#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
MLXIP	22877	broad.mit.edu	37	12	122623075	122623075	+	Frame_Shift_Del	DEL	C	C	-	rs370845887		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr12:122623075delC	ENST00000319080.7	+	14	2493	c.2361delC	c.(2359-2361)atcfs	p.I787fs	MLXIP_ENST00000538698.1_Frame_Shift_Del_p.I394fs					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GGGAGGAGATCGAGGAGCTCA	0.632																																					Esophageal Squamous(105;787 1493 16200 18566 52466)	ENST00000319080.7	1.000000	0.580000	1	7.700000e-01	0.990000	0.912718	0.990000	1.000000																										0				20						c.(2359-2361)atcfs		MLX interacting protein							27.0	34.0	31.0					12																	122623075		2180	4275	6455	SO:0001589	frameshift_variant	22877	0	0					g.chr12:122623075delC	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2361delC	chr12.hg19:g.122623075delC	ENSP00000312834:p.Ile787fs	0					MLXIP_ENST00000538698.1_Frame_Shift_Del_p.I394fs	p.I787fs			0	0	0	1.988815				14	2493	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		Frame_Shift_Del	DEL	ENST00000319080.7	0	1	hg19	c.2361delC		1																																																																																								0.194781		TCGA-XD-AAUI-01A-42D-A40W-08	0.632	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	1	0	1		2	2		0		0	0	24		24	23	1	1.910000	-19.970870	1	0.210000	NM_014938			14	16		117	115	0		1	0	0	0	0	24	0		0.999811	7.643365e-01	0	0	0	25	0	14	117
FRMD4A	55691	broad.mit.edu	37	10	13736001	13736001	+	Silent	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr10:13736001G>A	ENST00000357447.2	-	15	1382	c.1014C>T	c.(1012-1014)gcC>gcT	p.A338A	FRMD4A_ENST00000342409.2_Silent_p.A354A|FRMD4A_ENST00000358621.4_Silent_p.A323A|FRMD4A_ENST00000378503.1_Silent_p.A338A|FRMD4A_ENST00000492155.1_5'UTR	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	338					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						TCAGGTCGATGGCGATCTCAC	0.572																																						ENST00000357447.2	1.000000	0.950000	1	9.900000e-01	0.990000	0.997077	0.990000	1.000000																										0				41						c.(1012-1014)gcC>gcT		FERM domain containing 4A							172.0	130.0	145.0					10																	13736001		2203	4300	6503	SO:0001819	synonymous_variant	55691	0	0					g.chr10:13736001G>A	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1014C>T	chr10.hg19:g.13736001G>A		0					FRMD4A_ENST00000378503.1_Silent_p.A338A|FRMD4A_ENST00000358621.4_Silent_p.A323A|FRMD4A_ENST00000492155.1_5'UTR|FRMD4A_ENST00000342409.2_Silent_p.A354A	p.A338A	NM_018027.3	NP_060497.3	0	1	1	1.942227	Q9P2Q2	FRM4A_HUMAN		15	1382	-			A7E2Y3|Q5T377	Silent	SNP	ENST00000357447.2	1	1	hg19	c.1014C>T	CCDS7101.1	1																																																																																								0.157827		TCGA-XD-AAUI-01A-42D-A40W-08	0.572	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	1	0	1		2	2	2	0		0	0	55		55	54	1	1.910000	-20.000000	1	0.210000	NM_018027			39	38		220	217	1		1	0		0	0	55	0		1.000000	6.466338e-01	0	0	0	14	0	39	220
PARD3	56288	broad.mit.edu	37	10	34663857	34663857	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr10:34663857C>T	ENST00000374789.3	-	11	1938	c.1613G>A	c.(1612-1614)gGa>gAa	p.G538E	PARD3_ENST00000374773.1_Missense_Mutation_p.G538E|PARD3_ENST00000346874.4_Missense_Mutation_p.G538E|PARD3_ENST00000374790.3_Missense_Mutation_p.G494E|PARD3_ENST00000374776.1_Missense_Mutation_p.G538E|PARD3_ENST00000545693.1_Missense_Mutation_p.G538E|PARD3_ENST00000544292.1_Missense_Mutation_p.G268E|PARD3_ENST00000350537.4_Missense_Mutation_p.G538E|PARD3_ENST00000545260.1_Missense_Mutation_p.G494E|PARD3_ENST00000340077.5_Missense_Mutation_p.G538E|PARD3_ENST00000374768.1_5'Flank|PARD3_ENST00000374794.3_Missense_Mutation_p.G494E|PARD3_ENST00000374788.3_Missense_Mutation_p.G538E	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	538	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				GCTCACAGTTCCTTCCATCTT	0.438																																						ENST00000374789.3	0.230000	0.050000	1.700000e-01	8.000000e-02	0.120000	0.131042	0.120000	0.110000																										0				63						c.(1612-1614)gGa>gAa		par-3 family cell polarity regulator							156.0	153.0	154.0					10																	34663857		2203	4300	6503	SO:0001583	missense	56288	0	0					g.chr10:34663857C>T	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1613G>A	chr10.hg19:g.34663857C>T	ENSP00000363921:p.Gly538Glu	0					PARD3_ENST00000374773.1_Missense_Mutation_p.G538E|PARD3_ENST00000545693.1_Missense_Mutation_p.G538E|PARD3_ENST00000545260.1_Missense_Mutation_p.G494E|PARD3_ENST00000374794.3_Missense_Mutation_p.G494E|PARD3_ENST00000374788.3_Missense_Mutation_p.G538E|PARD3_ENST00000544292.1_Missense_Mutation_p.G268E|PARD3_ENST00000374768.1_5'Flank|PARD3_ENST00000374776.1_Missense_Mutation_p.G538E|PARD3_ENST00000346874.4_Missense_Mutation_p.G538E|PARD3_ENST00000374790.3_Missense_Mutation_p.G494E|PARD3_ENST00000350537.4_Missense_Mutation_p.G538E|PARD3_ENST00000340077.5_Missense_Mutation_p.G538E	p.G538E	NM_019619.3	NP_062565.2	0	1	1	1.942227	Q8TEW0	PARD3_HUMAN		11	1938	-		Breast(68;0.0707)	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	0	1	hg19	c.1613G>A	CCDS7178.1	0	.	.	.	.	.	.	.	.	.	.	c	13.72	2.321178	0.41096	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292	T;T;T;T;T;T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22	5.82	5.82	0.92795	5.82	5.82	0.92795	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.28200	0.0696	L	0.31157	0.91	0.80722	D	1	D;D;D;D;D;D;D;B;B;D;D;B;B;B;B	0.89917	1.0;0.993;0.998;0.997;0.994;0.998;0.997;0.195;0.324;0.997;0.994;0.217;0.008;0.026;0.001	D;P;D;P;D;D;P;B;B;D;D;B;B;B;B	0.80764	0.994;0.709;0.969;0.903;0.934;0.923;0.903;0.096;0.119;0.942;0.963;0.082;0.024;0.018;0.001	T	0.01276	-1.1398	10	0.05351	T	0.99	.	20.088	0.97803	0.0:1.0:0.0:0.0	.	494;494;538;538;538;538;538;538;494;538;538;538;538;538;268	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	E	538;494;538;538;538;494;538;494;538;538;538;268	ENSP00000443147:G538E;ENSP00000440857:G494E;ENSP00000363921:G538E;ENSP00000363920:G538E;ENSP00000340591:G538E;ENSP00000363926:G494E;ENSP00000311986:G538E;ENSP00000363922:G494E;ENSP00000363908:G538E;ENSP00000341844:G538E;ENSP00000363905:G538E;ENSP00000444429:G268E	ENSP00000341844:G538E	G	-	2	0	0	PARD3	34703863	34703863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.451000	0.80668	2.739000	0.93911	0.655000	0.94253	GGA	0.157827		TCGA-XD-AAUI-01A-42D-A40W-08	0.438	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	0	0	1		2	2	2	0		0	0	118		118	118	1	1.910000	-2.718959	1	0.210000	NM_019619			7	7		531	525	0		1	0		0	0	118	0		0.979938	1.083584e-01	0	0	0	37	0	7	531
CHAT	1103	broad.mit.edu	37	10	50857681	50857681	+	Splice_Site	SNP	C	C	T	rs371470622		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr10:50857681C>T	ENST00000337653.2	+	10	1663	c.1510C>T	c.(1510-1512)Cga>Tga	p.R504*	CHAT_ENST00000339797.1_Splice_Site_p.R386*|CHAT_ENST00000455728.2_Splice_Site_p.R386*|CHAT_ENST00000395559.2_Splice_Site_p.R386*|CHAT_ENST00000395562.2_Splice_Site_p.R422*|CHAT_ENST00000351556.3_Splice_Site_p.R386*	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	504					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	AAAACTTCAACGGTAAGGATA	0.602																																						ENST00000337653.2	1.000000	0.780000	1	9.200000e-01	0.990000	0.972845	0.990000	1.000000																										0				56						c.(1510-1512)Cga>Tga		choline O-acetyltransferase	Choline(DB00122)|Nicotine(DB00184)	C	stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	40.0	45.0	44.0		1156,1264,1156,1510,1156,1156,1156	0.1	1.0	10		44	1,8597		0,1,4298	no	stop-gained-near-splice,stop-gained-near-splice,stop-gained-near-splice,stop-gained-near-splice,stop-gained-near-splice,stop-gained-near-splice,stop-gained-near-splice	CHAT	NM_001142929.1,NM_001142933.1,NM_001142934.1,NM_020549.4,NM_020984.3,NM_020985.3,NM_020986.3	,,,,,,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,,,,,,	386/631,422/667,386/631,504/749,386/631,386/631,386/631	50857681	1,13003	2203	4299	6502	SO:0001630	splice_region_variant	1103	2	121392	33				g.chr10:50857681C>T	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1511+1C>T	chr10.hg19:g.50857681C>T		0					CHAT_ENST00000455728.2_Splice_Site_p.R386*|CHAT_ENST00000395559.2_Splice_Site_p.R386*|CHAT_ENST00000395562.2_Splice_Site_p.R422*|CHAT_ENST00000339797.1_Splice_Site_p.R386*|CHAT_ENST00000351556.3_Splice_Site_p.R386*	p.R504*	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	0	1	1	1.942227	P28329	CLAT_HUMAN		10	1663	+		all_neural(218;0.107)	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Splice_Site	SNP	ENST00000337653.2	0	0	hg19	c.1510C>T	CCDS7232.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.855479	0.97030	0.0	1.16E-4	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	.	.	.	4.77	0.0456	0.14231	4.77	0.0456	0.14231	.	0.156020	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-5.4337	7.7047	0.28642	0.5652:0.3444:0.0:0.0904	.	.	.	.	X	386;386;386;504;422;386	.	ENSP00000337103:R504X	R	+	1	2	2	CHAT	50527687	50527687	0.999000	0.42202	0.959000	0.39883	0.135000	0.20990	2.130000	0.42064	0.376000	0.24707	0.462000	0.41574	CGA	0.157827		TCGA-XD-AAUI-01A-42D-A40W-08	0.602	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	1	0	1		2	2	2	0		0	0	92		92	89	1	1.910000	-20.000000	1	0.210000	NM_020549	Nonsense_Mutation		37	37		264	261	1		1			0	0	92	0		1.000000	0	0	0	0	0	0	37	264
