					epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		GCCTCCATCAATGATGACAGG	0.438																																						ENST00000296424.4	1.000000	0.120000	1	2.200000e-01	0.380000	0.482223	0.380000	0.290000																										0				10						c.(715-717)aTt>aCt		3-hydroxybutyrate dehydrogenase, type 2							126.0	110.0	116.0					4																	104000881		2203	4300	6503	SO:0001583	missense	56898	0	0					g.chr4:104000881A>G	AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.716T>C	chr4.hg19:g.104000881A>G	ENSP00000296424:p.Ile239Thr	0					SLC9B2_ENST00000339611.4_5'Flank|SLC9B2_ENST00000503230.1_5'Flank|SLC9B2_ENST00000394785.3_5'Flank	p.I239T	NM_020139.3	NP_064524.3	1	2	3	2.026388	Q9BUT1	BDH2_HUMAN		10	836	-		Hepatocellular(203;0.217)	A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Missense_Mutation	SNP	ENST00000296424.4	0	1	hg19	c.716T>C	CCDS3663.1	0	.	.	.	.	.	.	.	.	.	.	A	23.2	4.392016	0.83011	.	.	ENSG00000164039	ENST00000296424	T	0.25414	1.8	5.31	5.31	0.75309	5.31	5.31	0.75309	NAD(P)-binding domain (1);	0.232522	0.43579	D	0.000549	T	0.48333	0.1494	M	0.72624	2.21	0.80722	D	1	D	0.61697	0.99	D	0.67900	0.954	T	0.51100	-0.8748	10	0.87932	D	0	.	13.0737	0.59075	1.0:0.0:0.0:0.0	.	239	Q9BUT1	BDH2_HUMAN	T	239	ENSP00000296424:I239T	ENSP00000296424:I239T	I	-	2	0	0	BDH2	104220330	104220330	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.861000	0.87004	2.130000	0.65690	0.477000	0.44152	ATT	0.111550		TCGA-US-A774-01A-21D-A32N-08	0.438	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157159.2	0	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	2	-5.554130	1	0.100000	NM_020139		0	4	4	0	263	262	0		1	1		0	0	31	0	0	0.890188	9.010234e-01	0	14	0	265	0	4	263
TADA2B	93624	broad.mit.edu	37	4	7056454	7056454	+	Silent	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr4:7056454G>A	ENST00000310074.7	+	2	1125	c.936G>A	c.(934-936)cgG>cgA	p.R312R	TADA2B_ENST00000512388.1_Silent_p.R237R|TADA2B_ENST00000515646.1_Silent_p.R220R	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	312					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R312R(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						AGGCAGCGCGGCATAAACGGG	0.557																																						ENST00000310074.7	0.610000	0.110000	4.500000e-01	1.900000e-01	0.300000	0.331177	0.300000	0.280000																										1	Substitution - coding silent(1)	p.R312R(1)	prostate(1)	18						c.(934-936)cgG>cgA		transcriptional adaptor 2B							57.0	67.0	63.0					4																	7056454		2035	4181	6216	SO:0001819	synonymous_variant	93624	0	0					g.chr4:7056454G>A	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.936G>A	chr4.hg19:g.7056454G>A		0					TADA2B_ENST00000515646.1_Silent_p.R220R|TADA2B_ENST00000512388.1_Silent_p.R237R	p.R312R	NM_152293.2	NP_689506.2	0	0	0	1.913273	Q86TJ2	TAD2B_HUMAN		2	1125	+			A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Silent	SNP	ENST00000310074.7	0	1	hg19	c.936G>A	CCDS47007.1	0																																																																																								0.052632		TCGA-US-A774-01A-21D-A32N-08	0.557	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	0	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	2	-2.822129	1	0.100000	NM_152293		0	5	5	0	318	314	0		1	0		0	0	49	0	0	0.935951	3.130629e-01	0	0	0	62	0	5	318
QDPR	5860	broad.mit.edu	37	4	17493886	17493886	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr4:17493886G>A	ENST00000281243.5	-	5	693	c.514C>T	c.(514-516)Ccg>Tcg	p.P172S	QDPR_ENST00000428702.2_Missense_Mutation_p.P141S|QDPR_ENST00000513615.1_Intron|QDPR_ENST00000508623.1_Intron	NM_000320.2	NP_000311.2	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	172					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|dihydrobiopterin metabolic process (GO:0051066)|L-phenylalanine catabolic process (GO:0006559)|liver development (GO:0001889)|response to aluminum ion (GO:0010044)|response to glucagon (GO:0033762)|response to lead ion (GO:0010288)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	6,7-dihydropteridine reductase activity (GO:0004155)|electron carrier activity (GO:0009055)|NADH binding (GO:0070404)|NADPH binding (GO:0070402)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	13						GCCCCGGGCGGCATGCCGCTG	0.642																																						ENST00000281243.5	0.570000	0.110000	4.300000e-01	1.800000e-01	0.280000	0.311395	0.280000	0.260000																										0				13						c.(514-516)Ccg>Tcg		quinoid dihydropteridine reductase							36.0	40.0	39.0					4																	17493886		2203	4300	6503	SO:0001583	missense	5860	0	0					g.chr4:17493886G>A	AB053170	CCDS3421.1	4p15.31	2014-04-01			ENSG00000151552	ENSG00000151552	1.5.1.34	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	9752	protein-coding gene	gene with protein product	"""6,7-dihydropteridine reductase"", ""short chain dehydrogenase/reductase family 33C, member 1"""	612676				19027726	Standard	NM_000320		Approved	DHPR, PKU2, SDR33C1	uc003gpd.3	P09417	OTTHUMG00000128537	ENST00000281243.5:c.514C>T	chr4.hg19:g.17493886G>A	ENSP00000281243:p.Pro172Ser	0					QDPR_ENST00000428702.2_Missense_Mutation_p.P141S|QDPR_ENST00000513615.1_Intron|QDPR_ENST00000508623.1_Intron	p.P172S	NM_000320.2	NP_000311.2	0	0	0	1.913273	P09417	DHPR_HUMAN		5	693	-			A8K158|B3KW71|Q53F52|Q9H3M5	Missense_Mutation	SNP	ENST00000281243.5	0	1	hg19	c.514C>T	CCDS3421.1	0	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156614	0.78114	.	.	ENSG00000151552	ENST00000281243;ENST00000428702	D;D	0.94457	-3.43;-3.43	5.26	5.26	0.73747	5.26	5.26	0.73747	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.97707	0.9248	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.975	D	0.98210	1.0472	10	0.56958	D	0.05	-8.7527	17.6482	0.88154	0.0:0.0:1.0:0.0	.	141;172	B3KW71;P09417	.;DHPR_HUMAN	S	172;141	ENSP00000281243:P172S;ENSP00000390944:P141S	ENSP00000281243:P172S	P	-	1	0	0	QDPR	17102984	17102984	1.000000	0.71417	0.997000	0.53966	0.399000	0.30720	8.814000	0.91968	2.448000	0.82819	0.557000	0.71058	CCG	0.052632		TCGA-US-A774-01A-21D-A32N-08	0.642	QDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250372.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	59	1	2	-3.055119	1	0.100000	NM_000320		0	5	5	0	340	334	0		1	0		0	0	66	0	0	0.935062	4.005050e-01	0	0	0	82	0	5	340
