#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
KCNQ2	3785	broad.mit.edu	37	20	62078155	62078158	+	Frame_Shift_Del	DEL	ACAG	ACAG	-			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr20:62078155_62078158delACAG	ENST00000359125.2	-	2	503_506	c.329_332delCTGT	c.(328-333)tctgtgfs	p.SV110fs	KCNQ2_ENST00000360480.3_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000344425.5_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000370224.1_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000344462.4_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000357249.2_Frame_Shift_Del_p.SV110fs|RP11-358D14.2_ENST00000436263.1_RNA|KCNQ2_ENST00000359689.1_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000354587.3_Frame_Shift_Del_p.SV110fs	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	110					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GGTGGAAAACACAGACAGCACGAG	0.632																																						ENST00000359125.2	0.680000	4.200000e-01	0.600000	0.470000	0.530000	0.543852	0.530000	0.540000																										0				65						c.(328-333)tctgtgfs		potassium voltage-gated channel, KQT-like subfamily, member 2	Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)																																			SO:0001589	frameshift_variant	3785	0	0					g.chr20:62078155_62078158delACAG	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.329_332delCTGT	chr20.hg19:g.62078159_62078162delACAG	ENSP00000352035:p.Ser110fs	1					KCNQ2_ENST00000370224.1_Frame_Shift_Del_p.SV110fs|RP11-358D14.2_ENST00000436263.1_RNA|KCNQ2_ENST00000357249.2_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000360480.3_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000344425.5_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000354587.3_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000344462.4_Frame_Shift_Del_p.SV110fs|KCNQ2_ENST00000359689.1_Frame_Shift_Del_p.SV110fs	p.SV110fs	NM_172107.2	NP_742105.1	1	2	3	2.336157	O43526	KCNQ2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.04e-05)	2	503_506	-	all_cancers(38;1.24e-11)		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Frame_Shift_Del	DEL	ENST00000359125.2	1	0	hg19	c.329_332delCTGT	CCDS13520.1	0																																																																																								0.487868		TCGA-US-A77E-01A-11D-A32N-08	0.632	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	1	0	0		91	2		0	0	0	16	194	0	194	205	1	2.070000	-18.895520	1	0.390000	NM_172109		0	76	124	0	793	817	0	0	1	0	0	0	0	194	0	0	0.272572	1.063594e-12	0	0	0	1	0	76	793
BRAF	673	broad.mit.edu	37	7	140477831	140477845	+	In_Frame_Del	DEL	GAGGTGTAGGTGCTG	GAGGTGTAGGTGCTG	-	rs375520366		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr7:140477831_140477845delGAGGTGTAGGTGCTG	ENST00000288602.6	-	12	1523_1537	c.1463_1477delCAGCACCTACACCTC	c.(1462-1479)acagcacctacacctcag>aag	p.488_493TAPTPQ>K		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	488	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L485_P490>Y(2)|p.N486_P490del(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TGTAACTGCTGAGGTGTAGGTGCTGTCACATTCAA	0.353		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	ENST00000288602.6	0.720000	3.500000e-01	0.630000	0.430000	0.520000	0.533661	0.520000	0.510000		61		Dom	yes			Dom	yes		7	7q34	7q34	673	Mis, T, O	v-raf murine sarcoma viral oncogene homolog B1	yes	yes	Cardio-facio-cutaneous syndrome	E	E	AKAP9, KIAA1549		melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	3	Complex - deletion inframe(2)|Deletion - In frame(1)	p.L485_P490>Y(2)|p.N486_P490del(1)	lung(2)|ovary(1)	27380						c.(1462-1479)acagcacctacacctcag>aag		B-Raf proto-oncogene, serine/threonine kinase	Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)																																			SO:0001651	inframe_deletion	673	0	0		Cardiofaciocutaneous syndrome	Familial Cancer Database	CFC, CFCS	g.chr7:140477831_140477845delGAGGTGTAGGTGCTG	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1463_1477delCAGCACCTACACCTC	chr7.hg19:g.140477831_140477845delGAGGTGTAGGTGCTG	ENSP00000288602:p.Thr488_Gln493delinsLys	1						p.488_493TAPTPQ>K	NM_004333.4	NP_004324.2	1	2	3	2.349308	P15056	BRAF_HUMAN		12	1523_1537	-	Melanoma(164;0.00956)		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	In_Frame_Del	DEL	ENST00000288602.6	0	1	hg19	c.1463_1477delCAGCACCTACACCTC	CCDS5863.1	0																																																																																								0.489540		TCGA-US-A77E-01A-11D-A32N-08	0.353	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	1	0	1		2	2		0	0	0	0	51	0	51	51	1	2.070000	-2.841673	1	0.390000	NM_004333		0	26	34	0	281	283	0	0	1	0	0	0	0	51	0	0	1.000000	2.167422e-01	0	0	0	10	0	26	281
NEBL	10529	broad.mit.edu	37	10	21074742	21074742	+	Silent	SNP	G	G	A	rs139156783		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr10:21074742G>A	ENST00000377122.4	-	28	3375	c.2979C>T	c.(2977-2979)taC>taT	p.Y993Y	NEBL_ENST00000377159.4_Silent_p.Y215Y|NEBL_ENST00000417816.2_Silent_p.Y249Y	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	993	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GCACTGTGCCGTACATCCAGC	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19355	0.0		0.0	False		,,,				2504	0.0					ENST00000377122.4	0.190000	2.000000e-02	0.140000	0.050000	0.080000	0.100113	0.080000	0.080000																										0				70						c.(2977-2979)taC>taT		nebulette							120.0	99.0	106.0					10																	21074742		2203	4300	6503	SO:0001819	synonymous_variant	10529	2	121412	41				g.chr10:21074742G>A	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2979C>T	chr10.hg19:g.21074742G>A		0					NEBL_ENST00000417816.2_Silent_p.Y249Y|NEBL_ENST00000377159.4_Silent_p.Y215Y	p.Y993Y	NM_006393.2	NP_006384.1	0	1	1	1.968530	O76041	NEBL_HUMAN		28	3375	-			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	0	1	hg19	c.2979C>T	CCDS7134.1	0																																																																																								0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.468	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	0	0	1		2	2	2	0	0	0	0	48	0	48	47	1	2.070000	-3.223479	1	0.390000	NM_006393		0	4	4	0	248	244	0	0	1	0		0	0	48	0	0	0.887304	1.181304e-01	0	0	0	29	0	4	248
MYO3A	53904	broad.mit.edu	37	10	26457784	26457784	+	Silent	SNP	C	C	T	rs35541310		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr10:26457784C>T	ENST00000265944.5	+	28	3421	c.3255C>T	c.(3253-3255)agC>agT	p.S1085S	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1085	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GGAAAGAAAGCGCTATAATAA	0.328													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17750	0.0		0.0	False		,,,				2504	0.0					ENST00000265944.5	1.000000	5.700000e-01	0.920000	0.680000	0.790000	0.803464	0.790000	1.000000																										0				146						c.(3253-3255)agC>agT		myosin IIIA		C		6,4400	11.4+/-27.6	0,6,2197	119.0	123.0	122.0		3255	-4.8	0.5	10	dbSNP_126	122	0,8600		0,0,4300	no	coding-synonymous	MYO3A	NM_017433.4		0,6,6497	TT,TC,CC		0.0,0.1362,0.0461		1085/1617	26457784	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	53904	16	121410	45				g.chr10:26457784C>T	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3255C>T	chr10.hg19:g.26457784C>T		0					MYO3A_ENST00000543632.1_Intron	p.S1085S	NM_017433.4	NP_059129.3	0	1	1	1.968530	Q8NEV4	MYO3A_HUMAN		28	3421	+			Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	ENST00000265944.5	1	1	hg19	c.3255C>T	CCDS7148.1	0																																																																																								0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.328	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	1	0	1		2	2	2	0	0	0	0	41	0	41	41	1	2.070000	-20.000000	1	0.390000	NM_017433		0	36	36	0	195	192	1	0	1	0		0	0	41	0	0	1.000000	0	0	0	0	1	0	36	195
APOA4	337	broad.mit.edu	37	11	116691783	116691783	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:116691783G>A	ENST00000357780.3	-	3	1105	c.991C>T	c.(991-993)Ccc>Tcc	p.P331S		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	331					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CCCGCATGGGGGCCCAGTTTC	0.592																																						ENST00000357780.3	1.000000	8.400000e-01	1.000000	0.930000	0.990000	0.976487	0.990000	1.000000																										0				20						c.(991-993)Ccc>Tcc		apolipoprotein A-IV							68.0	66.0	67.0					11																	116691783		2201	4292	6493	SO:0001583	missense	337	0	0					g.chr11:116691783G>A		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.991C>T	chr11.hg19:g.116691783G>A	ENSP00000350425:p.Pro331Ser	0						p.P331S	NM_000482.3	NP_000473.2	1	2	3	1.982548	P06727	APOA4_HUMAN		3	1105	-	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)	A8MSL6|Q14CW8|Q6Q787	Missense_Mutation	SNP	ENST00000357780.3	1	1	hg19	c.991C>T	CCDS31681.1	1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340577	0.41498	.	.	ENSG00000110244	ENST00000357780	T	0.76316	-1.01	5.39	4.46	0.54185	5.39	4.46	0.54185	Apolipoprotein/apolipophorin (1);	0.377447	0.26019	N	0.026825	T	0.73016	0.3533	M	0.64676	1.99	0.29390	N	0.862669	P	0.50272	0.933	P	0.45167	0.472	T	0.69394	-0.5157	10	0.29301	T	0.29	-39.6749	7.0255	0.24938	0.142:0.0:0.7148:0.1432	.	331	P06727	APOA4_HUMAN	S	331	ENSP00000350425:P331S	ENSP00000350425:P331S	P	-	1	0	0	APOA4	116196993	116196993	0.241000	0.23857	0.999000	0.59377	0.626000	0.37791	1.085000	0.30840	2.522000	0.85027	0.557000	0.71058	CCC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.592	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106279.2	1	0	1		2	2	2	0	0	0	0	85	0	85	85	1	2.070000	-3.644587	1	0.390000	NM_000482		0	93	93	0	371	369	1	0	1	0		0	0	85	0	0	1.000000	1	0	0	0	269	0	93	371
IFT46	56912	broad.mit.edu	37	11	118416522	118416522	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:118416522A>G	ENST00000264021.3	-	10	1137	c.719T>C	c.(718-720)aTt>aCt	p.I240T	IFT46_ENST00000264020.2_Missense_Mutation_p.I291T|IFT46_ENST00000530872.1_Missense_Mutation_p.I291T|TMEM25_ENST00000442938.2_Intron|TMEM25_ENST00000354284.4_Intron	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	240					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						GATCATGTCAATGTACTCTGC	0.507																																						ENST00000264021.3	0.930000	5.900000e-01	0.850000	0.670000	0.750000	0.761391	0.750000	0.750000																										0				9						c.(718-720)aTt>aCt		intraflagellar transport 46							180.0	148.0	159.0					11																	118416522		2200	4295	6495	SO:0001583	missense	56912	4	121412	37				g.chr11:118416522A>G	AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.719T>C	chr11.hg19:g.118416522A>G	ENSP00000264021:p.Ile240Thr	0					TMEM25_ENST00000442938.2_Intron|IFT46_ENST00000530872.1_Missense_Mutation_p.I291T|IFT46_ENST00000264020.2_Missense_Mutation_p.I291T|TMEM25_ENST00000354284.4_Intron	p.I240T	NM_001168618.1	NP_001162089.1	1	2	3	1.982548	Q9NQC8	IFT46_HUMAN		10	1137	-			A8K0F6|Q9H6V5	Missense_Mutation	SNP	ENST00000264021.3	1	1	hg19	c.719T>C	CCDS53718.1	0	.	.	.	.	.	.	.	.	.	.	A	13.21	2.169425	0.38315	.	.	ENSG00000118096	ENST00000264021;ENST00000264020;ENST00000530872	T;T;T	0.48522	0.82;0.81;0.81	6.03	4.91	0.64330	6.03	4.91	0.64330	.	0.364645	0.29335	N	0.012458	T	0.36936	0.0985	L	0.37561	1.115	0.41527	D	0.988432	B;B;B	0.21071	0.01;0.051;0.008	B;B;B	0.17433	0.012;0.018;0.011	T	0.16394	-1.0404	10	0.45353	T	0.12	-8.0521	9.5551	0.39334	0.8583:0.0:0.1417:0.0	.	291;240;291	E9PR06;Q9NQC8;Q9NQC8-2	.;IFT46_HUMAN;.	T	240;291;291	ENSP00000264021:I240T;ENSP00000264020:I291T;ENSP00000432384:I291T	ENSP00000264020:I291T	I	-	2	0	0	IFT46	117921732	117921732	0.998000	0.40836	0.992000	0.48379	0.823000	0.46562	3.755000	0.55197	1.104000	0.41587	0.533000	0.62120	ATT	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.507	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389627.1	1	0	1		2	2	2	0	0	0	0	78	0	78	77	1	2.070000	-20.000000	1	0.390000	NM_020153		0	68	68	0	394	389	1	0	1	1		0	0	78	0	0	1.000000	9.984372e-01	0	26	0	32	0	68	394
UPK2	7379	broad.mit.edu	37	11	118828843	118828843	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:118828843G>A	ENST00000264031.2	+	5	490	c.455G>A	c.(454-456)cGc>cAc	p.R152H	UPK2_ENST00000534788.1_3'UTR	NM_006760.3	NP_006751.1	O00526	UPK2_HUMAN	uroplakin 2	152					epithelial cell differentiation (GO:0030855)|membrane organization (GO:0061024)|multicellular organismal development (GO:0007275)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)				kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.122)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		GGTATGGCCCGCACAGGGGGC	0.617																																						ENST00000264031.2	0.160000	2.000000e-02	0.110000	0.040000	0.070000	0.081011	0.070000	0.070000																										0				5						c.(454-456)cGc>cAc		uroplakin 2							109.0	106.0	107.0					11																	118828843		2200	4295	6495	SO:0001583	missense	7379	0	0					g.chr11:118828843G>A	Y13645	CCDS8404.1	11q23	2008-07-21				ENSG00000110375			12579	protein-coding gene	gene with protein product	"""uroplakin II"", ""uroplakin-2"""	611558				9515818, 9846985	Standard	NM_006760		Approved	UP2, UPII, MGC138598	uc001puh.3	O00526		ENST00000264031.2:c.455G>A	chr11.hg19:g.118828843G>A	ENSP00000264031:p.Arg152His	0					UPK2_ENST00000534788.1_3'UTR	p.R152H	NM_006760.3	NP_006751.1	1	2	3	1.982548	O00526	UPK2_HUMAN		5	490	+	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.122)|all_neural(223;0.224)	B0YJ92|O00457|Q53YV0	Missense_Mutation	SNP	ENST00000264031.2	0	1	hg19	c.455G>A	CCDS8404.1	0	.	.	.	.	.	.	.	.	.	.	g	17.59	3.427814	0.62733	.	.	ENSG00000110375	ENST00000534788;ENST00000264031	T	0.41400	1.0	5.43	4.51	0.55191	5.43	4.51	0.55191	.	0.151206	0.31134	N	0.008188	T	0.61311	0.2337	M	0.65975	2.015	0.26235	N	0.978957	D	0.89917	1.0	D	0.87578	0.998	T	0.56908	-0.7901	10	0.46703	T	0.11	-3.4525	13.3218	0.60436	0.0836:0.0:0.9164:0.0	.	152	O00526	UPK2_HUMAN	H	18;152	ENSP00000264031:R152H	ENSP00000264031:R152H	R	+	2	0	0	UPK2	118334053	118334053	1.000000	0.71417	0.969000	0.41365	0.873000	0.50193	3.661000	0.54503	0.802000	0.34089	-0.937000	0.02696	CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.617	UPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389311.1	0	0	1		2	2	2	0	0	0	0	84	0	84	83	1	2.070000	-2.126169	0	0.390000	NM_006760		0	5	5	0	372	370	0	0	1			0	0	84	0	0	0.937064	0	0	0	0	0	0	5	372
FIBIN	387758	broad.mit.edu	37	11	27016362	27016362	+	Missense_Mutation	SNP	G	G	A	rs188656817		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:27016362G>A	ENST00000318627.2	+	1	735	c.289G>A	c.(289-291)Gtg>Atg	p.V97M		NM_203371.1	NP_976249.1	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog (zebrafish)	97						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(2)|lung(7)|upper_aerodigestive_tract(1)	11						TGCTGGGCGCGTGCTGGAGGG	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17641	0.0		0.0	False		,,,				2504	0.0					ENST00000318627.2	1.000000	6.700000e-01	1.000000	0.800000	0.940000	0.914454	0.940000	1.000000																										0				11						c.(289-291)Gtg>Atg		fin bud initiation factor homolog (zebrafish)							46.0	37.0	40.0					11																	27016362		2203	4299	6502	SO:0001583	missense	387758	2	121392	29				g.chr11:27016362G>A	BC026873	CCDS7861.1	11p14.2	2008-12-03				ENSG00000176971			33747	protein-coding gene	gene with protein product						17196583	Standard	NM_203371		Approved	MGC24932	uc001mrd.3	Q8TAL6		ENST00000318627.2:c.289G>A	chr11.hg19:g.27016362G>A	ENSP00000321962:p.Val97Met	0						p.V97M	NM_203371.1	NP_976249.1	1	2	3	1.976461	Q8TAL6	FIBIN_HUMAN		1	735	+				Missense_Mutation	SNP	ENST00000318627.2	1	1	hg19	c.289G>A	CCDS7861.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	27.4	4.826858	0.90955	.	.	ENSG00000176971	ENST00000318627	.	.	.	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.68723	0.3032	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70605	-0.4826	9	0.72032	D	0.01	-14.2051	18.3976	0.90504	0.0:0.0:1.0:0.0	.	97	Q8TAL6	FIBIN_HUMAN	M	97	.	ENSP00000321962:V97M	V	+	1	0	0	FIBIN	26972938	26972938	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	9.245000	0.95431	2.706000	0.92434	0.557000	0.71058	GTG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.657	FIBIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387945.1	1	0	1		2	2	2	0	0	0	0	45	0	45	45	1	2.070000	-20.000000	1	0.390000	NM_203371		0	32	32	0	142	142	1	0	1	0		0	0	45	0	0	1.000000	9.859475e-01	0	0	0	33	0	32	142
EXT2	2132	broad.mit.edu	37	11	44129401	44129401	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:44129401C>T	ENST00000343631.3	+	2	268	c.139C>T	c.(139-141)Ccc>Tcc	p.P47S	EXT2_ENST00000358681.4_Missense_Mutation_p.P47S|EXT2_ENST00000395673.3_Missense_Mutation_p.P80S|EXT2_ENST00000533608.1_Missense_Mutation_p.P47S			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	47					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						TCAGTTTTGGCCCCATTCTAT	0.527			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																													ENST00000343631.3	0.140000	1.000000e-02	0.100000	0.030000	0.060000	0.071930	0.060000	0.060000			yes	Rec		Multiple Exostoses Type 2	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	11p12-p11	2132	Mis, N, F, S	multiple exostoses type 2 gene				M	M		exostoses, osteosarcoma			0				32						c.(139-141)Ccc>Tcc		exostosin glycosyltransferase 2							154.0	159.0	157.0					11																	44129401		2203	4300	6503	SO:0001583	missense	2132	0	0		Hereditary Multiple Exostoses	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	g.chr11:44129401C>T		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.139C>T	chr11.hg19:g.44129401C>T	ENSP00000342656:p.Pro47Ser	0					EXT2_ENST00000358681.4_Missense_Mutation_p.P47S|EXT2_ENST00000395673.3_Missense_Mutation_p.P80S|EXT2_ENST00000533608.1_Missense_Mutation_p.P47S	p.P47S			1	2	3	1.976461	Q93063	EXT2_HUMAN		2	268	+			B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	ENST00000343631.3	0	1	hg19	c.139C>T	CCDS7908.1	0	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360982	0.41801	.	.	ENSG00000151348	ENST00000533608;ENST00000532479;ENST00000527014;ENST00000358681;ENST00000395673;ENST00000343631	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.45	4.52	0.55395	5.45	4.52	0.55395	.	0.050514	0.85682	D	0.000000	T	0.56863	0.2014	L	0.29908	0.895	0.80722	D	1	D;D;D;P;B	0.89917	1.0;0.984;0.979;0.956;0.296	D;P;P;P;B	0.83275	0.996;0.786;0.798;0.63;0.027	T	0.57636	-0.7777	10	0.44086	T	0.13	1.5466	15.282	0.73794	0.1413:0.8587:0.0:0.0	.	47;47;47;47;60	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	S	47;47;47;47;80;47	ENSP00000431173:P47S;ENSP00000433827:P47S;ENSP00000434716:P47S;ENSP00000351509:P47S;ENSP00000379032:P80S;ENSP00000342656:P47S	ENSP00000342656:P47S	P	+	1	0	0	EXT2	44085977	44085977	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.380000	0.79704	1.253000	0.44018	0.650000	0.86243	CCC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.527	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390074.1	0	0	1		2	2	2	0	0	0	0	84	0	84	83	1	2.070000	-2.259352	0	0.390000	NM_000401		0	5	5	0	420	416	0	0	1	0		0	0	84	0	0	0.936327	1.999998e-01	0	0	0	58	0	5	420
CKAP5	9793	broad.mit.edu	37	11	46780946	46780946	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:46780946G>A	ENST00000529230.1	-	34	4487	c.4441C>T	c.(4441-4443)Cgc>Tgc	p.R1481C	SNORD67_ENST00000516618.1_RNA|SNORD67_ENST00000390833.1_RNA|CKAP5_ENST00000415402.1_Missense_Mutation_p.R1481C|CKAP5_ENST00000312055.5_Missense_Mutation_p.R1481C|CKAP5_ENST00000354558.3_Missense_Mutation_p.R1481C			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1481					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AATTCTCGGCGGACCATCTGG	0.483																																					Ovarian(4;85 273 2202 4844 13323)	ENST00000529230.1	0.170000	2.000000e-02	0.120000	0.040000	0.070000	0.085034	0.070000	0.070000																										0				43						c.(4441-4443)Cgc>Tgc		cytoskeleton associated protein 5							107.0	101.0	103.0					11																	46780946		2201	4299	6500	SO:0001583	missense	9793	1	121412	33				g.chr11:46780946G>A		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.4441C>T	chr11.hg19:g.46780946G>A	ENSP00000432768:p.Arg1481Cys	0					SNORD67_ENST00000516618.1_RNA|CKAP5_ENST00000312055.5_Missense_Mutation_p.R1481C|CKAP5_ENST00000415402.1_Missense_Mutation_p.R1481C|SNORD67_ENST00000390833.1_RNA|CKAP5_ENST00000354558.3_Missense_Mutation_p.R1481C	p.R1481C			1	2	3	1.976461	Q14008	CKAP5_HUMAN		34	4487	-			Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	0	1	hg19	c.4441C>T	CCDS31477.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.81|19.81	3.896803|3.896803	0.72639|0.72639	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000527333|ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558;ENST00000526876	.|T;T;T;T	.|0.48201	.|0.84;0.85;0.82;0.82	5.53|5.53	5.53|5.53	0.82687|0.82687	5.53|5.53	5.53|5.53	0.82687|0.82687	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.094061	.|0.85682	.|D	.|0.000000	T|T	0.34745|0.34745	0.0908|0.0908	N|N	0.14661|0.14661	0.345|0.345	0.51767|0.51767	D|D	0.999933|0.999933	.|P;P;P	.|0.49447	.|0.924;0.894;0.83	.|B;B;B	.|0.39840	.|0.235;0.311;0.165	T|T	0.23084|0.23084	-1.0198|-1.0198	5|10	.|0.44086	.|T	.|0.13	-9.5534|-9.5534	19.8389|19.8389	0.96675|0.96675	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1481;1481;1481	.|Q14008-3;Q14008-2;Q14008	.|.;.;CKAP5_HUMAN	L|C	37|1481;1481;1481;1481;212	.|ENSP00000432768:R1481C;ENSP00000395302:R1481C;ENSP00000310227:R1481C;ENSP00000346566:R1481C	.|ENSP00000310227:R1481C	P|R	-|-	2|1	0|0	0|0	CKAP5|CKAP5	46737522|46737522	46737522|46737522	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.998000|0.998000	0.95712|0.95712	7.753000|7.753000	0.85153|0.85153	2.755000|2.755000	0.94549|0.94549	0.650000|0.650000	0.86243|0.86243	CCG|CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.483	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	0	0	1		2	2	2	0	0	0	0	71	0	71	71	1	2.070000	-2.916531	1	0.390000	NM_014756		0	5	5	0	354	352	0	0	1	0		0	0	71	0	0	0.937042	3.410767e-01	0	0	0	73	0	5	354
OR4A47	403253	broad.mit.edu	37	11	48510885	48510885	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:48510885C>A	ENST00000446524.1	+	1	617	c.541C>A	c.(541-543)Ccc>Acc	p.P181T		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P181A(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TGACATGTATCCCTTATTGAA	0.443																																						ENST00000446524.1	0.290000	1.200000e-01	0.250000	0.160000	0.190000	0.206301	0.190000	0.200000																										1	Substitution - Missense(1)	p.P181A(1)	urinary_tract(1)	29						c.(541-543)Ccc>Acc		olfactory receptor, family 4, subfamily A, member 47							167.0	159.0	162.0					11																	48510885		2201	4298	6499	SO:0001583	missense	403253	0	0					g.chr11:48510885C>A	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.541C>A	chr11.hg19:g.48510885C>A	ENSP00000412752:p.Pro181Thr	0						p.P181T	NM_001005512.2	NP_001005512.2	1	2	3	1.976461	Q6IF82	O4A47_HUMAN		1	617	+				Missense_Mutation	SNP	ENST00000446524.1	1	1	hg19	c.541C>A	CCDS31490.1	0	.	.	.	.	.	.	.	.	.	.	N	7.778	0.708860	0.15239	.	.	ENSG00000237388	ENST00000446524	T	0.00216	8.53	4.84	1.9	0.25705	4.84	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.117629	0.38778	N	0.001571	T	0.00666	0.0022	H	0.94658	3.565	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.38045	-0.9679	10	0.72032	D	0.01	.	6.6304	0.22853	0.0:0.6819:0.147:0.171	.	181	Q6IF82	O4A47_HUMAN	T	181	ENSP00000412752:P181T	ENSP00000412752:P181T	P	+	1	0	0	OR4A47	48467461	48467461	0.000000	0.05858	0.219000	0.23793	0.012000	0.07955	0.174000	0.16743	0.105000	0.17753	-0.409000	0.06214	CCC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.443	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	0	0	1		2	2	2	0	0	0	0	154	0	154	157	1	2.070000	-4.050987	1	0.390000	NM_001005512		0	25	25	0	619	595	0	0	1			0	0	154	0	0	1.000000	0	0	0	0	0	0	25	619
OR4S2	219431	broad.mit.edu	37	11	55418776	55418776	+	Missense_Mutation	SNP	A	A	C			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:55418776A>C	ENST00000312422.2	+	1	397	c.397A>C	c.(397-399)Atc>Ctc	p.I133L		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TTATATGACCATCATGAACCG	0.428																																						ENST00000312422.2	0.330000	1.700000e-01	0.290000	0.200000	0.240000	0.249778	0.240000	0.240000																										0				45						c.(397-399)Atc>Ctc		olfactory receptor, family 4, subfamily S, member 2							198.0	167.0	178.0					11																	55418776		2182	4042	6224	SO:0001583	missense	219431	0	0					g.chr11:55418776A>C	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.397A>C	chr11.hg19:g.55418776A>C	ENSP00000310337:p.Ile133Leu	0						p.I133L	NM_001004059.2	NP_001004059.2	1	2	3	1.976461	Q8NH73	OR4S2_HUMAN		1	397	+		all_epithelial(135;0.0748)	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	1	1	hg19	c.397A>C	CCDS31505.1	0	.	.	.	.	.	.	.	.	.	.	A	10.57	1.386439	0.25031	.	.	ENSG00000174982	ENST00000312422	T	0.00940	5.52	5.35	5.35	0.76521	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.243922	0.28453	N	0.015284	T	0.01387	0.0045	L	0.45698	1.435	0.26071	N	0.981224	B	0.14438	0.01	B	0.10450	0.005	T	0.38564	-0.9655	10	0.72032	D	0.01	.	10.9264	0.47193	0.8431:0.1569:0.0:0.0	.	133	Q8NH73	OR4S2_HUMAN	L	133	ENSP00000310337:I133L	ENSP00000310337:I133L	I	+	1	0	0	OR4S2	55175352	55175352	0.008000	0.16893	0.997000	0.53966	0.193000	0.23685	0.647000	0.24812	2.028000	0.59812	0.443000	0.29094	ATC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.428	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	1	0	1		2	2	2	0	0	0	0	184	0	184	181	1	2.070000	-6.012469	1	0.390000	NM_001004059		0	42	41	0	839	828	0	0	1			0	0	184	0	0	1.000000	0	0	0	0	0	0	42	839
CHRM1	1128	broad.mit.edu	37	11	62677297	62677297	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:62677297G>A	ENST00000306960.3	-	2	1817	c.1276C>T	c.(1276-1278)Cgg>Tgg	p.R426W	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	426					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	AAGGTGTCCCGGAAGGCTTTG	0.632																																						ENST00000306960.3	0.080000	0	0.060000	0.020000	0.030000	0.043167	0.030000	0.040000																										0				9						c.(1276-1278)Cgg>Tgg		cholinergic receptor, muscarinic 1	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)						164.0	158.0	160.0					11																	62677297		2201	4298	6499	SO:0001583	missense	1128	1	121412	33				g.chr11:62677297G>A	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.1276C>T	chr11.hg19:g.62677297G>A	ENSP00000306490:p.Arg426Trp	0					AP000438.2_ENST00000543624.1_RNA	p.R426W	NM_000738.2	NP_000729.2	1	2	3	1.982548	P11229	ACM1_HUMAN		2	1817	-			Q96RH1	Missense_Mutation	SNP	ENST00000306960.3	0	1	hg19	c.1276C>T	CCDS8040.1	0	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966720	0.53507	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.58358	0.34;0.34	3.98	1.97	0.26223	3.98	1.97	0.26223	.	0.792889	0.10240	N	0.698549	T	0.64972	0.2647	L	0.57536	1.79	0.39146	D	0.962134	D	0.89917	1.0	D	0.64321	0.924	T	0.62148	-0.6915	10	0.87932	D	0	-13.9234	9.6941	0.40147	0.0:0.0:0.4009:0.5991	.	426	P11229	ACM1_HUMAN	W	426	ENSP00000306490:R426W;ENSP00000441188:R426W	ENSP00000306490:R426W	R	-	1	2	2	CHRM1	62433873	62433873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.136000	0.64783	0.263000	0.21812	0.561000	0.74099	CGG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.632	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	0	0	1		2	2	2	0	0	0	0	183	0	183	183	1	2.070000	-1.903257	0	0.390000	NM_000738		0	6	6	0	820	804	0	0	1			0	0	183	0	0	0.962859	0	0	0	0	0	0	6	820
RCOR2	283248	broad.mit.edu	37	11	63680166	63680166	+	Nonsense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:63680166G>A	ENST00000301459.4	-	10	1396	c.1009C>T	c.(1009-1011)Cag>Tag	p.Q337*	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	337	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						GCCAAAAGCTGCTCATCTGTG	0.532																																						ENST00000301459.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				17						c.(1009-1011)Cag>Tag		REST corepressor 2							141.0	140.0	140.0					11																	63680166		2201	4297	6498	SO:0001587	stop_gained	283248	0	0					g.chr11:63680166G>A	BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.1009C>T	chr11.hg19:g.63680166G>A	ENSP00000301459:p.Gln337*	0					RCOR2_ENST00000473926.2_5'Flank	p.Q337*	NM_173587.3	NP_775858.2	1	2	3	1.982548	Q8IZ40	RCOR2_HUMAN		10	1396	-			Q96FP3	Nonsense_Mutation	SNP	ENST00000301459.4	0	1	hg19	c.1009C>T	CCDS8052.1	1	.	.	.	.	.	.	.	.	.	.	G	41	8.641449	0.98897	.	.	ENSG00000167771	ENST00000301459	.	.	.	4.45	4.45	0.53987	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.4081	0.83697	0.0:0.0:1.0:0.0	.	.	.	.	X	337	.	ENSP00000301459:Q337X	Q	-	1	0	0	RCOR2	63436742	63436742	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.524000	0.98036	2.479000	0.83701	0.561000	0.74099	CAG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.532	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	1	0	1		2	2	2	0	0	0	0	173	0	173	171	1	2.070000	-20.000000	1	0.390000	NM_173587		0	229	228	0	656	651	1	0	1	0		0	0	173	0	0	1.000000	6.699958e-02	0	0	0	2	0	229	656
