#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TP53	7157	broad.mit.edu	37	17	7578373	7578373	+	Frame_Shift_Del	DEL	T	T	-			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			T	-	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr17:7578373delT	ENST00000269305.4	-	5	746	c.557delA	c.(556-558)gatfs	p.D186fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.D186fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.D186fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.D186fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.D186fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.D186fs|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	186	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		D -> E (in a sporadic cancer; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> N (in sporadic cancers; somatic mutation).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(2)|p.V173fs*59(2)|p.D186_P191delDGLAPP(1)|p.D186V(1)|p.D186G(1)|p.S185_D186delSD(1)|p.D186fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCTCACCATCGCTATCTGA	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.900000	6.500000e-01	0.840000	7.000000e-01	0.770000	0.778834	0.770000	0.780000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		17	Whole gene deletion(8)|Deletion - Frameshift(3)|Substitution - Missense(2)|Deletion - In frame(2)|Unknown(2)	p.0?(8)|p.?(2)|p.V173fs*59(2)|p.D186_P191delDGLAPP(1)|p.D186V(1)|p.D186G(1)|p.S185_D186delSD(1)|p.D186fs*22(1)	bone(4)|central_nervous_system(3)|oesophagus(3)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|liver(1)	24185						c.(556-558)gatfs	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						48.0	46.0	47.0					17																	7578373		2203	4300	6503	SO:0001589	frameshift_variant	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578373delT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.557delA	chr17.hg19:g.7578373delT	ENSP00000269305:p.Asp186fs	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Frame_Shift_Del_p.D186fs|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Frame_Shift_Del_p.D186fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.D186fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.D186fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.D186fs	p.D186fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.673999	P04637	P53_HUMAN		5	746	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	1	1	hg19	c.557delA	CCDS11118.1	0																																																																																								0.398601		TCGA-US-A779-01A-11D-A32N-08	0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0	0	0	0	53	0	53	53	1	1.860000	-20.000000	1	0.570000	NM_000546		0	101	100	0	224	223	0	0	1	1	1	0	0	53	611	0	1.000000	9.907415e-01	1	2	166	17	425	101	224
RET	5979	broad.mit.edu	37	10	43622039	43622039	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr10:43622039C>T	ENST00000355710.3	+	19	3288	c.3056C>T	c.(3055-3057)gCg>gTg	p.A1019V	RET_ENST00000340058.5_Missense_Mutation_p.A1019V	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	1019					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TTGGACCTTGCGGCGTCCACT	0.557		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	ENST00000355710.3	0.040000	0	0.030000	0	0.010000	0.021732	0.010000	0.020000		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	10q11.2	5979	T, Mis, N, F	ret proto-oncogene	yes	yes	Hirschsprung disease	"""E, O"""	E, O	H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6	medullary thyroid,  papillary thyroid, pheochromocytoma	medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC	CCDC6/RET(4)|KIF5B/RET(79)	0				607						c.(3055-3057)gCg>gTg		ret proto-oncogene	Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)						252.0	239.0	243.0					10																	43622039		2203	4300	6503	SO:0001583	missense	5979	0	0		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	g.chr10:43622039C>T	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.3056C>T	chr10.hg19:g.43622039C>T	ENSP00000347942:p.Ala1019Val	0					RET_ENST00000340058.5_Missense_Mutation_p.A1019V	p.A1019V	NM_020975.4	NP_066124.1	0	0	0	2.036303	P07949	RET_HUMAN		19	3288	+		Ovarian(717;0.0423)	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	0	1	hg19	c.3056C>T	CCDS7200.1	0	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010130	0.75046	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	T;T	0.80304	-1.24;-1.36	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.83922	0.5359	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.998;0.999	D	0.85682	0.1301	10	0.52906	T	0.07	.	18.5126	0.90923	0.0:1.0:0.0:0.0	.	765;1019;1019	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	V	1019	ENSP00000347942:A1019V;ENSP00000344798:A1019V	ENSP00000344798:A1019V	A	+	2	0	0	RET	42942045	42942045	1.000000	0.71417	0.735000	0.30896	0.550000	0.35303	7.786000	0.85741	2.374000	0.81015	0.655000	0.94253	GCG	0.559967		TCGA-US-A779-01A-11D-A32N-08	0.557	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	0	0	1	2	2	2	2	0	0	0	0	250	250	250	248	1	1.860000	-1.898043	0	0.570000	NM_020975		0	7	7	0	1199	1179	0		1	0		0	0	250	0	0	0.979447	4.929913e-05	0	0	0	2	0	7	1199
PRDM11	56981	broad.mit.edu	37	11	45246062	45246062	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr11:45246062C>A	ENST00000530656.1	+	7	1139	c.1139C>A	c.(1138-1140)gCa>gAa	p.A380E	PRDM11_ENST00000263765.4_Missense_Mutation_p.A380E|PRDM11_ENST00000528980.1_Intron|PRDM11_ENST00000424263.2_Missense_Mutation_p.A346E|CTD-2560E9.3_ENST00000527450.1_RNA			Q9NQV5	PRD11_HUMAN	PR domain containing 11	380							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						AGTCAGTGTGCAACAACAATG	0.582																																					NSCLC(118;1511 1736 6472 36603 43224)	ENST00000530656.1	0.070000	0	0.050000	1.000000e-02	0.030000	0.036200	0.030000	0.040000																										0				26						c.(1138-1140)gCa>gAa		PR domain containing 11							104.0	110.0	108.0					11																	45246062		2203	4299	6502	SO:0001583	missense	56981	0	0					g.chr11:45246062C>A	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.1139C>A	chr11.hg19:g.45246062C>A	ENSP00000435976:p.Ala380Glu	0					CTD-2560E9.3_ENST00000527450.1_RNA|PRDM11_ENST00000528980.1_Intron|PRDM11_ENST00000424263.2_Missense_Mutation_p.A346E|PRDM11_ENST00000263765.4_Missense_Mutation_p.A380E	p.A380E			0	0	0	2.087902	Q9NQV5	PRD11_HUMAN		7	1139	+			Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	0	1	hg19	c.1139C>A		0	.	.	.	.	.	.	.	.	.	.	C	3.853	-0.031534	0.07543	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000424263	T;T;T	0.23950	1.88;1.88;1.9	5.41	2.37	0.29283	5.41	2.37	0.29283	.	0.371038	0.22974	N	0.053384	T	0.12220	0.0297	N	0.14661	0.345	0.09310	N	1	P	0.41848	0.763	B	0.39840	0.311	T	0.10965	-1.0607	10	0.25751	T	0.34	-4.2871	4.8943	0.13742	0.1119:0.3303:0.4654:0.0924	.	380	Q9NQV5	PRD11_HUMAN	E	380;380;346	ENSP00000263765:A380E;ENSP00000435976:A380E;ENSP00000394314:A346E	ENSP00000263765:A380E	A	+	2	0	0	PRDM11	45202638	45202638	0.994000	0.37717	0.003000	0.11579	0.009000	0.06853	3.098000	0.50259	0.656000	0.30886	-0.259000	0.10710	GCA	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.582	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	0	0	1	2	2	2	2	0	0	0	0	138	138	138	138	1	1.860000	-2.836805	1	0.570000	NM_020229		0	6	7	0	659	655	0		1	0		0	0	138	0	0	0.964596	1.253099e-04	0	0	0	2	0	6	659
TSGA10IP	254187	broad.mit.edu	37	11	65714436	65714436	+	RNA	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr11:65714436G>A	ENST00000532620.1	+	0	464				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						AAGAAGGACCGCAAGCCCAGG	0.597																																						ENST00000532620.1	0.130000	1.000000e-02	0.100000	3.000000e-02	0.050000	0.067967	0.050000	0.060000																										0				14								testis specific, 10 interacting protein							81.0	89.0	86.0					11																	65714436		2056	4204	6260			254187	0	0					g.chr11:65714436G>A	AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		chr11.hg19:g.65714436G>A		0					TSGA10IP_ENST00000608857.1_RNA				0	0	0	2.087902	Q3SY00	T10IP_HUMAN		0	464	+			Q3SXZ9|Q3SY01|Q96M26	RNA	SNP	ENST00000532620.1	0	1	hg19			0																																																																																								0.570000		TCGA-US-A779-01A-11D-A32N-08	0.597	TSGA10IP-001	KNOWN	basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000391373.2	0	0	1	2	2	2	2	0	0	0	0	62	62	62	62	1	1.860000	-3.063790	1	0.570000	NM_152762		0	4	4	0	251	248	0		1			0	0	62	0	0	0.888294	0	0	0	0	0	0	4	251
EPS8L2	64787	broad.mit.edu	37	11	722431	722431	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr11:722431G>A	ENST00000533256.1	+	14	1465	c.1090G>A	c.(1090-1092)Gca>Aca	p.A364T	EPS8L2_ENST00000530636.1_Missense_Mutation_p.A364T|EPS8L2_ENST00000318562.8_Missense_Mutation_p.A364T|AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000526198.1_Missense_Mutation_p.A380T			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	364					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCAGACATCGCACGCTCCGT	0.647																																						ENST00000533256.1	0.150000	2.000000e-02	0.110000	4.000000e-02	0.060000	0.078401	0.060000	0.060000																										0				13						c.(1090-1092)Gca>Aca		EPS8-like 2							87.0	74.0	79.0					11																	722431		2203	4300	6503	SO:0001583	missense	64787	4	121404	35				g.chr11:722431G>A	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1090G>A	chr11.hg19:g.722431G>A	ENSP00000435585:p.Ala364Thr	0					AP006621.9_ENST00000527021.2_RNA|EPS8L2_ENST00000526198.1_Missense_Mutation_p.A380T|EPS8L2_ENST00000530636.1_Missense_Mutation_p.A364T|EPS8L2_ENST00000318562.8_Missense_Mutation_p.A364T	p.A364T			0	1	1	2.073679	Q9H6S3	ES8L2_HUMAN		14	1465	+		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Missense_Mutation	SNP	ENST00000533256.1	0	1	hg19	c.1090G>A	CCDS31328.1	0	.	.	.	.	.	.	.	.	.	.	g	12.62	1.992138	0.35131	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	3.13	2.2	0.27929	3.13	2.2	0.27929	.	0.089102	0.43919	U	0.000514	T	0.67896	0.2942	M	0.69823	2.125	0.09310	N	1	D;D	0.89917	0.999;1.0	P;P	0.61275	0.886;0.87	T	0.59225	-0.7494	10	0.87932	D	0	-11.1368	9.2022	0.37265	0.1144:0.0:0.8856:0.0	.	380;364	B7ZKL3;Q9H6S3	.;ES8L2_HUMAN	T	364;364;364;380	ENSP00000320828:A364T;ENSP00000435585:A364T;ENSP00000436035:A364T;ENSP00000436230:A380T	ENSP00000320828:A364T	A	+	1	0	0	EPS8L2	712431	712431	0.964000	0.33143	0.005000	0.12908	0.689000	0.40095	3.519000	0.53458	0.664000	0.31047	0.486000	0.48141	GCA	0.568771		TCGA-US-A779-01A-11D-A32N-08	0.647	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	0	0	1	2	2	2	2	0	0	0	0	51	51	51	50	1	1.860000	-3.939549	1	0.570000	NM_022772		0	5	5	0	260	253	0		1	0		0	0	51	0	0	0.933638	9.708496e-01	0	0	0	345	0	5	260
DPP3	10072	broad.mit.edu	37	11	66260292	66260292	+	Missense_Mutation	SNP	A	A	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr11:66260292A>T	ENST00000360510.2	+	10	1159	c.1094A>T	c.(1093-1095)aAg>aTg	p.K365M	DPP3_ENST00000530165.1_Missense_Mutation_p.K335M|DPP3_ENST00000533799.1_3'UTR|DPP3_ENST00000531863.1_Missense_Mutation_p.K385M|DPP3_ENST00000532677.1_Missense_Mutation_p.K384M|DPP3_ENST00000541961.1_Missense_Mutation_p.K365M|DPP3_ENST00000453114.1_Missense_Mutation_p.K365M			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	365					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						ACCTTTGAGAAGGACAAGTTC	0.597																																						ENST00000360510.2	0.080000	0	0.060000	1.000000e-02	0.030000	0.042279	0.030000	0.040000																										0				23						c.(1093-1095)aAg>aTg		dipeptidyl-peptidase 3							92.0	91.0	92.0					11																	66260292		2200	4295	6495	SO:0001583	missense	10072	0	0					g.chr11:66260292A>T	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1094A>T	chr11.hg19:g.66260292A>T	ENSP00000353701:p.Lys365Met	0					DPP3_ENST00000453114.1_Missense_Mutation_p.K365M|DPP3_ENST00000533799.1_3'UTR|DPP3_ENST00000532677.1_Missense_Mutation_p.K384M|DPP3_ENST00000530165.1_Missense_Mutation_p.K335M|DPP3_ENST00000541961.1_Missense_Mutation_p.K365M|DPP3_ENST00000531863.1_Missense_Mutation_p.K385M	p.K365M			0	0	0	2.087902	Q9NY33	DPP3_HUMAN		10	1159	+			B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	0	1	hg19	c.1094A>T	CCDS8141.1	0	.	.	.	.	.	.	.	.	.	.	A	27.3	4.816240	0.90790	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807	T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67	5.41	5.41	0.78517	5.41	5.41	0.78517	.	0.094343	0.64402	D	0.000001	T	0.62060	0.2397	M	0.90082	3.085	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.70733	-0.4791	10	0.87932	D	0	.	13.4157	0.60968	1.0:0.0:0.0:0.0	.	384;365	G3V1D3;Q9NY33	.;DPP3_HUMAN	M	385;384;365;365;365;335;263	ENSP00000432782:K385M;ENSP00000435284:K384M;ENSP00000353701:K365M;ENSP00000389943:K365M;ENSP00000440502:K365M;ENSP00000436941:K335M	ENSP00000353701:K365M	K	+	2	0	0	DPP3	66016868	66016868	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	8.519000	0.90563	2.052000	0.61016	0.533000	0.62120	AAG	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.597	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2	0	0	0	2	2	2	2	0	0	0	0	131	131	131	130	1	1.860000	-5.235396	1	0.570000			0	6	2	0	569	559	0		1	0		0	0	131	0	0	0.962365	4.775254e-01	0	0	0	137	0	6	569
FAT3	120114	broad.mit.edu	37	11	92599977	92599977	+	Missense_Mutation	SNP	G	G	A	rs376837097		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr11:92599977G>A	ENST00000298047.6	+	21	11746	c.11729G>A	c.(11728-11730)cGt>cAt	p.R3910H	FAT3_ENST00000525166.1_Missense_Mutation_p.R3760H|FAT3_ENST00000533797.1_Missense_Mutation_p.R245H|FAT3_ENST00000409404.2_Missense_Mutation_p.R3910H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3910	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R3910L(2)|p.R485L(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATCTCGGGCCGTGCTGTCAAC	0.627										TCGA Ovarian(4;0.039)																												ENST00000298047.6	1.000000	6.800000e-01	1.000000	7.800000e-01	0.890000	0.889529	0.890000	1.000000																										3	Substitution - Missense(3)	p.R3910L(2)|p.R485L(1)	lung(3)	85						c.(11728-11730)cGt>cAt		FAT atypical cadherin 3							34.0	39.0	37.0					11																	92599977		2044	4192	6236	SO:0001583	missense	120114	1	120954	28				g.chr11:92599977G>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11729G>A	chr11.hg19:g.92599977G>A	ENSP00000298047:p.Arg3910His	0	TCGA Ovarian(4;0.039)				FAT3_ENST00000525166.1_Missense_Mutation_p.R3760H|FAT3_ENST00000533797.1_Missense_Mutation_p.R245H|FAT3_ENST00000409404.2_Missense_Mutation_p.R3910H	p.R3910H			0	0	0	2.087902	Q8TDW7	FAT3_HUMAN		21	11746	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	1	1	hg19	c.11729G>A		1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980435	0.53827	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.77	5.77	0.91146	5.77	5.77	0.91146	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.72755	0.3500	L	0.61387	1.9	0.80722	D	1	P;B	0.39831	0.69;0.039	B;B	0.30495	0.116;0.023	T	0.71407	-0.4602	9	0.15499	T	0.54	.	19.9934	0.97376	0.0:0.0:1.0:0.0	.	3910;3910	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	H	3910;3910;3760;245	ENSP00000298047:R3910H;ENSP00000387040:R3910H;ENSP00000432586:R3760H;ENSP00000436399:R245H	ENSP00000298047:R3910H	R	+	2	0	0	FAT3	92239625	92239625	1.000000	0.71417	0.964000	0.40570	0.724000	0.41520	6.323000	0.72891	2.732000	0.93576	0.561000	0.74099	CGT	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.627	FAT3-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	40	40	40	39	1	1.860000	-20.000000	1	0.570000	NM_001008781		0	45	45	0	131	131	1		1			0	0	40	0	0	1.000000	0	0	0	0	0	0	45	131
CNTN5	53942	broad.mit.edu	37	11	99872865	99872865	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr11:99872865G>A	ENST00000524871.1	+	9	1267	c.977G>A	c.(976-978)gGc>gAc	p.G326D	CNTN5_ENST00000279463.3_Missense_Mutation_p.G326D|CNTN5_ENST00000418526.2_Missense_Mutation_p.G252D|CNTN5_ENST00000527185.1_Missense_Mutation_p.G326D|CNTN5_ENST00000528682.1_Missense_Mutation_p.G326D	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	326	Ig-like C2-type 3.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TTTGCACTTGGCAAGTAAGTA	0.358																																						ENST00000524871.1	0.610000	8.000000e-02	0.440000	1.500000e-01	0.270000	0.306508	0.270000	0.240000																										0				81						c.(976-978)gGc>gAc		contactin 5							81.0	78.0	79.0					11																	99872865		1853	4086	5939	SO:0001583	missense	53942	0	0					g.chr11:99872865G>A	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.977G>A	chr11.hg19:g.99872865G>A	ENSP00000435637:p.Gly326Asp	0					CNTN5_ENST00000528682.1_Missense_Mutation_p.G326D|CNTN5_ENST00000418526.2_Missense_Mutation_p.G252D|CNTN5_ENST00000279463.3_Missense_Mutation_p.G326D|CNTN5_ENST00000527185.1_Missense_Mutation_p.G326D	p.G326D	NM_014361.3	NP_055176.1	0	0	0	2.087902	O94779	CNTN5_HUMAN		9	1267	+		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	0	1	hg19	c.977G>A	CCDS53696.1	0	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872029	0.91587	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	5.68	5.68	0.88126	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94479	0.8223	H	0.98738	4.315	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96454	0.9336	10	0.87932	D	0	.	18.779	0.91924	0.0:0.0:1.0:0.0	.	326;252;326	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	D	326;326;326;252;326	ENSP00000433575:G326D;ENSP00000436185:G326D;ENSP00000435637:G326D;ENSP00000393229:G252D;ENSP00000279463:G326D	ENSP00000279463:G326D	G	+	2	0	0	CNTN5	99378075	99378075	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.476000	0.97823	2.682000	0.91365	0.591000	0.81541	GGC	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.358	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	0	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	1.860000	-7.630658	1	0.570000	NM_014361		0	3	3	0	40	40	0		1			0	0	8	0	0	0.812630	0	0	0	0	0	0	3	40
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	5.900000e-01	1.000000	7.200000e-01	0.860000	0.856843	0.860000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	0	0	2.018561	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.554773		TCGA-US-A779-01A-11D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	19	19	19	19	1	1.860000	-19.758050	1	0.570000	NM_033360		2553	25	25	5479	73	73	1	1	1	1	1	0	0	19	322	1	1.000000	7.642343e-01	1	5	57	5	193	25	73
METTL7A	25840	broad.mit.edu	37	12	51319018	51319018	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr12:51319018C>T	ENST00000548553.1	+	2	1178	c.197C>T	c.(196-198)gCg>gTg	p.A66V	METTL7A_ENST00000332160.4_Missense_Mutation_p.A66V			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	66						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)	p.A66V(1)		endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						CAGGAGTTTGCGGGCCCCTCC	0.552																																						ENST00000548553.1	0.130000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.065929	0.050000	0.060000																										1	Substitution - Missense(1)	p.A66V(1)	lung(1)	10						c.(196-198)gCg>gTg		methyltransferase like 7A							41.0	41.0	41.0					12																	51319018		2203	4300	6503	SO:0001583	missense	25840	0	0					g.chr12:51319018C>T		CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.197C>T	chr12.hg19:g.51319018C>T	ENSP00000448785:p.Ala66Val	0					METTL7A_ENST00000332160.4_Missense_Mutation_p.A66V	p.A66V			0	0	0	2.018561	Q9H8H3	MET7A_HUMAN		2	1178	+			Q9H7R3|Q9UHZ7|Q9Y422	Missense_Mutation	SNP	ENST00000548553.1	0	1	hg19	c.197C>T	CCDS8804.1	0	.	.	.	.	.	.	.	.	.	.	C	10.75	1.439444	0.25900	.	.	ENSG00000185432	ENST00000548553;ENST00000550502;ENST00000332160;ENST00000433599	T;T;T	0.16597	2.33;2.33;2.33	5.0	-1.08	0.09936	5.0	-1.08	0.09936	.	0.852961	0.10781	N	0.634907	T	0.09598	0.0236	L	0.34521	1.04	0.09310	N	1	B;B	0.16802	0.017;0.019	B;B	0.12837	0.003;0.008	T	0.38993	-0.9635	10	0.20519	T	0.43	-1.5348	2.5233	0.04685	0.1123:0.4458:0.1094:0.3324	.	66;66	B4DDW1;Q9H8H3	.;MET7A_HUMAN	V	66	ENSP00000448785:A66V;ENSP00000450239:A66V;ENSP00000331787:A66V	ENSP00000331787:A66V	A	+	2	0	0	METTL7A	49605285	49605285	0.000000	0.05858	0.000000	0.03702	0.544000	0.35116	0.002000	0.13061	-0.304000	0.08843	-0.140000	0.14226	GCG	0.554773		TCGA-US-A779-01A-11D-A32N-08	0.552	METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404294.2	0	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	1.860000	-2.811091	1	0.570000	NM_014033		0	4	4	0	250	246	0		1	0		0	0	50	0	0	0.887331	5.965211e-01	0	1	0	112	0	4	250