UGT2B28	54490	broad.mit.edu	37	4	70146857	70146857	+	Silent	SNP	C	C	T	rs542781153		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr4:70146857C>T	ENST00000335568.5	+	1	641	c.639C>T	c.(637-639)aaC>aaT	p.N213N	UGT2B28_ENST00000511240.1_Silent_p.N213N	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	213					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						GGGTAAAAAACATGATCTATG	0.348													-|||	1	0.000199681	0.0	0.0	5008	,	,		15689	0.0		0.001	False		,,,				2504	0.0					ENST00000335568.5	1.000000	0.220000	1	3.500000e-01	0.540000	0.604138	0.540000	0.470000																										0				31						c.(637-639)aaC>aaT		UDP glucuronosyltransferase 2 family, polypeptide B28							68.0	72.0	71.0					4																	70146857		2027	4227	6254	SO:0001819	synonymous_variant	54490	45	117472	45				g.chr4:70146857C>T	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.639C>T	chr4.hg19:g.70146857C>T		0					UGT2B28_ENST00000511240.1_Silent_p.N213N	p.N213N	NM_053039.1	NP_444267.1	1	2	3	2.026388	Q9BY64	UDB28_HUMAN		1	641	+			B5BUM0|Q9BY62|Q9BY63	Silent	SNP	ENST00000335568.5	0	1	hg19	c.639C>T	CCDS3528.1	0																																																																																								0.111550		TCGA-US-A774-01A-21D-A32N-08	0.348	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	0	0	1	2	19	2	2	1	1	1	1	49	49	49	49	1	2	-3.536422	1	0.100000	NM_053039		0	7	7	0	297	292	0		0			1	0	49	0	0	0.011208	0	0	0	0	0	0	7	297
UGT2B28	54490	broad.mit.edu	37	4	70146870	70146870	+	Missense_Mutation	SNP	C	C	A	rs575693723	byFrequency	TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr4:70146870C>A	ENST00000335568.5	+	1	654	c.652C>A	c.(652-654)Ctt>Att	p.L218I	UGT2B28_ENST00000511240.1_Missense_Mutation_p.L218I	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	218					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						GATCTATGTGCTTTATTTTGA	0.348													-|||	3	0.000599042	0.0	0.0043	5008	,	,		15985	0.0		0.0	False		,,,				2504	0.0					ENST00000335568.5	1.000000	0.140000	1	2.400000e-01	0.400000	0.495836	0.400000	0.310000																										0				31						c.(652-654)Ctt>Att		UDP glucuronosyltransferase 2 family, polypeptide B28							63.0	69.0	67.0					4																	70146870		2032	4227	6259	SO:0001583	missense	54490	3	117424	31				g.chr4:70146870C>A	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.652C>A	chr4.hg19:g.70146870C>A	ENSP00000334276:p.Leu218Ile	0					UGT2B28_ENST00000511240.1_Missense_Mutation_p.L218I	p.L218I	NM_053039.1	NP_444267.1	1	2	3	2.026388	Q9BY64	UDB28_HUMAN		1	654	+			B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	0	1	hg19	c.652C>A	CCDS3528.1	0	.	.	.	.	.	.	.	.	.	.	-	5.407	0.260353	0.10239	.	.	ENSG00000135226	ENST00000335568;ENST00000511240	T;T	0.72505	-0.66;-0.66	2.18	0.143	0.14820	2.18	0.143	0.14820	.	0.335796	0.24254	U	0.040145	T	0.62332	0.2419	L	0.56769	1.78	0.09310	N	1	B;B	0.24368	0.102;0.031	B;B	0.32724	0.113;0.151	T	0.52946	-0.8507	10	0.36615	T	0.2	.	5.4611	0.16617	0.0:0.5448:0.0:0.4552	.	218;218	Q9BY64-2;Q9BY64	.;UDB28_HUMAN	I	218	ENSP00000334276:L218I;ENSP00000427399:L218I	ENSP00000334276:L218I	L	+	1	0	0	UGT2B28	70181459	70181459	0.000000	0.05858	0.029000	0.17559	0.094000	0.18550	-1.487000	0.02310	-0.148000	0.11234	0.184000	0.17185	CTT	0.111550		TCGA-US-A774-01A-21D-A32N-08	0.348	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	0	0	0	2	19	2	2	1	1	1	1	50	50	50	50	1	2	-4.316248	1	0.100000	NM_053039		0	5	3	0	303	298	0		0			1	0	50	0	0	0.002303	0	0	0	0	0	0	5	303
RRH	10692	broad.mit.edu	37	4	110756591	110756591	+	Nonsense_Mutation	SNP	C	C	T	rs568068949	byFrequency	TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr4:110756591C>T	ENST00000317735.4	+	3	401	c.367C>T	c.(367-369)Cga>Tga	p.R123*		NM_006583.2	NP_006574.1	O14718	OPSX_HUMAN	retinal pigment epithelium-derived rhodopsin homolog	123					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	12		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		GGCTGTGGACCGATACCTGAC	0.393													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15407	0.0		0.0	False		,,,				2504	0.0					ENST00000317735.4	1.000000	0.990000	1	9.900000e-01	0.990000	0.999255	0.990000	1.000000																										0				12						c.(367-369)Cga>Tga		retinal pigment epithelium-derived rhodopsin homolog							155.0	150.0	151.0					4																	110756591		2203	4300	6503	SO:0001587	stop_gained	10692	6	121412	40				g.chr4:110756591C>T	AF012270	CCDS3687.1	4q25	2012-08-08			ENSG00000180245	ENSG00000180245		"""GPCR / Class A : Opsin receptors"""	10450	protein-coding gene	gene with protein product	"""peropsin"""	605224				9275222	Standard	NM_006583		Approved	peropsin	uc003hzv.3	O14718	OTTHUMG00000132045	ENST00000317735.4:c.367C>T	chr4.hg19:g.110756591C>T	ENSP00000314992:p.Arg123*	0						p.R123*	NM_006583.2	NP_006574.1	1	2	3	2.026388	O14718	OPSX_HUMAN		3	401	+		Hepatocellular(203;0.217)	A1A4V2|Q7RTS4	Nonsense_Mutation	SNP	ENST00000317735.4	0	1	hg19	c.367C>T	CCDS3687.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.341306	0.95783	.	.	ENSG00000180245	ENST00000317735	.	.	.	5.88	5.02	0.67125	5.88	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1711	0.81817	0.1343:0.8657:0.0:0.0	.	.	.	.	X	123	.	ENSP00000314992:R123X	R	+	1	2	2	RRH	110976040	110976040	0.947000	0.32204	0.992000	0.48379	0.597000	0.36814	1.539000	0.36104	1.419000	0.47118	0.655000	0.94253	CGA	0.111550		TCGA-US-A774-01A-21D-A32N-08	0.393	RRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255066.1	1	0	1	2	2	2	2	0	0	0	0	71	71	71	69	1	2	-2.619821	1	0.100000	NM_006583		0	26	26	0	309	303	0		1			0	0	71	0	0	1.000000	0	0	0	0	0	0	26	309