ESRRA	2101	broad.mit.edu	37	11	64082689	64082689	+	Missense_Mutation	SNP	G	G	A	rs374006359		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:64082689G>A	ENST00000405666.1	+	6	1193	c.959G>A	c.(958-960)cGg>cAg	p.R320Q	PRDX5_ENST00000352435.4_5'Flank|ESRRA_ENST00000000442.6_Missense_Mutation_p.R320Q|ESRRA_ENST00000406310.1_Missense_Mutation_p.R319Q|PRDX5_ENST00000347941.4_5'Flank|PRDX5_ENST00000265462.4_5'Flank	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	320	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CAGGCCCTGCGGCTGGAGCGA	0.627																																						ENST00000405666.1	1.000000	8.900000e-01	1.000000	0.990000	0.990000	0.992830	0.990000	1.000000																										0				14						c.(958-960)cGg>cAg		estrogen-related receptor alpha		G	GLN/ARG	0,3998		0,0,1999	22.0	26.0	25.0		959	4.1	0.9	11		25	1,8313		0,1,4156	no	missense	ESRRA	NM_004451.3	43	0,1,6155	AA,AG,GG		0.012,0.0,0.0081	benign	320/424	64082689	1,12311	1999	4157	6156	SO:0001583	missense	2101	5	120840	33				g.chr11:64082689G>A	X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.959G>A	chr11.hg19:g.64082689G>A	ENSP00000384851:p.Arg320Gln	0					ESRRA_ENST00000000442.6_Missense_Mutation_p.R320Q|PRDX5_ENST00000265462.4_5'Flank|PRDX5_ENST00000352435.4_5'Flank|PRDX5_ENST00000347941.4_5'Flank|ESRRA_ENST00000406310.1_Missense_Mutation_p.R319Q	p.R320Q	NM_001282450.1	NP_001269379.1	1	2	3	1.982548	P11474	ERR1_HUMAN		6	1193	+			Q14514	Missense_Mutation	SNP	ENST00000405666.1	1	1	hg19	c.959G>A	CCDS41667.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.914|9.914	1.210433|1.210433	0.22289|0.22289	0.0|0.0	1.2E-4|1.2E-4	ENSG00000173153|ENSG00000173153	ENST00000545035|ENST00000406310;ENST00000000442;ENST00000405666	.|D;D;D	.|0.96334	.|-3.98;-3.98;-3.98	4.14|4.14	4.14|4.14	0.48551|0.48551	4.14|4.14	4.14|4.14	0.48551|0.48551	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	.|0.192229	.|0.44483	.|D	.|0.000441	D|D	0.89269|0.89269	0.6667|0.6667	N|N	0.16903|0.16903	0.455|0.455	0.44073|0.44073	D|D	0.996821|0.996821	.|B;P	.|0.51449	.|0.033;0.945	.|B;B	.|0.31547	.|0.0;0.132	D|D	0.90139|0.90139	0.4212|0.4212	5|10	.|0.39692	.|T	.|0.17	.|.	14.3272|14.3272	0.66528|0.66528	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|319;320	.|P11474-2;P11474	.|.;ERR1_HUMAN	S|Q	101|319;320;320	.|ENSP00000385971:R319Q;ENSP00000000442:R320Q;ENSP00000384851:R320Q	.|ENSP00000000442:R320Q	G|R	+|+	1|2	0|0	0|0	ESRRA|ESRRA	63839265|63839265	63839265|63839265	0.082000|0.082000	0.21442|0.21442	0.944000|0.944000	0.38274|0.38274	0.203000|0.203000	0.24098|0.24098	2.216000|2.216000	0.42871|0.42871	2.309000|2.309000	0.77851|0.77851	0.462000|0.462000	0.41574|0.41574	GGC|CGG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.627	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	1	0	1		2	2	2	0	0	0	0	38	0	38	38	1	2.070000	-20.000000	1	0.390000	NM_004451		0	51	49	0	174	170	1	0	1	1		0	0	38	0	0	1.000000	1	0	43	0	124	0	51	174
ADAMTS8	11095	broad.mit.edu	37	11	130284700	130284700	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr11:130284700G>A	ENST00000257359.6	-	5	1998	c.1292C>T	c.(1291-1293)gCg>gTg	p.A431V		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	431				YLTELLDGGHGDCLLDAPAAALPLPTGL -> FSGCHLQGW IHFKYLCKCVSELKCDLMP (in Ref. 3; AAF25806). {ECO:0000305}.	negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GGGCAGGGCCGCAGCAGGGGC	0.652																																						ENST00000257359.6	1.000000	8.000000e-01	1.000000	0.930000	0.990000	0.976490	0.990000	1.000000																										0				10						c.(1291-1293)gCg>gTg		ADAM metallopeptidase with thrombospondin type 1 motif, 8							16.0	19.0	18.0					11																	130284700		1938	4103	6041	SO:0001583	missense	11095	3	120648	27				g.chr11:130284700G>A	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1292C>T	chr11.hg19:g.130284700G>A	ENSP00000257359:p.Ala431Val	0						p.A431V	NM_007037.4	NP_008968.4	1	2	3	1.982548	Q9UP79	ATS8_HUMAN		5	1998	-	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	1	1	hg19	c.1292C>T	CCDS41732.1	1	.	.	.	.	.	.	.	.	.	.	G	7.801	0.713736	0.15306	.	.	ENSG00000134917	ENST00000257359;ENST00000414575	T	0.03580	3.88	5.42	4.5	0.54988	5.42	4.5	0.54988	.	0.751547	0.12761	N	0.441396	T	0.03564	0.0102	N	0.24115	0.695	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.38329	-0.9666	10	0.59425	D	0.04	.	9.1476	0.36942	0.0:0.119:0.5962:0.2848	.	431	Q9UP79	ATS8_HUMAN	V	431;460	ENSP00000257359:A431V	ENSP00000257359:A431V	A	-	2	0	0	ADAMTS8	129789910	129789910	0.000000	0.05858	0.040000	0.18447	0.079000	0.17450	0.809000	0.27168	1.264000	0.44198	0.655000	0.94253	GCG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.652	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	0	0	1		15	2	2	1	0	1	1	42	0	42	42	1	2.070000	-20.000000	1	0.390000	NM_007037		0	40	40	0	149	146	0	0	1	0		1	0	42	0	0	0.999919	1.199467e-01	0	0	0	3	0	40	149
FOXN4	121643	broad.mit.edu	37	12	109719343	109719343	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr12:109719343G>A	ENST00000299162.5	-	9	1267	c.1163C>T	c.(1162-1164)cCg>cTg	p.P388L	FOXN4_ENST00000355216.1_Missense_Mutation_p.P208L	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	388					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						GCTGAGGTCCGGCAGGGCGTG	0.657																																						ENST00000299162.5	1.000000	7.800000e-01	1.000000	0.930000	0.990000	0.974490	0.990000	1.000000																										0				16						c.(1162-1164)cCg>cTg		forkhead box N4							34.0	28.0	30.0					12																	109719343		2203	4298	6501	SO:0001583	missense	121643	1	121376	23				g.chr12:109719343G>A	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.1163C>T	chr12.hg19:g.109719343G>A	ENSP00000299162:p.Pro388Leu	0					FOXN4_ENST00000355216.1_Missense_Mutation_p.P208L	p.P388L	NM_213596.2	NP_998761.2	1	2	3	1.973903	Q96NZ1	FOXN4_HUMAN		9	1267	-			Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	ENST00000299162.5	1	1	hg19	c.1163C>T	CCDS9126.2	1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347910	0.61183	.	.	ENSG00000139445	ENST00000355216;ENST00000299162	D;D	0.95482	-3.72;-3.4	4.49	3.58	0.41010	4.49	3.58	0.41010	.	0.472963	0.19054	N	0.123947	D	0.96901	0.8988	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.69654	0.965;0.57	D	0.96418	0.9309	10	0.52906	T	0.07	-12.9682	13.1717	0.59602	0.0:0.0:0.8395:0.1605	.	388;388	A6H901;Q96NZ1	.;FOXN4_HUMAN	L	208;388	ENSP00000347354:P208L;ENSP00000299162:P388L	ENSP00000299162:P388L	P	-	2	0	0	FOXN4	108203726	108203726	1.000000	0.71417	0.819000	0.32651	0.417000	0.31264	4.115000	0.57865	1.212000	0.43366	0.561000	0.74099	CCG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.657	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	1	0	1		2	2	2	0	0	0	0	27	0	27	27	1	2.070000	-20.000000	1	0.390000	XM_062735		0	29	29	0	105	100	1	0	1			0	0	27	0	0	1.000000	0	0	0	0	0	0	29	105
C1RL	51279	broad.mit.edu	37	12	7254566	7254566	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr12:7254566G>A	ENST00000266542.4	-	3	510	c.418C>T	c.(418-420)Cgc>Tgc	p.R140C	C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_Missense_Mutation_p.R140C|C1RL_ENST00000545337.1_Missense_Mutation_p.R140C	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	140	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGCTGTGTGCGGAAGGTCAGC	0.622																																						ENST00000266542.4	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.057333	0.050000	0.050000																										0				16						c.(418-420)Cgc>Tgc		complement component 1, r subcomponent-like							118.0	108.0	111.0					12																	7254566		2203	4300	6503	SO:0001583	missense	51279	1	121412	35				g.chr12:7254566G>A	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.418C>T	chr12.hg19:g.7254566G>A	ENSP00000266542:p.Arg140Cys	0					C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_Missense_Mutation_p.R140C|C1RL_ENST00000545337.1_Missense_Mutation_p.R140C	p.R140C	NM_016546.2	NP_057630.2	1	2	3	1.980614	Q9NZP8	C1RL_HUMAN		3	510	-			Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	0	1	hg19	c.418C>T	CCDS8573.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.842|5.842	0.339585|0.339585	0.11069|0.11069	.|.	.|.	ENSG00000139178|ENSG00000139178	ENST00000534950|ENST00000266542;ENST00000396661;ENST00000544702;ENST00000543933;ENST00000545337	.|T;T;T;T	.|0.30448	.|1.53;1.53;1.53;1.53	3.76|3.76	-0.133|-0.133	0.13485|0.13485	3.76|3.76	-0.133|-0.133	0.13485|0.13485	.|CUB (5);	.|1.399260	.|0.04433	.|N	.|0.369511	T|T	0.35799|0.35799	0.0944|0.0944	M|M	0.88640|0.88640	2.97|2.97	0.24098|0.24098	N|N	0.995883|0.995883	.|B;B;B	.|0.33919	.|0.432;0.038;0.285	.|B;B;B	.|0.27887	.|0.051;0.007;0.084	T|T	0.30268|0.30268	-0.9984|-0.9984	5|10	.|0.45353	.|T	.|0.12	.|.	3.3529|3.3529	0.07159|0.07159	0.2989:0.0:0.5228:0.1783|0.2989:0.0:0.5228:0.1783	.|.	.|140;140;140	.|F5GWF3;F5H7C8;Q9NZP8	.|.;.;C1RL_HUMAN	L|C	39|140	.|ENSP00000266542:R140C;ENSP00000441885:R140C;ENSP00000437398:R140C;ENSP00000442611:R140C	.|ENSP00000266542:R140C	P|R	-|-	2|1	0|0	0|0	C1RL|C1RL	7145842|7145842	7145842|7145842	0.147000|0.147000	0.22687|0.22687	0.103000|0.103000	0.21229|0.21229	0.289000|0.289000	0.27227|0.27227	0.193000|0.193000	0.17116|0.17116	-0.034000|-0.034000	0.13713|0.13713	-1.529000|-1.529000	0.00923|0.00923	CCG|CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.622	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	0	0	1		2	2	2	0	0	0	0	157	0	157	157	1	2.070000	-2.133321	0	0.390000	NM_016546		0	6	5	0	618	611	0	0	1	0		0	0	157	0	0	0.963682	2.229390e-01	0	0	0	79	0	6	618
KRT72	140807	broad.mit.edu	37	12	52994910	52994910	+	Silent	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr12:52994910C>T	ENST00000537672.2	-	1	337	c.327G>A	c.(325-327)ccG>ccA	p.P109P	KRT72_ENST00000354310.4_Silent_p.P109P|KRT72_ENST00000293745.2_Silent_p.P109P|RP11-641A6.2_ENST00000551089.1_RNA|KRT72_ENST00000398066.3_5'UTR	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	109	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.P109P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CCACGTTGAGCGGGGCCAGGA	0.667																																						ENST00000537672.2	0.220000	4.000000e-02	0.160000	0.070000	0.100000	0.119667	0.100000	0.100000																										1	Substitution - coding silent(1)	p.P109P(1)	large_intestine(1)	36						c.(325-327)ccG>ccA		keratin 72							82.0	76.0	78.0					12																	52994910		2203	4300	6503	SO:0001819	synonymous_variant	140807	2	121412	34				g.chr12:52994910C>T	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.327G>A	chr12.hg19:g.52994910C>T		0					RP11-641A6.2_ENST00000551089.1_RNA|KRT72_ENST00000398066.3_5'UTR|KRT72_ENST00000354310.4_Silent_p.P109P|KRT72_ENST00000293745.2_Silent_p.P109P	p.P109P	NM_001146225.1	NP_001139697.1	1	2	3	1.980614	Q14CN4	K2C72_HUMAN		1	337	-			B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Silent	SNP	ENST00000537672.2	0	1	hg19	c.327G>A	CCDS8833.1	0	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239736	0.39598	.	.	ENSG00000170486	ENST00000549979	.	.	.	4.49	-1.94	0.07571	4.49	-1.94	0.07571	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27123	-1.0083	4	.	.	.	.	1.5914	0.02655	0.2117:0.371:0.1662:0.2511	.	.	.	.	H	95	.	.	R	-	2	0	0	KRT72	51281177	51281177	0.000000	0.05858	0.947000	0.38551	0.805000	0.45488	-2.331000	0.01110	-0.362000	0.08113	-1.083000	0.02208	CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.667	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	0	0	1		2	2	2	0	0	0	0	63	0	63	62	1	2.070000	-2.785011	1	0.390000	NM_080747		0	6	6	0	291	286	0	0	1			0	0	63	0	0	0.963522	0	0	0	0	0	0	6	291
SPRYD4	283377	broad.mit.edu	37	12	56863123	56863123	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr12:56863123G>A	ENST00000338146.5	+	2	461	c.386G>A	c.(385-387)cGc>cAc	p.R129H	MIP_ENST00000555551.1_5'Flank	NM_207344.3	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	129	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)	7						TATGCCCAGCGCAAGTGGTAC	0.572																																						ENST00000338146.5	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.056609	0.040000	0.050000																										0				7						c.(385-387)cGc>cAc		SPRY domain containing 4							137.0	127.0	130.0					12																	56863123		2203	4300	6503	SO:0001583	missense	283377	0	0					g.chr12:56863123G>A	AL832247	CCDS8920.1	12q13.3	2006-03-09				ENSG00000176422			27468	protein-coding gene	gene with protein product							Standard	NM_207344		Approved	DKFZp686N0877	uc001sli.4	Q8WW59		ENST00000338146.5:c.386G>A	chr12.hg19:g.56863123G>A	ENSP00000338034:p.Arg129His	0					MIP_ENST00000555551.1_5'Flank	p.R129H	NM_207344.3	NP_997227	1	2	3	1.976042	Q8WW59	SPRY4_HUMAN		2	461	+			A8K7A5	Missense_Mutation	SNP	ENST00000338146.5	0	1	hg19	c.386G>A	CCDS8920.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.514600	0.96402	.	.	ENSG00000176422	ENST00000338146;ENST00000543121	T	0.61158	0.13	5.46	5.46	0.80206	5.46	5.46	0.80206	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.102358	0.64402	D	0.000003	T	0.71796	0.3382	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.95	T	0.71101	-0.4690	10	0.51188	T	0.08	-18.1887	18.4593	0.90732	0.0:0.0:1.0:0.0	.	51;129	B4DUC9;Q8WW59	.;SPRY4_HUMAN	H	129;51	ENSP00000338034:R129H	ENSP00000338034:R129H	R	+	2	0	0	SPRYD4	55149390	55149390	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.921000	0.56454	2.735000	0.93741	0.561000	0.74099	CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.572	SPRYD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0	0	0	0	134	0	134	134	1	2.070000	-2.126141	0	0.390000	NM_207344		0	6	6	0	626	616	0	0	1	0		0	0	134	0	0	0.963333	8.336658e-02	0	0	0	42	0	6	626
LRP1	4035	broad.mit.edu	37	12	57590012	57590012	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr12:57590012G>T	ENST00000243077.3	+	55	9310	c.8844G>T	c.(8842-8844)aaG>aaT	p.K2948N	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2948	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCAGCCGCAAGCTCAGTGGCT	0.632																																						ENST00000243077.3	0.380000	6.000000e-02	0.270000	0.110000	0.180000	0.195639	0.180000	0.160000																										0				184						c.(8842-8844)aaG>aaT		low density lipoprotein receptor-related protein 1	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)						41.0	35.0	37.0					12																	57590012		2202	4298	6500	SO:0001583	missense	4035	0	0					g.chr12:57590012G>T	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8844G>T	chr12.hg19:g.57590012G>T	ENSP00000243077:p.Lys2948Asn	0					MIR1228_ENST00000408438.1_RNA	p.K2948N	NM_002332.2	NP_002323.2	1	2	3	1.976042	Q07954	LRP1_HUMAN		55	9310	+			Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	0	1	hg19	c.8844G>T	CCDS8932.1	0	.	.	.	.	.	.	.	.	.	.	G	13.76	2.334687	0.41297	.	.	ENSG00000123384	ENST00000243077	D	0.89681	-2.55	5.02	2.11	0.27256	5.02	2.11	0.27256	Growth factor, receptor (1);EGF-like calcium-binding (1);	0.000000	0.64402	D	0.000001	T	0.80989	0.4730	N	0.02685	-0.53	0.80722	D	1	D	0.61697	0.99	D	0.64776	0.929	T	0.74497	-0.3646	10	0.17832	T	0.49	.	6.2253	0.20703	0.2279:0.1436:0.6285:0.0	.	2948	Q07954	LRP1_HUMAN	N	2948	ENSP00000243077:K2948N	ENSP00000243077:K2948N	K	+	3	2	2	LRP1	55876279	55876279	0.962000	0.33011	1.000000	0.80357	0.982000	0.71751	0.431000	0.21444	0.687000	0.31509	0.655000	0.94253	AAG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.632	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	0	0	0		2	2	2	0	0	0	0	31	0	31	31	1	2.070000	-7.967799	1	0.390000	NM_002332		0	5	0	0	149	145	0	0	0	0		0	0	31	0	0	0.928190	8.527393e-01	0	0	0	105	0	5	149
RPH3A	22895	broad.mit.edu	37	12	113266105	113266105	+	Splice_Site	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr12:113266105G>A	ENST00000389385.4	+	3	479		c.e3-1		RPH3A_ENST00000551052.1_Splice_Site|RPH3A_ENST00000415485.3_Splice_Site|RPH3A_ENST00000420983.2_5'Flank|RPH3A_ENST00000447659.2_Splice_Site|RPH3A_ENST00000548866.1_Splice_Site|RPH3A_ENST00000543106.2_Splice_Site	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A						intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		ATGTTTTCCAGGAGCACTAGA	0.488																																						ENST00000389385.4	0.210000	3.000000e-02	0.150000	0.060000	0.100000	0.111507	0.100000	0.100000																										0				47						c.e3-1		rabphilin 3A							164.0	140.0	148.0					12																	113266105		2203	4300	6503	SO:0001630	splice_region_variant	22895	0	0					g.chr12:113266105G>A	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.-18-1G>A	chr12.hg19:g.113266105G>A		0					RPH3A_ENST00000543106.2_Splice_Site|RPH3A_ENST00000551052.1_Splice_Site|RPH3A_ENST00000415485.3_Splice_Site|RPH3A_ENST00000548866.1_Splice_Site|RPH3A_ENST00000447659.2_Splice_Site|RPH3A_ENST00000420983.2_5'Flank		NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	1	2	3	1.973903	Q9Y2J0	RP3A_HUMAN		3	479	+			B7Z3C3|Q96AE0	Splice_Site	SNP	ENST00000389385.4	0	1	hg19		CCDS44979.1	0																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.488	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	0	0	1		2	2	2	0	0	0	0	73	0	73	71	1	2.070000	-2.870380	1	0.390000	NM_014954	Intron	0	6	6	0	313	310	0	0	1			0	0	73	0	0	0.964325	0	0	0	0	0	0	6	313
MMP14	4323	broad.mit.edu	37	14	23315041	23315041	+	Silent	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr14:23315041G>A	ENST00000311852.6	+	10	1803	c.1542G>A	c.(1540-1542)ccG>ccA	p.P514P	MMP14_ENST00000548162.1_Intron	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	514					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	GAGGCCGGCCGGATGAGGGGA	0.637																																						ENST00000311852.6	0.210000	2.000000e-02	0.150000	0.050000	0.090000	0.103761	0.090000	0.080000																										0				20						c.(1540-1542)ccG>ccA		matrix metallopeptidase 14 (membrane-inserted)	Marimastat(DB00786)						59.0	68.0	65.0					14																	23315041		2203	4300	6503	SO:0001819	synonymous_variant	4323	2	121410	35				g.chr14:23315041G>A		CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.1542G>A	chr14.hg19:g.23315041G>A		0					MMP14_ENST00000548162.1_Intron	p.P514P	NM_004995.2	NP_004986.1	1	2	3	1.983148	P50281	MMP14_HUMAN		10	1803	+	all_cancers(95;9.47e-05)		A8K5L0|Q6GSF3|Q92678	Silent	SNP	ENST00000311852.6	0	1	hg19	c.1542G>A	CCDS9577.1	0																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.637	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071660.3	0	0	1		2	2	2	0	0	0	0	50	0	50	49	1	2.070000	-2.949559	1	0.390000	NM_004995		0	4	4	0	240	235	0	0	1	0		0	0	50	0	0	0.886206	9.998255e-01	0	0	0	1682	0	4	240
NKX2-8	26257	broad.mit.edu	37	14	37050517	37050517	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr14:37050517G>A	ENST00000258829.5	-	2	527	c.310C>T	c.(310-312)Cgg>Tgg	p.R104W		NM_014360.2	NP_055175.2	O15522	NKX28_HUMAN	NK2 homeobox 8	104					axonogenesis (GO:0007409)|liver development (GO:0001889)|lung development (GO:0030324)|negative regulation of epithelial cell proliferation (GO:0050680)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			upper_aerodigestive_tract(1)	1	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0171)		CGCTGCTGCCGGAAGCGCCGC	0.662																																						ENST00000258829.5	0.780000	1.000000e-01	0.560000	0.200000	0.350000	0.388295	0.350000	0.300000																										0				1						c.(310-312)Cgg>Tgg		NK2 homeobox 8							10.0	11.0	10.0					14																	37050517		2191	4291	6482	SO:0001583	missense	26257	0	0					g.chr14:37050517G>A		CCDS9660.1	14q13.3	2012-03-09	2007-07-09	2002-10-04	ENSG00000136327	ENSG00000136327		"""Homeoboxes / ANTP class : NKL subclass"""	16364	protein-coding gene	gene with protein product		603245	"""NK-2 homolog H (Drosophila)"", ""NK2 transcription factor related, locus 8 (Drosophila)"""	NKX2H		9446603	Standard	NM_014360		Approved	NKX2.8, Nkx2-9	uc001wtx.3	O15522	OTTHUMG00000028772	ENST00000258829.5:c.310C>T	chr14.hg19:g.37050517G>A	ENSP00000258829:p.Arg104Trp	0						p.R104W	NM_014360.2	NP_055175.2	0	1	1	1.968804	O15522	NKX28_HUMAN	Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	2	527	-	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Q8IUT7	Missense_Mutation	SNP	ENST00000258829.5	0	1	hg19	c.310C>T	CCDS9660.1	0	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911256	0.92178	.	.	ENSG00000136327	ENST00000258829	D	0.96459	-4.02	4.25	4.25	0.50352	4.25	4.25	0.50352	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.067264	0.64402	D	0.000008	D	0.97920	0.9316	M	0.80028	2.48	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	D	0.98869	1.0765	10	0.87932	D	0	.	15.8354	0.78793	0.0:0.0:1.0:0.0	.	104	O15522	NKX28_HUMAN	W	104	ENSP00000258829:R104W	ENSP00000258829:R104W	R	-	1	2	2	NKX2-8	36120268	36120268	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.079000	0.41577	2.186000	0.69663	0.549000	0.68633	CGG	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.662	NKX2-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071844.6	0	0	1		2	2	2	0	0	0	0	10	0	10	10	1	2.070000	-8.326563	1	0.390000			0	3	3	0	46	45	0	0	1			0	0	10	0	0	0.806023	0	0	0	0	0	0	3	46
BTBD7	55727	broad.mit.edu	37	14	93709084	93709084	+	Silent	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr14:93709084G>A	ENST00000334746.5	-	11	3241	c.2934C>T	c.(2932-2934)taC>taT	p.Y978Y	BTBD7_ENST00000393170.2_Silent_p.Y552Y|BTBD7_ENST00000554565.1_Silent_p.Y627Y	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	978					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		TATTGTGGCTGTACAGATCGG	0.483																																						ENST00000334746.5	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.057496	0.040000	0.050000																										0				35						c.(2932-2934)taC>taT		BTB (POZ) domain containing 7							148.0	133.0	138.0					14																	93709084		2203	4300	6503	SO:0001819	synonymous_variant	55727	1	121412	28				g.chr14:93709084G>A	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2934C>T	chr14.hg19:g.93709084G>A		0					BTBD7_ENST00000554565.1_Silent_p.Y627Y|BTBD7_ENST00000393170.2_Silent_p.Y552Y	p.Y978Y	NM_001002860.2	NP_001002860.2	0	1	1	1.968804	Q9P203	BTBD7_HUMAN		11	3241	-		all_cancers(154;0.08)	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Silent	SNP	ENST00000334746.5	0	1	hg19	c.2934C>T	CCDS32146.1	0																																																																																								0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.483	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	0	0	1		2	2	2	0	0	0	0	111	0	111	111	1	2.070000	-2.465566	0	0.390000	NM_001002860		0	5	5	0	525	520	0	0	1	0		0	0	111	0	0	0.936245	2.143140e-02	0	0	0	19	0	5	525
CLMN	79789	broad.mit.edu	37	14	95677190	95677190	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr14:95677190G>A	ENST00000298912.4	-	7	748	c.635C>T	c.(634-636)gCg>gTg	p.A212V		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	212	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		CCAACTGCCCGCAAAGTCCTG	0.567																																						ENST00000298912.4	0.100000	1.000000e-02	0.080000	0.030000	0.050000	0.058093	0.050000	0.060000																										0				44						c.(634-636)gCg>gTg		calmin (calponin-like, transmembrane)							94.0	99.0	97.0					14																	95677190		2203	4300	6503	SO:0001583	missense	79789	4	121402	35				g.chr14:95677190G>A	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.635C>T	chr14.hg19:g.95677190G>A	ENSP00000298912:p.Ala212Val	0						p.A212V	NM_024734.3	NP_079010.2	0	1	1	1.968804	Q96JQ2	CLMN_HUMAN		7	748	-			B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	0	1	hg19	c.635C>T	CCDS9933.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.119023	0.94385	.	.	ENSG00000165959	ENST00000298912	T	0.59638	0.25	5.93	5.93	0.95920	5.93	5.93	0.95920	Calponin homology domain (5);	0.000000	0.39341	N	0.001394	T	0.59797	0.2220	N	0.14661	0.345	0.80722	D	1	D	0.63046	0.992	P	0.57468	0.821	T	0.65113	-0.6247	10	0.72032	D	0.01	.	20.3311	0.98718	0.0:0.0:1.0:0.0	.	212	Q96JQ2	CLMN_HUMAN	V	212	ENSP00000298912:A212V	ENSP00000298912:A212V	A	-	2	0	0	CLMN	94746943	94746943	1.000000	0.71417	0.260000	0.24451	0.983000	0.72400	6.642000	0.74329	2.797000	0.96272	0.655000	0.94253	GCG	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.567	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2	0	0	1		2	2	2	0	0	0	0	152	0	152	151	1	2.070000	-1.844680	0	0.390000			0	7	6	0	695	681	0	0	1	0		0	0	152	0	0	0.979113	1.531691e-01	0	1	0	59	0	7	695
TPM1	7168	broad.mit.edu	37	15	63353068	63353068	+	Splice_Site	SNP	G	G	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr15:63353068G>T	ENST00000403994.3	+	5	573	c.493G>T	c.(493-495)Gtg>Ttg	p.V165L	TPM1_ENST00000358278.3_Splice_Site_p.V165L|TPM1_ENST00000317516.7_Splice_Site_p.V129L|TPM1_ENST00000559281.1_Splice_Site_p.V129L|TPM1_ENST00000560959.1_Splice_Site_p.V129L|TPM1_ENST00000357980.4_Splice_Site_p.V207L|TPM1_ENST00000288398.6_Splice_Site_p.V165L|TPM1_ENST00000559556.1_Splice_Site_p.V165L|TPM1_ENST00000560445.1_Intron|TPM1_ENST00000267996.7_Splice_Site_p.V165L|TPM1_ENST00000559397.1_Splice_Site_p.V165L|TPM1_ENST00000404484.4_Splice_Site_p.V129L|TPM1_ENST00000334895.5_Splice_Site_p.V129L	NM_001018005.1	NP_001018005.1	P09493	TPM1_HUMAN	tropomyosin 1 (alpha)	165					cardiac muscle contraction (GO:0060048)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|negative regulation of cell migration (GO:0030336)|positive regulation of ATPase activity (GO:0032781)|positive regulation of cell adhesion (GO:0045785)|positive regulation of heart rate by epinephrine (GO:0003065)|positive regulation of stress fiber assembly (GO:0051496)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|ruffle organization (GO:0031529)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|wound healing (GO:0042060)	bleb (GO:0032059)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|muscle thin filament tropomyosin (GO:0005862)|ruffle membrane (GO:0032587)|sarcomere (GO:0030017)|stress fiber (GO:0001725)	actin binding (GO:0003779)|cytoskeletal protein binding (GO:0008092)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(1)|large_intestine(1)|lung(2)	4						CCTGCTGCAGGTGGCCCGTAA	0.592																																						ENST00000403994.3	1.000000	6.900000e-01	1.000000	0.800000	0.910000	0.905602	0.910000	1.000000																										0				4						c.(493-495)Gtg>Ttg		tropomyosin 1 (alpha)							86.0	81.0	83.0					15																	63353068		2203	4300	6503	SO:0001630	splice_region_variant	7168	0	0					g.chr15:63353068G>T	AB209041	CCDS10181.1, CCDS32262.1, CCDS32263.1, CCDS32264.1, CCDS45273.1, CCDS58368.1, CCDS58369.1	15q22.1	2014-09-17			ENSG00000140416	ENSG00000140416		"""Tropomyosins"""	12010	protein-coding gene	gene with protein product		191010	"""chromosome 15 open reading frame 13"", ""cardiomyopathy, hypertrophic 3"""	C15orf13, CMH3		10343096, 8205619	Standard	XM_005254637		Approved		uc002all.3	P09493	OTTHUMG00000132803	ENST00000403994.3:c.493-1G>T	chr15.hg19:g.63353068G>T		0					TPM1_ENST00000317516.7_Splice_Site_p.V129L|TPM1_ENST00000358278.3_Splice_Site_p.V165L|TPM1_ENST00000559397.1_Splice_Site_p.V165L|TPM1_ENST00000560959.1_Splice_Site_p.V129L|TPM1_ENST00000404484.4_Splice_Site_p.V129L|TPM1_ENST00000334895.5_Splice_Site_p.V129L|TPM1_ENST00000357980.4_Splice_Site_p.V207L|TPM1_ENST00000559556.1_Splice_Site_p.V165L|TPM1_ENST00000267996.7_Splice_Site_p.V165L|TPM1_ENST00000288398.6_Splice_Site_p.V165L|TPM1_ENST00000560445.1_Intron|TPM1_ENST00000559281.1_Splice_Site_p.V129L	p.V165L	NM_001018005.1	NP_001018005.1	1	2	3	1.986821	P09493	TPM1_HUMAN		5	573	+			B7Z5T7|D9YZV2|D9YZV3|D9YZV8|P09494|P10469|Q6DV89|Q6DV90|Q7Z6L8|Q86W64|Q96IK2|Q9UCI1|Q9UCI2|Q9UCY9|Q9Y427	Splice_Site	SNP	ENST00000403994.3	1	0	hg19	c.493G>T	CCDS45273.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490295	0.84962	.	.	ENSG00000140416	ENST00000288398;ENST00000267996;ENST00000358278;ENST00000403994;ENST00000357980;ENST00000404484;ENST00000334895;ENST00000317516	D;D;D;D;D;D	0.98150	-4.75;-4.75;-4.75;-4.75;-4.75;-4.75	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.000000	0.44902	D	0.000411	D	0.99032	0.9669	M	0.92507	3.315	0.80722	D	1	P;P;D;P;B;B;P;D;D;D;D;P;P;P	0.69078	0.486;0.841;0.997;0.47;0.352;0.314;0.912;0.985;0.966;0.995;0.98;0.848;0.836;0.912	P;P;D;B;B;B;D;D;D;D;D;P;P;D	0.75020	0.622;0.846;0.985;0.337;0.261;0.366;0.919;0.957;0.961;0.965;0.979;0.817;0.87;0.919	D	0.99541	1.0963	9	.	.	.	-30.939	18.5512	0.91065	0.0:0.0:1.0:0.0	.	129;129;165;131;129;129;165;207;165;165;165;165;165;165	B7Z722;B7Z596;P09493-6;F5H7S3;D9YZV7;Q1ZYL5;D9YZV4;Q6ZN40;D9YZV8;D9YZV5;Q9Y427;D9YZV3;D9YZV2;P09493	.;.;.;.;.;.;.;.;.;.;.;.;.;TPM1_HUMAN	L	165;165;165;165;207;187;129;131	ENSP00000288398:V165L;ENSP00000267996:V165L;ENSP00000351022:V165L;ENSP00000385107:V165L;ENSP00000350667:V207L;ENSP00000334624:V129L	.	V	+	1	0	0	TPM1	61140121	61140121	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.869000	0.99810	2.628000	0.89032	0.491000	0.48974	GTG	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.592	TPM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000417083.2	1	0	1		2	2	2	0	0	0	0	52	0	52	52	1	2.070000	-20.000000	1	0.390000	NM_001018004	Missense_Mutation	0	49	49	0	226	223	1	0	1	1		0	0	52	0	0	1.000000	1	0	116	0	803	0	49	226