LRRC10	376132	broad.mit.edu	37	12	70003865	70003865	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr12:70003865C>T	ENST00000361484.3	-	1	1077	c.754G>A	c.(754-756)Gcc>Acc	p.A252T		NM_201550.2	NP_963844.2	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	252					cardiac muscle cell development (GO:0055013)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sarcomere (GO:0030017)				large_intestine(2)|lung(6)	8	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TAGCGCCTGGCTTTTCTAGGG	0.582																																						ENST00000361484.3	0.950000	6.700000e-01	0.890000	7.300000e-01	0.800000	0.816851	0.800000	0.810000																										0				8						c.(754-756)Gcc>Acc		leucine rich repeat containing 10							100.0	83.0	88.0					12																	70003865		2203	4300	6503	SO:0001583	missense	376132	0	0					g.chr12:70003865C>T	AK095935	CCDS31856.1	12q15	2009-09-08				ENSG00000198812			20264	protein-coding gene	gene with protein product		610846				14751244	Standard	NM_201550		Approved	HRLRRP, LRRC10A	uc001svc.3	Q5BKY1		ENST00000361484.3:c.754G>A	chr12.hg19:g.70003865C>T	ENSP00000355166:p.Ala252Thr	0						p.A252T	NM_201550.2	NP_963844.2	0	0	0	2.003645	Q5BKY1	LRC10_HUMAN	Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)	1	1077	-	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Q6ZVY4	Missense_Mutation	SNP	ENST00000361484.3	1	1	hg19	c.754G>A	CCDS31856.1	0	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599545	0.28534	.	.	ENSG00000198812	ENST00000361484	T	0.58060	0.36	5.63	2.59	0.31030	5.63	2.59	0.31030	.	0.485815	0.21421	N	0.074802	T	0.30135	0.0755	N	0.16478	0.41	0.27690	N	0.94614	B	0.06786	0.001	B	0.04013	0.001	T	0.14227	-1.0480	10	0.17832	T	0.49	.	7.034	0.24983	0.0:0.5914:0.1946:0.214	.	252	Q5BKY1	LRC10_HUMAN	T	252	ENSP00000355166:A252T	ENSP00000355166:A252T	A	-	1	0	0	LRRC10	68290132	68290132	0.993000	0.37304	0.998000	0.56505	0.930000	0.56654	1.083000	0.30815	0.823000	0.34589	0.561000	0.74099	GCC	0.552130		TCGA-US-A779-01A-11D-A32N-08	0.582	LRRC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403834.1	1	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	1.860000	-20.000000	1	0.570000	NM_201550		0	95	95	0	298	294	1		1			0	0	88	0	0	1.000000	0	0	0	0	0	0	95	298
GPR18	2841	broad.mit.edu	37	13	99907388	99907388	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr13:99907388G>A	ENST00000340807.3	-	3	1295	c.739C>T	c.(739-741)Ccc>Tcc	p.P247S	GPR18_ENST00000397473.2_Missense_Mutation_p.P247S|UBAC2_ENST00000403766.3_Intron|UBAC2_ENST00000376440.2_Intron|GPR18_ENST00000397470.2_Missense_Mutation_p.P247S			Q14330	GPR18_HUMAN	G protein-coupled receptor 18	247					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)	10	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	ATGTGGAAGGGCATAAAGCAG	0.527																																						ENST00000340807.3	0.100000	0	0.070000	2.000000e-02	0.040000	0.058526	0.040000	0.040000																										0				10						c.(739-741)Ccc>Tcc		G protein-coupled receptor 18	Glycine(DB00145)						200.0	151.0	168.0					13																	99907388		2203	4300	6503	SO:0001583	missense	2841	0	0					g.chr13:99907388G>A	L42324	CCDS9491.1	13q32	2014-01-30			ENSG00000125245	ENSG00000125245		"""GPCR / Class A : Orphans"""	4472	protein-coding gene	gene with protein product		602042				9205118	Standard	NM_005292		Approved		uc010afv.3	Q14330	OTTHUMG00000017266	ENST00000340807.3:c.739C>T	chr13.hg19:g.99907388G>A	ENSP00000343428:p.Pro247Ser	0					GPR18_ENST00000397470.2_Missense_Mutation_p.P247S|GPR18_ENST00000397473.2_Missense_Mutation_p.P247S|UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron	p.P247S			1	2	3	2.107508	Q14330	GPR18_HUMAN		3	1295	-	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		Q6GTM3|Q96HI6|Q9H2L2	Missense_Mutation	SNP	ENST00000340807.3	0	1	hg19	c.739C>T	CCDS9491.1	0	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722418	0.89298	.	.	ENSG00000125245	ENST00000397473;ENST00000397470;ENST00000340807	T;T;T	0.80304	-1.36;-1.36;-1.36	5.88	5.88	0.94601	5.88	5.88	0.94601	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92143	0.7509	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92507	0.6013	9	.	.	.	-21.4099	20.2187	0.98312	0.0:0.0:1.0:0.0	.	247	Q14330	GPR18_HUMAN	S	247	ENSP00000380613:P247S;ENSP00000380610:P247S;ENSP00000343428:P247S	.	P	-	1	0	0	GPR18	98705389	98705389	1.000000	0.71417	0.904000	0.35570	0.964000	0.63967	9.476000	0.97823	2.780000	0.95670	0.655000	0.94253	CCC	0.572437		TCGA-US-A779-01A-11D-A32N-08	0.527	GPR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045585.1	0	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	1.860000	-2.144067	0	0.570000			0	5	5	0	421	419	0		1	0		0	0	105	0	0	0.937114	0	0	0	0	1	0	5	421
NYNRIN	57523	broad.mit.edu	37	14	24877207	24877207	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr14:24877207G>T	ENST00000382554.3	+	3	649	c.331G>T	c.(331-333)Gtg>Ttg	p.V111L		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	111					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TGCCTACCTGGTGCCTGGCCC	0.642																																						ENST00000382554.3	1.000000	8.600000e-01	1.000000	9.200000e-01	0.990000	0.973416	0.990000	1.000000																										0				56						c.(331-333)Gtg>Ttg		NYN domain and retroviral integrase containing							66.0	72.0	70.0					14																	24877207		2093	4213	6306	SO:0001583	missense	57523	0	0					g.chr14:24877207G>T	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.331G>T	chr14.hg19:g.24877207G>T	ENSP00000371994:p.Val111Leu	0						p.V111L	NM_025081.2	NP_079357.2	0	0	0	2.070463	Q9P2P1	NYNRI_HUMAN		3	649	+			Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	1	1	hg19	c.331G>T	CCDS45090.1	1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375905	0.61735	.	.	ENSG00000205978	ENST00000382554	T	0.12255	2.7	4.82	4.82	0.62117	4.82	4.82	0.62117	.	0.830019	0.09626	N	0.776903	T	0.18130	0.0435	M	0.65975	2.015	0.24216	N	0.995458	B	0.21520	0.057	B	0.17979	0.02	T	0.08638	-1.0712	10	0.87932	D	0	.	8.9155	0.35579	0.0986:0.0:0.9014:0.0	.	111	Q9P2P1	NYNRI_HUMAN	L	111	ENSP00000371994:V111L	ENSP00000371994:V111L	V	+	1	0	0	NYNRIN	23947047	23947047	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.690000	0.54713	2.503000	0.84419	0.655000	0.94253	GTG	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.642	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1	1	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	1.860000	-20.000000	1	0.570000			0	138	138	0	342	340	1		1	1		0	0	105	0	0	1.000000	5.533697e-01	0	4	0	2	0	138	342
ADAM20	8748	broad.mit.edu	37	14	70991279	70991279	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr14:70991279G>A	ENST00000256389.3	-	2	590	c.346C>T	c.(346-348)Cgg>Tgg	p.R116W	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	66					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		CCCCCAAACCGCAGGCTATAG	0.527																																						ENST00000256389.3	0.110000	1.000000e-02	0.080000	2.000000e-02	0.040000	0.057814	0.040000	0.050000																										0				27						c.(346-348)Cgg>Tgg		ADAM metallopeptidase domain 20							112.0	86.0	95.0					14																	70991279		2203	4300	6503	SO:0001583	missense	8748	7	121402	41				g.chr14:70991279G>A	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.346C>T	chr14.hg19:g.70991279G>A	ENSP00000256389:p.Arg116Trp	0					RP11-486O13.4_ENST00000556646.1_lincRNA	p.R116W	NM_003814.4	NP_003805.3	0	0	0	2.070463	O43506	ADA20_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	2	590	-			Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	ENST00000256389.3	0	1	hg19	c.346C>T	CCDS32111.1	0	.	.	.	.	.	.	.	.	.	.	G	2.877	-0.232779	0.05983	.	.	ENSG00000134007	ENST00000256389	T	0.07216	3.21	4.14	-1.25	0.09405	4.14	-1.25	0.09405	Peptidase M12B, propeptide (1);	0.844512	0.09575	U	0.783660	T	0.07369	0.0186	L	0.54323	1.7	0.09310	N	1	B	0.26602	0.154	B	0.24269	0.052	T	0.40794	-0.9544	10	0.59425	D	0.04	.	1.3442	0.02160	0.2309:0.1227:0.4097:0.2367	.	66	O43506	ADA20_HUMAN	W	116	ENSP00000256389:R116W	ENSP00000256389:R116W	R	-	1	2	2	ADAM20	70061032	70061032	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.996000	0.03709	-0.123000	0.11745	0.650000	0.86243	CGG	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.527	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2	0	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	1.860000	-2.594234	1	0.570000			0	5	6	0	354	346	0		1			0	0	75	0	0	0.934678	0	0	0	0	0	0	5	354
LTBP2	4053	broad.mit.edu	37	14	74969572	74969572	+	Missense_Mutation	SNP	G	G	A	rs142182623	byFrequency	TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr14:74969572G>A	ENST00000261978.4	-	34	5340	c.4954C>T	c.(4954-4956)Cgg>Tgg	p.R1652W	LTBP2_ENST00000556690.1_Missense_Mutation_p.R1608W	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1652					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TAGCCTGGCCGGAAGTGGACC	0.632													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18329	0.0		0.001	False		,,,				2504	0.0					ENST00000261978.4	0.080000	0	0.060000	1.000000e-02	0.030000	0.044107	0.030000	0.040000																										0				58						c.(4954-4956)Cgg>Tgg		latent transforming growth factor beta binding protein 2		G	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	46.0	52.0	50.0		4954	5.0	1.0	14	dbSNP_134	50	0,8600		0,0,4300	yes	missense	LTBP2	NM_000428.2	101	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	1652/1822	74969572	2,13004	2203	4300	6503	SO:0001583	missense	4053	13	121412	42				g.chr14:74969572G>A		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4954C>T	chr14.hg19:g.74969572G>A	ENSP00000261978:p.Arg1652Trp	0					LTBP2_ENST00000556690.1_Missense_Mutation_p.R1608W	p.R1652W	NM_000428.2	NP_000419.1	0	0	0	2.070463	Q14767	LTBP2_HUMAN		34	5340	-			Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	0	1	hg19	c.4954C>T	CCDS9831.1	0	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	G	21.4	4.148204	0.78001	4.54E-4	0.0	ENSG00000119681	ENST00000261978;ENST00000556690	T;T	0.79141	-1.24;-1.24	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.000000	0.38217	N	0.001768	T	0.81039	0.4740	L	0.32530	0.975	0.38329	D	0.943745	D	0.89917	1.0	D	0.91635	0.999	T	0.83233	-0.0062	10	0.66056	D	0.02	.	11.1565	0.48491	0.0:0.0:0.7663:0.2337	.	1652	Q14767	LTBP2_HUMAN	W	1652;1608	ENSP00000261978:R1652W;ENSP00000451477:R1608W	ENSP00000261978:R1652W	R	-	1	2	2	LTBP2	74039325	74039325	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.443000	0.59994	2.610000	0.88304	0.561000	0.74099	CGG	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.632	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	0	0	1	2	2	2	2	0	0	0	0	98	98	98	97	1	1.860000	-2.763280	1	0.570000	NM_000428		0	5	6	0	464	459	0		1	0		0	0	98	0	0	0.936438	4.403375e-02	0	0	0	25	0	5	464
LTBP2	4053	broad.mit.edu	37	14	74988701	74988701	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr14:74988701G>A	ENST00000261978.4	-	17	3087	c.2701C>T	c.(2701-2703)Cgc>Tgc	p.R901C	LTBP2_ENST00000556690.1_Missense_Mutation_p.R901C	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	901	Cys-rich.|EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TTGATGCAGCGCCCTTTTCCC	0.622																																						ENST00000261978.4	0.510000	1.900000e-01	0.430000	2.500000e-01	0.330000	0.347093	0.330000	0.320000																										0				58						c.(2701-2703)Cgc>Tgc		latent transforming growth factor beta binding protein 2							78.0	70.0	73.0					14																	74988701		2203	4300	6503	SO:0001583	missense	4053	3	121400	31				g.chr14:74988701G>A		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2701C>T	chr14.hg19:g.74988701G>A	ENSP00000261978:p.Arg901Cys	0					LTBP2_ENST00000556690.1_Missense_Mutation_p.R901C	p.R901C	NM_000428.2	NP_000419.1	0	0	0	2.070463	Q14767	LTBP2_HUMAN		17	3087	-			Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	1	1	hg19	c.2701C>T	CCDS9831.1	0	.	.	.	.	.	.	.	.	.	.	G	19.50	3.840149	0.71488	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	T;T	0.22336	1.96;1.96	3.99	3.99	0.46301	3.99	3.99	0.46301	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.184414	0.26525	N	0.023890	T	0.47710	0.1460	M	0.86864	2.845	0.50467	D	0.999877	D	0.76494	0.999	P	0.62740	0.906	T	0.55970	-0.8056	10	0.52906	T	0.07	.	13.9681	0.64221	0.0:0.0:1.0:0.0	.	901	Q14767	LTBP2_HUMAN	C	901	ENSP00000261978:R901C;ENSP00000451477:R901C	ENSP00000261978:R901C	R	-	1	0	0	LTBP2	74058454	74058454	0.999000	0.42202	0.944000	0.38274	0.649000	0.38597	7.347000	0.79356	2.214000	0.71695	0.462000	0.41574	CGC	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.622	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.860000	-19.799490	1	0.570000	NM_000428		0	14	13	0	134	132	0		1	0		0	0	28	0	0	0.999772	2.650262e-01	0	1	0	9	0	14	134
TRIP11	9321	broad.mit.edu	37	14	92470800	92470800	+	Missense_Mutation	SNP	C	C	G			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr14:92470800C>G	ENST00000267622.4	-	11	3893	c.3520G>C	c.(3520-3522)Gat>Cat	p.D1174H		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1174					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CTTAGTGCATCTATTTCGATG	0.348			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	ENST00000267622.4	0.230000	6.000000e-02	0.180000	9.000000e-02	0.130000	0.141378	0.130000	0.130000				Dom	yes			Dom	yes		14	14q31-q32	14q31-q32	9321	T	thyroid hormone receptor interactor 11				L	L	PDGFRB		AML		0				58						c.(3520-3522)Gat>Cat		thyroid hormone receptor interactor 11							78.0	68.0	72.0					14																	92470800		2203	4300	6503	SO:0001583	missense	9321	0	0					g.chr14:92470800C>G	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.3520G>C	chr14.hg19:g.92470800C>G	ENSP00000267622:p.Asp1174His	0						p.D1174H	NM_004239.3	NP_004230.2	0	0	0	2.070463	Q15643	TRIPB_HUMAN		11	3893	-			B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	0	1	hg19	c.3520G>C	CCDS9899.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.27|15.27	2.784471|2.784471	0.49997|0.49997	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.07800|.	3.16|.	5.26|5.26	5.26|5.26	0.73747|0.73747	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59742|0.59742	0.2216|0.2216	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|T	0.54721|0.54721	-0.8251|-0.8251	10|5	0.72032|.	D|.	0.01|.	.|.	18.8762|18.8762	0.92337|0.92337	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	910;1174|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	H|T	1174;910|889	ENSP00000267622:D1174H|.	ENSP00000267622:D1174H|.	D|R	-|-	1|2	0|0	0|0	TRIP11|TRIP11	91540553|91540553	91540553|91540553	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.341000|0.341000	0.28922|0.28922	6.025000|6.025000	0.70864|0.70864	2.447000|2.447000	0.82792|0.82792	0.557000|0.557000	0.71058|0.71058	GAT|AGA	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.348	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1	0	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.860000	-4.009418	1	0.570000			0	9	9	0	235	235	0		1	0		0	0	49	0	0	0.994468	2.385097e-02	0	0	0	6	0	9	235
TRIP11	9321	broad.mit.edu	37	14	92470905	92470905	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr14:92470905C>T	ENST00000267622.4	-	11	3788	c.3415G>A	c.(3415-3417)Gaa>Aaa	p.E1139K		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1139					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TTTTTATTTTCATCTTGCAGT	0.338			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	ENST00000267622.4	0.280000	4.000000e-02	0.200000	7.000000e-02	0.130000	0.145638	0.130000	0.120000				Dom	yes			Dom	yes		14	14q31-q32	14q31-q32	9321	T	thyroid hormone receptor interactor 11				L	L	PDGFRB		AML		0				58						c.(3415-3417)Gaa>Aaa		thyroid hormone receptor interactor 11							65.0	61.0	62.0					14																	92470905		2203	4300	6503	SO:0001583	missense	9321	0	0					g.chr14:92470905C>T	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.3415G>A	chr14.hg19:g.92470905C>T	ENSP00000267622:p.Glu1139Lys	0						p.E1139K	NM_004239.3	NP_004230.2	0	0	0	2.070463	Q15643	TRIPB_HUMAN		11	3788	-			B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	0	1	hg19	c.3415G>A	CCDS9899.1	0	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785706	0.49997	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.07444	3.19	5.27	4.36	0.52297	5.27	4.36	0.52297	.	0.167607	0.51477	D	0.000096	T	0.19725	0.0474	L	0.34521	1.04	0.50632	D	0.999884	D;D	0.89917	1.0;1.0	D;D	0.91635	0.982;0.999	T	0.01156	-1.1434	10	0.62326	D	0.03	.	15.583	0.76459	0.0:0.8616:0.1384:0.0	.	875;1139	F5H1Z0;Q15643	.;TRIPB_HUMAN	K	1139;875	ENSP00000267622:E1139K	ENSP00000267622:E1139K	E	-	1	0	0	TRIP11	91540658	91540658	1.000000	0.71417	0.729000	0.30791	0.253000	0.25986	7.773000	0.85462	1.158000	0.42547	0.563000	0.77884	GAA	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.338	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1	0	0	0	2	2	2	2	0	0	0	0	25	25	25	24	1	1.860000	-7.131868	1	0.570000			0	4	4	0	113	113	0		1	0		0	0	25	0	0	0.891652	1.869489e-02	0	0	0	5	0	4	113
GLDN	342035	broad.mit.edu	37	15	51696848	51696848	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr15:51696848C>T	ENST00000335449.6	+	10	1609	c.1553C>T	c.(1552-1554)gCc>gTc	p.A518V	GLDN_ENST00000396399.2_Missense_Mutation_p.A394V	NM_181789.2	NP_861454.2	Q6ZMI3	GLDN_HUMAN	gliomedin	518	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|microvillus organization (GO:0032528)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		TCTGTTCTTGCCATGTTAGCA	0.378																																						ENST00000335449.6	0.070000	0	0.050000	1.000000e-02	0.020000	0.033324	0.020000	0.030000																										0				19						c.(1552-1554)gCc>gTc		gliomedin							145.0	141.0	142.0					15																	51696848		2196	4293	6489	SO:0001583	missense	342035	0	0					g.chr15:51696848C>T	AY358144	CCDS10140.2	15q15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000186417	ENSG00000186417			29514	protein-coding gene	gene with protein product		608603	"""collomin"""	COLM		16039564, 12642876	Standard	XM_005254338		Approved	CRG-L2, CLOM, colmedin, UNC-112	uc002aba.3	Q6ZMI3	OTTHUMG00000131746	ENST00000335449.6:c.1553C>T	chr15.hg19:g.51696848C>T	ENSP00000335196:p.Ala518Val	0					GLDN_ENST00000396399.2_Missense_Mutation_p.A394V	p.A518V	NM_181789.2	NP_861454.2	0	0	0	2.040521	Q6ZMI3	GLDN_HUMAN		10	1609	+			Q6UXZ7|Q7Z359	Missense_Mutation	SNP	ENST00000335449.6	0	1	hg19	c.1553C>T	CCDS10140.2	0	.	.	.	.	.	.	.	.	.	.	C	33	5.230301	0.95207	.	.	ENSG00000186417	ENST00000335449;ENST00000396399;ENST00000537339	D;D	0.89123	-2.47;-2.47	5.8	5.8	0.92144	5.8	5.8	0.92144	Olfactomedin-like (3);	0.000000	0.43110	D	0.000613	D	0.92899	0.7741	L	0.46741	1.465	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.91752	0.5413	10	0.42905	T	0.14	.	20.0693	0.97712	0.0:1.0:0.0:0.0	.	518	Q6ZMI3	GLDN_HUMAN	V	518;394;394	ENSP00000335196:A518V;ENSP00000379681:A394V	ENSP00000335196:A518V	A	+	2	0	0	GLDN	49484140	49484140	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.758000	0.94735	0.563000	0.77884	GCC	0.559967		TCGA-US-A779-01A-11D-A32N-08	0.378	GLDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254667.2	0	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	1.860000	-2.123722	0	0.570000	NM_181789		0	5	5	0	598	596	0		1			0	0	112	0	0	0.937228	0	0	0	0	0	0	5	598