NUP98	4928	broad.mit.edu	37	11	3704600	3704600	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr11:3704600G>A	ENST00000324932.7	-	30	5168	c.4748C>T	c.(4747-4749)gCt>gTt	p.A1583V	NUP98_ENST00000355260.3_Missense_Mutation_p.A1509V|NUP98_ENST00000359171.4_Missense_Mutation_p.A1509V	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1600					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AGTCTCTTTAGCCCAAGATTC	0.512			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																	ENST00000324932.7	1.000000	0.370000	7.500000e-01	4.600000e-01	0.580000	0.617040	0.580000	0.560000				Dom	yes			Dom	yes		11	11p15	11p15	4928	T	nucleoporin 98kDa				L	L	HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11		AML		0				66						c.(4747-4749)gCt>gTt		nucleoporin 98kDa							108.0	103.0	105.0					11																	3704600		2201	4298	6499	SO:0001583	missense	4928	0	0					g.chr11:3704600G>A	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4748C>T	chr11.hg19:g.3704600G>A	ENSP00000316032:p.Ala1583Val	0					NUP98_ENST00000355260.3_Missense_Mutation_p.A1509V|NUP98_ENST00000359171.4_Missense_Mutation_p.A1509V	p.A1583V	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	1	2	3	2.045850	P52948	NUP98_HUMAN		30	5168	-		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	1	1	hg19	c.4748C>T	CCDS7746.1	0	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052507	0.75960	.	.	ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260	.	.	.	6.02	5.1	0.69264	6.02	5.1	0.69264	.	0.131086	0.53938	D	0.000044	T	0.59404	0.2191	M	0.74647	2.275	0.23563	N	0.997403	D;D;P	0.53462	0.96;0.96;0.933	P;P;P	0.51615	0.675;0.6;0.461	T	0.56774	-0.7923	9	0.31617	T	0.26	-18.3788	15.8043	0.78481	0.0:0.0:0.8629:0.1371	.	1509;1583;1497	P52948-2;P52948-5;P52948-6	.;.;.	V	1583;1509;1509	.	ENSP00000316032:A1583V	A	-	2	0	0	NUP98	3661176	3661176	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.236000	0.51336	1.552000	0.49463	-0.187000	0.12897	GCT	0.217396		TCGA-XD-AAUI-01A-42D-A40W-08	0.512	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	1	0	1		2	2	2	0		0	0	80		80	80	1	1.910000	-6.003247	1	0.210000	NM_016320			22	22		349	345	1		1	1		0	0	80	0		0.999999	9.610911e-01	0	11	0	76	0	22	349
C2CD2L	9854	broad.mit.edu	37	11	118982297	118982297	+	Missense_Mutation	SNP	C	C	A	rs140133210	byFrequency	TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr11:118982297C>A	ENST00000528586.1	+	3	291	c.221C>A	c.(220-222)gCg>gAg	p.A74E	C2CD2L_ENST00000336702.3_Missense_Mutation_p.A326E			O14523	C2C2L_HUMAN	C2CD2-like	326						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						ACCAAGCCCGCGAGGGCTGGA	0.562																																						ENST00000528586.1	0.480000	0.070000	3.500000e-01	1.400000e-01	0.230000	0.252258	0.230000	0.210000																										0				13						c.(220-222)gCg>gAg		C2CD2-like							56.0	55.0	55.0					11																	118982297		2200	4295	6495	SO:0001583	missense	9854	0	0					g.chr11:118982297C>A	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.221C>A	chr11.hg19:g.118982297C>A	ENSP00000433600:p.Ala74Glu	1					C2CD2L_ENST00000336702.3_Missense_Mutation_p.A326E	p.A74E			0	1	1	1.839385	O14523	C2C2L_HUMAN		3	291	+			Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000528586.1	0	1	hg19	c.221C>A		0	.	.	.	.	.	.	.	.	.	.	C	7.519	0.656367	0.14580	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.40225	1.04;1.04	5.54	-11.1	0.00147	5.54	-11.1	0.00147	C2 calcium/lipid-binding domain, CaLB (1);	1.839290	0.02350	N	0.075789	T	0.24547	0.0595	N	0.14661	0.345	0.09310	N	1	B;B	0.24618	0.107;0.107	B;B	0.27715	0.082;0.082	T	0.48328	-0.9045	10	0.05525	T	0.97	-3.7304	19.4928	0.95059	0.0:0.217:0.0:0.783	.	326;326	O14523;O14523-2	C2C2L_HUMAN;.	E	326;74	ENSP00000338885:A326E;ENSP00000433600:A74E	ENSP00000338885:A326E	A	+	2	0	0	C2CD2L	118487507	118487507	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.299000	0.02754	-2.688000	0.00405	-0.140000	0.14226	GCG	0.117318		TCGA-XD-AAUI-01A-42D-A40W-08	0.562	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000388199.2	0	0	0		2	2	2	0		0	0	36		36	35	1	1.910000	-6.208200	1	0.210000	NM_014807			4	3		155	149	0		1	0		0	0	36	0		0.880480	2.301066e-01	0	0	0	29	0	4	155
ITFG2	55846	broad.mit.edu	37	12	2929953	2929953	+	Missense_Mutation	SNP	G	G	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr12:2929953G>T	ENST00000228799.2	+	6	749	c.610G>T	c.(610-612)Ggt>Tgt	p.G204C	ITFG2_ENST00000542548.1_Missense_Mutation_p.G92C|ITFG2_ENST00000419778.2_Missense_Mutation_p.G27C	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	204					germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GTCTCAGCCAGGTTGTGCGTA	0.562																																						ENST00000228799.2	0.890000	0.300000	6.900000e-01	4.100000e-01	0.530000	0.555264	0.530000	0.520000																										0				19						c.(610-612)Ggt>Tgt		integrin alpha FG-GAP repeat containing 2							135.0	115.0	121.0					12																	2929953		2203	4300	6503	SO:0001583	missense	55846	0	0					g.chr12:2929953G>T	AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.610G>T	chr12.hg19:g.2929953G>T	ENSP00000228799:p.Gly204Cys	0					ITFG2_ENST00000542548.1_Missense_Mutation_p.G92C|ITFG2_ENST00000419778.2_Missense_Mutation_p.G27C	p.G204C	NM_018463.3	NP_060933.3	1	2	3	2.021246	Q969R8	ITFG2_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.000818)	6	749	+			A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Missense_Mutation	SNP	ENST00000228799.2	1	1	hg19	c.610G>T	CCDS8513.1	0	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902630	0.92035	.	.	ENSG00000111203	ENST00000228799;ENST00000419778;ENST00000542548	T	0.72942	-0.7	5.08	5.08	0.68730	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.85500	0.5711	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87516	0.2443	10	0.87932	D	0	-21.1172	17.6386	0.88129	0.0:0.0:1.0:0.0	.	204	Q969R8	ITFG2_HUMAN	C	204;27;92	ENSP00000228799:G204C	ENSP00000228799:G204C	G	+	1	0	0	ITFG2	2800214	2800214	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.350000	0.97070	2.632000	0.89209	0.655000	0.94253	GGT	0.211656		TCGA-XD-AAUI-01A-42D-A40W-08	0.562	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253091.1	1	0	1		2	2	2	0		0	0	81		81	81	1	1.910000	-3.221883	1	0.210000	NM_018463			14	14		240	236	0		1	0		0	0	81	0		0.999752	9.667885e-02	0	1	0	8	0	14	240
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.790000	1	9.800000e-01	0.990000	0.981165	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	2	3	2.030377	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.217396		TCGA-XD-AAUI-01A-42D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	56		56	52	1	1.910000	-11.597720	1	0.210000	NM_033360			22	22		155	154	1		1	0	1	0	0	56	361		0.999999	5.055540e-01	1	1	41	5	401	22	155
