#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SMAD4	4089	broad.mit.edu	37	18	48604742	48604743	+	Frame_Shift_Del	DEL	CC	CC	-	rs377767374		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			CC	-	CC	CC		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr18:48604742_48604743delCC	ENST00000342988.3	+	12	2102_2103	c.1564_1565delCC	c.(1564-1566)cctfs	p.P522fs	SMAD4_ENST00000398417.2_Frame_Shift_Del_p.P522fs|SMAD4_ENST00000588745.1_Frame_Shift_Del_p.P426fs|SMAD4_ENST00000586253.1_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	522	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CAAAGAAACACCTTGCTGGATT	0.48																																						ENST00000342988.3	0.830000	5.700000e-01	7.700000e-01	6.300000e-01	0.690000	0.703254	0.690000	0.700000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454	GRCh37	CD000943	SMAD4	D		c.(1564-1566)cctfs		SMAD family member 4																																				SO:0001589	frameshift_variant	4089	0	0					g.chr18:48604742_48604743delCC	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1564_1565delCC	chr18.hg19:g.48604742_48604743delCC	ENSP00000341551:p.Pro522fs	1					SMAD4_ENST00000588745.1_Frame_Shift_Del_p.P426fs|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.P522fs	p.P522fs	NM_005359.5	NP_005350.1	0	1	1	1.633574	Q13485	SMAD4_HUMAN		12	2102_2103	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Frame_Shift_Del	DEL	ENST00000342988.3	1	1	hg19	c.1564_1565delCC	CCDS11950.1	0																																																																																								0.265823		TCGA-US-A77G-01A-11D-A32N-08	0.480	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	2	0	0	0	0	88	0	88	87	1	1.870000	-2.964154	1	0.420000	NM_005359		0	90	93	0	392	390	0	0	1	1	1	0	0	88	539	0	1.000000	9.999994e-01	1	31	116	60	413	90	392
SPEF2	79925	broad.mit.edu	37	5	35691186	35691187	+	Frame_Shift_Ins	INS	-	-	CCACCCT	rs576319777		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:35691186_35691187insCCACCCT	ENST00000356031.3	+	11	1726_1727	c.1572_1573insCCACCCT	c.(1573-1575)ccafs	p.-527fs	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Frame_Shift_Ins_p.-527fs|SPEF2_ENST00000509059.1_Frame_Shift_Ins_p.-527fs	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2						axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTGACAATTTACCACCCTCCAA	0.396																																						ENST00000356031.3	0.410000	2.000000e-01	3.600000e-01	2.400000e-01	0.290000	0.306600	0.290000	0.300000																										0				37						c.(1573-1575)ccafs		sperm flagellar 2																																				SO:0001589	frameshift_variant	79925	0	0					g.chr5:35691186_35691187insCCACCCT	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1573_1579dupCCACCCT	chr5.hg19:g.35691187_35691193dupCCACCCT	ENSP00000348314:p.Ser527fs	0					SPEF2_ENST00000440995.2_Frame_Shift_Ins_p.-527fs|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Frame_Shift_Ins_p.-527fs	p.-527fs	NM_024867.3	NP_079143.3	0	0	0	2.055894	Q9C093	SPEF2_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)	11	1726_1727	+	all_lung(31;7.56e-05)		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Ins	INS	ENST00000356031.3	0	1	hg19	c.1572_1573insCCACCCT	CCDS43309.1	0																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.396	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	1	0	1		2			0	0	0	0	68	0	68	68	1	1.870000	-6.736745	1	0.420000	NM_144722		0	28	47	0	419	424	0	0	1			0	0	68	0	0	1.000000			0	0	0	0	28	419
SRPK3	26576	broad.mit.edu	37	X	153050878	153050892	+	In_Frame_Del	DEL	CACAGTTCAGCGCCT	CACAGTTCAGCGCCT	-	rs371187433|rs376315195		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chrX:153050878_153050892delCACAGTTCAGCGCCT	ENST00000370101.3	+	15	1653_1667	c.1607_1621delCACAGTTCAGCGCCT	c.(1606-1623)acacagttcagcgccttt>att	p.536_541TQFSAF>I	SRPK3_ENST00000393786.3_In_Frame_Del_p.502_507TQFSAF>I|SRPK3_ENST00000370100.1_In_Frame_Del_p.461_466TQFSAF>I|SRPK3_ENST00000489426.1_In_Frame_Del_p.603_608TQFSAF>I|SRPK3_ENST00000370104.1_In_Frame_Del_p.535_540TQFSAF>I|SRPK3_ENST00000370108.3_In_Frame_Del_p.503_508TQFSAF>I|IDH3G_ENST00000497043.1_5'Flank	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	Q9UPE1	SRPK3_HUMAN	SRSF protein kinase 3	536	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|muscle tissue development (GO:0060537)|skeletal muscle tissue development (GO:0007519)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(2)|pancreas(2)|urinary_tract(1)	13	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GAGCAGGCCACACAGTTCAGCGCCTTTCTGCTGCC	0.628																																					Esophageal Squamous(167;766 3400 32156)	ENST00000370101.3	0.550000	3.700000e-01	5.100000e-01	4.100000e-01	0.450000	0.463432	0.450000	0.460000																										0				13						c.(1606-1623)acacagttcagcgccttt>att		SRSF protein kinase 3																																				SO:0001651	inframe_deletion	26576	0	0					g.chrX:153050878_153050892delCACAGTTCAGCGCCT	AF027406	CCDS35441.1, CCDS55537.1, CCDS55538.1	Xq28	2010-06-23	2010-06-23	2006-08-17	ENSG00000184343	ENSG00000184343			11402	protein-coding gene	gene with protein product			"""serine/threonine kinase 23"", ""SFRS protein kinase 3"""	STK23		16140986	Standard	NM_014370		Approved	MSSK1	uc004fil.3	Q9UPE1	OTTHUMG00000024207	ENST00000370101.3:c.1607_1621delCACAGTTCAGCGCCT	chrX.hg19:g.153050878_153050892delCACAGTTCAGCGCCT	ENSP00000359119:p.Thr536_Phe541delinsIle						SRPK3_ENST00000370104.1_In_Frame_Del_p.535_540TQFSAF>I|SRPK3_ENST00000370108.3_In_Frame_Del_p.503_508TQFSAF>I|IDH3G_ENST00000497043.1_5'Flank|SRPK3_ENST00000393786.3_In_Frame_Del_p.502_507TQFSAF>I|SRPK3_ENST00000489426.1_In_Frame_Del_p.603_608TQFSAF>I|SRPK3_ENST00000370100.1_In_Frame_Del_p.461_466TQFSAF>I	p.536_541TQFSAF>I	NM_001170760.1|NM_014370.3	NP_001164231.1|NP_055185.2	0	1	1		Q9UPE1	SRPK3_HUMAN		15	1653_1667	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		Q13583|Q4F970|Q562F5|Q9UM62	In_Frame_Del	DEL	ENST00000370101.3	1	1	hg19	c.1607_1621delCACAGTTCAGCGCCT	CCDS35441.1	0																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.628	SRPK3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354501.1	0	0	1		2			0	0	0	0	91	0	91	92	1	1.870000	-20.000000	1	0.420000	NM_014370		0	89	113	0	370	382	0	0	1			0	0	91	0	0	1.000000			0	0	0	0	89	370
PKD2L1	9033	broad.mit.edu	37	10	102056026	102056026	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr10:102056026G>A	ENST00000318222.3	-	7	1591	c.1209C>T	c.(1207-1209)ttC>ttT	p.F403F	PKD2L1_ENST00000338519.3_Silent_p.F328F|PKD2L1_ENST00000353274.3_Silent_p.F403F	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	403					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		GGAATATGTGGAAGCCCACAG	0.567																																						ENST00000318222.3	1.000000	7.700000e-01	1	8.800000e-01	0.990000	0.955954	0.990000	1.000000																										0				43						c.(1207-1209)ttC>ttT		polycystic kidney disease 2-like 1							51.0	49.0	50.0					10																	102056026		2203	4300	6503	SO:0001819	synonymous_variant	9033	2	121412	22				g.chr10:102056026G>A	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.1209C>T	chr10.hg19:g.102056026G>A		0					PKD2L1_ENST00000353274.3_Silent_p.F403F|PKD2L1_ENST00000338519.3_Silent_p.F328F	p.F403F	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	1	2	3	2.059775	Q9P0L9	PK2L1_HUMAN		7	1591	-		Colorectal(252;0.117)	O75972|Q5W039|Q9UP35|Q9UPA2	Silent	SNP	ENST00000318222.3	1	1	hg19	c.1209C>T	CCDS7492.1	1																																																																																								0.421215		TCGA-US-A77G-01A-11D-A32N-08	0.567	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	1.870000	-20.000000	1	0.420000	NM_016112		0	51	51	0	191	187	1		1			0	0	55	0	0	1.000000	0	0	0	0	0	0	51	191
TRPC6	7225	broad.mit.edu	37	11	101375398	101375398	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr11:101375398C>T	ENST00000344327.3	-	2	726	c.302G>A	c.(301-303)cGc>cAc	p.R101H	TRPC6_ENST00000532133.1_Missense_Mutation_p.R101H|TRPC6_ENST00000360497.4_Missense_Mutation_p.R101H|TRPC6_ENST00000348423.4_Missense_Mutation_p.R101H|TRPC6_ENST00000526713.1_5'Flank	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	101					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		ATCCAAAAAGCGTTCCTCCTC	0.483																																					Colon(166;1315 1927 11094 12848 34731)	ENST00000344327.3	1.000000	7.700000e-01	9.900000e-01	8.400000e-01	0.910000	0.915160	0.910000	1.000000																										0				55						c.(301-303)cGc>cAc		transient receptor potential cation channel, subfamily C, member 6							152.0	148.0	149.0					11																	101375398		2203	4299	6502	SO:0001583	missense	7225	3	121402	37				g.chr11:101375398C>T	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.302G>A	chr11.hg19:g.101375398C>T	ENSP00000340913:p.Arg101His	0					TRPC6_ENST00000348423.4_Missense_Mutation_p.R101H|TRPC6_ENST00000360497.4_Missense_Mutation_p.R101H|TRPC6_ENST00000526713.1_5'Flank|TRPC6_ENST00000532133.1_Missense_Mutation_p.R101H	p.R101H	NM_004621.5	NP_004612.2	1	2	3	2.058032	Q9Y210	TRPC6_HUMAN		2	726	-		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	1	1	hg19	c.302G>A	CCDS8311.1	1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839593	0.51057	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.80393	-1.17;-1.26;-1.09;-1.37	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.096864	0.64402	D	0.000001	D	0.87577	0.6212	L	0.47190	1.495	0.54753	D	0.999989	B;D;B	0.89917	0.37;1.0;0.128	B;D;B	0.91635	0.087;0.999;0.018	D	0.86300	0.1679	10	0.48119	T	0.1	-6.1692	20.206	0.98277	0.0:1.0:0.0:0.0	.	101;101;101	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	H	101	ENSP00000340913:R101H;ENSP00000435574:R101H;ENSP00000343672:R101H;ENSP00000353687:R101H	ENSP00000340913:R101H	R	-	2	0	0	TRPC6	100880608	100880608	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	3.915000	0.56409	2.785000	0.95823	0.655000	0.94253	CGC	0.421215		TCGA-US-A77G-01A-11D-A32N-08	0.483	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	1	0	1	2	2	2	2	0	0	0	0	141	141	141	139	1	1.870000	-20.000000	1	0.420000	NM_004621		0	127	125	0	533	527	1		1	0		0	0	141	0	0	1.000000	0	0	0	0	1	0	127	533
OR51A7	119687	broad.mit.edu	37	11	4929119	4929119	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr11:4929119C>T	ENST00000359350.4	+	1	520	c.520C>T	c.(520-522)Ctt>Ttt	p.L174F	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAAGAATCTTCTTTCTCACTC	0.388																																						ENST00000359350.4	0.150000	1.000000e-02	1.000000e-01	3.000000e-02	0.060000	0.081463	0.060000	0.060000																										0				33						c.(520-522)Ctt>Ttt		olfactory receptor, family 51, subfamily A, member 7							137.0	124.0	128.0					11																	4929119		2201	4298	6499	SO:0001583	missense	119687	0	0					g.chr11:4929119C>T	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.520C>T	chr11.hg19:g.4929119C>T	ENSP00000352305:p.Leu174Phe	0					MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	p.L174F	NM_001004749.1	NP_001004749.1	1	2	3	2.069199	Q8NH64	O51A7_HUMAN		1	520	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	0	1	hg19	c.520C>T	CCDS31364.1	0	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234429	0.58886	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.38240	1.15	5.02	4.08	0.47627	5.02	4.08	0.47627	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42172	D	0.000741	T	0.63010	0.2475	M	0.90922	3.16	0.21604	N	0.999623	D	0.89917	1.0	D	0.97110	1.0	T	0.57900	-0.7731	10	0.87932	D	0	.	7.8969	0.29712	0.1585:0.757:0.0:0.0845	.	174	Q8NH64	O51A7_HUMAN	F	174;174;163	ENSP00000352305:L174F	ENSP00000352305:L174F	L	+	1	0	0	OR51A7	4885695	4885695	0.004000	0.15560	0.995000	0.50966	0.955000	0.61496	0.280000	0.18790	2.596000	0.87737	0.655000	0.94253	CTT	0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.388	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	1.870000	-3.227376	1	0.420000	NM_001004749		0	5	5	0	388	383	0		1			0	0	88	0	0	0.935804	0	0	0	0	0	0	5	388
MMP26	56547	broad.mit.edu	37	11	5009493	5009493	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr11:5009493G>A	ENST00000380390.1	+	2	268	c.52G>A	c.(52-54)Gtt>Att	p.V18I	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000300762.1_Missense_Mutation_p.V18I			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26	18					collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	GTGTTTCGCCGTTCCAGTGCC	0.493																																						ENST00000380390.1	0.110000	1.000000e-02	8.000000e-02	3.000000e-02	0.040000	0.064504	0.040000	0.050000																										0				22						c.(52-54)Gtt>Att		matrix metallopeptidase 26	Marimastat(DB00786)						271.0	216.0	235.0					11																	5009493		2201	4298	6499	SO:0001583	missense	56547	5	121412	40				g.chr11:5009493G>A	AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.52G>A	chr11.hg19:g.5009493G>A	ENSP00000369753:p.Val18Ile	0					MMP26_ENST00000300762.1_Missense_Mutation_p.V18I|MMP26_ENST00000477339.1_Intron	p.V18I			1	2	3	2.069199	Q9NRE1	MMP26_HUMAN		2	268	+		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)	Q3MJ78|Q9GZS2|Q9NR87	Missense_Mutation	SNP	ENST00000380390.1	0	1	hg19	c.52G>A	CCDS7752.1	0	.	.	.	.	.	.	.	.	.	.	g	3.577	-0.086437	0.07097	.	.	ENSG00000167346	ENST00000380390;ENST00000300762	T;T	0.26067	1.76;1.76	3.3	-6.6	0.01824	3.3	-6.6	0.01824	.	0.975329	0.08322	N	0.963623	T	0.06872	0.0175	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26710	-1.0095	10	0.35671	T	0.21	0.1393	2.2024	0.03927	0.2392:0.4375:0.1215:0.2018	.	18	Q9NRE1	MMP26_HUMAN	I	18	ENSP00000369753:V18I;ENSP00000300762:V18I	ENSP00000300762:V18I	V	+	1	0	0	MMP26	4966069	4966069	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.164000	0.01275	-2.497000	0.00513	-4.594000	0.00004	GTT	0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.493	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142058.3	0	0	1	2	2	2	2	0	0	0	0	123	123	123	121	1	1.870000	-2.351227	0	0.420000	NM_021801		0	7	8	0	683	674	0		1			0	0	123	0	0	0.979845	0	0	0	0	0	0	7	683
HPX	3263	broad.mit.edu	37	11	6452915	6452915	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr11:6452915G>A	ENST00000265983.3	-	9	1185	c.1085C>T	c.(1084-1086)gCg>gTg	p.A362V		NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	362					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		GATAAAGGCCGCATCCACAGA	0.557																																						ENST00000265983.3	0.110000	0	8.000000e-02	2.000000e-02	0.040000	0.053477	0.040000	0.040000																										0				15						c.(1084-1086)gCg>gTg		hemopexin							76.0	78.0	78.0					11																	6452915		2201	4296	6497	SO:0001583	missense	3263	1	121412	31				g.chr11:6452915G>A	J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.1085C>T	chr11.hg19:g.6452915G>A	ENSP00000265983:p.Ala362Val	0						p.A362V	NM_000613.2	NP_000604.1	1	2	3	2.058032	P02790	HEMO_HUMAN		9	1185	-		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	B2R957	Missense_Mutation	SNP	ENST00000265983.3	0	1	hg19	c.1085C>T	CCDS7763.1	0	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336128	0.81801	.	.	ENSG00000110169	ENST00000265983	T	0.20200	2.09	5.62	5.62	0.85841	5.62	5.62	0.85841	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	P	0.59221	0.854	T	0.54463	-0.8290	10	0.87932	D	0	-12.4094	17.1339	0.86734	0.0:0.0:1.0:0.0	.	362	P02790	HEMO_HUMAN	V	362	ENSP00000265983:A362V	ENSP00000265983:A362V	A	-	2	0	0	HPX	6409491	6409491	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	6.271000	0.72569	2.656000	0.90262	0.561000	0.74099	GCG	0.421215		TCGA-US-A77G-01A-11D-A32N-08	0.557	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257256.1	0	0	1	2	2	2	2	0	0	0	0	89	89	89	87	1	1.870000	-2.276699	0	0.420000	NM_000613		0	5	5	0	526	520	0		1			0	0	89	0	0	0.935930	0	0	0	0	0	0	5	526
CHST1	8534	broad.mit.edu	37	11	45671609	45671609	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr11:45671609G>A	ENST00000308064.2	-	4	1535	c.865C>T	c.(865-867)Cgg>Tgg	p.R289W	CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	289					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CACGGGGGCCGCATGAGGCCG	0.617																																						ENST00000308064.2	0.100000	0	7.000000e-02	2.000000e-02	0.040000	0.050588	0.040000	0.040000																										0				42						c.(865-867)Cgg>Tgg		carbohydrate (keratan sulfate Gal-6) sulfotransferase 1							87.0	77.0	80.0					11																	45671609		2203	4299	6502	SO:0001583	missense	8534	0	0					g.chr11:45671609G>A	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.865C>T	chr11.hg19:g.45671609G>A	ENSP00000309270:p.Arg289Trp	0					CHST1_ENST00000533673.1_5'Flank|RP11-495O11.1_ENST00000525563.1_RNA	p.R289W	NM_003654.5	NP_003645.1	1	2	3	2.058032	O43916	CHST1_HUMAN		4	1535	-			D3DQP2	Missense_Mutation	SNP	ENST00000308064.2	0	1	hg19	c.865C>T	CCDS7913.1	0	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821565	0.71028	.	.	ENSG00000175264	ENST00000308064	T	0.76316	-1.01	4.89	4.89	0.63831	4.89	4.89	0.63831	Sulfotransferase domain (1);	0.062547	0.64402	D	0.000005	D	0.86422	0.5929	M	0.67953	2.075	0.58432	D	0.999998	D	0.89917	1.0	D	0.70935	0.971	D	0.85721	0.1325	10	0.37606	T	0.19	-19.3412	18.0436	0.89326	0.0:0.0:1.0:0.0	.	289	O43916	CHST1_HUMAN	W	289	ENSP00000309270:R289W	ENSP00000309270:R289W	R	-	1	2	2	CHST1	45628185	45628185	1.000000	0.71417	0.850000	0.33497	0.988000	0.76386	5.503000	0.66962	2.252000	0.74401	0.462000	0.41574	CGG	0.421215		TCGA-US-A77G-01A-11D-A32N-08	0.617	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	0	0	1	2	2	2	2	0	0	0	0	127	127	127	120	1	1.870000	-1.780105	0	0.420000	NM_003654		0	5	5	0	556	551	0		1	0		0	0	127	0	0	0.936315	1.743712e-02	0	0	0	18	0	5	556
DSCAML1	57453	broad.mit.edu	37	11	117651507	117651507	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr11:117651507C>T	ENST00000321322.6	-	2	246	c.245G>A	c.(244-246)gGc>gAc	p.G82D	DSCAML1_ENST00000527706.1_Missense_Mutation_p.G22D	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	22	Ig-like C2-type 1.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GAGGCTGGTGCCAACATCTTC	0.612																																						ENST00000321322.6	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999443	0.990000	1.000000																										0				110						c.(244-246)gGc>gAc		Down syndrome cell adhesion molecule like 1							10.0	9.0	10.0					11																	117651507		2161	4209	6370	SO:0001583	missense	57453	0	0					g.chr11:117651507C>T		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.245G>A	chr11.hg19:g.117651507C>T	ENSP00000315465:p.Gly82Asp	0					DSCAML1_ENST00000527706.1_Missense_Mutation_p.G22D	p.G82D	NM_020693.2	NP_065744.2	1	2	3	2.058032	Q8TD84	DSCL1_HUMAN		2	246	-	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	1	1	hg19	c.245G>A	CCDS8384.1	1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374942	0.42105	.	.	ENSG00000177103	ENST00000527706;ENST00000321322	T;T	0.61158	0.13;0.24	5.1	5.1	0.69264	5.1	5.1	0.69264	Immunoglobulin-like (1);	.	.	.	.	T	0.38241	0.1033	N	0.08118	0	0.51482	D	0.99992	B	0.26002	0.139	B	0.24701	0.055	T	0.26849	-1.0091	9	0.11182	T	0.66	.	18.9124	0.92491	0.0:1.0:0.0:0.0	.	22	Q8TD84	DSCL1_HUMAN	D	22;82	ENSP00000434335:G22D;ENSP00000315465:G82D	ENSP00000315465:G82D	G	-	2	0	0	DSCAML1	117156717	117156717	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.439000	0.44846	2.536000	0.85505	0.563000	0.77884	GGC	0.421215		TCGA-US-A77G-01A-11D-A32N-08	0.612	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	1	0	1	2	2	2	2	0	0	0	0	20	20	20	19	1	1.870000	-20.000000	1	0.420000	NM_020693		0	19	19	0	34	34	0		1			0	0	20	0	0	0.999998	0	0	0	0	0	0	19	34