PCDHGB4	8641	broad.mit.edu	37	5	140768992	140768992	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr5:140768992C>T	ENST00000519479.1	+	1	1541	c.1541C>T	c.(1540-1542)gCg>gTg	p.A514V	PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	514	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTGTTCGCGCAGCGCGCC	0.667																																						ENST00000519479.1	0.820000	0.290000	6.700000e-01	3.900000e-01	0.520000	0.539071	0.520000	0.510000																										0				37						c.(1540-1542)gCg>gTg		protocadherin gamma subfamily B, 4							47.0	53.0	51.0					5																	140768992		2044	4181	6225	SO:0001583	missense	8641	0	0					g.chr5:140768992C>T	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1541C>T	chr5.hg19:g.140768992C>T	ENSP00000428288:p.Ala514Val	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron	p.A514V	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	0	1	1	1.998511	Q9UN71	PCDGG_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1541	+			O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	0	1	hg19	c.1541C>T	CCDS54928.1	0	.	.	.	.	.	.	.	.	.	.	.	35	5.443208	0.96187	.	.	ENSG00000253953	ENST00000519479	T	0.43294	0.95	4.95	4.95	0.65309	4.95	4.95	0.65309	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.54498	0.1862	L	0.31578	0.945	0.38208	D	0.940379	D;D	0.89917	0.994;1.0	P;D	0.79108	0.89;0.992	T	0.62364	-0.6870	9	0.87932	D	0	.	18.196	0.89822	0.0:1.0:0.0:0.0	.	514;514	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	V	514	ENSP00000428288:A514V	ENSP00000428288:A514V	A	+	2	0	0	PCDHGB4	140749176	140749176	0.314000	0.24563	1.000000	0.80357	0.974000	0.67602	1.731000	0.38135	2.446000	0.82766	0.563000	0.77884	GCG	0.094112		TCGA-US-A774-01A-21D-A32N-08	0.667	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	0	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	2	-11.397640	1	0.100000	NM_003736		0	13	13	0	491	482	0		1	0		0	0	102	0	0	0.999485	6.567694e-02	0	0	0	15	0	13	491
SPEF2	79925	broad.mit.edu	37	5	35793392	35793392	+	Silent	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr5:35793392G>A	ENST00000356031.3	+	32	4840	c.4686G>A	c.(4684-4686)aaG>aaA	p.K1562K	SPEF2_ENST00000440995.2_Silent_p.K1557K|SPEF2_ENST00000303129.4_Silent_p.K359K|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1562					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGAAGTTCAAGGCTGTGGATA	0.507																																						ENST00000356031.3	0.880000	0.230000	6.900000e-01	3.500000e-01	0.500000	0.529154	0.500000	0.480000																										0				37						c.(4684-4686)aaG>aaA		sperm flagellar 2							100.0	99.0	99.0					5																	35793392		1981	4176	6157	SO:0001819	synonymous_variant	79925	0	0					g.chr5:35793392G>A	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4686G>A	chr5.hg19:g.35793392G>A		0					SPEF2_ENST00000303129.4_Silent_p.K359K|SPEF2_ENST00000440995.2_Silent_p.K1557K|CTD-2113L7.1_ENST00000510433.1_RNA	p.K1562K	NM_024867.3	NP_079143.3	0	1	1	1.986159	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)	32	4840	+	all_lung(31;7.56e-05)		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	ENST00000356031.3	0	1	hg19	c.4686G>A	CCDS43309.1	0																																																																																								0.091368		TCGA-US-A774-01A-21D-A32N-08	0.507	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	0	0	1	2	2	2	2	0	0	0	0	56	56	56	55	1	2	-3.247183	1	0.100000	NM_144722		0	8	8	0	316	313	0		1	0		0	0	56	0	0	0.989191	8.442618e-04	0	0	0	2	0	8	316
ZCCHC9	84240	broad.mit.edu	37	5	80607084	80607084	+	Missense_Mutation	SNP	A	A	C			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr5:80607084A>C	ENST00000254037.2	+	4	3838	c.683A>C	c.(682-684)gAa>gCa	p.E228A	ZCCHC9_ENST00000438268.2_Missense_Mutation_p.E228A|ZCCHC9_ENST00000506458.1_3'UTR|ZCCHC9_ENST00000380199.5_Missense_Mutation_p.E228A|ZCCHC9_ENST00000407610.3_Missense_Mutation_p.E228A			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	228					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		GATTGCCCTGAAAGTCAGAAT	0.413																																						ENST00000254037.2	0.240000	0.040000	1.800000e-01	7.000000e-02	0.120000	0.131621	0.120000	0.110000																										0				13						c.(682-684)gAa>gCa		zinc finger, CCHC domain containing 9							254.0	271.0	265.0					5																	80607084		2203	4300	6503	SO:0001583	missense	84240	0	0					g.chr5:80607084A>C	BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.683A>C	chr5.hg19:g.80607084A>C	ENSP00000254037:p.Glu228Ala	0					ZCCHC9_ENST00000506458.1_3'UTR|ZCCHC9_ENST00000380199.5_Missense_Mutation_p.E228A|ZCCHC9_ENST00000438268.2_Missense_Mutation_p.E228A|ZCCHC9_ENST00000407610.3_Missense_Mutation_p.E228A	p.E228A			0	1	1	1.998511	Q8N567	ZCHC9_HUMAN		4	3838	+		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)	B2RAE7|Q9H027	Missense_Mutation	SNP	ENST00000254037.2	0	1	hg19	c.683A>C	CCDS4054.1	0	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016841	0.75161	.	.	ENSG00000131732	ENST00000254037;ENST00000407610;ENST00000380199;ENST00000438268	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.32	5.32	0.75619	5.32	5.32	0.75619	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (2);	0.149315	0.64402	D	0.000016	T	0.57636	0.2067	M	0.76838	2.35	0.58432	D	0.99999	B	0.34103	0.437	B	0.41666	0.363	T	0.62129	-0.6919	10	0.56958	D	0.05	-18.5656	15.2491	0.73529	1.0:0.0:0.0:0.0	.	228	Q8N567	ZCHC9_HUMAN	A	228	ENSP00000254037:E228A;ENSP00000385047:E228A;ENSP00000369546:E228A;ENSP00000412637:E228A	ENSP00000254037:E228A	E	+	2	0	0	ZCCHC9	80642840	80642840	1.000000	0.71417	0.020000	0.16555	0.983000	0.72400	5.943000	0.70211	2.153000	0.67306	0.528000	0.53228	GAA	0.094112		TCGA-US-A774-01A-21D-A32N-08	0.413	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239213.1	0	0	0	2	2	2	2	0	0	0	0	155	155	155	152	1	2	-4.196290	1	0.100000	NM_032280		0	6	6	0	1039	1034	0		1	0		0	0	155	0	0	0.964475	8.495965e-02	0	0	0	70	0	6	1039