PLXNC1	10154	broad.mit.edu	37	12	94641698	94641698	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr12:94641698C>T	ENST00000258526.4	+	13	2657	c.2408C>T	c.(2407-2409)gCg>gTg	p.A803V		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	803					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TATTGTGTGGCGACTTACTGC	0.428																																						ENST00000258526.4	0.560000	0.260000	4.800000e-01	3.200000e-01	0.390000	0.407454	0.390000	0.400000																										0				64						c.(2407-2409)gCg>gTg		plexin C1							127.0	133.0	131.0					12																	94641698		2203	4300	6503	SO:0001583	missense	10154	1	121412	31				g.chr12:94641698C>T	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2408C>T	chr12.hg19:g.94641698C>T	ENSP00000258526:p.Ala803Val	0						p.A803V	NM_005761.2	NP_005752.1	0	0	0	1.988815	O60486	PLXC1_HUMAN		13	2657	+			Q59H25	Missense_Mutation	SNP	ENST00000258526.4	1	1	hg19	c.2408C>T	CCDS9049.1	0	.	.	.	.	.	.	.	.	.	.	C	3.557	-0.090472	0.07053	.	.	ENSG00000136040	ENST00000258526	T	0.07114	3.22	6.16	1.83	0.25207	6.16	1.83	0.25207	Cell surface receptor IPT/TIG (2);	0.869786	0.10286	N	0.692988	T	0.06096	0.0158	L	0.27053	0.805	0.09310	N	1	P	0.36944	0.574	B	0.31869	0.137	T	0.39461	-0.9613	10	0.27785	T	0.31	.	10.7249	0.46061	0.6283:0.2651:0.1066:0.0	.	803	O60486	PLXC1_HUMAN	V	803	ENSP00000258526:A803V	ENSP00000258526:A803V	A	+	2	0	0	PLXNC1	93165829	93165829	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.066000	0.11598	0.440000	0.26502	-0.175000	0.13238	GCG	0.194781		TCGA-XD-AAUI-01A-42D-A40W-08	0.428	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2	1	0	1		2	2	2	0		0	0	149		149	146	1	1.910000	-3.903845	1	0.210000				26	24		587	575	0		1	0		0	0	149	0		1.000000	1.123669e-02	0	0	0	4	0	26	587
FZD10	11211	broad.mit.edu	37	12	130649223	130649223	+	Missense_Mutation	SNP	C	C	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr12:130649223C>A	ENST00000229030.4	+	1	2220	c.1736C>A	c.(1735-1737)aCc>aAc	p.T579N	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_3'UTR			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	579					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CAGTCGCCCACCTGCGTGTGA	0.527																																						ENST00000229030.4	0.830000	0.130000	6.100000e-01	2.400000e-01	0.400000	0.434336	0.400000	0.360000																										0				35						c.(1735-1737)aCc>aAc		frizzled class receptor 10							15.0	19.0	17.0					12																	130649223		2169	4276	6445	SO:0001583	missense	11211	0	0					g.chr12:130649223C>A	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1736C>A	chr12.hg19:g.130649223C>A	ENSP00000229030:p.Thr579Asn	0					FZD10_ENST00000539839.1_3'UTR|FZD10-AS1_ENST00000505807.2_RNA	p.T579N			0	0	0	1.988815	Q9ULW2	FZD10_HUMAN		1	2220	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Missense_Mutation	SNP	ENST00000229030.4	0	1	hg19	c.1736C>A	CCDS9267.1	0	.	.	.	.	.	.	.	.	.	.	C	12.03	1.817078	0.32145	.	.	ENSG00000111432	ENST00000229030	T	0.77098	-1.07	4.69	4.69	0.59074	4.69	4.69	0.59074	.	0.000000	0.64402	U	0.000001	T	0.70684	0.3252	L	0.27053	0.805	0.53005	D	0.999969	B	0.32968	0.392	B	0.35813	0.211	T	0.74578	-0.3619	10	0.87932	D	0	.	17.6375	0.88127	0.0:1.0:0.0:0.0	.	579	Q9ULW2	FZD10_HUMAN	N	579	ENSP00000229030:T579N	ENSP00000229030:T579N	T	+	2	0	0	FZD10	129215176	129215176	1.000000	0.71417	0.989000	0.46669	0.397000	0.30659	3.619000	0.54196	2.127000	0.65507	0.561000	0.74099	ACC	0.194781		TCGA-XD-AAUI-01A-42D-A40W-08	0.527	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	30		30	30	1	1.910000	-7.556106	1	0.210000				4	4		97	96	0		1	0		0	0	30	0		0.889477	3.514690e-02	0	0	0	6	0	4	97
GPC6	10082	broad.mit.edu	37	13	95034762	95034762	+	Missense_Mutation	SNP	C	C	T	rs562467219		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr13:95034762C>T	ENST00000377047.4	+	7	1862	c.1247C>T	c.(1246-1248)aCg>aTg	p.T416M		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	416					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				ACAGCGGGCACGTCCAACGAG	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		21196	0.0		0.0	False		,,,				2504	0.001					ENST00000377047.4	1.000000	0.660000	1	7.900000e-01	0.930000	0.910749	0.930000	1.000000																										0				38						c.(1246-1248)aCg>aTg		glypican 6							145.0	131.0	135.0					13																	95034762		2203	4300	6503	SO:0001583	missense	10082	42	121412	48				g.chr13:95034762C>T	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.1247C>T	chr13.hg19:g.95034762C>T	ENSP00000366246:p.Thr416Met	0						p.T416M	NM_005708.3	NP_005699.1	1	2	3	2.024408	Q9Y625	GPC6_HUMAN		7	1862	+	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	1	1	hg19	c.1247C>T	CCDS9469.1	1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935396	0.52866	.	.	ENSG00000183098	ENST00000377047	T	0.51071	0.72	5.74	5.74	0.90152	5.74	5.74	0.90152	.	0.262572	0.38720	N	0.001587	T	0.36496	0.0969	L	0.34521	1.04	0.28457	N	0.916084	P	0.48350	0.909	B	0.39379	0.298	T	0.44682	-0.9312	10	0.54805	T	0.06	.	12.4114	0.55469	0.0:0.923:0.0:0.077	.	416	Q9Y625	GPC6_HUMAN	M	416	ENSP00000366246:T416M	ENSP00000366246:T416M	T	+	2	0	0	GPC6	93832763	93832763	0.856000	0.29760	0.999000	0.59377	0.660000	0.38997	2.153000	0.42282	2.708000	0.92522	0.650000	0.86243	ACG	0.213304		TCGA-XD-AAUI-01A-42D-A40W-08	0.537	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	1	0	1		2	2	2	0		0	0	85		85	84	1	1.910000	-12.176790	1	0.210000	NM_005708			34	34		314	307	0		1	0	0	0	0	85	0		1.000000	1.510796e-01	0	0	0	7	1	34	314
PYGL	5836	broad.mit.edu	37	14	51387719	51387719	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr14:51387719G>A	ENST00000216392.7	-	6	1059	c.727C>T	c.(727-729)Cgc>Tgc	p.R243C	PYGL_ENST00000532462.1_Missense_Mutation_p.R243C|PYGL_ENST00000544180.2_Missense_Mutation_p.R209C	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	243					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	GACCAGAGGCGCATGGTGTTG	0.498																																						ENST00000216392.7	0.860000	0.330000	7.200000e-01	4.300000e-01	0.560000	0.582669	0.560000	0.550000																										0				25						c.(727-729)Cgc>Tgc		phosphorylase, glycogen, liver	Adenosine monophosphate(DB00131)						106.0	104.0	105.0					14																	51387719		2203	4300	6503	SO:0001583	missense	5836	0	0					g.chr14:51387719G>A		CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.727C>T	chr14.hg19:g.51387719G>A	ENSP00000216392:p.Arg243Cys	0					PYGL_ENST00000532462.1_Missense_Mutation_p.R243C|PYGL_ENST00000544180.2_Missense_Mutation_p.R209C	p.R243C	NM_002863.4	NP_002854.3	0	0	0	1.997598	P06737	PYGL_HUMAN		6	1059	-	all_epithelial(31;0.00825)|Breast(41;0.148)		A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	ENST00000216392.7	1	1	hg19	c.727C>T	CCDS32080.1	0	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547610	0.86022	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.96232	-3.95;-3.95;-3.95	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	M	0.94101	3.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.99267	1.0892	10	0.87932	D	0	-0.3184	19.3504	0.94381	0.0:0.0:1.0:0.0	.	209;243;243	F5H816;E9PK47;P06737	.;.;PYGL_HUMAN	C	243;209;243	ENSP00000431657:R243C;ENSP00000443787:R209C;ENSP00000216392:R243C	ENSP00000216392:R243C	R	-	1	0	0	PYGL	50457469	50457469	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.626000	0.46460	2.885000	0.99019	0.655000	0.94253	CGC	0.199919		TCGA-XD-AAUI-01A-42D-A40W-08	0.498	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390654.3	1	0	1		15	2	2	0		0	1	60		60	58	1	1.910000	-2.965748	1	0.210000	NM_002863			15	15		237	235	0		1	1		0	0	60	0		0.561145	7.880128e-01	0	4	0	44	0	15	237
PLEKHG3	26030	broad.mit.edu	37	14	65210050	65210050	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr14:65210050C>T	ENST00000394691.1	+	17	3436	c.3289C>T	c.(3289-3291)Cgc>Tgc	p.R1097C	PLEKHG3_ENST00000484731.2_Missense_Mutation_p.R602C|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.R1041C|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.R630C|PLEKHG3_ENST00000492928.1_Intron			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	1097							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CAGGGTGGGCCGCTGCCGCAG	0.731																																						ENST00000394691.1	1.000000	0.410000	1	6.100000e-01	0.900000	0.836278	0.900000	1.000000																										0				29						c.(3289-3291)Cgc>Tgc		pleckstrin homology domain containing, family G (with RhoGef domain) member 3							16.0	21.0	19.0					14																	65210050		2200	4294	6494	SO:0001583	missense	26030	3	120986	34				g.chr14:65210050C>T	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.3289C>T	chr14.hg19:g.65210050C>T	ENSP00000378183:p.Arg1097Cys	1					PLEKHG3_ENST00000492928.1_Intron|PLEKHG3_ENST00000484731.2_Missense_Mutation_p.R602C|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.R630C|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.R1041C	p.R1097C			1	2	3	2.084678	A1L390	PKHG3_HUMAN		17	3436	+			A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	ENST00000394691.1	1	1	hg19	c.3289C>T		1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401959	0.42613	.	.	ENSG00000126822	ENST00000247226;ENST00000394691;ENST00000471182;ENST00000484731	T;T;T;T	0.62364	0.48;0.03;1.37;1.37	5.22	3.38	0.38709	5.22	3.38	0.38709	.	0.348750	0.24999	N	0.033935	T	0.65821	0.2728	L	0.53249	1.67	0.19300	N	0.999974	D;D;D;D	0.76494	0.999;0.998;0.988;0.997	P;P;P;P	0.53861	0.736;0.736;0.533;0.724	T	0.59026	-0.7531	10	0.87932	D	0	.	9.9514	0.41640	0.0:0.8303:0.0:0.1697	.	630;602;1097;1041	A1L390-2;G3V311;A1L390;A1L390-3	.;.;PKHG3_HUMAN;.	C	1041;1097;630;602	ENSP00000247226:R1041C;ENSP00000378183:R1097C;ENSP00000450945:R630C;ENSP00000450973:R602C	ENSP00000247226:R1041C	R	+	1	0	0	PLEKHG3	64279803	64279803	0.003000	0.15002	0.987000	0.45799	0.357000	0.29423	0.011000	0.13264	0.563000	0.29222	0.563000	0.77884	CGC	0.250901		TCGA-XD-AAUI-01A-42D-A40W-08	0.731	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	1	0	1		2	2	2	0		0	0	29		29	27	1	1.910000	-14.084520	1	0.210000	NM_015549			9	9		108	98	0		1	1		0	0	29	0		0.992214	9.345033e-01	0	20	0	40	0	9	108
