#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
MAP3K6	9064	broad.mit.edu	37	1	27688114	27688115	+	Frame_Shift_Ins	INS	-	-	GC	rs142955447		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr1:27688114_27688115insGC	ENST00000493901.1	-	12	1821_1822	c.1582_1583insGC	c.(1582-1584)ctgfs	p.L528fs	MAP3K6_ENST00000374040.3_Frame_Shift_Ins_p.L520fs|MAP3K6_ENST00000357582.2_Frame_Shift_Ins_p.L528fs	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	528					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CTCCAGGACCAGCACCTGCAGG	0.629																																						ENST00000493901.1	1.000000	0.530000	1.000000	0.720000	0.940000	0.885268	0.940000	1.000000																										0				10						c.(1582-1584)ctgfs		mitogen-activated protein kinase kinase kinase 6																																				SO:0001589	frameshift_variant	9064	0	0					g.chr1:27688114_27688115insGC	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.1581_1582dupGC	chr1.hg19:g.27688115_27688116dupGC	ENSP00000419591:p.Leu528fs	0					MAP3K6_ENST00000374040.3_Frame_Shift_Ins_p.L520fs|MAP3K6_ENST00000357582.2_Frame_Shift_Ins_p.L528fs	p.L528fs	NM_004672.3	NP_004663.3	0	0	0	1.957721	O95382	M3K6_HUMAN		12	1821_1822	-		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Frame_Shift_Ins	INS	ENST00000493901.1	0	1	hg19	c.1582_1583insGC	CCDS299.1	1																																																																																								0.075026		TCGA-XD-AAUH-01A-42D-A40W-08	0.629	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	1	0	1		2	2		0		0	0	57		57	58	1	2	-3.088860	1	0.100000	NM_004672			13	13		250	251	0		1	0	0	0	0	57	0		0.999581	6.119411e-01	0	0	0	40	0	13	250
ERLIN1	10613	broad.mit.edu	37	10	101911917	101911917	+	Missense_Mutation	SNP	C	C	T	rs373292585		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr10:101911917C>T	ENST00000421367.2	-	11	3725	c.1018G>A	c.(1018-1020)Gtc>Atc	p.V340I	ERLIN1_ENST00000407654.3_Missense_Mutation_p.V340I	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	338					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)							Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		TTTTGGATGACGTTCTCTCCA	0.458																																						ENST00000421367.2	1.000000	0.400000	1.000000	0.630000	0.980000	0.860177	0.980000	1.000000																										0										c.(1018-1020)Gtc>Atc		ER lipid raft associated 1							101.0	93.0	96.0					10																	101911917		2203	4300	6503	SO:0001583	missense	10613	4	121408	40				g.chr10:101911917C>T	AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.1018G>A	chr10.hg19:g.101911917C>T	ENSP00000410964:p.Val340Ile	0					ERLIN1_ENST00000407654.3_Missense_Mutation_p.V340I	p.V340I	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	1	2	3	2.014299	O75477	ERLN1_HUMAN		11	3725	-		Colorectal(252;0.234)	B0QZ42|Q53HV0	Missense_Mutation	SNP	ENST00000421367.2	0	1	hg19	c.1018G>A	CCDS7487.2	1	.	.	.	.	.	.	.	.	.	.	C	9.042	0.990018	0.18966	.	.	ENSG00000107566	ENST00000421367;ENST00000407654	T;T	0.63417	-0.04;-0.04	5.61	0.201	0.15186	5.61	0.201	0.15186	.	0.689394	0.13155	U	0.409529	T	0.33556	0.0867	N	0.08118	0	0.09310	N	0.999999	B;B	0.10296	0.0;0.003	B;B	0.06405	0.0;0.002	T	0.12502	-1.0545	10	0.30078	T	0.28	-15.3852	3.2164	0.06700	0.0833:0.2748:0.3616:0.2804	.	338;340	O75477;D3DR65	ERLN1_HUMAN;.	I	340	ENSP00000410964:V340I;ENSP00000384900:V340I	ENSP00000384900:V340I	V	-	1	0	0	ERLIN1	101901907	101901907	1.000000	0.71417	0.942000	0.38095	0.963000	0.63663	1.330000	0.33781	-0.138000	0.11434	-0.228000	0.12330	GTC	0.108911		TCGA-XD-AAUH-01A-42D-A40W-08	0.458	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2	0	0	1		2	2	2	0		0	0	24		24	24	1	2	-4.218542	1	0.100000	NM_006459			6	6		132	131	0		1	1		0	0	24	0		0.965260	8.227673e-01	0	6	0	66	0	6	132
CPT1A	1374	broad.mit.edu	37	11	68549244	68549244	+	Silent	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr11:68549244G>A	ENST00000265641.5	-	11	1501	c.1347C>T	c.(1345-1347)taC>taT	p.Y449Y	CPT1A_ENST00000539743.1_Silent_p.Y449Y|CPT1A_ENST00000540367.1_Silent_p.Y449Y|CPT1A_ENST00000376618.2_Silent_p.Y449Y	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	449					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GGTACCTGTCGTAACATCGGC	0.473																																						ENST00000265641.5	1.000000	0.610000	1.000000	0.760000	0.940000	0.900970	0.940000	1.000000																										0				42						c.(1345-1347)taC>taT		carnitine palmitoyltransferase 1A (liver)	Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)						317.0	253.0	275.0					11																	68549244		2200	4294	6494	SO:0001819	synonymous_variant	1374	2	121412	39				g.chr11:68549244G>A	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1347C>T	chr11.hg19:g.68549244G>A		0					CPT1A_ENST00000539743.1_Silent_p.Y449Y|CPT1A_ENST00000540367.1_Silent_p.Y449Y|CPT1A_ENST00000376618.2_Silent_p.Y449Y	p.Y449Y	NM_001876.3	NP_001867.2	1	2	3	2.009135	P50416	CPT1A_HUMAN	LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)	11	1501	-	Esophageal squamous(3;3.28e-14)		Q8TCU0|Q9BWK0	Silent	SNP	ENST00000265641.5	1	1	hg19	c.1347C>T	CCDS8185.1	1																																																																																								0.107586		TCGA-XD-AAUH-01A-42D-A40W-08	0.473	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	0	0	1		15	3	2	1		1	1	145		145	144	1	2	-4.417168	1	0.100000	NM_001876			26	25		552	543	0		1	0		1	0	145	0		0.968259	2.494480e-01	0	1	0	36	0	26	552
CCDC67	159989	broad.mit.edu	37	11	93088643	93088643	+	Nonsense_Mutation	SNP	C	C	T	rs374648091		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr11:93088643C>T	ENST00000298050.3	+	3	236	c.136C>T	c.(136-138)Cga>Tga	p.R46*	CCDC67_ENST00000530053.1_3'UTR|CCDC67_ENST00000527307.1_Nonsense_Mutation_p.R46*	NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	46					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				TTTGGAGACACGATTAGATCT	0.388																																						ENST00000298050.3	1.000000	0.610000	1.000000	0.850000	0.990000	0.945919	0.990000	1.000000																										0				22						c.(136-138)Cga>Tga		coiled-coil domain containing 67							105.0	107.0	106.0					11																	93088643		1879	4099	5978	SO:0001587	stop_gained	159989	1	120828	31				g.chr11:93088643C>T	AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.136C>T	chr11.hg19:g.93088643C>T	ENSP00000298050:p.Arg46*	0					CCDC67_ENST00000530053.1_3'UTR|CCDC67_ENST00000527307.1_Nonsense_Mutation_p.R46*	p.R46*	NM_181645.3	NP_857596.2	1	2	3	2.009135	Q05D60	DEUP1_HUMAN		3	236	+		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)	Q8NEF1|Q96LL7	Nonsense_Mutation	SNP	ENST00000298050.3	0	1	hg19	c.136C>T	CCDS44707.1	1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645274	0.87859	.	.	ENSG00000165325	ENST00000534747;ENST00000298050;ENST00000532819;ENST00000527307	.	.	.	5.54	1.18	0.20946	5.54	1.18	0.20946	.	0.445552	0.20432	N	0.092454	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	5.1073	0.14790	0.4125:0.4189:0.0919:0.0768	.	.	.	.	X	46	.	ENSP00000298050:R46X	R	+	1	2	2	CCDC67	92728291	92728291	0.998000	0.40836	0.995000	0.50966	0.994000	0.84299	1.260000	0.32968	0.656000	0.30886	0.491000	0.48974	CGA	0.107586		TCGA-XD-AAUH-01A-42D-A40W-08	0.388	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	41		41	40	1	2	-4.722607	1	0.100000	NM_181645			11	10		190	189	0		1	0		0	0	41	0		0.998387	1.078655e-02	0	0	0	3	0	11	190
RNF10	9921	broad.mit.edu	37	12	121000776	121000776	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr12:121000776C>T	ENST00000325954.4	+	8	1618	c.1157C>T	c.(1156-1158)gCc>gTc	p.A386V	RNF10_ENST00000413266.2_Missense_Mutation_p.A386V	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	386					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCGGGATTGGCCGGAAGCAGA	0.542																																						ENST00000325954.4	0.900000	0.170000	0.670000	0.290000	0.450000	0.488700	0.450000	0.400000																										0				27						c.(1156-1158)gCc>gTc		ring finger protein 10							151.0	134.0	140.0					12																	121000776		2203	4300	6503	SO:0001583	missense	9921	0	0					g.chr12:121000776C>T	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.1157C>T	chr12.hg19:g.121000776C>T	ENSP00000322242:p.Ala386Val	0					RNF10_ENST00000413266.2_Missense_Mutation_p.A386V	p.A386V	NM_014868.4	NP_055683.3	0	1	1	1.998579	Q8N5U6	RNF10_HUMAN		8	1618	+	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	0	1	hg19	c.1157C>T	CCDS9201.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.04|15.04	2.715693|2.715693	0.48622|0.48622	.|.	.|.	ENSG00000022840|ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000542438;ENST00000413266|ENST00000537740	D;D|.	0.89270|.	-2.49;-2.48|.	5.5|5.5	4.55|4.55	0.56014|0.56014	5.5|5.5	4.55|4.55	0.56014|0.56014	.|.	0.823828|.	0.11705|.	N|.	0.537503|.	T|T	0.46328|0.46328	0.1387|0.1387	L|L	0.29908|0.29908	0.895|0.895	0.35161|0.35161	D|D	0.770683|0.770683	B;B|.	0.21071|.	0.051;0.039|.	B;B|.	0.24541|.	0.054;0.019|.	T|T	0.50833|0.50833	-0.8781|-0.8781	10|5	0.22706|.	T|.	0.39|.	.|.	10.6165|10.6165	0.45454|0.45454	0.2039:0.7961:0.0:0.0|0.2039:0.7961:0.0:0.0	.|.	386;386|.	Q8N5U6-2;Q8N5U6|.	.;RNF10_HUMAN|.	V|S	386;386;116;386|64	ENSP00000322242:A386V;ENSP00000415682:A386V|.	ENSP00000322242:A386V|.	A|P	+|+	2|1	0|0	0|0	RNF10|RNF10	119485159|119485159	119485159|119485159	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.549000|0.549000	0.35272|0.35272	1.456000|1.456000	0.35201|0.35201	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GCC|CCG	0.094112		TCGA-XD-AAUH-01A-42D-A40W-08	0.542	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4	0	0	1		2	2	2	0		0	0	41		41	39	1	2	-2.565000	1	0.100000				5	5		226	217	0		1	0		0	0	41	0		0.931477	9.642978e-01	0	0	0	281	0	5	226