UTP20	27340	broad.mit.edu	37	12	101760468	101760468	+	Silent	SNP	C	C	T	rs112368779		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr12:101760468C>T	ENST00000261637.4	+	47	6432	c.6258C>T	c.(6256-6258)tcC>tcT	p.S2086S		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2086					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TTATTGAGTCCGGGCTTCGGG	0.458																																						ENST00000261637.4	0.160000	5.000000e-02	1.300000e-01	7.000000e-02	0.090000	0.106196	0.090000	0.100000																										0				88						c.(6256-6258)tcC>tcT		UTP20, small subunit (SSU) processome component, homolog (yeast)							124.0	123.0	123.0					12																	101760468		2203	4300	6503	SO:0001819	synonymous_variant	27340	1	121412	35				g.chr12:101760468C>T	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6258C>T	chr12.hg19:g.101760468C>T		1						p.S2086S	NM_014503.2	NP_055318.2	0	1	1	1.616471	O75691	UTP20_HUMAN		47	6432	+			Q9H3H4	Silent	SNP	ENST00000261637.4	1	1	hg19	c.6258C>T	CCDS9081.1	0																																																																																								0.267769		TCGA-US-A77G-01A-11D-A32N-08	0.458	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	0	0	1	2	2	2	2	0	0	0	0	105	105	105	103	1	1.870000	-2.416580	0	0.420000	NM_014503		0	14	14	0	514	507	0		1	0		0	0	105	0	0	0.999732	3.863188e-02	0	0	0	11	0	14	514
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	5.100000e-01	9.800000e-01	6.500000e-01	0.800000	0.810550	0.800000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	0	0	0	2.056247	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	1.870000	-12.947140	1	0.420000	NM_033360		1940	19	19	6087	93	93	1	1	1	1	1	0	0	17	340	1	0.999995	9.685956e-01	1	14	56	17	255	19	93
SPRYD3	84926	broad.mit.edu	37	12	53462066	53462066	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr12:53462066C>T	ENST00000301463.4	-	7	802	c.716G>A	c.(715-717)gGc>gAc	p.G239D	SPRYD3_ENST00000547837.1_Missense_Mutation_p.G276D	NM_032840.2	NP_116229.1	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	239										central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						GATGCTTTTGCCCTTCCCTAA	0.637																																						ENST00000301463.4	0.070000	0	5.000000e-02	1.000000e-02	0.030000	0.037918	0.030000	0.040000																										0				17						c.(715-717)gGc>gAc		SPRY domain containing 3							101.0	101.0	101.0					12																	53462066		2203	4300	6503	SO:0001583	missense	84926	0	0					g.chr12:53462066C>T	AK074694	CCDS8845.1	12q13.13	2006-11-29		2006-02-02		ENSG00000167778			25920	protein-coding gene	gene with protein product						14702039	Standard	NM_032840		Approved	FLJ14800	uc001sbt.2	Q8NCJ5	OTTHUMG00000170101	ENST00000301463.4:c.716G>A	chr12.hg19:g.53462066C>T	ENSP00000301463:p.Gly239Asp	0					SPRYD3_ENST00000547837.1_Missense_Mutation_p.G276D	p.G239D	NM_032840.2	NP_116229.1	0	1	1	2.052164	Q8NCJ5	SPRY3_HUMAN		7	802	-			B9EG99|Q96SK5	Missense_Mutation	SNP	ENST00000301463.4	0	1	hg19	c.716G>A	CCDS8845.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.152619	0.94645	.	.	ENSG00000167778	ENST00000301463;ENST00000547837	.	.	.	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.67363	0.2885	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.67345	-0.5694	9	0.48119	T	0.1	.	16.5377	0.84377	0.0:1.0:0.0:0.0	.	239	Q8NCJ5	SPRY3_HUMAN	D	239;276	.	ENSP00000301463:G239D	G	-	2	0	0	SPRYD3	51748333	51748333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.218000	0.77991	2.575000	0.86900	0.561000	0.74099	GGC	0.418779		TCGA-US-A77G-01A-11D-A32N-08	0.637	SPRYD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407264.1	0	0	1	2	2	2	2	0	0	0	0	176	176	176	175	1	1.870000	-1.980946	0	0.420000	NM_032840		0	6	6	0	858	846	0		1	0		0	0	176	0	0	0.963354	2.611069e-01	0	1	0	122	0	6	858
NCKAP1L	3071	broad.mit.edu	37	12	54917197	54917197	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr12:54917197C>T	ENST00000293373.6	+	19	1977	c.1898C>T	c.(1897-1899)gCc>gTc	p.A633V	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.A583V	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	633					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						AAGCACTGTGCCACTACAATC	0.473																																						ENST00000293373.6	0.070000	0	5.000000e-02	1.000000e-02	0.030000	0.037083	0.030000	0.040000																										0				80						c.(1897-1899)gCc>gTc		NCK-associated protein 1-like							164.0	173.0	170.0					12																	54917197		2203	4300	6503	SO:0001583	missense	3071	0	0					g.chr12:54917197C>T	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1898C>T	chr12.hg19:g.54917197C>T	ENSP00000293373:p.Ala633Val	0					NCKAP1L_ENST00000545638.2_Missense_Mutation_p.A583V	p.A633V	NM_005337.4	NP_005328.2	0	1	1	2.052164	P55160	NCKPL_HUMAN		19	1977	+			B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	0	1	hg19	c.1898C>T	CCDS31813.1	0	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701576	0.88924	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.39787	1.06;1.06	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.57814	-0.7746	10	0.36615	T	0.2	-15.2108	16.9443	0.86226	0.0:1.0:0.0:0.0	.	633	P55160	NCKPL_HUMAN	V	633;583	ENSP00000293373:A633V;ENSP00000445596:A583V	ENSP00000293373:A633V	A	+	2	0	0	NCKAP1L	53203464	53203464	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.491000	0.81471	2.673000	0.90976	0.655000	0.94253	GCC	0.418779		TCGA-US-A77G-01A-11D-A32N-08	0.473	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	0	0	1	2	2	2	2	0	0	0	0	147	147	147	146	1	1.870000	-2.087043	0	0.420000	NM_005337		0	6	6	0	876	870	0		1	0		0	0	147	0	0	0.964280	1.042657e-03	0	0	0	6	0	6	876
ARHGAP9	64333	broad.mit.edu	37	12	57868253	57868253	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr12:57868253G>A	ENST00000356411.2	-	15	1931	c.1793C>T	c.(1792-1794)gCg>gTg	p.A598V	ARHGAP9_ENST00000430041.2_Missense_Mutation_p.A395V|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.A669V|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.A579V|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.A579V|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.A658V			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	598	Lipid binding.|Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			GGAGGTGACCGCACGCTCTGC	0.517																																						ENST00000356411.2	0.200000	2.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.103111	0.090000	0.080000																										0				30						c.(1792-1794)gCg>gTg		Rho GTPase activating protein 9							87.0	73.0	78.0					12																	57868253		2203	4300	6503	SO:0001583	missense	64333	0	0					g.chr12:57868253G>A	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.1793C>T	chr12.hg19:g.57868253G>A	ENSP00000348782:p.Ala598Val	0					ARHGAP9_ENST00000550288.1_Missense_Mutation_p.A658V|ARHGAP9_ENST00000430041.2_Missense_Mutation_p.A395V|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.A579V|ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.A669V|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.A579V	p.A598V			0	1	1	2.052164	Q9BRR9	RHG09_HUMAN	GBM - Glioblastoma multiforme(3;3.37e-34)	15	1931	-			B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	0	1	hg19	c.1793C>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.68|19.68	3.873016|3.873016	0.72180|0.72180	.|.	.|.	ENSG00000123329|ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000423291;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000430041|ENST00000550399	T;T;T;T;T|.	0.19669|.	2.13;2.13;2.13;2.13;2.13|.	5.08|5.08	5.08|5.08	0.68730|0.68730	5.08|5.08	5.08|5.08	0.68730|0.68730	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);|.	0.075671|.	0.48286|.	D|.	0.000194|.	T|T	0.61565|0.61565	0.2357|0.2357	L|L	0.43152|0.43152	1.355|1.355	0.58432|0.58432	D|D	0.999992|0.999992	P;P;P;P;D|.	0.59767|.	0.934;0.837;0.758;0.934;0.986|.	P;B;B;P;P|.	0.54965|.	0.457;0.272;0.328;0.535;0.765|.	T|T	0.55854|0.55854	-0.8075|-0.8075	10|5	0.59425|.	D|.	0.04|.	.|.	15.8782|15.8782	0.79182|0.79182	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	658;598;579;579;395|.	Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9;B4DVI3|.	.;RHG09_HUMAN;.;.;.|.	V|W	579;598;249;579;669;628;395|49	ENSP00000377380:A579V;ENSP00000348782:A598V;ENSP00000394307:A579V;ENSP00000377386:A669V;ENSP00000397950:A395V|.	ENSP00000344852:A628V|.	A|R	-|-	2|1	0|2	0|2	ARHGAP9|ARHGAP9	56154520|56154520	56154520|56154520	1.000000|1.000000	0.71417|0.71417	0.954000|0.954000	0.39281|0.39281	0.245000|0.245000	0.25701|0.25701	5.408000|5.408000	0.66368|0.66368	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GCG|CGG	0.418779		TCGA-US-A77G-01A-11D-A32N-08	0.517	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	54	54	54	53	1	1.870000	-3.171083	1	0.420000	NM_032496		0	4	4	0	223	223	0		1	0		0	0	54	0	0	0.891148	3.081344e-02	0	0	0	12	0	4	223
GNS	2799	broad.mit.edu	37	12	65113959	65113959	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr12:65113959A>G	ENST00000258145.3	-	13	1593	c.1423T>C	c.(1423-1425)Ttt>Ctt	p.F475L	GNS_ENST00000542058.1_Missense_Mutation_p.F455L|GNS_ENST00000418919.2_Missense_Mutation_p.F419L|GNS_ENST00000543646.1_Missense_Mutation_p.F507L	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	475					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		ACTTCTACAAACACCTAGAGG	0.408																																						ENST00000258145.3	1.000000	9.100000e-01	1	9.800000e-01	0.990000	0.992277	0.990000	1.000000																										0				15						c.(1423-1425)Ttt>Ctt		glucosamine (N-acetyl)-6-sulfatase							169.0	173.0	172.0					12																	65113959		2203	4300	6503	SO:0001583	missense	2799	0	0					g.chr12:65113959A>G		CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.1423T>C	chr12.hg19:g.65113959A>G	ENSP00000258145:p.Phe475Leu	0					GNS_ENST00000543646.1_Missense_Mutation_p.F507L|GNS_ENST00000418919.2_Missense_Mutation_p.F419L|GNS_ENST00000542058.1_Missense_Mutation_p.F455L	p.F475L	NM_002076.3	NP_002067.1	0	1	1	2.052164	P15586	GNS_HUMAN	LUAD - Lung adenocarcinoma(6;0.115)	13	1593	-	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		B4DYH8|Q53F05	Missense_Mutation	SNP	ENST00000258145.3	1	1	hg19	c.1423T>C	CCDS8970.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	33|33	5.208974|5.208974	0.95069|0.95069	.|.	.|.	ENSG00000135677|ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825|ENST00000540196	T;T;T;T|T	0.64991|0.19105	1.84;-0.13;-0.13;-0.13|2.17	5.39|5.39	5.39|5.39	0.77823|0.77823	5.39|5.39	5.39|5.39	0.77823|0.77823	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.48059|0.48059	0.1479|0.1479	M|M	0.85777|0.85777	2.775|2.775	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.995;1.0;0.974;1.0|.	D;D;D;D|.	0.91635|.	0.969;0.999;0.949;0.998|.	T|T	0.53344|0.53344	-0.8452|-0.8452	9|6	.|.	.|.	.|.	-20.6884|-20.6884	15.7218|15.7218	0.77718|0.77718	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	455;507;475;419|.	B4DYH8;F6S8M0;P15586;Q7Z3X3|.	.;.;GNS_HUMAN;.|.	L|A	419;475;507;455;392|260	ENSP00000413130:F419L;ENSP00000258145:F475L;ENSP00000438497:F507L;ENSP00000444819:F455L|ENSP00000437782:V260A	.|.	F|V	-|-	1|2	0|0	0|0	GNS|GNS	63400226|63400226	63400226|63400226	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.904000|0.904000	0.53231|0.53231	9.204000|9.204000	0.95041|0.95041	2.180000|2.180000	0.69256|0.69256	0.459000|0.459000	0.35465|0.35465	TTT|GTT	0.418779		TCGA-US-A77G-01A-11D-A32N-08	0.408	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401195.2	1	0	1	2	2	2	2	0	0	0	0	127	127	127	125	1	1.870000	-20.000000	1	0.420000			0	166	163	0	578	573	1		1	1		0	0	127	0	0	1.000000	1	0	44	0	56	0	166	578
GOLGA3	2802	broad.mit.edu	37	12	133381515	133381515	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr12:133381515G>A	ENST00000450791.2	-	6	1567	c.1384C>T	c.(1384-1386)Cgg>Tgg	p.R462W	GOLGA3_ENST00000456883.2_Missense_Mutation_p.R462W|GOLGA3_ENST00000537452.1_Missense_Mutation_p.R462W|GOLGA3_ENST00000545875.1_Missense_Mutation_p.R462W|GOLGA3_ENST00000204726.3_Missense_Mutation_p.R462W			Q08378	GOGA3_HUMAN	golgin A3	462					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GAATCCTGCCGCTGCTGGCTG	0.612																																						ENST00000450791.2	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.080478	0.070000	0.070000																										0				64						c.(1384-1386)Cgg>Tgg		golgin A3							45.0	44.0	44.0					12																	133381515		2203	4291	6494	SO:0001583	missense	2802	1	121380	28				g.chr12:133381515G>A	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.1384C>T	chr12.hg19:g.133381515G>A	ENSP00000410378:p.Arg462Trp	0					GOLGA3_ENST00000545875.1_Missense_Mutation_p.R462W|GOLGA3_ENST00000204726.3_Missense_Mutation_p.R462W|GOLGA3_ENST00000456883.2_Missense_Mutation_p.R462W|GOLGA3_ENST00000537452.1_Missense_Mutation_p.R462W	p.R462W			0	1	1	2.050329	Q08378	GOGA3_HUMAN		6	1567	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	0	1	hg19	c.1384C>T	CCDS9281.1	0	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240122	0.79912	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.45	3.12	0.35913	5.45	3.12	0.35913	.	0.357463	0.36167	N	0.002757	T	0.74099	0.3672	N	0.14661	0.345	0.80722	D	1	D;D;D	0.71674	0.995;0.995;0.998	P;B;P	0.50708	0.648;0.431;0.62	T	0.73503	-0.3962	10	0.87932	D	0	.	7.5344	0.27702	0.0:0.0804:0.1589:0.7607	.	462;462;462	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	W	462	ENSP00000204726:R462W;ENSP00000410378:R462W;ENSP00000409303:R462W;ENSP00000442143:R462W;ENSP00000442603:R462W	ENSP00000204726:R462W	R	-	1	2	2	GOLGA3	131891588	131891588	1.000000	0.71417	0.973000	0.42090	0.927000	0.56198	2.687000	0.46976	0.376000	0.24707	0.561000	0.74099	CGG	0.418779		TCGA-US-A77G-01A-11D-A32N-08	0.612	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	0	0	1	2	2	2	2	0	0	0	0	91	91	91	90	1	1.870000	-2.925938	1	0.420000	NM_005895		0	6	6	0	404	398	0		1	0		0	0	91	0	0	0.963616	1.702012e-01	0	0	0	43	0	6	404
SLC46A3	283537	broad.mit.edu	37	13	29284936	29284936	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr13:29284936G>A	ENST00000266943.6	-	4	1474	c.1105C>T	c.(1105-1107)Cgg>Tgg	p.R369W	SLC46A3_ENST00000380814.4_Missense_Mutation_p.R369W	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3	369					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		AACATGGACCGTAGAACAGAG	0.398																																						ENST00000266943.6	1.000000	1.000000e-02	1.100000e-01	3.000000e-02	0.060000	0.151171	0.060000	0.060000																										0				15						c.(1105-1107)Cgg>Tgg		solute carrier family 46, member 3							145.0	137.0	140.0					13																	29284936		2203	4300	6503	SO:0001583	missense	283537	0	0					g.chr13:29284936G>A		CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.1105C>T	chr13.hg19:g.29284936G>A	ENSP00000266943:p.Arg369Trp	0					SLC46A3_ENST00000380814.4_Missense_Mutation_p.R369W	p.R369W	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	1	2	3	2.146113	Q7Z3Q1	S46A3_HUMAN		4	1474	-		Lung SC(185;0.0367)	Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Missense_Mutation	SNP	ENST00000266943.6	0	1	hg19	c.1105C>T	CCDS9332.1	0	.	.	.	.	.	.	.	.	.	.	G	17.35	3.367312	0.61513	.	.	ENSG00000139508	ENST00000266943;ENST00000380814	T;T	0.80304	-1.36;-1.36	5.87	4.05	0.47172	5.87	4.05	0.47172	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.89914	0.6853	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91020	0.4856	10	0.87932	D	0	-25.3129	15.0378	0.71764	0.0:0.0:0.7331:0.2669	.	369;369	Q7Z3Q1-2;Q7Z3Q1	.;S46A3_HUMAN	W	369	ENSP00000266943:R369W;ENSP00000370192:R369W	ENSP00000266943:R369W	R	-	1	2	2	SLC46A3	28182936	28182936	1.000000	0.71417	0.662000	0.29724	0.241000	0.25554	3.111000	0.50360	0.837000	0.34925	0.655000	0.94253	CGG	0.433095		TCGA-US-A77G-01A-11D-A32N-08	0.398	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276111.1	0	0	1	2	2	2	2	0	0	0	0	67	67	67	65	1	1.870000	-2.523234	1	0.420000	NM_181785		0	5	5	0	419	415	0		1	0		0	0	67	0	0	0.936324	2.783418e-01	0	0	0	74	0	5	419
SOHLH2	54937	broad.mit.edu	37	13	36744911	36744911	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr13:36744911G>A	ENST00000379881.3	-	10	1102	c.1014C>T	c.(1012-1014)tcC>tcT	p.S338S	SOHLH2_ENST00000554962.1_Silent_p.S415S|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.S415S	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	338					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		TCTCTGAGGCGGAGCTTGATG	0.388																																						ENST00000379881.3	1.000000	2.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.159773	0.070000	0.070000																										0				26						c.(1012-1014)tcC>tcT		spermatogenesis and oogenesis specific basic helix-loop-helix 2							98.0	96.0	97.0					13																	36744911		2203	4300	6503	SO:0001819	synonymous_variant	54937	0	0					g.chr13:36744911G>A	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.1014C>T	chr13.hg19:g.36744911G>A		0					SOHLH2_ENST00000554962.1_Silent_p.S415S|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.S415S	p.S338S	NM_017826.2	NP_060296.2	1	2	3	2.146113	Q9NX45	SOLH2_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	10	1102	-		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	ENST00000379881.3	0	1	hg19	c.1014C>T	CCDS9355.1	0																																																																																								0.433095		TCGA-US-A77G-01A-11D-A32N-08	0.388	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	0	0	1	2	2	2	2	0	0	0	0	73	73	73	70	1	1.870000	-3.061295	1	0.420000	NM_017826		0	6	5	0	429	426	0		1	0		0	0	73	0	0	0.964207	0	0	0	0	1	0	6	429
DIAPH3	81624	broad.mit.edu	37	13	60557994	60557994	+	Silent	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr13:60557994C>T	ENST00000400324.4	-	13	1609	c.1389G>A	c.(1387-1389)gaG>gaA	p.E463E	DIAPH3_ENST00000267215.4_Silent_p.E463E|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400330.1_Silent_p.E463E|DIAPH3_ENST00000400320.1_Silent_p.E417E|DIAPH3_ENST00000377908.2_Silent_p.E452E|DIAPH3_ENST00000400319.1_Silent_p.E393E	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	463	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		GGGATACACACTCATCAATTA	0.313																																						ENST00000400324.4	1.000000	8.100000e-01	1	8.900000e-01	0.980000	0.957805	0.980000	1.000000																										0				46						c.(1387-1389)gaG>gaA		diaphanous-related formin 3							107.0	104.0	105.0					13																	60557994		1842	4087	5929	SO:0001819	synonymous_variant	81624	0	0					g.chr13:60557994C>T	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.1389G>A	chr13.hg19:g.60557994C>T		0					DIAPH3_ENST00000400320.1_Silent_p.E417E|DIAPH3_ENST00000267215.4_Silent_p.E463E|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000377908.2_Silent_p.E452E|DIAPH3_ENST00000400319.1_Silent_p.E393E|DIAPH3_ENST00000400330.1_Silent_p.E463E	p.E463E	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	1	2	3	2.146113	Q9NSV4	DIAP3_HUMAN		13	1609	-		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Silent	SNP	ENST00000400324.4	1	1	hg19	c.1389G>A	CCDS41898.1	1																																																																																								0.433095		TCGA-US-A77G-01A-11D-A32N-08	0.313	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	1	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	1.870000	-20.000000	1	0.420000	NM_001042517		0	107	107	0	428	424	1		1	1		0	0	84	0	0	1.000000	4.258298e-01	0	4	0	3	0	107	428