HOMER2	9455	broad.mit.edu	37	15	83561566	83561566	+	Silent	SNP	C	C	T	rs201522712		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr15:83561566C>T	ENST00000304231.8	-	2	225	c.33G>A	c.(31-33)gcG>gcA	p.A11A	HOMER2_ENST00000450735.2_Silent_p.A11A|HOMER2_ENST00000399166.2_Silent_p.A11A|HOMER2_ENST00000426485.1_Silent_p.A11A	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	11	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.A11A(1)		cervix(1)|endometrium(2)|lung(6)	9						GGAAGACATGCGCTCGGGTGG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		17338	0.0		0.001	False		,,,				2504	0.0					ENST00000304231.8	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.073551	0.050000	0.060000																										1	Substitution - coding silent(1)	p.A11A(1)	large_intestine(1)	9						c.(31-33)gcG>gcA		homer homolog 2 (Drosophila)							141.0	140.0	141.0					15																	83561566		2008	4172	6180	SO:0001819	synonymous_variant	9455	3	120902	39				g.chr15:83561566C>T	AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.33G>A	chr15.hg19:g.83561566C>T		0					HOMER2_ENST00000450735.2_Silent_p.A11A|HOMER2_ENST00000399166.2_Silent_p.A11A|HOMER2_ENST00000426485.1_Silent_p.A11A	p.A11A	NM_199330.2	NP_955362.1	1	2	3	1.986821	Q9NSB8	HOME2_HUMAN		2	225	-			O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Silent	SNP	ENST00000304231.8	0	1	hg19	c.33G>A	CCDS45334.1	0																																																																																								0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.483	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1	0	0	1		2	2	2	0	0	0	0	98	0	98	97	1	2.070000	-2.272608	0	0.390000			0	5	5	0	471	466	0	0	1	0		0	0	98	0	0	0.936101	9.568124e-02	0	0	0	40	0	5	471
GNPTG	84572	broad.mit.edu	37	16	1412884	1412884	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:1412884G>A	ENST00000204679.4	+	10	843	c.800G>A	c.(799-801)gGc>gAc	p.G267D	LA16c-316G12.2_ENST00000569831.1_RNA	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit	267					carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				ACCCAGCACGGCATCCCCTAC	0.567																																						ENST00000204679.4	0.140000	2.000000e-02	0.100000	0.040000	0.060000	0.075491	0.060000	0.060000																										0				7						c.(799-801)gGc>gAc		N-acetylglucosamine-1-phosphate transferase, gamma subunit							89.0	95.0	93.0					16																	1412884		2199	4300	6499	SO:0001583	missense	84572	0	0					g.chr16:1412884G>A	BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835	ENST00000204679.4:c.800G>A	chr16.hg19:g.1412884G>A	ENSP00000204679:p.Gly267Asp	0					LA16c-316G12.2_ENST00000569831.1_RNA	p.G267D	NM_032520.4	NP_115909.1	1	2	3	1.983116	Q9UJJ9	GNPTG_HUMAN		10	843	+		Hepatocellular(780;0.0893)	B2R556|Q6XYD7|Q96L13	Missense_Mutation	SNP	ENST00000204679.4	0	1	hg19	c.800G>A	CCDS10436.1	0	.	.	.	.	.	.	.	.	.	.	G	16.58	3.161810	0.57368	.	.	ENSG00000090581	ENST00000204679	D	0.88664	-2.41	5.04	4.06	0.47325	5.04	4.06	0.47325	.	0.332660	0.35466	N	0.003194	D	0.87325	0.6149	M	0.71581	2.175	0.38684	D	0.952614	P	0.40578	0.722	B	0.39185	0.293	D	0.89026	0.3438	10	0.51188	T	0.08	-35.0628	12.1825	0.54220	0.0896:0.0:0.9104:0.0	.	267	Q9UJJ9	GNPTG_HUMAN	D	267	ENSP00000204679:G267D	ENSP00000204679:G267D	G	+	2	0	0	GNPTG	1352885	1352885	0.997000	0.39634	0.551000	0.28230	0.143000	0.21401	1.542000	0.36137	2.527000	0.85204	0.650000	0.86243	GGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.567	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109058.2	0	0	1		2	2	2	0	0	0	0	110	0	110	109	1	2.070000	-2.183592	0	0.390000	NM_032520		0	6	6	0	467	463	0	0	1	0		0	0	110	0	0	0.964259	9.488421e-01	0	1	0	415	0	6	467
XYLT1	64131	broad.mit.edu	37	16	17352929	17352929	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:17352929G>A	ENST00000261381.6	-	3	913	c.829C>T	c.(829-831)Cgc>Tgc	p.R277C		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	277					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATCTCCTGGCGGCAGTGCTTG	0.607																																						ENST00000261381.6	1.000000	7.100000e-01	1.000000	0.800000	0.890000	0.895581	0.890000	1.000000																										0				67						c.(829-831)Cgc>Tgc		xylosyltransferase I							69.0	64.0	66.0					16																	17352929		2197	4300	6497	SO:0001583	missense	64131	4	121102	36				g.chr16:17352929G>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.829C>T	chr16.hg19:g.17352929G>A	ENSP00000261381:p.Arg277Cys	0						p.R277C	NM_022166.3	NP_071449.1	1	2	3	1.982829	Q86Y38	XYLT1_HUMAN		3	913	-			Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	1	1	hg19	c.829C>T	CCDS10569.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508056	0.85282	.	.	ENSG00000103489	ENST00000261381	T	0.07444	3.19	5.43	5.43	0.79202	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.32406	0.0828	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.03306	-1.1050	10	0.87932	D	0	-31.9029	18.2463	0.89986	0.0:0.0:1.0:0.0	.	277	Q86Y38	XYLT1_HUMAN	C	277	ENSP00000261381:R277C	ENSP00000261381:R277C	R	-	1	0	0	XYLT1	17260430	17260430	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.731000	0.84895	2.547000	0.85894	0.655000	0.94253	CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.607	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	1	0	1		2	2	2	0	0	0	0	94	0	94	93	1	2.070000	-3.271079	1	0.390000	NM_022166		0	73	73	0	344	343	1	0	1	0		0	0	94	0	0	1.000000	9.600882e-01	0	1	0	26	0	73	344
ZNF646	9726	broad.mit.edu	37	16	31090857	31090857	+	Missense_Mutation	SNP	G	G	A	rs375913989		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:31090857G>A	ENST00000394979.2	+	1	3635	c.3212G>A	c.(3211-3213)cGc>cAc	p.R1071H	ZNF646_ENST00000300850.5_Missense_Mutation_p.R1071H			O15015	ZN646_HUMAN	zinc finger protein 646	1071					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						GTGAACCACCGCAAGATCCAC	0.617																																						ENST00000394979.2	0.080000	0	0.060000	0.020000	0.030000	0.043305	0.030000	0.040000																										0				49						c.(3211-3213)cGc>cAc		zinc finger protein 646		G	HIS/ARG	0,4394		0,0,2197	138.0	144.0	142.0		3212	4.8	1.0	16		142	1,8599		0,1,4299	no	missense	ZNF646	NM_014699.3	29	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1071/1833	31090857	1,12993	2197	4300	6497	SO:0001583	missense	9726	2	121412	38				g.chr16:31090857G>A	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.3212G>A	chr16.hg19:g.31090857G>A	ENSP00000378429:p.Arg1071His	0					ZNF646_ENST00000300850.5_Missense_Mutation_p.R1071H	p.R1071H			1	2	3	1.982829	O15015	ZN646_HUMAN		1	3635	+			Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	0	1	hg19	c.3212G>A		0	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004264	0.74932	0.0	1.16E-4	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.52057	0.68;0.68	5.75	4.78	0.61160	5.75	4.78	0.61160	.	.	.	.	.	T	0.33147	0.0853	L	0.31065	0.9	0.33612	D	0.603727	D	0.56521	0.976	B	0.41813	0.367	T	0.51498	-0.8698	9	0.62326	D	0.03	-15.9326	5.5911	0.17301	0.1514:0.0:0.6807:0.1679	.	1071	O15015-2	.	H	1071	ENSP00000300850:R1071H;ENSP00000378429:R1071H	ENSP00000300850:R1071H	R	+	2	0	0	ZNF646	30998358	30998358	0.512000	0.26186	1.000000	0.80357	0.987000	0.75469	1.081000	0.30791	1.389000	0.46526	0.563000	0.77884	CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.617	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	0	0	1		2	2	2	0	0	0	0	278	0	278	272	1	2.070000	-2.188596	0	0.390000	NM_014699		0	8	8	0	1060	1052	0	0	1	0		0	0	278	0	0	0.989029	1.581895e-02	0	0	0	22	0	8	1060
SLC6A2	6530	broad.mit.edu	37	16	55727937	55727937	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:55727937G>A	ENST00000379906.2	+	6	1189	c.934G>A	c.(934-936)Gca>Aca	p.A312T	SLC6A2_ENST00000568943.1_Missense_Mutation_p.A312T|SLC6A2_ENST00000219833.8_Missense_Mutation_p.A312T|SLC6A2_ENST00000414754.3_Missense_Mutation_p.A312T|SLC6A2_ENST00000566163.1_Missense_Mutation_p.A267T|SLC6A2_ENST00000567238.1_Missense_Mutation_p.A207T|SLC6A2_ENST00000561820.1_Missense_Mutation_p.A312T	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	312					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GATTGATGCCGCAACTCAGAT	0.453																																						ENST00000379906.2	0.110000	0	0.080000	0.020000	0.040000	0.056023	0.040000	0.050000																										0				41						c.(934-936)Gca>Aca		solute carrier family 6 (neurotransmitter transporter), member 2	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)						148.0	142.0	144.0					16																	55727937		2198	4300	6498	SO:0001583	missense	6530	1	121412	34				g.chr16:55727937G>A		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.934G>A	chr16.hg19:g.55727937G>A	ENSP00000369237:p.Ala312Thr	0					SLC6A2_ENST00000567238.1_Missense_Mutation_p.A207T|SLC6A2_ENST00000414754.3_Missense_Mutation_p.A312T|SLC6A2_ENST00000219833.8_Missense_Mutation_p.A312T|SLC6A2_ENST00000568943.1_Missense_Mutation_p.A312T|SLC6A2_ENST00000561820.1_Missense_Mutation_p.A312T|SLC6A2_ENST00000566163.1_Missense_Mutation_p.A267T	p.A312T	NM_001043.3	NP_001034.1	1	2	3	1.982829	P23975	SC6A2_HUMAN		6	1189	+			B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	0	1	hg19	c.934G>A	CCDS10754.1	0	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474824	0.43942	.	.	ENSG00000103546	ENST00000414754;ENST00000537705;ENST00000379906;ENST00000219833	T;T;T	0.75938	-0.98;-0.98;-0.98	4.74	4.74	0.60224	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	D	0.88418	0.6431	M	0.88031	2.925	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.996	D	0.91031	0.4864	10	0.87932	D	0	.	17.3376	0.87286	0.0:0.0:1.0:0.0	.	312;26;207;312	Q96KH8;F5H0T4;B4DX48;P23975	.;.;.;SC6A2_HUMAN	T	312;26;312;312	ENSP00000394956:A312T;ENSP00000369237:A312T;ENSP00000219833:A312T	ENSP00000219833:A312T	A	+	1	0	0	SLC6A2	54285438	54285438	1.000000	0.71417	0.999000	0.59377	0.930000	0.56654	9.501000	0.97979	2.196000	0.70406	0.561000	0.74099	GCA	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.453	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2	0	0	1		2	2	2	0	0	0	0	94	0	94	94	1	2.070000	-2.187734	0	0.390000			0	5	5	0	541	532	0	0	1			0	0	94	0	0	0.934726	0	0	0	0	0	0	5	541
KIFC3	3801	broad.mit.edu	37	16	57803635	57803635	+	Missense_Mutation	SNP	C	C	T	rs146824728	byFrequency	TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:57803635C>T	ENST00000379655.4	-	9	1347	c.1090G>A	c.(1090-1092)Gtc>Atc	p.V364I	KIFC3_ENST00000421376.2_Missense_Mutation_p.V225I|KIFC3_ENST00000539578.1_Missense_Mutation_p.V306I|KIFC3_ENST00000445690.2_Missense_Mutation_p.V364I|KIFC3_ENST00000540079.2_Missense_Mutation_p.V262I|KIFC3_ENST00000541240.1_Missense_Mutation_p.V386I|KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000562903.1_Missense_Mutation_p.V225I|KIFC3_ENST00000465878.2_Missense_Mutation_p.V225I|KIFC3_ENST00000543930.1_Missense_Mutation_p.V225I	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	364					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				TTGGTCCGGACGCCTATGGGG	0.667																																						ENST00000379655.4	1.000000	7.400000e-01	1.000000	0.860000	0.990000	0.950524	0.990000	1.000000																										0				23						c.(1090-1092)Gtc>Atc		kinesin family member C3		C	ILE/VAL,ILE/VAL,ILE/VAL	2,4394	6.2+/-15.9	0,2,2196	34.0	33.0	33.0		673,1090,1090	5.6	1.0	16	dbSNP_134	33	0,8600		0,0,4300	yes	missense,missense,missense	KIFC3	NM_001130099.1,NM_001130100.1,NM_005550.3	29,29,29	0,2,6496	TT,TC,CC		0.0,0.0455,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	225/688,364/827,364/834	57803635	2,12994	2198	4300	6498	SO:0001583	missense	3801	19	121404	40				g.chr16:57803635C>T	BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1090G>A	chr16.hg19:g.57803635C>T	ENSP00000368976:p.Val364Ile	0					KIFC3_ENST00000540079.2_Missense_Mutation_p.V262I|KIFC3_ENST00000543930.1_Missense_Mutation_p.V225I|KIFC3_ENST00000562903.1_Missense_Mutation_p.V225I|KIFC3_ENST00000465878.2_Missense_Mutation_p.V225I|KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000445690.2_Missense_Mutation_p.V364I|KIFC3_ENST00000541240.1_Missense_Mutation_p.V386I|KIFC3_ENST00000539578.1_Missense_Mutation_p.V306I|KIFC3_ENST00000421376.2_Missense_Mutation_p.V225I	p.V364I	NM_005550.3	NP_005541.3	1	2	3	1.976157	Q9BVG8	KIFC3_HUMAN		9	1347	-		all_neural(199;0.224)	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	ENST00000379655.4	1	1	hg19	c.1090G>A	CCDS10789.2	1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.503117	0.64298	4.55E-4	0.0	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000421376;ENST00000541240;ENST00000540079;ENST00000543930;ENST00000539578	T;T;T;T;T;T;T	0.74632	-0.82;-0.8;-0.79;-0.81;-0.78;-0.86;-0.79	5.6	5.6	0.85130	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.69504	0.3118	L	0.54323	1.7	0.58432	D	0.999999	B;P;B;B;B;B;P	0.44627	0.4;0.839;0.4;0.133;0.088;0.4;0.495	B;B;B;B;B;B;B	0.36845	0.051;0.234;0.051;0.08;0.04;0.051;0.058	T	0.71024	-0.4712	10	0.35671	T	0.21	.	18.1742	0.89756	0.0:1.0:0.0:0.0	.	386;306;225;262;69;364;225	B7Z484;F5H4I9;B7Z896;F5H3M2;B7Z3I6;Q9BVG8;A8K6S2	.;.;.;.;.;KIFC3_HUMAN;.	I	364;364;225;386;262;225;306	ENSP00000368976:V364I;ENSP00000401696:V364I;ENSP00000396399:V225I;ENSP00000442008:V386I;ENSP00000438805:V262I;ENSP00000444012:V225I;ENSP00000444884:V306I	ENSP00000368976:V364I	V	-	1	0	0	KIFC3	56361136	56361136	1.000000	0.71417	0.987000	0.45799	0.186000	0.23388	5.980000	0.70516	2.624000	0.88883	0.655000	0.94253	GTC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.667	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	1	0	1		2	2	2	0	0	0	0	47	0	47	45	1	2.070000	-20.000000	1	0.390000	NM_005550		0	37	37	0	151	149	1	0	1	1		0	0	47	0	0	1.000000	9.999954e-01	0	12	0	70	0	37	151
CDH11	1009	broad.mit.edu	37	16	65032559	65032559	+	Silent	SNP	C	C	T	rs574599418		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:65032559C>T	ENST00000268603.4	-	4	1044	c.429G>A	c.(427-429)tcG>tcA	p.S143S	CDH11_ENST00000566827.1_Silent_p.S17S|CDH11_ENST00000394156.3_Silent_p.S143S	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	143	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CAATGAATTCCGACGGTGGCT	0.557			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																												ENST00000268603.4	1.000000	7.400000e-01	1.000000	0.840000	0.950000	0.935818	0.950000	1.000000				Dom	yes			Dom	yes		16	16q22.1	16q22.1	1009	T	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""				M	M	USP6		aneurysmal bone cysts		0				88						c.(427-429)tcG>tcA		cadherin 11, type 2, OB-cadherin (osteoblast)							130.0	105.0	113.0					16																	65032559		2203	4300	6503	SO:0001819	synonymous_variant	1009	2	121412	35				g.chr16:65032559C>T	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.429G>A	chr16.hg19:g.65032559C>T		0	TSP Lung(24;0.17)				CDH11_ENST00000394156.3_Silent_p.S143S|CDH11_ENST00000566827.1_Silent_p.S17S	p.S143S	NM_001797.2	NP_001788.2	1	2	3	1.976157	P55287	CAD11_HUMAN		4	1044	-		Ovarian(137;0.0973)	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	1	1	hg19	c.429G>A	CCDS10803.1	1	.	.	.	.	.	.	.	.	.	.	C	7.100	0.573882	0.13623	.	.	ENSG00000140937	ENST00000536902	.	.	.	5.77	-11.5	0.00074	5.77	-11.5	0.00074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.1085	0.10049	0.127:0.3975:0.2727:0.2028	.	.	.	.	.	-1	.	.	.	-	.	.	.	CDH11	63590060	63590060	0.000000	0.05858	0.005000	0.12908	0.809000	0.45718	-2.084000	0.01363	-3.488000	0.00154	-1.021000	0.02439	.	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.557	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	1	0	1		15	2	2	0	0	0	1	68	0	68	68	1	2.070000	-3.179270	1	0.390000	NM_033664		0	56	56	0	243	242	1	0	1	0		0	0	68	0	0	1.000000	9.999999e-01	0	0	0	108	0	56	243
FHOD1	29109	broad.mit.edu	37	16	67273270	67273270	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:67273270C>T	ENST00000258201.4	-	2	536	c.289G>A	c.(289-291)Ggc>Agc	p.G97S		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	97	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TCATAGAAGCCCTCCAGCATC	0.582																																						ENST00000258201.4	0.830000	4.600000e-01	0.730000	0.540000	0.630000	0.639354	0.630000	0.630000																										0				34						c.(289-291)Ggc>Agc		formin homology 2 domain containing 1							91.0	78.0	83.0					16																	67273270		2198	4300	6498	SO:0001583	missense	29109	0	0					g.chr16:67273270C>T	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.289G>A	chr16.hg19:g.67273270C>T	ENSP00000258201:p.Gly97Ser	0						p.G97S	NM_013241.2	NP_037373.2	1	2	3	1.976157	Q9Y613	FHOD1_HUMAN		2	536	-		Ovarian(137;0.0563)	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	1	1	hg19	c.289G>A	CCDS10834.1	0	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610778	0.46527	.	.	ENSG00000135723	ENST00000258201	T	0.20200	2.09	4.85	2.67	0.31697	4.85	2.67	0.31697	GTPase-binding/formin homology 3 (1);	0.390655	0.28834	N	0.013983	T	0.15262	0.0368	L	0.41492	1.28	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07927	-1.0747	10	0.24483	T	0.36	.	8.5697	0.33561	0.0:0.8069:0.0:0.1931	.	97	Q9Y613	FHOD1_HUMAN	S	97	ENSP00000258201:G97S	ENSP00000258201:G97S	G	-	1	0	0	FHOD1	65830771	65830771	0.100000	0.21855	1.000000	0.80357	0.997000	0.91878	0.337000	0.19841	0.516000	0.28340	0.655000	0.94253	GGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.582	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2	1	0	1		2	2	2	0	0	0	0	87	0	87	85	1	2.070000	-3.318838	1	0.390000			0	42	39	0	300	296	1	0	1	1		0	0	87	0	0	1.000000	7.246828e-01	0	3	0	17	0	42	300
SLC12A4	6560	broad.mit.edu	37	16	67980419	67980419	+	Missense_Mutation	SNP	G	G	A	rs370220716		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:67980419G>A	ENST00000316341.3	-	18	2499	c.2359C>T	c.(2359-2361)Cgg>Tgg	p.R787W	SLC12A4_ENST00000537830.2_Missense_Mutation_p.R781W|SLC12A4_ENST00000572037.1_Missense_Mutation_p.R739W|SLC12A4_ENST00000541864.2_Missense_Mutation_p.R756W|SLC12A4_ENST00000338335.3_Intron|LCAT_ENST00000264005.5_5'Flank|CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000576616.1_Missense_Mutation_p.R787W|SLC12A4_ENST00000422611.2_Missense_Mutation_p.R789W	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	787					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GAGTTATGCCGCATGCCTCCC	0.652																																						ENST00000316341.3	0.190000	3.000000e-02	0.140000	0.050000	0.090000	0.102604	0.090000	0.090000																										0				29						c.(2359-2361)Cgg>Tgg		solute carrier family 12 (potassium/chloride transporter), member 4	Bumetanide(DB00887)|Potassium Chloride(DB00761)	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4396		0,0,2198	56.0	57.0	57.0		2359,2365,2341,2266,2359	2.2	1.0	16		57	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense,missense,missense	SLC12A4	NM_001145961.1,NM_001145962.1,NM_001145963.1,NM_001145964.1,NM_005072.4	101,101,101,101,101	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	787/1080,789/1088,781/1080,756/1055,787/1086	67980419	1,12993	2198	4299	6497	SO:0001583	missense	6560	1	121396	32				g.chr16:67980419G>A		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.2359C>T	chr16.hg19:g.67980419G>A	ENSP00000318557:p.Arg787Trp	0					SLC12A4_ENST00000338335.3_Intron|LCAT_ENST00000264005.5_5'Flank|SLC12A4_ENST00000541864.2_Missense_Mutation_p.R756W|SLC12A4_ENST00000572037.1_Missense_Mutation_p.R739W|SLC12A4_ENST00000537830.2_Missense_Mutation_p.R781W|SLC12A4_ENST00000576616.1_Missense_Mutation_p.R787W|CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000422611.2_Missense_Mutation_p.R789W	p.R787W	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	1	2	3	1.976157	Q9UP95	S12A4_HUMAN		18	2499	-		Ovarian(137;0.192)	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	0	1	hg19	c.2359C>T	CCDS10855.1	0	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728223	0.69074	0.0	1.16E-4	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000316341	D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07	4.57	2.23	0.28157	4.57	2.23	0.28157	.	0.048575	0.85682	D	0.000000	D	0.94837	0.8332	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D	0.63046	0.989;0.986;0.992;0.992;0.992;0.986	P;P;D;P;P;P	0.63381	0.877;0.582;0.914;0.761;0.828;0.582	D	0.93878	0.7168	10	0.87932	D	0	.	11.329	0.49465	0.0:0.0:0.3051:0.6949	.	789;787;756;781;787;787	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	W	789;756;781;787	ENSP00000395983:R789W;ENSP00000438334:R756W;ENSP00000445962:R781W;ENSP00000318557:R787W	ENSP00000318557:R787W	R	-	1	2	2	SLC12A4	66537920	66537920	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.502000	0.53332	0.220000	0.20860	-0.262000	0.10625	CGG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.652	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	0	0	1		15	5	2	1	0	1	1	86	0	86	86	1	2.070000	-2.414368	0	0.390000	NM_005072		0	6	6	0	341	341	0	0	0	0		1	0	86	0	0	0.036408	3.981331e-02	0	0	0	82	0	6	341
WWP2	11060	broad.mit.edu	37	16	69832593	69832593	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:69832593G>A	ENST00000359154.2	+	3	180	c.79G>A	c.(79-81)Gca>Aca	p.A27T	WWP2_ENST00000569174.1_Missense_Mutation_p.A27T|WWP2_ENST00000448661.1_Missense_Mutation_p.A27T|WWP2_ENST00000356003.2_Missense_Mutation_p.A27T	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	27	C2.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AGTGGTGTCCGCAAAGCCCAA	0.527											OREG0023909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000359154.2	0.140000	2.000000e-02	0.100000	0.030000	0.060000	0.072019	0.060000	0.060000																										0				42						c.(79-81)Gca>Aca		WW domain containing E3 ubiquitin protein ligase 2							117.0	115.0	116.0					16																	69832593		2198	4300	6498	SO:0001583	missense	11060	0	0					g.chr16:69832593G>A	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.79G>A	chr16.hg19:g.69832593G>A	ENSP00000352069:p.Ala27Thr	0		OREG0023909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1117	WWP2_ENST00000356003.2_Missense_Mutation_p.A27T|WWP2_ENST00000448661.1_Missense_Mutation_p.A27T|WWP2_ENST00000569174.1_Missense_Mutation_p.A27T	p.A27T	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	1	2	3	1.976157	O00308	WWP2_HUMAN		3	180	+			A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Missense_Mutation	SNP	ENST00000359154.2	0	1	hg19	c.79G>A	CCDS10885.1	0	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551721	0.86127	.	.	ENSG00000198373	ENST00000359154;ENST00000448661;ENST00000356003	T;T;T	0.80738	-1.41;-1.41;-1.41	5.76	5.76	0.90799	5.76	5.76	0.90799	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.198406	0.45606	D	0.000349	T	0.76054	0.3934	M	0.67397	2.05	0.80722	D	1	P	0.46020	0.871	B	0.32583	0.148	T	0.78339	-0.2242	9	.	.	.	.	16.6952	0.85333	0.0:0.0:1.0:0.0	.	27	O00308	WWP2_HUMAN	T	27	ENSP00000352069:A27T;ENSP00000396871:A27T;ENSP00000348283:A27T	.	A	+	1	0	0	WWP2	68390094	68390094	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.778000	0.62368	2.713000	0.92767	0.655000	0.94253	GCA	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.527	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	0	0	1		16	3	12	1	0	1	1	113	0	113	112	1	2.070000	-1.705587	0	0.390000	NM_007014		0	6	7	0	490	488	0	0	0	0	0	1	2	113	360	0	0.024402	2.503172e-02	3.173886e-01	0	1	41	693	6	490
PLCG2	5336	broad.mit.edu	37	16	81942078	81942078	+	Nonsense_Mutation	SNP	A	A	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr16:81942078A>T	ENST00000359376.3	+	17	1829	c.1615A>T	c.(1615-1617)Aag>Tag	p.K539*		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	539	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GAAGGTGGAGAAGAGGACGAG	0.547																																						ENST00000359376.3	1.000000	7.300000e-01	1.000000	0.850000	0.970000	0.940789	0.970000	1.000000																										0				58						c.(1615-1617)Aag>Tag		phospholipase C, gamma 2 (phosphatidylinositol-specific)							75.0	78.0	77.0					16																	81942078		1995	4162	6157	SO:0001587	stop_gained	5336	0	0					g.chr16:81942078A>T		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.1615A>T	chr16.hg19:g.81942078A>T	ENSP00000352336:p.Lys539*	0						p.K539*	NM_002661.3	NP_002652.2	1	2	3	1.976157	P16885	PLCG2_HUMAN		17	1829	+			D3DUL3|Q3ZTS2|Q59H45|Q969T5	Nonsense_Mutation	SNP	ENST00000359376.3	0	1	hg19	c.1615A>T	CCDS42204.1	1	.	.	.	.	.	.	.	.	.	.	A	40	8.275878	0.98737	.	.	ENSG00000197943	ENST00000359376	.	.	.	4.72	4.72	0.59763	4.72	4.72	0.59763	.	0.385009	0.29884	N	0.010957	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	7.2706	0.26254	0.8622:0.0:0.1378:0.0	.	.	.	.	X	539	.	ENSP00000352336:K539X	K	+	1	0	0	PLCG2	80499579	80499579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.998000	0.70653	1.770000	0.52166	0.460000	0.39030	AAG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.547	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1	1	0	1		2	2	2	0	0	0	0	44	0	44	44	1	2.070000	-20.000000	1	0.390000			0	45	43	0	191	190	1	0	1	0		0	0	44	0	0	1.000000	3.243658e-01	0	0	0	6	0	45	191
KRT36	8689	broad.mit.edu	37	17	39643660	39643660	+	Silent	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr17:39643660G>A	ENST00000328119.6	-	5	929	c.930C>T	c.(928-930)atC>atT	p.I310I	KRT36_ENST00000393986.2_Silent_p.I260I	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	310	Coil 2.|Rod.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				GTCTCAGCTCGATGATCTCCG	0.627																																						ENST00000328119.6	1.000000	4.900000e-01	0.940000	0.620000	0.760000	0.775080	0.760000	1.000000																										0				17						c.(928-930)atC>atT		keratin 36							76.0	56.0	63.0					17																	39643660		2203	4300	6503	SO:0001819	synonymous_variant	8689	0	0					g.chr17:39643660G>A	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.930C>T	chr17.hg19:g.39643660G>A		0					KRT36_ENST00000393986.2_Silent_p.I260I	p.I310I	NM_003771.4	NP_003762.1	1	2	3	1.988334	O76013	KRT36_HUMAN		5	929	-		Breast(137;0.000286)	Q86XG4	Silent	SNP	ENST00000328119.6	1	1	hg19	c.930C>T	CCDS11395.1	0																																																																																								0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.627	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	1	0	1		2	2	2	0	0	0	0	32	0	32	31	1	2.070000	-20.000000	1	0.390000	NM_003771		0	20	20	0	115	113	1	0	1	0		0	0	32	0	0	0.999997	0	0	0	0	1	0	20	115
ZBTB4	57659	broad.mit.edu	37	17	7369754	7369754	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr17:7369754G>A	ENST00000311403.4	-	3	706	c.367C>T	c.(367-369)Ccc>Tcc	p.P123S	ZBTB4_ENST00000380599.4_Missense_Mutation_p.P123S	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	123	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		AGGACCCGGGGTGGGGAAGAA	0.592																																						ENST00000311403.4	0.620000	1.500000e-01	0.490000	0.240000	0.350000	0.369311	0.350000	0.330000																										0				36						c.(367-369)Ccc>Tcc		zinc finger and BTB domain containing 4							12.0	16.0	15.0					17																	7369754		2169	4265	6434	SO:0001583	missense	57659	0	0					g.chr17:7369754G>A	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.367C>T	chr17.hg19:g.7369754G>A	ENSP00000307858:p.Pro123Ser	1					ZBTB4_ENST00000380599.4_Missense_Mutation_p.P123S	p.P123S	NM_020899.3	NP_065950.2	0	1	1	1.705046	Q9P1Z0	ZBTB4_HUMAN		3	706	-		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	ENST00000311403.4	0	1	hg19	c.367C>T	CCDS11107.1	0	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034919	0.35893	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.46451	0.87;0.87	4.5	4.5	0.54988	4.5	4.5	0.54988	BTB/POZ-like (2);BTB/POZ fold (2);	0.081322	0.48286	N	0.000193	T	0.14485	0.0350	N	0.01464	-0.85	0.34368	D	0.691707	B	0.33413	0.411	B	0.23018	0.043	T	0.16719	-1.0393	10	0.59425	D	0.04	-17.1852	8.349	0.32290	0.1059:0.0:0.8941:0.0	.	123	Q9P1Z0	ZBTB4_HUMAN	S	123	ENSP00000307858:P123S;ENSP00000369973:P123S	ENSP00000307858:P123S	P	-	1	0	0	ZBTB4	7310478	7310478	1.000000	0.71417	0.996000	0.52242	0.860000	0.49131	1.958000	0.40402	2.332000	0.79248	0.462000	0.41574	CCC	0.283869		TCGA-US-A77E-01A-11D-A32N-08	0.592	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	1	0	1		2	2	2	0	0	0	0	13	0	13	13	1	2.070000	-12.065770	1	0.390000	NM_020899		0	7	7	0	83	82	0	0	1	1		0	0	13	0	0	0.981287	8.041582e-01	0	2	0	36	0	7	83
ARMC7	79637	broad.mit.edu	37	17	73124988	73124988	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr17:73124988C>T	ENST00000245543.1	+	3	754	c.452C>T	c.(451-453)tCg>tTg	p.S151L	NT5C_ENST00000579082.1_5'Flank|ARMC7_ENST00000579096.1_3'UTR|ARMC7_ENST00000581078.1_3'UTR	NM_024585.2	NP_078861.1	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7	151						cytoplasm (GO:0005737)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|pancreas(3)	9	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			TTCTCCCTCTCGGCCAGCGCC	0.701																																						ENST00000245543.1	1.000000	8.000000e-01	1.000000	0.960000	0.990000	0.979937	0.990000	1.000000																										0				9						c.(451-453)tCg>tTg		armadillo repeat containing 7							25.0	23.0	24.0					17																	73124988		2203	4300	6503	SO:0001583	missense	79637	0	0					g.chr17:73124988C>T	AK025813	CCDS11714.1	17q25	2013-02-14				ENSG00000125449		"""Armadillo repeat containing"""	26168	protein-coding gene	gene with protein product						12477932	Standard	NM_024585		Approved	FLJ22160	uc002jmw.1	Q9H6L4		ENST00000245543.1:c.452C>T	chr17.hg19:g.73124988C>T	ENSP00000245543:p.Ser151Leu	0					NT5C_ENST00000579082.1_5'Flank|ARMC7_ENST00000581078.1_3'UTR|ARMC7_ENST00000579096.1_3'UTR	p.S151L	NM_024585.2	NP_078861.1	1	2	3	1.988334	Q9H6L4	ARMC7_HUMAN	LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)	3	754	+	all_lung(278;0.14)|Lung NSC(278;0.168)		B4DVA4	Missense_Mutation	SNP	ENST00000245543.1	1	1	hg19	c.452C>T	CCDS11714.1	1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697716	0.88830	.	.	ENSG00000125449	ENST00000245543	T	0.56444	0.46	5.18	5.18	0.71444	5.18	5.18	0.71444	Armadillo-like helical (1);Armadillo-type fold (1);	0.071680	0.64402	D	0.000016	T	0.70228	0.3200	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.63033	0.91	T	0.73219	-0.4052	10	0.72032	D	0.01	.	19.0722	0.93143	0.0:1.0:0.0:0.0	.	151	Q9H6L4	ARMC7_HUMAN	L	151	ENSP00000245543:S151L	ENSP00000245543:S151L	S	+	2	0	0	ARMC7	70636583	70636583	1.000000	0.71417	0.977000	0.42913	0.480000	0.33159	7.771000	0.85420	2.595000	0.87683	0.655000	0.94253	TCG	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.701	ARMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445846.1	1	0	1		2	2	2	0	0	0	0	26	0	26	26	1	2.070000	-20.000000	1	0.390000	NM_024585		0	28	28	0	98	98	1	0	1	1		0	0	26	0	0	1.000000	8.160037e-01	0	4	0	9	0	28	98