PAQR4	124222	broad.mit.edu	37	16	3021758	3021758	+	Missense_Mutation	SNP	G	G	A	rs200076772		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr16:3021758G>A	ENST00000318782.8	+	3	1061	c.631G>A	c.(631-633)Gca>Aca	p.A211T	PAQR4_ENST00000576565.1_Missense_Mutation_p.A144T|PAQR4_ENST00000574988.1_Missense_Mutation_p.A144T|PAQR4_ENST00000293978.8_Missense_Mutation_p.A172T|PKMYT1_ENST00000431515.2_Intron|PKMYT1_ENST00000571102.1_5'Flank|PAQR4_ENST00000572687.1_Missense_Mutation_p.A137T	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	211						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						GCGCATGGACGCACTGGCGCT	0.657																																						ENST00000318782.8	0.100000	0	0.080000	2.000000e-02	0.040000	0.054687	0.040000	0.040000																										0				8						c.(631-633)Gca>Aca		progestin and adipoQ receptor family member IV							46.0	50.0	48.0					16																	3021758		2197	4300	6497	SO:0001583	missense	124222	8	121360	41				g.chr16:3021758G>A		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.631G>A	chr16.hg19:g.3021758G>A	ENSP00000321804:p.Ala211Thr	0					PAQR4_ENST00000293978.8_Missense_Mutation_p.A172T|PAQR4_ENST00000572687.1_Missense_Mutation_p.A137T|PAQR4_ENST00000574988.1_Missense_Mutation_p.A144T|PKMYT1_ENST00000431515.2_Intron|PAQR4_ENST00000576565.1_Missense_Mutation_p.A144T|PKMYT1_ENST00000571102.1_5'Flank	p.A211T	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	0	0	0	2.039218	Q8N4S7	PAQR4_HUMAN		3	1061	+			A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Missense_Mutation	SNP	ENST00000318782.8	0	1	hg19	c.631G>A	CCDS10485.1	0	.	.	.	.	.	.	.	.	.	.	g	11.42	1.633267	0.29068	.	.	ENSG00000162073	ENST00000318782;ENST00000293978	T;T	0.30714	1.52;1.53	4.81	4.81	0.61882	4.81	4.81	0.61882	.	0.062180	0.64402	D	0.000007	T	0.38639	0.1048	M	0.64080	1.96	0.37162	D	0.902642	D;P;P	0.56521	0.976;0.78;0.919	P;B;B	0.48840	0.592;0.187;0.37	T	0.41088	-0.9528	10	0.23302	T	0.38	-10.4425	15.3988	0.74818	0.0:0.0:1.0:0.0	.	136;172;211	Q8N4S7-3;Q8N4S7-2;Q8N4S7	.;.;PAQR4_HUMAN	T	211;137	ENSP00000321804:A211T;ENSP00000293978:A137T	ENSP00000293978:A137T	A	+	1	0	0	PAQR4	2961759	2961759	0.995000	0.38212	0.120000	0.21714	0.698000	0.40448	3.970000	0.56824	2.220000	0.72140	0.457000	0.33378	GCA	0.559967		TCGA-US-A779-01A-11D-A32N-08	0.657	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	1.860000	-2.926860	1	0.570000	NM_152341		0	5	5	0	368	364	0		1	0		0	0	85	0	0	0.936161	1.782135e-01	0	0	0	47	0	5	368
MEFV	4210	broad.mit.edu	37	16	3299648	3299648	+	Missense_Mutation	SNP	C	C	T	rs104895198		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr16:3299648C>T	ENST00000219596.1	-	3	1082	c.1043G>A	c.(1042-1044)cGc>cAc	p.R348H	MEFV_ENST00000541159.1_Missense_Mutation_p.R137H|MEFV_ENST00000536379.1_Missense_Mutation_p.R137H|MEFV_ENST00000339854.4_Missense_Mutation_p.R168H	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	348					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.R348H(1)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GCCAGGTGAGCGGCTGCCTGA	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16808	0.0		0.0	False		,,,				2504	0.001					ENST00000219596.1	0.970000	5.600000e-01	0.880000	6.600000e-01	0.760000	0.772374	0.760000	0.760000																										1	Substitution - Missense(1)	p.R348H(1)	ovary(1)	50						c.(1042-1044)cGc>cAc		Mediterranean fever		C	HIS/ARG,HIS/ARG	1,4391	2.1+/-5.4	0,1,2195	25.0	28.0	27.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1043,410	-8.2	0.0	16	dbSNP_132	27	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	MEFV	NM_000243.2,NM_001198536.1	29,29	0,4,6492	TT,TC,CC		0.0349,0.0228,0.0308	possibly-damaging,possibly-damaging	348/782,137/446	3299648	4,12988	2196	4300	6496	SO:0001583	missense	4210	30	121406	42				g.chr16:3299648C>T	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1043G>A	chr16.hg19:g.3299648C>T	ENSP00000219596:p.Arg348His	0					MEFV_ENST00000339854.4_Missense_Mutation_p.R168H|MEFV_ENST00000541159.1_Missense_Mutation_p.R137H|MEFV_ENST00000536379.1_Missense_Mutation_p.R137H	p.R348H	NM_000243.2	NP_000234.1	0	0	0	2.039218	O15553	MEFV_HUMAN		3	1082	-			D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	1	1	hg19	c.1043G>A	CCDS10498.1	0	.	.	.	.	.	.	.	.	.	.	C	5.370	0.253552	0.10185	2.28E-4	3.49E-4	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.64618	-0.11;0.32;0.22;0.33	4.11	-8.23	0.01033	4.11	-8.23	0.01033	.	2.533260	0.01059	N	0.004617	T	0.41971	0.1182	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.43410	-0.9393	10	0.33141	T	0.24	-27.6587	14.814	0.70017	0.0:0.7071:0.1089:0.184	.	348	O15553	MEFV_HUMAN	H	348;348;168;137;137;137	ENSP00000219596:R348H;ENSP00000339639:R168H;ENSP00000438711:R137H;ENSP00000445079:R137H	ENSP00000219596:R348H	R	-	2	0	0	MEFV	3239649	3239649	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.762000	0.00373	-2.922000	0.00304	-0.251000	0.11542	CGC	0.559967		TCGA-US-A779-01A-11D-A32N-08	0.657	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	1.860000	-3.318401	1	0.570000	NM_000243		0	40	40	0	139	137	1		1			0	0	41	0	0	1.000000	0	0	0	0	0	0	40	139
CREBBP	1387	broad.mit.edu	37	16	3824628	3824628	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr16:3824628C>A	ENST00000262367.5	-	12	3034	c.2225G>T	c.(2224-2226)cGt>cTt	p.R742L	CREBBP_ENST00000382070.3_Missense_Mutation_p.R704L	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	742					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGAGGCTGCACGAGGTCCCAT	0.522			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															ENST00000262367.5	0.110000	1.000000e-02	0.080000	2.000000e-02	0.040000	0.057138	0.040000	0.050000				Dom/Rec	yes			Dom/Rec	yes		16	16p13.3	16p13.3	1387	T, N, F, Mis, O	CREB binding protein (CBP)	yes	yes	Rubinstein-Taybi syndrome	L	L	MLL, MORF, RUNXBP2		ALL, AML, DLBCL, B-NHL 		0				295						c.(2224-2226)cGt>cTt		CREB binding protein							151.0	119.0	130.0					16																	3824628		2197	4300	6497	SO:0001583	missense	1387	0	0					g.chr16:3824628C>A	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2225G>T	chr16.hg19:g.3824628C>A	ENSP00000262367:p.Arg742Leu	0					CREBBP_ENST00000382070.3_Missense_Mutation_p.R704L	p.R742L	NM_004380.2	NP_004371.2	0	0	0	2.039218	Q92793	CBP_HUMAN		12	3034	-		Ovarian(90;0.0266)	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	0	1	hg19	c.2225G>T	CCDS10509.1	0	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333841	0.81801	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.84070	-1.8;-1.74	4.79	4.79	0.61399	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.88952	0.6577	L	0.56280	1.765	0.80722	D	1	D;D	0.89917	1.0;0.976	D;P	0.73380	0.98;0.901	D	0.88209	0.2889	10	0.44086	T	0.13	-18.4109	18.3882	0.90473	0.0:1.0:0.0:0.0	.	772;742	Q4LE28;Q92793	.;CBP_HUMAN	L	742;772;704	ENSP00000262367:R742L;ENSP00000371502:R704L	ENSP00000262367:R742L	R	-	2	0	0	CREBBP	3764629	3764629	1.000000	0.71417	0.203000	0.23512	0.964000	0.63967	6.965000	0.76067	2.663000	0.90544	0.557000	0.71058	CGT	0.559967		TCGA-US-A779-01A-11D-A32N-08	0.522	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	0	0	0	2	2	2	2	0	0	0	0	68	68	68	68	1	1.860000	-5.314512	1	0.570000	NM_004380		0	5	0	0	352	349	0		0	0		0	0	68	0	0	0.934175	3.945584e-02	0	0	0	18	0	5	352
SMG1	23049	broad.mit.edu	37	16	18858860	18858860	+	Silent	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr16:18858860G>A	ENST00000446231.2	-	38	6323	c.5911C>T	c.(5911-5913)Ctg>Ttg	p.L1971L	SMG1_ENST00000389467.3_Silent_p.L1971L			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1971	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGTTGTTGCAGCAAAACTCCC	0.493																																						ENST00000446231.2	0.120000	2.000000e-02	0.090000	3.000000e-02	0.050000	0.066963	0.050000	0.060000																										0				92						c.(5911-5913)Ctg>Ttg		SMG1 phosphatidylinositol 3-kinase-related kinase							118.0	119.0	119.0					16																	18858860		2114	4241	6355	SO:0001819	synonymous_variant	23049	0	0					g.chr16:18858860G>A	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.5911C>T	chr16.hg19:g.18858860G>A		0					SMG1_ENST00000389467.3_Silent_p.L1971L	p.L1971L			0	0	0	2.039218	Q96Q15	SMG1_HUMAN		38	6323	-			O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	0	1	hg19	c.5911C>T	CCDS45430.1	0																																																																																								0.559967		TCGA-US-A779-01A-11D-A32N-08	0.493	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	0	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	1.860000	-2.587348	1	0.570000	NM_015092		0	7	7	0	400	398	0		1	0		0	0	79	0	0	0.980470	2.493445e-03	0	0	0	4	0	7	400
PMFBP1	83449	broad.mit.edu	37	16	72170640	72170640	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr16:72170640G>A	ENST00000237353.10	-	8	1258	c.997C>T	c.(997-999)Cgc>Tgc	p.R333C	PMFBP1_ENST00000537465.1_Missense_Mutation_p.R333C|PMFBP1_ENST00000355636.6_Missense_Mutation_p.R188C	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	333						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				AGTTCCACGCGCAGATCCTTC	0.552																																						ENST00000237353.10	0.160000	1.000000e-02	0.120000	4.000000e-02	0.070000	0.083045	0.070000	0.070000																										0				45						c.(997-999)Cgc>Tgc		polyamine modulated factor 1 binding protein 1							99.0	82.0	87.0					16																	72170640		2198	4300	6498	SO:0001583	missense	83449	4	121412	37				g.chr16:72170640G>A	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.997C>T	chr16.hg19:g.72170640G>A	ENSP00000237353:p.Arg333Cys	0					PMFBP1_ENST00000537465.1_Missense_Mutation_p.R333C|PMFBP1_ENST00000355636.6_Missense_Mutation_p.R188C	p.R333C	NM_031293.2	NP_112583.2	0	0	0	2.043785	Q8TBY8	PMFBP_HUMAN		8	1258	-		Ovarian(137;0.179)	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	0	1	hg19	c.997C>T	CCDS32483.1	0	.	.	.	.	.	.	.	.	.	.	G	17.38	3.375346	0.61735	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.19250	2.18;2.19;2.16	4.85	1.33	0.21861	4.85	1.33	0.21861	.	0.554792	0.13865	N	0.357364	T	0.33440	0.0863	L	0.36672	1.1	0.42002	D	0.990895	D;D;D	0.89917	1.0;0.999;1.0	D;P;D	0.83275	0.996;0.881;0.996	T	0.07121	-1.0789	10	0.59425	D	0.04	-1.6358	10.8676	0.46864	0.0:0.0:0.3296:0.6704	.	333;333;333	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	C	333;333;188	ENSP00000443817:R333C;ENSP00000237353:R333C;ENSP00000347854:R188C	ENSP00000237353:R333C	R	-	1	0	0	PMFBP1	70728141	70728141	0.994000	0.37717	0.976000	0.42696	0.795000	0.44927	0.773000	0.26661	0.403000	0.25479	0.563000	0.77884	CGC	0.565041		TCGA-US-A779-01A-11D-A32N-08	0.552	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	0	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	1.860000	-5.280537	1	0.570000	NM_031293		0	4	4	0	202	200	0		1	0		0	0	35	0	0	0.888902	0	0	0	0	1	0	4	202
KCNG4	93107	broad.mit.edu	37	16	84256037	84256037	+	Missense_Mutation	SNP	G	G	A	rs142742654		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr16:84256037G>A	ENST00000308251.4	-	3	1414	c.1346C>T	c.(1345-1347)cCg>cTg	p.P449L		NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	449					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						AGACGTGGCCGGGAAGGCCAT	0.627																																						ENST00000308251.4	0.080000	0	0.060000	1.000000e-02	0.030000	0.042550	0.030000	0.040000																										0				31						c.(1345-1347)cCg>cTg		potassium voltage-gated channel, subfamily G, member 4		G	LEU/PRO	0,4400		0,0,2200	71.0	70.0	70.0		1346	5.6	1.0	16	dbSNP_134	70	1,8599	1.2+/-3.3	0,1,4299	no	missense	KCNG4	NM_172347.2	98	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	449/520	84256037	1,12999	2200	4300	6500	SO:0001583	missense	93107	5	121412	39				g.chr16:84256037G>A	AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.1346C>T	chr16.hg19:g.84256037G>A	ENSP00000312129:p.Pro449Leu	0						p.P449L	NM_172347.2	NP_758857.1	0	0	0	2.043785	Q8TDN1	KCNG4_HUMAN		3	1414	-			Q96H24	Missense_Mutation	SNP	ENST00000308251.4	0	1	hg19	c.1346C>T	CCDS10945.1	0	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831268	0.91036	0.0	1.16E-4	ENSG00000168418	ENST00000308251	T	0.56103	0.48	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.75496	0.3857	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78380	-0.2226	10	0.87932	D	0	.	18.6264	0.91340	0.0:0.0:1.0:0.0	.	449	Q8TDN1	KCNG4_HUMAN	L	449	ENSP00000312129:P449L	ENSP00000312129:P449L	P	-	2	0	0	KCNG4	82813538	82813538	1.000000	0.71417	0.999000	0.59377	1.000000	0.99986	9.869000	0.99810	2.631000	0.89168	0.655000	0.94253	CCG	0.565041		TCGA-US-A779-01A-11D-A32N-08	0.627	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269079.2	0	0	1	2	2	2	2	0	0	0	0	101	101	101	98	1	1.860000	-2.234781	0	0.570000	NM_172347		0	5	5	0	478	470	0		1			0	0	101	0	0	0.935064	0	0	0	0	0	0	5	478
KIAA1468	57614	broad.mit.edu	37	18	59919929	59919929	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr18:59919929C>T	ENST00000398130.2	+	12	1998	c.1766C>T	c.(1765-1767)gCg>gTg	p.A589V	KIAA1468_ENST00000256858.6_Missense_Mutation_p.A589V	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	589										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				GTGGCATTTGCGCGTCATGTT	0.388																																						ENST00000398130.2	0.150000	2.000000e-02	0.110000	4.000000e-02	0.070000	0.079148	0.070000	0.070000																										0				47						c.(1765-1767)gCg>gTg		KIAA1468							128.0	111.0	117.0					18																	59919929		2203	4300	6503	SO:0001583	missense	57614	1	121412	27				g.chr18:59919929C>T	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1766C>T	chr18.hg19:g.59919929C>T	ENSP00000381198:p.Ala589Val	0					KIAA1468_ENST00000256858.6_Missense_Mutation_p.A589V	p.A589V	NM_020854.3	NP_065905.2	1	2	3	2.089381	Q9P260	K1468_HUMAN		12	1998	+		Colorectal(73;0.186)		Missense_Mutation	SNP	ENST00000398130.2	0	1	hg19	c.1766C>T	CCDS11979.2	0	.	.	.	.	.	.	.	.	.	.	C	34	5.376217	0.95945	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.44482	0.92;0.92	5.81	5.81	0.92471	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65344	0.2682	M	0.66378	2.025	0.80722	D	1	D;D;D	0.89917	0.979;1.0;1.0	P;D;D	0.91635	0.802;0.999;0.998	T	0.61481	-0.7054	9	.	.	.	-14.7767	20.0621	0.97678	0.0:1.0:0.0:0.0	.	589;589;233	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	V	589	ENSP00000381198:A589V;ENSP00000256858:A589V	.	A	+	2	0	0	KIAA1468	58070909	58070909	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.723000	0.84788	2.750000	0.94351	0.655000	0.94253	GCG	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.388	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	0	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.860000	-2.366711	0	0.570000	NM_020854		0	5	5	0	259	255	0		1	0		0	0	57	0	0	0.935597	7.287236e-02	0	0	0	19	0	5	259
MRPL34	64981	broad.mit.edu	37	19	17417119	17417119	+	Silent	SNP	G	G	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:17417119G>T	ENST00000252602.1	+	2	435	c.210G>T	c.(208-210)ctG>ctT	p.L70L	ABHD8_ENST00000247706.3_5'Flank|MRPL34_ENST00000602206.1_Nonstop_Mutation_p.*37L|MRPL34_ENST00000600434.1_Silent_p.L70L|MRPL34_ENST00000595444.1_Silent_p.L162L|MRPL34_ENST00000594999.1_Silent_p.L70L	NM_023937.3	NP_076426.1	Q9BQ48	RM34_HUMAN	mitochondrial ribosomal protein L34	70					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(1)	2						TCCGGCGCCTGAGCACGCCGG	0.672																																						ENST00000252602.1	1.000000	4.900000e-01	0.940000	6.200000e-01	0.770000	0.778722	0.770000	1.000000																										0				2						c.(208-210)ctG>ctT		mitochondrial ribosomal protein L34							9.0	13.0	12.0					19																	17417119		2168	4231	6399	SO:0001819	synonymous_variant	64981	0	0					g.chr19:17417119G>T	AB049652	CCDS12356.1	19p13.1	2012-09-13						"""Mitochondrial ribosomal proteins / large subunits"""	14488	protein-coding gene	gene with protein product		611840				11543634	Standard	NM_023937		Approved	L34mt, MGC2633, MGC24974	uc002ngc.1	Q9BQ48		ENST00000252602.1:c.210G>T	chr19.hg19:g.17417119G>T		0					MRPL34_ENST00000594999.1_Silent_p.L70L|ABHD8_ENST00000247706.3_5'Flank|MRPL34_ENST00000602206.1_Nonstop_Mutation_p.*37L|MRPL34_ENST00000600434.1_Silent_p.L70L|MRPL34_ENST00000595444.1_Silent_p.L162L	p.L70L	NM_023937.3	NP_076426.1	0	0	0	2.045239	Q9BQ48	RM34_HUMAN		2	435	+				Silent	SNP	ENST00000252602.1	1	0	hg19	c.210G>T	CCDS12356.1	0																																																																																								0.565041		TCGA-US-A779-01A-11D-A32N-08	0.672	MRPL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463516.1	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	1.860000	-20.000000	1	0.570000	NM_023937		0	18	18	0	63	62	1		1	1		0	0	25	0	0	0.999991	1	0	147	0	238	0	18	63
UNC13A	23025	broad.mit.edu	37	19	17720864	17720864	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:17720864G>A	ENST00000519716.2	-	43	4695	c.4696C>T	c.(4696-4698)Cgg>Tgg	p.R1566W	UNC13A_ENST00000550896.1_Missense_Mutation_p.R1539W|UNC13A_ENST00000551649.1_Missense_Mutation_p.R1585W|UNC13A_ENST00000252773.7_Missense_Mutation_p.R1566W|UNC13A_ENST00000552293.1_Missense_Mutation_p.R1560W|UNC13A_ENST00000428389.2_Missense_Mutation_p.R1654W	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1566	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						ATGAACGGCCGGAAGATGCCA	0.517																																						ENST00000519716.2	0.080000	1.000000e-02	0.060000	2.000000e-02	0.040000	0.047979	0.040000	0.040000																										0				61						c.(4696-4698)Cgg>Tgg		unc-13 homolog A (C. elegans)							122.0	130.0	127.0					19																	17720864		2154	4277	6431	SO:0001583	missense	23025	0	0					g.chr19:17720864G>A	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.4696C>T	chr19.hg19:g.17720864G>A	ENSP00000429562:p.Arg1566Trp	0					UNC13A_ENST00000551649.1_Missense_Mutation_p.R1585W|UNC13A_ENST00000252773.7_Missense_Mutation_p.R1566W|UNC13A_ENST00000552293.1_Missense_Mutation_p.R1560W|UNC13A_ENST00000550896.1_Missense_Mutation_p.R1539W|UNC13A_ENST00000428389.2_Missense_Mutation_p.R1654W	p.R1566W	NM_001080421.2	NP_001073890.2	0	0	0	2.045239	Q9UPW8	UN13A_HUMAN		43	4695	-			E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	0	1	hg19	c.4696C>T	CCDS46013.2	0	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007738	0.75046	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	4.13	4.13	0.48395	4.13	4.13	0.48395	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.84005	0.5377	M	0.89968	3.075	0.46981	D	0.999273	D	0.89917	1.0	D	0.85130	0.997	D	0.87780	0.2611	10	0.87932	D	0	-17.1577	13.9527	0.64129	0.0:0.0:1.0:0.0	.	1566	Q9UPW8	UN13A_HUMAN	W	1566;1654;1566;1585;1560;1539	ENSP00000429562:R1566W;ENSP00000400409:R1654W;ENSP00000252773:R1566W;ENSP00000447236:R1585W;ENSP00000447572:R1560W;ENSP00000446831:R1539W	ENSP00000252773:R1566W	R	-	1	2	2	UNC13A	17581864	17581864	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.923000	0.56469	1.869000	0.54173	0.478000	0.44815	CGG	0.565041		TCGA-US-A779-01A-11D-A32N-08	0.517	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	0	0	1	2	2	2	2	0	0	0	0	144	144	144	142	1	1.860000	-2.046657	0	0.570000	XM_038604		0	8	8	0	642	633	0		1	0		0	0	144	0	0	0.988807	0	0	0	0	1	0	8	642