E2F7	144455	broad.mit.edu	37	12	77423797	77423797	+	Silent	SNP	C	C	T	rs368328521		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr12:77423797C>T	ENST00000322886.7	-	10	1933	c.1698G>A	c.(1696-1698)gcG>gcA	p.A566A	E2F7_ENST00000416496.2_Silent_p.A566A	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	566					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						CTGACCCTGACGCTGGTCCCT	0.582																																						ENST00000322886.7	1.000000	0.340000	0.810000	0.460000	0.620000	0.644291	0.620000	1.000000																										0				42						c.(1696-1698)gcG>gcA		E2F transcription factor 7							100.0	92.0	94.0					12																	77423797		2203	4300	6503	SO:0001819	synonymous_variant	144455	12	121412	44				g.chr12:77423797C>T	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1698G>A	chr12.hg19:g.77423797C>T		0					E2F7_ENST00000416496.2_Silent_p.A566A	p.A566A	NM_203394.2	NP_976328.2	0	1	1	1.998579	Q96AV8	E2F7_HUMAN		10	1933	-			A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	ENST00000322886.7	0	1	hg19	c.1698G>A	CCDS9016.1	0																																																																																								0.094112		TCGA-XD-AAUH-01A-42D-A40W-08	0.582	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	0	0	1		2	2	2	0		0	0	55		55	50	1	2	-3.736389	1	0.100000	XM_084871			12	12		375	368	0		1	0		0	0	55	0		0.999048	0	0	1	0	0	0	12	375
ALX1	8092	broad.mit.edu	37	12	85674140	85674140	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr12:85674140C>T	ENST00000316824.3	+	1	256	c.101C>T	c.(100-102)aCg>aTg	p.T34M		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	34					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		GTTATGGAGACGCTGGACAAT	0.567																																						ENST00000316824.3	1.000000	0.420000	0.980000	0.570000	0.750000	0.764997	0.750000	1.000000																										0				26						c.(100-102)aCg>aTg		ALX homeobox 1							67.0	66.0	67.0					12																	85674140		2203	4300	6503	SO:0001583	missense	8092	2	121412	38				g.chr12:85674140C>T	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.101C>T	chr12.hg19:g.85674140C>T	ENSP00000315417:p.Thr34Met	0						p.T34M	NM_006982.2	NP_008913.2	0	1	1	1.998579	Q15699	ALX1_HUMAN		1	256	+			Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	1	1	hg19	c.101C>T	CCDS9028.1	0	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409340	0.62399	.	.	ENSG00000180318	ENST00000316824	D	0.92545	-3.06	5.48	5.48	0.80851	5.48	5.48	0.80851	.	0.091744	0.85682	D	0.000000	D	0.85522	0.5716	N	0.14661	0.345	0.44117	D	0.996899	D	0.54047	0.964	B	0.41299	0.353	D	0.88533	0.3104	10	0.87932	D	0	.	15.694	0.77481	0.0:0.8631:0.1369:0.0	.	34	Q15699	ALX1_HUMAN	M	34	ENSP00000315417:T34M	ENSP00000315417:T34M	T	+	2	0	0	ALX1	84198271	84198271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.605000	0.46283	2.562000	0.86427	0.650000	0.86243	ACG	0.094112		TCGA-XD-AAUH-01A-42D-A40W-08	0.567	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	0	0	1		2	2	2	0		0	0	79		79	78	1	2	-13.643090	1	0.100000	NM_006982			13	14		330	326	0		1			0	0	79	0		0.999531	0	0	0	0	0	0	13	330
TMEM132D	121256	broad.mit.edu	37	12	130185196	130185196	+	Silent	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr12:130185196G>A	ENST00000422113.2	-	2	453	c.127C>T	c.(127-129)Ctg>Ttg	p.L43L	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	43					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TAGGTGGGCAGCAAGGAAAAC	0.557																																						ENST00000422113.2	1.000000	0.520000	1.000000	0.730000	0.990000	0.900447	0.990000	1.000000																										0				152						c.(127-129)Ctg>Ttg		transmembrane protein 132D							117.0	80.0	93.0					12																	130185196		2203	4300	6503	SO:0001819	synonymous_variant	121256	0	0					g.chr12:130185196G>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.127C>T	chr12.hg19:g.130185196G>A		0					RP11-174M13.2_ENST00000544036.1_lincRNA	p.L43L	NM_133448.2	NP_597705.2	0	1	1	1.998579	Q14C87	T132D_HUMAN		2	453	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	1	1	hg19	c.127C>T	CCDS9266.1	1																																																																																								0.094112		TCGA-XD-AAUH-01A-42D-A40W-08	0.557	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	1	0	1		2	2	2	0		0	0	33		33	33	1	2	-3.336040	1	0.100000	NM_133448			10	10		188	177	0		1	0		0	0	33	0		0.996135	1.805466e-02	0	0	0	4	0	10	188
TLN2	83660	broad.mit.edu	37	15	63054530	63054530	+	Silent	SNP	G	G	A	rs138708550		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr15:63054530G>A	ENST00000561311.1	+	38	5069	c.4839G>A	c.(4837-4839)tcG>tcA	p.S1613S	TLN2_ENST00000306829.6_Silent_p.S1613S|TLN2_ENST00000472902.1_Silent_p.S6S			Q9Y4G6	TLN2_HUMAN	talin 2	1613					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGAGTTCATCGTACCTCATTC	0.542																																						ENST00000561311.1	1.000000	0.510000	1.000000	0.630000	0.790000	0.803127	0.790000	1.000000																										0				99						c.(4837-4839)tcG>tcA		talin 2		G		1,4405	2.1+/-5.4	0,1,2202	255.0	217.0	230.0		4839	-3.7	1.0	15	dbSNP_134	230	0,8600		0,0,4300	no	coding-synonymous	TLN2	NM_015059.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1613/2543	63054530	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	83660	1	121412	38				g.chr15:63054530G>A	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.4839G>A	chr15.hg19:g.63054530G>A		0					TLN2_ENST00000306829.6_Silent_p.S1613S|TLN2_ENST00000472902.1_Silent_p.S6S	p.S1613S			1	2	3	2.005477	Q9Y4G6	TLN2_HUMAN		38	5069	+			A6NLB8	Silent	SNP	ENST00000561311.1	1	1	hg19	c.4839G>A	CCDS32261.1	0																																																																																								0.106700		TCGA-XD-AAUH-01A-42D-A40W-08	0.542	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2	0	0	1		2	2	2	0		0	0	142		142	137	1	2	-3.431150	1	0.100000				24	23		608	602	0		1	0		0	0	142	0		1.000000	2.154476e-02	0	0	0	6	0	24	608
SPESP1	246777	broad.mit.edu	37	15	69238075	69238075	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr15:69238075G>A	ENST00000310673.3	+	2	356	c.202G>A	c.(202-204)Gca>Aca	p.A68T	NOX5_ENST00000260364.5_Intron|NOX5_ENST00000455873.3_Intron|RP11-809H16.2_ENST00000557966.1_RNA|NOX5_ENST00000448182.3_Intron|SPESP1_ENST00000560188.1_3'UTR	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	68					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						TTATTCTATAGCATCAAAGGG	0.368																																						ENST00000310673.3	1.000000	0.400000	1.000000	0.540000	0.730000	0.748828	0.730000	1.000000																										0				19						c.(202-204)Gca>Aca		sperm equatorial segment protein 1							105.0	107.0	106.0					15																	69238075		2200	4298	6498	SO:0001583	missense	246777	0	0					g.chr15:69238075G>A	AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.202G>A	chr15.hg19:g.69238075G>A	ENSP00000312284:p.Ala68Thr	0					SPESP1_ENST00000560188.1_3'UTR|NOX5_ENST00000260364.5_Intron|NOX5_ENST00000448182.3_Intron|RP11-809H16.2_ENST00000557966.1_RNA|NOX5_ENST00000455873.3_Intron	p.A68T	NM_145658.3	NP_663633.1	1	2	3	2.005477	Q6UW49	SPESP_HUMAN		2	356	+			Q8NG22|Q8WVH8	Missense_Mutation	SNP	ENST00000310673.3	1	1	hg19	c.202G>A	CCDS10230.1	0	.	.	.	.	.	.	.	.	.	.	G	6.226	0.409882	0.11812	.	.	ENSG00000258484	ENST00000310673	T	0.23147	1.92	5.21	-0.685	0.11328	5.21	-0.685	0.11328	.	1.519990	0.04196	N	0.329090	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.23716	0.048	T	0.28681	-1.0036	10	0.40728	T	0.16	-1.6811	5.0363	0.14436	0.2807:0.2783:0.441:0.0	.	68	Q6UW49	SPESP_HUMAN	T	68	ENSP00000312284:A68T	ENSP00000312284:A68T	A	+	1	0	0	SPESP1	67025129	67025129	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.047000	0.14056	-0.013000	0.14199	-0.137000	0.14449	GCA	0.106700		TCGA-XD-AAUH-01A-42D-A40W-08	0.368	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257125.1	0	0	1		2	2	2	1		1	0	80		80	80	1	2	-12.933240	1	0.100000	NM_145658			13	13		366	365	0		1	0		1	0	80	0		0.999545	0	0	0	0	1	0	13	366
MYH11	4629	broad.mit.edu	37	16	15931828	15931828	+	Silent	SNP	C	C	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr16:15931828C>T	ENST00000300036.5	-	2	391	c.282G>A	c.(280-282)acG>acA	p.T94T	MYH11_ENST00000452625.2_Silent_p.T94T|MYH11_ENST00000576790.2_Silent_p.T94T|MYH11_ENST00000396324.3_Silent_p.T94T	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	94	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGTTGAGGCACGTCAGCTCCG	0.547			T	CBFB	AML																																	ENST00000300036.5	1.000000	0.460000	1.000000	0.610000	0.810000	0.808204	0.810000	1.000000				Dom	yes			Dom	yes		16	16p13.13-p13.12	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""				L	L	CBFB		AML		0				123						c.(280-282)acG>acA		myosin, heavy chain 11, smooth muscle							241.0	195.0	210.0					16																	15931828		2197	4300	6497	SO:0001819	synonymous_variant	4629	1	121412	31				g.chr16:15931828C>T	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.282G>A	chr16.hg19:g.15931828C>T		0					MYH11_ENST00000576790.2_Silent_p.T94T|MYH11_ENST00000452625.2_Silent_p.T94T|MYH11_ENST00000396324.3_Silent_p.T94T	p.T94T	NM_002474.2	NP_002465.1	1	2	3	2.023071	P35749	MYH11_HUMAN		2	391	-			D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	1	1	hg19	c.282G>A	CCDS10565.1	0																																																																																								0.110672		TCGA-XD-AAUH-01A-42D-A40W-08	0.547	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	0	0	1		2	2	2	0		0	0	91		91	89	1	2	-3.685797	1	0.100000	NM_001040113			16	16		414	405	0		1	0		0	0	91	0		0.999924	8.558807e-01	0	0	0	92	0	16	414