ENGASE	64772	broad.mit.edu	37	17	77081767	77081767	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr17:77081767C>T	ENST00000579016.1	+	13	1766	c.1766C>T	c.(1765-1767)cCg>cTg	p.P589L		NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	589						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						TCACGGCCGCCGGGTAGTCGG	0.647																																						ENST00000579016.1	1.000000	7.800000e-01	1.000000	0.890000	0.990000	0.961933	0.990000	1.000000																										0				25						c.(1765-1767)cCg>cTg		endo-beta-N-acetylglucosaminidase							35.0	39.0	38.0					17																	77081767		2046	4201	6247	SO:0001583	missense	64772	2	120930	30				g.chr17:77081767C>T	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1766C>T	chr17.hg19:g.77081767C>T	ENSP00000462333:p.Pro589Leu	0						p.P589L	NM_001042573.2	NP_001036038.1	1	2	3	1.988334	Q8NFI3	ENASE_HUMAN		13	1766	+			Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	ENST00000579016.1	1	1	hg19	c.1766C>T	CCDS42394.1	1	.	.	.	.	.	.	.	.	.	.	C	4.447	0.082790	0.08533	.	.	ENSG00000167280	ENST00000545583	.	.	.	5.12	-2.66	0.06077	5.12	-2.66	0.06077	.	0.740232	0.11997	N	0.509178	T	0.22820	0.0551	L	0.36672	1.1	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.17992	-1.0351	9	0.28530	T	0.3	-14.6675	0.6221	0.00780	0.2261:0.2603:0.1292:0.3843	.	589	Q8NFI3	ENASE_HUMAN	L	589	.	ENSP00000438577:P589L	P	+	2	0	0	ENGASE	74593362	74593362	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.211000	0.09332	-0.062000	0.13088	0.462000	0.41574	CCG	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.647	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	1	0	1		2	2	2	0	0	0	0	54	0	54	52	1	2.070000	-3.423686	1	0.390000	NM_022759		0	56	55	0	228	224	1	0	1	1		0	0	54	0	0	1.000000	9.999064e-01	0	18	0	41	0	56	228
GAA	2548	broad.mit.edu	37	17	78085870	78085870	+	Silent	SNP	C	C	T	rs112517802		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr17:78085870C>T	ENST00000302262.3	+	12	1944	c.1725C>T	c.(1723-1725)taC>taT	p.Y575Y	GAA_ENST00000390015.3_Silent_p.Y575Y	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	575			Y -> C (in GSD2). {ECO:0000269|PubMed:22644586}.|Y -> S (in GSD2; juvenile form). {ECO:0000269|PubMed:14695532}.		cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	ACAACCTCTACGGCCTGACCG	0.657																																						ENST00000302262.3	1.000000	8.300000e-01	1.000000	0.920000	0.990000	0.974530	0.990000	1.000000																										0				21						c.(1723-1725)taC>taT		glucosidase, alpha; acid	Acarbose(DB00284)|Miglitol(DB00491)						119.0	100.0	107.0					17																	78085870		2203	4300	6503	SO:0001819	synonymous_variant	2548	2	121412	37				g.chr17:78085870C>T		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.1725C>T	chr17.hg19:g.78085870C>T		0					GAA_ENST00000390015.3_Silent_p.Y575Y	p.Y575Y	NM_000152.3	NP_000143.2	1	2	3	1.988334	P10253	LYAG_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)	12	1944	+	all_neural(118;0.117)		Q09GN4|Q14351|Q16302|Q8IWE7	Silent	SNP	ENST00000302262.3	1	1	hg19	c.1725C>T	CCDS32760.1	1																																																																																								0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.657	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1	1	0	1		2	2	2	0	0	0	0	95	0	95	94	1	2.070000	-20.000000	1	0.390000			0	86	85	0	345	338	0	0	1	1		0	0	95	0	0	1.000000	1	0	9	0	126	0	86	345
CELF4	56853	broad.mit.edu	37	18	34854360	34854360	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr18:34854360G>A	ENST00000591282.1	-	6	714	c.715C>T	c.(715-717)Cgg>Tgg	p.R239W	CELF4_ENST00000588597.1_Missense_Mutation_p.R228W|CELF4_ENST00000361795.5_Missense_Mutation_p.R238W|CELF4_ENST00000601019.1_Missense_Mutation_p.R238W|CELF4_ENST00000603232.1_Missense_Mutation_p.R239W|RP11-797E24.3_ENST00000586610.1_RNA|RP11-797E24.3_ENST00000588766.1_RNA|CELF4_ENST00000420428.2_Missense_Mutation_p.R239W|CELF4_ENST00000591287.1_Missense_Mutation_p.R238W|CELF4_ENST00000334919.5_Missense_Mutation_p.R229W|CELF4_ENST00000412753.1_Missense_Mutation_p.R239W			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	239	Necessary for TNNT2 exon 5 inclusion.|Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)	p.R239W(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						TGCATTCGCCGCATCGTGCGC	0.667																																						ENST00000591282.1	0.100000	0	0.070000	0.020000	0.040000	0.047934	0.040000	0.040000																										1	Substitution - Missense(1)	p.R239W(1)	large_intestine(1)	44						c.(715-717)Cgg>Tgg		CUGBP, Elav-like family member 4							103.0	85.0	91.0					18																	34854360		2203	4300	6503	SO:0001583	missense	56853	0	0					g.chr18:34854360G>A	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.715C>T	chr18.hg19:g.34854360G>A	ENSP00000464794:p.Arg239Trp	0					CELF4_ENST00000601019.1_Missense_Mutation_p.R238W|CELF4_ENST00000420428.2_Missense_Mutation_p.R239W|CELF4_ENST00000334919.5_Missense_Mutation_p.R229W|CELF4_ENST00000603232.1_Missense_Mutation_p.R239W|CELF4_ENST00000588597.1_Missense_Mutation_p.R228W|CELF4_ENST00000361795.5_Missense_Mutation_p.R238W|RP11-797E24.3_ENST00000588766.1_RNA|CELF4_ENST00000591287.1_Missense_Mutation_p.R238W|RP11-797E24.3_ENST00000586610.1_RNA|CELF4_ENST00000412753.1_Missense_Mutation_p.R239W	p.R239W			1	2	3	1.976333	Q9BZC1	CELF4_HUMAN		6	714	-			Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Missense_Mutation	SNP	ENST00000591282.1	0	1	hg19	c.715C>T	CCDS32818.1	0	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159388	0.78226	.	.	ENSG00000101489	ENST00000361795;ENST00000412753;ENST00000420428;ENST00000334919;ENST00000361683	T;T;T	0.06449	3.3;3.31;3.31	4.55	3.59	0.41128	4.55	3.59	0.41128	.	0.000000	0.85682	D	0.000000	T	0.29882	0.0747	M	0.91510	3.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.993;1.0;0.999;0.996	T	0.19614	-1.0300	10	0.87932	D	0	-12.5849	12.0837	0.53686	0.0:0.0:0.7247:0.2753	.	238;228;229;238;239	Q9BZC1-3;B4DHA8;Q9BZC1-5;Q9BZC1-2;Q9BZC1	.;.;.;.;CELF4_HUMAN	W	239;239;238;229;122	ENSP00000355089:R239W;ENSP00000406823:R239W;ENSP00000335631:R229W	ENSP00000335631:R229W	R	-	1	2	2	CELF4	33108358	33108358	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.280000	0.43443	2.373000	0.80994	0.561000	0.74099	CGG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.667	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440892.1	0	0	1		14	2	2	1	0	1	1	164	0	164	162	1	2.070000	-1.778118	0	0.390000	NM_020180		0	5	5	0	632	622	0	0	0			1	0	164	0	0	0.028245	0	0	0	0	0	0	5	632
PGLYRP2	114770	broad.mit.edu	37	19	15586705	15586705	+	Missense_Mutation	SNP	G	G	A	rs373142402		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr19:15586705G>A	ENST00000340880.4	-	2	1256	c.776C>T	c.(775-777)aCg>aTg	p.T259M	PGLYRP2_ENST00000292609.4_Missense_Mutation_p.T259M	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	259					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						GTCCAAAAGCGTAAAGGTCCG	0.612													g|||	1	0.000199681	0.0	0.0014	5008	,	,		19754	0.0		0.0	False		,,,				2504	0.0					ENST00000340880.4	1.000000	2.000000e-02	0.170000	0.050000	0.100000	0.137632	0.100000	0.090000																										0				28						c.(775-777)aCg>aTg		peptidoglycan recognition protein 2							35.0	35.0	35.0					19																	15586705		2203	4300	6503	SO:0001583	missense	114770	18	121412	42				g.chr19:15586705G>A	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.776C>T	chr19.hg19:g.15586705G>A	ENSP00000345968:p.Thr259Met	0					PGLYRP2_ENST00000292609.4_Missense_Mutation_p.T259M	p.T259M	NM_052890.3	NP_443122.3	1	2	3	1.994306	Q96PD5	PGRP2_HUMAN		2	1256	-			A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Missense_Mutation	SNP	ENST00000340880.4	0	1	hg19	c.776C>T	CCDS12330.2	0	.	.	.	.	.	.	.	.	.	.	g	3.963	-0.009976	0.07727	.	.	ENSG00000161031	ENST00000340880;ENST00000292609	T;T	0.05025	3.53;3.51	5.31	3.19	0.36642	5.31	3.19	0.36642	.	0.237201	0.32901	N	0.005502	T	0.07728	0.0194	M	0.76002	2.32	0.22819	N	0.998691	P;P	0.43431	0.807;0.576	B;B	0.37267	0.245;0.048	T	0.31943	-0.9925	10	0.66056	D	0.02	-22.5225	4.5625	0.12166	0.0828:0.1521:0.6077:0.1574	.	259;259	Q96PD5-2;Q96PD5	.;PGRP2_HUMAN	M	259	ENSP00000345968:T259M;ENSP00000292609:T259M	ENSP00000292609:T259M	T	-	2	0	0	PGLYRP2	15447705	15447705	0.978000	0.34361	0.446000	0.26920	0.000000	0.00434	2.391000	0.44424	0.647000	0.30713	-1.032000	0.02404	ACG	0.394721		TCGA-US-A77E-01A-11D-A32N-08	0.612	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	0	0	1		2	2	2	0	0	0	0	43	0	43	43	1	2.070000	-5.363324	1	0.390000	NM_052890		0	4	4	0	223	223	0	0	1			0	0	43	0	0	0.891148	0	0	0	0	0	0	4	223
SHKBP1	92799	broad.mit.edu	37	19	41096643	41096643	+	Silent	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr19:41096643C>T	ENST00000291842.5	+	17	1825	c.1776C>T	c.(1774-1776)ggC>ggT	p.G592G	LTBP4_ENST00000545697.1_5'Flank|SHKBP1_ENST00000600733.1_Silent_p.G567G|LTBP4_ENST00000204005.9_5'Flank	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	592					protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAGCAGGTGGCCTGACGGAGC	0.662																																						ENST00000291842.5	1.000000	6.200000e-01	0.870000	0.690000	0.770000	0.789007	0.770000	0.780000																										0				29						c.(1774-1776)ggC>ggT		SH3KBP1 binding protein 1							56.0	65.0	62.0					19																	41096643		2203	4300	6503	SO:0001819	synonymous_variant	92799	0	0					g.chr19:41096643C>T	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1776C>T	chr19.hg19:g.41096643C>T		0					SHKBP1_ENST00000600733.1_Silent_p.G567G|LTBP4_ENST00000545697.1_5'Flank|LTBP4_ENST00000204005.9_5'Flank	p.G592G	NM_138392.3	NP_612401.2	1	2	3	2.001483	Q8TBC3	SHKB1_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)	17	1825	+			Q8N2I6|Q8WY93|Q96IB8	Silent	SNP	ENST00000291842.5	1	1	hg19	c.1776C>T	CCDS12560.1	0																																																																																								0.395890		TCGA-US-A77E-01A-11D-A32N-08	0.662	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	1	0	1		2	2	2	0	0	0	0	114	0	114	112	1	2.070000	-20.000000	1	0.390000	NM_138392		0	79	77	0	448	443	1	0	1	1		0	0	114	0	0	1.000000	1	0	71	0	133	0	79	448
PSG6	5675	broad.mit.edu	37	19	43411874	43411874	+	Missense_Mutation	SNP	G	G	A	rs142652144		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr19:43411874G>A	ENST00000292125.2	-	4	883	c.839C>T	c.(838-840)cCg>cTg	p.P280L	PSG6_ENST00000187910.2_Missense_Mutation_p.P280L|PSG6_ENST00000402603.4_Intron	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	280	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				CGGACTGACCGGGAGGCTCTG	0.478													.|||	1	0.000199681	0.0	0.0014	5008	,	,		21246	0.0		0.0	False		,,,				2504	0.0					ENST00000292125.2	1.000000	8.700000e-01	1.000000	0.920000	0.980000	0.972773	0.980000	1.000000																										0				44						c.(838-840)cCg>cTg		pregnancy specific beta-1-glycoprotein 6		G	LEU/PRO,LEU/PRO	11,4391		0,11,2190	276.0	266.0	270.0		839,839	-1.3	0.0	19	dbSNP_134	270	0,8598		0,0,4299	no	missense,missense	PSG6	NM_001031850.2,NM_002782.3	98,98	0,11,6489	AA,AG,GG		0.0,0.2499,0.0846	,	280/425,280/436	43411874	11,12989	2201	4299	6500	SO:0001583	missense	5675	23	121356	50				g.chr19:43411874G>A		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.839C>T	chr19.hg19:g.43411874G>A	ENSP00000292125:p.Pro280Leu	0					PSG6_ENST00000187910.2_Missense_Mutation_p.P280L|PSG6_ENST00000402603.4_Intron	p.P280L	NM_002782.4	NP_002773.1	1	2	3	2.001483	Q00889	PSG6_HUMAN		4	883	-		Prostate(69;0.00899)	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	1	1	hg19	c.839C>T	CCDS12613.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	N	0.009	-1.803836	0.00611	0.002499	0.0	ENSG00000170848	ENST00000187910;ENST00000292125	T;T	0.13307	2.6;2.6	1.42	-1.33	0.09172	1.42	-1.33	0.09172	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.21962	0.0529	L	0.52266	1.64	0.09310	N	1	D;B	0.89917	1.0;0.015	D;B	0.97110	1.0;0.038	T	0.16453	-1.0402	9	0.39692	T	0.17	.	1.6928	0.02856	0.2473:0.0:0.4168:0.3359	.	280;280	Q00889;Q00889-2	PSG6_HUMAN;.	L	280	ENSP00000187910:P280L;ENSP00000292125:P280L	ENSP00000187910:P280L	P	-	2	0	0	PSG6	48103714	48103714	0.000000	0.05858	0.005000	0.12908	0.184000	0.23303	0.090000	0.15025	-0.070000	0.12908	0.134000	0.15878	CCG	0.395890		TCGA-US-A77E-01A-11D-A32N-08	0.478	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	1	0	1		2	2	2	0	0	0	0	274	0	274	268	1	2.070000	-2.719552	1	0.390000	NM_002782		0	256	253	0	1086	1042	1	0	1			0	0	274	0	0	1.000000	0	0	0	0	0	0	256	1086
C5AR1	728	broad.mit.edu	37	19	47823129	47823129	+	Missense_Mutation	SNP	C	C	T	rs200400919		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr19:47823129C>T	ENST00000355085.3	+	2	117	c.95C>T	c.(94-96)aCg>aTg	p.T32M		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	32					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)	p.T32M(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		ACTTCTAACACGCTGCGTGTT	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20641	0.0		0.0	False		,,,				2504	0.001					ENST00000355085.3	1.000000	8.000000e-01	1.000000	0.900000	0.990000	0.963577	0.990000	1.000000																										1	Substitution - Missense(1)	p.T32M(1)	lung(1)	20						c.(94-96)aCg>aTg		complement component 5a receptor 1							168.0	142.0	150.0					19																	47823129		2203	4300	6503	SO:0001583	missense	728	4	121412	38				g.chr19:47823129C>T		CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.95C>T	chr19.hg19:g.47823129C>T	ENSP00000347197:p.Thr32Met	0						p.T32M	NM_001736.3	NP_001727.1	1	2	3	2.001483	P21730	C5AR1_HUMAN		2	117	+		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		Missense_Mutation	SNP	ENST00000355085.3	1	1	hg19	c.95C>T	CCDS33063.1	1	.	.	.	.	.	.	.	.	.	.	C	9.210	1.030611	0.19512	.	.	ENSG00000197405	ENST00000355085	T	0.37411	1.2	3.85	-7.7	0.01259	3.85	-7.7	0.01259	.	0.484862	0.17251	U	0.181174	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	P	0.51653	0.947	B	0.38296	0.27	T	0.32771	-0.9894	10	0.48119	T	0.1	.	2.3954	0.04388	0.2001:0.3146:0.3273:0.158	.	32	P21730	C5AR_HUMAN	M	32	ENSP00000347197:T32M	ENSP00000347197:T32M	T	+	2	0	0	C5AR1	52514969	52514969	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-3.504000	0.00449	-2.504000	0.00508	-0.792000	0.03331	ACG	0.395890		TCGA-US-A77E-01A-11D-A32N-08	0.532	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466925.1	0	0	1		2	2	2	0	0	0	0	77	0	77	76	1	2.070000	-20.000000	1	0.390000	NM_001736		0	69	69	0	286	284	1	0	1	0		0	0	77	0	0	1.000000	9.188805e-01	0	0	0	20	0	69	286
NLRP4	147945	broad.mit.edu	37	19	56369561	56369561	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr19:56369561A>G	ENST00000301295.6	+	3	1224	c.802A>G	c.(802-804)Aag>Gag	p.K268E	NLRP4_ENST00000346986.5_Missense_Mutation_p.K268E|NLRP4_ENST00000587891.1_Missense_Mutation_p.K193E	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	268	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GCTGAGGAAGAAGATGCTCCC	0.592																																						ENST00000301295.6	1.000000	7.600000e-01	1.000000	0.840000	0.940000	0.933178	0.940000	1.000000																										0				42						c.(802-804)Aag>Gag		NLR family, pyrin domain containing 4							74.0	82.0	79.0					19																	56369561		2203	4300	6503	SO:0001583	missense	147945	0	0					g.chr19:56369561A>G	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.802A>G	chr19.hg19:g.56369561A>G	ENSP00000301295:p.Lys268Glu	0					NLRP4_ENST00000346986.5_Missense_Mutation_p.K268E|NLRP4_ENST00000587891.1_Missense_Mutation_p.K193E	p.K268E	NM_134444.4	NP_604393.2	1	2	3	2.011441	Q96MN2	NALP4_HUMAN		3	1224	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	1	1	hg19	c.802A>G	CCDS12936.1	1	.	.	.	.	.	.	.	.	.	.	A	15.58	2.876238	0.51801	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.79653	-1.29;-1.29	4.1	3.05	0.35203	4.1	3.05	0.35203	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.81640	0.4865	L	0.41079	1.255	0.09310	N	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.78314	0.947;0.984;0.991	T	0.67692	-0.5605	9	0.18276	T	0.48	.	6.9127	0.24344	0.629:0.0:0.0:0.371	.	268;193;268	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	E	268	ENSP00000301295:K268E;ENSP00000344787:K268E	ENSP00000301295:K268E	K	+	1	0	0	NLRP4	61061373	61061373	0.000000	0.05858	0.008000	0.14137	0.087000	0.18053	1.126000	0.31344	0.689000	0.31550	0.533000	0.62120	AAG	0.397054		TCGA-US-A77E-01A-11D-A32N-08	0.592	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	1	0	1		2	2	2	0	0	0	0	96	0	96	96	1	2.070000	-20.000000	1	0.390000	NM_134444		0	77	76	0	346	343	1	0	1			0	0	96	0	0	1.000000	0	0	0	0	0	0	77	346
MED16	10025	broad.mit.edu	37	19	868430	868430	+	Nonsense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr19:868430C>T	ENST00000589119.1	-	14	2468	c.2469G>A	c.(2467-2469)tgG>tgA	p.W823*	MED16_ENST00000325464.1_Nonsense_Mutation_p.W823*|MED16_ENST00000395808.3_Nonsense_Mutation_p.W823*|MED16_ENST00000312090.6_Nonsense_Mutation_p.W842*|MED16_ENST00000269814.4_3'UTR			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	823					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTTCTTGATCCAGCGCTGCT	0.667																																						ENST00000589119.1	1.000000	2.400000e-01	0.580000	0.330000	0.430000	0.470238	0.430000	0.410000																										0				21						c.(2467-2469)tgG>tgA		mediator complex subunit 16							39.0	37.0	38.0					19																	868430		2201	4297	6498	SO:0001587	stop_gained	10025	0	0					g.chr19:868430C>T	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.2469G>A	chr19.hg19:g.868430C>T	ENSP00000464810:p.Trp823*	0					MED16_ENST00000395808.3_Nonsense_Mutation_p.W823*|MED16_ENST00000269814.4_3'UTR|MED16_ENST00000312090.6_Nonsense_Mutation_p.W842*|MED16_ENST00000325464.1_Nonsense_Mutation_p.W823*	p.W823*			1	2	3	2.013232	Q9Y2X0	MED16_HUMAN		14	2468	-		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Nonsense_Mutation	SNP	ENST00000589119.1	0	1	hg19	c.2469G>A	CCDS12047.1	0	.	.	.	.	.	.	.	.	.	.	C	40	8.283552	0.98742	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808	.	.	.	4.27	4.27	0.50696	4.27	4.27	0.50696	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.7101	15.6761	0.77326	0.0:1.0:0.0:0.0	.	.	.	.	X	823;842;823	.	ENSP00000308528:W842X	W	-	3	0	0	MED16	819430	819430	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.266000	0.78452	1.941000	0.56285	0.511000	0.50034	TGG	0.397054		TCGA-US-A77E-01A-11D-A32N-08	0.667	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	1	0	1		2	2	2	0	0	0	0	37	0	37	37	1	2.070000	-18.449790	1	0.390000	NM_005481		0	13	13	0	147	146	0	0	1	1		0	0	37	0	0	0.999589	9.999975e-01	0	99	0	204	0	13	147
NLRP8	126205	broad.mit.edu	37	19	56467178	56467178	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr19:56467178G>A	ENST00000291971.3	+	3	1825	c.1754G>A	c.(1753-1755)aGg>aAg	p.R585K	NLRP8_ENST00000590542.1_Missense_Mutation_p.R585K	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	585					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GGTAATAAGAGGAAACTGCTG	0.498																																						ENST00000291971.3	1.000000	5.700000e-01	0.980000	0.680000	0.810000	0.821973	0.810000	1.000000																										0				35						c.(1753-1755)aGg>aAg		NLR family, pyrin domain containing 8							51.0	47.0	49.0					19																	56467178		2203	4300	6503	SO:0001583	missense	126205	0	0					g.chr19:56467178G>A	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1754G>A	chr19.hg19:g.56467178G>A	ENSP00000291971:p.Arg585Lys	0					NLRP8_ENST00000590542.1_Missense_Mutation_p.R585K	p.R585K	NM_176811.2	NP_789781.2	1	2	3	2.011441	Q86W28	NALP8_HUMAN		3	1825	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	1	1	hg19	c.1754G>A	CCDS12937.1	0	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.716604	0.00706	.	.	ENSG00000179709	ENST00000291971	D	0.88431	-2.38	2.03	-3.26	0.05064	2.03	-3.26	0.05064	.	.	.	.	.	T	0.70649	0.3248	N	0.08118	0	0.09310	N	1	B;B	0.20780	0.036;0.048	B;B	0.13407	0.007;0.009	T	0.56703	-0.7935	9	0.18710	T	0.47	.	4.4176	0.11465	0.2921:0.221:0.4869:0.0	.	585;585	Q86W28-2;Q86W28	.;NALP8_HUMAN	K	585	ENSP00000291971:R585K	ENSP00000291971:R585K	R	+	2	0	0	NLRP8	61158990	61158990	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.103000	0.10940	-1.059000	0.03193	-0.507000	0.04495	AGG	0.397054		TCGA-US-A77E-01A-11D-A32N-08	0.498	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	1	0	1		2	2	2	0	0	0	0	45	0	45	45	1	2.070000	-20.000000	1	0.390000	NM_176811		0	31	31	0	168	167	1	0	1			0	0	45	0	0	1.000000	0	0	0	0	0	0	31	168
GABRD	2563	broad.mit.edu	37	1	1961076	1961076	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr1:1961076G>A	ENST00000378585.4	+	8	1017	c.934G>A	c.(934-936)Gtc>Atc	p.V312I		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	312					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGCACTGGACGTCTACTTCTG	0.592																																						ENST00000378585.4	1.000000	6.000000e-01	1.000000	0.710000	0.840000	0.846143	0.840000	1.000000																										0				20						c.(934-936)Gtc>Atc		gamma-aminobutyric acid (GABA) A receptor, delta	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)						119.0	102.0	108.0					1																	1961076		2201	4300	6501	SO:0001583	missense	2563	17	121328	42				g.chr1:1961076G>A	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.934G>A	chr1.hg19:g.1961076G>A	ENSP00000367848:p.Val312Ile	0						p.V312I	NM_000815.4	NP_000806.2	1	2	3	2.026464	O14764	GBRD_HUMAN		8	1017	+	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)	Q8N4N9	Missense_Mutation	SNP	ENST00000378585.4	1	1	hg19	c.934G>A	CCDS36.1	0	.	.	.	.	.	.	.	.	.	.	G	8.302	0.820039	0.16678	.	.	ENSG00000187730	ENST00000378585	D	0.85773	-2.03	4.0	4.0	0.46444	4.0	4.0	0.46444	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.145269	0.46145	D	0.000310	D	0.85969	0.5821	L	0.36672	1.1	0.58432	D	0.999996	D	0.76494	0.999	D	0.79784	0.993	T	0.80984	-0.1138	10	0.02654	T	1	-16.1297	15.6431	0.77025	0.0:0.0:1.0:0.0	.	312	O14764	GBRD_HUMAN	I	312	ENSP00000367848:V312I	ENSP00000367848:V312I	V	+	1	0	0	GABRD	1950936	1950936	1.000000	0.71417	0.994000	0.49952	0.343000	0.28985	9.302000	0.96175	2.239000	0.73571	0.561000	0.74099	GTC	0.399370		TCGA-US-A77E-01A-11D-A32N-08	0.592	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	1	0	1		2	2	2	0	0	0	0	40	0	40	40	1	2.070000	-20.000000	1	0.390000	NM_000815		0	36	36	0	189	189	1	0	1	0		0	0	40	0	0	1.000000	3.828524e-01	0	0	0	8	0	36	189
CELA3A	10136	broad.mit.edu	37	1	22329556	22329556	+	Missense_Mutation	SNP	C	C	T	rs550611930		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr1:22329556C>T	ENST00000290122.3	+	2	123	c.104C>T	c.(103-105)gCg>gTg	p.A35V	RN7SL768P_ENST00000584415.1_RNA|CELA3A_ENST00000374663.1_Missense_Mutation_p.A35V	NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	35	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)	p.A35V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGTGAGGATGCGGTCCCCTAC	0.612																																						ENST00000290122.3	1.000000	1.000000e-02	0.100000	0.030000	0.060000	0.112506	0.060000	0.060000																										1	Substitution - Missense(1)	p.A35V(1)	lung(1)	18						c.(103-105)gCg>gTg		chymotrypsin-like elastase family, member 3A							61.0	90.0	81.0					1																	22329556		2140	4289	6429	SO:0001583	missense	10136	1	119974	32				g.chr1:22329556C>T	D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.104C>T	chr1.hg19:g.22329556C>T	ENSP00000290122:p.Ala35Val	0					RN7SL768P_ENST00000584415.1_RNA|CELA3A_ENST00000374663.1_Missense_Mutation_p.A35V	p.A35V	NM_005747.4	NP_005738.4	1	2	3	2.014975	P09093	CEL3A_HUMAN		2	123	+			B1AQ53|Q9BRW4	Missense_Mutation	SNP	ENST00000290122.3	0	1	hg19	c.104C>T	CCDS220.1	0	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689677	0.68271	.	.	ENSG00000142789	ENST00000290122;ENST00000374663;ENST00000374661	T;D	0.94417	2.07;-3.42	3.47	2.54	0.30619	3.47	2.54	0.30619	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.92639	0.7661	L	0.48260	1.515	0.43756	D	0.996263	D	0.71674	0.998	P	0.52627	0.704	D	0.89403	0.3697	9	0.39692	T	0.17	-25.4813	6.7714	0.23596	0.0:0.8655:0.0:0.1345	.	35	P09093	CEL3A_HUMAN	V	35;35;51	ENSP00000290122:A35V;ENSP00000363795:A35V	ENSP00000290122:A35V	A	+	2	0	0	CELA3A	22202143	22202143	0.996000	0.38824	0.042000	0.18584	0.880000	0.50808	3.389000	0.52516	0.781000	0.33589	0.400000	0.26472	GCG	0.397054		TCGA-US-A77E-01A-11D-A32N-08	0.612	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007791.1	0	0	1		2	2	2	0	0	0	0	91	0	91	91	1	2.070000	-2.066993	0	0.390000	NM_005747		0	5	5	0	444	427	0	0	1	0		0	0	91	0	0	0.931308	1.207299e-03	0	0	0	4	0	5	444
NES	10763	broad.mit.edu	37	1	156639754	156639754	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr1:156639754G>T	ENST00000368223.3	-	4	4358	c.4226C>A	c.(4225-4227)tCc>tAc	p.S1409Y		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1409	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAACCCATCGGACTCCCCATC	0.647																																						ENST00000368223.3	1.000000	1.600000e-01	0.430000	0.230000	0.310000	0.351699	0.310000	0.300000																										0				64						c.(4225-4227)tCc>tAc		nestin							22.0	24.0	24.0					1																	156639754		2201	4297	6498	SO:0001583	missense	10763	0	0					g.chr1:156639754G>T	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.4226C>A	chr1.hg19:g.156639754G>T	ENSP00000357206:p.Ser1409Tyr	0						p.S1409Y	NM_006617.1	NP_006608.1	1	2	3	2.005218	P48681	NEST_HUMAN		4	4358	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	1	1	hg19	c.4226C>A	CCDS1151.1	0	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219120	0.58560	.	.	ENSG00000132688	ENST00000368223	D	0.93811	-3.29	4.46	4.46	0.54185	4.46	4.46	0.54185	.	0.000000	0.32640	N	0.005837	D	0.94215	0.8143	M	0.66939	2.045	0.26797	N	0.969277	D	0.76494	0.999	D	0.71184	0.972	D	0.89006	0.3425	10	0.87932	D	0	.	11.8552	0.52433	0.0:0.0:0.8245:0.1755	.	1409	P48681	NEST_HUMAN	Y	1409	ENSP00000357206:S1409Y	ENSP00000357206:S1409Y	S	-	2	0	0	NES	154906378	154906378	0.996000	0.38824	1.000000	0.80357	0.933000	0.57130	3.567000	0.53813	2.316000	0.78162	0.557000	0.71058	TCC	0.395890		TCGA-US-A77E-01A-11D-A32N-08	0.647	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	1	0	1		2	2	2	0	0	0	0	54	0	54	53	1	2.070000	-14.998890	1	0.390000	NM_006617		0	11	11	0	176	175	0	0	1	0		0	0	54	0	0	0.998442	7.919837e-01	0	0	0	49	0	11	176
PTCH2	8643	broad.mit.edu	37	1	45294946	45294946	+	Silent	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr1:45294946G>A	ENST00000372192.3	-	10	1384	c.1254C>T	c.(1252-1254)tgC>tgT	p.C418C	PTCH2_ENST00000447098.2_Silent_p.C418C	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	418	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					GGGACTGGGCGCAGTCCCACC	0.687									Basal Cell Nevus syndrome																													ENST00000372192.3	1.000000	4.000000e-02	0.190000	0.070000	0.110000	0.167791	0.110000	0.110000																										0				50						c.(1252-1254)tgC>tgT		patched 2							26.0	30.0	28.0					1																	45294946		2203	4298	6501	SO:0001819	synonymous_variant	8643	1	121380	28	Basal Cell Nevus syndrome	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	g.chr1:45294946G>A	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.1254C>T	chr1.hg19:g.45294946G>A		0					PTCH2_ENST00000447098.2_Silent_p.C418C	p.C418C	NM_003738.4	NP_003729.3	1	2	3	2.014431	Q9Y6C5	PTC2_HUMAN		10	1384	-	Acute lymphoblastic leukemia(166;0.155)		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Silent	SNP	ENST00000372192.3	0	1	hg19	c.1254C>T	CCDS516.1	0																																																																																								0.397054		TCGA-US-A77E-01A-11D-A32N-08	0.687	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	0	0	1		2	2	2	0	0	0	0	54	0	54	52	1	2.070000	-6.115855	1	0.390000	NM_003738		0	5	5	0	237	234	0	0	1	0		0	0	54	0	0	0.936124	4.035170e-03	0	0	0	4	0	5	237