RYR3	6263	broad.mit.edu	37	15	33895400	33895400	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr15:33895400G>A	ENST00000389232.4	+	18	2069	c.1999G>A	c.(1999-2001)Gac>Aac	p.D667N	RYR3_ENST00000415757.3_Missense_Mutation_p.D667N	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	667	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCTGATTATCGACCAGGTGGA	0.567																																						ENST00000389232.4	0.740000	0.400000	6.600000e-01	4.700000e-01	0.560000	0.571921	0.560000	0.560000																										0				311						c.(1999-2001)Gac>Aac		ryanodine receptor 3							139.0	144.0	142.0					15																	33895400		2007	4168	6175	SO:0001583	missense	6263	0	0					g.chr15:33895400G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1999G>A	chr15.hg19:g.33895400G>A	ENSP00000373884:p.Asp667Asn	1					RYR3_ENST00000415757.3_Missense_Mutation_p.D667N	p.D667N	NM_001036.3	NP_001027.3	0	0	0	1.872458	Q15413	RYR3_HUMAN		18	2069	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	1	1	hg19	c.1999G>A	CCDS45210.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.058903	0.93846	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.70516	-0.49;-0.49	5.42	4.5	0.54988	5.42	4.5	0.54988	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.85392	0.5686	M	0.85299	2.745	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.88122	0.2832	10	0.66056	D	0.02	.	15.8752	0.79156	0.0:0.0:0.8636:0.1364	.	667;667	Q15413-2;Q15413	.;RYR3_HUMAN	N	667	ENSP00000373884:D667N;ENSP00000399610:D667N	ENSP00000354735:D667N	D	+	1	0	0	RYR3	31682692	31682692	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	9.522000	0.98032	1.529000	0.49120	-0.164000	0.13417	GAC	0.145392		TCGA-XD-AAUI-01A-42D-A40W-08	0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	0	0	1		2	2	2	0		0	0	146		146	142	1	1.910000	-7.797808	1	0.210000				37	37		540	530	0		1			0	0	146	0		1.000000	0	0	0	0	0	0	37	540
RYR3	6263	broad.mit.edu	37	15	34130000	34130000	+	Missense_Mutation	SNP	C	C	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr15:34130000C>A	ENST00000389232.4	+	89	11889	c.11819C>A	c.(11818-11820)tCc>tAc	p.S3940Y	RYR3_ENST00000415757.3_Missense_Mutation_p.S3935Y	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3940					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAATTATCTCCAAAAAAGAA	0.398																																						ENST00000389232.4	0.970000	0.410000	8.200000e-01	5.200000e-01	0.660000	0.675355	0.660000	0.650000																										0				311						c.(11818-11820)tCc>tAc		ryanodine receptor 3							82.0	77.0	79.0					15																	34130000		1841	4091	5932	SO:0001583	missense	6263	0	0					g.chr15:34130000C>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11819C>A	chr15.hg19:g.34130000C>A	ENSP00000373884:p.Ser3940Tyr	1					RYR3_ENST00000415757.3_Missense_Mutation_p.S3935Y	p.S3940Y	NM_001036.3	NP_001027.3	0	0	0	1.872458	Q15413	RYR3_HUMAN		89	11889	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	1	1	hg19	c.11819C>A	CCDS45210.1	0	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490354	0.64074	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.85013	-1.93	5.4	5.4	0.78164	5.4	5.4	0.78164	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93572	0.7948	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.988;0.999	D	0.93668	0.6987	10	0.59425	D	0.04	.	19.373	0.94498	0.0:1.0:0.0:0.0	.	3935;3940	Q15413-2;Q15413	.;RYR3_HUMAN	Y	3940;3936	ENSP00000373884:S3940Y	ENSP00000354735:S3936Y	S	+	2	0	0	RYR3	31917292	31917292	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.554000	0.82212	2.817000	0.96982	0.551000	0.68910	TCC	0.145392		TCGA-XD-AAUI-01A-42D-A40W-08	0.398	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	1	0	1		2	2	2	0		0	0	63		63	62	1	1.910000	-2.920913	1	0.210000				18	18		221	218	0		1			0	0	63	0		0.999983	0	0	0	0	0	0	18	221
TMC3	342125	broad.mit.edu	37	15	81650502	81650502	+	Missense_Mutation	SNP	A	A	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr15:81650502A>G	ENST00000359440.5	-	7	866	c.731T>C	c.(730-732)aTt>aCt	p.I244T	RP11-761I4.3_ENST00000560851.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.I244T|RP11-761I4.3_ENST00000559781.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						TTTTAAAAGAATGATGAAGCT	0.408																																						ENST00000359440.5	0.680000	0.130000	5.100000e-01	2.200000e-01	0.350000	0.375172	0.350000	0.320000																										0				34						c.(730-732)aTt>aCt		transmembrane channel-like 3							50.0	52.0	51.0					15																	81650502		1889	4106	5995	SO:0001583	missense	342125	0	0					g.chr15:81650502A>G	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.731T>C	chr15.hg19:g.81650502A>G	ENSP00000352413:p.Ile244Thr	1					RP11-761I4.3_ENST00000559781.1_RNA|TMC3_ENST00000558726.1_Missense_Mutation_p.I244T|RP11-761I4.3_ENST00000560851.1_RNA	p.I244T	NM_001080532.1	NP_001074001.1	0	0	0	1.877483				7	866	-				Missense_Mutation	SNP	ENST00000359440.5	0	1	hg19	c.731T>C	CCDS45324.1	0	.	.	.	.	.	.	.	.	.	.	A	11.85	1.763052	0.31228	.	.	ENSG00000188869	ENST00000359440	T	0.50001	0.76	5.59	4.46	0.54185	5.59	4.46	0.54185	.	0.478461	0.21754	N	0.069626	T	0.23054	0.0557	N	0.02854	-0.475	0.28128	N	0.930305	B;B	0.14805	0.004;0.011	B;B	0.17098	0.009;0.017	T	0.12863	-1.0531	10	0.39692	T	0.17	-9.4363	8.7012	0.34327	0.8534:0.0:0.1466:0.0	.	244;244	Q7Z5M5-2;Q7Z5M5	.;TMC3_HUMAN	T	244	ENSP00000352413:I244T	ENSP00000352413:I244T	I	-	2	0	0	TMC3	79437557	79437557	1.000000	0.71417	0.465000	0.27155	0.944000	0.59088	5.350000	0.66016	0.971000	0.38288	0.481000	0.45027	ATT	0.147329		TCGA-XD-AAUI-01A-42D-A40W-08	0.408	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	1	0	1		2	2	2	0		0	0	33		33	33	1	1.910000	-8.136713	1	0.210000	NM_181841			5	5		128	127	0		1	0		0	0	33	0		0.937519	0	0	0	0	1	0	5	128
IFT140	9742	broad.mit.edu	37	16	1633329	1633329	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr16:1633329G>A	ENST00000426508.2	-	12	1781	c.1418C>T	c.(1417-1419)gCg>gTg	p.A473V	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	473					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				ACTCCGTATCGCGGCTCCAGA	0.567																																						ENST00000426508.2	0.510000	0.090000	3.800000e-01	1.600000e-01	0.250000	0.275999	0.250000	0.230000																										0				53						c.(1417-1419)gCg>gTg		intraflagellar transport 140							87.0	70.0	76.0					16																	1633329		2199	4300	6499	SO:0001583	missense	9742	2	121412	30				g.chr16:1633329G>A	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1418C>T	chr16.hg19:g.1633329G>A	ENSP00000406012:p.Ala473Val	0					IFT140_ENST00000439987.2_5'UTR|LA16c-395F10.2_ENST00000563162.1_RNA	p.A473V	NM_014714.3	NP_055529.2	0	0	0	1.926961	Q96RY7	IF140_HUMAN		12	1781	-		Hepatocellular(780;0.219)	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	ENST00000426508.2	0	1	hg19	c.1418C>T	CCDS10439.1	0	.	.	.	.	.	.	.	.	.	.	G	5.952	0.359713	0.11239	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.69685	-0.42	5.48	-2.97	0.05530	5.48	-2.97	0.05530	.	1.408220	0.04710	N	0.417384	T	0.46483	0.1395	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.18429	-1.0337	10	0.25106	T	0.35	.	6.8317	0.23913	0.4417:0.0:0.4466:0.1116	.	473;198	Q96RY7;B4DR58	IF140_HUMAN;.	V	473	ENSP00000406012:A473V	ENSP00000380562:A473V	A	-	2	0	0	IFT140	1573330	1573330	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.229000	0.09098	-0.918000	0.03808	-0.797000	0.03246	GCG	0.169906		TCGA-XD-AAUI-01A-42D-A40W-08	0.567	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	0	0	1		2	2	2	0		0	0	51		51	50	1	1.910000	-6.885066	1	0.210000	NM_014714			5	5		185	180	0		1	0		0	0	51	0		0.933915	5.712201e-02	0	1	0	11	0	5	185