ATP2A1	487	broad.mit.edu	37	16	28909687	28909687	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr16:28909687G>A	ENST00000357084.3	+	14	1946	c.1679G>A	c.(1678-1680)cGc>cAc	p.R560H	ATP2A1_ENST00000536376.1_Missense_Mutation_p.R435H|ATP2A1_ENST00000395503.4_Missense_Mutation_p.R560H	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	560					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GACACCCTGCGCTGCTTGGCC	0.637																																						ENST00000357084.3	1.000000	0.600000	1.000000	0.820000	0.990000	0.939077	0.990000	1.000000																										0				38						c.(1678-1680)cGc>cAc		ATPase, Ca++ transporting, cardiac muscle, fast twitch 1							42.0	47.0	45.0					16																	28909687		2197	4300	6497	SO:0001583	missense	487	1	121410	31				g.chr16:28909687G>A		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1679G>A	chr16.hg19:g.28909687G>A	ENSP00000349595:p.Arg560His	0					ATP2A1_ENST00000395503.4_Missense_Mutation_p.R560H|ATP2A1_ENST00000536376.1_Missense_Mutation_p.R435H	p.R560H	NM_173201.3	NP_775293.1	1	3	4	2.036193	O14983	AT2A1_HUMAN		14	1946	+			A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	1	1	hg19	c.1679G>A	CCDS10643.1	1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006056	0.93287	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.94862	-3.54;-3.54;-3.54	5.43	4.46	0.54185	5.43	4.46	0.54185	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.98710	0.9567	H	0.99777	4.77	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.98994	1.0809	10	0.87932	D	0	.	15.1782	0.72931	0.0:0.142:0.858:0.0	.	435;560;560	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	H	560;560;597;435	ENSP00000349595:R560H;ENSP00000378879:R560H;ENSP00000443101:R435H	ENSP00000349595:R560H	R	+	2	0	0	ATP2A1	28817188	28817188	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.735000	0.98825	1.267000	0.44247	0.655000	0.94253	CGC	0.181818		TCGA-XD-AAUH-01A-42D-A40W-08	0.637	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	1	0	1		2	2	2	0		0	0	41		41	39	1	2	-14.013450	1	0.100000	NM_004320			12	12		233	231	0		1			0	0	41	0		0.999141	0	0	0	0	0	0	12	233
SETD1A	9739	broad.mit.edu	37	16	30978877	30978877	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr16:30978877G>A	ENST00000262519.8	+	10	3424	c.2738G>A	c.(2737-2739)cGt>cAt	p.R913H		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	913	Glu-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						AAGAGGCCTCGTCCCTCCACT	0.557																																						ENST00000262519.8	1.000000	0.630000	1.000000	0.790000	0.990000	0.922207	0.990000	1.000000																										0				59						c.(2737-2739)cGt>cAt		SET domain containing 1A							73.0	64.0	67.0					16																	30978877		2197	4300	6497	SO:0001583	missense	9739	1	121412	30				g.chr16:30978877G>A	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.2738G>A	chr16.hg19:g.30978877G>A	ENSP00000262519:p.Arg913His	0						p.R913H	NM_014712.1	NP_055527.1	1	2	3	2.009411	O15047	SET1A_HUMAN		10	3424	+			A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	1	1	hg19	c.2738G>A	CCDS32435.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218472	0.79464	.	.	ENSG00000099381	ENST00000262519	T	0.57752	0.38	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.142143	0.45867	D	0.000336	T	0.72187	0.3429	M	0.68593	2.085	0.52501	D	0.999954	D	0.89917	1.0	D	0.85130	0.997	T	0.73575	-0.3939	10	0.87932	D	0	.	18.3124	0.90204	0.0:0.0:1.0:0.0	.	913	O15047	SET1A_HUMAN	H	913	ENSP00000262519:R913H	ENSP00000262519:R913H	R	+	2	0	0	SETD1A	30886378	30886378	1.000000	0.71417	0.931000	0.37212	0.976000	0.68499	8.812000	0.91959	2.857000	0.98124	0.650000	0.86243	CGT	0.107586		TCGA-XD-AAUH-01A-42D-A40W-08	0.557	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	0	0	1		14	4	2	1		1	1	124		124	121	1	2	-3.315943	1	0.100000	NM_014712			23	23		462	451	0		1	1		1	0	124	0		0.945802	5.733433e-01	0	7	0	76	0	23	462
HEATR3	55027	broad.mit.edu	37	16	50128699	50128699	+	Missense_Mutation	SNP	T	T	C			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr16:50128699T>C	ENST00000299192.7	+	12	1785	c.1594T>C	c.(1594-1596)Tcc>Ccc	p.S532P	HEATR3_ENST00000564942.1_3'UTR|HEATR3_ENST00000285767.4_Missense_Mutation_p.S446P	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	532										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CAAGAACATTTCCCAGGTAAG	0.308																																						ENST00000299192.7	1.000000	0.350000	0.950000	0.470000	0.630000	0.673044	0.630000	0.590000																										0				28						c.(1594-1596)Tcc>Ccc		HEAT repeat containing 3							86.0	91.0	89.0					16																	50128699		2198	4300	6498	SO:0001583	missense	55027	0	0					g.chr16:50128699T>C	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1594T>C	chr16.hg19:g.50128699T>C	ENSP00000299192:p.Ser532Pro	0					HEATR3_ENST00000285767.4_Missense_Mutation_p.S446P|HEATR3_ENST00000564942.1_3'UTR	p.S532P	NM_182922.2	NP_891552.1	1	2	3	2.009411	Q7Z4Q2	HEAT3_HUMAN		12	1785	+			A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	ENST00000299192.7	1	1	hg19	c.1594T>C	CCDS10739.1	0	.	.	.	.	.	.	.	.	.	.	T	11.42	1.633940	0.29068	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.64260	-0.09;-0.09	5.92	3.27	0.37495	5.92	3.27	0.37495	Armadillo-type fold (1);	0.267227	0.44902	N	0.000418	T	0.40196	0.1107	N	0.12746	0.255	0.32459	N	0.544366	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.0	T	0.36601	-0.9741	10	0.30854	T	0.27	.	9.138	0.36886	0.0:0.3849:0.0:0.6151	.	446;532	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	P	446;532	ENSP00000285767:S446P;ENSP00000299192:S532P	ENSP00000285767:S446P	S	+	1	0	0	HEATR3	48686200	48686200	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	0.500000	0.22562	0.324000	0.23333	0.533000	0.62120	TCC	0.107586		TCGA-XD-AAUH-01A-42D-A40W-08	0.308	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	0	0	1		2	2	2	0		0	0	97		97	96	1	2	-3.659411	1	0.100000	NM_182922			14	14		460	451	0		1	0		0	0	97	0		0.999727	4.000499e-01	0	0	0	44	0	14	460
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.730000	0.120000	0.540000	0.210000	0.350000	0.380745	0.350000	0.320000	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	24185	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	c.(733-735)Ggc>Agc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	SO:0001583	missense	7157	1	121412	39	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577548C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	chr17.hg19:g.7577548C>T	ENSP00000269305:p.Gly245Ser	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S	p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	0	0	1.941209	P04637	P53_HUMAN		7	922	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.733G>A	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	0	TP53	7518273	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	0.066390		TCGA-XD-AAUH-01A-42D-A40W-08	0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	0	0	1		2	2	2	0		0	0	53		53	53	1	2	-2.672102	1	0.100000	NM_000546			4	4		232	227	0		1	1	1	0	0	53	646		0.886033	3.157887e-01	9.980583e-01	9	30	46	864	4	232
JAK3	3718	broad.mit.edu	37	19	17945947	17945947	+	Silent	SNP	C	C	T	rs200499852		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr19:17945947C>T	ENST00000527670.1	-	14	2021	c.1992G>A	c.(1990-1992)ccG>ccA	p.P664P	JAK3_ENST00000534444.1_Silent_p.P664P|JAK3_ENST00000458235.1_Silent_p.P664P			P52333	JAK3_HUMAN	Janus kinase 3	664	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	TGATGAAGGGCGGGCTCCCAT	0.637		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																	ENST00000527670.1	1.000000	0.510000	1.000000	0.720000	0.980000	0.893074	0.980000	1.000000		2		Dom	yes			Dom	yes		19	19p13.1	19p13.1	3718	Mis	Janus kinase 3				L	L			acute megakaryocytic leukemia, ETP ALL		0				147						c.(1990-1992)ccG>ccA		Janus kinase 3	Tofacitinib(DB08895)	C		0,4406		0,0,2203	49.0	48.0	48.0		1992	-9.8	0.1	19		48	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	JAK3	NM_000215.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		664/1125	17945947	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3718	6	121412	37				g.chr19:17945947C>T	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1992G>A	chr19.hg19:g.17945947C>T		0					JAK3_ENST00000458235.1_Silent_p.P664P|JAK3_ENST00000534444.1_Silent_p.P664P	p.P664P			0	1	1	1.998282	P52333	JAK3_HUMAN		14	2021	-			Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Silent	SNP	ENST00000527670.1	1	1	hg19	c.1992G>A	CCDS12366.1	1																																																																																								0.094112		TCGA-XD-AAUH-01A-42D-A40W-08	0.637	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	1	0	1		2	2	2	0		0	0	31		31	32	1	2	-3.309372	1	0.100000	NM_000215			10	10		192	189	0		1	0		0	0	31	0		0.996869	3.104419e-01	0	0	0	21	0	10	192