CNIH3	149111	broad.mit.edu	37	1	224868727	224868727	+	Splice_Site	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr1:224868727C>T	ENST00000272133.3	+	2	1031	c.149C>T	c.(148-150)gCg>gTg	p.A50V		NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3	50					intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)			large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		CCTGTTCATGCGGTAAGTGGC	0.473																																						ENST00000272133.3	1.000000	5.900000e-01	0.890000	0.680000	0.770000	0.787582	0.770000	0.780000																										0				9						c.(148-150)gCg>gTg		cornichon family AMPA receptor auxiliary protein 3							116.0	112.0	113.0					1																	224868727		2203	4300	6503	SO:0001630	splice_region_variant	149111	3	121412	37				g.chr1:224868727C>T	AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.150+1C>T	chr1.hg19:g.224868727C>T		0						p.A50V	NM_152495.1	NP_689708.1	1	2	3	1.991274	Q8TBE1	CNIH3_HUMAN		2	1031	+	Breast(184;0.218)			Splice_Site	SNP	ENST00000272133.3	1	0	hg19	c.149C>T	CCDS1544.1	0	.	.	.	.	.	.	.	.	.	.	C	23.2	4.386315	0.82902	.	.	ENSG00000143786	ENST00000272133	.	.	.	5.32	5.32	0.75619	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.67268	0.2875	L	0.29908	0.895	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	T	0.69800	-0.5047	9	0.59425	D	0.04	-0.2012	17.7753	0.88505	0.0:1.0:0.0:0.0	.	50	Q8TBE1	CNIH3_HUMAN	V	50	.	ENSP00000272133:A50V	A	+	2	0	0	CNIH3	222935350	222935350	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	5.322000	0.65852	2.504000	0.84457	0.551000	0.68910	GCG	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.473	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091752.2	1	0	1		13	2	2	1	0	1	1	97	0	97	97	1	2.070000	-3.022584	1	0.390000	NM_152495	Missense_Mutation	0	53	50	0	297	291	1	0	1	0		1	0	97	0	0	1.000000	4.662368e-01	0	0	0	10	0	53	297
INSM1	3642	broad.mit.edu	37	20	20350394	20350394	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr20:20350394G>A	ENST00000310227.1	+	1	1630	c.1483G>A	c.(1483-1485)Gaa>Aaa	p.E495K		NM_002196.2	NP_002187.1	Q01101	INSM1_HUMAN	insulinoma-associated 1	495					adrenal chromaffin cell differentiation (GO:0061104)|cell cycle (GO:0007049)|endocrine pancreas development (GO:0031018)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|noradrenergic neuron development (GO:0003358)|norepinephrine biosynthetic process (GO:0042421)|pancreatic A cell differentiation (GO:0003310)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of gene expression (GO:0010468)|regulation of protein complex assembly (GO:0043254)|sympathetic ganglion development (GO:0061549)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell differentiation (GO:0003309)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|cyclin binding (GO:0030332)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			liver(1)|lung(3)|ovary(1)|prostate(1)	6				READ - Rectum adenocarcinoma(2;0.0649)		CCACCCATCCGAAAACAGACA	0.672																																						ENST00000310227.1	1.000000	6.100000e-01	1.000000	0.730000	0.870000	0.869705	0.870000	1.000000																										0				6						c.(1483-1485)Gaa>Aaa		insulinoma-associated 1							18.0	21.0	20.0					20																	20350394		2178	4252	6430	SO:0001583	missense	3642	0	0					g.chr20:20350394G>A		CCDS13143.1	20p11.2	2012-07-10			ENSG00000173404	ENSG00000173404			6090	protein-coding gene	gene with protein product		600010				8188699, 16569215	Standard	NM_002196		Approved	IA-1, IA1	uc002wrx.3	Q01101	OTTHUMG00000032004	ENST00000310227.1:c.1483G>A	chr20.hg19:g.20350394G>A	ENSP00000312631:p.Glu495Lys	1						p.E495K	NM_002196.2	NP_002187.1	1	2	3	2.336157	Q01101	INSM1_HUMAN		1	1630	+				Missense_Mutation	SNP	ENST00000310227.1	1	1	hg19	c.1483G>A	CCDS13143.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524404	0.85600	.	.	ENSG00000173404	ENST00000310227	T	0.00856	5.61	5.41	5.41	0.78517	5.41	5.41	0.78517	Zinc finger, C2H2 (1);	0.000000	0.64402	U	0.000001	T	0.01661	0.0053	M	0.61703	1.905	0.51482	D	0.999923	D	0.58620	0.983	B	0.39660	0.306	T	0.61589	-0.7032	10	0.87932	D	0	-11.8587	14.4248	0.67207	0.0729:0.0:0.9271:0.0	.	495	Q01101	INSM1_HUMAN	K	495	ENSP00000312631:E495K	ENSP00000312631:E495K	E	+	1	0	0	INSM1	20298394	20298394	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.963000	0.87922	2.522000	0.85027	0.650000	0.86243	GAA	0.487868		TCGA-US-A77E-01A-11D-A32N-08	0.672	INSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078223.1	1	0	1		2	2	2	0	0	0	0	37	0	37	36	1	2.070000	-20.000000	1	0.390000	NM_002196		0	31	31	0	186	183	1	0	1	0		0	0	37	0	0	1.000000	2.191781e-02	0	0	0	2	0	31	186
NNAT	4826	broad.mit.edu	37	20	36149750	36149750	+	Missense_Mutation	SNP	C	C	G			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr20:36149750C>G	ENST00000062104.2	+	1	134	c.17C>G	c.(16-18)gCg>gGg	p.A6G	BLCAP_ENST00000414542.2_5'UTR|BLCAP_ENST00000373537.2_Intron|NNAT_ENST00000346199.2_Missense_Mutation_p.A6G|BLCAP_ENST00000397135.1_Intron|BLCAP_ENST00000397131.1_Intron|BLCAP_ENST00000397134.1_5'Flank|BLCAP_ENST00000397137.1_Intron	NM_005386.2	NP_005377.1	Q16517	NNAT_HUMAN	neuronatin	6					brain development (GO:0007420)|neuron differentiation (GO:0030182)|positive regulation of insulin secretion (GO:0032024)|protein lipoylation (GO:0009249)|regulation of protein localization (GO:0032880)|response to glucose (GO:0009749)|transport (GO:0006810)	cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|lung(1)	3		Myeloproliferative disorder(115;0.00878)				GCAGTGGCGGCGGCCTCGGCT	0.627																																						ENST00000062104.2	0.240000	1.000000e-01	0.200000	0.130000	0.160000	0.175047	0.160000	0.160000																										0				3						c.(16-18)gCg>gGg		neuronatin							142.0	145.0	144.0					20																	36149750		2203	4300	6503	SO:0001583	missense	4826	0	0					g.chr20:36149750C>G		CCDS13296.1, CCDS13297.1	20q11.2-q12	2007-12-07			ENSG00000053438	ENSG00000053438			7860	protein-coding gene	gene with protein product		603106				8660979	Standard	NM_005386		Approved	Peg5	uc002xhd.3	Q16517	OTTHUMG00000032420	ENST00000062104.2:c.17C>G	chr20.hg19:g.36149750C>G	ENSP00000062104:p.Ala6Gly	1					BLCAP_ENST00000397131.1_Intron|BLCAP_ENST00000397135.1_Intron|BLCAP_ENST00000373537.2_Intron|BLCAP_ENST00000414542.2_5'UTR|NNAT_ENST00000346199.2_Missense_Mutation_p.A6G|BLCAP_ENST00000397137.1_Intron|BLCAP_ENST00000397134.1_5'Flank	p.A6G	NM_005386.2	NP_005377.1	1	2	3	2.336157	Q16517	NNAT_HUMAN		1	134	+		Myeloproliferative disorder(115;0.00878)	B2R558|E1P5V6|Q16596|Q5U0N3	Missense_Mutation	SNP	ENST00000062104.2	1	1	hg19	c.17C>G	CCDS13296.1	0	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052781	0.55218	.	.	ENSG00000053438	ENST00000062104;ENST00000346199	.	.	.	4.59	4.59	0.56863	4.59	4.59	0.56863	.	0.000000	0.48767	D	0.000176	T	0.71600	0.3359	.	.	.	0.33830	D	0.630072	D;D	0.61080	0.989;0.989	D;D	0.64237	0.923;0.923	T	0.80132	-0.1510	8	0.87932	D	0	-8.0572	13.2076	0.59807	0.0:1.0:0.0:0.0	.	6;6	Q16517-2;Q16517	.;NNAT_HUMAN	G	6	.	ENSP00000062104:A6G	A	+	2	0	0	NNAT	35583164	35583164	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	2.991000	0.49409	2.836000	0.97738	0.655000	0.94253	GCG	0.487868		TCGA-US-A77E-01A-11D-A32N-08	0.627	NNAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079116.2	0	0	1		2	2	2	0	0	0	0	283	0	283	281	1	2.070000	-1.905460	0	0.390000	NM_005386		0	34	31	0	1244	1207	0	0	1	0		0	0	283	0	0	1.000000	1.065260e-02	0	1	0	5	0	34	1244
PREX1	57580	broad.mit.edu	37	20	47324917	47324917	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr20:47324917C>T	ENST00000371941.3	-	6	686	c.664G>A	c.(664-666)Gcg>Acg	p.A222T	PREX1_ENST00000396220.1_Missense_Mutation_p.A222T	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	222	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CTCTGGACCGCGGGGTGGTCT	0.582																																						ENST00000371941.3	1.000000	7.600000e-01	0.950000	0.810000	0.880000	0.886949	0.880000	0.890000																										0				110						c.(664-666)Gcg>Acg		phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1							119.0	129.0	126.0					20																	47324917		2203	4300	6503	SO:0001583	missense	57580	0	0					g.chr20:47324917C>T	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.664G>A	chr20.hg19:g.47324917C>T	ENSP00000361009:p.Ala222Thr	1					PREX1_ENST00000396220.1_Missense_Mutation_p.A222T	p.A222T	NM_020820.3	NP_065871	1	2	3	2.336157	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)	6	686	-			E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	1	1	hg19	c.664G>A	CCDS13410.1	1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.965570	0.53507	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.64085	-0.08;-0.08	5.64	5.64	0.86602	5.64	5.64	0.86602	Dbl homology (DH) domain (5);	0.000000	0.53938	U	0.000049	T	0.65575	0.2704	L	0.40543	1.245	0.41921	D	0.990515	D	0.55800	0.973	P	0.51777	0.679	T	0.61337	-0.7083	10	0.29301	T	0.29	.	19.7013	0.96054	0.0:1.0:0.0:0.0	.	222	Q8TCU6	PREX1_HUMAN	T	222	ENSP00000361009:A222T;ENSP00000379522:A222T	ENSP00000361009:A222T	A	-	1	0	0	PREX1	46758324	46758324	1.000000	0.71417	0.163000	0.22734	0.196000	0.23810	4.780000	0.62382	2.657000	0.90304	0.655000	0.94253	GCG	0.487868		TCGA-US-A77E-01A-11D-A32N-08	0.582	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	1	0	1		2	2	2	0	0	0	0	233	0	233	227	1	2.070000	-20.000000	1	0.390000	NM_020820		0	176	174	0	1040	1017	1	0	1	0		0	0	233	0	0	1.000000	3.275801e-01	0	0	0	8	0	176	1040
GNAS	2778	broad.mit.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr20:57484421G>A	ENST00000371085.3	+	8	1026	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	ENST00000371085.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000				Dom	yes			Dom	yes		20	20q13.2	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	yes	McCune-Albright syndrome; pseudohypoparathyroidism, type IA	E	E			pituitary adenoma		88	Substitution - Missense(88)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)	pancreas(28)|large_intestine(19)|thyroid(12)|pituitary(12)|liver(6)|biliary_tract(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)	441						c.(601-603)cGt>cAt		GNAS complex locus							80.0	78.0	79.0					20																	57484421		2203	4300	6503	SO:0001583	missense	2778	10	121412	32				g.chr20:57484421G>A	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.602G>A	chr20.hg19:g.57484421G>A	ENSP00000360126:p.Arg201His	1	TSP Lung(22;0.16)				GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H	p.R201H	NM_000516.4	NP_000507.1	1	2	3	2.336157	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)	8	1026	+	all_lung(29;0.0104)		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	1	1	hg19	c.602G>A	CCDS13472.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.430570	0.96150	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-2.96;-5.93	5.53	5.53	0.82687	5.53	5.53	0.82687	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.994;0.983;1.0	D	0.96812	0.9597	10	0.87932	D	0	.	19.4606	0.94915	0.0:0.0:1.0:0.0	.	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	H	844;830;187;201;202;186;187	ENSP00000360141:R844H;ENSP00000360143:R830H;ENSP00000360136:R187H;ENSP00000360126:R201H;ENSP00000346328:R202H;ENSP00000265620:R186H;ENSP00000304472:R187H	ENSP00000265620:R186H	R	+	2	0	0	GNAS	56917816	56917816	1.000000	0.71417	0.963000	0.40424	0.936000	0.57629	9.291000	0.96070	2.596000	0.87737	0.563000	0.77884	CGT	0.487868		TCGA-US-A77E-01A-11D-A32N-08	0.423	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	1	0	1		2	2	2	0	0	0	0	51	0	51	50	1	2.070000	-9.037880	1	0.390000	NM_000516		0	113	111	0	255	252	1	0	1	1	1	0	0	51	408	0	1.000000	1	1	1287	229	1966	556	113	255
U2AF1	7307	broad.mit.edu	37	21	44524456	44524456	+	Missense_Mutation	SNP	G	G	A	rs371769427		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr21:44524456G>A	ENST00000291552.4	-	2	193	c.101C>T	c.(100-102)tCt>tTt	p.S34F	U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000398137.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	34					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S34F(45)|p.S34Y(12)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GTGCAACCGAGAGCACCTGTC	0.358			Mis		"""CLL, MDS"""																																	ENST00000291552.4	1.000000	5.900000e-01	0.970000	0.700000	0.830000	0.832257	0.830000	1.000000				Dom	yes			Dom	yes		21	21q22.3	21q22.3	7307	Mis	U2 small nuclear RNA auxiliary factor 1				L	L			CLL, MDS		57	Substitution - Missense(57)	p.S34F(45)|p.S34Y(12)	haematopoietic_and_lymphoid_tissue(43)|lung(12)|endometrium(2)	126						c.(100-102)tCt>tTt		U2 small nuclear RNA auxiliary factor 1		G	PHE/SER,PHE/SER,	1,4405		0,1,2202	67.0	64.0	65.0		101,101,	5.5	1.0	21		65	0,8600		0,0,4300	no	missense,missense,utr-5	U2AF1	NM_001025203.1,NM_006758.2,NM_001025204.1	155,155,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,	34/241,34/241,	44524456	1,13005	2203	4300	6503	SO:0001583	missense	7307	5	121412	36				g.chr21:44524456G>A	BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.101C>T	chr21.hg19:g.44524456G>A	ENSP00000291552:p.Ser34Phe	0					U2AF1_ENST00000459639.1_5'UTR|U2AF1_ENST00000398137.1_5'UTR|U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000380276.2_Missense_Mutation_p.S34F	p.S34F	NM_006758.2	NP_006749.1	1	2	3	1.980002	Q01081	U2AF1_HUMAN		2	193	-			Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	1	1	hg19	c.101C>T	CCDS13694.1	0	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025187	0.93518	2.27E-4	0.0	ENSG00000160201	ENST00000380276;ENST00000291552	T;T	0.46063	0.88;0.88	5.47	5.47	0.80525	5.47	5.47	0.80525	Zinc finger, CCCH-type (3);	0.000000	0.85682	D	0.000000	T	0.77239	0.4101	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.997	D	0.84864	0.0821	10	0.87932	D	0	-15.7954	19.3169	0.94218	0.0:0.0:1.0:0.0	.	34;34;34	Q69YM7;Q01081;Q701P4	.;U2AF1_HUMAN;.	F	34	ENSP00000369629:S34F;ENSP00000291552:S34F	ENSP00000291552:S34F	S	-	2	0	0	U2AF1	43397525	43397525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.864000	0.92294	2.560000	0.86352	0.563000	0.77884	TCT	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.358	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	1	0	1		2	2	2	0	0	0	0	43	0	43	43	1	2.070000	-3.186309	1	0.390000	NM_006758		0	32	31	0	166	164	1	0	1	1	1	0	0	43	283	0	1.000000	1	1	85	102	202	444	32	166
COL6A2	1292	broad.mit.edu	37	21	47552344	47552344	+	Missense_Mutation	SNP	G	G	A	rs140020002		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr21:47552344G>A	ENST00000300527.4	+	28	3042	c.2938G>A	c.(2938-2940)Gtg>Atg	p.V980M		NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	980	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGGCAGCGACGTGGACATGGA	0.662																																						ENST00000300527.4	1.000000	8.900000e-01	1.000000	0.990000	0.990000	0.992813	0.990000	1.000000																										0				43						c.(2938-2940)Gtg>Atg		collagen, type VI, alpha 2		G	MET/VAL	2,4402	4.2+/-10.8	0,2,2200	70.0	58.0	62.0		2938	4.4	1.0	21	dbSNP_134	62	0,8600		0,0,4300	no	missense	COL6A2	NM_001849.3	21	0,2,6500	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	980/1020	47552344	2,13002	2202	4300	6502	SO:0001583	missense	1292	9	121176	40				g.chr21:47552344G>A	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2938G>A	chr21.hg19:g.47552344G>A	ENSP00000300527:p.Val980Met	0						p.V980M	NM_001849.3	NP_001840.3	1	2	3	1.980002	P12110	CO6A2_HUMAN		28	3042	+	Breast(49;0.245)		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	1	1	hg19	c.2938G>A	CCDS13728.1	1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.717812	0.30413	4.54E-4	0.0	ENSG00000142173	ENST00000300527	T	0.80393	-1.37	4.4	4.4	0.53042	4.4	4.4	0.53042	von Willebrand factor, type A (3);	0.388276	0.26069	N	0.026522	D	0.86887	0.6041	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.87150	0.2208	10	0.56958	D	0.05	-16.4704	10.6536	0.45663	0.0893:0.0:0.9107:0.0	.	980	P12110	CO6A2_HUMAN	M	980	ENSP00000300527:V980M	ENSP00000300527:V980M	V	+	1	0	0	COL6A2	46376772	46376772	1.000000	0.71417	0.994000	0.49952	0.290000	0.27261	5.117000	0.64667	2.001000	0.58596	0.297000	0.19635	GTG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.662	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1	1	0	1		2	2	2	0	0	0	0	48	0	48	47	1	2.070000	-20.000000	1	0.390000			0	37	37	0	120	118	1	0	1	0		0	0	48	0	0	1.000000	1	0	1	0	3128	0	37	120
MCM3AP	8888	broad.mit.edu	37	21	47664991	47664991	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr21:47664991G>A	ENST00000397708.1	-	24	5022	c.4768C>T	c.(4768-4770)Cat>Tat	p.H1590Y	MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.H1590Y|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000421927.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	1590					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CTTCTGTCATGGAAAAAGCGG	0.552																																						ENST00000397708.1	1.000000	6.600000e-01	0.980000	0.750000	0.860000	0.864055	0.860000	1.000000																										0				72						c.(4768-4770)Cat>Tat		minichromosome maintenance complex component 3 associated protein							71.0	72.0	72.0					21																	47664991		2203	4300	6503	SO:0001583	missense	8888	0	0					g.chr21:47664991G>A	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4768C>T	chr21.hg19:g.47664991G>A	ENSP00000380820:p.His1590Tyr	0					MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP_ENST00000291688.1_Missense_Mutation_p.H1590Y|MCM3AP-AS1_ENST00000588753.1_RNA|AP001469.7_ENST00000444966.1_RNA|MCM3AP_ENST00000467026.1_5'UTR|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA	p.H1590Y			1	2	3	1.980002	O60318	GANP_HUMAN		24	5022	-	Breast(49;0.112)		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	1	1	hg19	c.4768C>T	CCDS13734.1	1	.	.	.	.	.	.	.	.	.	.	G	8.432	0.848790	0.17034	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000539647	T;T	0.03272	3.99;3.99	5.45	4.37	0.52481	5.45	4.37	0.52481	.	0.551176	0.21218	N	0.078193	T	0.04182	0.0116	L	0.31294	0.92	0.31865	N	0.620481	B;B	0.06786	0.001;0.001	B;B	0.10450	0.001;0.005	T	0.06789	-1.0807	10	0.39692	T	0.17	-10.1882	15.096	0.72235	0.0801:0.0:0.9199:0.0	.	1590;85	O60318;B3KT88	MCM3A_HUMAN;.	Y	1590;1590;85	ENSP00000380820:H1590Y;ENSP00000291688:H1590Y	ENSP00000291688:H1590Y	H	-	1	0	0	MCM3AP	46489419	46489419	0.996000	0.38824	0.984000	0.44739	0.846000	0.48090	2.460000	0.45031	2.545000	0.85829	0.655000	0.94253	CAT	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.552	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	1	0	1		2	2	2	0	0	0	0	52	0	52	50	1	2.070000	-3.055940	1	0.390000	NM_003906		0	53	53	0	262	258	1	0	1	1		0	0	52	0	0	1.000000	9.999926e-01	0	28	0	61	0	53	262
ST6GAL2	84620	broad.mit.edu	37	2	107450522	107450522	+	Missense_Mutation	SNP	G	G	A	rs533150647		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:107450522G>A	ENST00000409382.3	-	3	1634	c.1024C>T	c.(1024-1026)Cgc>Tgc	p.R342C	ST6GAL2_ENST00000409087.3_Missense_Mutation_p.R342C|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.R342C|AC016994.2_ENST00000425419.1_RNA	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	342					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)	p.R342C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						TTAATGATGCGTATGGTGGTT	0.393													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16791	0.0		0.0	False		,,,				2504	0.0					ENST00000409382.3	1.000000	6.900000e-01	0.980000	0.770000	0.870000	0.873282	0.870000	1.000000																										1	Substitution - Missense(1)	p.R342C(1)	large_intestine(1)	65						c.(1024-1026)Cgc>Tgc		ST6 beta-galactosamide alpha-2,6-sialyltranferase 2							224.0	213.0	217.0					2																	107450522		2203	4300	6503	SO:0001583	missense	84620	2	121412	40				g.chr2:107450522G>A	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1024C>T	chr2.hg19:g.107450522G>A	ENSP00000386942:p.Arg342Cys	0					ST6GAL2_ENST00000409087.3_Missense_Mutation_p.R342C|AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.R342C	p.R342C	NM_001142351.1	NP_001135823.1	1	2	3	1.974951	Q96JF0	SIAT2_HUMAN		3	1634	-			D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	1	1	hg19	c.1024C>T	CCDS2073.1	1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606524	0.87157	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.78924	-1.22;-1.22;-1.22	6.03	6.03	0.97812	6.03	6.03	0.97812	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);	0.000000	0.85682	D	0.000000	D	0.92740	0.7692	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94296	0.7533	10	0.87932	D	0	-37.1524	19.545	0.95291	0.0:0.0:1.0:0.0	.	342;342	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	C	342	ENSP00000355273:R342C;ENSP00000386942:R342C;ENSP00000387332:R342C	ENSP00000355273:R342C	R	-	1	0	0	ST6GAL2	106816954	106816954	1.000000	0.71417	0.990000	0.47175	0.813000	0.45954	9.869000	0.99810	2.861000	0.98227	0.655000	0.94253	CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.393	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	1	0	1		2	2	2	0	0	0	0	64	0	64	63	1	2.070000	-20.000000	1	0.390000	NM_032528		0	67	66	0	327	319	1	0	1	0		0	0	64	0	0	1.000000	0	0	0	0	1	0	67	327
POLR1B	84172	broad.mit.edu	37	2	113322044	113322044	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:113322044C>T	ENST00000263331.5	+	10	2294	c.1714C>T	c.(1714-1716)Cca>Tca	p.P572S	POLR1B_ENST00000541869.1_Missense_Mutation_p.P610S|POLR1B_ENST00000409894.3_Intron|POLR1B_ENST00000417433.2_Missense_Mutation_p.P516S|POLR1B_ENST00000537335.1_Missense_Mutation_p.P361S	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	572					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						GGATCTTGCTCCAGGCATCGC	0.498																																					Ovarian(16;256 576 9537 23969 41147)	ENST00000263331.5	1.000000	7.000000e-01	0.940000	0.770000	0.850000	0.861290	0.850000	1.000000																										0				42						c.(1714-1716)Cca>Tca		polymerase (RNA) I polypeptide B, 128kDa							275.0	246.0	256.0					2																	113322044		2203	4300	6503	SO:0001583	missense	84172	0	0					g.chr2:113322044C>T	AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1714C>T	chr2.hg19:g.113322044C>T	ENSP00000263331:p.Pro572Ser	0					POLR1B_ENST00000537335.1_Missense_Mutation_p.P361S|POLR1B_ENST00000541869.1_Missense_Mutation_p.P610S|POLR1B_ENST00000409894.3_Intron|POLR1B_ENST00000417433.2_Missense_Mutation_p.P516S	p.P572S	NM_019014.4	NP_061887.2	1	2	3	1.974951	Q9H9Y6	RPA2_HUMAN		10	2294	+			B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	ENST00000263331.5	1	1	hg19	c.1714C>T	CCDS2097.1	1	.	.	.	.	.	.	.	.	.	.	C	8.254	0.809758	0.16537	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000537335;ENST00000417433;ENST00000458012	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.51	5.83	3.97	0.46021	5.83	3.97	0.46021	RNA polymerase I, Rpa2 specific (1);	0.150076	0.64402	D	0.000009	T	0.68274	0.2983	L	0.43152	1.355	0.58432	D	0.999992	B;B;B	0.25105	0.118;0.0;0.094	B;B;B	0.33254	0.108;0.003;0.16	T	0.59306	-0.7479	10	0.12766	T	0.61	-13.5536	15.3557	0.74425	0.0:0.7349:0.265:0.0	.	610;516;572	F5GZX4;Q9H9Y6-2;Q9H9Y6	.;.;RPA2_HUMAN	S	572;610;361;516;36	ENSP00000263331:P572S;ENSP00000444136:P610S;ENSP00000437914:P361S;ENSP00000405358:P516S;ENSP00000394408:P36S	ENSP00000263331:P572S	P	+	1	0	0	POLR1B	113038515	113038515	1.000000	0.71417	0.534000	0.28014	0.274000	0.26718	3.052000	0.49893	0.738000	0.32606	0.650000	0.86243	CCA	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.498	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	1	0	1		2	2	2	0	0	0	0	107	0	107	104	1	2.070000	-3.087977	1	0.390000	NM_019014		0	92	91	0	458	452	1	0	1	1		0	0	107	0	0	1.000000	8.025777e-01	0	4	0	13	0	92	458
ZEB2	9839	broad.mit.edu	37	2	145162490	145162490	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:145162490G>A	ENST00000558170.2	-	5	1689	c.505C>T	c.(505-507)Cgc>Tgc	p.R169C	ZEB2_ENST00000303660.4_Missense_Mutation_p.R169C|ZEB2_ENST00000539609.3_Missense_Mutation_p.R145C|ZEB2_ENST00000409487.3_Missense_Mutation_p.R169C	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	169					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		GTGTCACTGCGCTGAAGGTAC	0.493																																					Melanoma(33;1235 1264 5755 16332)	ENST00000558170.2	1.000000	6.000000e-01	1.000000	0.720000	0.860000	0.856880	0.860000	1.000000																										0				107						c.(505-507)Cgc>Tgc		zinc finger E-box binding homeobox 2							90.0	75.0	80.0					2																	145162490		2203	4300	6503	SO:0001583	missense	9839	1	121412	26				g.chr2:145162490G>A	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.505C>T	chr2.hg19:g.145162490G>A	ENSP00000454157:p.Arg169Cys	0					ZEB2_ENST00000303660.4_Missense_Mutation_p.R169C|ZEB2_ENST00000409487.3_Missense_Mutation_p.R169C|ZEB2_ENST00000539609.3_Missense_Mutation_p.R145C	p.R169C	NM_014795.3	NP_055610.1	1	2	3	1.974951	O60315	ZEB2_HUMAN		5	1689	-			A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	1	1	hg19	c.505C>T	CCDS2186.1	1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489988	0.64074	.	.	ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861	T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09	5.62	5.62	0.85841	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.86560	0.5962	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77004	0.989;0.948;0.948;0.948	D	0.86852	0.2024	10	0.87932	D	0	-8.3326	20.0114	0.97452	0.0:0.0:1.0:0.0	.	145;34;168;169	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	C	164;145;169;169;169;169	ENSP00000443792:R145C;ENSP00000302501:R169C;ENSP00000386854:R169C;ENSP00000395496:R169C;ENSP00000376601:R169C	ENSP00000302501:R169C	R	-	1	0	0	ZEB2	144878960	144878960	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.820000	0.86633	2.795000	0.96236	0.655000	0.94253	CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.493	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	1	0	1		2	2	2	0	0	0	0	44	0	44	44	1	2.070000	-20.000000	1	0.390000	NM_014795		0	31	31	0	154	152	1	0	1	0		0	0	44	0	0	1.000000	6.696461e-01	0	0	0	13	0	31	154
TTN	7273	broad.mit.edu	37	2	179466769	179466769	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:179466769G>A	ENST00000591111.1	-	234	50530	c.50306C>T	c.(50305-50307)tCa>tTa	p.S16769L	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S9345L|TTN_ENST00000359218.5_Missense_Mutation_p.S9470L|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S9537L|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S18410L|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S15842L|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16769	Ig-like 101.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCCCAAGATGATTTTGGTGT	0.403																																						ENST00000591111.1	1.000000	7.900000e-01	1.000000	0.870000	0.970000	0.950199	0.970000	1.000000																										0				1448						c.(50305-50307)tCa>tTa		titin							172.0	168.0	169.0					2																	179466769		1875	4113	5988	SO:0001583	missense	7273	0	0					g.chr2:179466769G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50306C>T	chr2.hg19:g.179466769G>A	ENSP00000465570:p.Ser16769Leu	0					TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S15842L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S9345L|TTN_ENST00000589042.1_Missense_Mutation_p.S18410L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S9537L|TTN_ENST00000359218.5_Missense_Mutation_p.S9470L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA	p.S16769L			1	2	3	1.974951	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	234	50530	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.50306C>T		1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512432	0.44660	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	6.07	6.07	0.98685	6.07	6.07	0.98685	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50803	0.1637	N	0.11789	0.175	0.34748	D	0.731475	B;B;B;B	0.28128	0.101;0.101;0.201;0.101	B;B;B;B	0.28385	0.089;0.089;0.089;0.089	T	0.59778	-0.7390	9	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	9345;9470;9537;16769	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	15842;9345;9537;9470;9345	ENSP00000343764:S15842L;ENSP00000434586:S9345L;ENSP00000340554:S9537L;ENSP00000352154:S9470L	ENSP00000340554:S9537L	S	-	2	0	0	TTN	179175014	179175014	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.331000	0.79192	2.885000	0.99019	0.655000	0.94253	TCA	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1		2	2	2	0	0	0	0	84	0	84	84	1	2.070000	-20.000000	1	0.390000	NM_133378		0	85	82	0	363	361	1	0	1			0	0	84	0	0	1.000000	0	0	0	0	0	0	85	363
COL5A2	1290	broad.mit.edu	37	2	189929337	189929337	+	Silent	SNP	T	T	C			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			T	C	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:189929337T>C	ENST00000374866.3	-	25	1936	c.1662A>G	c.(1660-1662)aaA>aaG	p.K554K		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	554					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCTGGCTTCCTTTGGGTCCTG	0.507																																						ENST00000374866.3	0.880000	5.100000e-01	0.780000	0.590000	0.680000	0.690797	0.680000	0.680000																										0				95						c.(1660-1662)aaA>aaG		collagen, type V, alpha 2							56.0	59.0	58.0					2																	189929337		2203	4300	6503	SO:0001819	synonymous_variant	1290	0	0					g.chr2:189929337T>C	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1662A>G	chr2.hg19:g.189929337T>C		0						p.K554K	NM_000393.3	NP_000384.2	1	2	3	1.974951	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)	25	1936	-			P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Silent	SNP	ENST00000374866.3	1	1	hg19	c.1662A>G	CCDS33350.1	0																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.507	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	1	0	1		2	2	2	0	0	0	0	63	0	63	63	1	2.070000	-20.000000	1	0.390000	NM_000393		0	46	46	0	300	295	0	0	1	0		0	0	63	0	0	1.000000	1	0	0	0	283	0	46	300