C14orf93	60686	broad.mit.edu	37	14	23467783	23467783	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr14:23467783G>A	ENST00000299088.6	-	2	879	c.450C>T	c.(448-450)agC>agT	p.S150S	C14orf93_ENST00000341470.4_Silent_p.S150S|RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000397377.1_5'UTR|C14orf93_ENST00000557513.1_5'Flank|C14orf93_ENST00000397382.4_Silent_p.S150S|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000406429.2_Silent_p.S150S|C14orf93_ENST00000397379.3_Silent_p.S150S	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	150						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		CCTGCACGCCGCTGCCCACGC	0.637																																						ENST00000299088.6	0.190000	3.000000e-02	1.400000e-01	5.000000e-02	0.090000	0.101752	0.090000	0.090000																										0				17						c.(448-450)agC>agT		chromosome 14 open reading frame 93							37.0	37.0	37.0					14																	23467783		2203	4300	6503	SO:0001819	synonymous_variant	60686	1	121412	33				g.chr14:23467783G>A	AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.450C>T	chr14.hg19:g.23467783G>A		1					C14orf93_ENST00000557513.1_5'Flank|C14orf93_ENST00000397377.1_5'UTR|RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000406429.2_Silent_p.S150S|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000397382.4_Silent_p.S150S|C14orf93_ENST00000341470.4_Silent_p.S150S|C14orf93_ENST00000397379.3_Silent_p.S150S	p.S150S	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	0	1	1	1.647296	Q9H972	CN093_HUMAN		2	879	-	all_cancers(95;3.3e-05)		B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Silent	SNP	ENST00000299088.6	0	1	hg19	c.450C>T	CCDS9583.1	0																																																																																								0.265823		TCGA-US-A77G-01A-11D-A32N-08	0.637	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	0	0	1	2	2	2	2	0	0	0	0	52	52	52	52	1	1.870000	-3.518828	1	0.420000	NM_021944		0	5	5	0	212	208	0		1	0		0	0	52	0	0	0.934390	1.262221e-01	0	0	0	22	0	5	212
FANCM	57697	broad.mit.edu	37	14	45658329	45658329	+	Missense_Mutation	SNP	G	G	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr14:45658329G>T	ENST00000267430.5	+	20	5189	c.5104G>T	c.(5104-5106)Gac>Tac	p.D1702Y	FANCM_ENST00000542564.2_Missense_Mutation_p.D1676Y	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1702					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CAAACAACAGGACCATTGTTT	0.398								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													ENST00000267430.5	1.000000	7.500000e-01	9.700000e-01	8.200000e-01	0.890000	0.895139	0.890000	1.000000																										0				85						c.(5104-5106)Gac>Tac	Involved in tolerance or repair of DNA crosslinks	Fanconi anemia, complementation group M							116.0	114.0	114.0					14																	45658329		2203	4300	6503	SO:0001583	missense	57697	0	0		Fanconi Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	g.chr14:45658329G>T	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5104G>T	chr14.hg19:g.45658329G>T	ENSP00000267430:p.Asp1702Tyr	0					FANCM_ENST00000542564.2_Missense_Mutation_p.D1676Y	p.D1702Y	NM_020937.2	NP_065988.1	0	1	1	2.054670	Q8IYD8	FANCM_HUMAN		20	5189	+			B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	1	1	hg19	c.5104G>T	CCDS32070.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.75|14.75	2.627860|2.627860	0.46944|0.46944	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	T;T;T|.	0.76578|.	-1.03;-1.03;-1.03|.	4.83|4.83	2.99|2.99	0.34606|0.34606	4.83|4.83	2.99|2.99	0.34606|0.34606	.|.	1.959200|.	0.02691|.	N|.	0.110584|.	T|T	0.40372|0.40372	0.1114|0.1114	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	D;D|.	0.56521|.	0.976;0.976|.	P;P|.	0.47744|.	0.556;0.556|.	T|T	0.25047|0.25047	-1.0143|-1.0143	10|5	0.54805|.	T|.	0.06|.	.|.	7.073|7.073	0.25189|0.25189	0.2863:0.0:0.7137:0.0|0.2863:0.0:0.7137:0.0	.|.	1676;1702|.	B2RTQ9;Q8IYD8|.	.;FANCM_HUMAN|.	Y|V	1702;1676;1218|634	ENSP00000267430:D1702Y;ENSP00000442493:D1676Y;ENSP00000452033:D1218Y|.	ENSP00000267430:D1702Y|.	D|G	+|+	1|2	0|0	0|0	FANCM|FANCM	44728079|44728079	44728079|44728079	0.290000|0.290000	0.24343|0.24343	0.001000|0.001000	0.08648|0.08648	0.313000|0.313000	0.28021|0.28021	1.643000|1.643000	0.37217|0.37217	0.565000|0.565000	0.29255|0.29255	0.650000|0.650000	0.86243|0.86243	GAC|GGA	0.418779		TCGA-US-A77G-01A-11D-A32N-08	0.398	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	1	0	1	2	2	2	2	0	0	0	0	113	113	113	112	1	1.870000	-20.000000	1	0.420000	XM_048128		0	124	121	0	534	525	1		1	0		0	0	113	0	0	1.000000	3.936267e-01	0	1	0	6	0	124	534
PGBD4	161779	broad.mit.edu	37	15	34396066	34396066	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr15:34396066G>A	ENST00000397766.2	+	1	1793	c.1334G>A	c.(1333-1335)cGc>cAc	p.R445H	EMC7_ENST00000256545.4_5'Flank|EMC7_ENST00000532113.1_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	445										breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		CCATCTGAGCGCAAAAGACAC	0.413																																						ENST00000397766.2	0.150000	2.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.085546	0.070000	0.080000																										0				16						c.(1333-1335)cGc>cAc		piggyBac transposable element derived 4							77.0	71.0	73.0					15																	34396066		2201	4298	6499	SO:0001583	missense	161779	0	0					g.chr15:34396066G>A	AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.1334G>A	chr15.hg19:g.34396066G>A	ENSP00000380872:p.Arg445His	0					EMC7_ENST00000256545.4_5'Flank|EMC7_ENST00000532113.1_5'Flank	p.R445H	NM_152595.4	NP_689808.2	0	0	0	2.032407	Q96DM1	PGBD4_HUMAN		1	1793	+		all_lung(180;1.76e-08)	A1L487|A8K0C6|Q8N9E8	Missense_Mutation	SNP	ENST00000397766.2	0	1	hg19	c.1334G>A	CCDS10033.1	0	.	.	.	.	.	.	.	.	.	.	g	17.93	3.508096	0.64410	.	.	ENSG00000182405	ENST00000397766	T	0.19938	2.11	1.02	-1.24	0.09435	1.02	-1.24	0.09435	.	3.690650	0.02398	N	0.080343	T	0.34106	0.0886	L	0.55481	1.735	0.09310	N	0.99999	D	0.67145	0.996	D	0.68353	0.957	T	0.23511	-1.0186	10	0.25106	T	0.35	.	1.9806	0.03426	0.4088:0.0:0.3294:0.2618	.	445	Q96DM1	PGBD4_HUMAN	H	445	ENSP00000380872:R445H	ENSP00000380872:R445H	R	+	2	0	0	PGBD4	32183358	32183358	0.487000	0.25988	0.009000	0.14445	0.953000	0.61014	0.430000	0.21428	-0.479000	0.06813	0.306000	0.20318	CGC	0.415087		TCGA-US-A77G-01A-11D-A32N-08	0.413	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251522.1	0	0	1	2	2	2	2	0	0	0	0	85	85	85	85	1	1.870000	-2.432565	0	0.420000			0	6	6	0	377	375	0		1	0		0	0	85	0	0	0.964702	3.768252e-04	0	0	0	2	0	6	377
TLN2	83660	broad.mit.edu	37	15	63088384	63088384	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr15:63088384C>A	ENST00000561311.1	+	46	6172	c.5942C>A	c.(5941-5943)aCa>aAa	p.T1981K	TLN2_ENST00000306829.6_Missense_Mutation_p.T1981K			Q9Y4G6	TLN2_HUMAN	talin 2	1981					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GCATGCATTACAGCCGCCACC	0.562																																						ENST00000561311.1	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.080351	0.070000	0.070000																										0				99						c.(5941-5943)aCa>aAa		talin 2							70.0	67.0	68.0					15																	63088384		2203	4300	6503	SO:0001583	missense	83660	0	0					g.chr15:63088384C>A	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5942C>A	chr15.hg19:g.63088384C>A	ENSP00000453508:p.Thr1981Lys	0					TLN2_ENST00000306829.6_Missense_Mutation_p.T1981K	p.T1981K			0	0	0	2.031128	Q9Y4G6	TLN2_HUMAN		46	6172	+			A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	0	1	hg19	c.5942C>A	CCDS32261.1	0	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317805	0.81469	.	.	ENSG00000171914	ENST00000306829	T	0.69040	-0.37	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.75155	0.3811	M	0.64997	1.995	0.80722	D	1	D	0.67145	0.996	P	0.55303	0.773	T	0.70941	-0.4735	10	0.23302	T	0.38	-17.5484	19.3855	0.94554	0.0:1.0:0.0:0.0	.	1981	Q9Y4G6	TLN2_HUMAN	K	1981	ENSP00000303476:T1981K	ENSP00000303476:T1981K	T	+	2	0	0	TLN2	60875437	60875437	1.000000	0.71417	0.964000	0.40570	0.521000	0.34408	7.776000	0.85560	2.569000	0.86673	0.655000	0.94253	ACA	0.415087		TCGA-US-A77G-01A-11D-A32N-08	0.562	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2	0	0	0	2	2	2	2	0	0	0	0	63	63	63	62	1	1.870000	-5.984040	1	0.420000			0	6	1	0	402	399	0		0	0		0	0	63	0	0	0.963044	9.775769e-02	0	0	0	30	0	6	402
KIAA0556	23247	broad.mit.edu	37	16	27640032	27640032	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr16:27640032A>G	ENST00000261588.4	+	4	210	c.191A>G	c.(190-192)cAc>cGc	p.H64R		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	64						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AGGCTGGAGCACTTGGAGCAA	0.488																																						ENST00000261588.4	0.530000	3.300000e-01	4.800000e-01	3.700000e-01	0.420000	0.432112	0.420000	0.420000																										0				76						c.(190-192)cAc>cGc		KIAA0556							150.0	138.0	142.0					16																	27640032		2197	4300	6497	SO:0001583	missense	23247	0	0					g.chr16:27640032A>G	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.191A>G	chr16.hg19:g.27640032A>G	ENSP00000261588:p.His64Arg	0						p.H64R	NM_015202.2	NP_056017.2	0	0	0	2.054990	O60303	K0556_HUMAN		4	210	+			A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	1	1	hg19	c.191A>G	CCDS32415.1	0	.	.	.	.	.	.	.	.	.	.	A	12.65	2.000654	0.35320	.	.	ENSG00000047578	ENST00000261588	T	0.39997	1.05	5.21	5.21	0.72293	5.21	5.21	0.72293	.	0.237136	0.35349	N	0.003262	T	0.51092	0.1654	L	0.48642	1.525	0.40163	D	0.977085	D	0.61697	0.99	P	0.61592	0.891	T	0.45366	-0.9266	10	0.22109	T	0.4	.	12.6144	0.56567	1.0:0.0:0.0:0.0	.	64	O60303	K0556_HUMAN	R	64	ENSP00000261588:H64R	ENSP00000261588:H64R	H	+	2	0	0	KIAA0556	27547533	27547533	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.096000	0.50243	1.973000	0.57446	0.454000	0.30748	CAC	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.488	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	1	0	1	2	2	2	2	0	0	0	0	128	128	128	128	1	1.870000	-18.467950	1	0.420000	NM_015202		0	69	69	0	699	688	0		1	1		0	0	128	0	0	1.000000	1.948003e-01	0	2	0	7	0	69	699
WDR90	197335	broad.mit.edu	37	16	711075	711075	+	Missense_Mutation	SNP	G	G	A	rs377695532		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr16:711075G>A	ENST00000293879.4	+	29	3416	c.3416G>A	c.(3415-3417)cGc>cAc	p.R1139H	WDR90_ENST00000549091.1_Missense_Mutation_p.R1139H			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1139										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				ACGTGCGGCCGCCTGGTGGTG	0.746																																						ENST00000293879.4	0.810000	9.000000e-02	5.300000e-01	1.800000e-01	0.330000	0.364061	0.330000	0.290000																										0				37						c.(3415-3417)cGc>cAc		WD repeat domain 90		G	HIS/ARG	1,3813		0,1,1906	7.0	9.0	9.0		3416	3.0	0.6	16		9	0,8202		0,0,4101	no	missense	WDR90	NM_145294.4	29	0,1,6007	AA,AG,GG		0.0,0.0262,0.0083	benign	1139/1749	711075	1,12015	1907	4101	6008	SO:0001583	missense	197335	15	116534	34				g.chr16:711075G>A	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.3416G>A	chr16.hg19:g.711075G>A	ENSP00000293879:p.Arg1139His	0					WDR90_ENST00000549091.1_Missense_Mutation_p.R1139H	p.R1139H			1	2	3	2.077619	Q96KV7	WDR90_HUMAN		29	3416	+		Hepatocellular(780;0.0218)	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	0	1	hg19	c.3416G>A	CCDS42092.1	0	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648178	0.29336	2.62E-4	0.0	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.42513	1.55;0.97	4.96	3.0	0.34707	4.96	3.0	0.34707	Quinonprotein alcohol dehydrogenase-like (1);	0.436630	0.26072	N	0.026520	T	0.24236	0.0587	N	0.12182	0.205	0.80722	D	1	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.002	T	0.03807	-1.1002	10	0.42905	T	0.14	.	10.5167	0.44894	0.1582:0.0:0.8418:0.0	.	1139;1139	F8VUX9;Q96KV7	.;WDR90_HUMAN	H	1139	ENSP00000448122:R1139H;ENSP00000293879:R1139H	ENSP00000293879:R1139H	R	+	2	0	0	WDR90	651076	651076	0.817000	0.29147	0.620000	0.29132	0.104000	0.19210	4.351000	0.59398	0.619000	0.30197	-0.671000	0.03813	CGC	0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.746	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	0	0	1	2	2	2	2	0	0	0	0	13	13	13	12	1	1.870000	-7.311756	1	0.420000	NM_145294		0	3	3	0	47	47	0		1	0		0	0	13	0	0	0.812596	5.522551e-01	0	0	0	25	0	3	47
HAS3	3038	broad.mit.edu	37	16	69148721	69148721	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr16:69148721G>A	ENST00000306560.1	+	4	1370	c.1214G>A	c.(1213-1215)cGc>cAc	p.R405H	HAS3_ENST00000219322.3_Intron|HAS3_ENST00000569188.1_Missense_Mutation_p.R405H	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	405					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.R405H(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		TACCGGGGCCGCATCTGGAAC	0.542																																						ENST00000306560.1	0.100000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.052942	0.040000	0.040000																										1	Substitution - Missense(1)	p.R405H(1)	large_intestine(1)	16						c.(1213-1215)cGc>cAc		hyaluronan synthase 3							117.0	109.0	112.0					16																	69148721		2198	4300	6498	SO:0001583	missense	3038	1	121412	31				g.chr16:69148721G>A	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1214G>A	chr16.hg19:g.69148721G>A	ENSP00000304440:p.Arg405His	0					HAS3_ENST00000569188.1_Missense_Mutation_p.R405H|HAS3_ENST00000219322.3_Intron	p.R405H	NM_005329.2	NP_005320.2	0	0	0	2.054990	O00219	HYAS3_HUMAN		4	1370	+		Ovarian(137;0.101)	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	ENST00000306560.1	0	1	hg19	c.1214G>A	CCDS10871.1	0	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700380	0.88924	.	.	ENSG00000103044	ENST00000306560	T	0.59364	0.27	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.68869	0.3048	L	0.59436	1.845	0.58432	D	0.999998	D	0.63046	0.992	P	0.54312	0.748	T	0.65899	-0.6056	10	0.44086	T	0.13	-8.402	20.2544	0.98414	0.0:0.0:1.0:0.0	.	405	O00219	HAS3_HUMAN	H	405	ENSP00000304440:R405H	ENSP00000304440:R405H	R	+	2	0	0	HAS3	67706222	67706222	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.749000	0.74883	2.885000	0.99019	0.655000	0.94253	CGC	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.542	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	0	0	1	2	18	3	2	1	1	1	1	124	124	124	122	1	1.870000	-2.015021	0	0.420000	NM_138612		0	6	7	0	620	615	0		0	0		1	0	124	0	0	0.010155	2.440147e-02	0	0	0	51	0	6	620
JPH3	57338	broad.mit.edu	37	16	87636931	87636931	+	Missense_Mutation	SNP	C	C	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr16:87636931C>A	ENST00000284262.2	+	1	421	c.179C>A	c.(178-180)aCg>aAg	p.T60K	RP11-482M8.3_ENST00000602388.1_RNA	NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	60	Gly-rich.				calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		AGCGGCAACACGTACCAGGGC	0.677																																						ENST00000284262.2	0.320000	5.000000e-02	2.300000e-01	9.000000e-02	0.150000	0.167051	0.150000	0.140000																										0				30						c.(178-180)aCg>aAg		junctophilin 3							37.0	35.0	35.0					16																	87636931		2198	4298	6496	SO:0001583	missense	57338	0	0					g.chr16:87636931C>A	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.179C>A	chr16.hg19:g.87636931C>A	ENSP00000284262:p.Thr60Lys	0					RP11-482M8.3_ENST00000602388.1_RNA	p.T60K	NM_020655.2	NP_065706.2	1	2	3	2.061710	Q8WXH2	JPH3_HUMAN		1	421	+			D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Missense_Mutation	SNP	ENST00000284262.2	0	1	hg19	c.179C>A	CCDS10962.1	0	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048418	0.75846	.	.	ENSG00000154118	ENST00000301008;ENST00000284262	T	0.55930	0.49	4.07	4.07	0.47477	4.07	4.07	0.47477	.	0.177447	0.47852	D	0.000213	T	0.40670	0.1126	N	0.04787	-0.16	0.58432	D	0.999998	B	0.22851	0.076	B	0.39771	0.309	T	0.38520	-0.9657	10	0.30854	T	0.27	.	15.2272	0.73359	0.0:1.0:0.0:0.0	.	60	Q8WXH2	JPH3_HUMAN	K	60	ENSP00000284262:T60K	ENSP00000284262:T60K	T	+	2	0	0	JPH3	86194432	86194432	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.759000	0.38420	1.800000	0.52685	0.462000	0.41574	ACG	0.421215		TCGA-US-A77G-01A-11D-A32N-08	0.677	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2	0	0	0	2	2	2	2	0	0	0	0	48	48	48	48	1	1.870000	-7.799874	1	0.420000			0	5	0	0	163	161	0		0	0		0	0	48	0	0	0.931268	0	0	0	0	1	0	5	163
MYO1D	4642	broad.mit.edu	37	17	31082528	31082528	+	Silent	SNP	G	G	A	rs576692452	byFrequency	TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr17:31082528G>A	ENST00000318217.5	-	11	1753	c.1449C>T	c.(1447-1449)gcC>gcT	p.A483A	MYO1D_ENST00000579584.1_Silent_p.A483A|MYO1D_ENST00000394649.4_Silent_p.A395A|MYO1D_ENST00000584232.1_5'UTR	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	483	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TGGAAAAATGGGCGTGTTTGC	0.393																																						ENST00000318217.5	0.290000	9.000000e-02	2.300000e-01	1.300000e-01	0.170000	0.191313	0.170000	0.180000																										0				39						c.(1447-1449)gcC>gcT		myosin ID							123.0	111.0	115.0					17																	31082528		2203	4300	6503	SO:0001819	synonymous_variant	4642	0	0					g.chr17:31082528G>A	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1449C>T	chr17.hg19:g.31082528G>A		0					MYO1D_ENST00000584232.1_5'UTR|MYO1D_ENST00000394649.4_Silent_p.A395A|MYO1D_ENST00000579584.1_Silent_p.A483A	p.A483A	NM_015194.1	NP_056009.1	1	2	3	2.072926	O94832	MYO1D_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0362)	11	1753	-			A6H8V3|Q8NHP9	Silent	SNP	ENST00000318217.5	1	1	hg19	c.1449C>T	CCDS32615.1	0																																																																																								0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.393	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1	0	0	0	2	2	2	2	0	0	0	0	80	80	80	79	1	1.870000	-3.695217	1	0.420000			0	15	15	0	399	394	0		1	1		0	0	80	0	0	0.999865	9.531356e-01	0	7	0	132	0	15	399
KRTAP3-1	83896	broad.mit.edu	37	17	39165249	39165249	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr17:39165249G>A	ENST00000391588.1	-	1	117	c.78C>T	c.(76-78)tgC>tgT	p.C26C	KRTAP3-1_ENST00000581033.1_5'UTR	NM_031958.1	NP_114164.1	Q9BYR8	KRA31_HUMAN	keratin associated protein 3-1	26	4 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00043)				CTCCACAGCGGCAGCTTTTAT	0.592																																						ENST00000391588.1	0.110000	0	8.000000e-02	2.000000e-02	0.040000	0.061580	0.040000	0.040000																										0				8						c.(76-78)tgC>tgT		keratin associated protein 3-1							85.0	88.0	87.0					17																	39165249		2203	4296	6499	SO:0001819	synonymous_variant	83896	0	0					g.chr17:39165249G>A	AJ406931	CCDS32645.1	17q21.2	2013-06-25			ENSG00000212901	ENSG00000212901		"""Keratin associated proteins"""	16778	protein-coding gene	gene with protein product						11279113	Standard	NM_031958		Approved	KAP3.1	uc002hvt.1	Q9BYR8	OTTHUMG00000133595	ENST00000391588.1:c.78C>T	chr17.hg19:g.39165249G>A		0					KRTAP3-1_ENST00000581033.1_5'UTR	p.C26C	NM_031958.1	NP_114164.1	1	2	3	2.072926	Q9BYR8	KRA31_HUMAN		1	117	-		Breast(137;0.00043)	Q14DM4	Silent	SNP	ENST00000391588.1	0	1	hg19	c.78C>T	CCDS32645.1	0																																																																																								0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.592	KRTAP3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257699.1	0	0	1	2	2	2	2	0	0	0	0	102	102	102	100	1	1.870000	-3.103783	1	0.420000			0	5	5	0	539	524	0		1			0	0	102	0	0	0.933107	0	0	0	0	0	0	5	539