IZUMO1	284359	broad.mit.edu	37	19	49245081	49245081	+	Missense_Mutation	SNP	G	G	C			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr19:49245081G>C	ENST00000332955.2	-	8	1266	c.719C>G	c.(718-720)tCc>tGc	p.S240C	RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	240	Ig-like C2-type.				cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		GGCTGGGCTGGAATTCACAGA	0.607																																						ENST00000332955.2	1.000000	0.420000	1.000000	0.630000	0.910000	0.845495	0.910000	1.000000																										0				17						c.(718-720)tCc>tGc		izumo sperm-egg fusion 1							46.0	45.0	45.0					19																	49245081		2203	4300	6503	SO:0001583	missense	284359	0	0					g.chr19:49245081G>C	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.719C>G	chr19.hg19:g.49245081G>C	ENSP00000327786:p.Ser240Cys	0					RASIP1_ENST00000222145.4_5'Flank	p.S240C	NM_182575.2	NP_872381.2	1	2	3	2.002937	Q8IYV9	IZUM1_HUMAN		8	1266	-		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	ENST00000332955.2	0	1	hg19	c.719C>G	CCDS12732.1	1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764786	0.69878	.	.	ENSG00000182264	ENST00000332955	D	0.84223	-1.82	5.26	-1.64	0.08318	5.26	-1.64	0.08318	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.688430	0.01088	N	0.005125	D	0.86594	0.5970	L	0.27053	0.805	0.09310	N	1	D	0.69078	0.997	P	0.57468	0.821	T	0.76751	-0.2844	10	0.56958	D	0.05	0.0117	15.0773	0.72087	0.0:0.0:0.1984:0.8016	.	240	Q8IYV9	IZUM1_HUMAN	C	240	ENSP00000327786:S240C	ENSP00000327786:S240C	S	-	2	0	0	IZUMO1	53936893	53936893	0.000000	0.05858	0.000000	0.03702	0.245000	0.25701	-0.261000	0.08694	-0.282000	0.09128	0.561000	0.74099	TCC	0.106256		TCGA-XD-AAUH-01A-42D-A40W-08	0.607	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	0	0	1		2	2	2	0		0	0	31		31	30	1	2	-10.591370	1	0.100000	NM_182575			8	8		182	175	0		1			0	0	31	0		0.988147	0	0	0	0	0	0	8	182
SESN2	83667	broad.mit.edu	37	1	28595710	28595710	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr1:28595710G>A	ENST00000253063.3	+	2	428	c.107G>A	c.(106-108)cGg>cAg	p.R36Q		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	36					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGAGAGCCGGGCTCGGCGA	0.557																																						ENST00000253063.3	1.000000	0.350000	0.860000	0.480000	0.650000	0.672658	0.650000	1.000000																										0				27						c.(106-108)cGg>cAg		sestrin 2							60.0	65.0	63.0					1																	28595710		2203	4300	6503	SO:0001583	missense	83667	3	121394	42				g.chr1:28595710G>A	AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.107G>A	chr1.hg19:g.28595710G>A	ENSP00000253063:p.Arg36Gln	0						p.R36Q	NM_031459.4	NP_113647.1	0	0	0	1.957721	P58004	SESN2_HUMAN		2	428	+		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)	Q5T7D0|Q96SI5	Missense_Mutation	SNP	ENST00000253063.3	1	1	hg19	c.107G>A	CCDS321.1	0	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436114	0.25813	.	.	ENSG00000130766	ENST00000253063	T	0.17054	2.3	5.38	2.31	0.28768	5.38	2.31	0.28768	.	0.689341	0.14538	N	0.313426	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39418	-0.9615	10	0.08599	T	0.76	-16.7583	1.6538	0.02777	0.2294:0.3653:0.2696:0.1357	.	36	P58004	SESN2_HUMAN	Q	36	ENSP00000253063:R36Q	ENSP00000253063:R36Q	R	+	2	0	0	SESN2	28468297	28468297	0.000000	0.05858	0.629000	0.29254	0.872000	0.50106	0.514000	0.22786	0.616000	0.30141	0.655000	0.94253	CGG	0.075026		TCGA-XD-AAUH-01A-42D-A40W-08	0.557	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009840.1	0	0	1		2	2	2	0		0	0	76		76	68	1	2	-2.370503	0	0.100000				11	11		318	288	0		1	0		0	0	76	0		0.997313	8.001076e-03	0	0	0	4	0	11	318
CRYZL1	9946	broad.mit.edu	37	21	34975784	34975784	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr21:34975784G>A	ENST00000381554.3	-	7	476	c.391C>T	c.(391-393)Cgt>Tgt	p.R131C	CRYZL1_ENST00000361534.2_Missense_Mutation_p.R155C|CRYZL1_ENST00000381540.3_Missense_Mutation_p.R131C|AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000445393.1_Missense_Mutation_p.R93C|CRYZL1_ENST00000290244.5_Missense_Mutation_p.R116C	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	131					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						GTATAGGCACGCACTCCATCC	0.423																																						ENST00000381554.3	0.600000	0.110000	0.450000	0.190000	0.300000	0.325157	0.300000	0.280000																										0				3						c.(391-393)Cgt>Tgt		crystallin, zeta (quinone reductase)-like 1							235.0	186.0	203.0					21																	34975784		2203	4300	6503	SO:0001583	missense	9946	4	121412	37				g.chr21:34975784G>A	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.391C>T	chr21.hg19:g.34975784G>A	ENSP00000370966:p.Arg131Cys	0					AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000445393.1_Missense_Mutation_p.R93C|CRYZL1_ENST00000381540.3_Missense_Mutation_p.R131C|CRYZL1_ENST00000361534.2_Missense_Mutation_p.R155C|CRYZL1_ENST00000290244.5_Missense_Mutation_p.R116C	p.R131C	NM_145858.2	NP_665857.2	0	1	1	1.992862	O95825	QORL1_HUMAN		7	476	-			B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	ENST00000381554.3	0	1	hg19	c.391C>T	CCDS13633.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.25|11.25	1.583221|1.583221	0.28268|0.28268	.|.	.|.	ENSG00000205758|ENSG00000205758	ENST00000440526|ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000426935;ENST00000431177;ENST00000417979	.|T;T;T;T;T;T;T;T	.|0.40476	.|1.59;1.59;1.59;1.59;1.59;1.03;1.03;1.03	5.41|5.41	4.53|4.53	0.55603|0.55603	5.41|5.41	4.53|4.53	0.55603|0.55603	.|GroES-like (1);	.|0.269718	.|0.34676	.|N	.|0.003765	T|T	0.42291|0.42291	0.1196|0.1196	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	.|B;B	.|0.22604	.|0.019;0.072	.|B;B	.|0.22601	.|0.036;0.04	T|T	0.39961|0.39961	-0.9588|-0.9588	5|10	.|0.72032	.|D	.|0.01	-14.8776|-14.8776	12.8285|12.8285	0.57733|0.57733	0.0797:0.0:0.9203:0.0|0.0797:0.0:0.9203:0.0	.|.	.|131;155	.|O95825;A6NHJ8	.|QORL1_HUMAN;.	V|C	74|131;116;131;93;155;131;79;131;79	.|ENSP00000370966:R131C;ENSP00000290244:R116C;ENSP00000370951:R131C;ENSP00000399730:R93C;ENSP00000355075:R155C;ENSP00000387660:R79C;ENSP00000405510:R131C;ENSP00000402844:R79C	.|ENSP00000290244:R116C	A|R	-|-	2|1	0|0	0|0	CRYZL1|CRYZL1	33897654|33897654	33897654|33897654	0.913000|0.913000	0.31002|0.31002	0.545000|0.545000	0.28153|0.28153	0.516000|0.516000	0.34256|0.34256	2.811000|2.811000	0.47986|0.47986	1.276000|1.276000	0.44395|0.44395	0.655000|0.655000	0.94253|0.94253	GCG|CGT	0.092742		TCGA-XD-AAUH-01A-42D-A40W-08	0.423	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	0	0	1		14	2	2	1		1	1	100		100	97	1	2	-2.733975	1	0.100000	NM_145858			5	6		349	343	0		0	0		1	0	100	0		0.027566	3.214975e-02	0	0	0	16	0	5	349
DYRK1A	1859	broad.mit.edu	37	21	38884243	38884243	+	Silent	SNP	T	T	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr21:38884243T>A	ENST00000398960.2	+	11	1776	c.1701T>A	c.(1699-1701)ggT>ggA	p.G567G	DYRK1A_ENST00000398956.2_Missense_Mutation_p.L526M|DYRK1A_ENST00000338785.3_3'UTR|DYRK1A_ENST00000455387.2_Silent_p.G339G|DYRK1A_ENST00000339659.4_Silent_p.G558G	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	567					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CTCCTCTTGGTTGGTCAGGCA	0.428																																					Melanoma(114;464 1602 31203 43785 45765)	ENST00000398960.2	1.000000	0.410000	0.970000	0.560000	0.750000	0.757359	0.750000	1.000000																										0				42						c.(1699-1701)ggT>ggA		dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A							89.0	82.0	85.0					21																	38884243		2203	4300	6503	SO:0001819	synonymous_variant	1859	0	0					g.chr21:38884243T>A	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1701T>A	chr21.hg19:g.38884243T>A		0					DYRK1A_ENST00000339659.4_Silent_p.G558G|DYRK1A_ENST00000398956.2_Missense_Mutation_p.L526M|DYRK1A_ENST00000455387.2_Silent_p.G339G|DYRK1A_ENST00000338785.3_3'UTR	p.G567G	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	0	1	1	1.992862	Q13627	DYR1A_HUMAN		11	1776	+			O60769|Q92582|Q92810|Q9UNM5	Silent	SNP	ENST00000398960.2	1	1	hg19	c.1701T>A	CCDS42925.1	0	.	.	.	.	.	.	.	.	.	.	T	10.52	1.372020	0.24857	.	.	ENSG00000157540	ENST00000398956	T	0.57907	0.37	5.54	-3.43	0.04810	5.54	-3.43	0.04810	.	.	.	.	.	T	0.30727	0.0774	.	.	.	0.80722	D	1	B	0.12013	0.005	B	0.09377	0.004	T	0.12142	-1.0559	8	0.40728	T	0.16	.	1.1146	0.01711	0.2244:0.3067:0.1152:0.3537	.	526	Q13627-3	.	M	526	ENSP00000381929:L526M	ENSP00000381929:L526M	L	+	1	2	2	DYRK1A	37806113	37806113	0.958000	0.32768	0.989000	0.46669	0.154000	0.21943	0.013000	0.13310	-0.443000	0.07180	-0.316000	0.08728	TTG	0.092742		TCGA-XD-AAUH-01A-42D-A40W-08	0.428	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	0	0	1		2	2	2	0		0	0	67		67	67	1	2	-13.009270	1	0.100000	NM_001396			12	12		308	301	0		1	1		0	0	67	0		0.999040	3.373776e-01	0	7	0	23	0	12	308
GEN1	348654	broad.mit.edu	37	2	17963200	17963200	+	Silent	SNP	C	C	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr2:17963200C>T	ENST00000381254.2	+	14	2935	c.2721C>T	c.(2719-2721)agC>agT	p.S907S	SMC6_ENST00000402989.1_Intron|GEN1_ENST00000317402.7_Silent_p.S907S	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	907					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GATTCCAAAGCACTTGAAATT	0.348								Homologous recombination																														ENST00000381254.2	1.000000	0.300000	1.000000	0.480000	0.740000	0.743132	0.740000	1.000000																										0				16						c.(2719-2721)agC>agT	Homologous recombination	GEN1 Holliday junction 5' flap endonuclease							44.0	49.0	47.0					2																	17963200		2178	4292	6470	SO:0001819	synonymous_variant	348654	0	0					g.chr2:17963200C>T	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.2721C>T	chr2.hg19:g.17963200C>T		0					GEN1_ENST00000317402.7_Silent_p.S907S|SMC6_ENST00000402989.1_Intron	p.S907S	NM_001130009.1	NP_001123481.1	1	2	3	2.003610	Q17RS7	GEN_HUMAN		14	2935	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)		Q17RS9|Q6ZN37	Silent	SNP	ENST00000381254.2	0	1	hg19	c.2721C>T	CCDS1691.1	0																																																																																								0.106256		TCGA-XD-AAUH-01A-42D-A40W-08	0.348	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241661.2	0	0	1		2	2	2	0		0	0	47		47	46	1	2	-8.141538	1	0.100000	NM_182625			6	6		173	168	0		1	0		0	0	47	0		0.962615	8.137784e-02	0	0	0	12	0	6	173