PKD1	5310	broad.mit.edu	37	16	2162878	2162878	+	Silent	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr16:2162878G>A	ENST00000262304.4	-	13	3280	c.3072C>T	c.(3070-3072)gtC>gtT	p.V1024V	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.V1024V	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1024	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCACTGTGGAGACCTGCAGAC	0.642																																						ENST00000262304.4	1.000000	0.360000	8.400000e-01	4.900000e-01	0.650000	0.668789	0.650000	1.000000																										0				72						c.(3070-3072)gtC>gtT		polycystic kidney disease 1 (autosomal dominant)							127.0	123.0	124.0					16																	2162878		2197	4298	6495	SO:0001819	synonymous_variant	5310	1	120976	34				g.chr16:2162878G>A	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3072C>T	chr16.hg19:g.2162878G>A		0					RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.V1024V	p.V1024V	NM_001009944.2	NP_001009944	0	0	0	1.926961	P98161	PKD1_HUMAN		13	3280	-			Q15140|Q15141	Silent	SNP	ENST00000262304.4	1	1	hg19	c.3072C>T	CCDS32369.1	0																																																																																								0.169906		TCGA-XD-AAUI-01A-42D-A40W-08	0.642	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1	1	0	1		2	2	2	0		0	0	59		59	59	1	1.910000	-16.376080	1	0.210000				12	12		156	153	0		1	0		0	0	59	0		0.999136	1.504626e-01	0	0	0	9	0	12	156
CHST5	23563	broad.mit.edu	37	16	75564081	75564081	+	Silent	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr16:75564081G>A	ENST00000336257.3	-	3	1596	c.202C>T	c.(202-204)Ctg>Ttg	p.L68L	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Silent_p.L74L	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	68					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						CACGAGGACAGCACCAGCACG	0.662																																						ENST00000336257.3			0	0																														0				24						c.(202-204)Ctg>Ttg		carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5							42.0	37.0	38.0					16																	75564081		2198	4300	6498	SO:0001819	synonymous_variant	23563	0	0					g.chr16:75564081G>A	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.202C>T	chr16.hg19:g.75564081G>A							RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Silent_p.L74L	p.L68L	NM_024533.4	NP_078809.2					Q9GZS9	CHST5_HUMAN		3	1596	-			B2RV23|Q7LCN3|Q9UBY3	Silent	SNP	ENST00000336257.3	0	1	hg19	c.202C>T	CCDS10919.1																																																																																											TCGA-XD-AAUI-01A-42D-A40W-08	0.662	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	0	0	1		2	2	2	0		0	0	51		51	50	1	1.910000	-6.337946	1	0.210000	NM_012126			5	5		251	250	0		1	0		0	0	51	0		0.937505	6.337115e-02	0	0	0	17	0	5	251
IL17C	27189	broad.mit.edu	37	16	88706390	88706390	+	Silent	SNP	G	G	A	rs376824715		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr16:88706390G>A	ENST00000244241.4	+	3	553	c.504G>A	c.(502-504)tcG>tcA	p.S168S		NM_013278.3	NP_037410.1	Q9P0M4	IL17C_HUMAN	interleukin 17C	168					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|neutrophil differentiation (GO:0030223)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			large_intestine(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0477)		GCGACGGCTCGGGGCTCCCCA	0.716													G|||	1	0.000199681	0.0	0.0	5008	,	,		14461	0.0		0.0	False		,,,				2504	0.001					ENST00000244241.4	1.000000	0.380000	1	5.000000e-01	0.660000	0.712927	0.660000	0.600000																										0				2						c.(502-504)tcG>tcA		interleukin 17C		G		0,3990		0,0,1995	32.0	39.0	37.0		504	-7.7	0.0	16		37	1,8285		0,1,4142	no	coding-synonymous	IL17C	NM_013278.3		0,1,6137	AA,AG,GG		0.0121,0.0,0.0081		168/198	88706390	1,12275	1995	4143	6138	SO:0001819	synonymous_variant	27189	4	120554	34				g.chr16:88706390G>A	AF152099	CCDS42217.1	16q24	2011-07-14			ENSG00000124391	ENSG00000124391		"""Interleukins and interleukin receptors"""	5983	protein-coding gene	gene with protein product		604628				10639155	Standard	NM_013278		Approved	IL-17C, CX2, IL-21, MGC126884, MGC138401	uc002fla.3	Q9P0M4		ENST00000244241.4:c.504G>A	chr16.hg19:g.88706390G>A		1						p.S168S	NM_013278.3	NP_037410.1	2	2	4	2.173436	Q9P0M4	IL17C_HUMAN		3	553	+			Q3MIG8|Q9HC75	Silent	SNP	ENST00000244241.4	1	1	hg19	c.504G>A	CCDS42217.1	0																																																																																								0.268383		TCGA-XD-AAUI-01A-42D-A40W-08	0.716	IL17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422575.1	1	0	1		2	2	2	0		0	0	85		85	82	1	1.910000	-2.506811	1	0.210000	NM_013278			18	18		288	281	1		1	1		0	0	85	0		0.999980	2.826653e-01	0	4	0	13	0	18	288
DNAH9	1770	broad.mit.edu	37	17	11725368	11725368	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr17:11725368C>T	ENST00000262442.4	+	46	8907	c.8839C>T	c.(8839-8841)Cga>Tga	p.R2947*	DNAH9_ENST00000454412.2_Nonsense_Mutation_p.R2947*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2947	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCGGATCCGGCGACAGCTGAA	0.463																																						ENST00000262442.4	1.000000	0.570000	1	7.200000e-01	0.870000	0.860084	0.870000	1.000000																										0				290						c.(8839-8841)Cga>Tga		dynein, axonemal, heavy chain 9							62.0	60.0	60.0					17																	11725368		2203	4300	6503	SO:0001587	stop_gained	1770	7	121412	36				g.chr17:11725368C>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8839C>T	chr17.hg19:g.11725368C>T	ENSP00000262442:p.Arg2947*	1					DNAH9_ENST00000454412.2_Nonsense_Mutation_p.R2947*	p.R2947*	NM_001372.3	NP_001363.2	0	1	1	1.862336	Q9NYC9	DYH9_HUMAN		46	8907	+		Breast(5;0.0122)|all_epithelial(5;0.131)	A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	SNP	ENST00000262442.4	0	1	hg19	c.8839C>T	CCDS11160.1	1	.	.	.	.	.	.	.	.	.	.	C	48	14.878058	0.99813	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	.	.	.	4.21	-1.36	0.09085	4.21	-1.36	0.09085	.	0.146107	0.23074	U	0.052233	.	.	.	.	.	.	0.21762	N	0.999553	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2049	0.59790	0.5135:0.4865:0.0:0.0	.	.	.	.	X	2947;2947;1529	.	ENSP00000262442:R2947X	R	+	1	2	2	DNAH9	11666093	11666093	0.296000	0.24398	0.019000	0.16419	0.046000	0.14306	0.403000	0.20982	0.203000	0.20529	0.467000	0.42956	CGA	0.123488		TCGA-XD-AAUI-01A-42D-A40W-08	0.463	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	1	0	1		2	2	2	0		0	0	36		36	36	1	1.910000	-20.000000	1	0.210000	NM_001372			17	17		130	129	1		1			0	0	36	0		0.999974	0	0	0	0	0	0	17	130
LRRC37B	114659	broad.mit.edu	37	17	30374829	30374829	+	Silent	SNP	A	A	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr17:30374829A>G	ENST00000341671.7	+	9	2297	c.2292A>G	c.(2290-2292)ttA>ttG	p.L764L	LRRC37B_ENST00000584368.1_Silent_p.L725L|LRRC37B_ENST00000394713.3_Silent_p.L713L|LRRC37B_ENST00000543378.2_Silent_p.L682L|LRRC37B_ENST00000327564.7_Silent_p.L791L	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	764						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				TGAAGATGTTACAAGCCCGGA	0.488																																						ENST00000341671.7	1.000000	0.820000	1	9.400000e-01	0.990000	0.978822	0.990000	1.000000																										0				29						c.(2290-2292)ttA>ttG		leucine rich repeat containing 37B							124.0	128.0	126.0					17																	30374829		2203	4300	6503	SO:0001819	synonymous_variant	114659	0	0					g.chr17:30374829A>G	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.2292A>G	chr17.hg19:g.30374829A>G		1					LRRC37B_ENST00000543378.2_Silent_p.L682L|LRRC37B_ENST00000394713.3_Silent_p.L713L|LRRC37B_ENST00000584368.1_Silent_p.L725L|LRRC37B_ENST00000327564.7_Silent_p.L791L	p.L764L	NM_052888.2	NP_443120.2	2	2	4	2.236854	Q96QE4	LR37B_HUMAN		9	2297	+		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)	Q17RC9|Q5YKG6	Silent	SNP	ENST00000341671.7	1	1	hg19	c.2292A>G	CCDS32609.1	1																																																																																								0.289121		TCGA-XD-AAUI-01A-42D-A40W-08	0.488	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	1	0	1		2	2	2	0		0	0	182		182	181	1	1.910000	-20.000000	1	0.210000	NM_052888			64	64		587	577	1		1	1		0	0	182	0		1.000000	8.211094e-01	0	4	0	27	0	64	587