DOCK10	55619	broad.mit.edu	37	2	225651759	225651759	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:225651759G>A	ENST00000258390.7	-	50	5702	c.5635C>T	c.(5635-5637)Cgt>Tgt	p.R1879C	DOCK10_ENST00000409592.3_Missense_Mutation_p.R1873C	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1879	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AATGCCACACGATAGTAGCGA	0.433																																						ENST00000258390.7	1.000000	6.500000e-01	0.920000	0.730000	0.820000	0.831826	0.820000	0.830000																										0				87						c.(5635-5637)Cgt>Tgt		dedicator of cytokinesis 10							124.0	119.0	121.0					2																	225651759		1901	4114	6015	SO:0001583	missense	55619	0	0					g.chr2:225651759G>A	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5635C>T	chr2.hg19:g.225651759G>A	ENSP00000258390:p.Arg1879Cys	0					DOCK10_ENST00000409592.3_Missense_Mutation_p.R1873C	p.R1879C	NM_014689.2	NP_055504.2	1	2	3	1.974951	Q96BY6	DOC10_HUMAN		50	5702	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	1	1	hg19	c.5635C>T	CCDS46528.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.238466|4.238466	0.79800|0.79800	.|.	.|.	ENSG00000135905|ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702|ENST00000535663	T;T|.	0.32988|.	1.43;1.43|.	5.99|5.99	5.09|5.09	0.68999|0.68999	5.99|5.99	5.09|5.09	0.68999|0.68999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85483|0.85483	0.5707|0.5707	M|M	0.93507|0.93507	3.425|3.425	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	0.994;1.0;0.991;0.997|.	D|D	0.89507|0.89507	0.3768|0.3768	10|5	0.87932|.	D|.	0|.	.|.	15.2244|15.2244	0.73339|0.73339	0.0:0.0:0.7376:0.2624|0.0:0.0:0.7376:0.2624	.|.	1879;700;1873;541|.	Q96BY6;B4DF07;B3FL70;B4DEY4|.	DOC10_HUMAN;.;.;.|.	C|L	1873;1879;384|26	ENSP00000386694:R1873C;ENSP00000258390:R1879C|.	ENSP00000258390:R1879C|.	R|S	-|-	1|2	0|0	0|0	DOCK10|DOCK10	225360003|225360003	225360003|225360003	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	4.329000|4.329000	0.59260|0.59260	1.477000|1.477000	0.48234|0.48234	0.655000|0.655000	0.94253|0.94253	CGT|TCG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.433	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1	1	0	1		2	2	2	0	0	0	0	83	0	83	83	1	2.070000	-3.328643	1	0.390000			0	69	69	0	359	353	1	0	1	0		0	0	83	0	0	1.000000	3.826724e-01	0	0	0	8	0	69	359
ITSN2	50618	broad.mit.edu	37	2	24531532	24531532	+	Silent	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:24531532C>T	ENST00000355123.4	-	8	1190	c.747G>A	c.(745-747)cgG>cgA	p.R249R	ITSN2_ENST00000407704.1_5'Flank|ITSN2_ENST00000361999.3_Silent_p.R249R|ITSN2_ENST00000406921.3_Silent_p.R249R	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	249	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAATTTTTGCCGATATTTTA	0.428																																						ENST00000355123.4	0.140000	1.000000e-02	0.100000	0.030000	0.060000	0.071595	0.060000	0.060000																										0				61						c.(745-747)cgG>cgA		intersectin 2							139.0	141.0	140.0					2																	24531532		2203	4300	6503	SO:0001819	synonymous_variant	50618	0	0					g.chr2:24531532C>T	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.747G>A	chr2.hg19:g.24531532C>T		0					ITSN2_ENST00000406921.3_Silent_p.R249R|ITSN2_ENST00000361999.3_Silent_p.R249R|ITSN2_ENST00000407704.1_5'Flank	p.R249R	NM_006277.2	NP_006268.2	1	2	3	1.974951	Q9NZM3	ITSN2_HUMAN		8	1190	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	ENST00000355123.4	0	1	hg19	c.747G>A	CCDS1710.2	0																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.428	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	0	0	1		2	2	2	0	0	0	0	88	0	88	87	1	2.070000	-2.321241	0	0.390000	NM_006277		0	5	5	0	422	422	0	0	1	0		0	0	88	0	0	0.937885	9.243794e-03	0	0	0	10	0	5	422
POMC	5443	broad.mit.edu	37	2	25384178	25384178	+	Silent	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:25384178G>A	ENST00000405623.1	-	3	1031	c.576C>T	c.(574-576)gaC>gaT	p.D192D	POMC_ENST00000395826.2_Silent_p.D192D|POMC_ENST00000264708.3_Silent_p.D192D|POMC_ENST00000380794.1_Silent_p.D192D|RP11-509E16.1_ENST00000567599.1_lincRNA			P01189	COLI_HUMAN	proopiomelanocortin	192					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	CGGCAGGGCCGTCGGGGCCAT	0.697																																					Colon(110;1515 1566 8452 10082 43216)	ENST00000405623.1	1.000000	6.800000e-01	1.000000	0.850000	0.990000	0.949142	0.990000	1.000000																										0				12						c.(574-576)gaC>gaT		proopiomelanocortin	Loperamide(DB00836)						12.0	13.0	13.0					2																	25384178		2199	4294	6493	SO:0001819	synonymous_variant	5443	1	121012	26				g.chr2:25384178G>A		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.576C>T	chr2.hg19:g.25384178G>A		0					POMC_ENST00000264708.3_Silent_p.D192D|RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000395826.2_Silent_p.D192D|POMC_ENST00000380794.1_Silent_p.D192D	p.D192D			1	2	3	1.974951	P01189	COLI_HUMAN		3	1031	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		P78442|Q53T23|Q9UD39|Q9UD40	Silent	SNP	ENST00000405623.1	1	1	hg19	c.576C>T	CCDS1717.1	1																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.697	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	1	0	1		2	2	2	0	0	0	0	22	0	22	21	1	2.070000	-20.000000	1	0.390000	NM_001035256		0	19	17	0	73	70	0	0	1	0		0	0	22	0	0	0.999993	4.542598e-01	0	0	0	7	0	19	73
NRXN1	9378	broad.mit.edu	37	2	50765563	50765563	+	Silent	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:50765563C>T	ENST00000406316.2	-	10	3447	c.1971G>A	c.(1969-1971)cgG>cgA	p.R657R	NRXN1_ENST00000402717.3_Silent_p.R649R|NRXN1_ENST00000405472.3_Silent_p.R649R|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000404971.1_Silent_p.R697R|NRXN1_ENST00000401669.2_Silent_p.R657R|NRXN1_ENST00000406859.3_Silent_p.R657R	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	657	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CAGCCATTTGCCGGATATCTT	0.502																																						ENST00000406316.2	0.060000	0	0.050000	0.010000	0.020000	0.030122	0.020000	0.020000																										0				58						c.(1969-1971)cgG>cgA		neurexin 1							266.0	276.0	273.0					2																	50765563		2189	4294	6483	SO:0001819	synonymous_variant	9378	0	0					g.chr2:50765563C>T	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1971G>A	chr2.hg19:g.50765563C>T		0					NRXN1_ENST00000406859.3_Silent_p.R657R|NRXN1_ENST00000404971.1_Silent_p.R697R|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000401669.2_Silent_p.R657R|NRXN1_ENST00000402717.3_Silent_p.R649R|NRXN1_ENST00000405472.3_Silent_p.R649R	p.R657R	NM_004801.4	NP_004792.1	1	2	3	1.974951	Q9ULB1	NRX1A_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)	10	3447	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	0	1	hg19	c.1971G>A	CCDS54360.1	0																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.502	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2	0	0	1		16	2	2	1	0	1	1	303	0	303	299	1	2.070000	-2.349706	0	0.390000			0	7	7	0	1303	1288	0	0	0			1	0	303	0	0	0.043074	0	0	0	0	0	0	7	1303
C2orf54	79919	broad.mit.edu	37	2	241827790	241827790	+	Silent	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr2:241827790G>A	ENST00000388934.4	-	4	1328	c.1170C>T	c.(1168-1170)tcC>tcT	p.S390S	C2orf54_ENST00000307486.8_Silent_p.S241S|C2orf54_ENST00000402775.2_Silent_p.S222S	NM_001085437.1	NP_001078906	Q08AI8	CB054_HUMAN	chromosome 2 open reading frame 54	390										haematopoietic_and_lymphoid_tissue(1)|lung(4)|prostate(1)	6		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		CCTTGAGCCCGGAGCCGATGC	0.721																																						ENST00000388934.4	1.000000	5.100000e-01	1.000000	0.710000	0.950000	0.883321	0.950000	1.000000																										0				6						c.(1168-1170)tcC>tcT		chromosome 2 open reading frame 54																																				SO:0001819	synonymous_variant	79919	22	115602	36				g.chr2:241827790G>A	AK026324, AK056601	CCDS42839.1, CCDS42840.1, CCDS63187.1	2q37.3	2011-02-23			ENSG00000172478	ENSG00000172478			26216	protein-coding gene	gene with protein product							Standard	NM_001282921		Approved	FLJ22671	uc002wae.4	Q08AI8	OTTHUMG00000151906	ENST00000388934.4:c.1170C>T	chr2.hg19:g.241827790G>A		0					C2orf54_ENST00000402775.2_Silent_p.S222S|C2orf54_ENST00000307486.8_Silent_p.S241S	p.S390S	NM_001085437.1	NP_001078906	0	1	1	1.972134	Q08AI8	CB054_HUMAN		4	1328	-		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	B3KPP9|H7BXM3|Q08AI9|Q53QU5|Q9H622	Silent	SNP	ENST00000388934.4	1	1	hg19	c.1170C>T	CCDS42839.1	1																																																																																								0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.721	C2orf54-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324353.1	1	0	1		2	2	2	0	0	0	0	16	0	16	15	1	2.070000	-19.487670	1	0.390000	NM_024861, NM_001085437		0	10	10	0	44	41	0	0	1	0		0	0	16	0	0	0.997028	0	0	1	0	0	0	10	44
PVRL3	25945	broad.mit.edu	37	3	110852707	110852707	+	Missense_Mutation	SNP	G	G	A	rs15611		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:110852707G>A	ENST00000485303.1	+	6	1570	c.1295G>A	c.(1294-1296)cGg>cAg	p.R432Q	PVRL3_ENST00000319792.3_3'UTR|PVRL3_ENST00000493615.1_Intron	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	432			R -> L (in dbSNP:rs15611).		adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						AGGAGAAGACGGACGTTTCGT	0.413																																						ENST00000485303.1	1.000000	8.600000e-01	1.000000	0.950000	0.990000	0.982550	0.990000	1.000000																										0				19						c.(1294-1296)cGg>cAg		poliovirus receptor-related 3							142.0	140.0	141.0					3																	110852707		2203	4300	6503	SO:0001583	missense	25945	2	121412	40				g.chr3:110852707G>A	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000485303.1:c.1295G>A	chr3.hg19:g.110852707G>A	ENSP00000418070:p.Arg432Gln	0					PVRL3_ENST00000493615.1_Intron|PVRL3_ENST00000319792.3_3'UTR	p.R432Q	NM_001243286.1|NM_015480.2	NP_001230215.1|NP_056295.1	1	2	3	1.977426	Q9NQS3	PVRL3_HUMAN		6	1570	+			E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	ENST00000485303.1	1	1	hg19	c.1295G>A	CCDS2957.1	1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181044	0.38511	.	.	ENSG00000177707	ENST00000485303	T	0.15834	2.39	5.87	5.87	0.94306	5.87	5.87	0.94306	Cytochrome c1, transmembrane anchor, C-terminal (1);	0.064498	0.64402	D	0.000010	T	0.08714	0.0216	N	0.21097	0.63	0.80722	D	1	P	0.48503	0.911	B	0.28991	0.097	T	0.16660	-1.0395	10	0.33940	T	0.23	.	11.0918	0.48121	0.0834:0.0:0.9166:0.0	.	432	Q9NQS3	PVRL3_HUMAN	Q	432	ENSP00000418070:R432Q	ENSP00000418070:R432Q	R	+	2	0	0	PVRL3	112335397	112335397	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.640000	0.67875	2.801000	0.96364	0.454000	0.30748	CGG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.413	PVRL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354045.1	1	0	1		2	2	2	0	0	0	0	123	0	123	123	1	2.070000	-3.618345	1	0.390000	NM_015480		0	98	97	0	383	379	1	0	1	1		0	0	123	0	0	1.000000	9.984107e-01	0	7	0	33	0	98	383
ATP2C1	27032	broad.mit.edu	37	3	130718462	130718462	+	Missense_Mutation	SNP	C	C	G			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:130718462C>G	ENST00000510168.1	+	27	3138	c.2588C>G	c.(2587-2589)cCg>cGg	p.P863R	ATP2C1_ENST00000504381.1_Missense_Mutation_p.P808R|ATP2C1_ENST00000504948.1_Missense_Mutation_p.P847R|ATP2C1_ENST00000359644.3_Missense_Mutation_p.P863R|ATP2C1_ENST00000508532.1_Missense_Mutation_p.P863R|ATP2C1_ENST00000328560.8_Missense_Mutation_p.P863R|ATP2C1_ENST00000533801.2_Missense_Mutation_p.P858R|ATP2C1_ENST00000505330.1_Missense_Mutation_p.P847R|ATP2C1_ENST00000428331.2_Missense_Mutation_p.P863R|ATP2C1_ENST00000513801.1_Missense_Mutation_p.P847R|ATP2C1_ENST00000393221.4_Missense_Mutation_p.P897R|ATP2C1_ENST00000507488.2_Missense_Mutation_p.P847R|ATP2C1_ENST00000422190.2_Missense_Mutation_p.P863R			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	863					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TACTTTCCTCCGCTTCAGAAG	0.343									Hailey-Hailey disease																												Esophageal Squamous(99;456 1443 27647 34099 42636)	ENST00000510168.1	1.000000	6.100000e-01	0.970000	0.720000	0.830000	0.840070	0.830000	1.000000																										0				39						c.(2587-2589)cCg>cGg		ATPase, Ca++ transporting, type 2C, member 1	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						112.0	105.0	108.0					3																	130718462		2203	4300	6503	SO:0001583	missense	27032	0	0		Hailey-Hailey disease	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	g.chr3:130718462C>G	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.2588C>G	chr3.hg19:g.130718462C>G	ENSP00000427461:p.Pro863Arg	0					ATP2C1_ENST00000504381.1_Missense_Mutation_p.P808R|ATP2C1_ENST00000428331.2_Missense_Mutation_p.P863R|ATP2C1_ENST00000328560.8_Missense_Mutation_p.P863R|ATP2C1_ENST00000359644.3_Missense_Mutation_p.P863R|ATP2C1_ENST00000507488.2_Missense_Mutation_p.P847R|ATP2C1_ENST00000504948.1_Missense_Mutation_p.P847R|ATP2C1_ENST00000513801.1_Missense_Mutation_p.P847R|ATP2C1_ENST00000505330.1_Missense_Mutation_p.P847R|ATP2C1_ENST00000508532.1_Missense_Mutation_p.P863R|ATP2C1_ENST00000393221.4_Missense_Mutation_p.P897R|ATP2C1_ENST00000422190.2_Missense_Mutation_p.P863R|ATP2C1_ENST00000533801.2_Missense_Mutation_p.P858R	p.P863R			1	2	3	1.977426	P98194	AT2C1_HUMAN		27	3138	+			B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	ENST00000510168.1	1	1	hg19	c.2588C>G	CCDS46914.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.8|25.8	4.678165|4.678165	0.88542|0.88542	.|.	.|.	ENSG00000017260|ENSG00000017260	ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421|ENST00000504612	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.89123|.	-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47|.	5.91|5.91	5.91|5.91	0.95273|0.95273	5.91|5.91	5.91|5.91	0.95273|0.95273	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87107|0.87107	0.6095|0.6095	M|M	0.92833|0.92833	3.35|3.35	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.91635|.	0.999;0.999;0.996;0.999;0.996;0.999;0.999|.	D|D	0.89107|0.89107	0.3493|0.3493	10|5	0.41790|.	T|.	0.15|.	.|.	20.2985|20.2985	0.98592|0.98592	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	897;858;897;863;897;863;863|.	G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194|.	.;.;.;.;.;.;AT2C1_HUMAN|.	R|G	847;808;847;897;858;863;863;847;847;863;863;863;863;862|817	ENSP00000423774:P847R;ENSP00000425320:P808R;ENSP00000421326:P847R;ENSP00000376914:P897R;ENSP00000432956:P858R;ENSP00000427461:P863R;ENSP00000424783:P863R;ENSP00000423330:P847R;ENSP00000422872:P847R;ENSP00000329664:P863R;ENSP00000395809:P863R;ENSP00000352665:P863R;ENSP00000402677:P863R|.	ENSP00000329664:P863R|.	P|R	+|+	2|1	0|0	0|0	ATP2C1|ATP2C1	132201152|132201152	132201152|132201152	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.925000|0.925000	0.55904|0.55904	7.812000|7.812000	0.86109|0.86109	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	CCG|CGC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.343	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356648.2	1	0	1		2	2	2	0	0	0	0	41	0	41	41	1	2.070000	-2.679540	1	0.390000	NM_001001486		0	39	37	0	200	198	1	0	1	1		0	0	41	0	0	1.000000	1	0	80	0	159	0	39	200
FBLN2	2199	broad.mit.edu	37	3	13672892	13672892	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:13672892G>A	ENST00000295760.7	+	15	3077	c.3008G>A	c.(3007-3009)gGg>gAg	p.G1003E	FBLN2_ENST00000492059.1_Missense_Mutation_p.G1050E|FBLN2_ENST00000404922.3_Missense_Mutation_p.G1050E|FBLN2_ENST00000535798.1_Missense_Mutation_p.G1029E	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	1003	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			AACGTGCCAGGGAGCTACCAG	0.637																																						ENST00000295760.7	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999968	0.990000	1.000000																										0				24						c.(3007-3009)gGg>gAg		fibulin 2							29.0	33.0	32.0					3																	13672892		2158	4257	6415	SO:0001583	missense	2199	0	0					g.chr3:13672892G>A	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.3008G>A	chr3.hg19:g.13672892G>A	ENSP00000295760:p.Gly1003Glu	1					FBLN2_ENST00000492059.1_Missense_Mutation_p.G1050E|FBLN2_ENST00000404922.3_Missense_Mutation_p.G1050E|FBLN2_ENST00000535798.1_Missense_Mutation_p.G1029E	p.G1003E	NM_001998.2	NP_001989.2	0	2	2	1.968864	P98095	FBLN2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)	15	3077	+			B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	0	1	hg19	c.3008G>A	CCDS46762.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.288281|5.288281	0.95517|0.95517	.|.	.|.	ENSG00000163520|ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059|ENST00000295761	D;D;D;D|D	0.90504|0.99557	-2.56;-2.56;-2.68;-2.56|-6.16	5.39|5.39	5.39|5.39	0.77823|0.77823	5.39|5.39	5.39|5.39	0.77823|0.77823	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.99775|0.99775	0.9907|0.9907	H|H	0.95294|0.95294	3.65|3.65	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.97158|0.97158	0.9836|0.9836	10|8	0.87932|0.87932	D|D	0|0	.|.	19.1574|19.1574	0.93517|0.93517	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1003;1050;1029|.	P98095;P98095-2;F5H1F3|.	FBLN2_HUMAN;.;.|.	E|R	1029;1050;1003;1050|22	ENSP00000445705:G1029E;ENSP00000384169:G1050E;ENSP00000295760:G1003E;ENSP00000420042:G1050E|ENSP00000295761:G22R	ENSP00000295760:G1003E|ENSP00000295761:G22R	G|G	+|+	2|1	0|0	0|0	FBLN2|FBLN2	13647893|13647893	13647893|13647893	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.977000|0.977000	0.68977|0.68977	9.839000|9.839000	0.99476|0.99476	2.525000|2.525000	0.85131|0.85131	0.655000|0.655000	0.94253|0.94253	GGG|GGA	0.390000		TCGA-US-A77E-01A-11D-A32N-08	0.637	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	1	0	1		2	2	2	0	0	0	0	11	0	11	10	1	2.070000	-20.000000	1	0.390000	NM_001004019		0	26	26	0	45	45	1	0	1	0	1	0	0	11	1028	0	1.000000	1	1	1	530	322	1085	26	45
DNAJC13	23317	broad.mit.edu	37	3	132175223	132175223	+	Silent	SNP	C	C	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:132175223C>A	ENST00000260818.6	+	10	1325	c.1077C>A	c.(1075-1077)ctC>ctA	p.L359L	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	359					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						GCCTTCACCTCAGGTTCTTAG	0.378																																						ENST00000260818.6	1.000000	7.000000e-01	1.000000	0.810000	0.930000	0.916596	0.930000	1.000000																										0				34						c.(1075-1077)ctC>ctA		DnaJ (Hsp40) homolog, subfamily C, member 13							93.0	88.0	90.0					3																	132175223		2203	4300	6503	SO:0001819	synonymous_variant	23317	0	0					g.chr3:132175223C>A	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1077C>A	chr3.hg19:g.132175223C>A		0					DNAJC13_ENST00000486798.1_3'UTR	p.L359L	NM_015268.3	NP_056083.3	1	2	3	1.977426	O75165	DJC13_HUMAN		10	1325	+			Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	ENST00000260818.6	1	1	hg19	c.1077C>A	CCDS33857.1	1																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.378	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	1	0	1		2	2	2	0	0	0	0	45	0	45	45	1	2.070000	-2.844505	1	0.390000	NM_015268		0	47	47	0	211	207	1	0	1	1		0	0	45	0	0	1.000000	7.860263e-01	0	5	0	10	0	47	211
ALS2CL	259173	broad.mit.edu	37	3	46729748	46729748	+	Missense_Mutation	SNP	G	G	A	rs143519761		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:46729748G>A	ENST00000318962.4	-	3	225	c.142C>T	c.(142-144)Cgg>Tgg	p.R48W	ALS2CL_ENST00000415953.1_Missense_Mutation_p.R48W	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	48					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		TGCAAGAGCCGCAGGCACTCT	0.612																																						ENST00000318962.4	1.000000	5.600000e-01	0.930000	0.660000	0.790000	0.797108	0.790000	1.000000																										0				29						c.(142-144)Cgg>Tgg		ALS2 C-terminal like		G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	40.0	40.0	40.0		142,142	2.2	0.3	3	dbSNP_134	40	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ALS2CL	NM_001190707.1,NM_147129.3	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	48/954,48/954	46729748	1,13005	2203	4300	6503	SO:0001583	missense	259173	9	121358	38				g.chr3:46729748G>A	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.142C>T	chr3.hg19:g.46729748G>A	ENSP00000313670:p.Arg48Trp	0					ALS2CL_ENST00000415953.1_Missense_Mutation_p.R48W	p.R48W	NM_147129.3	NP_667340.2	1	2	3	1.977426	Q60I27	AL2CL_HUMAN		3	225	-			Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	1	1	hg19	c.142C>T	CCDS2743.1	0	.	.	.	.	.	.	.	.	.	.	G	9.542	1.113617	0.20795	0.0	1.16E-4	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.17691	2.26;2.26	4.15	2.19	0.27852	4.15	2.19	0.27852	.	0.879668	0.09620	N	0.777724	T	0.11196	0.0273	L	0.29908	0.895	0.19300	N	0.999979	D	0.56968	0.978	B	0.36504	0.226	T	0.20338	-1.0278	10	0.72032	D	0.01	.	8.7355	0.34525	0.0:0.0:0.5869:0.4131	.	48	Q60I27	AL2CL_HUMAN	W	48	ENSP00000313670:R48W;ENSP00000413223:R48W	ENSP00000313670:R48W	R	-	1	2	2	ALS2CL	46704752	46704752	0.003000	0.15002	0.255000	0.24374	0.221000	0.24807	0.312000	0.19397	1.098000	0.41479	-0.196000	0.12772	CGG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.612	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	1	0	1		2	2	2	0	0	0	0	50	0	50	50	1	2.070000	-20.000000	1	0.390000	NM_147129		0	32	32	0	176	175	1	0	1	1		0	0	50	0	0	1.000000	9.912157e-01	0	22	0	22	0	32	176
DNAH1	25981	broad.mit.edu	37	3	52392752	52392752	+	Splice_Site	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:52392752C>T	ENST00000420323.2	+	25	4526	c.4265C>T	c.(4264-4266)aCg>aTg	p.T1422M		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1422	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCCTACCCCACGGTGAGCCGC	0.672																																						ENST00000420323.2	0.820000	3.600000e-01	0.690000	0.450000	0.560000	0.577949	0.560000	0.560000																										0				62						c.(4264-4266)aCg>aTg		dynein, axonemal, heavy chain 1							36.0	42.0	40.0					3																	52392752		2154	4260	6414	SO:0001630	splice_region_variant	25981	5	121158	34				g.chr3:52392752C>T	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.4266+1C>T	chr3.hg19:g.52392752C>T		0						p.T1422M	NM_015512.4	NP_056327	1	2	3	1.977426	Q9P2D7	DYH1_HUMAN		25	4526	+			B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Splice_Site	SNP	ENST00000420323.2	1	0	hg19	c.4265C>T	CCDS46842.1	0	.	.	.	.	.	.	.	.	.	.	c	14.44	2.535864	0.45176	.	.	ENSG00000114841	ENST00000420323	T	0.57752	0.38	5.4	-1.98	0.07480	5.4	-1.98	0.07480	.	1.606480	0.03543	N	0.224331	T	0.55353	0.1915	M	0.85197	2.74	0.09310	N	1	P	0.38767	0.646	B	0.36989	0.238	T	0.52223	-0.8604	10	0.52906	T	0.07	.	6.2438	0.20805	0.4428:0.3398:0.0:0.2173	.	1422	C9JXH6	.	M	1422	ENSP00000401514:T1422M	ENSP00000401514:T1422M	T	+	2	0	0	DNAH1	52367792	52367792	0.000000	0.05858	0.032000	0.17829	0.425000	0.31504	0.412000	0.21131	-0.236000	0.09753	-0.119000	0.15052	ACG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.672	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	1	0	1		2	2	2	0	0	0	0	55	0	55	55	1	2.070000	-20.000000	1	0.390000	NM_015512	Missense_Mutation	0	21	21	0	171	170	1	0	1	1		0	0	55	0	0	0.999998	1.040082e-01	0	3	0	2	0	21	171
OR5H1	26341	broad.mit.edu	37	3	97852400	97852400	+	Missense_Mutation	SNP	C	C	T	rs267599953		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:97852400C>T	ENST00000354565.2	+	1	859	c.859C>T	c.(859-861)Cct>Tct	p.P287S	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TTTGTTAAATCCTATCATCTA	0.363																																						ENST00000354565.2	1.000000	7.200000e-01	1.000000	0.810000	0.910000	0.911651	0.910000	1.000000																										0				34						c.(859-861)Cct>Tct		olfactory receptor, family 5, subfamily H, member 1							91.0	97.0	95.0					3																	97852400		2203	4299	6502	SO:0001583	missense	26341	0	0					g.chr3:97852400C>T	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.859C>T	chr3.hg19:g.97852400C>T	ENSP00000346575:p.Pro287Ser	0					RP11-343D2.11_ENST00000508964.1_RNA	p.P287S	NM_001005338.1	NP_001005338.1	1	2	3	1.977426	A6NKK0	OR5H1_HUMAN		1	859	+				Missense_Mutation	SNP	ENST00000354565.2	1	1	hg19	c.859C>T	CCDS33797.1	1	.	.	.	.	.	.	.	.	.	.	C	9.923	1.212625	0.22289	.	.	ENSG00000231192	ENST00000354565	T	0.63417	-0.04	3.38	3.38	0.38709	3.38	3.38	0.38709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000271	T	0.68833	0.3044	M	0.88842	2.985	0.35061	D	0.761587	B	0.33238	0.403	B	0.37239	0.244	T	0.81182	-0.1049	10	0.87932	D	0	.	12.2602	0.54647	0.0:1.0:0.0:0.0	.	287	A6NKK0	OR5H1_HUMAN	S	287	ENSP00000346575:P287S	ENSP00000346575:P287S	P	+	1	0	0	OR5H1	99335090	99335090	1.000000	0.71417	0.685000	0.30070	0.005000	0.04900	6.901000	0.75693	1.712000	0.51347	0.195000	0.17529	CCT	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.363	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	1	0	1		2	2	2	0	0	0	0	67	0	67	66	1	2.070000	-3.224316	1	0.390000	NM_001005338		0	66	65	0	302	301	1	0	1			0	0	67	0	0	1.000000	0	0	0	0	0	0	66	302
CPA3	1359	broad.mit.edu	37	3	148599357	148599357	+	Nonsense_Mutation	SNP	C	C	T	rs141357361	byFrequency	TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr3:148599357C>T	ENST00000296046.3	+	7	677	c.625C>T	c.(625-627)Cga>Tga	p.R209*	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	209					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R209R(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			ACTCTTGGACCGAATGAATTT	0.343																																						ENST00000296046.3	0.880000	4.500000e-01	0.760000	0.540000	0.640000	0.658225	0.640000	0.640000																										1	Substitution - coding silent(1)	p.R209R(1)	lung(1)	35						c.(625-627)Cga>Tga		carboxypeptidase A3 (mast cell)							124.0	121.0	122.0					3																	148599357		2203	4300	6503	SO:0001587	stop_gained	1359	60	121408	50				g.chr3:148599357C>T		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.625C>T	chr3.hg19:g.148599357C>T	ENSP00000296046:p.Arg209*	0					RP11-680B3.2_ENST00000488190.1_RNA	p.R209*	NM_001870.2	NP_001861.2	1	2	3	1.977426	P15088	CBPA3_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)	7	677	+			Q96E94	Nonsense_Mutation	SNP	ENST00000296046.3	0	1	hg19	c.625C>T	CCDS3138.1	0	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071142	0.76301	.	.	ENSG00000163751	ENST00000296046	.	.	.	5.06	3.09	0.35607	5.06	3.09	0.35607	.	0.546116	0.18299	N	0.145492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	10.9886	0.47537	0.5206:0.4794:0.0:0.0	.	.	.	.	X	209	.	ENSP00000296046:R209X	R	+	1	2	2	CPA3	150082047	150082047	0.162000	0.22906	0.643000	0.29450	0.200000	0.23975	1.401000	0.34589	1.325000	0.45301	-0.182000	0.12963	CGA	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.343	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	1	0	1		2	2	2	0	0	0	0	67	0	67	67	1	2.070000	-3.142530	1	0.390000	NM_001870		0	32	31	0	222	219	1	0	1	0		0	0	67	0	0	1.000000	2.765583e-01	0	0	0	8	0	32	222
GBA3	57733	broad.mit.edu	37	4	22749669	22749669	+	RNA	SNP	T	T	G			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr4:22749669T>G	ENST00000503442.1	+	0	377				GBA3_ENST00000511446.2_RNA|GBA3_ENST00000508166.1_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GTGGATTGGATCTACGTGGTA	0.383																																						ENST00000503442.1	1.000000	4.700000e-01	1.000000	0.640000	0.840000	0.825446	0.840000	1.000000																										0				33								glucosidase, beta, acid 3 (gene/pseudogene)							36.0	34.0	35.0					4																	22749669		1836	4091	5927			57733	0	0					g.chr4:22749669T>G	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		chr4.hg19:g.22749669T>G		0					GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA		NM_001128432.2	NP_001121904.1	1	2	3	1.996179	Q9H227	GBA3_HUMAN		0	377	+			Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	RNA	SNP	ENST00000503442.1	0	1	hg19			0																																																																																								0.394721		TCGA-US-A77E-01A-11D-A32N-08	0.383	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2	0	0	1		2	2	2	0	0	0	0	24	0	24	23	1	2.070000	-19.983290	1	0.390000			0	12	12	0	63	62	0	0	1	0		0	0	24	0	0	0.999331	2.042507e-01	0	0	0	5	0	12	63
TBC1D9	23158	broad.mit.edu	37	4	141622724	141622724	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr4:141622724G>A	ENST00000442267.2	-	2	249	c.175C>T	c.(175-177)Cgg>Tgg	p.R59W	Y_RNA_ENST00000384426.1_RNA	NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	59							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				GGAGCGACCCGGGCGCTGGAG	0.517																																						ENST00000442267.2	1.000000	5.900000e-01	1.000000	0.700000	0.830000	0.840335	0.830000	1.000000																										0				31						c.(175-177)Cgg>Tgg		TBC1 domain family, member 9 (with GRAM domain)							58.0	59.0	59.0					4																	141622724		1916	4122	6038	SO:0001583	missense	23158	1	120842	28				g.chr4:141622724G>A	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.175C>T	chr4.hg19:g.141622724G>A	ENSP00000411197:p.Arg59Trp	0					Y_RNA_ENST00000384426.1_RNA	p.R59W	NM_015130.2	NP_055945.2	1	2	3	1.996179	Q6ZT07	TBCD9_HUMAN		2	249	-	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	1	1	hg19	c.175C>T	CCDS47136.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148616	0.78001	.	.	ENSG00000109436	ENST00000442267	T	0.23552	1.9	5.39	4.45	0.53987	5.39	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.48822	0.1521	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.51403	-0.8710	10	0.87932	D	0	-4.7968	10.5771	0.45233	0.0:0.0:0.4702:0.5298	.	59	Q6ZT07	TBCD9_HUMAN	W	59	ENSP00000411197:R59W	ENSP00000411197:R59W	R	-	1	2	2	TBC1D9	141842174	141842174	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	4.245000	0.58734	1.314000	0.45095	0.655000	0.94253	CGG	0.394721		TCGA-US-A77E-01A-11D-A32N-08	0.517	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	1	0	1		2	2	2	0	0	0	0	26	0	26	26	1	2.070000	-2.924440	1	0.390000	NM_015130		0	31	31	0	161	157	1	0	1	0		0	0	26	0	0	1.000000	3.887059e-01	0	0	0	8	0	31	161