OTOF	9381	broad.mit.edu	37	2	26683776	26683776	+	Missense_Mutation	SNP	C	C	T	rs373876327		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr2:26683776C>T	ENST00000272371.2	-	44	5782	c.5656G>A	c.(5656-5658)Gtc>Atc	p.V1886I	OTOF_ENST00000339598.3_Missense_Mutation_p.V1119I|OTOF_ENST00000403946.3_Missense_Mutation_p.V1886I|OTOF_ENST00000338581.6_Missense_Mutation_p.V1119I|OTOF_ENST00000402415.3_Missense_Mutation_p.V1196I	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1886			V -> A (in dbSNP:rs45442103).		membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCCTTTGACGCGCTTTTGC	0.647													c|||	1	0.000199681	0.0	0.0	5008	,	,		15202	0.001		0.0	False		,,,				2504	0.0				GBM(102;732 1451 20652 24062 31372)	ENST00000272371.2	1.000000	0.370000	1.000000	0.560000	0.820000	0.794860	0.820000	1.000000																										0				106						c.(5656-5658)Gtc>Atc		otoferlin			ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	86.0	70.0	75.0		3355,5656,3586,3355	3.8	1.0	2		75	0,8600		0,0,4300	no	missense,missense,missense,missense	OTOF	NM_004802.3,NM_194248.2,NM_194322.2,NM_194323.2	29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign,benign	1119/1231,1886/1998,1196/1308,1119/1231	26683776	1,13005	2203	4300	6503	SO:0001583	missense	9381	0	0					g.chr2:26683776C>T	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5656G>A	chr2.hg19:g.26683776C>T	ENSP00000272371:p.Val1886Ile	0					OTOF_ENST00000402415.3_Missense_Mutation_p.V1196I|OTOF_ENST00000339598.3_Missense_Mutation_p.V1119I|OTOF_ENST00000338581.6_Missense_Mutation_p.V1119I|OTOF_ENST00000403946.3_Missense_Mutation_p.V1886I	p.V1886I	NM_194248.2	NP_919224.1	1	2	3	2.003610	Q9HC10	OTOF_HUMAN		44	5782	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	1	1	hg19	c.5656G>A	CCDS1725.1	0	.	.	.	.	.	.	.	.	.	.	c	14.31	2.498530	0.44455	2.27E-4	0.0	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	4.73	3.85	0.44370	4.73	3.85	0.44370	C2 calcium/lipid-binding domain, CaLB (1);	0.061467	0.64402	D	0.000005	T	0.65004	0.2650	L	0.35487	1.065	0.52501	D	0.999958	B;B;B;B	0.29909	0.261;0.042;0.036;0.018	B;B;B;B	0.22753	0.041;0.018;0.024;0.018	T	0.59695	-0.7406	10	0.26408	T	0.33	-24.5353	12.7675	0.57401	0.0:0.9189:0.0:0.0811	.	1886;1119;1196;1119	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	I	1119;1119;1196;1886;1886	ENSP00000345137:V1119I;ENSP00000344521:V1119I;ENSP00000383906:V1196I;ENSP00000272371:V1886I;ENSP00000385255:V1886I	ENSP00000272371:V1886I	V	-	1	0	0	OTOF	26537280	26537280	0.994000	0.37717	0.987000	0.45799	0.970000	0.65996	2.719000	0.47244	0.991000	0.38814	0.457000	0.33378	GTC	0.106256		TCGA-XD-AAUH-01A-42D-A40W-08	0.647	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3	0	0	1		2	2	2	0		0	0	44		44	41	1	2	-9.675513	1	0.100000				8	8		205	197	0		1			0	0	44	0		0.988041	0	0	0	0	0	0	8	205
PLEKHH2	130271	broad.mit.edu	37	2	43939401	43939401	+	Missense_Mutation	SNP	A	A	G			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr2:43939401A>G	ENST00000282406.4	+	15	2449	c.2339A>G	c.(2338-2340)gAt>gGt	p.D780G		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	780	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTGACTGCAGATTCTCCCAAT	0.418																																						ENST00000282406.4	1.000000	0.380000	1.000000	0.530000	0.730000	0.747277	0.730000	1.000000																										0				56						c.(2338-2340)gAt>gGt		pleckstrin homology domain containing, family H (with MyTH4 domain) member 2							155.0	144.0	148.0					2																	43939401		2203	4300	6503	SO:0001583	missense	130271	0	0					g.chr2:43939401A>G	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2339A>G	chr2.hg19:g.43939401A>G	ENSP00000282406:p.Asp780Gly	0						p.D780G	NM_172069.3	NP_742066.2	1	2	3	2.010757	Q8IVE3	PKHH2_HUMAN		15	2449	+		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	1	1	hg19	c.2339A>G	CCDS1812.1	0	.	.	.	.	.	.	.	.	.	.	A	24.0	4.482238	0.84747	.	.	ENSG00000152527	ENST00000282406	T	0.14144	2.53	5.16	5.16	0.70880	5.16	5.16	0.70880	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	M	0.87097	2.86	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.81914	0.953;0.995	T	0.51896	-0.8647	10	0.87932	D	0	-24.0949	14.981	0.71311	1.0:0.0:0.0:0.0	.	780;217	Q8IVE3;Q8IVE3-2	PKHH2_HUMAN;.	G	780	ENSP00000282406:D780G	ENSP00000282406:D780G	D	+	2	0	0	PLEKHH2	43792905	43792905	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.890000	0.92477	1.935000	0.56089	0.377000	0.23210	GAT	0.108028		TCGA-XD-AAUH-01A-42D-A40W-08	0.418	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	0	0	1		2	2	2	0		0	0	110		110	109	1	2	-12.584310	1	0.100000	NM_172069			12	12		344	339	0		1	0		0	0	110	0		0.999077	1.301965e-02	0	0	0	5	0	12	344
CNTNAP5	129684	broad.mit.edu	37	2	125192175	125192175	+	Missense_Mutation	SNP	A	A	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr2:125192175A>T	ENST00000431078.1	+	5	1008	c.644A>T	c.(643-645)gAt>gTt	p.D215V		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	215	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATGCAAGGAGATGGGGTCCTG	0.507																																						ENST00000431078.1	1.000000	0.380000	1.000000	0.570000	0.830000	0.802473	0.830000	1.000000																										0				176						c.(643-645)gAt>gTt		contactin associated protein-like 5							97.0	98.0	97.0					2																	125192175		2075	4225	6300	SO:0001583	missense	129684	0	0					g.chr2:125192175A>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.644A>T	chr2.hg19:g.125192175A>T	ENSP00000399013:p.Asp215Val	0						p.D215V	NM_130773.2	NP_570129.1	1	2	3	2.010757	Q8WYK1	CNTP5_HUMAN		5	1008	+			Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	1	1	hg19	c.644A>T	CCDS46401.1	0	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370207	0.82573	.	.	ENSG00000155052	ENST00000431078	T	0.80909	-1.43	5.48	5.48	0.80851	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.49305	D	0.000151	D	0.91257	0.7244	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93000	0.6422	10	0.87932	D	0	.	14.7735	0.69699	1.0:0.0:0.0:0.0	.	215	Q8WYK1	CNTP5_HUMAN	V	215	ENSP00000399013:D215V	ENSP00000399013:D215V	D	+	2	0	0	CNTNAP5	124908645	124908645	1.000000	0.71417	0.999000	0.59377	0.911000	0.54048	9.169000	0.94788	2.084000	0.62774	0.533000	0.62120	GAT	0.108028		TCGA-XD-AAUH-01A-42D-A40W-08	0.507	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3	0	0	1		2	2	2	0		0	0	53		53	53	1	2	-3.929229	1	0.100000				8	8		205	203	0		1			0	0	53	0		0.989367	0	0	0	0	0	0	8	205
LSAMP	4045	broad.mit.edu	37	3	115560805	115560805	+	Missense_Mutation	SNP	G	G	A	rs117984283		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr3:115560805G>A	ENST00000490035.2	-	6	1305	c.806C>T	c.(805-807)aCg>aTg	p.T269M	LSAMP_ENST00000498645.1_5'UTR|LSAMP_ENST00000539563.1_Missense_Mutation_p.T266M	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	269	Ig-like C2-type 3.				cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		CTGGCCCTCCGTGCTCTTAAT	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		18695	0.001		0.0	False		,,,				2504	0.0					ENST00000490035.2	1.000000	0.180000	0.850000	0.310000	0.500000	0.558793	0.500000	1.000000																										0				31						c.(805-807)aCg>aTg		limbic system-associated membrane protein		G	MET/THR	0,4406		0,0,2203	104.0	91.0	95.0		806	4.9	1.0	3	dbSNP_132	95	1,8599	1.2+/-3.3	0,1,4299	no	missense	LSAMP	NM_002338.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	269/339	115560805	1,13005	2203	4300	6503	SO:0001583	missense	4045	3	121412	38				g.chr3:115560805G>A	U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.806C>T	chr3.hg19:g.115560805G>A	ENSP00000419000:p.Thr269Met	0					LSAMP_ENST00000498645.1_5'UTR|LSAMP_ENST00000539563.1_Missense_Mutation_p.T266M	p.T269M	NM_002338.3	NP_002329.2	1	2	3	2.000707	Q13449	LSAMP_HUMAN		6	1305	-		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)	Q8IV49	Missense_Mutation	SNP	ENST00000490035.2	0	1	hg19	c.806C>T	CCDS2982.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	15.98	2.991249	0.54041	0.0	1.16E-4	ENSG00000185565	ENST00000333617;ENST00000490035;ENST00000539563	T;T;T	0.68624	-0.34;-0.34;-0.34	5.87	4.89	0.63831	5.87	4.89	0.63831	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.335564	0.33854	N	0.004494	T	0.69744	0.3145	L	0.46614	1.455	0.39182	D	0.96279	D;D	0.65815	0.995;0.995	P;P	0.55545	0.666;0.778	T	0.68269	-0.5453	10	0.33141	T	0.24	-5.6108	13.4795	0.61328	0.1018:0.0:0.8982:0.0	.	269;269	B2RCU8;Q13449	.;LSAMP_HUMAN	M	253;269;266	ENSP00000328455:T253M;ENSP00000419000:T269M;ENSP00000443429:T266M	ENSP00000328455:T253M	T	-	2	0	0	LSAMP	117043495	117043495	0.996000	0.38824	0.998000	0.56505	0.996000	0.88848	2.307000	0.43682	2.785000	0.95823	0.655000	0.94253	ACG	0.105812		TCGA-XD-AAUH-01A-42D-A40W-08	0.483	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354495.4	0	0	1		2	2	2	0		0	0	56		56	53	1	2	-3.191423	1	0.100000	NM_002338			5	5		221	216	0		1	0		0	0	56	0		0.934504	3.091247e-01	0	0	0	43	0	5	221