CASC3	22794	broad.mit.edu	37	17	38320039	38320039	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr17:38320039C>T	ENST00000264645.7	+	7	1317	c.1091C>T	c.(1090-1092)cCa>cTa	p.P364L		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	364					gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						GATCCATCTCCAGAAGCAGAT	0.587																																						ENST00000264645.7	1.000000	0.330000	1	4.000000e-01	0.490000	0.580754	0.490000	0.470000																										0				16						c.(1090-1092)cCa>cTa		cancer susceptibility candidate 3							143.0	144.0	144.0					17																	38320039		2203	4300	6503	SO:0001583	missense	22794	0	0					g.chr17:38320039C>T	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.1091C>T	chr17.hg19:g.38320039C>T	ENSP00000264645:p.Pro364Leu	1						p.P364L	NM_007359.4	NP_031385.2	1	3	4	2.263984	O15234	CASC3_HUMAN		7	1317	+			A8K8R0	Missense_Mutation	SNP	ENST00000264645.7	1	1	hg19	c.1091C>T	CCDS11362.1	0	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426140	0.83667	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.056403	0.64402	D	0.000001	T	0.73434	0.3586	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.75187	-0.3406	9	0.72032	D	0.01	-8.0315	19.2489	0.93914	0.0:1.0:0.0:0.0	.	364;364	B4DKR6;O15234	.;CASC3_HUMAN	L	364	.	ENSP00000264645:P364L	P	+	2	0	0	CASC3	35573565	35573565	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.784000	0.68990	2.648000	0.89879	0.563000	0.77884	CCA	0.315009		TCGA-XD-AAUI-01A-42D-A40W-08	0.587	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257127.3	1	0	1		2	2	2	0		0	0	172		172	170	1	1.910000	-3.072344	1	0.210000	NM_007359			33	33		736	720	0		1	1		0	0	172	0		1.000000	7.201792e-01	0	4	0	54	0	33	736
DHX58	79132	broad.mit.edu	37	17	40260081	40260081	+	Missense_Mutation	SNP	C	C	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr17:40260081C>A	ENST00000251642.3	-	7	946	c.724G>T	c.(724-726)Gac>Tac	p.D242Y		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	242					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCCAGGTGGTCATGGATTTGG	0.557																																						ENST00000251642.3	1.000000	0.100000	4.000000e-01	1.500000e-01	0.220000	0.334120	0.220000	0.200000																										0				16						c.(724-726)Gac>Tac		DEXH (Asp-Glu-X-His) box polypeptide 58							136.0	119.0	125.0					17																	40260081		2203	4300	6503	SO:0001583	missense	79132	0	0					g.chr17:40260081C>A	BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.724G>T	chr17.hg19:g.40260081C>A	ENSP00000251642:p.Asp242Tyr	0						p.D242Y	NM_024119.2	NP_077024.2	1	2	3	2.082176	Q96C10	DHX58_HUMAN		7	946	-		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)	Q9HAM6	Missense_Mutation	SNP	ENST00000251642.3	0	1	hg19	c.724G>T	CCDS11416.1	0	.	.	.	.	.	.	.	.	.	.	C	13.11	2.139297	0.37728	.	.	ENSG00000108771	ENST00000251642;ENST00000423748;ENST00000413196	T;T	0.24350	2.0;1.86	5.08	1.82	0.25136	5.08	1.82	0.25136	.	0.408706	0.26991	N	0.021480	T	0.27967	0.0689	M	0.64997	1.995	0.09310	N	0.999996	B;D	0.55385	0.245;0.971	B;P	0.47645	0.08;0.553	T	0.11348	-1.0591	10	0.45353	T	0.12	-12.1084	6.7211	0.23330	0.0:0.5553:0.2787:0.166	.	235;242	B7Z455;Q96C10	.;DHX58_HUMAN	Y	242;205;242	ENSP00000251642:D242Y;ENSP00000416389:D242Y	ENSP00000251642:D242Y	D	-	1	0	0	DHX58	37513607	37513607	0.000000	0.05858	0.515000	0.27774	0.061000	0.15899	0.163000	0.16520	0.117000	0.18138	0.563000	0.77884	GAC	0.224654		TCGA-XD-AAUI-01A-42D-A40W-08	0.557	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	0	0	1		2	2	2	0		0	0	105		105	104	1	1.910000	-2.934218	1	0.210000	NM_024119			8	8		372	362	0		1	0		0	0	105	0		0.988345	8.365598e-02	0	0	0	20	0	8	372
BPTF	2186	broad.mit.edu	37	17	65925454	65925454	+	Missense_Mutation	SNP	G	G	A	rs201775041		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr17:65925454G>A	ENST00000321892.4	+	19	6440	c.6379G>A	c.(6379-6381)Gtt>Att	p.V2127I	BPTF_ENST00000335221.5_Missense_Mutation_p.V2127I|BPTF_ENST00000424123.3_Missense_Mutation_p.V1988I|BPTF_ENST00000306378.6_Missense_Mutation_p.V2001I			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2127					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTTTTAAGGCGTTGTTCAAGT	0.433																																						ENST00000321892.4	0.660000	0.220000	5.400000e-01	3.100000e-01	0.410000	0.433162	0.410000	0.400000																										0				78						c.(6379-6381)Gtt>Att		bromodomain PHD finger transcription factor							84.0	82.0	83.0					17																	65925454		2203	4300	6503	SO:0001583	missense	2186	15	121412	44				g.chr17:65925454G>A	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.6379G>A	chr17.hg19:g.65925454G>A	ENSP00000315454:p.Val2127Ile	1					BPTF_ENST00000335221.5_Missense_Mutation_p.V2127I|BPTF_ENST00000424123.3_Missense_Mutation_p.V1988I|BPTF_ENST00000306378.6_Missense_Mutation_p.V2001I	p.V2127I			0	1	1	1.853394	Q12830	BPTF_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)	19	6440	+	all_cancers(12;6e-11)		Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	1	1	hg19	c.6379G>A		0	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348665	0.24426	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.64803	-0.06;-0.12;-0.09	5.84	4.85	0.62838	5.84	4.85	0.62838	.	.	.	.	.	T	0.44808	0.1311	N	0.17082	0.46	0.33129	D	0.542898	P;P	0.47034	0.466;0.889	B;B	0.36922	0.029;0.236	T	0.56786	-0.7921	9	0.34782	T	0.22	-11.045	15.4007	0.74838	0.0676:0.0:0.9324:0.0	.	2001;2127	Q12830-2;Q12830-4	.;.	I	2001;2127;2127	ENSP00000307208:V2001I;ENSP00000334351:V2127I;ENSP00000315454:V2127I	ENSP00000307208:V2001I	V	+	1	0	0	BPTF	63355916	63355916	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	3.766000	0.55280	1.443000	0.47586	0.650000	0.86243	GTT	0.117318		TCGA-XD-AAUI-01A-42D-A40W-08	0.433	BPTF-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	77		77	77	1	1.910000	-13.869140	1	0.210000	NM_182641, NM_004459			12	12		234	233	0		1	1		0	0	77	0		0.999162	3.570716e-01	0	4	0	20	0	12	234
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.760000	1	8.800000e-01	0.980000	0.953148	0.980000	1.000000	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	24185	GRCh37	CM920675	TP53	M	rs11540652	c.(742-744)cGg>cAg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	7157	7	121412	38	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577538C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	chr17.hg19:g.7577538C>T	ENSP00000269305:p.Arg248Gln	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q	p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.862336	P04637	P53_HUMAN		7	932	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.743G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	0	TP53	7518263	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	0.123488		TCGA-XD-AAUI-01A-42D-A40W-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	8	0		0	0	72		72	72	1	1.910000	-2.603265	1	0.210000	NM_000546			28	28		156	150	1		1	1	1	0	2	72	899		1.000000	9.996647e-01	1	27	84	46	845	28	156
ABCA9	10350	broad.mit.edu	37	17	66979885	66979885	+	Silent	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr17:66979885G>A	ENST00000340001.4	-	36	4816	c.4605C>T	c.(4603-4605)atC>atT	p.I1535I	ABCA9_ENST00000370732.2_3'UTR|ABCA9_ENST00000453985.2_Silent_p.I1497I|ABCA9_ENST00000482072.1_5'Flank	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1535					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					AAAGCCTCAGGATCTCTGCAT	0.463																																						ENST00000340001.4	1.000000	0.790000	9.900000e-01	8.700000e-01	0.940000	0.937043	0.940000	0.990000																										0				91						c.(4603-4605)atC>atT		ATP-binding cassette, sub-family A (ABC1), member 9							111.0	104.0	106.0					17																	66979885		2203	4300	6503	SO:0001819	synonymous_variant	10350	0	0					g.chr17:66979885G>A	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4605C>T	chr17.hg19:g.66979885G>A		1					ABCA9_ENST00000370732.2_3'UTR|ABCA9_ENST00000482072.1_5'Flank|ABCA9_ENST00000453985.2_Silent_p.I1497I	p.I1535I	NM_080283.3	NP_525022.2	0	1	1	1.853394	Q8IUA7	ABCA9_HUMAN		36	4816	-	Breast(10;1.47e-12)		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Silent	SNP	ENST00000340001.4	1	1	hg19	c.4605C>T	CCDS11681.1	1																																																																																								0.117318		TCGA-XD-AAUI-01A-42D-A40W-08	0.463	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	1	0	0		2	2	2	0		0	0	85		85	85	1	1.910000	-19.981730	1	0.210000	NM_172386			47	47		286	284	1		1	0		0	0	85	0		1.000000	4.291758e-01	0	0	0	10	0	47	286