NR2F1	7025	broad.mit.edu	37	5	92929289	92929289	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr5:92929289C>T	ENST00000327111.3	+	3	2700	c.1013C>T	c.(1012-1014)gCg>gTg	p.A338V	NR2F1_ENST00000506162.1_3'UTR	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	338					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		CTGTCGGATGCGGCCCACATC	0.592																																						ENST00000327111.3	0.350000	0.070000	2.700000e-01	1.200000e-01	0.180000	0.198479	0.180000	0.170000																										0				21						c.(1012-1014)gCg>gTg		nuclear receptor subfamily 2, group F, member 1							70.0	79.0	76.0					5																	92929289		2203	4300	6503	SO:0001583	missense	7025	0	0					g.chr5:92929289C>T	BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.1013C>T	chr5.hg19:g.92929289C>T	ENSP00000325819:p.Ala338Val	0					NR2F1_ENST00000506162.1_3'UTR	p.A338V	NM_005654.4	NP_005645.1	0	1	1	1.998511	P10589	COT1_HUMAN		3	2700	+		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		Missense_Mutation	SNP	ENST00000327111.3	0	1	hg19	c.1013C>T	CCDS4068.1	0	.	.	.	.	.	.	.	.	.	.	C	8.028	0.761144	0.15914	.	.	ENSG00000175745	ENST00000327111	D	0.96365	-3.99	6.17	6.17	0.99709	6.17	6.17	0.99709	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.360994	0.30219	N	0.010135	D	0.90013	0.6882	N	0.02842	-0.48	0.80722	D	1	B	0.11235	0.004	B	0.10450	0.005	D	0.84686	0.0720	10	0.16420	T	0.52	.	20.4898	0.99202	0.0:1.0:0.0:0.0	.	338	P10589	COT1_HUMAN	V	338	ENSP00000325819:A338V	ENSP00000325819:A338V	A	+	2	0	0	NR2F1	92955045	92955045	0.951000	0.32395	1.000000	0.80357	0.986000	0.74619	2.198000	0.42705	2.941000	0.99782	0.655000	0.94253	GCG	0.094112		TCGA-US-A774-01A-21D-A32N-08	0.592	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	0	0	1	2	21	4	2	1	1	1	1	106	106	106	104	1	2	-2.123779	0	0.100000	NM_005654		0	6	6	0	683	672	0		0	0		1	0	106	0	0	0.002372	3.761570e-03	0	0	0	54	0	6	683
PCDHGA10	56106	broad.mit.edu	37	5	140792948	140792948	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr5:140792948G>A	ENST00000398610.2	+	1	206	c.206G>A	c.(205-207)cGc>cAc	p.R69H	PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	69	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGGAGTCCGCATAGTCTCC	0.607																																						ENST00000398610.2	0.330000	0.060000	2.500000e-01	1.100000e-01	0.170000	0.185758	0.170000	0.160000																										0				43						c.(205-207)cGc>cAc		protocadherin gamma subfamily A, 10							61.0	76.0	71.0					5																	140792948		2107	4261	6368	SO:0001583	missense	56106	0	0					g.chr5:140792948G>A		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.206G>A	chr5.hg19:g.140792948G>A	ENSP00000381611:p.Arg69His	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron	p.R69H	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	0	1	1	1.998511	Q9Y5H3	PCDGA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	206	+			Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	0	1	hg19	c.206G>A	CCDS47292.1	0	.	.	.	.	.	.	.	.	.	.	g	17.12	3.308170	0.60305	.	.	ENSG00000253846	ENST00000398610	T	0.38240	1.15	5.62	5.62	0.85841	5.62	5.62	0.85841	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.54271	0.1848	M	0.93106	3.38	0.27629	N	0.9481	P;P	0.50710	0.923;0.938	B;P	0.47981	0.427;0.563	T	0.62048	-0.6936	9	0.48119	T	0.1	.	9.8976	0.41329	0.1519:0.0:0.8481:0.0	.	69;69	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	H	69	ENSP00000381611:R69H	ENSP00000381611:R69H	R	+	2	0	0	PCDHGA10	140773132	140773132	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.477000	0.66799	2.639000	0.89480	0.557000	0.71058	CGC	0.094112		TCGA-US-A774-01A-21D-A32N-08	0.607	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	0	0	1	2	2	2	2	0	0	0	0	147	147	147	145	1	2	-2.107876	0	0.100000	NM_018913		0	6	6	0	731	727	0		1	0		0	0	147	0	0	0.964470	1.487040e-03	0	0	0	6	0	6	731
HIST1H3I	8354	broad.mit.edu	37	6	27839741	27839741	+	Missense_Mutation	SNP	A	A	C			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr6:27839741A>C	ENST00000328488.2	-	1	358	c.353T>G	c.(352-354)gTc>gGc	p.V118G		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	118					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CATAATAGTGACGCGTTTGGC	0.567																																						ENST00000328488.2	1.000000	0.850000	1	9.900000e-01	0.990000	0.987875	0.990000	1.000000																										0				11						c.(352-354)gTc>gGc		histone cluster 1, H3i							129.0	141.0	137.0					6																	27839741		2203	4300	6503	SO:0001583	missense	8354	0	0					g.chr6:27839741A>C	X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.353T>G	chr6.hg19:g.27839741A>C	ENSP00000329554:p.Val118Gly	0						p.V118G	NM_003533.2	NP_003524.1	1	2	3	2.014510	P68431	H31_HUMAN		1	358	-			A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000328488.2	1	1	hg19	c.353T>G	CCDS4636.1	1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744292	0.49151	.	.	ENSG00000182572	ENST00000328488	T	0.50277	0.75	4.12	4.12	0.48240	4.12	4.12	0.48240	.	.	.	.	.	T	0.52885	0.1762	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59910	-0.7365	6	0.87932	D	0	.	13.3331	0.60500	1.0:0.0:0.0:0.0	.	.	.	.	G	118	ENSP00000329554:V118G	ENSP00000329554:V118G	V	-	2	0	0	HIST1H3I	27947720	27947720	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	8.793000	0.91862	2.086000	0.62901	0.528000	0.53228	GTC	0.108911		TCGA-US-A774-01A-21D-A32N-08	0.567	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1	1	0	1	2	2	2	2	0	0	0	0	178	178	178	177	1	2	-20.000000	1	0.100000	NM_003533		0	47	47	0	790	781	0		1			0	0	178	0	0	1.000000	0	0	0	0	0	0	47	790