SRGAP3	9901	broad.mit.edu	37	3	9036070	9036070	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr3:9036070C>T	ENST00000383836.3	-	19	2792	c.2365G>A	c.(2365-2367)Gtg>Atg	p.V789M	SRGAP3_ENST00000360413.3_Missense_Mutation_p.V765M	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	789					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		AGTCCATCCACGCCGTTGTGC	0.577			T	RAF1	pilocytic astrocytoma																																	ENST00000383836.3	1.000000	0.390000	1.000000	0.540000	0.730000	0.747724	0.730000	1.000000				Dom	yes			Dom	yes		3	3p25.3	3p25.3	9901	T	SLIT-ROBO Rho GTPase activating protein 3				M	M	RAF1		pilocytic astrocytoma	SRGAP3/RAF1(6)	0				54						c.(2365-2367)Gtg>Atg		SLIT-ROBO Rho GTPase activating protein 3							88.0	88.0	88.0					3																	9036070		2203	4300	6503	SO:0001583	missense	9901	6	121412	43				g.chr3:9036070C>T	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2365G>A	chr3.hg19:g.9036070C>T	ENSP00000373347:p.Val789Met	0					SRGAP3_ENST00000360413.3_Missense_Mutation_p.V765M	p.V789M	NM_014850.3	NP_055665.1	1	2	3	2.000707	O43295	SRGP3_HUMAN		19	2792	-			Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	1	1	hg19	c.2365G>A	CCDS2572.1	0	.	.	.	.	.	.	.	.	.	.	C	23.8	4.461566	0.84317	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.48522	0.81;0.81	4.95	4.95	0.65309	4.95	4.95	0.65309	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.57666	0.2069	L	0.31420	0.93	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.945	T	0.55560	-0.8122	10	0.34782	T	0.22	.	18.1343	0.89612	0.0:1.0:0.0:0.0	.	765;789	O43295-2;O43295	.;SRGP2_HUMAN	M	789;765	ENSP00000373347:V789M;ENSP00000353587:V765M	ENSP00000353587:V765M	V	-	1	0	0	SRGAP3	9011070	9011070	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.879000	0.63100	2.433000	0.82419	0.650000	0.86243	GTG	0.105812		TCGA-XD-AAUH-01A-42D-A40W-08	0.577	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3	0	0	1		2	2	2	0		0	0	64		64	62	1	2	-3.916487	1	0.100000				12	12		336	327	0		1	0		0	0	64	0		0.999009	8.392423e-03	0	0	0	4	0	12	336
PTPRG	5793	broad.mit.edu	37	3	62257096	62257096	+	Missense_Mutation	SNP	G	G	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr3:62257096G>T	ENST00000474889.1	+	21	3425	c.3048G>T	c.(3046-3048)agG>agT	p.R1016S	PTPRG-AS1_ENST00000475371.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG_ENST00000295874.10_Missense_Mutation_p.R987S|PTPRG-AS1_ENST00000462497.1_RNA|PTPRG-AS1_ENST00000479018.1_RNA|PTPRG-AS1_ENST00000474795.1_RNA	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1016	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		AGAATGAAAGGGTAGTGATCC	0.478																																						ENST00000474889.1	1.000000	0.450000	1.000000	0.640000	0.890000	0.846998	0.890000	1.000000																										0				62						c.(3046-3048)agG>agT		protein tyrosine phosphatase, receptor type, G							102.0	101.0	101.0					3																	62257096		2203	4300	6503	SO:0001583	missense	5793	0	0					g.chr3:62257096G>T	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.3048G>T	chr3.hg19:g.62257096G>T	ENSP00000418112:p.Arg1016Ser	0					PTPRG_ENST00000295874.10_Missense_Mutation_p.R987S|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000462497.1_RNA|PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000475371.1_RNA|PTPRG-AS1_ENST00000479018.1_RNA	p.R1016S	NM_002841.3	NP_002832.3	1	2	3	2.000707	P23470	PTPRG_HUMAN		21	3425	+			B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	1	1	hg19	c.3048G>T	CCDS2895.1	1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341750	0.61073	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.15017	2.46;2.46	5.74	2.67	0.31697	5.74	2.67	0.31697	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.85682	D	0.000000	T	0.45175	0.1329	H	0.94582	3.555	0.44079	D	0.996834	P;D;D	0.69078	0.6;0.997;0.997	B;D;D	0.65010	0.382;0.931;0.922	T	0.40905	-0.9538	10	0.87932	D	0	.	6.245	0.20811	0.2928:0.0:0.567:0.1403	.	262;987;1016	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	S	1016;987	ENSP00000418112:R1016S;ENSP00000295874:R987S	ENSP00000295874:R987S	R	+	3	2	2	PTPRG	62232136	62232136	0.062000	0.20869	0.021000	0.16686	0.953000	0.61014	0.448000	0.21726	0.299000	0.22661	0.591000	0.81541	AGG	0.105812		TCGA-XD-AAUH-01A-42D-A40W-08	0.478	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	0	0	1		2	2	2	0		0	0	65		65	64	1	2	-2.896817	1	0.100000	NM_002841			10	10		228	216	0		1	0		0	0	65	0		0.996181	1.685431e-01	0	0	0	16	0	10	228
GATA2	2624	broad.mit.edu	37	3	128200008	128200008	+	Silent	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr3:128200008G>A	ENST00000341105.2	-	6	1628	c.1297C>T	c.(1297-1299)Ctg>Ttg	p.L433L	GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000487848.1_Silent_p.L433L|GATA2_ENST00000430265.2_Silent_p.L419L	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	433					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		TGTCCAGCCAGGGCAGCTGCA	0.617			Mis		AML(CML blast transformation)																																	ENST00000341105.2	1.000000	0.370000	1.000000	0.530000	0.740000	0.749466	0.740000	1.000000				Dom	yes			Dom	yes		3	3q21.3	3q21.3	2624	Mis	GATA binding protein 2				L	L			AML(CML blast transformation)		0				79						c.(1297-1299)Ctg>Ttg		GATA binding protein 2							124.0	109.0	114.0					3																	128200008		2203	4300	6503	SO:0001819	synonymous_variant	2624	0	0					g.chr3:128200008G>A	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1297C>T	chr3.hg19:g.128200008G>A		0					GATA2_ENST00000430265.2_Silent_p.L419L|GATA2_ENST00000487848.1_Silent_p.L433L|GATA2_ENST00000489987.1_5'UTR	p.L433L	NM_032638.4	NP_116027.2	1	2	3	2.000707	P23769	GATA2_HUMAN		6	1628	-			D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Silent	SNP	ENST00000341105.2	0	1	hg19	c.1297C>T	CCDS3049.1	0																																																																																								0.105812		TCGA-XD-AAUH-01A-42D-A40W-08	0.617	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1	0	0	1		2	2	2	0		0	0	58		58	53	1	2	-2.888201	1	0.100000	NM_032638			10	9		280	276	0		1	0		0	0	58	0		0.996742	9.926587e-02	0	0	0	14	0	10	280
ST8SIA4	7903	broad.mit.edu	37	5	100222206	100222206	+	Missense_Mutation	SNP	C	C	T	rs376980451		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr5:100222206C>T	ENST00000231461.5	-	3	654	c.344G>A	c.(343-345)cGc>cAc	p.R115H	ST8SIA4_ENST00000507360.2_5'UTR|ST8SIA4_ENST00000451528.2_Missense_Mutation_p.R115H	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	115					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		TAGTGTCCGGCGCCTGTCAAG	0.433																																						ENST00000231461.5	1.000000	0.290000	0.970000	0.420000	0.590000	0.638706	0.590000	0.540000																										0				25						c.(343-345)cGc>cAc		ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4		C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	137.0	130.0	132.0		344,344	5.9	1.0	5		132	0,8600		0,0,4300	no	missense,missense	ST8SIA4	NM_175052.1,NM_005668.4	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	115/169,115/360	100222206	1,13005	2203	4300	6503	SO:0001583	missense	7903	3	121412	38				g.chr5:100222206C>T	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.344G>A	chr5.hg19:g.100222206C>T	ENSP00000231461:p.Arg115His	0					ST8SIA4_ENST00000451528.2_Missense_Mutation_p.R115H|ST8SIA4_ENST00000507360.2_5'UTR	p.R115H	NM_005668.4	NP_005659.1	1	2	3	2.010893	Q92187	SIA8D_HUMAN		3	654	-		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	1	1	hg19	c.344G>A	CCDS4091.1	0	.	.	.	.	.	.	.	.	.	.	C	11.10	1.538956	0.27475	2.27E-4	0.0	ENSG00000113532	ENST00000231461;ENST00000451528	T;T	0.31247	1.5;1.5	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.13200	0.0320	N	0.02916	-0.46	0.58432	D	0.999998	B	0.29115	0.233	B	0.20184	0.028	T	0.16541	-1.0399	10	0.02654	T	1	.	19.3049	0.94157	0.0:1.0:0.0:0.0	.	115	Q92187	SIA8D_HUMAN	H	115	ENSP00000231461:R115H;ENSP00000428914:R115H	ENSP00000231461:R115H	R	-	2	0	0	ST8SIA4	100250105	100250105	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	3.665000	0.54532	2.809000	0.96659	0.557000	0.71058	CGC	0.108028		TCGA-XD-AAUH-01A-42D-A40W-08	0.433	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	0	0	1		2	2	2	0		0	0	119		119	119	1	2	-2.810048	1	0.100000	NM_005668			10	10		361	354	0		1	0		0	0	119	0		0.996669	6.553383e-02	0	0	0	14	0	10	361
SLIT3	6586	broad.mit.edu	37	5	168310293	168310293	+	Silent	SNP	G	G	A	rs372146302	byFrequency	TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr5:168310293G>A	ENST00000519560.1	-	5	881	c.462C>T	c.(460-462)cgC>cgT	p.R154R	SLIT3_ENST00000404867.3_Silent_p.R154R|SLIT3_ENST00000332966.8_Silent_p.R154R	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	154					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGGTGATGCCGCGGAACGCCT	0.502													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18893	0.001		0.0	False		,,,				2504	0.0				Ovarian(29;311 847 10864 17279 24903)	ENST00000519560.1	1.000000	0.270000	1.000000	0.420000	0.630000	0.668449	0.630000	1.000000																										0				100						c.(460-462)cgC>cgT		slit homolog 3 (Drosophila)		G		0,4406		0,0,2203	130.0	107.0	115.0		462	-9.9	0.0	5		115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLIT3	NM_003062.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		154/1524	168310293	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6586	5	121412	41				g.chr5:168310293G>A	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.462C>T	chr5.hg19:g.168310293G>A		0					SLIT3_ENST00000404867.3_Silent_p.R154R|SLIT3_ENST00000332966.8_Silent_p.R154R	p.R154R	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	1	2	3	2.010893	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	5	881	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	1	1	hg19	c.462C>T	CCDS4369.1	0																																																																																								0.108028		TCGA-XD-AAUH-01A-42D-A40W-08	0.502	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	0	0	1		2	2	2	0		0	0	49		49	47	1	2	-2.946364	1	0.100000	NM_003062			7	7		242	238	0		1	0		0	0	49	0		0.979893	6.846996e-01	0	0	0	80	0	7	242