ZFP82	284406	broad.mit.edu	37	19	36884698	36884698	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:36884698G>A	ENST00000392161.3	-	5	786	c.544C>T	c.(544-546)Cgc>Tgc	p.R182C	ZFP82_ENST00000392171.1_Missense_Mutation_p.R182C	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGCTGTTGGCGCACTCTGAAC	0.438																																						ENST00000392161.3	0.130000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.070359	0.060000	0.060000																										0				25						c.(544-546)Cgc>Tgc		ZFP82 zinc finger protein							98.0	87.0	91.0					19																	36884698		2203	4300	6503	SO:0001583	missense	284406	1	121412	29				g.chr19:36884698G>A	AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.544C>T	chr19.hg19:g.36884698G>A	ENSP00000431265:p.Arg182Cys	0					ZFP82_ENST00000392171.1_Missense_Mutation_p.R182C	p.R182C	NM_133466.2	NP_597723.1	0	0	0	2.045239	Q8N141	ZFP82_HUMAN		5	786	-			Q8NC63|Q8TF53	Missense_Mutation	SNP	ENST00000392161.3	0	1	hg19	c.544C>T	CCDS12493.1	0	.	.	.	.	.	.	.	.	.	.	G	13.60	2.285544	0.40394	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	T;T	0.16073	2.37;2.37	4.05	2.92	0.33932	4.05	2.92	0.33932	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37393	N	0.002115	T	0.26991	0.0661	L	0.43646	1.37	0.22911	N	0.998579	D	0.89917	1.0	D	0.63488	0.915	T	0.01977	-1.1236	10	0.35671	T	0.21	.	10.9206	0.47163	0.0:0.0:0.8124:0.1876	.	182	Q8N141	ZFP82_HUMAN	C	182	ENSP00000431265:R182C;ENSP00000446080:R182C	ENSP00000431265:R182C	R	-	1	0	0	ZFP82	41576538	41576538	0.000000	0.05858	0.991000	0.47740	0.979000	0.70002	-0.345000	0.07770	2.282000	0.76494	0.655000	0.94253	CGC	0.565041		TCGA-US-A779-01A-11D-A32N-08	0.438	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	0	0	1	2	16	2	2	1	1	1	1	63	63	63	63	1	1.860000	-2.867962	1	0.570000	NM_133466		0	5	5	0	288	282	0		0			1	0	63	0	0	0.010352	0	0	0	0	0	0	5	288
HIF3A	64344	broad.mit.edu	37	19	46825050	46825050	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:46825050A>G	ENST00000377670.4	+	10	1193	c.1162A>G	c.(1162-1164)Atc>Gtc	p.I388V	HIF3A_ENST00000339613.2_Missense_Mutation_p.I332V|HIF3A_ENST00000300862.3_Missense_Mutation_p.I386V|HIF3A_ENST00000244303.6_Missense_Mutation_p.I319V|HIF3A_ENST00000472815.1_Missense_Mutation_p.I319V|HIF3A_ENST00000420102.2_Missense_Mutation_p.I337V|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000600383.1_Missense_Mutation_p.I319V	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	388					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		TGGCCCCCGGATCCTTGCCTT	0.682																																						ENST00000377670.4	1.000000	8.600000e-01	1.000000	9.100000e-01	0.970000	0.965124	0.970000	1.000000																										0				33						c.(1162-1164)Atc>Gtc		hypoxia inducible factor 3, alpha subunit							55.0	67.0	63.0					19																	46825050		2203	4300	6503	SO:0001583	missense	64344	0	0					g.chr19:46825050A>G	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1162A>G	chr19.hg19:g.46825050A>G	ENSP00000366898:p.Ile388Val	0					HIF3A_ENST00000244303.6_Missense_Mutation_p.I319V|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000472815.1_Missense_Mutation_p.I319V|HIF3A_ENST00000300862.3_Missense_Mutation_p.I386V|HIF3A_ENST00000420102.2_Missense_Mutation_p.I337V|HIF3A_ENST00000600383.1_Missense_Mutation_p.I319V|HIF3A_ENST00000339613.2_Missense_Mutation_p.I332V	p.I388V	NM_152795.3	NP_690008.2	1	2	3	2.143403	Q9Y2N7	HIF3A_HUMAN		10	1193	+		Ovarian(192;0.00965)|all_neural(266;0.0887)	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	1	1	hg19	c.1162A>G	CCDS12681.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.499|6.499	0.460253|0.460253	0.12342|0.12342	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000472815|ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	.|T;T;T;T;T	.|0.64803	.|0.63;-0.11;0.51;0.63;-0.12	4.43|4.43	3.42|3.42	0.39159|0.39159	4.43|4.43	3.42|3.42	0.39159|0.39159	.|.	.|1.554280	.|0.03882	.|N	.|0.277189	T|T	0.53351|0.53351	0.1791|0.1791	N|N	0.24115|0.24115	0.695|0.695	0.24933|0.24933	N|N	0.991907|0.991907	.|B;B;B;P;B;B;B	.|0.48350	.|0.074;0.048;0.119;0.909;0.073;0.073;0.024	.|B;B;B;P;B;B;B	.|0.48304	.|0.062;0.048;0.067;0.573;0.031;0.031;0.01	T|T	0.43686|0.43686	-0.9376|-0.9376	5|10	.|0.11182	.|T	.|0.66	.|.	6.4511|6.4511	0.21903|0.21903	0.8903:0.0:0.1097:0.0|0.8903:0.0:0.1097:0.0	.|.	.|337;319;386;337;332;388;388	.|F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185	.|.;.;.;.;.;HIF3A_HUMAN;.	G|V	360|388;388;319;332;332;386;337	.|ENSP00000366898:I388V;ENSP00000244303:I319V;ENSP00000341877:I332V;ENSP00000300862:I386V;ENSP00000407771:I337V	.|ENSP00000244302:I388V	D|I	+|+	2|1	0|0	0|0	HIF3A|HIF3A	51516890|51516890	51516890|51516890	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.473000|0.473000	0.32948|0.32948	0.753000|0.753000	0.26376|0.26376	0.874000|0.874000	0.35823|0.35823	0.533000|0.533000	0.62120|0.62120	GAT|ATC	0.576041		TCGA-US-A779-01A-11D-A32N-08	0.682	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3	1	0	1	2	2	2	2	0	0	0	0	152	152	152	150	1	1.860000	-20.000000	1	0.570000			0	212	210	0	561	548	1		1	0		0	0	152	1	0	1.000000	0	0	0	0	1	0	212	561
CNOT3	4849	broad.mit.edu	37	19	54646728	54646728	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:54646728G>A	ENST00000406403.1	+	1	1617	c.14G>A	c.(13-15)cGc>cAc	p.R5H	CNOT3_ENST00000358389.3_5'UTR|CNOT3_ENST00000221232.5_Missense_Mutation_p.R5H			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	5					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCGGACAAGCGCAAACTCCAA	0.527																																						ENST00000406403.1	1.000000	0	0.070000	2.000000e-02	0.040000	0.091633	0.040000	0.040000																										0				28						c.(13-15)cGc>cAc		CCR4-NOT transcription complex, subunit 3							196.0	161.0	173.0					19																	54646728		2203	4300	6503	SO:0001583	missense	4849	0	0					g.chr19:54646728G>A	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.14G>A	chr19.hg19:g.54646728G>A	ENSP00000383954:p.Arg5His	0					CNOT3_ENST00000221232.5_Missense_Mutation_p.R5H|CNOT3_ENST00000358389.3_5'UTR	p.R5H			1	2	3	2.148291	O75175	CNOT3_HUMAN		1	1617	+	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)		Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	0	1	hg19	c.14G>A	CCDS12880.1	0	.	.	.	.	.	.	.	.	.	.	G	30	5.051461	0.93793	.	.	ENSG00000088038	ENST00000221232;ENST00000406403	T;T	0.73363	-0.74;-0.74	4.87	4.87	0.63330	4.87	4.87	0.63330	Not CCR4-Not complex component, N-terminal (1);	0.135232	0.48286	D	0.000197	D	0.88328	0.6407	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.90703	0.4622	10	0.87932	D	0	-24.7136	15.3142	0.74059	0.0:0.0:1.0:0.0	.	5;5	B7Z6J7;O75175	.;CNOT3_HUMAN	H	5	ENSP00000221232:R5H;ENSP00000383954:R5H	ENSP00000221232:R5H	R	+	2	0	0	CNOT3	59338540	59338540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.832000	0.86757	2.429000	0.82318	0.655000	0.94253	CGC	0.577229		TCGA-US-A779-01A-11D-A32N-08	0.527	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	0	0	1	2	2	2	2	0	0	0	0	121	121	121	120	1	1.860000	-1.887841	0	0.570000	NM_014516		0	6	7	0	523	520	0		1	0		0	0	121	0	0	0.964741	9.862287e-02	0	1	0	38	0	6	523
LAIR1	3903	broad.mit.edu	37	19	54872775	54872775	+	Missense_Mutation	SNP	C	C	T	rs202185118		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:54872775C>T	ENST00000391742.2	-	3	264	c.112G>A	c.(112-114)Gtg>Atg	p.V38M	LAIR1_ENST00000313038.6_Missense_Mutation_p.V31M|LAIR1_ENST00000474878.1_Missense_Mutation_p.V37M|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000434277.2_Missense_Mutation_p.V37M|LAIR1_ENST00000391743.3_Missense_Mutation_p.V20M|LAIR1_ENST00000348231.4_Missense_Mutation_p.V38M			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	38	Ig-like C2-type.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		AGGGGGATCACGGTGCCTGGC	0.582																																						ENST00000391742.2	1.000000	2.000000e-02	0.090000	4.000000e-02	0.060000	0.109562	0.060000	0.060000																										0				26						c.(112-114)Gtg>Atg		leukocyte-associated immunoglobulin-like receptor 1		C	MET/VAL,MET/VAL	2,4404		0,2,2201	100.0	106.0	104.0		112,112	-1.8	0.0	19		104	1,8599		0,1,4299	yes	missense,missense	LAIR1	NM_002287.3,NM_021706.2	21,21	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign,benign	38/288,38/271	54872775	3,13003	2203	4300	6503	SO:0001583	missense	3903	23	121412	48				g.chr19:54872775C>T	AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.112G>A	chr19.hg19:g.54872775C>T	ENSP00000375622:p.Val38Met	0					LAIR1_ENST00000474878.1_Missense_Mutation_p.V37M|LAIR1_ENST00000313038.6_Missense_Mutation_p.V31M|LAIR1_ENST00000434277.2_Missense_Mutation_p.V37M|LAIR1_ENST00000348231.4_Missense_Mutation_p.V38M|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000391743.3_Missense_Mutation_p.V20M	p.V38M			1	2	3	2.148761	Q6GTX8	LAIR1_HUMAN		3	264	-	Ovarian(34;0.19)			Missense_Mutation	SNP	ENST00000391742.2	0	1	hg19	c.112G>A	CCDS12891.1	0	.	.	.	.	.	.	.	.	.	.	.	13.40	2.225204	0.39300	4.54E-4	1.16E-4	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000348231;ENST00000313038;ENST00000474878;ENST00000438193	T;T;T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48;2.48;5.55	3.16	-1.77	0.07982	3.16	-1.77	0.07982	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.038110	0.07680	N	0.936945	T	0.22781	0.0550	M	0.72353	2.195	0.09310	N	1	P;B;B;P;P;P	0.49696	0.628;0.448;0.436;0.927;0.626;0.673	B;B;B;P;B;B	0.52554	0.267;0.266;0.118;0.702;0.097;0.323	T	0.28396	-1.0045	10	0.35671	T	0.21	.	6.5499	0.22427	0.0:0.5255:0.0:0.4745	.	38;20;37;37;38;38	Q6GTX8-4;A8MZ84;Q6GTX8-3;D3YTC8;Q6GTX8-2;Q6GTX8	.;.;.;.;.;LAIR1_HUMAN	M	20;38;37;38;31;37;32	ENSP00000375623:V20M;ENSP00000375622:V38M;ENSP00000391003:V37M;ENSP00000301193:V38M;ENSP00000319204:V31M;ENSP00000418998:V37M;ENSP00000392058:V32M	ENSP00000319204:V31M	V	-	1	0	0	LAIR1	59564587	59564587	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.630000	0.05502	-0.205000	0.10219	-0.210000	0.12710	GTG	0.577229		TCGA-US-A779-01A-11D-A32N-08	0.582	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1	0	0	1	2	2	2	2	0	0	0	0	145	145	145	144	1	1.860000	-2.756040	1	0.570000			0	11	11	0	638	632	0		1	0		0	0	145	0	0	0.998261	1.471472e-02	0	0	0	10	0	11	638
BRSK1	84446	broad.mit.edu	37	19	55814225	55814225	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:55814225C>T	ENST00000309383.1	+	10	1295	c.1018C>T	c.(1018-1020)Cgc>Tgc	p.R340C	BRSK1_ENST00000326848.7_Missense_Mutation_p.R35C|BRSK1_ENST00000590333.1_Missense_Mutation_p.R356C|BRSK1_ENST00000585418.1_Missense_Mutation_p.R340C	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	340	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TCGCGAGCTGCGCAGTGAGGA	0.662																																						ENST00000309383.1	1.000000	7.400000e-01	1.000000	8.300000e-01	0.930000	0.925591	0.930000	1.000000																										0				48						c.(1018-1020)Cgc>Tgc		BR serine/threonine kinase 1							56.0	44.0	48.0					19																	55814225		2203	4300	6503	SO:0001583	missense	84446	0	0					g.chr19:55814225C>T	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.1018C>T	chr19.hg19:g.55814225C>T	ENSP00000310649:p.Arg340Cys	0					BRSK1_ENST00000585418.1_Missense_Mutation_p.R340C|BRSK1_ENST00000590333.1_Missense_Mutation_p.R356C|BRSK1_ENST00000326848.7_Missense_Mutation_p.R35C	p.R340C	NM_032430.1	NP_115806.1	1	2	3	2.148761	Q8TDC3	BRSK1_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	10	1295	+		Renal(1328;0.245)	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	1	1	hg19	c.1018C>T	CCDS12921.1	1	.	.	.	.	.	.	.	.	.	.	.	16.92	3.256628	0.59321	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	T;T	0.72167	-0.63;1.95	4.69	3.62	0.41486	4.69	3.62	0.41486	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);	0.301128	0.28865	N	0.013882	T	0.66157	0.2761	N	0.08118	0	0.49483	D	0.999797	D;D	0.71674	0.996;0.998	P;P	0.61201	0.771;0.885	T	0.72620	-0.4238	10	0.72032	D	0.01	.	13.1288	0.59369	0.1618:0.8382:0.0:0.0	.	340;356	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	C	340;35;35	ENSP00000310649:R340C;ENSP00000320853:R35C	ENSP00000310649:R340C	R	+	1	0	0	BRSK1	60506037	60506037	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.281000	0.43452	1.075000	0.40932	0.655000	0.94253	CGC	0.577229		TCGA-US-A779-01A-11D-A32N-08	0.662	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	1.860000	-5.355290	1	0.570000	NM_032430		0	67	66	0	189	187	1		1	0		0	0	74	0	0	1.000000	3.934358e-01	0	1	0	4	0	67	189
OR7D4	125958	broad.mit.edu	37	19	9324694	9324694	+	Missense_Mutation	SNP	C	C	T	rs373618218		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:9324694C>T	ENST00000308682.2	-	1	848	c.820G>A	c.(820-822)Gcc>Acc	p.A274T		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						ATCACTGAGGCGGTGGAGCTG	0.552																																						ENST00000308682.2	0.130000	2.000000e-02	0.100000	4.000000e-02	0.060000	0.073202	0.060000	0.060000																										0				26						c.(820-822)Gcc>Acc		olfactory receptor, family 7, subfamily D, member 4		C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	71.0	63.0	65.0		820	2.4	0.4	19		65	0,8600		0,0,4300	no	missense	OR7D4	NM_001005191.2	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	274/313	9324694	1,13005	2203	4300	6503	SO:0001583	missense	125958	3	121412	38				g.chr19:9324694C>T		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.820G>A	chr19.hg19:g.9324694C>T	ENSP00000310488:p.Ala274Thr	0						p.A274T	NM_001005191.2	NP_001005191.1	0	0	0	2.045239	Q8NG98	OR7D4_HUMAN		1	848	-			A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	ENST00000308682.2	0	1	hg19	c.820G>A	CCDS32901.1	0	.	.	.	.	.	.	.	.	.	.	C	5.291	0.239022	0.10023	2.27E-4	0.0	ENSG00000174667	ENST00000308682	T	0.38077	1.16	3.49	2.44	0.29823	3.49	2.44	0.29823	GPCR, rhodopsin-like superfamily (1);	0.112635	0.39759	N	0.001267	T	0.34395	0.0896	M	0.70842	2.15	0.09310	N	1	B	0.27765	0.188	B	0.31290	0.127	T	0.34502	-0.9826	10	0.59425	D	0.04	.	5.1087	0.14798	0.0:0.665:0.2133:0.1217	.	274	Q8NG98	OR7D4_HUMAN	T	274	ENSP00000310488:A274T	ENSP00000310488:A274T	A	-	1	0	0	OR7D4	9185694	9185694	0.000000	0.05858	0.371000	0.25978	0.046000	0.14306	-0.229000	0.09098	0.831000	0.34780	0.205000	0.17691	GCC	0.565041		TCGA-US-A779-01A-11D-A32N-08	0.552	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1	0	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	1.860000	-3.283063	1	0.570000			0	6	6	0	323	316	0		1			0	0	80	0	0	0.962952	0	0	0	0	0	0	6	323
NLRP8	126205	broad.mit.edu	37	19	56466799	56466799	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr19:56466799G>A	ENST00000291971.3	+	3	1446	c.1375G>A	c.(1375-1377)Gca>Aca	p.A459T	NLRP8_ENST00000590542.1_Missense_Mutation_p.A459T	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	459	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCACTTGGCCGCAGACAGCAT	0.498																																						ENST00000291971.3	1.000000	1.000000e-02	0.070000	2.000000e-02	0.040000	0.095049	0.040000	0.040000																										0				35						c.(1375-1377)Gca>Aca		NLR family, pyrin domain containing 8							108.0	101.0	104.0					19																	56466799		2203	4300	6503	SO:0001583	missense	126205	1	121412	31				g.chr19:56466799G>A	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1375G>A	chr19.hg19:g.56466799G>A	ENSP00000291971:p.Ala459Thr	0					NLRP8_ENST00000590542.1_Missense_Mutation_p.A459T	p.A459T	NM_176811.2	NP_789781.2	1	2	3	2.148761	Q86W28	NALP8_HUMAN		3	1446	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	0	1	hg19	c.1375G>A	CCDS12937.1	0	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979924	0.34942	.	.	ENSG00000179709	ENST00000291971	D	0.83837	-1.77	2.04	0.947	0.19555	2.04	0.947	0.19555	.	.	.	.	.	D	0.87438	0.6177	M	0.74647	2.275	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.65010	0.928;0.931	T	0.75419	-0.3324	9	0.72032	D	0.01	.	5.6935	0.17843	0.0:0.0:0.6797:0.3203	.	459;459	Q86W28-2;Q86W28	.;NALP8_HUMAN	T	459	ENSP00000291971:A459T	ENSP00000291971:A459T	A	+	1	0	0	NLRP8	61158611	61158611	0.057000	0.20700	0.001000	0.08648	0.002000	0.02628	2.681000	0.46926	0.401000	0.25424	-0.426000	0.05927	GCA	0.577229		TCGA-US-A779-01A-11D-A32N-08	0.498	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	0	0	1	2	21	2	2	0	0	0	1	91	91	91	89	1	1.860000	-2.083570	0	0.570000	NM_176811		0	7	7	0	557	553	0		0			0	0	91	0	0	0.005371	0	0	0	0	0	0	7	557
POU2F1	5451	broad.mit.edu	37	1	167343484	167343484	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr1:167343484C>A	ENST00000541643.3	+	7	635	c.473C>A	c.(472-474)gCc>gAc	p.A158D	POU2F1_ENST00000367866.2_Missense_Mutation_p.A181D|POU2F1_ENST00000367862.5_Missense_Mutation_p.A170D|POU2F1_ENST00000420254.3_Missense_Mutation_p.A158D|POU2F1_ENST00000429375.2_Intron|POU2F1_ENST00000452019.1_Missense_Mutation_p.A158D|POU2F1_ENST00000367865.1_3'UTR			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	158					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GCCTCTGCTGCCACGCCCATG	0.617																																						ENST00000541643.3	0.230000	3.000000e-02	0.170000	6.000000e-02	0.100000	0.120126	0.100000	0.100000																										0				30						c.(472-474)gCc>gAc		POU class 2 homeobox 1							26.0	26.0	26.0					1																	167343484		2203	4299	6502	SO:0001583	missense	5451	0	0					g.chr1:167343484C>A	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.473C>A	chr1.hg19:g.167343484C>A	ENSP00000441285:p.Ala158Asp	0					POU2F1_ENST00000420254.3_Missense_Mutation_p.A158D|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Missense_Mutation_p.A170D|POU2F1_ENST00000452019.1_Missense_Mutation_p.A158D|POU2F1_ENST00000429375.2_Intron|POU2F1_ENST00000367866.2_Missense_Mutation_p.A181D	p.A158D			1	2	3	2.091686	P14859	PO2F1_HUMAN		7	635	+			B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	ENST00000541643.3	0	1	hg19	c.473C>A		0	.	.	.	.	.	.	.	.	.	.	C	37	6.377326	0.97520	.	.	ENSG00000143190	ENST00000367866;ENST00000452019;ENST00000492850;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.167697	0.37530	N	0.002053	D	0.84188	0.5417	L	0.52573	1.65	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;D	0.85130	0.991;0.996;0.997;0.99	D	0.84611	0.0678	10	0.72032	D	0.01	.	20.0589	0.97667	0.0:1.0:0.0:0.0	.	158;170;156;158	P14859-4;P14859-2;P14859-3;P14859	.;.;.;PO2F1_HUMAN	D	181;158;35;156;158;158;170;66	ENSP00000356840:A181D;ENSP00000391523:A158D;ENSP00000356839:A156D;ENSP00000414660:A158D;ENSP00000441285:A158D;ENSP00000356836:A170D;ENSP00000415993:A66D	ENSP00000356836:A170D	A	+	2	0	0	POU2F1	165610108	165610108	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.453000	0.80700	2.732000	0.93576	0.650000	0.86243	GCC	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.617	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	0	2	2	2	2	0	0	0	0	32	32	32	25	1	1.860000	-7.160779	1	0.570000	NM_002697		0	5	0	0	168	161	0		0	0		0	0	32	0	0	0.925901	1.363636e-03	0	0	0	2	0	5	168
CFH	3075	broad.mit.edu	37	1	196714957	196714957	+	Silent	SNP	A	A	C			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			A	C	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr1:196714957A>C	ENST00000367429.4	+	21	3561	c.3321A>C	c.(3319-3321)ggA>ggC	p.G1107G		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1107	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ATTCTACAGGAAAATGTGGGC	0.398																																						ENST00000367429.4	1.000000	7.400000e-01	0.940000	8.000000e-01	0.860000	0.874567	0.860000	0.870000																										0				101						c.(3319-3321)ggA>ggC		complement factor H							160.0	152.0	155.0					1																	196714957		2203	4300	6503	SO:0001819	synonymous_variant	3075	0	0					g.chr1:196714957A>C	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3321A>C	chr1.hg19:g.196714957A>C		0						p.G1107G	NM_000186.3	NP_000177.2	1	2	3	2.091686	P08603	CFAH_HUMAN		21	3561	+			A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000367429.4	1	1	hg19	c.3321A>C	CCDS1385.1	1																																																																																								0.571222		TCGA-US-A779-01A-11D-A32N-08	0.398	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	1	0	1	2	2	2	2	0	0	0	0	96	96	96	96	1	1.860000	-20.000000	1	0.570000	NM_000186		0	138	138	0	418	413	1		1	0		0	0	96	0	0	1.000000	9.999986e-01	0	0	0	61	0	138	418