USP43	124739	broad.mit.edu	37	17	9631939	9631939	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr17:9631939G>A	ENST00000285199.7	+	15	3100	c.3004G>A	c.(3004-3006)Gtg>Atg	p.V1002M	USP43_ENST00000570475.1_Missense_Mutation_p.V997M|USP43_ENST00000570827.2_3'UTR	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	1002					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						TCTGAGGTCCGTGTTTCGGAA	0.602																																						ENST00000285199.7	0.180000	2.000000e-02	1.300000e-01	4.000000e-02	0.080000	0.092279	0.080000	0.080000																										0				26						c.(3004-3006)Gtg>Atg		ubiquitin specific peptidase 43							34.0	38.0	37.0					17																	9631939		1961	4142	6103	SO:0001583	missense	124739	0	0					g.chr17:9631939G>A	AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.3004G>A	chr17.hg19:g.9631939G>A	ENSP00000285199:p.Val1002Met	1					USP43_ENST00000570827.2_3'UTR|USP43_ENST00000570475.1_Missense_Mutation_p.V997M	p.V1002M	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	0	1	1	1.648062	Q70EL4	UBP43_HUMAN		15	3100	+			A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Missense_Mutation	SNP	ENST00000285199.7	0	1	hg19	c.3004G>A	CCDS45610.1	0	.	.	.	.	.	.	.	.	.	.	G	6.121	0.390479	0.11581	.	.	ENSG00000154914	ENST00000285199	T	0.10192	2.9	5.24	-0.892	0.10570	5.24	-0.892	0.10570	.	7.908350	0.00166	N	0.000002	T	0.10723	0.0262	L	0.57536	1.79	0.18873	N	0.999985	B;P;B;P	0.42757	0.297;0.668;0.297;0.789	B;B;B;B	0.27500	0.023;0.055;0.023;0.08	T	0.46162	-0.9211	10	0.51188	T	0.08	-12.3583	8.6472	0.34013	0.4535:0.0:0.5465:0.0	.	997;691;1002;514	B7ZVX5;Q70EL4-3;Q70EL4;Q70EL4-2	.;.;UBP43_HUMAN;.	M	1002	ENSP00000285199:V1002M	ENSP00000285199:V1002M	V	+	1	0	0	USP43	9572664	9572664	0.014000	0.17966	0.378000	0.26068	0.003000	0.03518	0.017000	0.13399	-0.027000	0.13873	-0.768000	0.03414	GTG	0.265823		TCGA-US-A77G-01A-11D-A32N-08	0.602	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439855.3	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.870000	-3.861965	1	0.420000	NM_153210		0	4	4	0	195	195	0		1	0		0	0	61	0	0	0.891223	5.136861e-02	0	0	0	14	0	4	195
DHX8	1659	broad.mit.edu	37	17	41601211	41601211	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr17:41601211G>A	ENST00000262415.3	+	23	3731	c.3659G>A	c.(3658-3660)cGc>cAc	p.R1220H	DHX8_ENST00000540306.1_Intron	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	1220					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		TTCCGACGGCGCTGAAAGGCA	0.517																																					NSCLC(56;1548 1661 49258 49987)	ENST00000262415.3	0.240000	2.000000e-02	1.600000e-01	5.000000e-02	0.090000	0.119707	0.090000	0.090000																										0				42						c.(3658-3660)cGc>cAc		DEAH (Asp-Glu-Ala-His) box polypeptide 8							76.0	66.0	70.0					17																	41601211		2203	4300	6503	SO:0001583	missense	1659	1	121412	28				g.chr17:41601211G>A	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.3659G>A	chr17.hg19:g.41601211G>A	ENSP00000262415:p.Arg1220His	0					DHX8_ENST00000540306.1_Intron	p.R1220H	NM_004941.1	NP_004932.1	1	2	3	2.072926	Q14562	DHX8_HUMAN		23	3731	+		Breast(137;0.00908)		Missense_Mutation	SNP	ENST00000262415.3	0	1	hg19	c.3659G>A	CCDS11464.1	0	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780753	0.70222	.	.	ENSG00000067596	ENST00000262415	T	0.03801	3.8	6.16	5.2	0.72013	6.16	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	L	0.36672	1.1	0.58432	D	0.999999	D	0.71674	0.998	P	0.52481	0.7	T	0.03423	-1.1038	10	0.87932	D	0	.	14.6997	0.69147	0.0688:0.0:0.9312:0.0	.	1220	Q14562	DHX8_HUMAN	H	1220	ENSP00000262415:R1220H	ENSP00000262415:R1220H	R	+	2	0	0	DHX8	38956737	38956737	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	9.841000	0.99482	1.628000	0.50416	-0.145000	0.13849	CGC	0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.517	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1	0	0	1	2	2	2	2	0	0	0	0	42	42	42	41	1	1.870000	-3.290682	1	0.420000			0	4	4	0	208	206	0		1	0		0	0	42	0	0	0.888951	5.900968e-01	0	0	0	93	0	4	208
PSG7	5676	broad.mit.edu	37	19	43433639	43433639	+	RNA	SNP	G	G	T	rs531432163	byFrequency	TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr19:43433639G>T	ENST00000406070.2	-	0	760				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				GCACTCACTGGGTTCCGTATT	0.507																																						ENST00000406070.2	1.000000	8.700000e-01	1	9.200000e-01	0.960000	0.965739	0.960000	1.000000																										0												pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)							235.0	249.0	244.0					19																	43433639		2201	4300	6501			5676	1	121348	40				g.chr19:43433639G>T			19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		chr19.hg19:g.43433639G>T		0					PSG7_ENST00000446844.3_RNA		NM_002783.2	NP_002774.2	1	2	3	2.102128	Q13046	PSG7_HUMAN		0	760	-		Prostate(69;0.00682)	Q15232	RNA	SNP	ENST00000406070.2	1	1	hg19			1																																																																																								0.427217		TCGA-US-A77G-01A-11D-A32N-08	0.507	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	0	0	1	2	2	2	2	0	0	0	0	429	429	429	439	1	1.870000	-20.000000	1	0.420000	NM_001206650		0	380	366	0	1508	1427	0		1			0	0	429	0	0	1.000000	0	0	0	0	0	0	380	1508
C3	718	broad.mit.edu	37	19	6719298	6719298	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr19:6719298C>T	ENST00000245907.6	-	2	283	c.191G>A	c.(190-192)gGc>gAc	p.G64D		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	64					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TAGTTTTTTGCCTGGGAAGTC	0.592																																						ENST00000245907.6	1.000000	0	7.000000e-02	2.000000e-02	0.040000	0.093086	0.040000	0.040000																										0				72						c.(190-192)gGc>gAc		complement component 3	Intravenous Immunoglobulin(DB00028)						236.0	169.0	192.0					19																	6719298		2203	4300	6503	SO:0001583	missense	718	0	0					g.chr19:6719298C>T	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.191G>A	chr19.hg19:g.6719298C>T	ENSP00000245907:p.Gly64Asp	0						p.G64D	NM_000064.2	NP_000055.2	1	2	3	2.100189	P01024	CO3_HUMAN		2	283	-			A7E236	Missense_Mutation	SNP	ENST00000245907.6	0	1	hg19	c.191G>A	CCDS32883.1	0	.	.	.	.	.	.	.	.	.	.	C	7.629	0.678519	0.14841	.	.	ENSG00000125730	ENST00000245907	T	0.79845	-1.31	4.87	-9.75	0.00506	4.87	-9.75	0.00506	.	2.754490	0.01396	N	0.013408	T	0.60209	0.2251	N	0.22421	0.69	0.09310	N	1	B	0.26318	0.146	B	0.28709	0.093	T	0.51957	-0.8639	10	0.11794	T	0.64	.	3.9794	0.09489	0.0806:0.3674:0.1424:0.4095	.	64	P01024	CO3_HUMAN	D	64	ENSP00000245907:G64D	ENSP00000245907:G64D	G	-	2	0	0	C3	6670298	6670298	0.000000	0.05858	0.001000	0.08648	0.154000	0.21943	-1.181000	0.03085	-1.444000	0.01950	0.305000	0.20034	GGC	0.427217		TCGA-US-A77G-01A-11D-A32N-08	0.592	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	0	0	1	2	2	2	2	0	0	0	0	132	132	132	131	1	1.870000	-2.381119	0	0.420000	NM_000064		0	6	6	0	687	684	0		1	0		0	0	132	0	0	0.964606	4.766381e-01	0	0	0	166	0	6	687
KCNA7	3743	broad.mit.edu	37	19	49573549	49573549	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr19:49573549G>A	ENST00000221444.1	-	2	1497	c.1142C>T	c.(1141-1143)gCg>gTg	p.A381V		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	381					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	CAGCACGCCCGCAATGGCACA	0.557																																					Colon(74;686 1235 3793 23366 48562)	ENST00000221444.1	0.180000	2.000000e-02	1.300000e-01	4.000000e-02	0.080000	0.091382	0.080000	0.070000																										0				11						c.(1141-1143)gCg>gTg		potassium voltage-gated channel, shaker-related subfamily, member 7	Dalfampridine(DB06637)						78.0	67.0	70.0					19																	49573549		2203	4300	6503	SO:0001583	missense	3743	1	121412	31				g.chr19:49573549G>A	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.1142C>T	chr19.hg19:g.49573549G>A	ENSP00000221444:p.Ala381Val	1						p.A381V	NM_031886.2	NP_114092.2	0	1	1	1.714791	Q96RP8	KCNA7_HUMAN		2	1497	-		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	A1KYX7|Q9BYS4	Missense_Mutation	SNP	ENST00000221444.1	0	1	hg19	c.1142C>T	CCDS12755.1	0	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862088	0.91511	.	.	ENSG00000104848	ENST00000221444	D	0.98313	-4.86	4.65	4.65	0.58169	4.65	4.65	0.58169	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97096	0.9051	L	0.48260	1.515	0.80722	D	1	D	0.60575	0.988	P	0.47251	0.542	D	0.97729	1.0201	10	0.72032	D	0.01	.	16.6617	0.85242	0.0:0.0:1.0:0.0	.	381	Q96RP8	KCNA7_HUMAN	V	381	ENSP00000221444:A381V	ENSP00000221444:A381V	A	-	2	0	0	KCNA7	54265361	54265361	1.000000	0.71417	0.982000	0.44146	0.872000	0.50106	9.860000	0.99555	2.321000	0.78463	0.491000	0.48974	GCG	0.265823		TCGA-US-A77G-01A-11D-A32N-08	0.557	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	0	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	1.870000	-3.365417	1	0.420000	NM_031886		0	4	4	0	197	197	0		1			0	0	57	0	0	0.891217	0	0	0	0	0	0	4	197
PADI3	51702	broad.mit.edu	37	1	17593248	17593248	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr1:17593248G>A	ENST00000375460.3	+	5	483	c.443G>A	c.(442-444)gGc>gAc	p.G148D		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	148					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGGTATGGCGGCATCTTGCTG	0.597																																						ENST00000375460.3	0.120000	1.000000e-02	8.000000e-02	2.000000e-02	0.050000	0.068156	0.050000	0.050000																										0				32						c.(442-444)gGc>gAc		peptidyl arginine deiminase, type III	L-Citrulline(DB00155)						168.0	136.0	147.0					1																	17593248		2203	4300	6503	SO:0001583	missense	51702	0	0					g.chr1:17593248G>A	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.443G>A	chr1.hg19:g.17593248G>A	ENSP00000364609:p.Gly148Asp	0						p.G148D	NM_016233.2	NP_057317.2	1	2	3	2.073686	Q9ULW8	PADI3_HUMAN		5	483	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	0	1	hg19	c.443G>A	CCDS179.1	0	.	.	.	.	.	.	.	.	.	.	G	17.32	3.359635	0.61403	.	.	ENSG00000142619	ENST00000375460	T	0.14266	2.52	5.15	4.23	0.50019	5.15	4.23	0.50019	Protein-arginine deiminase (PAD), central domain (2);	0.052990	0.85682	D	0.000000	T	0.10423	0.0255	N	0.08118	0	0.38404	D	0.945756	P	0.38335	0.627	B	0.42112	0.376	T	0.27226	-1.0080	10	0.87932	D	0	-23.3232	14.4617	0.67453	0.0:0.8491:0.1509:0.0	.	148	Q9ULW8	PADI3_HUMAN	D	148	ENSP00000364609:G148D	ENSP00000364609:G148D	G	+	2	0	0	PADI3	17465835	17465835	1.000000	0.71417	0.661000	0.29709	0.848000	0.48234	5.229000	0.65316	1.169000	0.42739	-0.270000	0.10280	GGC	0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.597	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1	0	0	1	2	2	2	2	0	0	0	0	120	120	120	119	1	1.870000	-2.498435	0	0.420000			0	5	5	0	478	470	0		1			0	0	120	0	0	0.934712	0	0	0	0	0	0	5	478
ANKRD34A	284615	broad.mit.edu	37	1	145474624	145474624	+	Silent	SNP	C	C	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr1:145474624C>A	ENST00000323397.4	+	4	2589	c.1296C>A	c.(1294-1296)ccC>ccA	p.P432P	LIX1L_ENST00000369308.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	432	Pro-rich.					cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ACGTCAGTCCCCACCCTCCCA	0.687																																						ENST00000323397.4	0.210000	2.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.109494	0.090000	0.090000																										0				20						c.(1294-1296)ccC>ccA		ankyrin repeat domain 34A							26.0	23.0	24.0					1																	145474624		2202	4290	6492	SO:0001819	synonymous_variant	284615	0	0					g.chr1:145474624C>A	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1296C>A	chr1.hg19:g.145474624C>A		1					LIX1L_ENST00000369308.3_5'Flank|RP11-315I20.1_ENST00000600340.1_RNA	p.P432P	NM_001039888.2	NP_001034977.1	0	2	2	2.236663	Q69YU3	AN34A_HUMAN		4	2589	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		B3KSU3	Silent	SNP	ENST00000323397.4	0	1	hg19	c.1296C>A	CCDS30829.1	0																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.687	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1	0	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	1.870000	-3.564516	1	0.420000			0	4	4	0	210	203	0		1	0		0	0	28	0	0	0.883199	1.879019e-03	0	0	0	3	0	4	210
ACOT7	11332	broad.mit.edu	37	1	6409894	6409894	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr1:6409894C>T	ENST00000377855.2	-	2	352	c.206G>A	c.(205-207)gGc>gAc	p.G69D	ACOT7_ENST00000361521.4_Missense_Mutation_p.G59D|ACOT7_ENST00000377845.3_Missense_Mutation_p.G39D|ACOT7_ENST00000541130.1_Missense_Mutation_p.G39D|ACOT7_ENST00000377842.3_Missense_Mutation_p.G18D|ACOT7_ENST00000608083.1_Missense_Mutation_p.G27D|ACOT7_ENST00000545482.1_Intron	NM_181864.2	NP_863654.1	O00154	BACH_HUMAN	acyl-CoA thioesterase 7	69	Acyl coenzyme A hydrolase 1.				coenzyme A biosynthetic process (GO:0015937)|fatty acid catabolic process (GO:0009062)|long-chain fatty-acyl-CoA catabolic process (GO:0036116)|medium-chain fatty acid biosynthetic process (GO:0051792)|medium-chain fatty-acyl-CoA catabolic process (GO:0036114)|palmitic acid biosynthetic process (GO:1900535)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)	carboxylic ester hydrolase activity (GO:0052689)|fatty-acyl-CoA binding (GO:0000062)|long-chain fatty acyl-CoA binding (GO:0036042)|palmitoyl-CoA hydrolase activity (GO:0016290)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	16	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		GTGGACATTGCCGGCCACGTT	0.592																																					GBM(74;673 1226 4974 11850 13190)	ENST00000377855.2	1.000000	3.000000e-02	1.600000e-01	6.000000e-02	0.090000	0.133444	0.090000	0.090000																										0				16						c.(205-207)gGc>gAc		acyl-CoA thioesterase 7							63.0	53.0	57.0					1																	6409894		2203	4300	6503	SO:0001583	missense	11332	0	0					g.chr1:6409894C>T	AB074417	CCDS65.1, CCDS66.1, CCDS67.1, CCDS30573.1	1p36	2008-08-14			ENSG00000097021	ENSG00000097021		"""Acyl CoA thioesterases"""	24157	protein-coding gene	gene with protein product	"""brain acyl CoA hydrolase"""	602587				10578051, 16103133, 16940157	Standard	XM_005263427		Approved	BACH, ACH1, ACT, CTE-II, LACH1, MGC1126, hBACH	uc001amt.3	O00154	OTTHUMG00000001295	ENST00000377855.2:c.206G>A	chr1.hg19:g.6409894C>T	ENSP00000367086:p.Gly69Asp	0					ACOT7_ENST00000545482.1_Intron|ACOT7_ENST00000377842.3_Missense_Mutation_p.G18D|ACOT7_ENST00000608083.1_Missense_Mutation_p.G27D|ACOT7_ENST00000361521.4_Missense_Mutation_p.G59D|ACOT7_ENST00000377845.3_Missense_Mutation_p.G39D|ACOT7_ENST00000541130.1_Missense_Mutation_p.G39D	p.G69D	NM_181864.2	NP_863654.1	1	2	3	2.088200	O00154	BACH_HUMAN		2	352	-	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)	A8K0K7|A8K232|A8K6B8|A8K837|B3KQ12|O43703|Q53Y78|Q5JYL2|Q5JYL3|Q5JYL4|Q5JYL5|Q5JYL6|Q5TGR4|Q9UJM9|Q9Y539|Q9Y540	Missense_Mutation	SNP	ENST00000377855.2	0	1	hg19	c.206G>A	CCDS65.1	0	.	.	.	.	.	.	.	.	.	.	C	29.3	4.993767	0.93167	.	.	ENSG00000097021	ENST00000377855;ENST00000377845;ENST00000377842;ENST00000361521;ENST00000541130	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	4.48	4.48	0.54585	4.48	4.48	0.54585	Thioesterase superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67896	0.2942	M	0.75085	2.285	0.53688	D	0.999974	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;0.991;1.0;0.987	T	0.72327	-0.4327	10	0.72032	D	0.01	.	14.7432	0.69472	0.0:1.0:0.0:0.0	.	59;69;39;18	B3KQ12;O00154;O00154-5;O00154-6	.;BACH_HUMAN;.;.	D	69;39;18;59;39	ENSP00000367086:G69D;ENSP00000367076:G39D;ENSP00000367073:G18D;ENSP00000354615:G59D;ENSP00000441872:G39D	ENSP00000354615:G59D	G	-	2	0	0	ACOT7	6332481	6332481	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	7.065000	0.76727	2.349000	0.79799	0.650000	0.86243	GGC	0.424831		TCGA-US-A77G-01A-11D-A32N-08	0.592	ACOT7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003773.1	0	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	1.870000	-3.555150	1	0.420000	NM_007274		0	5	5	0	259	256	0		1	0		0	0	57	0	0	0.936240	5.332093e-01	0	0	0	84	0	5	259
TRIM67	440730	broad.mit.edu	37	1	231339743	231339743	+	Silent	SNP	C	C	T	rs368294541		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr1:231339743C>T	ENST00000366653.5	+	6	1665	c.1665C>T	c.(1663-1665)gcC>gcT	p.A555A	TRIM67_ENST00000449018.3_Silent_p.A493A|TRIM67_ENST00000444294.3_Silent_p.A553A|TRIM67_ENST00000366652.2_Silent_p.A555A			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	555	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				ACGACGGTGCCGGGGGACAGT	0.627																																						ENST00000366653.5	1.000000	4.300000e-01	1	5.300000e-01	0.650000	0.709099	0.650000	0.600000																										0				29						c.(1663-1665)gcC>gcT		tripartite motif containing 67							52.0	67.0	62.0					1																	231339743		2036	4178	6214	SO:0001819	synonymous_variant	440730	6	120994	38				g.chr1:231339743C>T	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1665C>T	chr1.hg19:g.231339743C>T		1					TRIM67_ENST00000449018.3_Silent_p.A493A|TRIM67_ENST00000366652.2_Silent_p.A555A|TRIM67_ENST00000444294.3_Silent_p.A553A	p.A555A			1	2	3	2.247887	Q6ZTA4	TRI67_HUMAN		6	1665	+	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)	Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	ENST00000366653.5	1	1	hg19	c.1665C>T	CCDS44333.1	0																																																																																								0.467010		TCGA-US-A77G-01A-11D-A32N-08	0.627	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	1.870000	-3.142781	1	0.420000	NM_001004342		0	32	32	0	241	240	1		1			0	0	56	0	0	1.000000	0	0	0	0	0	0	32	241
PREX1	57580	broad.mit.edu	37	20	47247332	47247332	+	Splice_Site	SNP	C	C	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr20:47247332C>A	ENST00000371941.3	-	36	4549	c.4527G>T	c.(4525-4527)agG>agT	p.R1509S	PREX1_ENST00000396220.1_Splice_Site_p.G1544V	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1509					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGTAAAATGCCCTGCGAGAGA	0.622																																						ENST00000371941.3	1.000000	8.800000e-01	1	9.800000e-01	0.990000	0.989745	0.990000	1.000000																										0				110						c.(4525-4527)agG>agT		phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1							73.0	64.0	67.0					20																	47247332		2203	4300	6503	SO:0001630	splice_region_variant	57580	0	0					g.chr20:47247332C>A	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.4527-1G>T	chr20.hg19:g.47247332C>A		0					PREX1_ENST00000396220.1_Splice_Site_p.G1544V	p.R1509S	NM_020820.3	NP_065871	0	0	0	2.025145	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)	36	4549	-			E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Splice_Site	SNP	ENST00000371941.3	1	0	hg19	c.4527G>T	CCDS13410.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.592|9.592	1.126450|1.126450	0.20959|0.20959	.|.	.|.	ENSG00000124126|ENSG00000124126	ENST00000396220|ENST00000371941	T|T	0.62941|0.65732	-0.01|-0.17	4.32|4.32	4.32|4.32	0.51571|0.51571	4.32|4.32	4.32|4.32	0.51571|0.51571	.|.	.|0.000000	.|0.64402	.|U	.|0.000010	T|T	0.71643|0.71643	0.3364|0.3364	M|M	0.71581|0.71581	2.175|2.175	0.48040|0.48040	D|D	0.999579|0.999579	.|D;D	.|0.58620	.|0.971;0.983	.|P;P	.|0.57324	.|0.78;0.818	T|T	0.75428|0.75428	-0.3321|-0.3321	7|10	0.87932|0.87932	D|D	0|0	.|.	10.5481|10.5481	0.45072|0.45072	0.0:0.9103:0.0:0.0897|0.0:0.9103:0.0:0.0897	.|.	.|1509;806	.|Q8TCU6;Q8TCU6-2	.|PREX1_HUMAN;.	V|S	1544|1509	ENSP00000379522:G1544V|ENSP00000361009:R1509S	ENSP00000379522:G1544V|ENSP00000361009:R1509S	G|R	-|-	2|3	0|2	0|2	PREX1|PREX1	46680739|46680739	46680739|46680739	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.439000|0.439000	0.31926|0.31926	3.607000|3.607000	0.54102|0.54102	1.974000|1.974000	0.57490|0.57490	0.558000|0.558000	0.71614|0.71614	GGG|AGG	0.410090		TCGA-US-A77G-01A-11D-A32N-08	0.622	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	1.870000	-4.544402	1	0.420000	NM_020820	Missense_Mutation	0	70	70	0	227	222	1		1	0		0	0	59	0	0	1.000000	7.219600e-01	0	0	0	10	0	70	227