PCDHA5	56143	broad.mit.edu	37	5	140201497	140201497	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr5:140201497G>A	ENST00000529859.1	+	1	137	c.137G>A	c.(136-138)cGc>cAc	p.R46H	PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.R46H|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.R46H	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	46	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R46H(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGTTGGCCGCATCGCGCAG	0.657																																						ENST00000529859.1	0.160000	2.000000e-02	0.120000	0.040000	0.070000	0.093106	0.070000	0.080000																										2	Substitution - Missense(2)	p.R46H(2)	kidney(2)	60						c.(136-138)cGc>cAc		protocadherin alpha 5							56.0	64.0	61.0					5																	140201497		2203	4300	6503	SO:0001583	missense	56143	0	0					g.chr5:140201497G>A	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.137G>A	chr5.hg19:g.140201497G>A	ENSP00000436557:p.Arg46His	0					PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.R46H|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.R46H	p.R46H	NM_018908.2	NP_061731.1	1	2	3	1.991597	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	137	+			O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	0	1	hg19	c.137G>A	CCDS54917.1	0	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294143	0.60086	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.27256	1.68;1.68;1.68	3.87	2.98	0.34508	3.87	2.98	0.34508	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.25827	0.0629	M	0.63428	1.95	0.25612	N	0.986495	P;P;P	0.46987	0.848;0.888;0.609	B;B;B	0.38803	0.282;0.253;0.185	T	0.11275	-1.0594	9	0.72032	D	0.01	.	10.3243	0.43783	0.1721:0.0:0.8279:0.0	.	46;46;46	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	H	46	ENSP00000433416:R46H;ENSP00000436557:R46H;ENSP00000367366:R46H	ENSP00000367366:R46H	R	+	2	0	0	PCDHA5	140181681	140181681	0.004000	0.15560	1.000000	0.80357	0.960000	0.62799	1.772000	0.38552	0.719000	0.32188	0.585000	0.79938	CGC	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.657	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	0	0	1		2	2	2	0	0	0	0	115	0	115	115	1	2.070000	-2.229413	0	0.390000	NM_018908		0	7	7	0	479	475	0	0	1			0	0	115	0	0	0.980177	0	0	0	0	0	0	7	479
FOXI1	2299	broad.mit.edu	37	5	169533243	169533243	+	Silent	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr5:169533243G>A	ENST00000306268.6	+	1	343	c.282G>A	c.(280-282)ccG>ccA	p.P94P	FOXI1_ENST00000449804.2_Silent_p.P94P			Q12951	FOXI1_HUMAN	forkhead box I1	94	Pro-rich.				embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCAGAGGCCGCTGCTGCCCA	0.697									Pendred syndrome																													ENST00000306268.6	1.000000	5.300000e-01	1.000000	0.740000	0.990000	0.904822	0.990000	1.000000																										0				35						c.(280-282)ccG>ccA		forkhead box I1							9.0	8.0	9.0					5																	169533243		2184	4261	6445	SO:0001819	synonymous_variant	2299	0	0		Pendred syndrome	Familial Cancer Database	Goiter-Deafness syndrome	g.chr5:169533243G>A	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.282G>A	chr5.hg19:g.169533243G>A		0					FOXI1_ENST00000449804.2_Silent_p.P94P	p.P94P			1	2	3	1.991597	Q12951	FOXI1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	1	343	+	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Q14518|Q66SR7|Q8N6L8	Silent	SNP	ENST00000306268.6	1	1	hg19	c.282G>A	CCDS4372.1	1																																																																																								0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.697	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	1	0	1		2	2	2	0	0	0	0	17	0	17	17	1	2.070000	-18.510660	1	0.390000	NM_144769, NM_012188		0	9	9	0	37	36	0	0	1	0		0	0	17	0	0	0.995341	0	0	0	0	1	0	9	37
C7	730	broad.mit.edu	37	5	40981607	40981607	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr5:40981607G>A	ENST00000313164.9	+	18	2823	c.2464G>A	c.(2464-2466)Gct>Act	p.A822T		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	822	Factor I module (FIM) 2.			GA -> AL (in Ref. 3). {ECO:0000305}.	cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TGAGGCGGGCGCTCTGAGATG	0.567																																						ENST00000313164.9	1.000000	6.700000e-01	1.000000	0.810000	0.990000	0.929971	0.990000	1.000000																										0										c.(2464-2466)Gct>Act		complement component 7							60.0	62.0	61.0					5																	40981607		2106	4232	6338	SO:0001583	missense	730	5	121058	34				g.chr5:40981607G>A	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2464G>A	chr5.hg19:g.40981607G>A	ENSP00000322061:p.Ala822Thr	0						p.A822T	NM_000587.2	NP_000578.2	1	2	3	1.991597	P10643	CO7_HUMAN		18	2823	+		Ovarian(839;0.0112)	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	1	1	hg19	c.2464G>A	CCDS47201.1	1	.	.	.	.	.	.	.	.	.	.	G	4.186	0.033170	0.08101	.	.	ENSG00000112936	ENST00000313164	T	0.65364	-0.15	5.83	-0.108	0.13588	5.83	-0.108	0.13588	Factor I / membrane attack complex (1);	1.811360	0.02513	N	0.091774	T	0.48857	0.1523	L	0.37850	1.14	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10200	-1.0640	10	0.27082	T	0.32	0.8429	2.9604	0.05890	0.462:0.1118:0.3117:0.1144	.	822	P10643	CO7_HUMAN	T	822	ENSP00000322061:A822T	ENSP00000322061:A822T	A	+	1	0	0	C7	41017364	41017364	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.255000	0.08769	-0.082000	0.12640	-0.992000	0.02543	GCT	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.567	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1	1	0	1		2	2	2	0	0	0	0	17	0	17	16	1	2.070000	-20.000000	1	0.390000			0	24	24	0	101	99	1	0	1	0		0	0	17	0	0	1.000000	1	0	1	0	171	0	24	101
VCAN	1462	broad.mit.edu	37	5	82876174	82876174	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr5:82876174C>T	ENST00000265077.3	+	15	10677	c.10112C>T	c.(10111-10113)tCa>tTa	p.S3371L	VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.S2384L|VCAN_ENST00000502527.2_Missense_Mutation_p.S630L|VCAN_ENST00000342785.4_Missense_Mutation_p.S1617L|VCAN_ENST00000512590.2_Missense_Mutation_p.S1569L	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3371					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AAAAATTCCTCATCAGCAAAG	0.393																																						ENST00000265077.3	1.000000	9.700000e-01	1.000000	0.990000	0.990000	0.998263	0.990000	1.000000																										0				190						c.(10111-10113)tCa>tTa		versican	Hyaluronan(DB08818)						77.0	82.0	80.0					5																	82876174		2203	4300	6503	SO:0001583	missense	1462	0	0					g.chr5:82876174C>T	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.10112C>T	chr5.hg19:g.82876174C>T	ENSP00000265077:p.Ser3371Leu	0					VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Missense_Mutation_p.S1617L|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.S2384L|VCAN_ENST00000512590.2_Missense_Mutation_p.S1569L|VCAN_ENST00000502527.2_Missense_Mutation_p.S630L	p.S3371L	NM_004385.4	NP_004376.2	1	2	3	1.991597	P13611	CSPG2_HUMAN		15	10677	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	1	1	hg19	c.10112C>T	CCDS4060.1	1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957027	0.53293	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	D;D;D;D;D	0.87029	-2.19;-2.2;-1.94;-1.94;-1.85	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.000000	0.44483	D	0.000456	D	0.89750	0.6805	N	0.24115	0.695	0.38290	D	0.942687	D;B;P;D	0.89917	0.999;0.386;0.502;1.0	D;B;B;D	0.74023	0.964;0.23;0.403;0.982	D	0.91528	0.5240	10	0.72032	D	0.01	.	20.0706	0.97721	0.0:1.0:0.0:0.0	.	1617;630;2384;3371	P13611-3;P13611-4;P13611-2;P13611	.;.;.;CSPG2_HUMAN	L	3371;2384;1617;1569;630	ENSP00000265077:S3371L;ENSP00000340062:S2384L;ENSP00000342768:S1617L;ENSP00000425959:S1569L;ENSP00000421362:S630L	ENSP00000265077:S3371L	S	+	2	0	0	VCAN	82911930	82911930	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.512000	0.60469	2.744000	0.94065	0.655000	0.94253	TCA	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.393	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	1	0	1		2	2	2	0	0	0	0	56	0	56	56	1	2.070000	-4.083793	1	0.390000	NM_004385		0	59	59	0	186	184	1	0	1	0		0	0	56	0	0	1.000000	1	0	0	0	550	0	59	186
STC2	8614	broad.mit.edu	37	5	172744926	172744926	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr5:172744926C>T	ENST00000265087.4	-	4	2142	c.833G>A	c.(832-834)gGc>gAc	p.G278D	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	278					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AGCCCCAAGGCCCCCGACTCT	0.612																																						ENST00000265087.4	1.000000	8.700000e-01	1.000000	0.940000	0.990000	0.982136	0.990000	1.000000																										0				25						c.(832-834)gGc>gAc		stanniocalcin 2							77.0	81.0	80.0					5																	172744926		2203	4300	6503	SO:0001583	missense	8614	1	121412	33				g.chr5:172744926C>T	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.833G>A	chr5.hg19:g.172744926C>T	ENSP00000265087:p.Gly278Asp	0					STC2_ENST00000520593.1_5'Flank	p.G278D	NM_003714.2	NP_003705.1	1	2	3	1.991597	O76061	STC2_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	4	2142	-	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)		Missense_Mutation	SNP	ENST00000265087.4	1	1	hg19	c.833G>A	CCDS4388.1	1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978009	0.34942	.	.	ENSG00000113739	ENST00000265087	.	.	.	5.31	1.1	0.20463	5.31	1.1	0.20463	.	0.502817	0.22661	N	0.057194	T	0.22205	0.0535	N	0.24115	0.695	0.09310	N	0.999996	B	0.10296	0.003	B	0.09377	0.004	T	0.10064	-1.0646	9	0.38643	T	0.18	-5.3352	2.7467	0.05268	0.2356:0.2927:0.3461:0.1256	.	278	O76061	STC2_HUMAN	D	278	.	ENSP00000265087:G278D	G	-	2	0	0	STC2	172677532	172677532	0.000000	0.05858	0.000000	0.03702	0.913000	0.54294	-0.238000	0.08977	0.181000	0.19994	0.650000	0.86243	GGC	0.392370		TCGA-US-A77E-01A-11D-A32N-08	0.612	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	0	0	1		2	2	2	0	0	0	0	151	0	151	148	1	2.070000	-20.000000	1	0.390000	NM_003714		0	125	123	0	498	490	1	0	1	0		0	0	151	0	0	1.000000	9.946677e-01	0	0	0	33	0	125	498
SERINC1	57515	broad.mit.edu	37	6	122773086	122773086	+	Missense_Mutation	SNP	T	T	C			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr6:122773086T>C	ENST00000339697.4	-	6	790	c.706A>G	c.(706-708)Aac>Gac	p.N236D		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	236					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		AGGAGCATGTTGACACTGATG	0.393																																						ENST00000339697.4	1.000000	8.300000e-01	1.000000	0.950000	0.990000	0.981579	0.990000	1.000000																										0				13						c.(706-708)Aac>Gac		serine incorporator 1							100.0	89.0	93.0					6																	122773086		2203	4300	6503	SO:0001583	missense	57515	0	0					g.chr6:122773086T>C	AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.706A>G	chr6.hg19:g.122773086T>C	ENSP00000342962:p.Asn236Asp	0						p.N236D	NM_020755.2	NP_065806.1	1	2	3	1.979114	Q9NRX5	SERC1_HUMAN		6	790	-			B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Missense_Mutation	SNP	ENST00000339697.4	1	1	hg19	c.706A>G	CCDS5125.1	1	.	.	.	.	.	.	.	.	.	.	T	32	5.185893	0.94885	.	.	ENSG00000111897	ENST00000339697;ENST00000368454	T;T	0.20069	2.1;2.1	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.53899	0.1825	H	0.95917	3.74	0.80722	D	1	D	0.58268	0.982	D	0.72075	0.976	T	0.70699	-0.4800	10	0.87932	D	0	-14.7994	15.9701	0.80008	0.0:0.0:0.0:1.0	.	236	Q9NRX5	SERC1_HUMAN	D	236	ENSP00000342962:N236D;ENSP00000357439:N236D	ENSP00000342962:N236D	N	-	1	0	0	SERINC1	122814785	122814785	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.166000	0.68216	0.528000	0.53228	AAC	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.393	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	1	0	1		2	2	2	0	0	0	0	49	0	49	49	1	2.070000	-20.000000	1	0.390000	NM_020755		0	53	53	0	198	194	1	0	1	1		0	0	49	0	0	1.000000	1	0	82	0	183	0	53	198
PHACTR1	221692	broad.mit.edu	37	6	13206098	13206098	+	Missense_Mutation	SNP	C	C	T	rs549074819		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr6:13206098C>T	ENST00000379350.1	+	7	845	c.716C>T	c.(715-717)cCg>cTg	p.P239L	PHACTR1_ENST00000457702.2_Missense_Mutation_p.P94L|PHACTR1_ENST00000332995.7_Missense_Mutation_p.P239L|PHACTR1_ENST00000379345.2_Intron			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	239					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			CTGTCGCCTCCGCTACCTCCA	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18938	0.0		0.0	False		,,,				2504	0.0					ENST00000379350.1	1.000000	2.000000e-02	0.120000	0.040000	0.070000	0.111398	0.070000	0.070000																										0				26						c.(715-717)cCg>cTg		phosphatase and actin regulator 1							58.0	62.0	61.0					6																	13206098		1968	4153	6121	SO:0001583	missense	221692	1	120926	30				g.chr6:13206098C>T	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.716C>T	chr6.hg19:g.13206098C>T	ENSP00000368655:p.Pro239Leu	0					PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000332995.7_Missense_Mutation_p.P239L|PHACTR1_ENST00000457702.2_Missense_Mutation_p.P94L	p.P239L			1	2	3	1.996224	Q9C0D0	PHAR1_HUMAN	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)	7	845	+	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379350.1	0	1	hg19	c.716C>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.605951|4.605951	0.87157|0.87157	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000379350;ENST00000332995;ENST00000432934;ENST00000457702|ENST00000415087	T;T;T|.	0.44482|.	0.92;1.13;1.25|.	5.15|5.15	5.15|5.15	0.70609|0.70609	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.44871|0.44871	0.1314|0.1314	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.87578|.	0.992;0.997;0.998|.	T|T	0.34502|0.34502	-0.9826|-0.9826	10|5	0.72032|.	D|.	0.01|.	-16.0863|-16.0863	17.7928|17.7928	0.88561|0.88561	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	308;239;239|.	E7ESR5;Q9C0D0;Q9C0D0-2|.	.;PHAR1_HUMAN;.|.	L|C	239;239;308;94|74	ENSP00000368655:P239L;ENSP00000329880:P239L;ENSP00000397669:P94L|.	ENSP00000329880:P239L|.	P|R	+|+	2|1	0|0	0|0	PHACTR1|PHACTR1	13314077|13314077	13314077|13314077	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.012000|7.012000	0.76366|0.76366	2.665000|2.665000	0.90641|0.90641	0.561000|0.561000	0.74099|0.74099	CCG|CGC	0.394721		TCGA-US-A77E-01A-11D-A32N-08	0.587	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1	0	0	1		2	2	2	0	0	0	0	96	0	96	95	1	2.070000	-2.029818	0	0.390000	XM_166420		0	5	5	0	356	351	0	0	1			0	0	96	0	0	0.935646	0	0	0	0	0	0	5	356
NUP153	9972	broad.mit.edu	37	6	17706578	17706578	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr6:17706578C>T	ENST00000262077.2	-	1	40	c.41G>A	c.(40-42)gGc>gAc	p.G14D	RP11-500C11.3_ENST00000606771.1_RNA|NUP153_ENST00000537253.1_Missense_Mutation_p.G14D	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	14	Gly-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CCGGATCTTGCCGCCACCGCC	0.726																																						ENST00000262077.2	1.000000	4.000000e-02	0.190000	0.080000	0.120000	0.160111	0.120000	0.120000																										0				53						c.(40-42)gGc>gAc		nucleoporin 153kDa							53.0	45.0	48.0					6																	17706578		2201	4299	6500	SO:0001583	missense	9972	0	0					g.chr6:17706578C>T	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.41G>A	chr6.hg19:g.17706578C>T	ENSP00000262077:p.Gly14Asp	0					NUP153_ENST00000537253.1_Missense_Mutation_p.G14D|RP11-500C11.3_ENST00000606771.1_RNA	p.G14D	NM_005124.2	NP_005115.2	1	2	3	1.996224	P49790	NU153_HUMAN	all cancers(50;0.0981)|Epithelial(50;0.112)	1	40	-	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	0	1	hg19	c.41G>A	CCDS4541.1	0	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008788	0.75046	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.35048	1.33;1.43	3.12	3.12	0.35913	3.12	3.12	0.35913	.	0.000000	0.35525	N	0.003147	T	0.40015	0.1100	L	0.46157	1.445	0.42084	D	0.991265	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.33548	-0.9864	10	0.87932	D	0	-8.5848	10.0092	0.41975	0.0:1.0:0.0:0.0	.	14;36;14	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	D	14;36;14	ENSP00000262077:G14D;ENSP00000444029:G14D	ENSP00000262077:G14D	G	-	2	0	0	NUP153	17814557	17814557	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.110000	0.50352	2.085000	0.62840	0.591000	0.81541	GGC	0.394721		TCGA-US-A77E-01A-11D-A32N-08	0.726	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1	0	0	1		2	2	2	0	0	0	0	52	0	52	51	1	2.070000	-3.085488	1	0.390000			0	6	6	0	258	254	0	0	1	0		0	0	52	0	0	0.963787	4.173195e-02	0	0	0	12	0	6	258
TNXB	7148	broad.mit.edu	37	6	32046862	32046862	+	Silent	SNP	G	G	A	rs369938377		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr6:32046862G>A	ENST00000375244.3	-	11	4524	c.4323C>T	c.(4321-4323)taC>taT	p.Y1441Y	RNA5SP206_ENST00000516703.1_RNA|TNXB_ENST00000375247.2_Silent_p.Y1441Y			P22105	TENX_HUMAN	tenascin XB	1528					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CGTGGAGGCCGTACAGGTGCA	0.697																																						ENST00000375244.3	1.000000	2.000000e-02	0.120000	0.040000	0.070000	0.106896	0.070000	0.070000																										0				8						c.(4321-4323)taC>taT		tenascin XB		G		1,2591		0,1,1295	54.0	62.0	59.0		4323	-5.5	0.7	6		59	0,5136		0,0,2568	no	coding-synonymous	TNXB	NM_019105.6		0,1,3863	AA,AG,GG		0.0,0.0386,0.0129		1441/4243	32046862	1,7727	1296	2568	3864	SO:0001819	synonymous_variant	7148	5	120864	39				g.chr6:32046862G>A	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.4323C>T	chr6.hg19:g.32046862G>A		0					TNXB_ENST00000375247.2_Silent_p.Y1441Y|RNA5SP206_ENST00000516703.1_RNA	p.Y1441Y			1	2	3	1.996224	P22105	TENX_HUMAN		11	4524	-			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	0	1	hg19	c.4323C>T		0																																																																																								0.394721		TCGA-US-A77E-01A-11D-A32N-08	0.697	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	0	0	1		2	2	2	0	0	0	0	105	0	105	102	1	2.070000	-2.602696	1	0.390000	NM_019105		0	5	5	0	377	373	0	0	1	0		0	0	105	0	0	0.936193	2.725191e-03	0	0	0	5	0	5	377
DST	667	broad.mit.edu	37	6	56492887	56492887	+	Nonsense_Mutation	SNP	C	C	T	rs149154059		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr6:56492887C>T	ENST00000361203.3	-	29	3922	c.3915G>A	c.(3913-3915)tgG>tgA	p.W1305*	DST_ENST00000518935.1_Nonsense_Mutation_p.W979*|DST_ENST00000370788.2_Nonsense_Mutation_p.W1305*|DST_ENST00000370769.4_Nonsense_Mutation_p.W1305*|DST_ENST00000244364.6_Nonsense_Mutation_p.W979*|DST_ENST00000446842.2_Nonsense_Mutation_p.W979*|DST_ENST00000421834.2_Nonsense_Mutation_p.W1305*|DST_ENST00000370765.6_Nonsense_Mutation_p.W979*|DST_ENST00000312431.6_Nonsense_Mutation_p.W1305*|DST_ENST00000370754.5_Nonsense_Mutation_p.W1483*			Q03001	DYST_HUMAN	dystonin	1305					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCTGCTGGATCCAATCATCTA	0.403																																						ENST00000361203.3	0.460000	1.700000e-01	0.380000	0.220000	0.290000	0.303844	0.290000	0.280000																										0				105						c.(3913-3915)tgG>tgA		dystonin							141.0	131.0	134.0					6																	56492887		2203	4300	6503	SO:0001587	stop_gained	667	0	0					g.chr6:56492887C>T	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3915G>A	chr6.hg19:g.56492887C>T	ENSP00000354508:p.Trp1305*	0					DST_ENST00000370788.2_Nonsense_Mutation_p.W1305*|DST_ENST00000421834.2_Nonsense_Mutation_p.W1305*|DST_ENST00000370754.5_Nonsense_Mutation_p.W1483*|DST_ENST00000446842.2_Nonsense_Mutation_p.W979*|DST_ENST00000370765.6_Nonsense_Mutation_p.W979*|DST_ENST00000312431.6_Nonsense_Mutation_p.W1305*|DST_ENST00000518935.1_Nonsense_Mutation_p.W979*|DST_ENST00000244364.6_Nonsense_Mutation_p.W979*|DST_ENST00000370769.4_Nonsense_Mutation_p.W1305*	p.W1305*			1	2	3	1.979114	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)	29	3922	-	Lung NSC(77;0.103)		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	ENST00000361203.3	0	1	hg19	c.3915G>A		0	.	.	.	.	.	.	.	.	.	.	C	42	9.322677	0.99137	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	.	.	.	5.45	5.45	0.79879	5.45	5.45	0.79879	.	0.000000	0.49305	D	0.000156	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6695	0.95905	0.0:1.0:0.0:0.0	.	.	.	.	X	979;1483;1305;1305;979;1305;1305;1305;979;1345;979;979	.	ENSP00000244364:W979X	W	-	3	0	0	DST	56600846	56600846	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.880000	0.69698	2.701000	0.92244	0.650000	0.86243	TGG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.403	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	1	0	0		2	2	2	0	0	0	0	52	0	52	52	1	2.070000	-17.959750	1	0.390000	NM_001723		0	15	16	0	252	250	0	0	1	0		0	0	52	0	0	0.999881	3.123456e-01	0	1	0	18	0	15	252
COL12A1	1303	broad.mit.edu	37	6	75901461	75901461	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr6:75901461G>A	ENST00000322507.8	-	5	659	c.350C>T	c.(349-351)tCg>tTg	p.S117L	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.S117L|COL12A1_ENST00000483888.2_Missense_Mutation_p.S117L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	117	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGGCTTTGTCGAACTACCTGT	0.299																																						ENST00000322507.8	0.880000	5.100000e-01	0.780000	0.590000	0.680000	0.691649	0.680000	0.680000																										0				169						c.(349-351)tCg>tTg		collagen, type XII, alpha 1							142.0	135.0	137.0					6																	75901461		1798	4055	5853	SO:0001583	missense	1303	3	120760	39				g.chr6:75901461G>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.350C>T	chr6.hg19:g.75901461G>A	ENSP00000325146:p.Ser117Leu	0					COL12A1_ENST00000416123.2_Missense_Mutation_p.S117L|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.S117L	p.S117L	NM_004370.5	NP_004361.3	1	2	3	1.979114	Q99715	COCA1_HUMAN		5	659	-			O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	1	1	hg19	c.350C>T	CCDS43482.1	0	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967274	0.34754	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	D;D;D	0.86769	-2.17;-2.16;-2.15	5.97	5.97	0.96955	5.97	5.97	0.96955	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.488510	0.20737	N	0.086602	T	0.56232	0.1971	N	0.08118	0	0.21579	N	0.99963	B	0.02656	0.0	B	0.01281	0.0	T	0.30822	-0.9965	10	0.22706	T	0.39	.	8.1231	0.30982	0.0784:0.0:0.7627:0.1589	.	117	Q99715	COCA1_HUMAN	L	117	ENSP00000325146:S117L;ENSP00000412864:S117L;ENSP00000421216:S117L	ENSP00000325146:S117L	S	-	2	0	0	COL12A1	75958181	75958181	0.123000	0.22298	0.822000	0.32727	0.868000	0.49771	1.943000	0.40253	2.833000	0.97629	0.585000	0.79938	TCG	0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.299	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	1	0	1		2	2	2	0	0	0	0	65	0	65	64	1	2.070000	-19.461560	1	0.390000	NM_004370		0	47	47	0	306	303	1	0	1	0		0	0	65	0	0	1.000000	9.726732e-01	0	0	0	39	0	47	306
TRDN	10345	broad.mit.edu	37	6	123539785	123539785	+	Silent	SNP	A	A	G			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr6:123539785A>G	ENST00000398178.3	-	41	2172	c.2151T>C	c.(2149-2151)ggT>ggC	p.G717G	TRDN_ENST00000334268.4_Silent_p.G709G	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	717					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AATTTGCTTGACCAGAGCTCT	0.438																																						ENST00000398178.3	1.000000	5.000000e-01	0.990000	0.640000	0.800000	0.807459	0.800000	1.000000																										0				41						c.(2149-2151)ggT>ggC		triadin							114.0	107.0	109.0					6																	123539785		1887	4114	6001	SO:0001819	synonymous_variant	10345	0	0					g.chr6:123539785A>G	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.2151T>C	chr6.hg19:g.123539785A>G		0					TRDN_ENST00000334268.4_Silent_p.G709G	p.G717G	NM_006073.3	NP_006064.2	1	2	3	1.979114	Q13061	TRDN_HUMAN		41	2172	-			A5D6W5|F5H2W7|Q6NSB8	Silent	SNP	ENST00000398178.3	0	1	hg19	c.2151T>C	CCDS55053.1	0																																																																																								0.391187		TCGA-US-A77E-01A-11D-A32N-08	0.438	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0	0	0	0	15	0	15	15	1	2.070000	-11.907530	1	0.390000			0	18	18	0	97	96	1	0	1			0	0	15	0	0	0.999989	0	0	0	0	0	0	18	97
KIAA1549	57670	broad.mit.edu	37	7	138566147	138566147	+	Missense_Mutation	SNP	G	G	C			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr7:138566147G>C	ENST00000422774.1	-	11	4264	c.4216C>G	c.(4216-4218)Cgt>Ggt	p.R1406G	KIAA1549_ENST00000242365.4_Missense_Mutation_p.R1356G|KIAA1549_ENST00000440172.1_Missense_Mutation_p.R1406G			Q9HCM3	K1549_HUMAN	KIAA1549	1406						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CCTCTGTGACGAACATTCTTG	0.502			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	ENST00000422774.1	1.000000	7.200000e-01	1.000000	0.810000	0.910000	0.911890	0.910000	1.000000				Dom	yes			Dom	yes		7	7q34	7q34	57670	O	KIAA1549				O	O	BRAF		pilocytic astrocytoma	KIAA1549/BRAF(703)	0				7						c.(4216-4218)Cgt>Ggt		KIAA1549							132.0	135.0	134.0					7																	138566147		1995	4168	6163	SO:0001583	missense	57670	0	0					g.chr7:138566147G>C		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4216C>G	chr7.hg19:g.138566147G>C	ENSP00000416040:p.Arg1406Gly	1					KIAA1549_ENST00000242365.4_Missense_Mutation_p.R1356G|KIAA1549_ENST00000440172.1_Missense_Mutation_p.R1406G	p.R1406G			1	2	3	2.349308	Q9HCM3	K1549_HUMAN		11	4264	-			B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	1	1	hg19	c.4216C>G	CCDS56513.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221722	0.79464	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.27557	1.66;1.66;1.68	5.23	5.23	0.72850	5.23	5.23	0.72850	.	0.101100	0.64402	D	0.000003	T	0.55242	0.1908	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.81914	0.995;0.965;0.991;0.965	T	0.56547	-0.7961	10	0.72032	D	0.01	.	17.5362	0.87832	0.0:0.0:1.0:0.0	.	1406;190;1406;190	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3	K1549_HUMAN;.;.;.	G	1406;1356;1406	ENSP00000406661:R1406G;ENSP00000242365:R1356G;ENSP00000416040:R1406G	ENSP00000242365:R1356G	R	-	1	0	0	KIAA1549	138216687	138216687	1.000000	0.71417	0.942000	0.38095	0.793000	0.44817	5.140000	0.64807	2.716000	0.92895	0.655000	0.94253	CGT	0.489540		TCGA-US-A77E-01A-11D-A32N-08	0.502	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1	1	0	1		2	2	2	0	0	0	0	79	0	79	79	1	2.070000	-2.880992	1	0.390000			0	68	66	0	385	380	1	0	1	1		0	0	79	0	0	1.000000	5.601395e-01	0	5	0	7	0	68	385
ZNF212	7988	broad.mit.edu	37	7	148951330	148951330	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr7:148951330C>T	ENST00000335870.2	+	5	1440	c.1312C>T	c.(1312-1314)Cac>Tac	p.H438Y		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			GAGCTTCAGTCACCCATCTGA	0.587																																						ENST00000335870.2	1.000000	8.100000e-01	1.000000	0.920000	0.990000	0.973299	0.990000	1.000000																										0				9						c.(1312-1314)Cac>Tac		zinc finger protein 212							147.0	108.0	121.0					7																	148951330		2203	4300	6503	SO:0001583	missense	7988	0	0					g.chr7:148951330C>T	U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.1312C>T	chr7.hg19:g.148951330C>T	ENSP00000338572:p.His438Tyr	1						p.H438Y	NM_012256.3	NP_036388.2	1	2	3	2.349308	Q9UDV6	ZN212_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00171)	5	1440	+	Melanoma(164;0.15)		B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	ENST00000335870.2	1	1	hg19	c.1312C>T	CCDS5896.1	1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789182	0.70337	.	.	ENSG00000170260	ENST00000335870	T	0.06528	3.29	5.1	5.1	0.69264	5.1	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000051	T	0.10895	0.0266	N	0.19112	0.55	0.37851	D	0.92938	D	0.67145	0.996	D	0.65010	0.931	T	0.43147	-0.9409	10	0.16420	T	0.52	-15.4352	14.3872	0.66953	0.0:1.0:0.0:0.0	.	438	Q9UDV6	ZN212_HUMAN	Y	438	ENSP00000338572:H438Y	ENSP00000338572:H438Y	H	+	1	0	0	ZNF212	148582263	148582263	0.000000	0.05858	1.000000	0.80357	0.932000	0.56968	0.028000	0.13644	2.536000	0.85505	0.561000	0.74099	CAC	0.489540		TCGA-US-A77E-01A-11D-A32N-08	0.587	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352710.1	1	0	1		2	2	2	0	0	0	0	61	0	61	60	1	2.070000	-20.000000	1	0.390000	NM_012256		0	59	59	0	287	287	1	0	1	1		0	0	61	0	0	1.000000	9.923151e-01	0	14	0	25	0	59	287
CARD11	84433	broad.mit.edu	37	7	2984085	2984085	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr7:2984085G>A	ENST00000396946.4	-	5	848	c.445C>T	c.(445-447)Cgc>Tgc	p.R149C	AC004906.3_ENST00000423194.1_RNA	NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	149					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		AGCTCGCAGCGTTGCAGGTCC	0.607			Mis		DLBCL																																	ENST00000396946.4	1.000000	7.700000e-01	1.000000	0.850000	0.950000	0.939554	0.950000	1.000000				Dom	yes			Dom	yes		7	7p22	7p22	84433	Mis	"""caspase recruitment domain family, member 11"""				L	L			DLBCL		0				150						c.(445-447)Cgc>Tgc		caspase recruitment domain family, member 11							94.0	86.0	89.0					7																	2984085		2203	4300	6503	SO:0001583	missense	84433	0	0					g.chr7:2984085G>A	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.445C>T	chr7.hg19:g.2984085G>A	ENSP00000380150:p.Arg149Cys	1					AC004906.3_ENST00000423194.1_RNA	p.R149C	NM_032415.4	NP_115791.3	1	2	3	2.339105	Q9BXL7	CAR11_HUMAN		5	848	-		Ovarian(82;0.0115)	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	1	1	hg19	c.445C>T	CCDS5336.2	1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124918	0.56613	.	.	ENSG00000198286	ENST00000396946	T	0.35048	1.33	4.38	4.38	0.52667	4.38	4.38	0.52667	.	0.370990	0.28766	N	0.014207	T	0.44265	0.1285	L	0.43152	1.355	0.58432	D	0.999992	D	0.76494	0.999	P	0.55871	0.786	T	0.42799	-0.9430	10	0.72032	D	0.01	-31.7767	12.44	0.55619	0.0:0.0:0.8323:0.1677	.	149	Q9BXL7	CAR11_HUMAN	C	149	ENSP00000380150:R149C	ENSP00000380150:R149C	R	-	1	0	0	CARD11	2950611	2950611	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.048000	0.57390	2.153000	0.67306	0.655000	0.94253	CGC	0.480210		TCGA-US-A77E-01A-11D-A32N-08	0.607	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	1	0	1		2	2	2	0	0	0	0	118	0	118	118	1	2.070000	-20.000000	1	0.390000	NM_032415		0	87	85	0	466	460	1	0	1	1		0	0	118	0	0	1.000000	9.456846e-01	0	9	0	19	0	87	466