IL22RA1	58985	broad.mit.edu	37	1	24447351	24447351	+	Missense_Mutation	SNP	T	T	C			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr1:24447351T>C	ENST00000270800.1	-	7	1707	c.1669A>G	c.(1669-1671)Aca>Gca	p.T557A		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	557					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TCCAGTTCTGTGGGCTGCTCC	0.607																																						ENST00000270800.1	0.960000	6.700000e-01	0.890000	7.400000e-01	0.810000	0.821099	0.810000	0.810000																										0				19						c.(1669-1671)Aca>Gca		interleukin 22 receptor, alpha 1							54.0	60.0	58.0					1																	24447351		2203	4300	6503	SO:0001583	missense	58985	0	0					g.chr1:24447351T>C	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.1669A>G	chr1.hg19:g.24447351T>C	ENSP00000270800:p.Thr557Ala	0						p.T557A	NM_021258.3	NP_067081.2	0	0	0	2.065936	Q8N6P7	I22R1_HUMAN		7	1707	-		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)	A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	ENST00000270800.1	1	1	hg19	c.1669A>G	CCDS247.1	0	.	.	.	.	.	.	.	.	.	.	T	12.49	1.954597	0.34471	.	.	ENSG00000142677	ENST00000270800	T	0.11385	2.78	4.97	-9.84	0.00479	4.97	-9.84	0.00479	.	2.787690	0.01292	N	0.010041	T	0.07052	0.0179	L	0.27053	0.805	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.08055	0.003;0.003	T	0.23511	-1.0186	10	0.41790	T	0.15	11.0103	8.4218	0.32705	0.1227:0.5662:0.0:0.3111	.	489;557	B4E2V9;Q8N6P7	.;I22R1_HUMAN	A	557	ENSP00000270800:T557A	ENSP00000270800:T557A	T	-	1	0	0	IL22RA1	24319938	24319938	0.000000	0.05858	0.000000	0.03702	0.862000	0.49288	-2.028000	0.01431	-1.664000	0.01479	0.529000	0.55759	ACA	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.607	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	1.860000	-20.000000	1	0.570000			0	95	93	0	310	303	1		1	1		0	0	87	0	0	1.000000	1	0	74	0	73	0	95	310
SUSD4	55061	broad.mit.edu	37	1	223465880	223465880	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr1:223465880C>T	ENST00000343846.3	-	2	895	c.262G>A	c.(262-264)Gga>Aga	p.G88R	SUSD4_ENST00000494793.2_Missense_Mutation_p.G88R|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366878.4_Missense_Mutation_p.G88R|SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000344029.6_Missense_Mutation_p.G88R			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	88	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		AGCTTGAATCCGTCTTGGCAG	0.512																																						ENST00000343846.3	0.980000	7.200000e-01	0.910000	7.700000e-01	0.840000	0.847133	0.840000	0.840000																										0				17						c.(262-264)Gga>Aga		sushi domain containing 4							119.0	124.0	122.0					1																	223465880		2203	4300	6503	SO:0001583	missense	55061	0	0					g.chr1:223465880C>T	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.262G>A	chr1.hg19:g.223465880C>T	ENSP00000344219:p.Gly88Arg	0					SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366878.4_Missense_Mutation_p.G88R|SUSD4_ENST00000494793.2_Missense_Mutation_p.G88R|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000344029.6_Missense_Mutation_p.G88R	p.G88R			1	2	3	2.091686	Q5VX71	SUSD4_HUMAN		2	895	-			D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	ENST00000343846.3	1	1	hg19	c.262G>A	CCDS41471.1	0	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685607	0.88639	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000271787;ENST00000344029	T;T;T	0.76709	-1.04;-1.04;-1.04	5.36	5.36	0.76844	5.36	5.36	0.76844	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.46442	D	0.000285	D	0.88742	0.6519	M	0.78344	2.41	0.80722	D	1	D;P	0.89917	1.0;0.952	D;B	0.97110	1.0;0.411	D	0.89846	0.4006	10	0.87932	D	0	-7.532	19.0844	0.93198	0.0:1.0:0.0:0.0	.	88;88	Q5VX71-3;Q5VX71	.;SUSD4_HUMAN	R	88	ENSP00000344219:G88R;ENSP00000355843:G88R;ENSP00000339926:G88R	ENSP00000271787:G88R	G	-	1	0	0	SUSD4	221532503	221532503	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.685000	0.68204	2.506000	0.84524	0.561000	0.74099	GGA	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.512	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	1	0	1	2	2	2	2	0	0	0	0	105	105	105	105	1	1.860000	-4.689269	1	0.570000	NM_017982		0	135	131	0	427	421	1		1	1		0	0	105	0	0	1.000000	9.990046e-01	0	11	0	24	0	135	427
ZNF831	128611	broad.mit.edu	37	20	57768280	57768280	+	Missense_Mutation	SNP	G	G	C			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr20:57768280G>C	ENST00000371030.2	+	1	2206	c.2206G>C	c.(2206-2208)Ggc>Cgc	p.G736R		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	736							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TGCACTGGGTGGCAGAGACAG	0.627																																						ENST00000371030.2	0.490000	6.000000e-02	0.350000	1.200000e-01	0.220000	0.245742	0.220000	0.190000																										0				125						c.(2206-2208)Ggc>Cgc		zinc finger protein 831							19.0	23.0	21.0					20																	57768280		2021	4174	6195	SO:0001583	missense	128611	0	0					g.chr20:57768280G>C	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2206G>C	chr20.hg19:g.57768280G>C	ENSP00000360069:p.Gly736Arg	0						p.G736R	NM_178457.1	NP_848552.1	0	0	0	2.062638	Q5JPB2	ZN831_HUMAN		1	2206	+	all_lung(29;0.0085)		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	0	1	hg19	c.2206G>C	CCDS42894.1	0	.	.	.	.	.	.	.	.	.	.	G	12.48	1.951969	0.34471	.	.	ENSG00000124203	ENST00000371030	T	0.04275	3.66	5.08	-4.76	0.03229	5.08	-4.76	0.03229	.	0.547276	0.17694	N	0.165163	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	P	0.49961	0.93	P	0.48030	0.564	T	0.39881	-0.9592	10	0.48119	T	0.1	-2.5812	6.2258	0.20708	0.3917:0.0:0.4426:0.1657	.	736	Q5JPB2	ZN831_HUMAN	R	736	ENSP00000360069:G736R	ENSP00000360069:G736R	G	+	1	0	0	ZNF831	57201675	57201675	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.311000	0.08124	-0.793000	0.04475	0.643000	0.83706	GGC	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.627	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	0	0	0	2	2	2	2	0	0	0	0	9	9	9	9	1	1.860000	-7.428794	1	0.570000	NM_178457		0	3	0	0	51	50	0		0			0	0	9	0	0	0.787372	0	0	0	0	0	0	3	51
AIRE	326	broad.mit.edu	37	21	45710997	45710997	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr21:45710997C>T	ENST00000291582.5	+	8	1026	c.899C>T	c.(898-900)gCc>gTc	p.A300V	AIRE_ENST00000355347.4_Missense_Mutation_p.A93V|AIRE_ENST00000329347.4_Missense_Mutation_p.A93V	NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	300					humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)	p.A103V(1)|p.A300V(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		GACGAGTGTGCCGTGTGTCGG	0.657									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																													ENST00000291582.5	0.100000	1.000000e-02	0.080000	3.000000e-02	0.040000	0.056028	0.040000	0.050000																										2	Substitution - Missense(2)	p.A103V(1)|p.A300V(1)	kidney(2)	14						c.(898-900)gCc>gTc		autoimmune regulator							99.0	83.0	89.0					21																	45710997		2203	4300	6503	SO:0001583	missense	326	0	0		Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy	Familial Cancer Database	APECED	g.chr21:45710997C>T	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.899C>T	chr21.hg19:g.45710997C>T	ENSP00000291582:p.Ala300Val	0					AIRE_ENST00000329347.4_Missense_Mutation_p.A93V|AIRE_ENST00000355347.4_Missense_Mutation_p.A93V	p.A300V	NM_000383.3	NP_000374.1	0	0	0	2.067827	O43918	AIRE_HUMAN		8	1026	+			B2RP50|O43922|O43932|O75745	Missense_Mutation	SNP	ENST00000291582.5	0	1	hg19	c.899C>T	CCDS13706.1	0	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920439	0.52653	.	.	ENSG00000160224	ENST00000291582;ENST00000337909;ENST00000397994;ENST00000355347;ENST00000329347	D;D;D	0.94497	-3.44;-3.44;-3.44	3.86	2.96	0.34315	3.86	2.96	0.34315	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.44902	D	0.000411	D	0.93536	0.7937	N	0.21142	0.635	0.52099	D	0.999946	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	D	0.91753	0.5414	10	0.48119	T	0.1	-32.3727	8.9219	0.35617	0.2232:0.7768:0.0:0.0	.	103;300	B2RP50;O43918	.;AIRE_HUMAN	V	300;103;103;93;93	ENSP00000291582:A300V;ENSP00000347505:A93V;ENSP00000331055:A93V	ENSP00000291582:A300V	A	+	2	0	0	AIRE	44535425	44535425	1.000000	0.71417	0.089000	0.20774	0.196000	0.23810	6.738000	0.74822	0.725000	0.32318	0.462000	0.41574	GCC	0.567535		TCGA-US-A779-01A-11D-A32N-08	0.657	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195842.2	0	0	1	2	2	2	2	0	0	0	0	103	103	103	100	1	1.860000	-2.344952	0	0.570000			0	7	7	0	489	481	0		1			0	0	103	0	0	0.979594	0	0	0	0	0	0	7	489
ZC3H7B	23264	broad.mit.edu	37	22	41742053	41742053	+	Silent	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr22:41742053C>T	ENST00000352645.4	+	14	1763	c.1506C>T	c.(1504-1506)ttC>ttT	p.F502F	ZC3H7B_ENST00000351589.4_Silent_p.F502F	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	518					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						ACTGCACCTTCGCCTACCATC	0.607																																						ENST00000352645.4	0.200000	9.000000e-02	0.170000	1.100000e-01	0.130000	0.145362	0.130000	0.150000																										0				38						c.(1504-1506)ttC>ttT		zinc finger CCCH-type containing 7B							197.0	167.0	177.0					22																	41742053		2203	4300	6503	SO:0001819	synonymous_variant	23264	0	0					g.chr22:41742053C>T		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.1506C>T	chr22.hg19:g.41742053C>T		1					ZC3H7B_ENST00000351589.4_Silent_p.F502F	p.F502F	NM_017590.4	NP_060060.3	1	2	3	2.627496	Q9UGR2	Z3H7B_HUMAN		14	1763	+			A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Silent	SNP	ENST00000352645.4	1	1	hg19	c.1506C>T	CCDS14013.1	0																																																																																								0.665370		TCGA-US-A779-01A-11D-A32N-08	0.607	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	0	0	1	2	2	2	2	0	0	0	0	201	201	201	201	1	1.860000	-2.822420	1	0.570000	NM_017590		0	32	31	0	989	982	0		1	0		0	0	201	0	0	1.000000	5.638036e-01	0	0	0	59	0	32	989
PLXNB2	23654	broad.mit.edu	37	22	50716129	50716129	+	Missense_Mutation	SNP	G	G	C			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr22:50716129G>C	ENST00000449103.1	-	33	5227	c.5087C>G	c.(5086-5088)cCc>cGc	p.P1696R	PLXNB2_ENST00000359337.4_Missense_Mutation_p.P1696R			O15031	PLXB2_HUMAN	plexin B2	1696					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GATGAAGTGGGGGTTCTTGAG	0.627																																						ENST00000449103.1	0.640000	4.300000e-01	0.590000	4.800000e-01	0.530000	0.543486	0.530000	0.540000																										0				66						c.(5086-5088)cCc>cGc		plexin B2							66.0	74.0	72.0					22																	50716129		2134	4260	6394	SO:0001583	missense	23654	0	0					g.chr22:50716129G>C		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.5087C>G	chr22.hg19:g.50716129G>C	ENSP00000409171:p.Pro1696Arg	1					PLXNB2_ENST00000359337.4_Missense_Mutation_p.P1696R	p.P1696R			0	1	1	1.439548	O15031	PLXB2_HUMAN		33	5227	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	1	1	hg19	c.5087C>G	CCDS43035.1	0	.	.	.	.	.	.	.	.	.	.	G	24.3	4.515467	0.85389	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399964	T;T	0.70045	-0.45;-0.45	4.21	4.21	0.49690	4.21	4.21	0.49690	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.084908	0.50627	D	0.000119	D	0.85265	0.5657	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89427	0.3714	10	0.87932	D	0	.	16.7466	0.85474	0.0:0.0:1.0:0.0	.	1696	O15031	PLXB2_HUMAN	R	1696;1696;326	ENSP00000409171:P1696R;ENSP00000352288:P1696R	ENSP00000352288:P1696R	P	-	2	0	0	PLXNB2	49058256	49058256	1.000000	0.71417	0.948000	0.38648	0.954000	0.61252	9.181000	0.94874	2.170000	0.68504	0.491000	0.48974	CCC	0.398601		TCGA-US-A779-01A-11D-A32N-08	0.627	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	1	0	1	2	2	2	2	0	0	0	0	116	116	116	116	1	1.860000	-3.826611	1	0.570000	NM_012401		0	81	75	0	294	290	1		1	1	1	0	0	116	381	0	1.000000	1	1	253	84	159	174	81	294
RBMS1	5937	broad.mit.edu	37	2	161159916	161159916	+	Missense_Mutation	SNP	T	T	C			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr2:161159916T>C	ENST00000348849.3	-	5	915	c.485A>G	c.(484-486)aAa>aGa	p.K162R	RBMS1_ENST00000409972.1_Missense_Mutation_p.K129R|RBMS1_ENST00000409289.2_Missense_Mutation_p.K129R|RBMS1_ENST00000392753.3_Missense_Mutation_p.K162R|RBMS1_ENST00000409075.1_Missense_Mutation_p.K129R|RBMS1_ENST00000474820.1_5'UTR	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	162	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								TCCAAATGGTTTGAGCATATT	0.413																																						ENST00000348849.3	0.630000	3.700000e-01	0.570000	4.300000e-01	0.490000	0.507226	0.490000	0.500000																									PLA2R1/RBMS1(2)	0										c.(484-486)aAa>aGa		RNA binding motif, single stranded interacting protein 1							155.0	136.0	142.0					2																	161159916		2203	4300	6503	SO:0001583	missense	5937	0	0					g.chr2:161159916T>C	D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.485A>G	chr2.hg19:g.161159916T>C	ENSP00000294904:p.Lys162Arg	0					RBMS1_ENST00000409075.1_Missense_Mutation_p.K129R|RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000392753.3_Missense_Mutation_p.K162R|RBMS1_ENST00000409289.2_Missense_Mutation_p.K129R|RBMS1_ENST00000409972.1_Missense_Mutation_p.K129R	p.K162R	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	0	0	0	2.057654	P29558	RBMS1_HUMAN		5	915	-			Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Missense_Mutation	SNP	ENST00000348849.3	1	1	hg19	c.485A>G	CCDS2213.1	0	.	.	.	.	.	.	.	.	.	.	T	22.4	4.291114	0.80914	.	.	ENSG00000153250	ENST00000348849;ENST00000409075;ENST00000409289;ENST00000392753;ENST00000409972	T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33	5.7	5.7	0.88788	5.7	5.7	0.88788	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	N	0.25144	0.715	0.80722	D	1	B;B;B;P;B;B;B	0.51449	0.004;0.118;0.009;0.945;0.128;0.002;0.008	B;B;B;D;B;B;B	0.71870	0.02;0.275;0.07;0.975;0.179;0.044;0.131	T	0.04360	-1.0957	10	0.54805	T	0.06	.	15.9541	0.79871	0.0:0.0:0.0:1.0	.	129;28;162;162;28;129;162	D3DPB2;Q5CZ65;P29558;P29558-2;Q5CZ66;E7ETU5;B4DN88	.;.;RBMS1_HUMAN;.;.;.;.	R	162;129;129;162;129	ENSP00000294904:K162R;ENSP00000386347:K129R;ENSP00000386571:K129R;ENSP00000376508:K162R;ENSP00000387280:K129R	ENSP00000294904:K162R	K	-	2	0	0	RBMS1	160868162	160868162	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.163000	0.67991	0.533000	0.62120	AAA	0.565041		TCGA-US-A779-01A-11D-A32N-08	0.413	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255043.4	1	0	1	2	2	2	2	0	0	0	0	69	69	69	69	1	1.860000	-19.999680	1	0.570000	NM_016836		0	50	50	0	296	290	1		1	1		0	0	69	0	0	1.000000	5.837977e-01	0	6	0	7	0	50	296
PPP1R1C	151242	broad.mit.edu	37	2	182850872	182850872	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr2:182850872C>T	ENST00000409137.3	+	1	278	c.35C>T	c.(34-36)gCc>gTc	p.A12V	PPP1R1C_ENST00000452904.1_Missense_Mutation_p.A12V|PPP1R1C_ENST00000280295.3_Missense_Mutation_p.A12V|PPP1R1C_ENST00000409702.1_Missense_Mutation_p.A12V|PPP1R1C_ENST00000475249.1_Intron	NM_001261424.1|NM_001261425.1	NP_001248353.1|NP_001248354.1	Q8WVI7	PPR1C_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1C	12					cell cycle (GO:0007049)|cell division (GO:0051301)|negative regulation of catalytic activity (GO:0043086)|positive regulation of cell growth (GO:0030307)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0628)			ATACAGTTTGCCGTGCCTGTA	0.448																																						ENST00000409137.3	0.090000	0	0.070000	2.000000e-02	0.040000	0.050447	0.040000	0.040000																										0				6						c.(34-36)gCc>gTc		protein phosphatase 1, regulatory (inhibitor) subunit 1C							150.0	144.0	146.0					2																	182850872		2010	4183	6193	SO:0001583	missense	151242	0	0					g.chr2:182850872C>T	AF494535, BC017943	CCDS46468.1, CCDS58740.1	2q31.3	2012-04-17			ENSG00000150722	ENSG00000150722		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14940	protein-coding gene	gene with protein product		613240				11948623	Standard	NM_001261424		Approved	Inhibitor-1-like	uc010frm.2	Q8WVI7	OTTHUMG00000154326	ENST00000409137.3:c.35C>T	chr2.hg19:g.182850872C>T	ENSP00000386359:p.Ala12Val	0					PPP1R1C_ENST00000409702.1_Missense_Mutation_p.A12V|PPP1R1C_ENST00000280295.3_Missense_Mutation_p.A12V|PPP1R1C_ENST00000475249.1_Intron|PPP1R1C_ENST00000452904.1_Missense_Mutation_p.A12V	p.A12V	NM_001261424.1|NM_001261425.1	NP_001248353.1|NP_001248354.1	0	0	0	2.039556	Q8WVI7	PPR1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0628)	1	278	+			Q5HYJ5|Q8TD54	Missense_Mutation	SNP	ENST00000409137.3	0	1	hg19	c.35C>T	CCDS46468.1	0	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558951	0.86231	.	.	ENSG00000150722	ENST00000452904;ENST00000409137;ENST00000280295;ENST00000409702	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.053176	0.85682	D	0.000000	T	0.49304	0.1549	M	0.69823	2.125	0.58432	D	0.99999	P;P	0.48503	0.911;0.834	P;P	0.50896	0.642;0.653	T	0.46857	-0.9161	10	0.72032	D	0.01	-13.2258	20.5827	0.99408	0.0:1.0:0.0:0.0	.	12;12	Q8WVI7-2;Q8WVI7	.;PPR1C_HUMAN	V	12	ENSP00000399602:A12V;ENSP00000386359:A12V;ENSP00000280295:A12V;ENSP00000386778:A12V	ENSP00000280295:A12V	A	+	2	0	0	PPP1R1C	182559117	182559117	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	5.971000	0.70440	2.941000	0.99782	0.655000	0.94253	GCC	0.559967		TCGA-US-A779-01A-11D-A32N-08	0.448	PPP1R1C-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334874.1	0	0	1	2	2	2	2	0	0	0	0	99	99	99	99	1	1.860000	-2.105576	0	0.570000	NM_001080545		0	6	6	0	467	461	0		1	0		0	0	99	0	0	0.963782	0	0	0	0	1	0	6	467
ADRA2B	151	broad.mit.edu	37	2	96780765	96780765	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr2:96780765C>T	ENST00000409345.3	-	1	1219	c.1124G>A	c.(1123-1125)gGc>gAc	p.G375D		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	375					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)			endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CACAAAAACGCCAATGACCAC	0.622																																						ENST00000409345.3	1.000000	5.800000e-01	0.980000	7.000000e-01	0.830000	0.835738	0.830000	1.000000																										0				16						c.(1123-1125)gGc>gAc		adrenoceptor alpha 2B	Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)						51.0	58.0	56.0					2																	96780765		2197	4292	6489	SO:0001583	missense	151	0	0					g.chr2:96780765C>T	M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.1124G>A	chr2.hg19:g.96780765C>T	ENSP00000387281:p.Gly375Asp	0						p.G375D	NM_000682.5	NP_000673	0	0	0	2.057654	P18089	ADA2B_HUMAN		1	1219	-			Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	SNP	ENST00000409345.3	1	1	hg19	c.1124G>A	CCDS56129.1	0	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308310	0.81247	.	.	ENSG00000222040	ENST00000409345	T	0.38560	1.13	5.61	5.61	0.85477	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.81346	0.4803	H	0.99682	4.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89685	0.3893	9	0.87932	D	0	.	17.1963	0.86893	0.0:1.0:0.0:0.0	.	378	P18089	ADA2B_HUMAN	D	375	ENSP00000387281:G375D	ENSP00000387281:G375D	G	-	2	0	0	ADRA2B	96144492	96144492	1.000000	0.71417	0.421000	0.26609	0.650000	0.38633	7.810000	0.86072	2.658000	0.90341	0.551000	0.68910	GGC	0.565041		TCGA-US-A779-01A-11D-A32N-08	0.622	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334990.1	1	0	1	2	2	2	2	0	0	0	0	29	29	29	28	1	1.860000	-20.000000	1	0.570000			0	27	26	0	85	82	1		1	0		0	0	29	0	0	1.000000	6.193745e-02	0	0	0	2	0	27	85