MC3R	4159	broad.mit.edu	37	20	54824819	54824819	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr20:54824819G>A	ENST00000243911.2	+	1	1032	c.920G>A	c.(919-921)cGc>cAc	p.R307H		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	307					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			CTGGAATTGCGCAACACCTTT	0.517																																						ENST00000243911.2	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.045718	0.030000	0.040000																										0				26						c.(919-921)cGc>cAc		melanocortin 3 receptor							168.0	160.0	163.0					20																	54824819		2203	4300	6503	SO:0001583	missense	4159	0	0					g.chr20:54824819G>A		CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.920G>A	chr20.hg19:g.54824819G>A	ENSP00000243911:p.Arg307His	0						p.R307H	NM_019888.3	NP_063941.3	0	0	0	2.025145	P41968	MC3R_HUMAN	Colorectal(105;0.202)	1	1032	+			Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	0	1	hg19	c.920G>A	CCDS13449.2	0	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520625	0.64747	.	.	ENSG00000124089	ENST00000243911	T	0.58358	0.34	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000014	D	0.82917	0.5141	H	0.97440	4.005	0.51767	D	0.99993	D	0.89917	1.0	D	0.83275	0.996	D	0.89536	0.3789	10	0.87932	D	0	.	18.1096	0.89530	0.0:0.0:1.0:0.0	.	344	P41968	MC3R_HUMAN	H	307	ENSP00000243911:R307H	ENSP00000243911:R307H	R	+	2	0	0	MC3R	54258226	54258226	1.000000	0.71417	0.990000	0.47175	0.182000	0.23217	9.731000	0.98807	2.362000	0.80069	0.555000	0.69702	CGC	0.410090		TCGA-US-A77G-01A-11D-A32N-08	0.517	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2	0	0	1	2	2	2	2	0	0	0	0	152	152	152	152	1	1.870000	-1.752984	0	0.420000			0	7	7	0	810	805	0		1			0	0	152	0	0	0.980208	0	0	0	0	0	0	7	810
PATZ1	23598	broad.mit.edu	37	22	31740473	31740473	+	Silent	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr22:31740473C>T	ENST00000266269.5	-	1	1745	c.1116G>A	c.(1114-1116)cgG>cgA	p.R372R	PATZ1_ENST00000351933.4_Silent_p.R372R|PATZ1_ENST00000405309.3_Silent_p.R372R|AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000215919.3_Silent_p.R372R	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	372					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R372R(2)	EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						ACAGCTTGTGCCGGTTAAGAT	0.582																																						ENST00000266269.5	0.110000	2.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.064621	0.050000	0.060000																									EWSR1/PATZ1(2)	2	Substitution - coding silent(2)	p.R372R(2)	kidney(2)	12						c.(1114-1116)cgG>cgA		POZ (BTB) and AT hook containing zinc finger 1							113.0	108.0	110.0					22																	31740473		2203	4300	6503	SO:0001819	synonymous_variant	23598	1	121412	32				g.chr22:31740473C>T	AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1116G>A	chr22.hg19:g.31740473C>T		0					PATZ1_ENST00000215919.3_Silent_p.R372R|AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000405309.3_Silent_p.R372R|PATZ1_ENST00000351933.4_Silent_p.R372R	p.R372R	NM_014323.2	NP_055138.2	0	0	0	2.045565	Q9HBE1	PATZ1_HUMAN		1	1745	-			Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Silent	SNP	ENST00000266269.5	0	1	hg19	c.1116G>A	CCDS13894.1	0																																																																																								0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.582	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1	0	0	1	2	17	4	2	1	1	1	1	120	120	120	117	1	1.870000	-1.944095	0	0.420000	NM_032052		0	7	7	0	577	569	0		0	0		1	0	120	0	0	0.028322	2.022992e-02	0	0	0	68	0	7	577
CYTH4	27128	broad.mit.edu	37	22	37707094	37707094	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr22:37707094G>A	ENST00000248901.6	+	10	1061	c.874G>A	c.(874-876)Gag>Aag	p.E292K		NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	292	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						CTACTACTTCGAGTTCACCAC	0.612																																						ENST00000248901.6	1.000000	9.400000e-01	1	9.900000e-01	0.990000	0.996423	0.990000	1.000000																										0				15						c.(874-876)Gag>Aag		cytohesin 4							157.0	125.0	136.0					22																	37707094		2203	4300	6503	SO:0001583	missense	27128	1	121412	34				g.chr22:37707094G>A	AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.874G>A	chr22.hg19:g.37707094G>A	ENSP00000248901:p.Glu292Lys	0						p.E292K	NM_013385.3	NP_037517.1	0	0	0	2.045565	Q9UIA0	CYH4_HUMAN		10	1061	+			Q5R3F9|Q9UGT6	Missense_Mutation	SNP	ENST00000248901.6	1	1	hg19	c.874G>A	CCDS13946.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.46|16.46	3.130571|3.130571	0.56828|0.56828	.|.	.|.	ENSG00000100055|ENSG00000100055	ENST00000248901|ENST00000446506	T|.	0.72725|.	-0.68|.	4.7|4.7	4.7|4.7	0.59300|0.59300	4.7|4.7	4.7|4.7	0.59300|0.59300	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.054141|.	0.64402|.	D|.	0.000001|.	T|T	0.46092|0.46092	0.1375|0.1375	N|N	0.10972|0.10972	0.075|0.075	0.80722|0.80722	D|D	1|1	P|.	0.40211|.	0.707|.	B|.	0.32583|.	0.148|.	T|T	0.41680|0.41680	-0.9495|-0.9495	10|5	0.31617|.	T|.	0.26|.	.|.	16.7637|16.7637	0.85519|0.85519	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	292|.	Q9UIA0|.	CYH4_HUMAN|.	K|Q	292|44	ENSP00000248901:E292K|.	ENSP00000248901:E292K|.	E|R	+|+	1|2	0|0	0|0	CYTH4|CYTH4	36037040|36037040	36037040|36037040	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	7.751000|7.751000	0.85126|0.85126	2.309000|2.309000	0.77851|0.77851	0.655000|0.655000	0.94253|0.94253	GAG|CGA	0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.612	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318917.1	1	0	1	2	2	2	2	0	0	0	0	140	140	140	138	1	1.870000	-4.446789	1	0.420000			0	140	135	0	462	458	1		1	0		0	0	140	0	0	1.000000	2.345171e-01	0	0	0	4	0	140	462
ATG9A	79065	broad.mit.edu	37	2	220089227	220089227	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr2:220089227C>T	ENST00000409618.1	-	8	1305	c.866G>A	c.(865-867)cGc>cAc	p.R289H	AC068946.1_ENST00000408417.1_RNA|ATG9A_ENST00000409422.1_Missense_Mutation_p.R228H|ATG9A_ENST00000361242.4_Missense_Mutation_p.R289H|ATG9A_ENST00000488833.1_5'Flank|ATG9A_ENST00000396761.2_Missense_Mutation_p.R289H			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	289					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCACAGGATGCGGTTGCTGAG	0.567																																						ENST00000409618.1	1.000000	7.200000e-01	1	8.500000e-01	0.990000	0.945515	0.990000	1.000000																										0				13						c.(865-867)cGc>cAc		autophagy related 9A							35.0	43.0	40.0					2																	220089227		2073	4194	6267	SO:0001583	missense	79065	1	121004	28				g.chr2:220089227C>T	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.866G>A	chr2.hg19:g.220089227C>T	ENSP00000386710:p.Arg289His	0					ATG9A_ENST00000488833.1_5'Flank|ATG9A_ENST00000396761.2_Missense_Mutation_p.R289H|AC068946.1_ENST00000408417.1_RNA|ATG9A_ENST00000409422.1_Missense_Mutation_p.R228H|ATG9A_ENST00000361242.4_Missense_Mutation_p.R289H	p.R289H			0	0	0	2.036806	Q7Z3C6	ATG9A_HUMAN		8	1305	-		Renal(207;0.0474)	Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Missense_Mutation	SNP	ENST00000409618.1	1	1	hg19	c.866G>A	CCDS42820.1	1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.749084	0.49257	.	.	ENSG00000198925	ENST00000396761;ENST00000409618;ENST00000361242;ENST00000409422	T;T;T;T	0.39592	1.51;1.51;1.51;1.07	5.31	5.31	0.75309	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.58581	0.2132	L	0.46885	1.475	0.50632	D	0.999889	D	0.89917	1.0	D	0.68353	0.957	T	0.55915	-0.8065	10	0.42905	T	0.14	.	18.9912	0.92793	0.0:1.0:0.0:0.0	.	289	Q7Z3C6	ATG9A_HUMAN	H	289;289;289;228	ENSP00000379983:R289H;ENSP00000386710:R289H;ENSP00000355173:R289H;ENSP00000386535:R228H	ENSP00000355173:R289H	R	-	2	0	0	ATG9A	219797471	219797471	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.953000	0.70290	2.481000	0.83766	0.655000	0.94253	CGC	0.415087		TCGA-US-A77G-01A-11D-A32N-08	0.567	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	1	0	1	2	2	2	2	0	0	0	0	31	31	31	30	1	1.870000	-20.000000	1	0.420000	NM_024085		0	32	32	0	118	118	1		1	1		0	0	31	0	0	1.000000	9.999971e-01	0	26	0	54	0	32	118
GMPPA	29926	broad.mit.edu	37	2	220366590	220366590	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr2:220366590C>T	ENST00000358215.3	+	5	629	c.260C>T	c.(259-261)gCc>gTc	p.A87V	GMPPA_ENST00000341142.3_Missense_Mutation_p.A87V|GMPPA_ENST00000373908.1_Missense_Mutation_p.A87V|GMPPA_ENST00000373917.3_Missense_Mutation_p.A87V|AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000313597.5_Missense_Mutation_p.A87V	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	87					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		CAGGAATTTGCCCCCCTAGGC	0.592																																						ENST00000358215.3	0.150000	2.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.084670	0.070000	0.080000																										0				20						c.(259-261)gCc>gTc		GDP-mannose pyrophosphorylase A							74.0	70.0	71.0					2																	220366590		2203	4300	6503	SO:0001583	missense	29926	0	0					g.chr2:220366590C>T	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.260C>T	chr2.hg19:g.220366590C>T	ENSP00000350949:p.Ala87Val	0					GMPPA_ENST00000313597.5_Missense_Mutation_p.A87V|GMPPA_ENST00000373917.3_Missense_Mutation_p.A87V|GMPPA_ENST00000341142.3_Missense_Mutation_p.A87V|AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000373908.1_Missense_Mutation_p.A87V	p.A87V	NM_205847.2	NP_995319.1	0	0	0	2.036806	Q96IJ6	GMPPA_HUMAN		5	629	+		Renal(207;0.0183)	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	0	1	hg19	c.260C>T	CCDS2441.1	0	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284479	0.59867	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000455657;ENST00000435316;ENST00000341142	D;D;D;D;T;T;D	0.93906	-3.31;-3.31;-3.31;-3.31;-0.7;-0.7;-3.31	4.68	3.8	0.43715	4.68	3.8	0.43715	Nucleotidyl transferase (1);	0.270854	0.34338	N	0.004044	D	0.88548	0.6466	L	0.33093	0.98	0.40974	D	0.984729	B;P	0.37276	0.001;0.589	B;B	0.35727	0.008;0.209	D	0.87535	0.2455	10	0.54805	T	0.06	-29.327	12.5741	0.56354	0.0:0.9176:0.0:0.0824	.	87;87	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	V	87;87;87;87;87;52;87	ENSP00000315925:A87V;ENSP00000363027:A87V;ENSP00000350949:A87V;ENSP00000363016:A87V;ENSP00000392465:A87V;ENSP00000411060:A52V;ENSP00000340760:A87V	ENSP00000315925:A87V	A	+	2	0	0	GMPPA	220074834	220074834	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	5.950000	0.70265	0.967000	0.38186	0.561000	0.74099	GCC	0.415087		TCGA-US-A77G-01A-11D-A32N-08	0.592	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	0	0	1	2	16	6	2	1	1	1	1	82	82	82	82	1	1.870000	-2.162292	0	0.420000	NM_013335		0	6	6	0	381	379	0		0	0		1	0	82	0	0	0.023214	1.863027e-02	0	0	0	98	0	6	381
DNMT3A	1788	broad.mit.edu	37	2	25471001	25471001	+	Missense_Mutation	SNP	C	C	T	rs201097136		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr2:25471001C>T	ENST00000264709.3	-	7	1097	c.760G>A	c.(760-762)Gca>Aca	p.A254T	DNMT3A_ENST00000380746.4_Missense_Mutation_p.A65T|DNMT3A_ENST00000321117.5_Missense_Mutation_p.A254T|DNMT3A_ENST00000402667.1_Missense_Mutation_p.A31T	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	254	Interaction with DNMT1 and DNMT3B.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGGGGGATGCGGGGTCAGTG	0.627			"""Mis, F, N, S"""		AML								C|||	1	0.000199681	0.0	0.0	5008	,	,		15713	0.0		0.001	False		,,,				2504	0.0					ENST00000264709.3	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.082646	0.070000	0.080000				Rec	yes			Rec	yes		2	2p23	2p23	1788	Mis, F, N, S	DNA (cytosine-5-)-methyltransferase 3 alpha				L	L			AML		0				1021						c.(760-762)Gca>Aca		DNA (cytosine-5-)-methyltransferase 3 alpha							62.0	65.0	64.0					2																	25471001		2203	4300	6503	SO:0001583	missense	1788	1	121412	28				g.chr2:25471001C>T		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.760G>A	chr2.hg19:g.25471001C>T	ENSP00000264709:p.Ala254Thr	0					DNMT3A_ENST00000380746.4_Missense_Mutation_p.A65T|DNMT3A_ENST00000402667.1_Missense_Mutation_p.A31T|DNMT3A_ENST00000321117.5_Missense_Mutation_p.A254T	p.A254T	NM_175629.2	NP_783328.1	0	0	0	2.044086	Q9Y6K1	DNM3A_HUMAN		7	1097	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	0	1	hg19	c.760G>A	CCDS33157.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	28.5	4.928743	0.92389	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.93366	-3.21;-3.2;-3.2;-3.21	5.63	5.63	0.86233	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.90242	0.6949	N	0.24115	0.695	0.80722	D	1	P;D	0.61080	0.846;0.989	B;P	0.46917	0.071;0.531	D	0.89436	0.3720	10	0.31617	T	0.26	-4.9539	18.2356	0.89948	0.0:1.0:0.0:0.0	.	254;65	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	T	65;254;254;31	ENSP00000370122:A65T;ENSP00000324375:A254T;ENSP00000264709:A254T;ENSP00000384237:A31T	ENSP00000264709:A254T	A	-	1	0	0	DNMT3A	25324505	25324505	1.000000	0.71417	0.319000	0.25293	0.901000	0.52897	7.054000	0.76649	2.653000	0.90120	0.563000	0.77884	GCA	0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.627	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	0	0	1	2	2	2	2	0	0	0	0	108	108	108	106	1	1.870000	-2.001916	0	0.420000	NM_022552		0	8	8	0	505	500	0		1	0		0	0	108	0	0	0.989041	2.263251e-02	0	0	0	13	0	8	505
ASPRV1	151516	broad.mit.edu	37	2	70187919	70187919	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr2:70187919C>T	ENST00000320256.4	-	1	1478	c.902G>A	c.(901-903)cGc>cAc	p.R301H	PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						GGTGCATGTGCGGTGCTCAAA	0.557																																						ENST00000320256.4	0.090000	1.000000e-02	7.000000e-02	2.000000e-02	0.040000	0.050736	0.040000	0.040000																										0				14						c.(901-903)cGc>cAc		aspartic peptidase, retroviral-like 1							175.0	162.0	166.0					2																	70187919		2203	4300	6503	SO:0001583	missense	151516	1	121412	31				g.chr2:70187919C>T	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.902G>A	chr2.hg19:g.70187919C>T	ENSP00000315383:p.Arg301His	0					PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA	p.R301H	NM_152792.2	NP_690005.2	0	0	0	2.044086				1	1478	-				Missense_Mutation	SNP	ENST00000320256.4	0	1	hg19	c.902G>A	CCDS1897.1	0	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418130	0.83449	.	.	ENSG00000244617	ENST00000320256	T	0.51071	0.72	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.000000	0.43110	D	0.000601	T	0.55130	0.1901	N	0.24115	0.695	0.38945	D	0.958225	D	0.89917	1.0	D	0.83275	0.996	T	0.60500	-0.7251	10	0.59425	D	0.04	-16.4374	14.6246	0.68611	0.0:1.0:0.0:0.0	.	301	Q53RT3	APRV1_HUMAN	H	301	ENSP00000315383:R301H	ENSP00000315383:R301H	R	-	2	0	0	ASPRV1	70041423	70041423	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.858000	0.55979	2.530000	0.85305	0.655000	0.94253	CGC	0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.557	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	0	0	1	2	18	2	2	1	1	1	1	162	162	162	162	1	1.870000	-2.114061	0	0.420000	NM_152792		0	8	8	0	832	821	0		0	0		1	0	162	0	0	0.033767	3.370029e-03	0	0	0	8	0	8	832
EFHD1	80303	broad.mit.edu	37	2	233546356	233546356	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr2:233546356G>A	ENST00000264059.3	+	4	1124	c.647G>A	c.(646-648)cGg>cAg	p.R216Q	snoU13_ENST00000459149.1_RNA|EFHD1_ENST00000409613.1_Missense_Mutation_p.R120Q|EFHD1_ENST00000410095.1_Missense_Mutation_p.R104Q|EFHD1_ENST00000409708.1_Missense_Mutation_p.R104Q	NM_025202.3	NP_079478.1	Q9BUP0	EFHD1_HUMAN	EF-hand domain family, member D1	216					neuron projection development (GO:0031175)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|large_intestine(2)|lung(3)	7		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)		CAAGATGAGCGGAAGCGGGAG	0.542																																						ENST00000264059.3	0.090000	0	7.000000e-02	2.000000e-02	0.040000	0.049979	0.040000	0.040000																										0				7						c.(646-648)cGg>cAg		EF-hand domain family, member D1							108.0	98.0	101.0					2																	233546356		2203	4300	6503	SO:0001583	missense	80303	3	121412	40				g.chr2:233546356G>A		CCDS2497.1, CCDS58755.1	2q37.1	2014-07-01	2005-01-25		ENSG00000115468	ENSG00000115468		"""EF-hand domain containing"""	29556	protein-coding gene	gene with protein product	"""swiprosin-2"""	611617	"""EF hand domain containing 1"""			21244694	Standard	NM_025202		Approved	FLJ13612	uc002vtc.3	Q9BUP0	OTTHUMG00000133263	ENST00000264059.3:c.647G>A	chr2.hg19:g.233546356G>A	ENSP00000264059:p.Arg216Gln	0					snoU13_ENST00000459149.1_RNA|EFHD1_ENST00000409708.1_Missense_Mutation_p.R104Q|EFHD1_ENST00000409613.1_Missense_Mutation_p.R120Q|EFHD1_ENST00000410095.1_Missense_Mutation_p.R104Q	p.R216Q	NM_025202.3	NP_079478.1	0	0	0	2.031970	Q9BUP0	EFHD1_HUMAN		4	1124	+		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)	B2RD83|E9PFH3|Q9BTF8|Q9H8I2|Q9HBQ0	Missense_Mutation	SNP	ENST00000264059.3	0	1	hg19	c.647G>A	CCDS2497.1	0	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827702	0.90955	.	.	ENSG00000115468	ENST00000409613;ENST00000264059;ENST00000540187;ENST00000409708;ENST00000410095	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.65	3.7	0.42460	5.65	3.7	0.42460	.	0.332624	0.29715	N	0.011387	T	0.37376	0.1001	L	0.58302	1.8	0.58432	D	0.999998	P;P	0.44006	0.824;0.824	B;B	0.38156	0.121;0.266	T	0.34104	-0.9842	10	0.52906	T	0.07	-5.5142	11.0327	0.47783	0.0:0.14:0.7149:0.1451	.	120;216	E9PFH3;Q9BUP0	.;EFHD1_HUMAN	Q	120;216;119;104;104	ENSP00000386556:R120Q;ENSP00000264059:R216Q;ENSP00000386243:R104Q;ENSP00000386685:R104Q	ENSP00000264059:R216Q	R	+	2	0	0	EFHD1	233254600	233254600	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	1.562000	0.36353	1.362000	0.46000	0.586000	0.80456	CGG	0.415087		TCGA-US-A77G-01A-11D-A32N-08	0.542	EFHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257040.2	0	0	1	2	16	2	2	1	1	1	1	122	122	122	122	1	1.870000	-2.455305	0	0.420000	NM_025202		0	5	6	0	557	547	0		0	0		1	0	122	0	0	0.011331	1.924871e-02	0	0	0	19	0	5	557
ATP2B2	491	broad.mit.edu	37	3	10417285	10417285	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr3:10417285G>A	ENST00000352432.4	-	10	1314	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y	ATP2B2_ENST00000360273.2_Silent_p.Y415Y|ATP2B2_ENST00000397077.1_Silent_p.Y370Y|ATP2B2_ENST00000383800.4_Silent_p.Y370Y|ATP2B2_ENST00000343816.4_Silent_p.Y401Y			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	415					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CCACAGTGAAGTAGAGCACCA	0.557																																					Ovarian(125;1619 1709 15675 19819 38835)	ENST00000352432.4	1.000000	8.700000e-01	1	9.900000e-01	0.990000	0.989672	0.990000	1.000000																										0				74						c.(1243-1245)taC>taT		ATPase, Ca++ transporting, plasma membrane 2							76.0	63.0	67.0					3																	10417285		2203	4300	6503	SO:0001819	synonymous_variant	491	0	0					g.chr3:10417285G>A	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1245C>T	chr3.hg19:g.10417285G>A		0					ATP2B2_ENST00000397077.1_Silent_p.Y370Y|ATP2B2_ENST00000383800.4_Silent_p.Y370Y|ATP2B2_ENST00000360273.2_Silent_p.Y415Y|ATP2B2_ENST00000343816.4_Silent_p.Y401Y	p.Y415Y			0	0	0	2.047916	Q01814	AT2B2_HUMAN		10	1314	-			O00766|Q12994|Q16818	Silent	SNP	ENST00000352432.4	1	1	hg19	c.1245C>T	CCDS33701.1	1																																																																																								0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.557	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	1.870000	-20.000000	1	0.420000	NM_001683		0	54	54	0	173	171	1		1			0	0	53	0	0	1.000000	0	0	0	0	0	0	54	173