TECPR1	25851	broad.mit.edu	37	7	97858456	97858456	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr7:97858456G>T	ENST00000447648.2	-	16	2604	c.2305C>A	c.(2305-2307)Cac>Aac	p.H769N	TECPR1_ENST00000379795.3_Missense_Mutation_p.H770N|TECPR1_ENST00000542604.1_Missense_Mutation_p.H699N|TECPR1_ENST00000479975.1_5'Flank			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	769					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ATCCGCAGGTGGCCTCCCATC	0.642																																						ENST00000447648.2	1.000000	6.100000e-01	1.000000	0.900000	0.990000	0.958050	0.990000	1.000000																										0				26						c.(2305-2307)Cac>Aac		tectonin beta-propeller repeat containing 1							17.0	23.0	21.0					7																	97858456		1932	4115	6047	SO:0001583	missense	25851	0	0					g.chr7:97858456G>T		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.2305C>A	chr7.hg19:g.97858456G>T	ENSP00000404923:p.His769Asn	1					TECPR1_ENST00000542604.1_Missense_Mutation_p.H699N|TECPR1_ENST00000479975.1_5'Flank|TECPR1_ENST00000379795.3_Missense_Mutation_p.H770N	p.H769N			1	2	3	2.348736	Q7Z6L1	TCPR1_HUMAN		16	2604	-			A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	ENST00000447648.2	0	1	hg19	c.2305C>A	CCDS47648.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.208596	0.95069	.	.	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	T;T;T	0.49432	1.02;1.02;0.78	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.051894	0.85682	D	0.000000	T	0.68449	0.3002	M	0.76002	2.32	0.50171	D	0.999851	D;D	0.58970	0.984;0.979	D;P	0.66084	0.941;0.761	T	0.72577	-0.4251	10	0.72032	D	0.01	-30.3075	17.6109	0.88053	0.0:0.0:1.0:0.0	.	699;769	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	N	769;770;699	ENSP00000404923:H769N;ENSP00000369121:H770N;ENSP00000441121:H699N	ENSP00000369121:H770N	H	-	1	0	0	TECPR1	97696392	97696392	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.830000	0.99415	2.389000	0.81357	0.549000	0.68633	CAC	0.489540		TCGA-US-A77E-01A-11D-A32N-08	0.642	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	1	0	1		2	2	2	0	0	0	0	10	0	10	10	1	2.070000	-15.917780	1	0.390000	NM_015395		0	7	7	0	27	26	1	0	1	1		0	0	10	0	0	0.982807	9.828066e-01	0	6	0	27	0	7	27
DPP6	1804	broad.mit.edu	37	7	154667694	154667694	+	Silent	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr7:154667694C>T	ENST00000377770.3	+	20	2103	c.1962C>T	c.(1960-1962)ggC>ggT	p.G654G	DPP6_ENST00000427557.1_Silent_p.G547G|DPP6_ENST00000332007.3_Silent_p.G592G|DPP6_ENST00000404039.1_Silent_p.G590G			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	654					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GCAGCCACGGCGCGGTGGTGG	0.647																																					NSCLC(125;1384 1783 2490 7422 34254)	ENST00000377770.3	0.750000	2.300000e-01	0.600000	0.330000	0.450000	0.474469	0.450000	0.450000																										0				71						c.(1960-1962)ggC>ggT		dipeptidyl-peptidase 6							29.0	36.0	33.0					7																	154667694		2076	4202	6278	SO:0001819	synonymous_variant	1804	0	0					g.chr7:154667694C>T	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1962C>T	chr7.hg19:g.154667694C>T		1					DPP6_ENST00000427557.1_Silent_p.G547G|DPP6_ENST00000332007.3_Silent_p.G592G|DPP6_ENST00000404039.1_Silent_p.G590G	p.G654G			1	2	3	2.349308	P42658	DPP6_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0562)	20	2103	+	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)		Silent	SNP	ENST00000377770.3	1	1	hg19	c.1962C>T		0																																																																																								0.489540		TCGA-US-A77E-01A-11D-A32N-08	0.647	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	1	0	1		2	2	2	0	0	0	0	26	0	26	26	1	2.070000	-14.490230	1	0.390000	NM_130797		0	10	10	0	129	129	0	0	1	0		0	0	26	0	0	0.997221	1.857956e-02	0	0	0	3	0	10	129
IDO1	3620	broad.mit.edu	37	8	39775725	39775725	+	Splice_Site	SNP	A	A	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr8:39775725A>T	ENST00000518237.1	+	3	941	c.302A>T	c.(301-303)aAg>aTg	p.K101M	IDO1_ENST00000522495.1_Splice_Site_p.K101M|RP11-44K6.3_ENST00000517623.1_RNA|RP11-44K6.4_ENST00000522970.1_RNA|RP11-44K6.2_ENST00000520185.1_RNA	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	101					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	GATGTCCGTAAGGTTTGGAGA	0.398																																						ENST00000518237.1	1.000000	9.000000e-01	1.000000	0.990000	0.990000	0.993234	0.990000	1.000000																										0				12						c.(301-303)aAg>aTg		indoleamine 2,3-dioxygenase 1	L-Tryptophan(DB00150)|Melatonin(DB01065)						112.0	105.0	107.0					8																	39775725		1913	4134	6047	SO:0001630	splice_region_variant	3620	0	0					g.chr8:39775725A>T	M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.303+1A>T	chr8.hg19:g.39775725A>T		0					RP11-44K6.4_ENST00000522970.1_RNA|IDO1_ENST00000522495.1_Splice_Site_p.K101M|RP11-44K6.2_ENST00000520185.1_RNA|RP11-44K6.3_ENST00000517623.1_RNA	p.K101M	NM_002164.5	NP_002155.1	0	1	1	1.967067	P14902	I23O1_HUMAN		3	941	+			Q540B4	Splice_Site	SNP	ENST00000518237.1	1	0	hg19	c.302A>T	CCDS47847.1	1	.	.	.	.	.	.	.	.	.	.	A	16.87	3.243130	0.58995	.	.	ENSG00000131203	ENST00000519154;ENST00000522495;ENST00000518237	T;T;T	0.50277	0.75;0.75;0.75	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.166139	0.38605	N	0.001628	T	0.67767	0.2928	M	0.83953	2.67	0.41481	D	0.98816	D	0.65815	0.995	D	0.64144	0.922	T	0.72384	-0.4310	9	.	.	.	-19.5956	12.2669	0.54683	1.0:0.0:0.0:0.0	.	101	P14902	I23O1_HUMAN	M	101	ENSP00000428716:K101M;ENSP00000430505:K101M;ENSP00000430950:K101M	.	K	+	2	0	0	IDO1	39894882	39894882	0.998000	0.40836	0.974000	0.42286	0.281000	0.26958	4.977000	0.63792	2.154000	0.67381	0.477000	0.44152	AAG	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.398	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376987.1	1	0	1		2	2	2	0	0	0	0	63	0	63	60	1	2.070000	-20.000000	1	0.390000	NM_002164	Missense_Mutation	0	76	74	0	270	267	1	0	1	0		0	0	63	0	0	1.000000	3.070964e-01	0	1	0	4	0	76	270
SOX17	64321	broad.mit.edu	37	8	55372148	55372148	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr8:55372148G>T	ENST00000297316.4	+	2	1042	c.838G>T	c.(838-840)Ggt>Tgt	p.G280C		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	280	Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			AGAGCCCGCGGGTCCCTCGAT	0.761																																						ENST00000297316.4	1.000000	8.400000e-01	1.000000	0.990000	0.990000	0.990877	0.990000	1.000000																										0				18						c.(838-840)Ggt>Tgt		SRY (sex determining region Y)-box 17							2.0	2.0	2.0					8																	55372148		1420	3036	4456	SO:0001583	missense	64321	0	0					g.chr8:55372148G>T	AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.838G>T	chr8.hg19:g.55372148G>T	ENSP00000297316:p.Gly280Cys	0						p.G280C	NM_022454.3	NP_071899.1	0	1	1	1.967067	Q9H6I2	SOX17_HUMAN	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)	2	1042	+		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)		Missense_Mutation	SNP	ENST00000297316.4	0	1	hg19	c.838G>T	CCDS6159.1	1	.	.	.	.	.	.	.	.	.	.	G	6.286	0.420879	0.11928	.	.	ENSG00000164736	ENST00000297316	T	0.77620	-1.11	4.44	3.49	0.39957	4.44	3.49	0.39957	.	0.789630	0.11802	N	0.527999	T	0.73583	0.3605	M	0.63843	1.955	0.25014	N	0.99138	B	0.33345	0.409	B	0.34489	0.184	T	0.64394	-0.6418	10	0.37606	T	0.19	.	9.5602	0.39364	0.0:0.153:0.6895:0.1574	.	280	Q9H6I2	SOX17_HUMAN	C	280	ENSP00000297316:G280C	ENSP00000297316:G280C	G	+	1	0	0	SOX17	55534701	55534701	0.009000	0.17119	0.185000	0.23176	0.085000	0.17905	1.627000	0.37050	2.006000	0.58801	0.455000	0.32223	GGT	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.761	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378526.2	1	0	1		2	2	2	0	0	0	0	8	0	8	8	1	2.070000	-19.982810	1	0.390000			0	7	7	0	12	11	0	0	1	0		0	0	8	0	0	0.985060	3.320158e-01	0	0	0	3	0	7	12
LAPTM4B	55353	broad.mit.edu	37	8	98817579	98817579	+	Splice_Site	SNP	A	A	T	rs149932386		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr8:98817579A>T	ENST00000521545.2	+	2	333		c.e2-1		LAPTM4B_ENST00000445593.2_Splice_Site			Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			TTCTTGTTGCAGATCATCAAT	0.388																																						ENST00000521545.2	0.320000	1.400000e-01	0.280000	0.170000	0.220000	0.231466	0.220000	0.220000																										0				10						c.e2-1		lysosomal protein transmembrane 4 beta							103.0	98.0	100.0					8																	98817579		2203	4300	6503	SO:0001630	splice_region_variant	55353	0	0					g.chr8:98817579A>T	AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000521545.2:c.100-1A>T	chr8.hg19:g.98817579A>T		0					LAPTM4B_ENST00000445593.2_Splice_Site				0	1	1	1.967067	Q86VI4	LAP4B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.149)	2	333	+	Breast(36;1.59e-06)		Q3ZCV5|Q7L909|Q86VH8|Q9H060	Splice_Site	SNP	ENST00000521545.2	1	0	hg19			0	.	.	.	.	.	.	.	.	.	.	A	19.74	3.884628	0.72410	.	.	ENSG00000104341	ENST00000445593;ENST00000378722;ENST00000517924;ENST00000521545	.	.	.	5.07	5.07	0.68467	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.653	0.56772	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	LAPTM4B	98886755	98886755	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.723000	0.84788	2.036000	0.60181	0.533000	0.62120	.	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.388	LAPTM4B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000380016.2	1	0	1		2	2	2	0	0	0	0	95	0	95	93	1	2.070000	-1.522542	0	0.390000		Intron	0	22	12	0	483	461	0	0	1			0	0	95	0	0	0.999998	0	0	0	0	0	0	22	483
DGAT1	8694	broad.mit.edu	37	8	145541605	145541605	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr8:145541605C>T	ENST00000332324.4	-	9	1100	c.827G>A	c.(826-828)cGc>cAc	p.R276H	GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000527438.1_5'Flank|DGAT1_ENST00000531896.1_Silent_p.A306A	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	276					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			CAGCAGAAAGCGCTTCCGGAT	0.622																																						ENST00000332324.4	0.350000	9.000000e-02	0.280000	0.130000	0.190000	0.212676	0.190000	0.190000																										0				9						c.(826-828)cGc>cAc		diacylglycerol O-acyltransferase 1							28.0	35.0	33.0					8																	145541605		2202	4293	6495	SO:0001583	missense	8694	0	0					g.chr8:145541605C>T	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.827G>A	chr8.hg19:g.145541605C>T	ENSP00000332258:p.Arg276His	0					GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000531896.1_Silent_p.A306A|DGAT1_ENST00000527438.1_5'Flank	p.R276H	NM_012079.4	NP_036211.2	0	1	1	1.967067	O75907	DGAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)	9	1100	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		B2RWQ2|D3DWL6|Q96BB8	Missense_Mutation	SNP	ENST00000332324.4	0	1	hg19	c.827G>A	CCDS6420.1	0	.	.	.	.	.	.	.	.	.	.	C	21.9	4.213109	0.79352	.	.	ENSG00000185000	ENST00000332324	T	0.72942	-0.7	4.77	4.77	0.60923	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.66336	0.2779	M	0.66439	2.03	0.80722	D	1	P	0.46457	0.878	B	0.36845	0.234	T	0.71457	-0.4587	10	0.42905	T	0.14	-15.1045	15.3179	0.74095	0.0:1.0:0.0:0.0	.	276	O75907	DGAT1_HUMAN	H	276	ENSP00000332258:R276H	ENSP00000332258:R276H	R	-	2	0	0	DGAT1	145512413	145512413	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.047000	0.76599	2.481000	0.83766	0.555000	0.69702	CGC	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.622	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382059.3	0	0	1		2	2	2	0	0	0	0	46	0	46	45	1	2.070000	-9.903371	1	0.390000	NM_012079		0	8	8	0	205	202	0	0	1	1		0	0	46	0	0	0.989158	9.948823e-01	0	14	0	235	0	8	205
ELAVL2	1993	broad.mit.edu	37	9	23692693	23692693	+	Missense_Mutation	SNP	A	A	C			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr9:23692693A>C	ENST00000397312.2	-	7	1216	c.942T>G	c.(940-942)aaT>aaG	p.N314K	ELAVL2_ENST00000380110.4_Missense_Mutation_p.N344K|ELAVL2_ENST00000380117.1_Missense_Mutation_p.N314K|ELAVL2_ENST00000544538.1_Missense_Mutation_p.N314K|ELAVL2_ENST00000223951.6_Missense_Mutation_p.N301K	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	314	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		CTTTGCATTTATTGGTGTTAA	0.473																																						ENST00000397312.2	0.310000	1.300000e-01	0.270000	0.160000	0.210000	0.220407	0.210000	0.210000																										0				39						c.(940-942)aaT>aaG		ELAV like neuron-specific RNA binding protein 2							136.0	117.0	124.0					9																	23692693		2203	4300	6503	SO:0001583	missense	1993	0	0					g.chr9:23692693A>C	BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.942T>G	chr9.hg19:g.23692693A>C	ENSP00000380479:p.Asn314Lys	1					ELAVL2_ENST00000223951.6_Missense_Mutation_p.N301K|ELAVL2_ENST00000544538.1_Missense_Mutation_p.N314K|ELAVL2_ENST00000380117.1_Missense_Mutation_p.N314K|ELAVL2_ENST00000380110.4_Missense_Mutation_p.N344K	p.N314K	NM_004432.3	NP_004423.2	0	2	2	1.971494	Q12926	ELAV2_HUMAN		7	1216	-			D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	1	1	hg19	c.942T>G	CCDS6515.1	0	.	.	.	.	.	.	.	.	.	.	A	12.36	1.913291	0.33815	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	5.94	4.81	0.61882	5.94	4.81	0.61882	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.12178	0.0296	L	0.28740	0.885	0.80722	D	1	P;D	0.61080	0.776;0.989	B;D	0.66497	0.377;0.944	T	0.05435	-1.0885	10	0.51188	T	0.08	.	8.3434	0.32258	0.7382:0.0:0.2618:0.0	.	314;301	Q12926;Q12926-2	ELAV2_HUMAN;.	K	301;314;314;301;314;342	ENSP00000223951:N301K;ENSP00000380479:N314K;ENSP00000440998:N314K;ENSP00000369460:N314K	ENSP00000223951:N301K	N	-	3	2	2	ELAVL2	23682693	23682693	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.183000	0.58317	1.074000	0.40909	0.528000	0.53228	AAT	0.390000		TCGA-US-A77E-01A-11D-A32N-08	0.473	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	1	0	1		2	2	2	0	0	0	0	111	0	111	110	1	2.070000	-19.576970	1	0.390000	NM_004432		0	20	20	0	465	458	0	0	1			0	0	111	0	0	0.999995	0	0	0	0	0	0	20	465
TRPM3	80036	broad.mit.edu	37	9	73442926	73442926	+	Silent	SNP	C	C	T	rs376572718		TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr9:73442926C>T	ENST00000377111.2	-	6	1053	c.810G>A	c.(808-810)cgG>cgA	p.R270R	TRPM3_ENST00000408909.2_Silent_p.R117R|TRPM3_ENST00000358082.3_Silent_p.R117R|TRPM3_ENST00000396280.5_Silent_p.R117R|TRPM3_ENST00000396292.4_Silent_p.R117R|TRPM3_ENST00000361823.5_Silent_p.R117R|TRPM3_ENST00000357533.2_Silent_p.R272R|TRPM3_ENST00000423814.3_Silent_p.R272R|TRPM3_ENST00000396285.1_Silent_p.R117R|TRPM3_ENST00000396283.1_Silent_p.R117R|TRPM3_ENST00000360823.2_Silent_p.R117R|TRPM3_ENST00000377110.3_Silent_p.R270R|TRPM3_ENST00000377105.1_Silent_p.R117R|TRPM3_ENST00000377106.1_Silent_p.R117R|TRPM3_ENST00000377101.1_Silent_p.R117R	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	270					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TCTGGTATGGCCGGACAACCT	0.458																																						ENST00000377111.2	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.057714	0.040000	0.050000																										0				95						c.(808-810)cgG>cgA		transient receptor potential cation channel, subfamily M, member 3		C	,,,,,,,,	0,4406		0,0,2203	151.0	143.0	146.0		351,810,351,351,351,351,351,351,351	1.7	1.0	9		146	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TRPM3	NM_001007470.1,NM_001007471.2,NM_020952.4,NM_024971.5,NM_206944.3,NM_206945.3,NM_206946.3,NM_206947.3,NM_206948.2	,,,,,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,,,	117/256,270/1708,117/1555,117/1567,117/1545,117/1557,117/1580,117/1570,117/231	73442926	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	80036	2	121410	35				g.chr9:73442926C>T	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.810G>A	chr9.hg19:g.73442926C>T		0					TRPM3_ENST00000360823.2_Silent_p.R117R|TRPM3_ENST00000396283.1_Silent_p.R117R|TRPM3_ENST00000361823.5_Silent_p.R117R|TRPM3_ENST00000396285.1_Silent_p.R117R|TRPM3_ENST00000423814.3_Silent_p.R272R|TRPM3_ENST00000396292.4_Silent_p.R117R|TRPM3_ENST00000377105.1_Silent_p.R117R|TRPM3_ENST00000358082.3_Silent_p.R117R|TRPM3_ENST00000377101.1_Silent_p.R117R|TRPM3_ENST00000377110.3_Silent_p.R270R|TRPM3_ENST00000408909.2_Silent_p.R117R|TRPM3_ENST00000396280.5_Silent_p.R117R|TRPM3_ENST00000377106.1_Silent_p.R117R|TRPM3_ENST00000357533.2_Silent_p.R272R	p.R270R	NM_001007471.2	NP_001007472.2	0	1	1	1.968358	Q9HCF6	TRPM3_HUMAN		6	1053	-			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	0	1	hg19	c.810G>A		0	.	.	.	.	.	.	.	.	.	.	C	9.804	1.181369	0.21787	0.0	1.16E-4	ENSG00000083067	ENST00000396280	.	.	.	5.83	1.69	0.24217	5.83	1.69	0.24217	.	.	.	.	.	T	0.46502	0.1396	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27365	-1.0076	4	.	.	.	-20.7328	4.1127	0.10067	0.2451:0.4474:0.0:0.3075	.	.	.	.	T	117	.	.	A	-	1	0	0	TRPM3	72632746	72632746	0.626000	0.27120	0.998000	0.56505	0.980000	0.70556	-0.166000	0.09954	0.371000	0.24564	0.650000	0.86243	GCC	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.458	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	0	0	1		2	2	2	0	0	0	0	128	0	128	126	1	2.070000	-2.167190	0	0.390000	NM_206945		0	5	5	0	523	520	0	0	1			0	0	128	0	0	0.936874	0	0	0	0	0	0	5	523
KIF27	55582	broad.mit.edu	37	9	86504131	86504131	+	Missense_Mutation	SNP	A	A	C			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr9:86504131A>C	ENST00000297814.2	-	7	1990	c.1847T>G	c.(1846-1848)aTa>aGa	p.I616R	KIF27_ENST00000376347.1_Missense_Mutation_p.I7R|KIF27_ENST00000413982.1_Missense_Mutation_p.I616R|KIF27_ENST00000334204.2_Missense_Mutation_p.I616R	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	616					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TCCAGCAAATATTCGATCCAG	0.403																																						ENST00000297814.2	0.300000	1.400000e-01	0.260000	0.180000	0.210000	0.225328	0.210000	0.220000																										0				43						c.(1846-1848)aTa>aGa		kinesin family member 27							144.0	144.0	144.0					9																	86504131		2203	4300	6503	SO:0001583	missense	55582	0	0					g.chr9:86504131A>C	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.1847T>G	chr9.hg19:g.86504131A>C	ENSP00000297814:p.Ile616Arg	0					KIF27_ENST00000334204.2_Missense_Mutation_p.I616R|KIF27_ENST00000413982.1_Missense_Mutation_p.I616R|KIF27_ENST00000376347.1_Missense_Mutation_p.I7R	p.I616R	NM_017576.1	NP_060046.1	0	1	1	1.968358	Q86VH2	KIF27_HUMAN		7	1990	-			B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	1	1	hg19	c.1847T>G	CCDS6665.1	0	.	.	.	.	.	.	.	.	.	.	A	17.75	3.465512	0.63513	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	4.85	3.62	0.41486	4.85	3.62	0.41486	.	0.461427	0.16718	U	0.202373	T	0.30448	0.0765	N	0.08118	0	0.38420	D	0.946164	P;P;B	0.42993	0.467;0.797;0.337	B;P;B	0.44359	0.133;0.447;0.054	T	0.11446	-1.0587	10	0.29301	T	0.29	.	10.6689	0.45747	0.8568:0.0:0.0:0.1432	.	616;616;616	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	R	616;616;616;7	ENSP00000297814:I616R;ENSP00000401688:I616R;ENSP00000333928:I616R;ENSP00000365525:I7R	ENSP00000297814:I616R	I	-	2	0	0	KIF27	85693951	85693951	1.000000	0.71417	0.999000	0.59377	0.826000	0.46750	5.222000	0.65277	1.949000	0.56562	0.455000	0.32223	ATA	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.403	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	0	0	1		2	2	2	0	0	0	0	118	0	118	118	1	2.070000	-20.000000	1	0.390000	NM_017576		0	32	31	0	714	700	0	0	1	0		0	0	118	0	0	1.000000	0	0	0	0	1	0	32	714
KLF4	9314	broad.mit.edu	37	9	110249341	110249341	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chr9:110249341G>T	ENST00000374672.4	-	4	1705	c.1232C>A	c.(1231-1233)tCc>tAc	p.S411Y		NM_004235.4	NP_004226.3	O43474	KLF4_HUMAN	Kruppel-like factor 4 (gut)	445	Pro-rich.				cellular response to cycloheximide (GO:0071409)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|epidermal cell differentiation (GO:0009913)|epidermis morphogenesis (GO:0048730)|fat cell differentiation (GO:0045444)|mesodermal cell fate determination (GO:0007500)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of muscle hyperplasia (GO:0014740)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic camera-type eye development (GO:0031077)|post-embryonic hemopoiesis (GO:0035166)|regulation of cell differentiation (GO:0045595)|response to retinoic acid (GO:0032526)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001010)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(5)|large_intestine(1)|lung(3)|pancreas(1)|prostate(2)	16						CTTGAGATGGGAACTCTTTGT	0.592																																						ENST00000374672.4	0.950000	6.900000e-01	0.890000	0.750000	0.810000	0.827054	0.810000	0.820000																										0				16						c.(1231-1233)tCc>tAc		Kruppel-like factor 4 (gut)							301.0	267.0	279.0					9																	110249341		2203	4300	6503	SO:0001583	missense	9314	0	0					g.chr9:110249341G>T	AF022184	CCDS6770.2	9q31	2013-01-08			ENSG00000136826	ENSG00000136826		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6348	protein-coding gene	gene with protein product		602253				9422764, 16372018	Standard	NM_004235		Approved	EZF, GKLF	uc004bdg.3	O43474	OTTHUMG00000020449	ENST00000374672.4:c.1232C>A	chr9.hg19:g.110249341G>T	ENSP00000363804:p.Ser411Tyr	0						p.S411Y	NM_004235.4	NP_004226.3	0	1	1	1.968358	O43474	KLF4_HUMAN		4	1705	-			B2R8S4|B3KT79|L0R3I6|L0R4N5|P78338|Q5T3J8|Q5T3J9|Q8N717|Q9UNP3	Missense_Mutation	SNP	ENST00000374672.4	1	1	hg19	c.1232C>A	CCDS6770.2	0	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579183	0.86645	.	.	ENSG00000136826	ENST00000374672	T	0.35605	1.3	5.57	4.68	0.58851	5.57	4.68	0.58851	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.347798	0.21123	N	0.079795	T	0.66208	0.2766	M	0.89601	3.045	0.80722	D	1	D;D	0.76494	0.989;0.999	P;D	0.72625	0.641;0.978	T	0.74041	-0.3792	10	0.87932	D	0	.	14.0741	0.64880	0.0732:0.0:0.9268:0.0	.	445;411	O43474;O43474-1	KLF4_HUMAN;.	Y	411	ENSP00000363804:S411Y	ENSP00000363804:S411Y	S	-	2	0	0	KLF4	109289162	109289162	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.824000	0.99380	1.358000	0.45922	-0.136000	0.14681	TCC	0.388808		TCGA-US-A77E-01A-11D-A32N-08	0.592	KLF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053556.2	1	0	1		2	2	2	0	0	0	0	191	0	191	190	1	2.070000	-20.000000	1	0.390000	NM_004235		0	125	122	0	651	642	1	0	1	1		0	0	191	0	0	1.000000	1	0	63	0	70	0	125	651
KIF4A	24137	broad.mit.edu	37	X	69521814	69521814	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chrX:69521814G>A	ENST00000374403.3	+	6	663	c.581G>A	c.(580-582)gGc>gAc	p.G194D	KIF4A_ENST00000374388.3_Missense_Mutation_p.G194D	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	194	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TTGGAACAGGGCAACAACTCT	0.438																																						ENST00000374403.3	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.056321	0.040000	0.050000																										0				51						c.(580-582)gGc>gAc		kinesin family member 4A							130.0	109.0	116.0					X																	69521814		2203	4299	6502	SO:0001583	missense	24137	0	0					g.chrX:69521814G>A	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.581G>A	chrX.hg19:g.69521814G>A	ENSP00000363524:p.Gly194Asp						KIF4A_ENST00000374388.3_Missense_Mutation_p.G194D	p.G194D	NM_012310.4	NP_036442.3	0	1	1		O95239	KIF4A_HUMAN		6	663	+			B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	0	1	hg19	c.581G>A	CCDS14401.1	0	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645442	0.87859	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	D;D	0.83837	-1.77;-1.77	5.1	5.1	0.69264	5.1	5.1	0.69264	Kinesin, motor domain (4);	0.000000	0.53938	D	0.000051	D	0.95214	0.8448	H	0.99357	4.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	D	0.97585	1.0113	10	0.87932	D	0	.	16.5735	0.84631	0.0:0.0:1.0:0.0	.	194;194	O95239;O95239-2	KIF4A_HUMAN;.	D	194	ENSP00000363509:G194D;ENSP00000363524:G194D	ENSP00000363509:G194D	G	+	2	0	0	KIF4A	69438539	69438539	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.316000	0.96319	2.115000	0.64714	0.538000	0.68166	GGC	0.390000		TCGA-US-A77E-01A-11D-A32N-08	0.438	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	0	0	1		2	2	2	0	0	0	0	47	0	47	46	1	2.070000	-2.733447	1	0.390000	NM_012310		0	4	4	0	220	216	0	0	1	0		0	0	47	0	0	0.886880	1.718410e-03	0	0	0	3	0	4	220
ATP7A	538	broad.mit.edu	37	X	77244909	77244909	+	Missense_Mutation	SNP	A	A	T			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chrX:77244909A>T	ENST00000341514.6	+	4	946	c.791A>T	c.(790-792)gAa>gTa	p.E264V	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Missense_Mutation_p.E264V	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	264					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AAATCCTCAGAAGGGTCACAG	0.403																																						ENST00000341514.6	0.980000	7.300000e-01	0.930000	0.790000	0.860000	0.864439	0.860000	0.870000																										0				53						c.(790-792)gAa>gTa		ATPase, Cu++ transporting, alpha polypeptide	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)						162.0	143.0	149.0					X																	77244909		2203	4296	6499	SO:0001583	missense	538	0	0					g.chrX:77244909A>T	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.791A>T	chrX.hg19:g.77244909A>T	ENSP00000345728:p.Glu264Val						ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Missense_Mutation_p.E264V	p.E264V	NM_000052.5	NP_000043.4	0	1	1		Q04656	ATP7A_HUMAN		4	946	+			B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	1	1	hg19	c.791A>T	CCDS35339.1	1	.	.	.	.	.	.	.	.	.	.	A	3.798	-0.042338	0.07452	.	.	ENSG00000165240	ENST00000343533;ENST00000341514;ENST00000400860;ENST00000355691	D;D	0.96334	-3.98;-3.98	4.78	2.24	0.28232	4.78	2.24	0.28232	.	0.471910	0.20943	N	0.082889	D	0.95519	0.8544	M	0.88450	2.955	0.80722	D	1	B;B	0.28783	0.002;0.222	B;B	0.35688	0.007;0.208	D	0.91217	0.5003	10	0.30078	T	0.28	-11.1068	4.7038	0.12839	0.5353:0.2948:0.1699:0.0	.	264;274	Q04656;Q59HD1	ATP7A_HUMAN;.	V	264;264;264;274	ENSP00000343026:E264V;ENSP00000345728:E264V	ENSP00000345728:E264V	E	+	2	0	0	ATP7A	77131565	77131565	0.959000	0.32827	0.899000	0.35326	0.225000	0.24961	1.880000	0.39628	0.694000	0.31654	0.422000	0.28245	GAA	0.390000		TCGA-US-A77E-01A-11D-A32N-08	0.403	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	1	0	1		2	2	2	0	0	0	0	83	0	83	82	1	2.070000	-20.000000	1	0.390000	NM_000052		0	114	113	0	222	222	1	0	1	0		0	0	83	0	0	1.000000	2.691430e-01	0	1	0	2	0	114	222
DRP2	1821	broad.mit.edu	37	X	100500426	100500426	+	Missense_Mutation	SNP	T	T	A			TCGA-US-A77E-01A-11D-A32N-08	TCGA-US-A77E-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41e7b7ba-2ad3-461e-b034-9012b11b0ac6	d4212d5b-eb9c-4720-a339-23763029e0e2	g.chrX:100500426T>A	ENST00000395209.3	+	11	1692	c.1165T>A	c.(1165-1167)Tac>Aac	p.Y389N	DRP2_ENST00000402866.1_Missense_Mutation_p.Y389N|DRP2_ENST00000541709.1_Missense_Mutation_p.Y311N|DRP2_ENST00000538510.1_Missense_Mutation_p.Y389N	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	389					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GACAGAGTTATACCAAACCCT	0.468																																						ENST00000395209.3	0.400000	5.000000e-02	0.290000	0.100000	0.180000	0.202488	0.180000	0.160000																										0				31						c.(1165-1167)Tac>Aac		dystrophin related protein 2							132.0	100.0	111.0					X																	100500426		2203	4300	6503	SO:0001583	missense	1821	0	0					g.chrX:100500426T>A	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1165T>A	chrX.hg19:g.100500426T>A	ENSP00000378635:p.Tyr389Asn						DRP2_ENST00000541709.1_Missense_Mutation_p.Y311N|DRP2_ENST00000538510.1_Missense_Mutation_p.Y389N|DRP2_ENST00000402866.1_Missense_Mutation_p.Y389N	p.Y389N	NM_001939.2	NP_001930.2	0	1	1		Q13474	DRP2_HUMAN		11	1692	+			A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	0	1	hg19	c.1165T>A	CCDS14480.2	0	.	.	.	.	.	.	.	.	.	.	T	27.7	4.854763	0.91355	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.84	5.84	0.93424	5.84	5.84	0.93424	EF-hand domain, type 1 (1);	0.059046	0.64402	D	0.000001	T	0.77485	0.4137	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.63793	0.918	T	0.80616	-0.1303	10	0.87932	D	0	-13.6727	15.1354	0.72562	0.0:0.0:0.0:1.0	.	389	Q13474	DRP2_HUMAN	N	389;389;311;389	ENSP00000385038:Y389N;ENSP00000378635:Y389N;ENSP00000444752:Y311N;ENSP00000441051:Y389N	ENSP00000378635:Y389N	Y	+	1	0	0	DRP2	100387082	100387082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.957000	0.56846	0.486000	0.48141	TAC	0.390000		TCGA-US-A77E-01A-11D-A32N-08	0.468	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	0	0	0		2	2	2	0	0	0	0	8	0	8	8	1	2.070000	-7.624812	1	0.390000	NM_001939		0	3	2	0	44	44	0	0	1			0	0	8	0	0	0.805743	0	0	0	0	0	0	3	44