KIF1A	547	broad.mit.edu	37	2	241680688	241680688	+	Silent	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr2:241680688G>A	ENST00000320389.7	-	33	3602	c.3444C>T	c.(3442-3444)ggC>ggT	p.G1148G	KIF1A_ENST00000498729.2_Silent_p.G1249G	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1148					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GCACTCACTCGCCGTTGGCCT	0.657																																						ENST00000320389.7	1.000000	7.000000e-01	1.000000	9.000000e-01	0.990000	0.962822	0.990000	1.000000																										0				66						c.(3442-3444)ggC>ggT		kinesin family member 1A							26.0	32.0	30.0					2																	241680688		2105	4223	6328	SO:0001819	synonymous_variant	547	0	0					g.chr2:241680688G>A	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.3444C>T	chr2.hg19:g.241680688G>A		0					KIF1A_ENST00000498729.2_Silent_p.G1249G	p.G1148G	NM_004321.6	NP_004312.2	0	0	0	2.039556	Q12756	KIF1A_HUMAN		33	3602	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Silent	SNP	ENST00000320389.7	0	0	hg19	c.3444C>T	CCDS46561.1	1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.964924	0.34659	.	.	ENSG00000130294	ENST00000431776	.	.	.	4.44	1.37	0.22104	4.44	1.37	0.22104	.	.	.	.	.	T	0.57125	0.2032	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47911	-0.9080	4	.	.	.	.	8.8409	0.35142	0.0:0.1298:0.3973:0.4729	.	.	.	.	V	72	.	.	A	-	2	0	0	KIF1A	241329361	241329361	0.995000	0.38212	0.978000	0.43139	0.971000	0.66376	0.256000	0.18351	-0.040000	0.13580	0.460000	0.39030	GCG	0.559967		TCGA-US-A779-01A-11D-A32N-08	0.657	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	1	0	0	2	2	2	2	0	0	0	0	7	7	7	6	1	1.860000	-20.000000	1	0.570000	NM_138483		0	14	14	0	28	28	1		1	0		0	0	7	0	0	0.999916	5.463796e-01	0	0	0	5	0	14	28
VGLL4	9686	broad.mit.edu	37	3	11643423	11643423	+	Silent	SNP	G	G	A	rs151086238	byFrequency	TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr3:11643423G>A	ENST00000430365.2	-	2	561	c.156C>T	c.(154-156)acC>acT	p.T52T	VGLL4_ENST00000413604.1_5'UTR|VGLL4_ENST00000273038.3_Silent_p.T46T|VGLL4_ENST00000480288.1_5'Flank|VGLL4_ENST00000404339.1_Silent_p.T51T	NM_001128219.1	NP_001121691.1	Q14135	VGLL4_HUMAN	vestigial-like family member 4	46					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		GGGGAGGGCCGGTGCGGTGAC	0.592													G|||	4	0.000798722	0.003	0.0	5008	,	,		13377	0.0		0.0	False		,,,				2504	0.0					ENST00000430365.2	0.110000	1.000000e-02	0.080000	3.000000e-02	0.050000	0.059229	0.050000	0.060000																										0				10						c.(154-156)acC>acT		vestigial-like family member 4		G	,	21,4385	28.1+/-56.4	0,21,2182	79.0	77.0	78.0		156,138	-10.7	0.0	3	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	VGLL4	NM_001128219.1,NM_014667.2	,	0,22,6481	AA,AG,GG		0.0116,0.4766,0.1692	,	52/297,46/291	11643423	22,12984	2203	4300	6503	SO:0001819	synonymous_variant	9686	64	121412	51				g.chr3:11643423G>A	D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000430365.2:c.156C>T	chr3.hg19:g.11643423G>A		0					VGLL4_ENST00000413604.1_5'UTR|VGLL4_ENST00000273038.3_Silent_p.T46T|VGLL4_ENST00000404339.1_Silent_p.T51T|VGLL4_ENST00000480288.1_5'Flank	p.T52T	NM_001128219.1	NP_001121691.1	1	2	3	2.100008	Q14135	VGLL4_HUMAN		2	561	-			B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Silent	SNP	ENST00000430365.2	0	1	hg19	c.156C>T	CCDS46754.1	0																																																																																								0.571222		TCGA-US-A779-01A-11D-A32N-08	0.592	VGLL4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339133.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	105	1	1.860000	-2.247641	0	0.570000	NM_014667		0	7	6	0	466	462	0		1	0		0	0	108	0	0	0.980016	2.383197e-01	0	0	0	55	0	7	466
RFTN1	23180	broad.mit.edu	37	3	16475456	16475456	+	Silent	SNP	C	C	T	rs144679139		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr3:16475456C>T	ENST00000334133.4	-	3	506	c.234G>A	c.(232-234)tcG>tcA	p.S78S	RFTN1_ENST00000432519.1_Silent_p.S42S	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	78					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						GGGCCGCCAGCGAGAAGCCCT	0.647																																						ENST00000334133.4	0.150000	4.000000e-02	0.120000	6.000000e-02	0.080000	0.094968	0.080000	0.090000																										0				38						c.(232-234)tcG>tcA		raftlin, lipid raft linker 1							50.0	56.0	54.0					3																	16475456		2203	4300	6503	SO:0001819	synonymous_variant	23180	0	0					g.chr3:16475456C>T	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.234G>A	chr3.hg19:g.16475456C>T		0					RFTN1_ENST00000432519.1_Silent_p.S42S	p.S78S	NM_015150.1	NP_055965.1	1	2	3	2.100008	Q14699	RFTN1_HUMAN		3	506	-			Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Silent	SNP	ENST00000334133.4	0	1	hg19	c.234G>A	CCDS33712.1	0																																																																																								0.571222		TCGA-US-A779-01A-11D-A32N-08	0.647	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	1.860000	-11.139930	1	0.570000	NM_015150		0	13	13	0	503	498	0		1	0		0	0	107	0	0	0.999512	4.496843e-03	0	0	0	4	0	13	503
PLCD1	5333	broad.mit.edu	37	3	38049624	38049624	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr3:38049624G>A	ENST00000334661.4	-	14	2288	c.2066C>T	c.(2065-2067)gCg>gTg	p.A689V	PLCD1_ENST00000463876.1_Missense_Mutation_p.A710V	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	689	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TACCTCAAACGCAAACTCCGT	0.557																																						ENST00000334661.4	0.090000	0	0.070000	2.000000e-02	0.040000	0.047594	0.040000	0.040000																										0				24						c.(2065-2067)gCg>gTg		phospholipase C, delta 1							120.0	115.0	117.0					3																	38049624		2203	4300	6503	SO:0001583	missense	5333	1	121412	40				g.chr3:38049624G>A		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.2066C>T	chr3.hg19:g.38049624G>A	ENSP00000335600:p.Ala689Val	0					PLCD1_ENST00000463876.1_Missense_Mutation_p.A710V	p.A689V	NM_006225.3	NP_006216.2	1	2	3	2.100008	P51178	PLCD1_HUMAN		14	2288	-			B3KR14|Q86VN8	Missense_Mutation	SNP	ENST00000334661.4	0	1	hg19	c.2066C>T	CCDS2671.1	0	.	.	.	.	.	.	.	.	.	.	G	8.511	0.866463	0.17250	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	T;T	0.68181	-0.31;-0.31	5.15	4.0	0.46444	5.15	4.0	0.46444	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.475525	0.25677	N	0.029024	T	0.31702	0.0805	N	0.00525	-1.395	0.22648	N	0.998895	B;B	0.12013	0.005;0.003	B;B	0.08055	0.001;0.003	T	0.21143	-1.0254	10	0.23302	T	0.38	.	11.6796	0.51451	0.0:0.0:0.2929:0.7071	.	689;710	P51178;B3KR14	PLCD1_HUMAN;.	V	710;689	ENSP00000430344:A710V;ENSP00000335600:A689V	ENSP00000335600:A689V	A	-	2	0	0	PLCD1	38024628	38024628	0.000000	0.05858	0.989000	0.46669	0.071000	0.16799	0.102000	0.15272	0.932000	0.37266	-0.397000	0.06425	GCG	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.557	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2	0	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	1.860000	-2.522111	1	0.570000			0	5	5	0	434	432	0		1	0		0	0	95	0	0	0.937125	1.957615e-01	0	0	0	59	0	5	434
RYBP	23429	broad.mit.edu	37	3	72428210	72428210	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr3:72428210C>A	ENST00000477973.2	-	3	679	c.680G>T	c.(679-681)cGa>cTa	p.R227L		NM_012234.5	NP_036366.3	Q8N488	RYBP_HUMAN	RING1 and YY1 binding protein	0					apoptotic process (GO:0006915)|histone H2A monoubiquitination (GO:0035518)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			prostate(1)|upper_aerodigestive_tract(1)	2		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;0.000197)|Epithelial(33;0.00068)|LUSC - Lung squamous cell carcinoma(21;0.00228)|Lung(16;0.00677)|KIRC - Kidney renal clear cell carcinoma(39;0.198)|Kidney(39;0.232)		TGATTTGTTTCGCTGGTCTTT	0.393																																						ENST00000477973.2	1.000000	8.200000e-01	1.000000	9.200000e-01	0.990000	0.973549	0.990000	1.000000																										0				2						c.(679-681)cGa>cTa		RING1 and YY1 binding protein							188.0	167.0	173.0					3																	72428210		1918	4139	6057	SO:0001583	missense	23429	0	0					g.chr3:72428210C>A	AF179286		3p14.2	2008-07-18			ENSG00000163602	ENSG00000163602			10480	protein-coding gene	gene with protein product	"""YY1 and E4TF1 associated factor 1"", ""ring1 interactor RYBP"", ""apoptin-associating protein 1"", ""death effector domain-associated factor"""	607535				10369680	Standard	NM_012234		Approved	YEAF1, AAP1, DEDAF	uc003dpe.3	Q8N488	OTTHUMG00000159190	ENST00000477973.2:c.680G>T	chr3.hg19:g.72428210C>A	ENSP00000419494:p.Arg227Leu	0						p.R227L	NM_012234.5	NP_036366.3	1	2	3	2.100008	Q8N488	RYBP_HUMAN		3	679	-		Prostate(10;0.00174)|Lung NSC(201;0.0659)|Myeloproliferative disorder(1037;0.204)	Q9P2W5|Q9UMW4	Missense_Mutation	SNP	ENST00000477973.2	0	0	hg19	c.680G>T		1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191335	0.78902	.	.	ENSG00000163602	ENST00000477973	.	.	.	6.17	6.17	0.99709	6.17	6.17	0.99709	.	.	.	.	.	T	0.65749	0.2721	.	.	.	.	.	.	.	.	.	.	.	.	T	0.68044	-0.5513	3	.	.	.	-29.6366	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	.	.	.	L	227	.	.	R	-	2	0	0	RYBP	72510900	72510900	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.592000	0.67543	2.941000	0.99782	0.655000	0.94253	CGA	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.393	RYBP-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353762.3	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.860000	-6.696900	1	0.570000	NM_012234		0	63	63	0	151	150	1		1	1		0	0	55	0	0	1.000000	9.444030e-01	0	4	0	10	0	63	151
PDZRN3	23024	broad.mit.edu	37	3	73440202	73440202	+	Silent	SNP	G	G	A	rs538722275		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr3:73440202G>A	ENST00000263666.4	-	6	1434	c.1320C>T	c.(1318-1320)gaC>gaT	p.D440D	PDZRN3_ENST00000462146.2_Silent_p.D97D|PDZRN3_ENST00000535920.1_Silent_p.D162D|PDZRN3_ENST00000466780.1_Silent_p.D97D|PDZRN3_ENST00000479530.1_Silent_p.D157D|PDZRN3_ENST00000466348.1_5'UTR	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	440	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CGTCTTCATCGTCCGTCCGGT	0.443																																						ENST00000263666.4	0.160000	6.000000e-02	0.140000	8.000000e-02	0.100000	0.113674	0.100000	0.110000																										0				69						c.(1318-1320)gaC>gaT		PDZ domain containing ring finger 3							274.0	254.0	261.0					3																	73440202		2203	4300	6503	SO:0001819	synonymous_variant	23024	12	121412	48				g.chr3:73440202G>A	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1320C>T	chr3.hg19:g.73440202G>A		0					PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000535920.1_Silent_p.D162D|PDZRN3_ENST00000466780.1_Silent_p.D97D|PDZRN3_ENST00000479530.1_Silent_p.D157D|PDZRN3_ENST00000462146.2_Silent_p.D97D	p.D440D	NM_015009.1	NP_055824.1	1	2	3	2.100008	Q9UPQ7	PZRN3_HUMAN		6	1434	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	1	1	hg19	c.1320C>T	CCDS33789.1	0	.	.	.	.	.	.	.	.	.	.	G	8.064	0.768692	0.15983	.	.	ENSG00000121440	ENST00000494559	.	.	.	5.18	-9.21	0.00678	5.18	-9.21	0.00678	.	.	.	.	.	T	0.66327	0.2778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74100	-0.3774	4	.	.	.	.	20.3542	0.98835	0.8963:0.0:0.1037:0.0	.	.	.	.	M	37	.	.	T	-	2	0	0	PDZRN3	73522892	73522892	0.432000	0.25554	0.086000	0.20670	0.897000	0.52465	-0.105000	0.10907	-1.917000	0.01074	-0.880000	0.02959	ACG	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.443	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	0	0	1	2	2	2	2	0	0	0	0	164	164	164	163	1	1.860000	-2.907811	1	0.570000	XM_041363		0	27	26	0	837	823	0		1	0		0	0	164	0	0	1.000000	1.081481e-03	0	0	0	2	0	27	837
ZNF148	7707	broad.mit.edu	37	3	124953158	124953158	+	Missense_Mutation	SNP	C	C	T	rs376674595		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr3:124953158C>T	ENST00000360647.4	-	8	1168	c.683G>A	c.(682-684)cGc>cAc	p.R228H	ZNF148_ENST00000484491.1_Missense_Mutation_p.R228H|ZNF148_ENST00000468369.1_Missense_Mutation_p.R36H|ZNF148_ENST00000485866.1_Missense_Mutation_p.R228H|SLC12A8_ENST00000423114.2_Intron|ZNF148_ENST00000544464.1_Missense_Mutation_p.R23H|ZNF148_ENST00000492394.1_Missense_Mutation_p.R228H|ZNF148_ENST00000497929.1_5'UTR	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	228					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						TTCATCACAGCGAAATGGTTT	0.294																																						ENST00000360647.4	0.740000	4.500000e-01	0.670000	5.100000e-01	0.580000	0.595282	0.580000	0.590000																										0				28						c.(682-684)cGc>cAc		zinc finger protein 148		C	HIS/ARG	0,4406		0,0,2203	100.0	101.0	101.0		683	3.5	1.0	3		101	1,8593	1.2+/-3.3	0,1,4296	no	missense	ZNF148	NM_021964.2	29	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	benign	228/795	124953158	1,12999	2203	4297	6500	SO:0001583	missense	7707	0	0					g.chr3:124953158C>T	U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.683G>A	chr3.hg19:g.124953158C>T	ENSP00000353863:p.Arg228His	0					ZNF148_ENST00000468369.1_Missense_Mutation_p.R36H|ZNF148_ENST00000497929.1_5'UTR|SLC12A8_ENST00000423114.2_Intron|ZNF148_ENST00000492394.1_Missense_Mutation_p.R228H|ZNF148_ENST00000544464.1_Missense_Mutation_p.R23H|ZNF148_ENST00000485866.1_Missense_Mutation_p.R228H|ZNF148_ENST00000484491.1_Missense_Mutation_p.R228H	p.R228H	NM_021964.2	NP_068799.2	1	2	3	2.100008	Q9UQR1	ZN148_HUMAN		8	1168	-			D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	ENST00000360647.4	1	1	hg19	c.683G>A	CCDS3031.1	0	.	.	.	.	.	.	.	.	.	.	C	11.77	1.738426	0.30774	0.0	1.16E-4	ENSG00000163848	ENST00000360647;ENST00000468369;ENST00000484491;ENST00000544464;ENST00000492394;ENST00000485866;ENST00000543574	T;T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23;2.23	5.32	3.49	0.39957	5.32	3.49	0.39957	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.048859	0.85682	D	0.000000	T	0.13243	0.0321	L	0.35644	1.08	0.29133	N	0.879492	B;B	0.12013	0.005;0.001	B;B	0.06405	0.002;0.002	T	0.08027	-1.0742	10	0.44086	T	0.13	0.0288	9.7899	0.40699	0.0:0.786:0.0:0.214	.	36;228	G5E9X2;Q9UQR1	.;ZN148_HUMAN	H	228;36;228;23;228;228;228	ENSP00000353863:R228H;ENSP00000420102:R36H;ENSP00000420335:R228H;ENSP00000437916:R23H;ENSP00000419322:R228H;ENSP00000420448:R228H	ENSP00000353863:R228H	R	-	2	0	0	ZNF148	126435848	126435848	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.648000	0.46647	1.474000	0.48178	0.650000	0.86243	CGC	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.294	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	1	0	1	2	2	2	2	0	0	0	0	70	70	70	69	1	1.860000	-20.000000	1	0.570000	NM_021964		0	58	58	0	288	284	1		1	0		0	0	70	0	0	1.000000	2.026913e-01	0	0	0	5	0	58	288
RGS12	6002	broad.mit.edu	37	4	3318330	3318330	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr4:3318330G>A	ENST00000344733.5	+	2	1337	c.433G>A	c.(433-435)Gga>Aga	p.G145R	RGS12_ENST00000543385.1_Missense_Mutation_p.G145R|RGS12_ENST00000382788.3_Missense_Mutation_p.G145R|RGS12_ENST00000336727.3_Missense_Mutation_p.G145R	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	145					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCAGTCTGGTGGAATTTTCAA	0.468																																						ENST00000344733.5	1.000000	7.800000e-01	1.000000	8.600000e-01	0.940000	0.934538	0.940000	1.000000																										0				43						c.(433-435)Gga>Aga		regulator of G-protein signaling 12							59.0	65.0	63.0					4																	3318330		2203	4299	6502	SO:0001583	missense	6002	0	0					g.chr4:3318330G>A	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.433G>A	chr4.hg19:g.3318330G>A	ENSP00000339381:p.Gly145Arg	0					RGS12_ENST00000382788.3_Missense_Mutation_p.G145R|RGS12_ENST00000336727.3_Missense_Mutation_p.G145R|RGS12_ENST00000543385.1_Missense_Mutation_p.G145R	p.G145R	NM_198229.2	NP_937872.1	1	2	3	2.112040	O14924	RGS12_HUMAN		2	1337	+			B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	1	1	hg19	c.433G>A	CCDS3366.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196311	0.78902	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	T;T;T;T	0.37058	1.22;1.27;1.28;1.28	4.72	4.72	0.59763	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.61924	0.2386	M	0.77820	2.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.994;0.987;0.995	T	0.67960	-0.5535	10	0.72032	D	0.01	-22.7391	16.6763	0.85280	0.0:0.0:1.0:0.0	.	145;145;145	Q8WX97;O14924;O14924-4	.;RGS12_HUMAN;.	R	145	ENSP00000440566:G145R;ENSP00000339381:G145R;ENSP00000338509:G145R;ENSP00000372238:G145R	ENSP00000338509:G145R	G	+	1	0	0	RGS12	3288128	3288128	1.000000	0.71417	0.077000	0.20336	0.902000	0.53008	7.324000	0.79115	2.176000	0.68965	0.491000	0.48974	GGA	0.572437		TCGA-US-A779-01A-11D-A32N-08	0.468	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	76	1	1.860000	-6.547642	1	0.570000	NM_002926		0	104	102	0	285	281	1		1	0		0	0	76	0	0	1.000000	7.261600e-02	0	1	0	1	0	104	285
PPP2R2C	5522	broad.mit.edu	37	4	6380234	6380234	+	Silent	SNP	C	C	T	rs147944662	byFrequency	TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr4:6380234C>T	ENST00000382599.4	-	3	450	c.234G>A	c.(232-234)ccG>ccA	p.P78P	PPP2R2C_ENST00000506140.1_Silent_p.P71P|PPP2R2C_ENST00000515571.1_Silent_p.P61P|PPP2R2C_ENST00000314348.8_Intron|PPP2R2C_ENST00000507294.1_Silent_p.P71P|PPP2R2C_ENST00000335585.5_Silent_p.P78P			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	78					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						AGTCAAACTCCGGCTCGTGGC	0.572																																						ENST00000382599.4	0.130000	3.000000e-02	0.100000	5.000000e-02	0.070000	0.089242	0.070000	0.080000																										0				28						c.(232-234)ccG>ccA		protein phosphatase 2, regulatory subunit B, gamma		C	,,,	3,4403	6.2+/-15.9	0,3,2200	145.0	136.0	139.0		213,213,183,234	-9.3	0.0	4	dbSNP_134	139	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PPP2R2C	NM_001206994.1,NM_001206995.1,NM_001206996.1,NM_181876.2	,,,	0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308	,,,	71/441,71/441,61/431,78/448	6380234	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	5522	13	121412	46				g.chr4:6380234C>T	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.234G>A	chr4.hg19:g.6380234C>T		0					PPP2R2C_ENST00000515571.1_Silent_p.P61P|PPP2R2C_ENST00000506140.1_Silent_p.P71P|PPP2R2C_ENST00000314348.8_Intron|PPP2R2C_ENST00000507294.1_Silent_p.P71P|PPP2R2C_ENST00000335585.5_Silent_p.P78P	p.P78P			1	2	3	2.112040	Q9Y2T4	2ABG_HUMAN		3	450	-			A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Silent	SNP	ENST00000382599.4	0	1	hg19	c.234G>A		0																																																																																								0.572437		TCGA-US-A779-01A-11D-A32N-08	0.572	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	0	0	1	2	2	2	2	0	0	0	0	127	127	127	126	1	1.860000	-2.329434	0	0.570000	NM_181876		0	13	12	0	600	598	0		1	0		0	0	127	0	0	0.999522	7.757388e-03	0	0	0	6	0	13	600
MMRN1	22915	broad.mit.edu	37	4	90872802	90872802	+	Silent	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr4:90872802G>A	ENST00000394980.1	+	8	3484	c.3165G>A	c.(3163-3165)acG>acA	p.T1055T	MMRN1_ENST00000508372.1_Silent_p.T797T|MMRN1_ENST00000394981.1_Silent_p.T358T|MMRN1_ENST00000264790.2_Silent_p.T1055T			Q13201	MMRN1_HUMAN	multimerin 1	1055	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		ATGGGGGCACGTGCATAAATG	0.433																																						ENST00000394980.1	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999680	0.990000	1.000000																										0				72						c.(3163-3165)acG>acA		multimerin 1							107.0	91.0	97.0					4																	90872802		2203	4300	6503	SO:0001819	synonymous_variant	22915	3	121396	36				g.chr4:90872802G>A	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.3165G>A	chr4.hg19:g.90872802G>A		0					MMRN1_ENST00000394981.1_Silent_p.T358T|MMRN1_ENST00000264790.2_Silent_p.T1055T|MMRN1_ENST00000508372.1_Silent_p.T797T	p.T1055T			1	2	3	2.112040	Q13201	MMRN1_HUMAN		8	3484	+		Hepatocellular(203;0.114)	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	1	1	hg19	c.3165G>A	CCDS3635.1	1																																																																																								0.572437		TCGA-US-A779-01A-11D-A32N-08	0.433	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	1	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	1.860000	-11.634040	1	0.570000	NM_007351		0	95	95	0	178	176	1		1	0		0	0	39	0	0	1.000000	7.612792e-01	0	0	0	7	0	95	178