AHRR	57491	broad.mit.edu	37	5	433019	433019	+	Missense_Mutation	SNP	C	C	T	rs201402371		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr5:433019C>T	ENST00000505113.1	+	10	1125	c.1081C>T	c.(1081-1083)Cgg>Tgg	p.R361W	AHRR_ENST00000506456.1_Missense_Mutation_p.R217W|AHRR_ENST00000512529.1_Missense_Mutation_p.R207W|AHRR_ENST00000316418.5_Missense_Mutation_p.R379W	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	361					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			CCTGTGCCTCCGGGGTGGCCC	0.667																																						ENST00000505113.1	1.000000	0.320000	1.000000	0.560000	0.950000	0.830823	0.950000	1.000000																										0				20						c.(1081-1083)Cgg>Tgg		aryl-hydrocarbon receptor repressor		C	TRP/ARG,TRP/ARG	0,3922		0,0,1961	21.0	24.0	23.0		1081,1135	-2.2	0.1	5		23	1,8245		0,1,4122	yes	missense,missense	AHRR	NM_001242412.1,NM_020731.4	101,101	0,1,6083	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging,probably-damaging	361/702,379/720	433019	1,12167	1961	4123	6084	SO:0001583	missense	57491	34	120854	43				g.chr5:433019C>T	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.1081C>T	chr5.hg19:g.433019C>T	ENSP00000424601:p.Arg361Trp	0					AHRR_ENST00000316418.5_Missense_Mutation_p.R379W|AHRR_ENST00000512529.1_Missense_Mutation_p.R207W|AHRR_ENST00000506456.1_Missense_Mutation_p.R217W	p.R361W	NM_001242412.1	NP_001229341.1	1	2	3	2.015171	A9YTQ3	AHRR_HUMAN	Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)	10	1125	+			A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Missense_Mutation	SNP	ENST00000505113.1	0	1	hg19	c.1081C>T	CCDS56355.1	1	.	.	.	.	.	.	.	.	.	.	C	9.825	1.186883	0.21870	0.0	1.21E-4	ENSG00000063438	ENST00000505113;ENST00000316418;ENST00000512529;ENST00000506456	T;T;T;T	0.24151	2.19;2.19;1.87;1.87	3.9	-2.23	0.06930	3.9	-2.23	0.06930	.	0.377486	0.28504	N	0.015115	T	0.37758	0.1015	M	0.68317	2.08	0.09310	N	1	D;D;D	0.76494	0.999;0.99;0.998	D;B;P	0.66497	0.944;0.425;0.788	T	0.18524	-1.0334	10	0.66056	D	0.02	.	6.5247	0.22295	0.3451:0.5411:0.1138:0.0	.	217;361;379	D6RE68;A9YTQ3;A9YTQ3-2	.;AHRR_HUMAN;.	W	361;379;207;217	ENSP00000424601:R361W;ENSP00000323816:R379W;ENSP00000424880:R207W;ENSP00000426932:R217W	ENSP00000323816:R379W	R	+	1	2	2	AHRR	486019	486019	0.326000	0.24669	0.058000	0.19502	0.059000	0.15707	0.369000	0.20416	-0.463000	0.06973	-0.321000	0.08615	CGG	0.108911		TCGA-XD-AAUH-01A-42D-A40W-08	0.667	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	0	0	1		2	2	2	0		0	0	15		15	14	1	2	-7.328148	1	0.100000	NM_020731			4	4		94	88	0		1			0	0	15	0		0.876377	0	0	0	0	0	0	4	94
RASGEF1C	255426	broad.mit.edu	37	5	179545648	179545648	+	Silent	SNP	C	C	T	rs201724936		TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr5:179545648C>T	ENST00000393371.2	-	9	1340	c.1044G>A	c.(1042-1044)gcG>gcA	p.A348A	RASGEF1C_ENST00000519883.1_5'Flank|RASGEF1C_ENST00000522500.1_Silent_p.A197A|RASGEF1C_ENST00000361132.4_Silent_p.A348A			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	348	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCGGTGGGCCGCCCCGCGCA	0.667																																						ENST00000393371.2	1.000000	0.390000	1.000000	0.540000	0.750000	0.763204	0.750000	1.000000																										0				12						c.(1042-1044)gcG>gcA		RasGEF domain family, member 1C		C		0,4404		0,0,2202	53.0	62.0	59.0		1044	-8.4	0.4	5		59	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	RASGEF1C	NM_175062.3		0,4,6498	TT,TC,CC		0.0465,0.0,0.0308		348/467	179545648	4,13000	2202	4300	6502	SO:0001819	synonymous_variant	255426	23	121408	45				g.chr5:179545648C>T	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.1044G>A	chr5.hg19:g.179545648C>T		0					RASGEF1C_ENST00000522500.1_Silent_p.A197A|RASGEF1C_ENST00000519883.1_5'Flank|RASGEF1C_ENST00000361132.4_Silent_p.A348A	p.A348A			1	2	3	2.010893	Q8N431	RGF1C_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	9	1340	-	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	D3DWQ7|Q7Z4T0|Q8NA49	Silent	SNP	ENST00000393371.2	1	1	hg19	c.1044G>A	CCDS4452.1	0																																																																																								0.108028		TCGA-XD-AAUH-01A-42D-A40W-08	0.667	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	0	0	1		2	2	2	0		0	0	80		80	72	1	2	-3.318794	1	0.100000	NM_175062			11	11		306	292	0		1	0		0	0	80	0		0.997956	0	0	0	0	1	0	11	306
HIVEP2	3097	broad.mit.edu	37	6	143091520	143091520	+	Missense_Mutation	SNP	C	C	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr6:143091520C>A	ENST00000367604.1	-	4	4995	c.4356G>T	c.(4354-4356)atG>atT	p.M1452I	HIVEP2_ENST00000367603.2_Missense_Mutation_p.M1452I|HIVEP2_ENST00000012134.2_Missense_Mutation_p.M1452I			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCTTGGTTTCCATGAAGAGCT	0.512																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	ENST00000367604.1	0.990000	0.240000	0.770000	0.370000	0.550000	0.576429	0.550000	1.000000																										0				100						c.(4354-4356)atG>atT		human immunodeficiency virus type I enhancer binding protein 2							142.0	146.0	145.0					6																	143091520		1981	4161	6142	SO:0001583	missense	3097	0	0					g.chr6:143091520C>A	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.4356G>T	chr6.hg19:g.143091520C>A	ENSP00000356576:p.Met1452Ile	0					HIVEP2_ENST00000367603.2_Missense_Mutation_p.M1452I|HIVEP2_ENST00000012134.2_Missense_Mutation_p.M1452I	p.M1452I			0	1	1	1.989457	P31629	ZEP2_HUMAN		4	4995	-			Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	0	1	hg19	c.4356G>T	CCDS43510.1	0	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641175	0.29157	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.03065	4.06;4.06;4.06	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.076260	0.85682	D	0.000000	T	0.04092	0.0114	M	0.70787	2.145	0.48901	D	0.999729	B	0.22683	0.073	B	0.15052	0.012	T	0.23440	-1.0188	10	0.49607	T	0.09	-19.6967	20.0826	0.97783	0.0:1.0:0.0:0.0	.	1452	P31629	ZEP2_HUMAN	I	1452	ENSP00000356576:M1452I;ENSP00000356575:M1452I;ENSP00000012134:M1452I	ENSP00000012134:M1452I	M	-	3	0	0	HIVEP2	143133213	143133213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.156000	0.42310	2.746000	0.94184	0.655000	0.94253	ATG	0.091826		TCGA-XD-AAUH-01A-42D-A40W-08	0.512	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1	0	0	1		2	2	2	0		0	0	64		64	63	1	2	-2.898455	1	0.100000				7	7		254	247	0		1	0		0	0	64	0		0.979059	1.274244e-01	0	0	0	20	0	7	254
THBS2	7058	broad.mit.edu	37	6	169622382	169622382	+	Silent	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr6:169622382G>A	ENST00000366787.3	-	20	3432	c.3183C>T	c.(3181-3183)tcC>tcT	p.S1061S	THBS2_ENST00000488355.1_5'UTR|XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	1061	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GGGACACGCCGGAGTAGCCAT	0.637																																					Esophageal Squamous(91;219 1934 18562 44706)	ENST00000366787.3	1.000000	0.690000	1.000000	0.970000	0.990000	0.972497	0.990000	1.000000																										0				111						c.(3181-3183)tcC>tcT		thrombospondin 2							46.0	42.0	44.0					6																	169622382		2203	4300	6503	SO:0001819	synonymous_variant	7058	4	121404	36				g.chr6:169622382G>A		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3183C>T	chr6.hg19:g.169622382G>A		0					THBS2_ENST00000488355.1_5'UTR|XXyac-YX65C7_A.2_ENST00000444188.1_RNA	p.S1061S	NM_003247.2	NP_003238.2	0	1	1	1.989457	P35442	TSP2_HUMAN		20	3432	-		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)	A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	1	1	hg19	c.3183C>T	CCDS34574.1	1																																																																																								0.091826		TCGA-XD-AAUH-01A-42D-A40W-08	0.637	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	1	0	1		2	2	2	0		0	0	32		32	28	1	2	-3.077777	1	0.100000	NM_003247			9	6		115	103	0		1	0		0	0	32	0		0.990678	9.956683e-01	0	0	0	129	0	9	115
DNAH11	8701	broad.mit.edu	37	7	21631113	21631113	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr7:21631113C>T	ENST00000409508.3	+	14	2616	c.2585C>T	c.(2584-2586)aCc>aTc	p.T862I	DNAH11_ENST00000328843.6_Missense_Mutation_p.T862I	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	862	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GCAGCCTTCACCTTGGAGGAC	0.502									Kartagener syndrome																													ENST00000409508.3	1.000000	0.490000	1.000000	0.710000	0.990000	0.892330	0.990000	1.000000																										0				230						c.(2584-2586)aCc>aTc		dynein, axonemal, heavy chain 11							41.0	44.0	43.0					7																	21631113		2008	4151	6159	SO:0001583	missense	8701	0	0		Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21631113C>T	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.2585C>T	chr7.hg19:g.21631113C>T	ENSP00000475939:p.Thr862Ile	0					DNAH11_ENST00000328843.6_Missense_Mutation_p.T862I	p.T862I	NM_001277115.1	NP_001264044.1	1	2	3	2.006724	Q96DT5	DYH11_HUMAN		14	2616	+			Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	1	1	hg19	c.2585C>T		1	.	.	.	.	.	.	.	.	.	.	C	1.792	-0.479214	0.04383	.	.	ENSG00000105877	ENST00000328843	T	0.23754	1.89	5.63	-1.61	0.08399	5.63	-1.61	0.08399	.	1.431370	0.03866	N	0.274805	T	0.13243	0.0321	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20306	-1.0279	9	0.30854	T	0.27	.	0.9212	0.01315	0.1893:0.2843:0.2844:0.242	.	862	Q96DT5	DYH11_HUMAN	I	862	ENSP00000330671:T862I	ENSP00000330671:T862I	T	+	2	0	0	DNAH11	21597638	21597638	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.302000	0.08221	-0.000000	0.14550	0.561000	0.74099	ACC	0.107143		TCGA-XD-AAUH-01A-42D-A40W-08	0.502	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1		2	2	2	0		0	0	38		38	38	1	2	-11.758290	1	0.100000	NM_003777			9	9		183	181	0		1			0	0	38	0		0.994286	0	0	0	0	0	0	9	183