OXNAD1	92106	broad.mit.edu	37	3	16312479	16312479	+	Missense_Mutation	SNP	T	T	G			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr3:16312479T>G	ENST00000285083.5	+	3	485	c.20T>G	c.(19-21)aTg>aGg	p.M7R	OXNAD1_ENST00000544043.1_Missense_Mutation_p.M25R|OXNAD1_ENST00000606098.1_Missense_Mutation_p.M7R|OXNAD1_ENST00000605932.1_Missense_Mutation_p.M7R|OXNAD1_ENST00000435829.2_Missense_Mutation_p.M25R	NM_138381.3	NP_612390.1	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	7						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	13						GCTGCTGTTATGATTCCTGGG	0.458																																						ENST00000285083.5	1.000000	8.500000e-01	1	9.100000e-01	0.980000	0.967673	0.980000	1.000000																										0				13						c.(19-21)aTg>aGg		oxidoreductase NAD-binding domain containing 1							201.0	188.0	193.0					3																	16312479		2203	4300	6503	SO:0001583	missense	92106	1	121412	36				g.chr3:16312479T>G	AL832787	CCDS2630.1	3p25-p24	2010-03-19			ENSG00000154814	ENSG00000154814			25128	protein-coding gene	gene with protein product						12477932	Standard	NM_138381		Approved	MGC15763	uc003caw.3	Q96HP4	OTTHUMG00000129867	ENST00000285083.5:c.20T>G	chr3.hg19:g.16312479T>G	ENSP00000285083:p.Met7Arg	0					OXNAD1_ENST00000435829.2_Missense_Mutation_p.M25R|OXNAD1_ENST00000544043.1_Missense_Mutation_p.M25R|OXNAD1_ENST00000605932.1_Missense_Mutation_p.M7R|OXNAD1_ENST00000606098.1_Missense_Mutation_p.M7R	p.M7R	NM_138381.3	NP_612390.1	0	0	0	2.047916	Q96HP4	OXND1_HUMAN		3	485	+			Q2HYC7|Q59FA4	Missense_Mutation	SNP	ENST00000285083.5	1	1	hg19	c.20T>G	CCDS2630.1	1	.	.	.	.	.	.	.	.	.	.	T	10.50	1.366861	0.24771	.	.	ENSG00000154814	ENST00000285083;ENST00000435829;ENST00000544043	T;T;T	0.22134	2.29;1.97;2.25	5.07	2.62	0.31277	5.07	2.62	0.31277	.	1.342610	0.04581	N	0.394909	T	0.21590	0.0520	L	0.36672	1.1	0.09310	N	1	B;B	0.22683	0.073;0.044	B;B	0.25405	0.06;0.027	T	0.36456	-0.9747	10	0.72032	D	0.01	-16.2189	9.2363	0.37468	0.0:0.0:0.3581:0.6419	.	25;7	F5H620;Q96HP4	.;OXND1_HUMAN	R	7;7;25	ENSP00000285083:M7R;ENSP00000389872:M7R;ENSP00000437967:M25R	ENSP00000285083:M7R	M	+	2	0	0	OXNAD1	16287483	16287483	0.009000	0.17119	0.002000	0.10522	0.181000	0.23173	0.823000	0.27366	0.377000	0.24735	-0.313000	0.08912	ATG	0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.458	OXNAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252109.1	1	0	1	2	2	2	2	0	0	0	0	134	134	134	133	1	1.870000	-20.000000	1	0.420000	NM_138381		0	155	154	0	587	576	1		1	1		0	0	134	0	0	1.000000	9.914238e-01	0	15	0	15	0	155	587
SCN5A	6331	broad.mit.edu	37	3	38639417	38639417	+	Missense_Mutation	SNP	G	G	A	rs199473580		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr3:38639417G>A	ENST00000333535.4	-	14	2214	c.2065C>T	c.(2065-2067)Cgt>Tgt	p.R689C	SCN5A_ENST00000414099.2_Missense_Mutation_p.R689C|SCN5A_ENST00000443581.1_Missense_Mutation_p.R689C|SCN5A_ENST00000425664.1_Missense_Mutation_p.R689C|SCN5A_ENST00000450102.2_Missense_Mutation_p.R689C|SCN5A_ENST00000449557.2_Missense_Mutation_p.R689C|SCN5A_ENST00000451551.2_Missense_Mutation_p.R689C|SCN5A_ENST00000413689.1_Missense_Mutation_p.R689C|SCN5A_ENST00000423572.2_Missense_Mutation_p.R689C|SCN5A_ENST00000455624.2_Missense_Mutation_p.R689C			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	689					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TGGGCGAGACGGTTCCAGCAT	0.532																																						ENST00000333535.4	1.000000	6.600000e-01	9.300000e-01	7.400000e-01	0.830000	0.838319	0.830000	1.000000																										0				107						c.(2065-2067)Cgt>Tgt		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						115.0	120.0	119.0					3																	38639417		2133	4234	6367	SO:0001583	missense	6331	2	121132	34				g.chr3:38639417G>A	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2065C>T	chr3.hg19:g.38639417G>A	ENSP00000328968:p.Arg689Cys	0					SCN5A_ENST00000450102.2_Missense_Mutation_p.R689C|SCN5A_ENST00000451551.2_Missense_Mutation_p.R689C|SCN5A_ENST00000413689.1_Missense_Mutation_p.R689C|SCN5A_ENST00000423572.2_Missense_Mutation_p.R689C|SCN5A_ENST00000455624.2_Missense_Mutation_p.R689C|SCN5A_ENST00000443581.1_Missense_Mutation_p.R689C|SCN5A_ENST00000425664.1_Missense_Mutation_p.R689C|SCN5A_ENST00000449557.2_Missense_Mutation_p.R689C|SCN5A_ENST00000414099.2_Missense_Mutation_p.R689C	p.R689C			0	0	0	2.047916	Q14524	SCN5A_HUMAN		14	2214	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	1	1	hg19	c.2065C>T	CCDS46796.1	0	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304276	0.40795	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96300	-3.88;-3.91;-3.91;-3.91;-3.91;-3.88;-3.91;-3.97;-3.91;-3.91	4.9	4.9	0.64082	4.9	4.9	0.64082	.	1.137170	0.06183	N	0.679836	D	0.97785	0.9273	M	0.80183	2.485	0.44603	D	0.997576	D;D;D;D;D;D;D	0.71674	0.978;0.991;0.987;0.978;0.978;0.998;0.987	B;B;P;B;B;P;P	0.52710	0.328;0.328;0.528;0.328;0.328;0.707;0.528	D	0.94661	0.7848	10	0.87932	D	0	.	18.2549	0.90016	0.0:0.0:1.0:0.0	.	689;689;689;689;689;689;689	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	C	689	ENSP00000398962:R689C;ENSP00000398266:R689C;ENSP00000410257:R689C;ENSP00000388797:R689C;ENSP00000397915:R689C;ENSP00000416634:R689C;ENSP00000328968:R689C;ENSP00000399524:R689C;ENSP00000403355:R689C;ENSP00000413996:R689C	ENSP00000328968:R689C	R	-	1	0	0	SCN5A	38614421	38614421	0.134000	0.22483	0.982000	0.44146	0.405000	0.30901	1.004000	0.29822	2.563000	0.86464	0.491000	0.48974	CGT	0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.532	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	1.870000	-2.980424	1	0.420000	NM_198056		0	68	68	0	318	315	1		1			0	0	91	0	0	1.000000	0	0	0	0	0	0	68	318
PTPN23	25930	broad.mit.edu	37	3	47452686	47452686	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr3:47452686C>T	ENST00000265562.4	+	20	3475	c.3398C>T	c.(3397-3399)tCt>tTt	p.S1133F	PTPN23_ENST00000431726.1_Missense_Mutation_p.S1007F	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1133					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGCACTCAGTCTCCTGGGGGT	0.711																																						ENST00000265562.4	1.000000	7.100000e-01	1	8.700000e-01	0.990000	0.954746	0.990000	1.000000																										0				23						c.(3397-3399)tCt>tTt		protein tyrosine phosphatase, non-receptor type 23							7.0	9.0	8.0					3																	47452686		2134	4220	6354	SO:0001583	missense	25930	0	0					g.chr3:47452686C>T	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.3398C>T	chr3.hg19:g.47452686C>T	ENSP00000265562:p.Ser1133Phe	0					PTPN23_ENST00000431726.1_Missense_Mutation_p.S1007F	p.S1133F	NM_015466.2	NP_056281.1	0	0	0	2.047916	Q9H3S7	PTN23_HUMAN		20	3475	+			A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	1	1	hg19	c.3398C>T	CCDS2754.1	1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.109780	0.37242	.	.	ENSG00000076201	ENST00000265562	T	0.02631	4.22	5.3	4.37	0.52481	5.3	4.37	0.52481	.	0.135690	0.49916	D	0.000126	T	0.02083	0.0065	N	0.08118	0	0.22701	N	0.998834	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.48736	-0.9009	10	0.33141	T	0.24	-6.0248	14.322	0.66491	0.0:0.8504:0.1496:0.0	.	1007;1133	B4DST5;Q9H3S7	.;PTN23_HUMAN	F	1133	ENSP00000265562:S1133F	ENSP00000265562:S1133F	S	+	2	0	0	PTPN23	47427690	47427690	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	2.033000	0.41136	2.468000	0.83385	0.563000	0.77884	TCT	0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.711	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	1	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	1.870000	-20.000000	1	0.420000	NM_015466		0	23	23	0	80	80	0		1	1		0	0	30	0	0	1.000000	9.999977e-01	0	31	0	54	0	23	80
DNAH1	25981	broad.mit.edu	37	3	52383089	52383089	+	Silent	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr3:52383089C>T	ENST00000420323.2	+	13	2553	c.2292C>T	c.(2290-2292)tcC>tcT	p.S764S		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	764	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACATTGCCTCCTTTCTCAAGT	0.577																																						ENST00000420323.2	1.000000	7.800000e-01	1	8.900000e-01	0.990000	0.961789	0.990000	1.000000																										0				62						c.(2290-2292)tcC>tcT		dynein, axonemal, heavy chain 1							129.0	131.0	130.0					3																	52383089		2193	4279	6472	SO:0001819	synonymous_variant	25981	0	0					g.chr3:52383089C>T	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.2292C>T	chr3.hg19:g.52383089C>T		0						p.S764S	NM_015512.4	NP_056327	0	0	0	2.047916	Q9P2D7	DYH1_HUMAN		13	2553	+			B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	1	1	hg19	c.2292C>T	CCDS46842.1	1																																																																																								0.417554		TCGA-US-A77G-01A-11D-A32N-08	0.577	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	1	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	1.870000	-3.802473	1	0.420000	NM_015512		0	52	52	0	190	189	1		1	1		0	0	55	0	0	1.000000	2.988486e-01	0	4	0	1	0	52	190
TLR1	7096	broad.mit.edu	37	4	38799732	38799732	+	Nonsense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr4:38799732G>A	ENST00000502213.2	-	3	950	c.721C>T	c.(721-723)Caa>Taa	p.Q241*	TLR1_ENST00000308979.2_Nonsense_Mutation_p.Q241*			Q15399	TLR1_HUMAN	toll-like receptor 1	241					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						GGATTTGTTTGAAGTTTCGCC	0.348																																					GBM(5;216 373 40795 46382)	ENST00000502213.2	1.000000	8.300000e-01	1	9.500000e-01	0.990000	0.982638	0.990000	1.000000																										0				28						c.(721-723)Caa>Taa		toll-like receptor 1							59.0	65.0	63.0					4																	38799732		2203	4299	6502	SO:0001587	stop_gained	7096	0	0					g.chr4:38799732G>A	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.721C>T	chr4.hg19:g.38799732G>A	ENSP00000421259:p.Gln241*	0					TLR1_ENST00000308979.2_Nonsense_Mutation_p.Q241*	p.Q241*			0	0	0	2.055408	Q15399	TLR1_HUMAN		3	950	-			D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Nonsense_Mutation	SNP	ENST00000502213.2	0	1	hg19	c.721C>T	CCDS33973.1	1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798266	0.70567	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	.	.	.	4.69	0.633	0.17712	4.69	0.633	0.17712	.	1.133800	0.06641	N	0.761075	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	9.2911	0.37786	0.0:0.11:0.2678:0.6222	.	.	.	.	X	241	.	ENSP00000354932:Q241X	Q	-	1	0	0	TLR1	38476127	38476127	0.050000	0.20438	0.077000	0.20336	0.001000	0.01503	0.818000	0.27295	0.259000	0.21709	-0.169000	0.13324	CAA	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.348	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	1.870000	-20.000000	1	0.420000			0	49	48	0	164	162	1		1	1		0	0	36	0	0	1.000000	3.307641e-01	0	2	0	3	0	49	164
TMPRSS11E	28983	broad.mit.edu	37	4	69337338	69337338	+	Missense_Mutation	SNP	A	A	G			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr4:69337338A>G	ENST00000305363.4	+	5	551	c.487A>G	c.(487-489)Aaa>Gaa	p.K163E		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	163	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						AGTTAAAATTAAAAGTAAGTT	0.308																																						ENST00000305363.4	1.000000	7.000000e-01	9.300000e-01	7.700000e-01	0.840000	0.854301	0.840000	0.850000																										0				24						c.(487-489)Aaa>Gaa		transmembrane protease, serine 11E							76.0	81.0	79.0					4																	69337338		2203	4298	6501	SO:0001583	missense	28983	0	0					g.chr4:69337338A>G	AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.487A>G	chr4.hg19:g.69337338A>G	ENSP00000307519:p.Lys163Glu	0						p.K163E	NM_014058.3	NP_054777.2	0	0	0	2.055408	Q9UL52	TM11E_HUMAN		5	551	+			A6NL71|Q14DC8|Q6UW31	Missense_Mutation	SNP	ENST00000305363.4	1	1	hg19	c.487A>G	CCDS33993.1	0	.	.	.	.	.	.	.	.	.	.	A	8.476	0.858592	0.17178	.	.	ENSG00000087128	ENST00000305363	T	0.31769	1.48	5.83	5.83	0.93111	5.83	5.83	0.93111	.	0.391906	0.21879	N	0.067776	T	0.19765	0.0475	L	0.27053	0.805	0.31370	N	0.680243	P	0.37781	0.608	B	0.35413	0.202	T	0.09662	-1.0664	10	0.10111	T	0.7	.	12.5838	0.56406	1.0:0.0:0.0:0.0	.	163	Q9UL52	TM11E_HUMAN	E	163	ENSP00000307519:K163E	ENSP00000307519:K163E	K	+	1	0	0	TMPRSS11E	69019933	69019933	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	3.137000	0.50562	2.229000	0.72834	0.482000	0.46254	AAA	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.308	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360584.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	1.870000	-20.000000	1	0.420000	NM_014058		0	102	101	0	468	462	1		1			0	0	77	0	0	1.000000	0	0	0	0	0	0	102	468
PCDH18	54510	broad.mit.edu	37	4	138449640	138449640	+	Missense_Mutation	SNP	A	A	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr4:138449640A>T	ENST00000344876.4	-	3	3118	c.2732T>A	c.(2731-2733)aTt>aAt	p.I911N	PCDH18_ENST00000511115.1_Missense_Mutation_p.I91N|PCDH18_ENST00000412923.2_Missense_Mutation_p.I910N|PCDH18_ENST00000510305.1_Missense_Mutation_p.I122N|PCDH18_ENST00000507846.1_Missense_Mutation_p.I690N	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	911	Interaction with DAB1. {ECO:0000250}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					ACCTGCTGGAATTCTTCCATC	0.403																																						ENST00000344876.4	1.000000	8.600000e-01	1	9.200000e-01	0.980000	0.971106	0.980000	1.000000																										0				86						c.(2731-2733)aTt>aAt		protocadherin 18							141.0	156.0	151.0					4																	138449640		2203	4300	6503	SO:0001583	missense	54510	0	0					g.chr4:138449640A>T	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2732T>A	chr4.hg19:g.138449640A>T	ENSP00000355082:p.Ile911Asn	0					PCDH18_ENST00000507846.1_Missense_Mutation_p.I690N|PCDH18_ENST00000511115.1_Missense_Mutation_p.I91N|PCDH18_ENST00000412923.2_Missense_Mutation_p.I910N|PCDH18_ENST00000510305.1_Missense_Mutation_p.I122N	p.I911N	NM_019035.3	NP_061908.1	1	2	3	2.070103	Q9HCL0	PCD18_HUMAN		3	3118	-	all_hematologic(180;0.24)		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	1	1	hg19	c.2732T>A	CCDS34064.1	1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.410409	0.42715	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305;ENST00000511115	T;T;T;T;T	0.52754	0.74;0.74;0.65;1.57;1.57	5.56	4.38	0.52667	5.56	4.38	0.52667	.	0.000000	0.43747	D	0.000521	T	0.37571	0.1008	L	0.40543	1.245	0.34420	D	0.697313	B;B;B;B	0.10296	0.003;0.0;0.001;0.001	B;B;B;B	0.08055	0.003;0.0;0.001;0.0	T	0.42327	-0.9458	10	0.28530	T	0.3	.	11.4281	0.50022	0.9295:0.0:0.0705:0.0	.	91;690;910;911	B4DLR6;D6RIG4;Q9HCL0-2;Q9HCL0	.;.;.;PCD18_HUMAN	N	911;910;690;122;91	ENSP00000355082:I911N;ENSP00000390688:I910N;ENSP00000425903:I690N;ENSP00000424269:I122N;ENSP00000425647:I91N	ENSP00000355082:I911N	I	-	2	0	0	PCDH18	138669090	138669090	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	6.178000	0.71968	0.943000	0.37553	0.533000	0.62120	ATT	0.422426		TCGA-US-A77G-01A-11D-A32N-08	0.403	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	1	0	1	2	2	2	2	0	0	0	0	171	171	171	170	1	1.870000	-20.000000	1	0.420000	NM_019035		0	191	186	0	730	715	1		1	0		0	0	171	0	0	1.000000	3.642832e-01	0	0	0	6	0	191	730
SLC6A18	348932	broad.mit.edu	37	5	1244416	1244416	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:1244416C>T	ENST00000324642.3	+	10	1547	c.1424C>T	c.(1423-1425)gCc>gTc	p.A475V	SLC6A18_ENST00000296821.4_Missense_Mutation_p.A373V	NM_182632.2	NP_872438.2	Q96N87	S6A18_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 18	475					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(4)|upper_aerodigestive_tract(1)	34	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GACAATTTTGCCGCTTCCCCG	0.582																																						ENST00000324642.3	0.090000	0	7.000000e-02	2.000000e-02	0.040000	0.048496	0.040000	0.040000																										0				34						c.(1423-1425)gCc>gTc		solute carrier family 6 (neutral amino acid transporter), member 18							147.0	147.0	147.0					5																	1244416		2203	4300	6503	SO:0001583	missense	348932	0	0					g.chr5:1244416C>T	AK055798	CCDS3860.1	5p15	2013-07-19	2013-07-19		ENSG00000164363	ENSG00000164363		"""Solute carriers"""	26441	protein-coding gene	gene with protein product		610300	"""solute carrier family 6 (neurotransmitter transporter), member 18"", ""solute carrier family 6, member 18"""			19478081	Standard	NM_182632		Approved	FLJ31236, Xtrp2	uc003jby.2	Q96N87	OTTHUMG00000090356	ENST00000324642.3:c.1424C>T	chr5.hg19:g.1244416C>T	ENSP00000323549:p.Ala475Val	0					SLC6A18_ENST00000296821.4_Missense_Mutation_p.A373V	p.A475V	NM_182632.2	NP_872438.2	0	0	0	2.055894	Q96N87	S6A18_HUMAN	Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)	10	1547	+	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)			Missense_Mutation	SNP	ENST00000324642.3	0	1	hg19	c.1424C>T	CCDS3860.1	0	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975383	0.34848	.	.	ENSG00000164363	ENST00000324642;ENST00000296821	T;T	0.76578	-1.03;-1.03	4.87	-1.66	0.08265	4.87	-1.66	0.08265	.	0.373560	0.27126	N	0.020814	T	0.58177	0.2104	N	0.21617	0.685	0.09310	N	1	B	0.16802	0.019	B	0.15052	0.012	T	0.49341	-0.8950	10	0.87932	D	0	.	5.9492	0.19235	0.0:0.3423:0.141:0.5167	.	475	Q96N87	S6A18_HUMAN	V	475;373	ENSP00000323549:A475V;ENSP00000296821:A373V	ENSP00000296821:A373V	A	+	2	0	0	SLC6A18	1297416	1297416	0.226000	0.23696	0.000000	0.03702	0.001000	0.01503	0.643000	0.24750	-0.361000	0.08125	-1.036000	0.02392	GCC	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.582	SLC6A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206728.3	0	0	1	2	2	2	2	0	0	0	0	112	112	112	111	1	1.870000	-1.823947	0	0.420000	NM_182632		0	6	6	0	677	668	0		1			0	0	112	0	0	0.963618	0	0	0	0	0	0	6	677
CHSY3	337876	broad.mit.edu	37	5	129520070	129520070	+	Missense_Mutation	SNP	G	G	A	rs140992502		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:129520070G>A	ENST00000305031.4	+	3	1593	c.1235G>A	c.(1234-1236)cGc>cAc	p.R412H	CHSY3_ENST00000507545.1_3'UTR	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	412					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		ATGCTCAGCCGCAAAATTTCT	0.478																																						ENST00000305031.4	0.160000	2.000000e-02	1.200000e-01	5.000000e-02	0.070000	0.089023	0.070000	0.080000																										0				28						c.(1234-1236)cGc>cAc		chondroitin sulfate synthase 3		G	HIS/ARG	0,4406		0,0,2203	98.0	89.0	92.0		1235	4.5	1.0	5	dbSNP_134	92	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CHSY3	NM_175856.4	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	412/883	129520070	2,13004	2203	4300	6503	SO:0001583	missense	337876	22	121412	45				g.chr5:129520070G>A	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1235G>A	chr5.hg19:g.129520070G>A	ENSP00000302629:p.Arg412His	0					CHSY3_ENST00000507545.1_3'UTR	p.R412H	NM_175856.4	NP_787052.3	0	0	0	2.055894	Q70JA7	CHSS3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	3	1593	+		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	0	1	hg19	c.1235G>A	CCDS34223.1	0	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647807	0.87958	0.0	2.33E-4	ENSG00000198108	ENST00000305031	T	0.15834	2.39	4.5	4.5	0.54988	4.5	4.5	0.54988	.	0.000000	0.64402	D	0.000016	T	0.27241	0.0668	M	0.65975	2.015	0.80722	D	1	P	0.48998	0.918	P	0.45998	0.5	T	0.03017	-1.1082	9	.	.	.	-2.8659	18.5119	0.90920	0.0:0.0:1.0:0.0	.	412	Q70JA7	CHSS3_HUMAN	H	412	ENSP00000302629:R412H	.	R	+	2	0	0	CHSY3	129547969	129547969	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.601000	0.98297	2.779000	0.95612	0.650000	0.86243	CGC	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.478	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	0	0	1	2	19	2	2	0	0	0	1	64	64	64	64	1	1.870000	-2.305597	0	0.420000	NM_175856		0	6	7	0	365	364	0		0	0		0	0	64	0	0	0.006403	0	0	0	0	1	0	6	365