TAP1	6890	broad.mit.edu	37	6	32820252	32820252	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr6:32820252C>T	ENST00000354258.4	-	2	967	c.806G>A	c.(805-807)gGc>gAc	p.G269D	TAP1_ENST00000425148.2_Missense_Mutation_p.G8D|PSMB9_ENST00000374859.2_5'Flank|PSMB9_ENST00000395330.1_Intron|PSMB9_ENST00000453265.2_5'Flank	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	269	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	AGTGAGGCGGCCCGTAAAGAA	0.507																																						ENST00000354258.4	0.880000	0.190000	6.700000e-01	3.000000e-01	0.460000	0.492787	0.460000	0.430000																										0				21						c.(805-807)gGc>gAc		transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	Lapatinib(DB01259)						97.0	93.0	95.0					6																	32820252		1510	2707	4217	SO:0001583	missense	6890	0	0					g.chr6:32820252C>T		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.806G>A	chr6.hg19:g.32820252C>T	ENSP00000346206:p.Gly269Asp	0					PSMB9_ENST00000395330.1_Intron|PSMB9_ENST00000374859.2_5'Flank|PSMB9_ENST00000453265.2_5'Flank|TAP1_ENST00000425148.2_Missense_Mutation_p.G8D	p.G269D	NM_000593.5	NP_000584.2	1	5	6	1.993923	Q03518	TAP1_HUMAN		2	967	-			Q16149|Q96CP4	Missense_Mutation	SNP	ENST00000354258.4	0	1	hg19	c.806G>A	CCDS4758.1	0	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195941	0.78902	.	.	ENSG00000168394	ENST00000354258;ENST00000425148	D;D	0.91407	-2.84;-2.84	4.78	4.78	0.61160	4.78	4.78	0.61160	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.870577	0.09721	N	0.764435	D	0.95592	0.8567	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94207	0.7455	10	0.87932	D	0	-17.1129	15.3702	0.74557	0.0:1.0:0.0:0.0	.	269	Q03518	TAP1_HUMAN	D	269;8	ENSP00000346206:G269D;ENSP00000401919:G8D	ENSP00000346206:G269D	G	-	2	0	0	TAP1	32928230	32928230	1.000000	0.71417	0.830000	0.32933	0.412000	0.31113	6.583000	0.74053	2.470000	0.83445	0.551000	0.68910	GGC	0.250000		TCGA-US-A774-01A-21D-A32N-08	0.507	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	0	0	0	2	2	2	2	0	0	0	0	56	56	56	56	1	2	-6.106004	1	0.100000	NM_000593		0	6	6	0	329	321	0		1	0		0	0	56	0	0	0.962637	9.672154e-01	0	0	0	341	0	6	329
MUC17	140453	broad.mit.edu	37	7	100683951	100683951	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr7:100683951C>T	ENST00000306151.4	+	3	9318	c.9254C>T	c.(9253-9255)tCa>tTa	p.S3085L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3085	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S3085*(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGTCAGTTCATCTCCTACA	0.522																																						ENST00000306151.4	1.000000	0.820000	1	9.400000e-01	0.990000	0.978708	0.990000	1.000000																										1	Substitution - Nonsense(1)	p.S3085*(1)	lung(1)	343						c.(9253-9255)tCa>tTa		mucin 17, cell surface associated							261.0	259.0	260.0					7																	100683951		2203	4300	6503	SO:0001583	missense	140453	6	121404	43				g.chr7:100683951C>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9254C>T	chr7.hg19:g.100683951C>T	ENSP00000302716:p.Ser3085Leu	0						p.S3085L	NM_001040105.1	NP_001035194.1	1	2	3	2.041249	Q685J3	MUC17_HUMAN		3	9318	+	Lung NSC(181;0.136)|all_lung(186;0.182)		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	1	1	hg19	c.9254C>T	CCDS34711.1	1	.	.	.	.	.	.	.	.	.	.	c	8.482	0.859960	0.17178	.	.	ENSG00000169876	ENST00000306151	T	0.02301	4.35	1.18	1.18	0.20946	1.18	1.18	0.20946	.	.	.	.	.	T	0.02848	0.0085	L	0.29908	0.895	0.09310	N	1	P	0.48350	0.909	P	0.48704	0.587	T	0.51973	-0.8637	9	0.25106	T	0.35	.	8.4028	0.32597	0.0:1.0:0.0:0.0	.	3085	Q685J3	MUC17_HUMAN	L	3085	ENSP00000302716:S3085L	ENSP00000302716:S3085L	S	+	2	0	0	MUC17	100470671	100470671	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.146000	0.16180	0.986000	0.38683	0.121000	0.15741	TCA	0.114609		TCGA-US-A774-01A-21D-A32N-08	0.522	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	1	0	1	2	2	2	2	0	0	0	0	268	268	268	266	1	2	-7.734039	1	0.100000	NM_001040105		0	70	69	0	1296	1281	1		1	1		0	0	268	0	0	1.000000	3.928003e-01	0	14	0	12	0	70	1296
RELN	5649	broad.mit.edu	37	7	103629780	103629780	+	Silent	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr7:103629780C>T	ENST00000428762.1	-	1	183	c.24G>A	c.(22-24)cgG>cgA	p.R8R	RELN_ENST00000343529.5_Silent_p.R8R|RELN_ENST00000424685.2_Silent_p.R8R	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	8					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGAAAGTCTGCCGGGCCCAGC	0.716																																					NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1	1.000000	0.270000	1	4.900000e-01	0.860000	0.786009	0.860000	1.000000																										0				227						c.(22-24)cgG>cgA		reelin							7.0	9.0	9.0					7																	103629780		2175	4257	6432	SO:0001819	synonymous_variant	5649	0	0					g.chr7:103629780C>T		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.24G>A	chr7.hg19:g.103629780C>T		0					RELN_ENST00000343529.5_Silent_p.R8R|RELN_ENST00000424685.2_Silent_p.R8R	p.R8R	NM_005045.3	NP_005036.2	1	2	3	2.041249	P78509	RELN_HUMAN		1	183	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	0	1	hg19	c.24G>A	CCDS47680.1	1																																																																																								0.114609		TCGA-US-A774-01A-21D-A32N-08	0.716	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	0	0	1	2	2	2	2	0	0	0	0	35	35	35	33	1	2	-7.441180	1	0.100000	NM_005045		0	4	4	0	114	110	0		1			0	0	35	1	0	0.883367	0	0	0	0	0	0	4	114