DSC1	1823	broad.mit.edu	37	18	28710559	28710559	+	Missense_Mutation	SNP	C	C	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr18:28710559C>G	ENST00000257198.5	-	16	2864	c.2603G>C	c.(2602-2604)cGg>cCg	p.R868P	RP11-408H20.3_ENST00000582307.1_RNA|RP11-408H20.2_ENST00000581836.1_RNA|DSC1_ENST00000257197.3_3'UTR	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	868					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TTCTTCCTGCCGATCGCTGCA	0.438																																						ENST00000257198.5	0.790000	0.420000	7.000000e-01	5.000000e-01	0.590000	0.607759	0.590000	0.590000																										0				53						c.(2602-2604)cGg>cCg		desmocollin 1							156.0	155.0	155.0					18																	28710559		2203	4300	6503	SO:0001583	missense	1823	0	0					g.chr18:28710559C>G	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2603G>C	chr18.hg19:g.28710559C>G	ENSP00000257198:p.Arg868Pro	0					DSC1_ENST00000257197.3_3'UTR|RP11-408H20.3_ENST00000582307.1_RNA|RP11-408H20.2_ENST00000581836.1_RNA	p.R868P	NM_024421.2	NP_077739.1	0	0	0	1.913322	Q08554	DSC1_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00778)	16	2864	-			Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	1	1	hg19	c.2603G>C	CCDS11894.1	0	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460536	0.43736	.	.	ENSG00000134765	ENST00000257198	T	0.76839	-1.05	6.17	1.38	0.22167	6.17	1.38	0.22167	Cadherin, cytoplasmic domain (1);	0.137951	0.33235	N	0.005138	T	0.67878	0.2940	M	0.63843	1.955	0.09310	N	1	B	0.15719	0.014	B	0.20955	0.032	T	0.60383	-0.7274	10	0.59425	D	0.04	.	1.3924	0.02253	0.1426:0.3912:0.1396:0.3265	.	868	Q08554	DSC1_HUMAN	P	868	ENSP00000257198:R868P	ENSP00000257198:R868P	R	-	2	0	0	DSC1	26964557	26964557	0.926000	0.31397	0.445000	0.26908	0.605000	0.37080	0.758000	0.26447	0.492000	0.27815	0.655000	0.94253	CGG	0.164375		TCGA-XD-AAUI-01A-42D-A40W-08	0.438	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	1	0	1		2	2	2	0		0	0	147		147	144	1	1.910000	-2.879449	1	0.210000	NM_004948, NM_024421			36	36		505	496	0		1			0	0	147	0		1.000000	0	0	0	0	0	0	36	505
C19orf57	79173	broad.mit.edu	37	19	14006193	14006193	+	Silent	SNP	G	G	A	rs375479370		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr19:14006193G>A	ENST00000586783.1	-	2	197	c.198C>T	c.(196-198)gcC>gcT	p.A66A	C19orf57_ENST00000454313.1_Silent_p.A66A|C19orf57_ENST00000346736.2_Silent_p.A66A|C19orf57_ENST00000591586.1_Silent_p.A66A			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	66					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			ACCTGGAGACGGCCTTTCCTG	0.562																																						ENST00000586783.1	1.000000	0.070000	2.800000e-01	1.200000e-01	0.180000	0.227040	0.180000	0.170000																										0				14						c.(196-198)gcC>gcT		chromosome 19 open reading frame 57		G		0,4406		0,0,2203	164.0	143.0	150.0		198	-8.1	0.0	19		150	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C19orf57	NM_024323.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		66/638	14006193	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79173	1	121412	34				g.chr19:14006193G>A	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.198C>T	chr19.hg19:g.14006193G>A		0					C19orf57_ENST00000346736.2_Silent_p.A66A|C19orf57_ENST00000454313.1_Silent_p.A66A|C19orf57_ENST00000591586.1_Silent_p.A66A	p.A66A			1	2	3	2.028289	Q0VDD7	CS057_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;2e-21)	2	197	-			Q13411|Q8N825|Q96D63|Q9BU49	Silent	SNP	ENST00000586783.1	0	1	hg19	c.198C>T		0																																																																																								0.214126		TCGA-XD-AAUI-01A-42D-A40W-08	0.562	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	0	0	1		16	2	2	1		1	1	86		86	86	1	1.910000	-2.718714	1	0.210000	NM_024323			7	7		377	374	0		0	0		1	0	86	0		0.041244	4.795013e-04	0	0	0	2	0	7	377
LSR	51599	broad.mit.edu	37	19	35753531	35753531	+	Silent	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr19:35753531G>A	ENST00000361790.3	+	5	1017	c.858G>A	c.(856-858)ccG>ccA	p.P286P	LSR_ENST00000347609.4_Silent_p.P249P|LSR_ENST00000427250.1_Intron|AD000684.2_ENST00000602262.1_RNA|LSR_ENST00000602122.1_Silent_p.P267P|LSR_ENST00000360798.3_Intron|LSR_ENST00000597933.1_3'UTR|LSR_ENST00000354900.3_Silent_p.P267P	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	286	Cys-rich.				embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			AGTGCTGCCCGCACACTTGCT	0.622																																						ENST00000361790.3	1.000000	0.060000	3.100000e-01	1.100000e-01	0.170000	0.276476	0.170000	0.150000																										0				13						c.(856-858)ccG>ccA		lipolysis stimulated lipoprotein receptor							111.0	88.0	96.0					19																	35753531		2203	4300	6503	SO:0001819	synonymous_variant	51599	4	121412	37				g.chr19:35753531G>A	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.858G>A	chr19.hg19:g.35753531G>A		1					AD000684.2_ENST00000602262.1_RNA|LSR_ENST00000347609.4_Silent_p.P249P|LSR_ENST00000602122.1_Silent_p.P267P|LSR_ENST00000597933.1_3'UTR|LSR_ENST00000427250.1_Intron|LSR_ENST00000354900.3_Silent_p.P267P|LSR_ENST00000360798.3_Intron	p.P286P	NM_205834.3	NP_991403.1	1	3	4	2.395528	Q86X29	LSR_HUMAN	Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)	5	1017	+	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Silent	SNP	ENST00000361790.3	0	1	hg19	c.858G>A	CCDS12450.1	0																																																																																								0.329656		TCGA-XD-AAUI-01A-42D-A40W-08	0.622	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	0	0	1		2	2	2	0		0	0	87		87	87	1	1.910000	-2.513202	1	0.210000	NM_015925			6	6		429	421	0		1	1		0	0	87	0		0.963160	9.853121e-01	0	2	0	560	0	6	429
LRRC8E	80131	broad.mit.edu	37	19	7965572	7965572	+	Missense_Mutation	SNP	G	G	A	rs190239641	byFrequency	TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr19:7965572G>A	ENST00000306708.6	+	3	2266	c.2165G>A	c.(2164-2166)cGc>cAc	p.R722H	RN7SL115P_ENST00000392196.5_RNA|AC010336.1_ENST00000539278.1_5'UTR	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	722					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						TTCTTCTGCCGCAAGCTGCGG	0.657													G|||	2	0.000399361	0.0	0.0014	5008	,	,		17805	0.0		0.001	False		,,,				2504	0.0					ENST00000306708.6	0.370000	0.060000	2.800000e-01	1.100000e-01	0.180000	0.202923	0.180000	0.170000																										0				35						c.(2164-2166)cGc>cAc		leucine rich repeat containing 8 family, member E							65.0	55.0	58.0					19																	7965572		2203	4300	6503	SO:0001583	missense	80131	11	121410	41				g.chr19:7965572G>A		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.2165G>A	chr19.hg19:g.7965572G>A	ENSP00000306524:p.Arg722His	0					RN7SL115P_ENST00000392196.5_RNA|AC010336.1_ENST00000539278.1_5'UTR	p.R722H	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	0	1	1	1.923094	Q6NSJ5	LRC8E_HUMAN		3	2266	+			B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Missense_Mutation	SNP	ENST00000306708.6	0	1	hg19	c.2165G>A	CCDS12189.1	0	2	9.157509157509158E-4	0	0.0	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	7.848	0.723462	0.15439	.	.	ENSG00000171017	ENST00000306708	T	0.10382	2.88	4.35	2.07	0.26955	4.35	2.07	0.26955	.	0.307696	0.29444	N	0.012138	T	0.06826	0.0174	L	0.31578	0.945	0.24912	N	0.992033	B	0.13594	0.008	B	0.10450	0.005	T	0.24693	-1.0153	10	0.40728	T	0.16	.	4.6497	0.12589	0.3968:0.0:0.6032:0.0	.	722	Q6NSJ5	LRC8E_HUMAN	H	722	ENSP00000306524:R722H	ENSP00000306524:R722H	R	+	2	0	0	LRRC8E	7871572	7871572	0.992000	0.36948	0.479000	0.27329	0.045000	0.14185	2.928000	0.48908	1.028000	0.39785	0.585000	0.79938	CGC	0.153087		TCGA-XD-AAUI-01A-42D-A40W-08	0.657	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	0	0	1		2	2	2	0		0	0	79		79	78	1	1.910000	-2.308896	0	0.210000	NM_025061			5	5		250	244	0		1	0		0	0	79	0		0.934172	2.900688e-02	0	0	0	11	0	5	250
USP29	57663	broad.mit.edu	37	19	57641566	57641566	+	Missense_Mutation	SNP	T	T	A	rs145552693		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr19:57641566T>A	ENST00000254181.4	+	4	1977	c.1523T>A	c.(1522-1524)aTc>aAc	p.I508N	USP29_ENST00000598197.1_Missense_Mutation_p.I508N	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	508	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGGGTCCTTATCATTCATCTG	0.368																																						ENST00000254181.4	1.000000	0.040000	2.100000e-01	7.000000e-02	0.120000	0.205652	0.120000	0.110000																										0				85						c.(1522-1524)aTc>aAc		ubiquitin specific peptidase 29							107.0	111.0	110.0					19																	57641566		2203	4300	6503	SO:0001583	missense	57663	0	0					g.chr19:57641566T>A		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1523T>A	chr19.hg19:g.57641566T>A	ENSP00000254181:p.Ile508Asn	1					USP29_ENST00000598197.1_Missense_Mutation_p.I508N	p.I508N	NM_020903.2	NP_065954.1	0	2	2	1.961025	Q9HBJ7	UBP29_HUMAN		4	1977	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		Missense_Mutation	SNP	ENST00000254181.4	0	1	hg19	c.1523T>A	CCDS33124.1	0	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737455	0.30774	.	.	ENSG00000131864	ENST00000254181	T	0.77229	-1.08	2.69	1.66	0.24008	2.69	1.66	0.24008	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.32819	U	0.005605	D	0.84483	0.5482	M	0.78916	2.43	0.31512	N	0.663476	D	0.89917	1.0	D	0.97110	1.0	T	0.81992	-0.0678	10	0.87932	D	0	-10.247	5.9622	0.19305	0.0:0.138:0.0:0.8619	.	508	Q9HBJ7	UBP29_HUMAN	N	508	ENSP00000254181:I508N	ENSP00000254181:I508N	I	+	2	0	0	USP29	62333378	62333378	1.000000	0.71417	0.168000	0.22838	0.221000	0.24807	3.064000	0.49986	0.430000	0.26230	0.482000	0.46254	ATC	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.368	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1	0	0	1		2	2	2	0		0	0	103		103	103	1	1.910000	-5.220647	1	0.210000				5	5		435	432	0		1			0	0	103	0		0.936748	0	0	0	0	0	0	5	435