JADE1	79960	broad.mit.edu	37	4	129783124	129783124	+	Missense_Mutation	SNP	G	G	A	rs536855766		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr4:129783124G>A	ENST00000226319.6	+	9	1527	c.1247G>A	c.(1246-1248)cGt>cAt	p.R416H	PHF17_ENST00000413543.2_Missense_Mutation_p.R416H|PHF17_ENST00000512960.1_Missense_Mutation_p.R416H|PHF17_ENST00000511647.1_Missense_Mutation_p.R416H|PHF17_ENST00000452328.2_Missense_Mutation_p.R404H	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GTGAGTGTCCGTAAGCAGAAG	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18532	0.0		0.0	False		,,,				2504	0.001					ENST00000226319.6	0.100000	0	0.070000	2.000000e-02	0.040000	0.057919	0.040000	0.040000																										0				29						c.(1246-1248)cGt>cAt									106.0	100.0	102.0					4																	129783124		2203	4300	6503	SO:0001583	missense	0	3	121412	35				g.chr4:129783124G>A																												ENST00000226319.6:c.1247G>A	chr4.hg19:g.129783124G>A	ENSP00000226319:p.Arg416His	0					PHF17_ENST00000413543.2_Missense_Mutation_p.R416H|PHF17_ENST00000511647.1_Missense_Mutation_p.R416H|PHF17_ENST00000452328.2_Missense_Mutation_p.R404H|PHF17_ENST00000512960.1_Missense_Mutation_p.R416H	p.R416H	NM_199320.2	NP_955352.1	1	2	3	2.112040				9	1527	+				Missense_Mutation	SNP	ENST00000226319.6	0	1	hg19	c.1247G>A	CCDS34062.1	0	.	.	.	.	.	.	.	.	.	.	G	16.81	3.224990	0.58668	.	.	ENSG00000077684	ENST00000226319;ENST00000511647;ENST00000452328;ENST00000512960;ENST00000535321;ENST00000413543	T;T;T;T;T	0.49139	0.88;0.79;0.88;0.88;0.79	5.01	4.17	0.49024	5.01	4.17	0.49024	.	0.000000	0.85682	D	0.000000	T	0.69628	0.3132	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.73830	-0.3859	9	.	.	.	.	13.6817	0.62489	0.0745:0.0:0.9255:0.0	.	404;416;416	Q6IE81-2;Q6IE81;Q6IE81-3	.;JADE1_HUMAN;.	H	416;416;404;416;416;416	ENSP00000226319:R416H;ENSP00000423737:R416H;ENSP00000388015:R404H;ENSP00000425730:R416H;ENSP00000404211:R416H	.	R	+	2	0	0	PHF17	130002574	130002574	1.000000	0.71417	0.821000	0.32701	0.166000	0.22503	8.901000	0.92560	1.346000	0.45694	-0.150000	0.13652	CGT	0.572437		TCGA-US-A779-01A-11D-A32N-08	0.607	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1	0	0	1	2	17	2	2	1	1	1	1	103	103	103	103	1	1.860000	-2.231350	0	0.570000			0	6	7	0	499	487	0		0	0		1	0	103	0	0	0.014118	3.653600e-02	0	0	0	21	0	6	499
CMYA5	202333	broad.mit.edu	37	5	79026738	79026738	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr5:79026738G>A	ENST00000446378.2	+	2	2181	c.2150G>A	c.(2149-2151)cGt>cAt	p.R717H		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	717					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ACAATTGACCGTAAGTCCCCG	0.448																																						ENST00000446378.2	0.130000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.065064	0.050000	0.050000																										0				128						c.(2149-2151)cGt>cAt		cardiomyopathy associated 5							84.0	79.0	81.0					5																	79026738		1924	4138	6062	SO:0001583	missense	202333	5	120868	38				g.chr5:79026738G>A	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.2150G>A	chr5.hg19:g.79026738G>A	ENSP00000394770:p.Arg717His	1						p.R717H	NM_153610.3	NP_705838.3	0	1	1	1.593299	Q8N3K9	CMYA5_HUMAN		2	2181	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	0	1	hg19	c.2150G>A	CCDS47238.1	0	.	.	.	.	.	.	.	.	.	.	g	8.935	0.964478	0.18583	.	.	ENSG00000164309	ENST00000446378	T	0.46451	0.87	5.56	-11.1	0.00147	5.56	-11.1	0.00147	.	1.948280	0.02137	N	0.056869	T	0.08179	0.0204	N	0.00237	-1.79	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38394	-0.9663	10	0.30078	T	0.28	.	1.3491	0.02169	0.16:0.331:0.2504:0.2586	.	717	Q8N3K9	CMYA5_HUMAN	H	717	ENSP00000394770:R717H	ENSP00000394770:R717H	R	+	2	0	0	CMYA5	79062494	79062494	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.582000	0.02117	-2.338000	0.00627	-1.007000	0.02485	CGT	0.432531		TCGA-US-A779-01A-11D-A32N-08	0.448	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	0	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	1.860000	-3.010015	1	0.570000	NM_153610		0	4	4	0	197	197	0		1			0	0	55	0	0	0.891217	0	0	0	0	0	0	4	197
NR2F1	7025	broad.mit.edu	37	5	92921011	92921011	+	Silent	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr5:92921011C>T	ENST00000327111.3	+	1	1969	c.282C>T	c.(280-282)agC>agT	p.S94S	NR2F1-AS1_ENST00000513055.1_RNA	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	94					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		ACAAGTCGAGCGGCAAGCACT	0.642																																						ENST00000327111.3	0.430000	7.000000e-02	0.320000	1.200000e-01	0.200000	0.227761	0.200000	0.190000																										0				21						c.(280-282)agC>agT		nuclear receptor subfamily 2, group F, member 1							30.0	27.0	28.0					5																	92921011		2203	4300	6503	SO:0001819	synonymous_variant	7025	0	0					g.chr5:92921011C>T	BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.282C>T	chr5.hg19:g.92921011C>T		1					NR2F1-AS1_ENST00000513055.1_RNA	p.S94S	NM_005654.4	NP_005645.1	0	1	1	1.593299	P10589	COT1_HUMAN		1	1969	+		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		Silent	SNP	ENST00000327111.3	0	1	hg19	c.282C>T	CCDS4068.1	0																																																																																								0.432531		TCGA-US-A779-01A-11D-A32N-08	0.642	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	0	0	1	2	2	2	2	0	0	0	0	21	21	21	21	1	1.860000	-8.529821	1	0.570000	NM_005654		0	4	4	0	51	50	0		1	0		0	0	21	0	0	0.888536	7.128013e-02	0	0	0	5	0	4	51
ZNF184	7738	broad.mit.edu	37	6	27420760	27420760	+	Missense_Mutation	SNP	A	A	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr6:27420760A>T	ENST00000211936.6	-	6	862	c.578T>A	c.(577-579)cTt>cAt	p.L193H	ZNF184_ENST00000377419.1_Missense_Mutation_p.L193H	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TTGTGTTACAAGGTTTGAACT	0.368																																						ENST00000211936.6	0.380000	2.400000e-01	0.350000	2.700000e-01	0.300000	0.313255	0.300000	0.310000																										0				48						c.(577-579)cTt>cAt		zinc finger protein 184							230.0	228.0	229.0					6																	27420760		2203	4300	6503	SO:0001583	missense	7738	0	0					g.chr6:27420760A>T	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.578T>A	chr6.hg19:g.27420760A>T	ENSP00000211936:p.Leu193His	1					ZNF184_ENST00000377419.1_Missense_Mutation_p.L193H	p.L193H	NM_007149.2	NP_009080.2	0	1	1	1.601799	Q99676	ZN184_HUMAN		6	862	-			B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	1	1	hg19	c.578T>A	CCDS4624.1	0	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222112	0.58560	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	T;T	0.08370	3.1;3.1	5.32	0.257	0.15574	5.32	0.257	0.15574	.	0.879076	0.09630	N	0.776357	T	0.06371	0.0164	M	0.91300	3.195	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31888	-0.9927	10	0.54805	T	0.06	.	7.6793	0.28505	0.642:0.0:0.358:0.0	.	193	Q99676	ZN184_HUMAN	H	193	ENSP00000211936:L193H;ENSP00000366636:L193H	ENSP00000211936:L193H	L	-	2	0	0	ZNF184	27528739	27528739	0.003000	0.15002	0.002000	0.10522	0.577000	0.36160	1.919000	0.40015	0.147000	0.19030	0.454000	0.30748	CTT	0.445054		TCGA-US-A779-01A-11D-A32N-08	0.368	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	1	0	1	2	2	2	2	0	0	0	0	141	141	141	138	1	1.860000	-20.000000	1	0.570000	NM_007149		0	73	72	0	566	560	1		1	1		0	0	141	0	0	1.000000	1.898061e-01	0	2	0	5	0	73	566
C4A	720	broad.mit.edu	37	6	31964274	31964274	+	Silent	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr6:31964274C>T	ENST00000428956.2	+	28	3657	c.3573C>T	c.(3571-3573)caC>caT	p.H1191H	C4A_ENST00000498271.1_Silent_p.H1191H	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	1191					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	TGGGTGCCCACGCAGCTGCCA	0.592																																						ENST00000428956.2	0.170000	6.000000e-02	0.140000	8.000000e-02	0.100000	0.116895	0.100000	0.110000																										0										c.(3571-3573)caC>caT		complement component 4A (Rodgers blood group)	Intravenous Immunoglobulin(DB00028)						63.0	76.0	72.0					6																	31964274		1553	3533	5086	SO:0001819	synonymous_variant	720	7	120696	40				g.chr6:31964274C>T	L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.3573C>T	chr6.hg19:g.31964274C>T		0					C4A_ENST00000498271.1_Silent_p.H1191H	p.H1191H	NM_007293.2	NP_009224.2	0	0	0	2.009721	P0C0L4	CO4A_HUMAN		28	3657	+			A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Silent	SNP	ENST00000428956.2	1	1	hg19	c.3573C>T	CCDS47404.1	0																																																																																								0.544008		TCGA-US-A779-01A-11D-A32N-08	0.592	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	0	0	0	2	2	2	2	0	0	0	0	158	158	158	172	1	1.860000	-16.110340	1	0.570000	NM_007293		0	18	18	0	517	498	0		1	0		0	0	158	0	0	0.999976	5.422706e-01	0	0	0	52	0	18	517
IYD	389434	broad.mit.edu	37	6	150715311	150715311	+	Missense_Mutation	SNP	G	G	A	rs377381152		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr6:150715311G>A	ENST00000344419.3	+	4	747	c.607G>A	c.(607-609)Gca>Aca	p.A203T	IYD_ENST00000392255.3_Missense_Mutation_p.A203T|IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T|IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000425615.3_Missense_Mutation_p.A148T	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	203					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		TGGTTTCGCCGCAAATGGCAA	0.433																																						ENST00000344419.3	0.100000	1.000000e-02	0.070000	2.000000e-02	0.040000	0.052904	0.040000	0.050000																										0				15						c.(607-609)Gca>Aca		iodotyrosine deiodinase		A	THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	122.0	109.0	113.0		607,607,607	2.1	0.0	6		113	0,8600		0,0,4300	no	missense,missense,missense	IYD	NM_001164694.1,NM_001164695.1,NM_203395.2	58,58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	203/294,203/248,203/290	150715311	1,13005	2203	4300	6503	SO:0001583	missense	389434	3	121412	38				g.chr6:150715311G>A	AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.607G>A	chr6.hg19:g.150715311G>A	ENSP00000343763:p.Ala203Thr	1					IYD_ENST00000500320.3_Missense_Mutation_p.A203T|IYD_ENST00000392255.3_Missense_Mutation_p.A203T|IYD_ENST00000392256.2_Missense_Mutation_p.A203T|IYD_ENST00000229447.5_Missense_Mutation_p.A203T|IYD_ENST00000425615.3_Missense_Mutation_p.A148T	p.A203T	NM_203395.2	NP_981932.1	0	1	1	1.677508	Q6PHW0	IYD1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.215)	4	747	+		Ovarian(120;0.028)	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	0	1	hg19	c.607G>A	CCDS5227.1	0	.	.	.	.	.	.	.	.	.	.	g	5.689	0.311597	0.10789	2.27E-4	0.0	ENSG00000009765	ENST00000229447;ENST00000344419;ENST00000392256;ENST00000392255;ENST00000500320;ENST00000425615	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	6.17	2.1	0.27182	6.17	2.1	0.27182	Nitroreductase-like (3);	0.509560	0.22264	N	0.062376	T	0.43055	0.1230	L	0.46885	1.475	0.09310	N	1	B;B;B;B	0.20261	0.004;0.043;0.001;0.002	B;B;B;B	0.18561	0.003;0.022;0.001;0.005	T	0.24548	-1.0157	10	0.27785	T	0.31	-23.7178	1.2452	0.01971	0.2372:0.2256:0.3896:0.1475	.	121;203;203;203	Q2VPV9;C9JFW2;Q6PHW0-3;Q6PHW0	.;.;.;IYD1_HUMAN	T	203;203;203;203;203;148	ENSP00000229447:A203T;ENSP00000343763:A203T;ENSP00000376085:A203T;ENSP00000376084:A203T;ENSP00000441276:A203T;ENSP00000390081:A148T	ENSP00000229447:A203T	A	+	1	0	0	IYD	150757004	150757004	0.019000	0.18553	0.001000	0.08648	0.174000	0.22865	0.255000	0.18333	0.496000	0.27904	-0.119000	0.15052	GCA	0.443005		TCGA-US-A779-01A-11D-A32N-08	0.433	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	0	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	1.860000	-2.001450	0	0.570000	NM_203395		0	5	5	0	299	299	0		1	0		0	0	75	0	0	0.938043	5.741988e-02	0	0	0	19	0	5	299
FAM3C	10447	broad.mit.edu	37	7	120991269	120991269	+	Silent	SNP	A	A	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr7:120991269A>T	ENST00000359943.3	-	9	735	c.522T>A	c.(520-522)acT>acA	p.T174T		NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C	174					multicellular organismal development (GO:0007275)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	cytokine activity (GO:0005125)			kidney(1)|lung(8)	9	all_neural(327;0.117)					AACCAAGATTAGTAATAGATG	0.428																																						ENST00000359943.3	0.940000	5.700000e-01	0.840000	6.500000e-01	0.740000	0.750470	0.740000	0.740000																										0				9						c.(520-522)acT>acA		family with sequence similarity 3, member C							74.0	71.0	72.0					7																	120991269		2203	4297	6500	SO:0001819	synonymous_variant	10447	0	0					g.chr7:120991269A>T	D87120	CCDS5782.1	7q22.1-q31.1	2014-08-14			ENSG00000196937	ENSG00000196937			18664	protein-coding gene	gene with protein product	"""predicted osteoblast protein"", ""interleukin-like EMT inducer"", ""interleukin-like epithelial-mesenchymal transition inducer"""	608618				12160727	Standard	NM_014888		Approved	GS3876, ILEI	uc010lkm.3	Q92520	OTTHUMG00000156979	ENST00000359943.3:c.522T>A	chr7.hg19:g.120991269A>T		0						p.T174T	NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	1	2	3	2.102114	Q92520	FAM3C_HUMAN		9	735	-	all_neural(327;0.117)		A6NDN2|A8K3R7	Silent	SNP	ENST00000359943.3	1	1	hg19	c.522T>A	CCDS5782.1	0																																																																																								0.571222		TCGA-US-A779-01A-11D-A32N-08	0.428	FAM3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346945.1	1	0	1	2	2	2	2	0	0	0	0	47	47	47	48	1	1.860000	-20.000000	1	0.570000	NM_001040020		0	51	51	0	190	188	1		1	1		0	0	47	0	0	1.000000	9.993122e-01	0	18	0	26	0	51	190
VWC2	375567	broad.mit.edu	37	7	49815696	49815696	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr7:49815696G>A	ENST00000340652.4	+	2	1221	c.665G>A	c.(664-666)gGc>gAc	p.G222D		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	222	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						GAGTTCCGGGGCAAGACCTAT	0.617																																						ENST00000340652.4	1.000000	4.600000e-01	1.000000	6.800000e-01	0.950000	0.873084	0.950000	1.000000																										0				8						c.(664-666)gGc>gAc		von Willebrand factor C domain containing 2							18.0	23.0	21.0					7																	49815696		2095	4222	6317	SO:0001583	missense	375567	0	0					g.chr7:49815696G>A	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.665G>A	chr7.hg19:g.49815696G>A	ENSP00000341819:p.Gly222Asp	0						p.G222D	NM_198570.3	NP_940972.2	1	2	3	2.090908	Q2TAL6	VWC2_HUMAN		2	1221	+			Q6UXE2	Missense_Mutation	SNP	ENST00000340652.4	0	1	hg19	c.665G>A	CCDS5508.1	1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.334557	0.81801	.	.	ENSG00000188730	ENST00000340652	T	0.72615	-0.67	4.84	3.95	0.45737	4.84	3.95	0.45737	von Willebrand factor, type C (3);	0.062437	0.64402	D	0.000006	T	0.78641	0.4315	M	0.66939	2.045	0.53005	D	0.999969	P	0.47962	0.903	P	0.57502	0.822	T	0.80425	-0.1388	10	0.59425	D	0.04	.	12.8246	0.57712	0.0796:0.0:0.9204:0.0	.	222	Q2TAL6	VWC2_HUMAN	D	222	ENSP00000341819:G222D	ENSP00000341819:G222D	G	+	2	0	0	VWC2	49786242	49786242	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.650000	0.74368	2.383000	0.81215	0.561000	0.74099	GGC	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.617	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	1	0	1	2	2	2	2	0	0	0	0	8	8	8	8	1	1.860000	-16.875490	1	0.570000	NM_198570		0	7	7	0	19	19	0		1			0	0	8	0	0	0.985917	0	0	0	0	0	0	7	19
WBSCR17	64409	broad.mit.edu	37	7	70853388	70853388	+	Splice_Site	SNP	G	G	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr7:70853388G>T	ENST00000333538.5	+	3	1223		c.e3+1		WBSCR17_ENST00000498380.2_Splice_Site	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17						protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGCGACGAAGGTACAGGGGTG	0.582																																						ENST00000333538.5	0.180000	2.000000e-02	0.130000	5.000000e-02	0.080000	0.094784	0.080000	0.080000																										0				100						c.e3+1		Williams-Beuren syndrome chromosome region 17							104.0	75.0	85.0					7																	70853388		2203	4300	6503	SO:0001630	splice_region_variant	64409	0	0					g.chr7:70853388G>T	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.589+1G>T	chr7.hg19:g.70853388G>T		0					WBSCR17_ENST00000498380.2_Splice_Site		NM_022479.1	NP_071924.1	1	2	3	2.090908	Q6IS24	GLTL3_HUMAN		3	1223	+		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)	Q8NFV9|Q9NTA8	Splice_Site	SNP	ENST00000333538.5	0	1	hg19		CCDS5540.1	0	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379837	0.42207	.	.	ENSG00000185274	ENST00000333538;ENST00000447516	.	.	.	5.58	5.58	0.84498	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9334	0.92576	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	WBSCR17	70491324	70491324	1.000000	0.71417	1.000000	0.80357	0.044000	0.14063	9.588000	0.98232	2.782000	0.95742	0.655000	0.94253	.	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.582	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	0	0	0	2	2	2	2	0	0	0	0	43	43	43	42	1	1.860000	-6.570489	1	0.570000	NM_022479	Intron	0	5	1	0	215	213	0		0			0	0	43	0	0	0.933621	0	0	0	0	0	0	5	215
SEMA3D	223117	broad.mit.edu	37	7	84642125	84642125	+	Missense_Mutation	SNP	T	T	C			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr7:84642125T>C	ENST00000284136.6	-	15	1784	c.1741A>G	c.(1741-1743)Atc>Gtc	p.I581V	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	581	PSI.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CACTGGGTGATTGGGTCGCCA	0.393																																					Ovarian(63;442 1191 17318 29975 31528)	ENST00000284136.6	0.160000	3.000000e-02	0.120000	5.000000e-02	0.080000	0.088598	0.080000	0.080000																										0				73						c.(1741-1743)Atc>Gtc		sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D							131.0	120.0	124.0					7																	84642125		2203	4300	6503	SO:0001583	missense	223117	0	0					g.chr7:84642125T>C	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1741A>G	chr7.hg19:g.84642125T>C	ENSP00000284136:p.Ile581Val	0					SEMA3D_ENST00000484038.1_5'UTR	p.I581V	NM_152754.2	NP_689967.2	1	2	3	2.090908	O95025	SEM3D_HUMAN		15	1784	-			A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	0	1	hg19	c.1741A>G	CCDS34676.1	0	.	.	.	.	.	.	.	.	.	.	T	4.555	0.102996	0.08731	.	.	ENSG00000153993	ENST00000284136	T	0.20881	2.04	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.228496	0.49305	D	0.000147	T	0.08935	0.0221	N	0.10733	0.035	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32824	-0.9892	10	0.15499	T	0.54	.	5.1256	0.14882	0.0:0.1083:0.1805:0.7112	.	581	O95025	SEM3D_HUMAN	V	581	ENSP00000284136:I581V	ENSP00000284136:I581V	I	-	1	0	0	SEMA3D	84480061	84480061	0.744000	0.28250	0.998000	0.56505	0.601000	0.36947	1.112000	0.31172	2.265000	0.75225	0.533000	0.62120	ATC	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.393	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	0	0	1	2	2	2	2	0	0	0	0	62	62	62	60	1	1.860000	-7.850361	1	0.570000	NM_152754		0	7	7	0	308	303	0		1			0	0	62	0	0	0.979783	0	0	0	0	0	0	7	308