ZNF277	11179	broad.mit.edu	37	7	111926929	111926929	+	Splice_Site	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr7:111926929C>T	ENST00000361822.3	+	2	222	c.93C>T	c.(91-93)gaC>gaT	p.D31D	ZNF277_ENST00000450657.1_Splice_Site_p.D31D|ZNF277_ENST00000421043.1_Splice_Site_p.D31D|RN7SKP187_ENST00000365536.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	31					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						CTATTCCAGACAGTAAGGATT	0.408																																						ENST00000361822.3	1.000000	0.280000	1	5.100000e-01	0.890000	0.801062	0.890000	1.000000																										0				15						c.(91-93)gaC>gaT		zinc finger protein 277							36.0	33.0	34.0					7																	111926929		2203	4300	6503	SO:0001630	splice_region_variant	11179	0	0					g.chr7:111926929C>T	AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.92-1C>T	chr7.hg19:g.111926929C>T		0					RN7SKP187_ENST00000365536.1_RNA|ZNF277_ENST00000450657.1_Splice_Site_p.D31D|ZNF277_ENST00000421043.1_Splice_Site_p.D31D	p.D31D	NM_021994.2	NP_068834.2	1	2	3	2.041249	Q9NRM2	ZN277_HUMAN		2	222	+			Q75MZ2|Q75MZ3|Q8WY14	Splice_Site	SNP	ENST00000361822.3	0	1	hg19	c.93C>T	CCDS5755.2	1																																																																																								0.114609		TCGA-US-A774-01A-21D-A32N-08	0.408	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316843.2	0	0	0	2	2	2	2	0	0	0	0	28	28	28	27	1	2	-7.115757	1	0.100000	NM_021994	Silent	0	4	0	0	109	105	0		0	0		0	0	28	0	0	0.871241	5.310108e-01	0	0	0	44	0	4	109
EGR3	1960	broad.mit.edu	37	8	22548167	22548167	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr8:22548167G>A	ENST00000317216.2	-	2	1340	c.983C>T	c.(982-984)aCg>aTg	p.T328M	EGR3_ENST00000524088.1_5'UTR|EGR3_ENST00000519492.1_3'UTR|RP11-459E5.1_ENST00000523627.1_RNA|EGR3_ENST00000522910.1_Missense_Mutation_p.T290M	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	328					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		CTTCTCGCCCGTATGAGTGCG	0.632																																						ENST00000317216.2	1.000000	0.080000	1	1.300000e-01	0.220000	0.364217	0.220000	0.180000																										0				10						c.(982-984)aCg>aTg		early growth response 3							71.0	70.0	70.0					8																	22548167		2203	4300	6503	SO:0001583	missense	1960	0	0					g.chr8:22548167G>A	X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.983C>T	chr8.hg19:g.22548167G>A	ENSP00000318057:p.Thr328Met	0					EGR3_ENST00000519492.1_3'UTR|EGR3_ENST00000522910.1_Missense_Mutation_p.T290M|EGR3_ENST00000524088.1_5'UTR|RP11-459E5.1_ENST00000523627.1_RNA	p.T328M	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	1	2	3	2.031014	Q06889	EGR3_HUMAN		2	1340	-		Prostate(55;0.0421)|Breast(100;0.102)	A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Missense_Mutation	SNP	ENST00000317216.2	0	1	hg19	c.983C>T	CCDS6033.1	0	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098407	0.76870	.	.	ENSG00000179388	ENST00000317216;ENST00000522910;ENST00000435199	T;T	0.26373	1.74;1.74	5.62	5.62	0.85841	5.62	5.62	0.85841	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.54191	0.1843	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.57242	-0.7845	10	0.87932	D	0	-20.0694	17.1549	0.86788	0.0:0.0:1.0:0.0	.	290;328	E7EW38;Q06889	.;EGR3_HUMAN	M	328;290;169	ENSP00000318057:T328M;ENSP00000430310:T290M	ENSP00000318057:T328M	T	-	2	0	0	EGR3	22604112	22604112	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.863000	0.99569	2.643000	0.89663	0.655000	0.94253	ACG	0.112426		TCGA-US-A774-01A-21D-A32N-08	0.632	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215098.1	0	0	1	2	2	2	2	0	0	0	0	115	115	115	115	1	2	-2.632552	1	0.100000	NM_004430		0	6	7	0	655	650	0		1	0		0	0	115	0	0	0.964427	5.326939e-03	0	0	0	10	0	6	655
ST18	9705	broad.mit.edu	37	8	53028835	53028835	+	Splice_Site	SNP	C	C	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr8:53028835C>A	ENST00000276480.7	-	25	3686	c.3003G>T	c.(3001-3003)atG>atT	p.M1001I		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	1001					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TTGAACTTACCATCTGTGGAA	0.478																																						ENST00000276480.7	1.000000	0.370000	1	5.100000e-01	0.700000	0.733840	0.700000	1.000000																										0				85						c.(3001-3003)atG>atT		suppression of tumorigenicity 18, zinc finger							195.0	156.0	169.0					8																	53028835		2203	4300	6503	SO:0001630	splice_region_variant	9705	0	0					g.chr8:53028835C>A	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.3003+1G>T	chr8.hg19:g.53028835C>A		0						p.M1001I	NM_014682.2	NP_055497.1	1	2	3	2.031014	O60284	ST18_HUMAN		25	3686	-		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)	Q17RY1	Splice_Site	SNP	ENST00000276480.7	0	1	hg19	c.3003G>T	CCDS6149.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.363299	0.95877	.	.	ENSG00000147488	ENST00000276480	T	0.49139	0.79	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.69033	0.3066	M	0.68317	2.08	0.80722	D	1	D	0.64830	0.994	D	0.72338	0.977	T	0.67995	-0.5526	10	0.54805	T	0.06	-22.9673	20.0735	0.97734	0.0:1.0:0.0:0.0	.	1001	O60284	ST18_HUMAN	I	1001	ENSP00000276480:M1001I	ENSP00000276480:M1001I	M	-	3	0	0	ST18	53191388	53191388	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.764000	0.85297	2.745000	0.94114	0.655000	0.94253	ATG	0.112426		TCGA-US-A774-01A-21D-A32N-08	0.478	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1	0	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	2	-2.591336	1	0.100000		Missense_Mutation	0	13	12	0	398	397	0		1	0		0	0	75	0	0	0.999535	1.222280e-03	0	0	0	2	0	13	398