PCDHA7	56141	broad.mit.edu	37	5	140216008	140216008	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:140216008G>A	ENST00000525929.1	+	1	2040	c.2040G>A	c.(2038-2040)tcG>tcA	p.S680S	PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000378125.3_Silent_p.S680S|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	680					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCGTCGTCGCGGGCATCGT	0.622																																					NSCLC(160;258 2013 5070 22440 28951)	ENST00000525929.1	1.000000	7.200000e-01	9.700000e-01	8.000000e-01	0.880000	0.887558	0.880000	1.000000																										0				63						c.(2038-2040)tcG>tcA		protocadherin alpha 7							89.0	82.0	84.0					5																	140216008		2203	4299	6502	SO:0001819	synonymous_variant	56141	0	0					g.chr5:140216008G>A	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2040G>A	chr5.hg19:g.140216008G>A		0					PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000378125.3_Silent_p.S680S|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron	p.S680S	NM_018910.2	NP_061733.1	0	0	0	2.055894	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2040	+			O75282	Silent	SNP	ENST00000525929.1	1	1	hg19	c.2040G>A	CCDS54918.1	1																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.622	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	1	0	1	2	2	2	2	0	0	0	0	107	107	107	105	1	1.870000	-20.000000	1	0.420000	NM_018910		0	89	88	0	388	381	1		1			0	0	107	0	0	1.000000	0	0	0	0	0	0	89	388
PCDHA8	56140	broad.mit.edu	37	5	140221029	140221029	+	Silent	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:140221029C>T	ENST00000531613.1	+	1	123	c.123C>T	c.(121-123)caC>caT	p.H41H	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.H41H|PCDHA3_ENST00000522353.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	41	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCCAAACACGGCACCTTCG	0.672																																						ENST00000531613.1	0.600000	3.300000e-01	5.300000e-01	3.900000e-01	0.460000	0.469365	0.460000	0.460000																										0				78						c.(121-123)caC>caT		protocadherin alpha 8							44.0	51.0	48.0					5																	140221029		2202	4299	6501	SO:0001819	synonymous_variant	56140	0	0					g.chr5:140221029C>T	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.123C>T	chr5.hg19:g.140221029C>T		0					PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000378123.3_Silent_p.H41H|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron	p.H41H	NM_018911.2	NP_061734.1	0	0	0	2.055894	Q9Y5H6	PCDA8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	123	+			B9EGT7|O75281	Silent	SNP	ENST00000531613.1	1	1	hg19	c.123C>T	CCDS54919.1	0																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.672	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	1	0	1	2	2	2	2	0	0	0	0	109	109	109	127	1	1.870000	-20.000000	1	0.420000	NM_018911		0	43	40	0	400	387	1		1			0	0	109	0	0	1.000000	0	0	0	0	0	0	43	400
PCDHGA8	9708	broad.mit.edu	37	5	140773877	140773877	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:140773877G>A	ENST00000398604.2	+	1	1497	c.1497G>A	c.(1495-1497)gcG>gcA	p.A499A	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	499	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAGGGGGCGCCCCTGTCCT	0.562																																						ENST00000398604.2	1.000000	7.500000e-01	1	8.600000e-01	0.990000	0.949281	0.990000	1.000000																										0				51						c.(1495-1497)gcG>gcA		protocadherin gamma subfamily A, 8							45.0	52.0	50.0					5																	140773877		2164	4284	6448	SO:0001819	synonymous_variant	9708	0	0					g.chr5:140773877G>A	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1497G>A	chr5.hg19:g.140773877G>A		0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	p.A499A	NM_032088.1	NP_114477.1	0	0	0	2.055894	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1497	+			A7MCZ4|O15039	Silent	SNP	ENST00000398604.2	1	1	hg19	c.1497G>A	CCDS47291.1	1																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.562	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	43	1	1.870000	-20.000000	1	0.420000	NM_032088		0	47	46	0	178	178	1		1	0		0	0	44	0	0	1.000000	0	0	1	0	0	0	47	178
FAM71B	153745	broad.mit.edu	37	5	156589868	156589868	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:156589868C>T	ENST00000302938.4	-	2	1503	c.1408G>A	c.(1408-1410)Gca>Aca	p.A470T		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	470						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGCCAGATGCGGACCGGTGG	0.532																																						ENST00000302938.4	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.044875	0.030000	0.040000																										0				68						c.(1408-1410)Gca>Aca		family with sequence similarity 71, member B							204.0	194.0	197.0					5																	156589868		2203	4300	6503	SO:0001583	missense	153745	1	121412	34				g.chr5:156589868C>T		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1408G>A	chr5.hg19:g.156589868C>T	ENSP00000305596:p.Ala470Thr	0						p.A470T	NM_130899.2	NP_570969.2	0	0	0	2.055894	Q8TC56	FA71B_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	2	1503	-	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	0	1	hg19	c.1408G>A	CCDS4335.1	0	.	.	.	.	.	.	.	.	.	.	C	9.219	1.032795	0.19590	.	.	ENSG00000170613	ENST00000302938	T	0.19806	2.12	4.64	-9.28	0.00656	4.64	-9.28	0.00656	.	1.737350	0.03907	N	0.281301	T	0.06735	0.0172	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.22906	-1.0203	10	0.23302	T	0.38	0.0025	4.3119	0.10974	0.1338:0.5568:0.1468:0.1627	.	470	Q8TC56	FA71B_HUMAN	T	470	ENSP00000305596:A470T	ENSP00000305596:A470T	A	-	1	0	0	FAM71B	156522446	156522446	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.937000	0.01547	-2.061000	0.00892	-1.268000	0.01426	GCA	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.532	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	0	0	1	2	2	2	2	0	0	0	0	153	153	153	152	1	1.870000	-2.015480	0	0.420000	NM_130899		0	6	6	0	731	719	0		1			0	0	153	0	0	0.963244	0	0	0	0	0	0	6	731
ENC1	8507	broad.mit.edu	37	5	73931388	73931388	+	Missense_Mutation	SNP	T	T	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:73931388T>A	ENST00000302351.4	-	2	2053	c.923A>T	c.(922-924)gAc>gTc	p.D308V	ENC1_ENST00000510316.1_Missense_Mutation_p.D235V|ENC1_ENST00000537006.1_Missense_Mutation_p.D308V	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	308					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		ATACAACTTGTCACACATGAA	0.498																																						ENST00000302351.4	1.000000	6.800000e-01	9.700000e-01	7.700000e-01	0.860000	0.871506	0.860000	1.000000																										0				20						c.(922-924)gAc>gTc		ectodermal-neural cortex 1 (with BTB domain)							95.0	99.0	97.0					5																	73931388		2203	4300	6503	SO:0001583	missense	8507	0	0					g.chr5:73931388T>A	AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.923A>T	chr5.hg19:g.73931388T>A	ENSP00000306356:p.Asp308Val	0					ENC1_ENST00000537006.1_Missense_Mutation_p.D308V|ENC1_ENST00000510316.1_Missense_Mutation_p.D235V	p.D308V	NM_003633.3	NP_003624.1	0	0	0	2.055894	O14682	ENC1_HUMAN		2	2053	-		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)	B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	ENST00000302351.4	1	1	hg19	c.923A>T	CCDS4021.1	1	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863395	0.71949	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	T;T;T	0.66280	-0.2;-0.2;-0.2	6.04	6.04	0.98038	6.04	6.04	0.98038	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.68732	0.3033	L	0.55990	1.75	0.80722	D	1	P	0.51351	0.944	P	0.52343	0.696	T	0.66548	-0.5896	10	0.33940	T	0.23	.	16.5763	0.84648	0.0:0.0:0.0:1.0	.	308	O14682	ENC1_HUMAN	V	308;235;308	ENSP00000306356:D308V;ENSP00000423804:D235V;ENSP00000446289:D308V	ENSP00000306356:D308V	D	-	2	0	0	ENC1	73967144	73967144	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.317000	0.78254	0.459000	0.35465	GAC	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.498	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219862.2	1	0	1	2	2	2	2	0	0	0	0	69	69	69	68	1	1.870000	-20.000000	1	0.420000	NM_003633		0	65	65	0	290	290	1		1	1		0	0	69	0	0	1.000000	9.999827e-01	0	36	0	38	0	65	290
MSH3	4437	broad.mit.edu	37	5	79974874	79974874	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:79974874G>A	ENST00000265081.6	+	8	1382	c.1302G>A	c.(1300-1302)gaG>gaA	p.E434E		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	434					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CCTTGTCCGAGCAAACAGAGG	0.478								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)	ENST00000265081.6	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.043238	0.030000	0.040000																										0				29						c.(1300-1302)gaG>gaA	Mismatch excision repair (MMR)	mutS homolog 3							137.0	134.0	135.0					5																	79974874		2203	4300	6503	SO:0001819	synonymous_variant	4437	0	0					g.chr5:79974874G>A	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.1302G>A	chr5.hg19:g.79974874G>A		0						p.E434E	NM_002439.4	NP_002430.3	0	0	0	2.055894	P20585	MSH3_HUMAN		8	1382	+		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	ENST00000265081.6	0	1	hg19	c.1302G>A	CCDS34195.1	0																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.478	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	0	0	1	2	2	2	2	0	0	0	0	158	158	158	157	1	1.870000	-2.659744	1	0.420000	NM_002439		0	7	7	0	870	865	0		1	0		0	0	158	0	0	0.980226	2.352844e-02	0	0	0	25	0	7	870
FGFR4	2264	broad.mit.edu	37	5	176520430	176520430	+	Silent	SNP	C	C	T	rs201812753	byFrequency	TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr5:176520430C>T	ENST00000292408.4	+	10	1520	c.1275C>T	c.(1273-1275)tcC>tcT	p.S425S	FGFR4_ENST00000502906.1_Silent_p.S425S|FGFR4_ENST00000393648.2_Missense_Mutation_p.P374L|FGFR4_ENST00000292410.3_Silent_p.S385S|FGFR4_ENST00000393637.1_Silent_p.S385S	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	425					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CAGGCTCTTCCGGCAAGTCAA	0.622										TSP Lung(9;0.080)			C|||	4	0.000798722	0.0	0.0	5008	,	,		16981	0.003		0.0	False		,,,				2504	0.001					ENST00000292408.4	1.000000	8.000000e-01	1	8.600000e-01	0.940000	0.936883	0.940000	1.000000																										0				34						c.(1273-1275)tcC>tcT		fibroblast growth factor receptor 4	Palifermin(DB00039)|Ponatinib(DB08901)						80.0	81.0	81.0					5																	176520430		2203	4300	6503	SO:0001819	synonymous_variant	2264	47	121410	51				g.chr5:176520430C>T	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1275C>T	chr5.hg19:g.176520430C>T		0	TSP Lung(9;0.080)				FGFR4_ENST00000393637.1_Silent_p.S385S|FGFR4_ENST00000393648.2_Missense_Mutation_p.P374L|FGFR4_ENST00000292410.3_Silent_p.S385S|FGFR4_ENST00000502906.1_Silent_p.S425S	p.S425S	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	0	0	0	2.055894	P22455	FGFR4_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	10	1520	+	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Silent	SNP	ENST00000292408.4	1	1	hg19	c.1275C>T	CCDS4410.1	1	2|2	9.157509157509158E-4|9.157509157509158E-4	0|0	0.0|0.0	0|0	0.0|0.0	2|2	0.0034965034965034965|0.0034965034965034965	0|0	0.0|0.0	C|C	10.16|10.16	1.274249|1.274249	0.23221|0.23221	.|.	.|.	ENSG00000160867|ENSG00000160867	ENST00000393648|ENST00000511076	T|.	0.78481|.	-1.18|.	4.76|4.76	-9.52|-9.52	0.00578|0.00578	4.76|4.76	-9.52|-9.52	0.00578|0.00578	.|.	.|.	.|.	.|.	.|.	T|T	0.43743|0.43743	0.1261|0.1261	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.52480|0.52480	-0.8570|-0.8570	8|4	0.44086|.	T|.	0.13|.	.|.	5.7567|5.7567	0.18176|0.18176	0.1148:0.0898:0.4839:0.3115|0.1148:0.0898:0.4839:0.3115	.|.	374|.	B4DVP5|.	.|.	L|W	374|57	ENSP00000377259:P374L|.	ENSP00000377259:P374L|.	P|R	+|+	2|1	0|2	0|2	FGFR4|FGFR4	176453036|176453036	176453036|176453036	0.000000|0.000000	0.05858|0.05858	0.212000|0.212000	0.23672|0.23672	0.653000|0.653000	0.38743|0.38743	-7.064000|-7.064000	0.00045|0.00045	-3.096000|-3.096000	0.00246|0.00246	-0.315000|-0.315000	0.08773|0.08773	CCG|CGG	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.622	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1	0	0	1	2	2	2	2	0	0	0	0	158	158	158	155	1	1.870000	-2.912873	1	0.420000			0	132	130	0	533	529	1		1	1		0	0	158	0	0	1.000000	9.993709e-01	0	8	0	38	0	132	533
HLA-A	3105	broad.mit.edu	37	6	29910558	29910558	+	Missense_Mutation	SNP	T	T	C	rs386698549|rs2075684	byFrequency	TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr6:29910558T>C	ENST00000396634.1	+	4	439	c.98T>C	c.(97-99)tTc>tCc	p.F33S	HLA-A_ENST00000376809.5_Missense_Mutation_p.F33S|HLA-A_ENST00000376802.2_Missense_Mutation_p.F33S|HLA-A_ENST00000376806.5_Missense_Mutation_p.F33S			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	33	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.F33S(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						AGGTATTTCTTCACATCCGTG	0.726									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			N|||	1863	0.372005	0.4811	0.3862	5008	,	,		13512	0.375		0.2584	False		,,,				2504	0.3282					ENST00000396634.1			0	0																														1	Substitution - Missense(1)	p.F33S(1)	haematopoietic_and_lymphoid_tissue(1)	30						c.(97-99)tTc>tCc		major histocompatibility complex, class I, A		C	SER/PHE	2248,2112		679,890,611	16.0	15.0	15.0		98	-2.3	0.0	6	dbSNP_96	15	2254,6276		475,1304,2486	no	missense	HLA-A	NM_002116.7	155	1154,2194,3097	CC,CT,TT		26.4244,48.4404,34.9263	benign	33/366	29910558	4502,8388	2180	4265	6445	SO:0001583	missense	3105	34584	120802	77	Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	g.chr6:29910558T>C	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.98T>C	chr6.hg19:g.29910558T>C	ENSP00000379873:p.Phe33Ser		Multiple Myeloma(9;0.094)				HLA-A_ENST00000376802.2_Missense_Mutation_p.F33S|HLA-A_ENST00000376806.5_Missense_Mutation_p.F33S|HLA-A_ENST00000376809.5_Missense_Mutation_p.F33S	p.F33S							P16189	1A31_HUMAN		4	439	+			O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	1	0	hg19	c.98T>C	CCDS34373.1		983	0.4500915750915751	280	0.5691056910569106	184	0.5082872928176796	317	0.5541958041958042	202	0.26649076517150394	.	2.038	-0.420810	0.04734	0.515596	0.264244	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00010	9.43;9.43;9.43;9.43	3.72	-2.31	0.06765	3.72	-2.31	0.06765	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	20.031000	0.00447	N	0.000090	T	0.00039	0.0001	L	0.38953	1.18	0.80722	P	0.0	B;B;B	0.14012	0.009;0.009;0.008	B;B;B	0.26864	0.074;0.04;0.04	T	0.15065	-1.0450	9	0.33141	T	0.24	.	5.7818	0.18310	0.2651:0.4571:0.0:0.2778	rs2075684;rs3179175;rs17423951;rs41542415	33;33;33	Q5SRN7;Q5SRN5;P04439	.;.;1A03_HUMAN	S	33	ENSP00000379873:F33S;ENSP00000366002:F33S;ENSP00000366005:F33S;ENSP00000365998:F33S	ENSP00000348012:F33S	F	+	2	0	0	HLA-A	30018537	30018537	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-6.129000	0.00079	-0.931000	0.03746	-4.308000	0.00007	TTC			TCGA-US-A77G-01A-11D-A32N-08	0.726	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	0	0	0	2	14	2	2	0	0	0	1	41	41	41	41	1	1.870000	-0.670151	0	0.420000	NM_002116		0	35	16	0	159	156	1		1	1		0	0	41	0	0	0.998461	1	0	213	0	1939	0	35	159
HLA-A	3105	broad.mit.edu	37	6	29910572	29910572	+	Missense_Mutation	SNP	C	C	T	rs45569434	byFrequency	TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr6:29910572C>T	ENST00000396634.1	+	4	453	c.112C>T	c.(112-114)Cgg>Tgg	p.R38W	HLA-A_ENST00000376809.5_Missense_Mutation_p.R38W|HLA-A_ENST00000376802.2_Missense_Mutation_p.R38W|HLA-A_ENST00000376806.5_Missense_Mutation_p.R38W			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	38	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						ATCCGTGTCCCGGCCCGGCCG	0.706									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																												ENST00000396634.1			0	0																														0				30						c.(112-114)Cgg>Tgg		major histocompatibility complex, class I, A							18.0	17.0	17.0					6																	29910572		2195	4282	6477	SO:0001583	missense	3105	7513	121162	61	Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	g.chr6:29910572C>T	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.112C>T	chr6.hg19:g.29910572C>T	ENSP00000379873:p.Arg38Trp		Multiple Myeloma(9;0.094)				HLA-A_ENST00000376802.2_Missense_Mutation_p.R38W|HLA-A_ENST00000376806.5_Missense_Mutation_p.R38W|HLA-A_ENST00000376809.5_Missense_Mutation_p.R38W	p.R38W							P16189	1A31_HUMAN		4	453	+			O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	1	0	hg19	c.112C>T	CCDS34373.1		81	0.03708791208791209	31	0.06300813008130081	21	0.058011049723756904	4	0.006993006993006993	25	0.032981530343007916	.	13.15	2.151849	0.38021	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00922	5.54;5.54;5.54;5.54	3.72	1.87	0.25490	3.72	1.87	0.25490	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	0.758419	0.10308	U	0.690295	T	0.02848	0.0085	H	0.94462	3.54	0.25023	N	0.991328	D;D;D;D;D	0.89917	1.0;0.998;1.0;0.999;1.0	D;P;D;D;D	0.73380	0.976;0.896;0.98;0.96;0.98	T	0.31475	-0.9942	10	0.87932	D	0	.	5.3229	0.15891	0.0:0.6744:0.2073:0.1183	rs45569434	38;38;38;38;38	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	W	38	ENSP00000379873:R38W;ENSP00000366002:R38W;ENSP00000366005:R38W;ENSP00000365998:R38W	ENSP00000348012:R38W	R	+	1	2	2	HLA-A	30018551	30018551	0.163000	0.22920	0.991000	0.47740	0.427000	0.31564	0.209000	0.17435	0.363000	0.24346	0.478000	0.44815	CGG			TCGA-US-A77G-01A-11D-A32N-08	0.706	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	0	0	0	2	14	2	2	0	0	0	1	40	40	40	40	1	1.870000	-1.006282	0	0.420000	NM_002116		0	34	19	0	153	149	1		1	1		0	0	40	0	0	0.998070	1	0	284	0	2200	0	34	153
HLA-A	3105	broad.mit.edu	37	6	29910604	29910604	+	Silent	SNP	C	C	A	rs12721675	byFrequency	TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr6:29910604C>A	ENST00000396634.1	+	4	485	c.144C>A	c.(142-144)gcC>gcA	p.A48A	HLA-A_ENST00000376809.5_Silent_p.A48A|HLA-A_ENST00000376802.2_Silent_p.A48A|HLA-A_ENST00000376806.5_Silent_p.A48A			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	48	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						GCTTCATCGCCGTGGGCTACG	0.701									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			c|||	1915	0.382388	0.4425	0.4597	5008	,	,		15112	0.3899		0.3807	False		,,,				2504	0.2403					ENST00000396634.1			0	0																														0				30						c.(142-144)gcC>gcA		major histocompatibility complex, class I, A							33.0	29.0	30.0					6																	29910604		2201	4298	6499	SO:0001819	synonymous_variant	3105	43954	121308	75	Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	g.chr6:29910604C>A	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.144C>A	chr6.hg19:g.29910604C>A			Multiple Myeloma(9;0.094)				HLA-A_ENST00000376802.2_Silent_p.A48A|HLA-A_ENST00000376806.5_Silent_p.A48A|HLA-A_ENST00000376809.5_Silent_p.A48A	p.A48A							P16189	1A31_HUMAN		4	485	+			O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	1	0	hg19	c.144C>A	CCDS34373.1																																																																																											TCGA-US-A77G-01A-11D-A32N-08	0.701	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	0	0	0	2	16	2	2	0	0	0	1	38	38	38	38	1	1.870000	-0.791091	0	0.420000	NM_002116		0	32	18	0	175	169	1		1	1		0	0	38	0	0	0.987747	1	0	281	0	3709	0	32	175