CNTNAP2	26047	broad.mit.edu	37	7	147600759	147600759	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr7:147600759G>A	ENST00000361727.3	+	14	2717	c.2201G>A	c.(2200-2202)cGc>cAc	p.R734H		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	734	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGCATCGAACGCAACTGCACA	0.582										HNSCC(39;0.1)																												ENST00000361727.3	0.280000	3.000000e-02	0.200000	7.000000e-02	0.120000	0.141018	0.120000	0.120000																										0				188						c.(2200-2202)cGc>cAc		contactin associated protein-like 2							77.0	63.0	68.0					7																	147600759		2203	4300	6503	SO:0001583	missense	26047	0	0					g.chr7:147600759G>A	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2201G>A	chr7.hg19:g.147600759G>A	ENSP00000354778:p.Arg734His	0	HNSCC(39;0.1)					p.R734H	NM_014141.5	NP_054860.1	1	2	3	2.091234	Q9UHC6	CNTP2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0319)	14	2717	+	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	0	1	hg19	c.2201G>A	CCDS5889.1	0	.	.	.	.	.	.	.	.	.	.	G	16.43	3.119856	0.56613	.	.	ENSG00000174469	ENST00000361727;ENST00000455301	T;T	0.09723	2.95;2.95	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.066576	0.64402	D	0.000013	T	0.12092	0.0294	L	0.38838	1.175	0.80722	D	1	B	0.17268	0.021	B	0.11329	0.006	T	0.05683	-1.0870	10	0.41790	T	0.15	.	18.4119	0.90554	0.0:0.0:1.0:0.0	.	734	Q9UHC6	CNTP2_HUMAN	H	734;125	ENSP00000354778:R734H;ENSP00000392208:R125H	ENSP00000354778:R734H	R	+	2	0	0	CNTNAP2	147231692	147231692	0.993000	0.37304	0.913000	0.36048	0.923000	0.55619	4.880000	0.63107	2.700000	0.92200	0.563000	0.77884	CGC	0.571222		TCGA-US-A779-01A-11D-A32N-08	0.582	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1	0	0	1	2	2	2	2	0	0	0	0	29	29	29	29	1	1.860000	-6.706039	1	0.570000			0	4	4	0	118	117	0		1			0	0	29	0	0	0.889673	0	0	0	0	0	0	4	118
CSMD3	114788	broad.mit.edu	37	8	113697844	113697844	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr8:113697844C>T	ENST00000297405.5	-	15	2517	c.2273G>A	c.(2272-2274)cGg>cAg	p.R758Q	CSMD3_ENST00000455883.2_Missense_Mutation_p.R654Q|CSMD3_ENST00000343508.3_Missense_Mutation_p.R718Q|CSMD3_ENST00000352409.3_Missense_Mutation_p.R758Q	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	758	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R758Q(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAGATGTATCCGGCTCCCTGG	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												ENST00000297405.5	0.750000	5.000000e-01	0.690000	5.500000e-01	0.620000	0.629503	0.620000	0.620000																										1	Substitution - Missense(1)	p.R758Q(1)	ovary(1)	646						c.(2272-2274)cGg>cAg		CUB and Sushi multiple domains 3							99.0	107.0	104.0					8																	113697844		2203	4299	6502	SO:0001583	missense	114788	0	0					g.chr8:113697844C>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2273G>A	chr8.hg19:g.113697844C>T	ENSP00000297405:p.Arg758Gln	0	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_ENST00000352409.3_Missense_Mutation_p.R758Q|CSMD3_ENST00000455883.2_Missense_Mutation_p.R654Q|CSMD3_ENST00000343508.3_Missense_Mutation_p.R718Q	p.R758Q	NM_198123.1	NP_937756.1	0	0	0	2.085231	Q7Z407	CSMD3_HUMAN		15	2517	-			Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	1	1	hg19	c.2273G>A	CCDS6315.1	0	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606831	0.87157	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27	5.96	5.96	0.96718	5.96	5.96	0.96718	CUB (5);	0.000000	0.64402	D	0.000002	T	0.40297	0.1111	L	0.56199	1.76	0.43145	D	0.994906	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.994;0.998;0.999	T	0.00970	-1.1496	10	0.34782	T	0.22	.	20.4008	0.98991	0.0:1.0:0.0:0.0	.	654;758;718	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Q	718;758;98;654;758	ENSP00000345799:R718Q;ENSP00000297405:R758Q;ENSP00000341558:R98Q;ENSP00000412263:R654Q;ENSP00000343124:R758Q	ENSP00000297405:R758Q	R	-	2	0	0	CSMD3	113767020	113767020	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	CGG	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.413	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	1	0	1	2	17	2	2	1	1	1	1	90	90	90	89	1	1.860000	-2.553247	1	0.570000	NM_052900		0	77	76	0	355	353	1		1			1	0	90	0	0	1.000000	0	0	0	0	0	0	77	355
RAD21	5885	broad.mit.edu	37	8	117869572	117869572	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr8:117869572G>A	ENST00000297338.2	-	6	909	c.622C>T	c.(622-624)Cat>Tat	p.H208Y	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	208					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TATTCTAAATGGTTAATTTTC	0.358																																						ENST00000297338.2	1.000000	6.400000e-01	0.920000	7.200000e-01	0.810000	0.824074	0.810000	0.820000																										0				32						c.(622-624)Cat>Tat		RAD21 homolog (S. pombe)							147.0	150.0	149.0					8																	117869572		2203	4300	6503	SO:0001583	missense	5885	0	0					g.chr8:117869572G>A	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.622C>T	chr8.hg19:g.117869572G>A	ENSP00000297338:p.His208Tyr	0					RAD21_ENST00000523547.1_5'UTR	p.H208Y	NM_006265.2	NP_006256.1	0	0	0	2.085231	O60216	RAD21_HUMAN		6	909	-	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)		A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	1	1	hg19	c.622C>T	CCDS6321.1	0	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458476	0.63401	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485	T;T;T	0.53857	0.6;1.51;1.51	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	M	0.62723	1.935	0.80722	D	1	D	0.54207	0.965	P	0.47827	0.558	T	0.63225	-0.6685	10	0.52906	T	0.07	-17.6597	19.717	0.96124	0.0:0.0:1.0:0.0	.	208	O60216	RAD21_HUMAN	Y	208	ENSP00000297338:H208Y;ENSP00000429342:H208Y;ENSP00000427923:H208Y	ENSP00000297338:H208Y	H	-	1	0	0	RAD21	117938753	117938753	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.161000	0.94739	2.734000	0.93682	0.563000	0.77884	CAT	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.358	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	1.860000	-4.384192	1	0.570000	NM_006265		0	58	57	0	190	189	1		1	1		0	0	49	0	0	1.000000	9.962710e-01	0	12	0	19	0	58	190
BMP1	649	broad.mit.edu	37	8	22064900	22064900	+	Missense_Mutation	SNP	C	C	T	rs150161793		TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr8:22064900C>T	ENST00000306385.5	+	18	3116	c.2446C>T	c.(2446-2448)Ccc>Tcc	p.P816S	BMP1_ENST00000354870.5_3'UTR	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	816	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CGCCAAGGCCCCCGTCCTCGG	0.627																																						ENST00000306385.5	0.850000	6.200000e-01	0.800000	6.700000e-01	0.730000	0.742986	0.730000	0.740000																										0				30						c.(2446-2448)Ccc>Tcc		bone morphogenetic protein 1							73.0	80.0	78.0					8																	22064900		2203	4300	6503	SO:0001583	missense	649	21	121410	47				g.chr8:22064900C>T		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.2446C>T	chr8.hg19:g.22064900C>T	ENSP00000305714:p.Pro816Ser	0					BMP1_ENST00000354870.5_3'UTR	p.P816S	NM_006129.4	NP_006120.1	0	0	0	2.085231	P13497	BMP1_HUMAN		18	3116	+			A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	1	1	hg19	c.2446C>T	CCDS6026.1	0	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927502	0.73327	.	.	ENSG00000168487	ENST00000306385	T	0.30182	1.54	5.26	4.38	0.52667	5.26	4.38	0.52667	CUB (5);	0.412825	0.17745	U	0.163437	T	0.34193	0.0889	L	0.48986	1.54	0.80722	D	1	B	0.23540	0.087	B	0.33690	0.168	T	0.08166	-1.0735	10	0.33141	T	0.24	.	14.7938	0.69863	0.0:0.8544:0.1456:0.0	.	816	P13497	BMP1_HUMAN	S	816	ENSP00000305714:P816S	ENSP00000305714:P816S	P	+	1	0	0	BMP1	22120845	22120845	0.989000	0.36119	0.182000	0.23118	0.911000	0.54048	4.070000	0.57548	1.204000	0.43247	0.561000	0.74099	CCC	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.627	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	1	0	1	2	2	2	2	0	0	0	0	141	141	141	141	1	1.860000	-3.940958	1	0.570000	NM_006132		0	126	125	0	471	467	1		1	1		0	0	141	0	0	1.000000	9.955004e-01	0	8	0	25	0	126	471
ZFAT	57623	broad.mit.edu	37	8	135614834	135614834	+	Silent	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chr8:135614834C>T	ENST00000377838.3	-	6	1302	c.1128G>A	c.(1126-1128)gcG>gcA	p.A376A	ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000520727.1_Silent_p.A364A|ZFAT_ENST00000523399.1_Silent_p.A314A|ZFAT_ENST00000520356.1_Silent_p.A364A|ZFAT_ENST00000429442.2_Silent_p.A364A|ZFAT_ENST00000520214.1_Silent_p.A364A	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	376					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GTGGGTCATGCGCGTCTCGGA	0.552																																						ENST00000377838.3	1.000000	1.000000e-02	1.000000	3.000000e-02	0.070000	0.243510	0.070000	0.070000																										0				54						c.(1126-1128)gcG>gcA		zinc finger and AT hook domain containing							74.0	75.0	74.0					8																	135614834		2114	4240	6354	SO:0001819	synonymous_variant	57623	2	121082	34				g.chr8:135614834C>T	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1128G>A	chr8.hg19:g.135614834C>T		1					ZFAT_ENST00000520214.1_Silent_p.A364A|ZFAT_ENST00000429442.2_Silent_p.A364A|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000523399.1_Silent_p.A314A|ZFAT_ENST00000520356.1_Silent_p.A364A|ZFAT_ENST00000520727.1_Silent_p.A364A	p.A376A	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	1	4	5	3.369021	Q9P243	ZFAT_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0432)	6	1302	-	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Silent	SNP	ENST00000377838.3	0	1	hg19	c.1128G>A	CCDS47924.1	0																																																																																								0.735246		TCGA-US-A779-01A-11D-A32N-08	0.552	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	0	0	1	2	24	2	2	1	1	1	1	84	84	84	84	1	1.860000	-2.068181	0	0.570000	NM_001029939		0	7	7	0	651	647	0		0	0		1	0	84	0	0	0.001391	1.601149e-03	0	0	0	5	0	7	651
SCML1	6322	broad.mit.edu	37	X	17770059	17770059	+	Silent	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chrX:17770059C>T	ENST00000380041.3	+	7	1156	c.828C>T	c.(826-828)tgC>tgT	p.C276C	SCML1_ENST00000380043.3_Silent_p.C249C|SCML1_ENST00000380045.3_Silent_p.C155C|SCML1_ENST00000398080.1_Silent_p.C155C	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	276	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					TTGCATTATGCCCTCTTGTCG	0.448																																						ENST00000380041.3	0.040000	0	0.030000	0	0.010000	0.020859	0.010000	0.020000																										0				10						c.(826-828)tgC>tgT		sex comb on midleg-like 1 (Drosophila)							377.0	317.0	337.0					X																	17770059		2203	4300	6503	SO:0001819	synonymous_variant	6322	0	0					g.chrX:17770059C>T		CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.828C>T	chrX.hg19:g.17770059C>T							SCML1_ENST00000380043.3_Silent_p.C249C|SCML1_ENST00000398080.1_Silent_p.C155C|SCML1_ENST00000380045.3_Silent_p.C155C	p.C276C	NM_001037540.1	NP_001032629.1	0	1	1		Q9UN30	SCML1_HUMAN		7	1156	+	Hepatocellular(33;0.183)		B0FZN6|B2RA08|Q5H968|Q5H969	Silent	SNP	ENST00000380041.3	0	1	hg19	c.828C>T	CCDS35210.1	0																																																																																								0.570000		TCGA-US-A779-01A-11D-A32N-08	0.448	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	0	0	1	2	2	2	2	0	0	0	0	294	294	294	289	1	1.860000	-1.744626	0	0.570000	NM_006746		0	7	7	0	1381	1362	0		1	0		0	0	294	0	0	0.979585	7.634997e-04	0	0	0	7	0	7	1381
BEND2	139105	broad.mit.edu	37	X	18183254	18183254	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chrX:18183254G>A	ENST00000380033.4	-	14	2407	c.2275C>T	c.(2275-2277)Cgt>Tgt	p.R759C		NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	759	BEN 2. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						CTAAGGCTACGGATACCGCTG	0.517																																						ENST00000380033.4	0.890000	7.000000e-01	0.850000	7.400000e-01	0.790000	0.798826	0.790000	0.800000																										0				49						c.(2275-2277)Cgt>Tgt		BEN domain containing 2							197.0	173.0	181.0					X																	18183254		2203	4300	6503	SO:0001583	missense	139105	0	0					g.chrX:18183254G>A	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2275C>T	chrX.hg19:g.18183254G>A	ENSP00000369372:p.Arg759Cys							p.R759C	NM_153346.4	NP_699177.2	0	1	1		Q8NDZ0	BEND2_HUMAN		14	2407	-			E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	1	1	hg19	c.2275C>T	CCDS14184.1	0	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879159	0.51801	.	.	ENSG00000177324	ENST00000380033	T	0.52295	0.67	5.69	1.73	0.24493	5.69	1.73	0.24493	BEN domain (2);	0.351432	0.26065	N	0.026542	T	0.34774	0.0909	L	0.52759	1.655	0.09310	N	1	D	0.53151	0.958	B	0.39027	0.288	T	0.32719	-0.9896	10	0.87932	D	0	-1.0766	5.6482	0.17602	0.2622:0.138:0.5998:0.0	.	759	Q8NDZ0	BEND2_HUMAN	C	759	ENSP00000369372:R759C	ENSP00000369372:R759C	R	-	1	0	0	BEND2	18093175	18093175	0.107000	0.21998	0.000000	0.03702	0.028000	0.11728	0.794000	0.26958	-0.077000	0.12752	-0.268000	0.10319	CGT	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.517	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	1	0	1	2	15	2	2	0	0	0	1	227	227	227	227	1	1.860000	-4.407056	1	0.570000	NM_153346		0	215	215	0	731	722	1		1			0	0	227	0	0	1.000000	0	0	0	0	0	0	215	731
USP51	158880	broad.mit.edu	37	X	55515068	55515068	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chrX:55515068C>T	ENST00000500968.3	-	2	387	c.305G>A	c.(304-306)cGc>cAc	p.R102H	USP51_ENST00000586165.1_Intron	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	102	Pro-rich.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						gcggggCTTGCGGCGCGGGCA	0.761																																						ENST00000500968.3	0.400000	6.000000e-02	0.300000	1.100000e-01	0.190000	0.211941	0.190000	0.180000																										0				30						c.(304-306)cGc>cAc		ubiquitin specific peptidase 51							6.0	7.0	7.0					X																	55515068		2137	4143	6280	SO:0001583	missense	158880	0	0					g.chrX:55515068C>T	BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.305G>A	chrX.hg19:g.55515068C>T	ENSP00000423333:p.Arg102His						USP51_ENST00000586165.1_Intron	p.R102H	NM_201286.3	NP_958443.1	0	1	1		Q70EK9	UBP51_HUMAN		2	387	-			Q8IWJ8	Missense_Mutation	SNP	ENST00000500968.3	0	1	hg19	c.305G>A	CCDS14370.1	0	.	.	.	.	.	.	.	.	.	.	.	10.19	1.283264	0.23392	.	.	ENSG00000247746	ENST00000500968	T	0.10192	2.9	2.65	1.75	0.24633	2.65	1.75	0.24633	.	0.980712	0.08228	U	0.978061	T	0.10252	0.0251	N	0.24115	0.695	0.26858	N	0.968015	P	0.52170	0.951	P	0.47044	0.535	T	0.29912	-0.9996	10	0.87932	D	0	.	6.2296	0.20728	0.2943:0.7057:0.0:0.0	.	102	Q70EK9	UBP51_HUMAN	H	102	ENSP00000423333:R102H	ENSP00000423333:R102H	R	-	2	0	0	USP51	55531793	55531793	0.994000	0.37717	0.972000	0.41901	0.020000	0.10135	0.821000	0.27338	0.514000	0.28300	0.502000	0.49764	CGC	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.761	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056871.2	0	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	1.860000	-7.929337	1	0.570000	NM_201286		0	4	4	0	76	76	0		1	0		0	0	16	0	0	0.892146	0	0	0	0	1	0	4	76
TAF1	6872	broad.mit.edu	37	X	70603864	70603864	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chrX:70603864G>A	ENST00000373790.4	+	13	2048	c.1997G>A	c.(1996-1998)cGc>cAc	p.R666H	TAF1_ENST00000449580.1_Missense_Mutation_p.R666H|TAF1_ENST00000423759.1_Missense_Mutation_p.R687H|TAF1_ENST00000276072.3_Missense_Mutation_p.R687H	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	666	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TTTTTTATGCGCACACCTCAG	0.453																																						ENST00000373790.4	0.070000	0	0.050000	1.000000e-02	0.030000	0.036685	0.030000	0.040000																										0				124						c.(1996-1998)cGc>cAc		TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa							220.0	177.0	192.0					X																	70603864		2203	4300	6503	SO:0001583	missense	6872	0	0					g.chrX:70603864G>A		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1997G>A	chrX.hg19:g.70603864G>A	ENSP00000362895:p.Arg666His						TAF1_ENST00000276072.3_Missense_Mutation_p.R687H|TAF1_ENST00000423759.1_Missense_Mutation_p.R687H|TAF1_ENST00000449580.1_Missense_Mutation_p.R666H	p.R666H	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	0	1	1		P21675	TAF1_HUMAN		13	2048	+	Renal(35;0.156)	all_lung(315;0.000321)	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	0	1	hg19	c.1997G>A	CCDS35325.1	0	.	.	.	.	.	.	.	.	.	.	.	32	5.171413	0.94807	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.10960	2.82;2.89;2.87;2.82	5.88	5.88	0.94601	5.88	5.88	0.94601	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.35799	0.0944	M	0.72624	2.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.04140	-1.0974	10	0.87932	D	0	.	19.1532	0.93499	0.0:0.0:1.0:0.0	.	666;687	P21675;P21675-2	TAF1_HUMAN;.	H	666;666;687;687	ENSP00000362895:R666H;ENSP00000389000:R666H;ENSP00000406549:R687H;ENSP00000276072:R687H	ENSP00000276072:R687H	R	+	2	0	0	TAF1	70520589	70520589	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.230000	0.95299	2.474000	0.83562	0.600000	0.82982	CGC	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.453	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	0	0	1	2	2	2	2	0	0	0	0	124	124	124	123	1	1.860000	-2.624227	1	0.570000	NM_004606		0	5	5	0	557	550	0		1	0		0	0	124	0	0	0.935720	1.897229e-03	0	0	0	6	0	5	557
ALG13	79868	broad.mit.edu	37	X	110980099	110980099	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A779-01A-11D-A32N-08	TCGA-US-A779-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a8a9f4d-daba-4f47-a0c9-65f13d90e4ce	1b04dc15-eff1-4be8-a22d-75f22e9b0cb8	g.chrX:110980099G>A	ENST00000394780.3	+	23	2699	c.2687G>A	c.(2686-2688)gGc>gAc	p.G896D	ALG13_ENST00000470971.1_3'UTR|ALG13_ENST00000251943.4_Missense_Mutation_p.G792D	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	896	Pro-rich.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						CCTACACACGGCAGGCCAGGT	0.433																																						ENST00000394780.3	0.060000	0	0.040000	0	0.020000	0.028478	0.020000	0.020000																										0				13						c.(2686-2688)gGc>gAc		ALG13, UDP-N-acetylglucosaminyltransferase subunit							200.0	173.0	181.0					X																	110980099		1568	3582	5150	SO:0001583	missense	79868	0	0					g.chrX:110980099G>A	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.2687G>A	chrX.hg19:g.110980099G>A	ENSP00000378260:p.Gly896Asp						ALG13_ENST00000251943.4_Missense_Mutation_p.G792D|ALG13_ENST00000470971.1_3'UTR	p.G896D	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	0	1	1		Q9NP73	ALG13_HUMAN		23	2699	+			B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	ENST00000394780.3	0	1	hg19	c.2687G>A	CCDS55477.1	0	.	.	.	.	.	.	.	.	.	.	G	12.12	1.841823	0.32513	.	.	ENSG00000101901	ENST00000251943;ENST00000394780;ENST00000436609	T;T	0.33865	1.39;3.01	5.49	2.7	0.31948	5.49	2.7	0.31948	.	0.548871	0.20332	N	0.094419	T	0.48150	0.1484	L	0.58101	1.795	0.09310	N	1	B;B;D	0.67145	0.082;0.049;0.996	B;B;P	0.62184	0.04;0.018;0.899	T	0.33085	-0.9882	10	0.28530	T	0.3	1.5933	10.6013	0.45369	0.2322:0.0:0.7678:0.0	.	818;896;792	Q9NP73-3;Q9NP73;Q9NP73-4	.;ALG13_HUMAN;.	D	792;896;529	ENSP00000251943:G792D;ENSP00000378260:G896D	ENSP00000251943:G792D	G	+	2	0	0	ALG13	110866755	110866755	0.055000	0.20627	0.049000	0.19019	0.885000	0.51271	0.494000	0.22467	0.596000	0.29794	0.600000	0.82982	GGC	0.570000		TCGA-US-A779-01A-11D-A32N-08	0.433	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	0	0	1	2	2	2	2	0	0	0	0	140	140	140	138	1	1.860000	-2.148112	0	0.570000	NM_018466		0	6	7	0	820	811	0		1	0		0	0	140	0	0	0.963970	4.195645e-03	0	0	0	11	0	6	820