TAF1L	138474	broad.mit.edu	37	9	32632378	32632378	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr9:32632378G>A	ENST00000242310.4	-	1	3289	c.3200C>T	c.(3199-3201)gCc>gTc	p.A1067V	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1067					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.A1067V(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGATCCACGGGCAAATTTACT	0.468																																						ENST00000242310.4	1.000000	0.100000	4.700000e-01	1.600000e-01	0.240000	0.356355	0.240000	0.220000																										1	Substitution - Missense(1)	p.A1067V(1)	prostate(1)	159						c.(3199-3201)gCc>gTc		TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like							178.0	178.0	178.0					9																	32632378		2203	4300	6503	SO:0001583	missense	138474	0	0					g.chr9:32632378G>A	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3200C>T	chr9.hg19:g.32632378G>A	ENSP00000418379:p.Ala1067Val	0					RP11-555J4.4_ENST00000430787.1_RNA	p.A1067V	NM_153809.2	NP_722516.1	1	2	3	2.014929	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	1	3289	-			Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	0	1	hg19	c.3200C>T	CCDS35003.1	0	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750747	0.89753	.	.	ENSG00000122728	ENST00000242310	T	0.18810	2.19	0.479	0.479	0.16796	0.479	0.479	0.16796	.	0.097880	0.64402	D	0.000001	T	0.41858	0.1177	M	0.82823	2.61	0.58432	D	0.999997	D	0.76494	0.999	D	0.76071	0.987	T	0.32241	-0.9914	10	0.72032	D	0.01	.	6.6915	0.23174	2.0E-4:0.0:0.9998:0.0	.	1067	Q8IZX4	TAF1L_HUMAN	V	1067	ENSP00000418379:A1067V	ENSP00000418379:A1067V	A	-	2	0	0	TAF1L	32622378	32622378	1.000000	0.71417	0.997000	0.53966	0.891000	0.51852	5.867000	0.69597	0.507000	0.28148	0.195000	0.17529	GCC	0.108911		TCGA-US-A774-01A-21D-A32N-08	0.468	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2	0	0	1	2	2	2	2	0	0	0	0	147	147	147	146	1	2	-1.947784	0	0.100000			0	8	8	0	735	709	0		1			0	0	147	0	0	0.987691	0	0	0	0	0	0	8	735
PTGES2	80142	broad.mit.edu	37	9	130885345	130885345	+	Missense_Mutation	SNP	C	C	T	rs368666888		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chr9:130885345C>T	ENST00000338961.6	-	5	1499	c.755G>A	c.(754-756)cGc>cAc	p.R252H	PTGES2_ENST00000277462.5_Missense_Mutation_p.R61H|PTGES2_ENST00000483625.1_5'UTR	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2	252					cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						GGTGGGCGTGCGGTACACATT	0.657																																						ENST00000338961.6	1.000000	0.120000	8.100000e-01	2.000000e-01	0.330000	0.434120	0.330000	0.280000																										0				4						c.(754-756)cGc>cAc		prostaglandin E synthase 2		C	HIS/ARG	0,4406		0,0,2203	60.0	54.0	56.0		755	3.5	1.0	9		56	1,8599		0,1,4299	no	missense	PTGES2	NM_025072.5	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	252/378	130885345	1,13005	2203	4300	6503	SO:0001583	missense	80142	2	121408	32				g.chr9:130885345C>T	AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730	ENST00000338961.6:c.755G>A	chr9.hg19:g.130885345C>T	ENSP00000345341:p.Arg252His	0					PTGES2_ENST00000483625.1_5'UTR|PTGES2_ENST00000277462.5_Missense_Mutation_p.R61H	p.R252H	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	1	2	3	2.017367	Q9H7Z7	PGES2_HUMAN		5	1499	-			Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Missense_Mutation	SNP	ENST00000338961.6	0	1	hg19	c.755G>A	CCDS6891.1	0	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837248	0.91117	0.0	1.16E-4	ENSG00000148334	ENST00000338961;ENST00000277462;ENST00000449878	T;T;T	0.44482	0.92;0.92;0.92	5.42	3.52	0.40303	5.42	3.52	0.40303	Glutathione S-transferase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.65260	0.2674	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.69877	-0.5026	10	0.62326	D	0.03	-7.5349	9.8637	0.41129	0.1372:0.789:0.0:0.0738	.	252	Q9H7Z7	PGES2_HUMAN	H	252;61;217	ENSP00000345341:R252H;ENSP00000277462:R61H;ENSP00000411378:R217H	ENSP00000277462:R61H	R	-	2	0	0	PTGES2	129925166	129925166	1.000000	0.71417	0.999000	0.59377	0.860000	0.49131	5.787000	0.69013	1.262000	0.44165	0.561000	0.74099	CGC	0.109352		TCGA-US-A774-01A-21D-A32N-08	0.657	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054339.1	0	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	2	-4.475698	1	0.100000			0	5	5	0	354	350	0		1	0		0	0	72	0	0	0.935172	8.398398e-01	0	0	0	239	0	5	354
GPRASP2	114928	broad.mit.edu	37	X	101972217	101972217	+	Missense_Mutation	SNP	C	C	T	rs186673137		TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chrX:101972217C>T	ENST00000535209.1	+	4	3251	c.2420C>T	c.(2419-2421)cCg>cTg	p.P807L	GPRASP2_ENST00000332262.5_Missense_Mutation_p.P807L|GPRASP2_ENST00000543253.1_Missense_Mutation_p.P807L			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	807						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AGTCTTGAGCCGCTTATTTCT	0.318													.|||	1	0.000264901	0.0	0.0014	3775	,	,		14251	0.0		0.0	False		,,,				2504	0.0					ENST00000535209.1	0.790000	0.350000	6.700000e-01	4.400000e-01	0.540000	0.563274	0.540000	0.540000																										0				30						c.(2419-2421)cCg>cTg		G protein-coupled receptor associated sorting protein 2							122.0	130.0	127.0					X																	101972217		2203	4296	6499	SO:0001583	missense	114928	8	115108	42				g.chrX:101972217C>T	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.2420C>T	chrX.hg19:g.101972217C>T	ENSP00000437394:p.Pro807Leu						GPRASP2_ENST00000332262.5_Missense_Mutation_p.P807L|GPRASP2_ENST00000543253.1_Missense_Mutation_p.P807L	p.P807L			0	1	1		Q96D09	GASP2_HUMAN		4	3251	+			D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	1	1	hg19	c.2420C>T	CCDS14501.