INHBA	3624	broad.mit.edu	37	7	41729994	41729994	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr7:41729994G>A	ENST00000242208.4	-	3	781	c.535C>T	c.(535-537)Cag>Tag	p.Q179*	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Nonsense_Mutation_p.Q179*|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	179					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GGGTGCTTCTGCTGCTGGAAG	0.562										TSP Lung(11;0.080)																												ENST00000242208.4	1.000000	0.810000	1.000000	0.990000	0.990000	0.986321	0.990000	1.000000																										0				55						c.(535-537)Cag>Tag		inhibin, beta A							101.0	94.0	97.0					7																	41729994		2203	4300	6503	SO:0001587	stop_gained	3624	0	0					g.chr7:41729994G>A		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.535C>T	chr7.hg19:g.41729994G>A	ENSP00000242208:p.Gln179*	0	TSP Lung(11;0.080)				INHBA_ENST00000442711.1_Nonsense_Mutation_p.Q179*|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR	p.Q179*	NM_002192.2	NP_002183.1	1	2	3	2.006724	P08476	INHBA_HUMAN		3	781	-			Q14599	Nonsense_Mutation	SNP	ENST00000242208.4	0	1	hg19	c.535C>T	CCDS5464.1	1	.	.	.	.	.	.	.	.	.	.	.	38	6.897179	0.97920	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	.	.	.	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.554170	0.20607	N	0.089047	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-18.9698	20.0699	0.97718	0.0:0.0:1.0:0.0	.	.	.	.	X	179	.	ENSP00000242208:Q179X	Q	-	1	0	0	INHBA	41696519	41696519	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.018000	0.70811	2.741000	0.93983	0.655000	0.94253	CAG	0.107143		TCGA-XD-AAUH-01A-42D-A40W-08	0.562	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1	0	0	1		19	4	2	1		1	1	53		53	53	1	2	-6.117271	1	0.100000				20	20		299	294	0		1	0		1	0	53	0		0.605908	1.382458e-01	0	0	0	30	0	20	299
GLI3	2737	broad.mit.edu	37	7	42188061	42188061	+	Missense_Mutation	SNP	T	T	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr7:42188061T>A	ENST00000395925.3	-	3	215	c.131A>T	c.(130-132)gAa>gTa	p.E44V	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	44					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TCCAGGACTTTCATCCTCTAA	0.403									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													ENST00000395925.3	1.000000	0.250000	0.970000	0.390000	0.580000	0.626844	0.580000	1.000000																										0				112						c.(130-132)gAa>gTa		GLI family zinc finger 3							98.0	93.0	95.0					7																	42188061		2203	4300	6503	SO:0001583	missense	2737	0	0		Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42188061T>A		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.131A>T	chr7.hg19:g.42188061T>A	ENSP00000379258:p.Glu44Val	0					GLI3_ENST00000479210.1_5'UTR	p.E44V	NM_000168.5	NP_000159.3	1	2	3	2.006724	P10071	GLI3_HUMAN		3	215	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	0	1	hg19	c.131A>T	CCDS5465.1	0	.	.	.	.	.	.	.	.	.	.	T	23.3	4.405126	0.83230	.	.	ENSG00000106571	ENST00000395925;ENST00000448703	T	0.17854	2.25	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.101413	0.64402	D	0.000003	T	0.27559	0.0677	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.04281	-1.0963	10	0.87932	D	0	.	15.9002	0.79369	0.0:0.0:0.0:1.0	.	44	P10071	GLI3_HUMAN	V	44	ENSP00000379258:E44V	ENSP00000379258:E44V	E	-	2	0	0	GLI3	42154586	42154586	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.669000	0.83911	2.161000	0.67846	0.455000	0.32223	GAA	0.107143		TCGA-XD-AAUH-01A-42D-A40W-08	0.403	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	0	0	1		2	2	2	0		0	0	76		76	74	1	2	-3.267079	1	0.100000	NM_000168			7	7		262	260	0		1	0		0	0	76	0		0.980472	9.073454e-03	0	0	0	5	0	7	262
FGL2	10875	broad.mit.edu	37	7	76825927	76825927	+	Nonsense_Mutation	SNP	A	A	T			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr7:76825927A>T	ENST00000248598.5	-	2	1021	c.989T>A	c.(988-990)tTa>tAa	p.L330*	CCDC146_ENST00000431197.1_Intron|CCDC146_ENST00000285871.4_Intron|RP11-467H10.2_ENST00000459742.1_RNA	NM_006682.2	NP_006673.1	Q14314	FGL2_HUMAN	fibrinogen-like 2	330	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	13						ACCAACGTGTAAACGATATTT	0.358																																						ENST00000248598.5	1.000000	0.350000	0.960000	0.480000	0.650000	0.683786	0.650000	1.000000																										0				13						c.(988-990)tTa>tAa		fibrinogen-like 2							168.0	158.0	161.0					7																	76825927		2203	4300	6503	SO:0001587	stop_gained	10875	0	0					g.chr7:76825927A>T	Z36531	CCDS5591.1	7q11.23	2013-02-06			ENSG00000127951	ENSG00000127951		"""Fibrinogen C domain containing"""	3696	protein-coding gene	gene with protein product		605351				7642106	Standard	NM_006682		Approved	pT49, T49	uc003ugb.3	Q14314	OTTHUMG00000130681	ENST00000248598.5:c.989T>A	chr7.hg19:g.76825927A>T	ENSP00000248598:p.Leu330*	0					RP11-467H10.2_ENST00000459742.1_RNA|CCDC146_ENST00000285871.4_Intron|CCDC146_ENST00000431197.1_Intron	p.L330*	NM_006682.2	NP_006673.1	1	2	3	2.006724	Q14314	FGL2_HUMAN		2	1021	-				Nonsense_Mutation	SNP	ENST00000248598.5	0	1	hg19	c.989T>A	CCDS5591.1	0	.	.	.	.	.	.	.	.	.	.	A	17.61	3.431927	0.62844	.	.	ENSG00000127951	ENST00000248598	.	.	.	6.03	6.03	0.97812	6.03	6.03	0.97812	.	0.131312	0.51477	D	0.000090	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2196	0.82251	1.0:0.0:0.0:0.0	.	.	.	.	X	330	.	ENSP00000248598:L330X	L	-	2	0	0	FGL2	76663863	76663863	0.982000	0.34865	0.023000	0.16930	0.381000	0.30169	8.962000	0.93254	2.308000	0.77769	0.533000	0.62120	TTA	0.107143		TCGA-XD-AAUH-01A-42D-A40W-08	0.358	FGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253176.1	0	0	1		2	2	2	0		0	0	86		86	84	1	2	-12.642690	1	0.100000	NM_006682			13	13		417	413	0		1	0		0	0	86	0		0.999519	5.033988e-01	0	0	0	53	0	13	417
WDR60	55112	broad.mit.edu	37	7	158716310	158716310	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr7:158716310G>A	ENST00000407559.3	+	17	2301	c.2143G>A	c.(2143-2145)Gga>Aga	p.G715R		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	715					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		ACTGTTTGCCGGAACAGCGCA	0.502																																						ENST00000407559.3	1.000000	0.100000	0.530000	0.170000	0.290000	0.379020	0.290000	0.240000																										0				35						c.(2143-2145)Gga>Aga		WD repeat domain 60							144.0	148.0	146.0					7																	158716310		2177	4285	6462	SO:0001583	missense	55112	3	121302	39				g.chr7:158716310G>A		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.2143G>A	chr7.hg19:g.158716310G>A	ENSP00000384290:p.Gly715Arg	0						p.G715R	NM_018051.4	NP_060521.4	1	2	3	2.006724	Q8WVS4	WDR60_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	17	2301	+	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	Q9NW58	Missense_Mutation	SNP	ENST00000407559.3	0	1	hg19	c.2143G>A	CCDS47757.1	0	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305740	0.23736	.	.	ENSG00000126870	ENST00000407559	D	0.86164	-2.08	5.19	5.19	0.71726	5.19	5.19	0.71726	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.94315	0.8173	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.954	D	0.95188	0.8305	10	0.87932	D	0	-33.8171	17.2998	0.87180	0.0:0.0:1.0:0.0	.	198;715	A4D230;Q8WVS4	.;WDR60_HUMAN	R	715	ENSP00000384290:G715R	ENSP00000384290:G715R	G	+	1	0	0	WDR60	158409071	158409071	1.000000	0.71417	0.187000	0.23214	0.081000	0.17604	7.228000	0.78079	2.407000	0.81776	0.655000	0.94253	GGA	0.107143		TCGA-XD-AAUH-01A-42D-A40W-08	0.502	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	0	0	1		13	2	2	1		1	1	117		117	115	1	2	-1.861523	0	0.100000	NM_018051			5	6		402	397	0		0	0		1	0	117	0		0.043790	1.688636e-02	0	0	0	13	0	5	402
SMC5	23137	broad.mit.edu	37	9	72920223	72920223	+	Missense_Mutation	SNP	T	T	G			TCGA-XD-AAUH-01A-42D-A40W-08	TCGA-XD-AAUH-11A-11D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c621b8f6-52ba-4ade-8ec0-247177d8356d	6f74fb89-bab6-4032-9747-1bc144399e91	g.chr9:72920223T>G	ENST00000361138.5	+	11	1583	c.1525T>G	c.(1525-1527)Tta>Gta	p.L509V		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	509	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						ATCAAATGACTTAAGAGCCTT	0.308																																						ENST00000361138.5	1.000000	0.390000	1.000000	0.530000	0.710000	0.737104	0.710000	1.000000																										0				35						c.(1525-1527)Tta>Gta		structural maintenance of chromosomes 5							84.0	90.0	88.0					9																	72920223		2202	4299	6501	SO:0001583	missense	23137	0	0					g.chr9:72920223T>G	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1525T>G	chr9.hg19:g.72920223T>G	ENSP00000354957:p.Leu509Val	0						p.L509V	NM_015110.3	NP_055925.2	1	2	3	2.006267	Q8IY18	SMC5_HUMAN		11	1583	+			A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	1	1	hg19	c.1525T>G	CCDS6632.1	0	.	.	.	.	.	.	.	.	.	.	T	18.53	3.642987	0.67244	.	.	ENSG00000198887	ENST00000361138	T	0.26373	1.74	5.36	1.43	0.22495	5.36	1.43	0.22495	RecF/RecN/SMC (1);	0.151160	0.43919	D	0.000502	T	0.27559	0.0677	M	0.61703	1.905	0.45883	D	0.998735	D	0.54207	0.965	P	0.48770	0.589	T	0.05241	-1.0897	10	0.62326	D	0.03	-7.6654	3.9845	0.09509	0.2939:0.1765:0.0:0.5296	.	509	Q8IY18	SMC5_HUMAN	V	509	ENSP00000354957:L509V	ENSP00000354957:L509V	L	+	1	2	2	SMC5	72110043	72110043	0.334000	0.24739	1.000000	0.80357	0.997000	0.91878	0.231000	0.17872	0.877000	0.35895	0.533000	0.62120	TTA	0.107143		TCGA-XD-AAUH-01A-42D-A40W-08	0.308	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	0	0	1		2	2	2	0		0	0	105		105	103	1	2	-3.687590	1	0.100000	NM_015110			13	13		376	371	0		1	0		0	0	105	0		0.999512	6.882822e-02	0	0	0	12	0	13	376