GLI3	2737	broad.mit.edu	37	7	42005520	42005520	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr7:42005520G>A	ENST00000395925.3	-	15	3235	c.3151C>T	c.(3151-3153)Cgg>Tgg	p.R1051W	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1051					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CCCTCGGGCCGCGTGTAATTC	0.662									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													ENST00000395925.3	1.000000	9.200000e-01	1	9.900000e-01	0.990000	0.995179	0.990000	1.000000																										0				112						c.(3151-3153)Cgg>Tgg		GLI family zinc finger 3							43.0	48.0	46.0					7																	42005520		2203	4300	6503	SO:0001583	missense	2737	1	121412	26	Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42005520G>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3151C>T	chr7.hg19:g.42005520G>A	ENSP00000379258:p.Arg1051Trp	0					GLI3_ENST00000479210.1_5'UTR	p.R1051W	NM_000168.5	NP_000159.3	0	0	0	2.057159	P10071	GLI3_HUMAN		15	3235	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	1	1	hg19	c.3151C>T	CCDS5465.1	1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693058	0.68271	.	.	ENSG00000106571	ENST00000395925	T	0.15834	2.39	5.47	5.47	0.80525	5.47	5.47	0.80525	.	0.100400	0.64402	D	0.000001	T	0.31513	0.0799	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	P	0.51657	0.676	T	0.01516	-1.1335	10	0.36615	T	0.2	.	17.5184	0.87780	0.0:0.0:1.0:0.0	.	1051	P10071	GLI3_HUMAN	W	1051	ENSP00000379258:R1051W	ENSP00000379258:R1051W	R	-	1	2	2	GLI3	41972045	41972045	1.000000	0.71417	0.926000	0.36857	0.689000	0.40095	7.435000	0.80391	2.561000	0.86390	0.563000	0.77884	CGG	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.662	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	1	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	1.870000	-20.000000	1	0.420000	NM_000168		0	71	71	0	223	221	1		1			0	0	64	0	0	1.000000	0	0	0	0	0	0	71	223
ZMIZ2	83637	broad.mit.edu	37	7	44805162	44805162	+	Missense_Mutation	SNP	C	C	G			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr7:44805162C>G	ENST00000309315.4	+	16	2349	c.2226C>G	c.(2224-2226)agC>agG	p.S742R	ZMIZ2_ENST00000413916.1_Missense_Mutation_p.S684R|ZMIZ2_ENST00000441627.1_Missense_Mutation_p.S742R|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.S710R|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.S716R	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	742	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTGCCCCCAGCGACTACCCTG	0.657																																					NSCLC(20;604 852 1948 16908 50522)	ENST00000309315.4	1.000000	5.100000e-01	9.600000e-01	6.300000e-01	0.780000	0.793675	0.780000	1.000000																										0				35						c.(2224-2226)agC>agG		zinc finger, MIZ-type containing 2							12.0	13.0	13.0					7																	44805162		1788	3903	5691	SO:0001583	missense	83637	0	0					g.chr7:44805162C>G	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.2226C>G	chr7.hg19:g.44805162C>G	ENSP00000311778:p.Ser742Arg	0					ZMIZ2_ENST00000441627.1_Missense_Mutation_p.S742R|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.S684R|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.S716R|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.S710R	p.S742R	NM_031449.3	NP_113637.3	0	0	0	2.057159	Q8NF64	ZMIZ2_HUMAN		16	2349	+			A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	1	1	hg19	c.2226C>G	CCDS43576.1	0	.	.	.	.	.	.	.	.	.	.	C	13.54	2.266217	0.40095	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.33865	1.4;1.39;1.39;1.39;1.41	5.14	-0.476	0.12100	5.14	-0.476	0.12100	.	0.724500	0.13304	N	0.398004	T	0.29914	0.0748	L	0.59436	1.845	0.32588	N	0.527618	B;P;B	0.37141	0.009;0.584;0.409	B;B;B	0.37833	0.017;0.259;0.203	T	0.36237	-0.9756	10	0.39692	T	0.17	-2.9204	5.127	0.14890	0.1374:0.4536:0.0:0.409	.	716;742;684	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	R	684;742;742;710;716;745	ENSP00000409648:S684R;ENSP00000311778:S742R;ENSP00000414723:S742R;ENSP00000396601:S710R;ENSP00000265346:S716R	ENSP00000265346:S716R	S	+	3	2	2	ZMIZ2	44771687	44771687	0.000000	0.05858	0.735000	0.30896	0.987000	0.75469	-2.469000	0.00992	0.016000	0.14998	0.561000	0.74099	AGC	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.657	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	1	0	1	2	2	2	2	0	0	0	0	26	26	26	26	1	1.870000	-20.000000	1	0.420000	NM_031449		0	20	20	0	101	98	0		1	1		0	0	26	0	0	0.999997	9.999964e-01	0	52	0	65	0	20	101
SCRIB	23513	broad.mit.edu	37	8	144896264	144896264	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr8:144896264G>A	ENST00000320476.3	-	2	190	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C	PUF60_ENST00000524570.1_5'Flank|SCRIB_ENST00000377533.3_5'UTR|MIR937_ENST00000401271.1_RNA|SCRIB_ENST00000356994.2_Missense_Mutation_p.R62C	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	62	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CCCAGCTTGCGCAAGTTCAGC	0.617																																					Pancreas(51;966 1133 10533 14576 29674)	ENST00000320476.3	1.000000	5.600000e-01	1	8.100000e-01	0.990000	0.932276	0.990000	1.000000																										0				42						c.(184-186)Cgc>Tgc		scribbled planar cell polarity protein							46.0	38.0	41.0					8																	144896264		2171	4268	6439	SO:0001583	missense	23513	0	0					g.chr8:144896264G>A	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.184C>T	chr8.hg19:g.144896264G>A	ENSP00000322938:p.Arg62Cys	0					SCRIB_ENST00000356994.2_Missense_Mutation_p.R62C|MIR937_ENST00000401271.1_RNA|PUF60_ENST00000524570.1_5'Flank|SCRIB_ENST00000377533.3_5'UTR	p.R62C	NM_015356.4	NP_056171	0	1	1	2.050966	Q14160	SCRIB_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)	2	190	-	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	0	1	hg19	c.184C>T	CCDS6411.1	1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873069	0.51695	.	.	ENSG00000180900	ENST00000356994;ENST00000320476	T;T	0.58940	0.3;0.3	4.49	-0.207	0.13189	4.49	-0.207	0.13189	.	.	.	.	.	T	0.74222	0.3688	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.77180	-0.2682	9	0.87932	D	0	.	13.3897	0.60816	0.0:0.0:0.392:0.608	.	62;62	Q14160;Q14160-3	SCRIB_HUMAN;.	C	62	ENSP00000349486:R62C;ENSP00000322938:R62C	ENSP00000322938:R62C	R	-	1	0	0	SCRIB	144968252	144968252	1.000000	0.71417	0.263000	0.24496	0.577000	0.36160	2.833000	0.48159	0.094000	0.17404	-0.182000	0.12963	CGC	0.418779		TCGA-US-A77G-01A-11D-A32N-08	0.617	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	1	0	1	2	2	2	2	0	0	0	0	9	9	9	9	1	1.870000	-17.505890	1	0.420000	NM_015356		0	8	8	0	26	26	0		1	1		0	0	9	0	0	0.992400	9.997887e-01	0	38	0	30	0	8	26
TJP2	9414	broad.mit.edu	37	9	71866162	71866162	+	Missense_Mutation	SNP	G	G	C			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr9:71866162G>C	ENST00000377245.4	+	21	3411	c.3203G>C	c.(3202-3204)aGt>aCt	p.S1068T	TJP2_ENST00000453658.2_Intron|TJP2_ENST00000348208.4_Intron|TJP2_ENST00000535702.1_Missense_Mutation_p.S1035T|TJP2_ENST00000539225.1_Missense_Mutation_p.S1099T	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	1068					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GGAGAGAGCAGTGAGGAGCAA	0.512																																						ENST00000377245.4	0.150000	1.000000e-02	1.100000e-01	3.000000e-02	0.060000	0.078938	0.060000	0.060000																										0				35						c.(3202-3204)aGt>aCt		tight junction protein 2							81.0	76.0	78.0					9																	71866162		2203	4300	6503	SO:0001583	missense	9414	0	0					g.chr9:71866162G>C	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.3203G>C	chr9.hg19:g.71866162G>C	ENSP00000366453:p.Ser1068Thr	0					TJP2_ENST00000535702.1_Missense_Mutation_p.S1035T|TJP2_ENST00000453658.2_Intron|TJP2_ENST00000348208.4_Intron|TJP2_ENST00000539225.1_Missense_Mutation_p.S1099T	p.S1068T	NM_004817.3	NP_004808.2	0	0	0	2.056560	Q9UDY2	ZO2_HUMAN		21	3411	+			A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	ENST00000377245.4	0	1	hg19	c.3203G>C	CCDS6627.1	0	.	.	.	.	.	.	.	.	.	.	G	3.985	-0.005558	0.07773	.	.	ENSG00000119139	ENST00000377245;ENST00000535702;ENST00000539225	T;T;T	0.08634	3.08;3.07;3.13	6.17	-1.69	0.08186	6.17	-1.69	0.08186	.	0.777732	0.12506	N	0.462854	T	0.02418	0.0074	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.06405	0.002;0.002;0.001	T	0.43048	-0.9415	10	0.22109	T	0.4	.	0.2337	0.00183	0.244:0.2391:0.234:0.2829	.	1099;1035;1068	F5H301;F5H886;Q9UDY2	.;.;ZO2_HUMAN	T	1068;1035;1099	ENSP00000366453:S1068T;ENSP00000442090:S1035T;ENSP00000438262:S1099T	ENSP00000366453:S1068T	S	+	2	0	0	TJP2	71055982	71055982	0.000000	0.05858	0.003000	0.11579	0.337000	0.28794	-0.333000	0.07894	-0.348000	0.08286	-0.176000	0.13171	AGT	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.512	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	0	0	0	2	2	2	2	0	0	0	0	57	57	57	57	1	1.870000	-5.443505	1	0.420000	NM_201629		0	4	0	0	294	292	0		0	0		0	0	57	0	0	0.886186	8.886348e-01	0	0	0	294	0	4	294
LHX2	9355	broad.mit.edu	37	9	126776246	126776246	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chr9:126776246C>T	ENST00000373615.4	+	2	866	c.127C>T	c.(127-129)Ccg>Tcg	p.P43S	RP11-85O21.4_ENST00000421041.1_RNA	NM_004789.3	NP_004780.3	P50458	LHX2_HUMAN	LIM homeobox 2	43					axon extension (GO:0048675)|axon guidance (GO:0007411)|cerebral cortex development (GO:0021987)|dorsal/ventral pattern formation (GO:0009953)|mesoderm development (GO:0007498)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural tube closure (GO:0001843)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|retina development in camera-type eye (GO:0060041)|telencephalon regionalization (GO:0021978)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)	10						GCAGACCATGCCGTCCATCAG	0.701																																						ENST00000373615.4	0.200000	3.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.103973	0.090000	0.090000																										0				10						c.(127-129)Ccg>Tcg		LIM homeobox 2							30.0	32.0	31.0					9																	126776246		2201	4298	6499	SO:0001583	missense	9355	0	0					g.chr9:126776246C>T	U11701	CCDS6853.1	9q33.3	2011-06-20			ENSG00000106689	ENSG00000106689		"""Homeoboxes / LIM class"""	6594	protein-coding gene	gene with protein product		603759				8649822, 10051612	Standard	NM_004789		Approved	LH-2, hLhx2	uc004boe.1	P50458	OTTHUMG00000020647	ENST00000373615.4:c.127C>T	chr9.hg19:g.126776246C>T	ENSP00000362717:p.Pro43Ser	0					RP11-85O21.4_ENST00000421041.1_RNA	p.P43S	NM_004789.3	NP_004780.3	1	2	3	2.063944	P50458	LHX2_HUMAN		2	866	+			O95860|Q52M57|Q8N1Z3	Missense_Mutation	SNP	ENST00000373615.4	0	1	hg19	c.127C>T	CCDS6853.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.325460|5.325460	0.95708|0.95708	.|.	.|.	ENSG00000106689|ENSG00000106689	ENST00000446480|ENST00000373615	.|D	.|0.83914	.|-1.78	5.91|5.91	5.91|5.91	0.95273|0.95273	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	.|0.116041	.|0.64402	.|D	.|0.000015	D|D	0.84160|0.84160	0.5411|0.5411	M|M	0.73598|0.73598	2.24|2.24	0.54753|0.54753	D|D	0.999984|0.999984	.|B;B	.|0.24721	.|0.11;0.029	.|B;B	.|0.25884	.|0.064;0.016	T|T	0.80181|0.80181	-0.1489|-0.1489	5|10	.|0.42905	.|T	.|0.14	.|.	18.8766|18.8766	0.92338|0.92338	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|43;43	.|B3KNJ5;P50458	.|.;LHX2_HUMAN	V|S	40|43	.|ENSP00000362717:P43S	.|ENSP00000362717:P43S	A|P	+|+	2|1	0|0	0|0	LHX2|LHX2	125816067|125816067	125816067|125816067	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.803000|7.803000	0.85983|0.85983	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GCC|CCG	0.421215		TCGA-US-A77G-01A-11D-A32N-08	0.701	LHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054010.2	0	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	1.870000	-3.012480	1	0.420000			0	5	5	0	267	266	0		1			0	0	59	0	0	0.937504	0	0	0	0	0	0	5	267
WDR44	54521	broad.mit.edu	37	X	117527019	117527019	+	Missense_Mutation	SNP	C	C	T			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chrX:117527019C>T	ENST00000254029.3	+	4	1006	c.611C>T	c.(610-612)gCc>gTc	p.A204V	WDR44_ENST00000371825.3_Missense_Mutation_p.A204V|WDR44_ENST00000371822.5_Missense_Mutation_p.A179V|WDR44_ENST00000493448.1_3'UTR	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	204						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.A204G(2)		breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						AAAGATTTTGCCGCTGTGGAA	0.488																																						ENST00000254029.3	0.060000	0	5.000000e-02	1.000000e-02	0.020000	0.033644	0.020000	0.030000																										2	Substitution - Missense(2)	p.A204G(2)	lung(2)	33						c.(610-612)gCc>gTc		WD repeat domain 44							144.0	125.0	132.0					X																	117527019		2203	4300	6503	SO:0001583	missense	54521	0	0					g.chrX:117527019C>T	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.611C>T	chrX.hg19:g.117527019C>T	ENSP00000254029:p.Ala204Val						WDR44_ENST00000371822.5_Missense_Mutation_p.A179V|WDR44_ENST00000371825.3_Missense_Mutation_p.A204V|WDR44_ENST00000493448.1_3'UTR	p.A204V	NM_019045.4	NP_061918.3	0	1	1		Q5JSH3	WDR44_HUMAN		4	1006	+			B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	0	1	hg19	c.611C>T	CCDS14572.1	0	.	.	.	.	.	.	.	.	.	.	C	7.626	0.677788	0.14841	.	.	ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825	T;T;T	0.73152	-0.72;-0.14;-0.02	5.69	2.87	0.33458	5.69	2.87	0.33458	.	0.693990	0.14300	N	0.328333	T	0.50497	0.1619	N	0.19112	0.55	0.21473	N	0.999679	B;B;B	0.18166	0.026;0.01;0.007	B;B;B	0.23419	0.046;0.022;0.015	T	0.36962	-0.9726	10	0.33940	T	0.23	-0.7721	2.9206	0.05767	0.1398:0.5526:0.1462:0.1614	.	179;204;204	F8W913;Q5JSH3-2;Q5JSH3	.;.;WDR44_HUMAN	V	179;204;204	ENSP00000360887:A179V;ENSP00000254029:A204V;ENSP00000360890:A204V	ENSP00000254029:A204V	A	+	2	0	0	WDR44	117411047	117411047	0.995000	0.38212	0.182000	0.23118	0.191000	0.23601	0.769000	0.26604	0.153000	0.19213	-0.253000	0.11424	GCC	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.488	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	0	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	1.870000	-2.079381	0	0.420000	NM_019045		0	5	5	0	416	411	0		1	0		0	0	61	0	0	0.935915	5.309212e-02	0	0	0	25	0	5	416
IL3RA	3563	broad.mit.edu	37	X	1497572	1497572	+	Missense_Mutation	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chrX:1497572G>A	ENST00000331035.4	+	10	1244	c.895G>A	c.(895-897)Gca>Aca	p.A299T	IL3RA_ENST00000381469.2_Missense_Mutation_p.A221T	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	299					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GGAGGAGGGCGCAAACACACG	0.672																																						ENST00000331035.4	0.120000	1.000000e-02	9.000000e-02	2.000000e-02	0.050000	0.060914	0.050000	0.050000																										0				3						c.(895-897)Gca>Aca		interleukin 3 receptor, alpha (low affinity)	Sargramostim(DB00020)						113.0	90.0	98.0					X																	1497572		2201	4295	6496	SO:0001583	missense	3563	28	121148	43				g.chrX:1497572G>A	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.895G>A	chrX.hg19:g.1497572G>A	ENSP00000327890:p.Ala299Thr						IL3RA_ENST00000381469.2_Missense_Mutation_p.A221T	p.A299T	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	0	1	1		P26951	IL3RA_HUMAN		10	1244	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Missense_Mutation	SNP	ENST00000331035.4	0	1	hg19	c.895G>A	CCDS14113.1	0	.	.	.	.	.	.	.	.	.	.	.	0.030	-1.340363	0.01277	.	.	ENSG00000185291	ENST00000331035;ENST00000381469	T;D	0.95918	1.53;-3.85	0.798	-1.59	0.08453	0.798	-1.59	0.08453	.	113.382000	0.00775	N	0.001236	D	0.86834	0.6028	N	0.08118	0	0.09310	N	1	B;B	0.14438	0.01;0.003	B;B	0.09377	0.004;0.0	T	0.80405	-0.1396	9	0.14252	T	0.57	.	.	.	.	.	220;299	P26951-2;P26951	.;IL3RA_HUMAN	T	299;221	ENSP00000327890:A299T;ENSP00000370878:A221T	ENSP00000327890:A299T	A	+	1	0	0	IL3RA	1457572	1457572	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.867000	0.00346	-0.741000	0.04797	-0.510000	0.04470	GCA	0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.672	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055600.3	0	0	1	2	2	2	2	0	0	0	0	38	38	38	38	1	1.870000	-3.187799	1	0.420000			0	4	4	0	188	187	0		1	0		0	0	38	0	0	0.890018	1.860800e-01	0	0	0	30	0	4	188
MAGEC3	139081	broad.mit.edu	37	X	140985098	140985098	+	Silent	SNP	C	C	T	rs371218735		TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chrX:140985098C>T	ENST00000298296.1	+	7	1554	c.1554C>T	c.(1552-1554)ccC>ccT	p.P518P	MAGEC3_ENST00000409007.1_Silent_p.P220P|MAGEC3_ENST00000443323.2_Silent_p.P140P|MAGEC3_ENST00000544766.1_Silent_p.P220P|MAGEC3_ENST00000536088.1_Silent_p.P220P	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	518	MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					ATATGGACCCCGACAACCACT	0.448													C|||	4	0.0010596	0.0	0.0	3775	,	,		13728	0.004		0.0	False		,,,				2504	0.0					ENST00000298296.1	0.080000	1.000000e-02	6.000000e-02	2.000000e-02	0.030000	0.045481	0.030000	0.040000																										0				69						c.(1552-1554)ccC>ccT		melanoma antigen family C, 3							156.0	151.0	153.0					X																	140985098		2203	4300	6503	SO:0001819	synonymous_variant	139081	17	121408	45				g.chrX:140985098C>T	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1554C>T	chrX.hg19:g.140985098C>T							MAGEC3_ENST00000443323.2_Silent_p.P140P|MAGEC3_ENST00000536088.1_Silent_p.P220P|MAGEC3_ENST00000409007.1_Silent_p.P220P|MAGEC3_ENST00000544766.1_Silent_p.P220P	p.P518P	NM_138702.1	NP_619647.1	0	1	1		Q8TD91	MAGC3_HUMAN		7	1554	+	Acute lymphoblastic leukemia(192;6.56e-05)		Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	ENST00000298296.1	0	1	hg19	c.1554C>T	CCDS14676.1	0																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.448	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	0	0	1	2	2	2	2	0	0	0	0	105	105	105	102	1	1.870000	-1.874510	0	0.420000	NM_138702		0	9	8	0	511	502	0		1			0	0	105	0	0	0.993766	0	0	0	0	0	0	9	511
PRRG3	79057	broad.mit.edu	37	X	150869406	150869406	+	Silent	SNP	G	G	A			TCGA-US-A77G-01A-11D-A32N-08	TCGA-US-A77G-11A-11D-A32N-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d1c1ef67-68f6-45f8-a296-7bd9201465b8	f15f5b8d-5e60-4946-9975-3fbff641efea	g.chrX:150869406G>A	ENST00000370353.3	+	4	987	c.597G>A	c.(595-597)gcG>gcA	p.A199A	PRRG3_ENST00000538575.1_Silent_p.A199A			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	199						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					AGGTGACTGCGCCCCAAGAGA	0.622																																						ENST00000370353.3	1.000000	9.000000e-01	1	9.400000e-01	0.970000	0.976447	0.970000	0.990000																										0				24						c.(595-597)gcG>gcA		proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)							74.0	61.0	66.0					X																	150869406		2203	4300	6503	SO:0001819	synonymous_variant	79057	8	121392	40				g.chrX:150869406G>A	AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.597G>A	chrX.hg19:g.150869406G>A							PRRG3_ENST00000538575.1_Silent_p.A199A	p.A199A			0	1	1		Q9BZD7	TMG3_HUMAN		4	987	+	Acute lymphoblastic leukemia(192;6.56e-05)		A1A523|A1A575|Q8N2N6	Silent	SNP	ENST00000370353.3	1	1	hg19	c.597G>A	CCDS14699.1	1																																																																																								0.420000		TCGA-US-A77G-01A-11D-A32N-08	0.622	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060880.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	1.870000	-20.000000	1	0.420000	NM_024082		0	120	118	0	127	125	1		1			0	0	39	0	0	1.000000	0	0	0	0	0	0	120	127