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	9.349	1.065104	0.20067	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.28255	1.62;1.62;1.62	4.04	3.16	0.36331	4.04	3.16	0.36331	Armadillo-type fold (1);	0.000000	0.41712	D	0.000830	T	0.48677	0.1513	M	0.65975	2.015	0.18873	N	0.999986	D	0.89917	1.0	D	0.83275	0.996	T	0.27054	-1.0085	10	0.72032	D	0.01	-5.9426	8.0819	0.30750	0.2402:0.7598:0.0:0.0	.	807	Q96D09	GASP2_HUMAN	L	807	ENSP00000437872:P807L;ENSP00000437394:P807L;ENSP00000339057:P807L	ENSP00000339057:P807L	P	+	2	0	0	GPRASP2	101858873	101858873	0.860000	0.29831	0.078000	0.20375	0.454000	0.32378	2.912000	0.48782	1.042000	0.40150	0.513000	0.50165	CCG	0.100000		TCGA-US-A774-01A-21D-A32N-08	0.318	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	0	0	1	2	2	2	2	0	0	0	0	135	135	135	135	1	2	-2.479206	0	0.100000	NM_138437		0	23	23	0	818	806	0		1	0		0	0	135	0	0	0.999999	8.468919e-02	0	0	0	17	0	23	818
FAM127B	26071	broad.mit.edu	37	X	134186027	134186027	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chrX:134186027C>T	ENST00000370775.2	-	1	178	c.112G>A	c.(112-114)Gac>Aac	p.D38N	FAM127B_ENST00000520964.1_5'UTR	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B	38										breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					GGGAGTCGGTCGGTATCTCCG	0.637																																						ENST00000370775.2	0.640000	0.230000	5.300000e-01	3.100000e-01	0.410000	0.426017	0.410000	0.400000																										0				14						c.(112-114)Gac>Aac		family with sequence similarity 127, member B							90.0	95.0	94.0					X																	134186027		2114	4210	6324	SO:0001583	missense	26071	3	121104	38				g.chrX:134186027C>T	AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.112G>A	chrX.hg19:g.134186027C>T	ENSP00000375267:p.Asp38Asn						FAM127B_ENST00000520964.1_5'UTR	p.D38N	NM_001078172.1	NP_001071640.1	0	1	1		Q9BWD3	F127B_HUMAN		1	178	-	Acute lymphoblastic leukemia(192;0.000127)		A2A2V9|Q8TBU2	Missense_Mutation	SNP	ENST00000370775.2	0	1	hg19	c.112G>A	CCDS43998.1	0	.	.	.	.	.	.	.	.	.	.	C	13.22	2.171400	0.38315	.	.	ENSG00000203950	ENST00000370775	T	0.31247	1.5	2.38	2.38	0.29361	2.38	2.38	0.29361	.	0.509400	0.14388	U	0.322689	T	0.41305	0.1153	L	0.50333	1.59	0.27449	N	0.953491	D;D	0.76494	0.999;0.993	D;P	0.74023	0.982;0.619	T	0.18461	-1.0336	10	0.17369	T	0.5	.	7.511	0.27573	0.0:1.0:0.0:0.0	.	36;38	Q6IPB9;Q9BWD3	.;F127B_HUMAN	N	38	ENSP00000375267:D38N	ENSP00000375267:D38N	D	-	1	0	0	FAM127B	134013693	134013693	1.000000	0.71417	0.995000	0.50966	0.112000	0.19704	2.055000	0.41345	1.470000	0.48102	0.292000	0.19580	GAC	0.100000		TCGA-US-A774-01A-21D-A32N-08	0.637	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058393.2	0	0	1	2	2	2	2	0	0	0	0	126	126	126	125	1	2	-2.872008	1	0.100000	NM_001078172		0	15	15	0	725	711	0		1	0		0	0	126	0	0	0.999851	8.836530e-01	0	0	0	185	0	15	725
L1CAM	3897	broad.mit.edu	37	X	153134383	153134383	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A774-01A-21D-A32N-08	TCGA-US-A774-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ab10fa94-b2a9-4edb-8047-9b949ad59060	0a9222a6-bcda-4169-afe6-015a10d017c5	g.chrX:153134383G>A	ENST00000370060.1	-	12	1481	c.1292C>T	c.(1291-1293)gCg>gTg	p.A431V	L1CAM_ENST00000361699.4_Missense_Mutation_p.A431V|L1CAM_ENST00000543994.1_Missense_Mutation_p.A433V|L1CAM_ENST00000361981.3_Missense_Mutation_p.A426V|L1CAM_ENST00000538883.1_Missense_Mutation_p.A433V|L1CAM_ENST00000370055.1_Missense_Mutation_p.A426V|L1CAM_ENST00000370057.3_Missense_Mutation_p.A431V	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	431	Ig-like C2-type 5.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGATTGTCCGCAGTCAGGAT	0.617																																						ENST00000370060.1	0.490000	0.100000	3.700000e-01	1.600000e-01	0.250000	0.273860	0.250000	0.240000																										0				81						c.(1291-1293)gCg>gTg		L1 cell adhesion molecule							128.0	97.0	107.0					X																	153134383		2203	4300	6503	SO:0001583	missense	3897	2	121410	34				g.chrX:153134383G>A	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1292C>T	chrX.hg19:g.153134383G>A	ENSP00000359077:p.Ala431Val						L1CAM_ENST00000361981.3_Missense_Mutation_p.A426V|L1CAM_ENST00000361699.4_Missense_Mutation_p.A431V|L1CAM_ENST00000538883.1_Missense_Mutation_p.A433V|L1CAM_ENST00000370055.1_Missense_Mutation_p.A426V|L1CAM_ENST00000370057.3_Missense_Mutation_p.A431V|L1CAM_ENST00000543994.1_Missense_Mutation_p.A433V	p.A431V	NM_001278116.1	NP_001265045.1	0	1	1		P32004	L1CAM_HUMAN		12	1481	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	0	1	hg19	c.1292C>T	CCDS14733.1	0	.	.	.	.	.	.	.	.	.	.	G	7.720	0.696948	0.15106	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.60424	0.19;0.2;0.19;0.21;0.23;0.23;0.19	5.53	0.212	0.15240	5.53	0.212	0.15240	Immunoglobulin-like (1);	1.465370	0.04158	N	0.322492	T	0.44540	0.1298	L	0.29908	0.895	0.09310	N	1	B;B;B	0.20164	0.034;0.017;0.042	B;B;B	0.16722	0.009;0.006;0.016	T	0.34477	-0.9827	10	0.62326	D	0.03	.	4.1815	0.10378	0.0831:0.2626:0.4422:0.212	.	426;431;431	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	V	431;433;431;433;426;426;431	ENSP00000359077:A431V;ENSP00000438430:A433V;ENSP00000359074:A431V;ENSP00000439645:A433V;ENSP00000354712:A426V;ENSP00000359072:A426V;ENSP00000355380:A431V	ENSP00000355380:A431V	A	-	2	0	0	L1CAM	152787577	152787577	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.054000	0.14205	-0.087000	0.12528	-0.347000	0.07816	GCG	0.100000		TCGA-US-A774-01A-21D-A32N-08	0.617	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	0	0	1	2	2	2	5	0	0	0	0	97	97	97	96	1	2	-2.239909	0	0.100000	NM_024003		0	6	6	0	494	489	0		1	0	0	0	1	97	450	0	0.964067	3.171730e-03	5.411525e-01	0	0	6	373	6	494