MTOR	2475	broad.mit.edu	37	1	11193143	11193143	+	Missense_Mutation	SNP	C	C	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr1:11193143C>G	ENST00000361445.4	-	38	5434	c.5358G>C	c.(5356-5358)tgG>tgC	p.W1786C	MTOR_ENST00000495435.1_5'UTR|MTOR_ENST00000376838.1_5'Flank	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1786	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TCACCTTGTACCAGCTGCGGT	0.577																																						ENST00000361445.4	1.000000	0.520000	9.100000e-01	6.300000e-01	0.750000	0.766159	0.750000	1.000000																										0				149						c.(5356-5358)tgG>tgC		mechanistic target of rapamycin (serine/threonine kinase)	Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)						135.0	127.0	130.0					1																	11193143		2203	4300	6503	SO:0001583	missense	2475	0	0					g.chr1:11193143C>G	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.5358G>C	chr1.hg19:g.11193143C>G	ENSP00000354558:p.Trp1786Cys	0					MTOR_ENST00000495435.1_5'UTR|MTOR_ENST00000376838.1_5'Flank	p.W1786C	NM_004958.3	NP_004949.1	1	2	3	2.034459	P42345	MTOR_HUMAN		38	5434	-			Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	1	1	hg19	c.5358G>C	CCDS127.1	0	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875568	0.51695	.	.	ENSG00000198793	ENST00000361445	T	0.72835	-0.69	5.65	4.74	0.60224	5.65	4.74	0.60224	PIK-related kinase (1);PIK-related kinase, FAT (1);Armadillo-like helical (1);	0.059201	0.64402	N	0.000001	T	0.73393	0.3581	M	0.80616	2.505	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71741	-0.4501	10	0.51188	T	0.08	-12.1729	16.7143	0.85394	0.0:0.8706:0.1294:0.0	.	1786	P42345	MTOR_HUMAN	C	1786	ENSP00000354558:W1786C	ENSP00000354558:W1786C	W	-	3	0	0	MTOR	11115730	11115730	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.456000	0.80751	1.367000	0.46095	0.655000	0.94253	TGG	0.214946		TCGA-XD-AAUI-01A-42D-A40W-08	0.577	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	1	0	1		2	2	2	0		0	0	106		106	104	1	1.910000	-9.515631	1	0.210000	NM_004958			33	33		392	387	0		1	1		0	0	106	0		1.000000	3.951495e-01	0	8	0	9	0	33	392
KRTAP24-1	643803	broad.mit.edu	37	21	31654596	31654596	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr21:31654596G>A	ENST00000340345.4	-	1	680	c.655C>T	c.(655-657)Cga>Tga	p.R219*		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	219	6 X 10 AA repeats of Y-[ILR]-[SVPC]- [NRTS]-[SNTG]-X-[QHRP]-[PSY]-[QSL]-[SRK].					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						CTCAGTGGTCGGCAGCTCGTA	0.443																																						ENST00000340345.4	0.490000	0.170000	4.100000e-01	2.300000e-01	0.310000	0.326617	0.310000	0.310000																										0				14						c.(655-657)Cga>Tga		keratin associated protein 24-1							97.0	95.0	96.0					21																	31654596		1861	4091	5952	SO:0001587	stop_gained	643803	2	120808	34				g.chr21:31654596G>A	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.655C>T	chr21.hg19:g.31654596G>A	ENSP00000339238:p.Arg219*	0						p.R219*	NM_001085455.1	NP_001078924.1	0	0	0	1.978313	Q3LI83	KR241_HUMAN		1	680	-			Q1XDX0	Nonsense_Mutation	SNP	ENST00000340345.4	0	1	hg19	c.655C>T	CCDS42915.1	0	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967829	0.53507	.	.	ENSG00000188694	ENST00000340345	.	.	.	4.04	3.15	0.36227	4.04	3.15	0.36227	.	1.427210	0.04871	N	0.445896	.	.	.	.	.	.	0.47214	D	0.999352	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.7357	8.2674	0.31821	0.1164:0.0:0.8836:0.0	.	.	.	.	X	219	.	ENSP00000339238:R219X	R	-	1	2	2	KRTAP24-1	30576467	30576467	0.010000	0.17322	0.013000	0.15412	0.022000	0.10575	1.624000	0.37018	0.998000	0.38996	-0.251000	0.11542	CGA	0.191319		TCGA-XD-AAUI-01A-42D-A40W-08	0.443	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	0	0	1		2	2	2	0		0	0	112		112	112	1	1.910000	-2.621413	1	0.210000	NM_001085455			14	13		407	402	0		1			0	0	112	0		0.999738	0	0	0	0	0	0	14	407
MYCN	4613	broad.mit.edu	37	2	16086019	16086019	+	Missense_Mutation	SNP	T	T	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr2:16086019T>A	ENST00000281043.3	+	3	1492	c.1195T>A	c.(1195-1197)Tcc>Acc	p.S399T		NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	399	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			CGACCTTCGGTCCAGCTTTCT	0.562			A		neuroblastoma																																	ENST00000281043.3	1.000000	0.750000	1	8.700000e-01	0.990000	0.952667	0.990000	1.000000				Dom	yes			Dom	yes		2	2p24.1	2p24.1	4613	A	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""				O	O			neuroblastoma		0				31						c.(1195-1197)Tcc>Acc		v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog							83.0	89.0	87.0					2																	16086019		2203	4300	6503	SO:0001583	missense	4613	0	0					g.chr2:16086019T>A	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.1195T>A	chr2.hg19:g.16086019T>A	ENSP00000281043:p.Ser399Thr	0						p.S399T	NM_005378.4	NP_005369.2	1	2	3	2.075048	P04198	MYCN_HUMAN	GBM - Glioblastoma multiforme(3;0.000332)	3	1492	+	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		Q53XS5|Q6LDT9	Missense_Mutation	SNP	ENST00000281043.3	1	1	hg19	c.1195T>A	CCDS1687.1	1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831915	0.50845	.	.	ENSG00000134323	ENST00000281043;ENST00000426211	D	0.98120	-4.73	5.14	3.98	0.46160	5.14	3.98	0.46160	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.95335	0.8486	N	0.05078	-0.115	0.53688	D	0.999976	D	0.64830	0.994	D	0.64506	0.926	D	0.92718	0.6189	10	0.22109	T	0.4	-18.6908	10.7944	0.46451	0.0:0.0748:0.0:0.9252	.	399	P04198	MYCN_HUMAN	T	399;317	ENSP00000281043:S399T	ENSP00000281043:S399T	S	+	1	0	0	MYCN	16003470	16003470	1.000000	0.71417	0.850000	0.33497	0.991000	0.79684	5.091000	0.64505	0.931000	0.37242	0.496000	0.49642	TCC	0.223053		TCGA-XD-AAUI-01A-42D-A40W-08	0.562	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	0	0	1		13	2	2	1		1	1	145		145	145	1	1.910000	-20.000000	1	0.210000	NM_005378			51	50		449	442	1		1	0		1	0	145	0		1.000000	3.028889e-02	0	0	0	3	0	51	449
LRP1B	53353	broad.mit.edu	37	2	141533746	141533746	+	Silent	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr2:141533746G>A	ENST00000389484.3	-	33	6392	c.5421C>T	c.(5419-5421)gaC>gaT	p.D1807D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1807					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGTTTCTTCCGTCTCTTTTGC	0.383										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	ENST00000389484.3	1.000000	0.880000	1	9.900000e-01	0.990000	0.992440	0.990000	1.000000																										0				606						c.(5419-5421)gaC>gaT		low density lipoprotein receptor-related protein 1B							128.0	124.0	125.0					2																	141533746		2203	4300	6503	SO:0001819	synonymous_variant	53353	6	121412	38				g.chr2:141533746G>A	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5421C>T	chr2.hg19:g.141533746G>A		0	TSP Lung(27;0.18)					p.D1807D	NM_018557.2	NP_061027.2	1	2	3	2.075048	Q9NZR2	LRP1B_HUMAN		33	6392	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	1	1	hg19	c.5421C>T	CCDS2182.1	1																																																																																								0.223053		TCGA-XD-AAUI-01A-42D-A40W-08	0.383	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	1	0	1		2	2	2	0		0	0	50		50	49	1	1.910000	-14.093960	1	0.210000	NM_018557			30	30		203	201	1		1			0	0	50	0		1.000000	0	0	0	0	0	0	30	203
SCN9A	6335	broad.mit.edu	37	2	167056341	167056341	+	Missense_Mutation	SNP	A	A	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr2:167056341A>G	ENST00000409435.1	-	26	4807	c.4808T>C	c.(4807-4809)tTt>tCt	p.F1603S	SCN9A_ENST00000409672.1_Missense_Mutation_p.F1592S|SCN9A_ENST00000303354.6_Missense_Mutation_p.F1604S|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000375387.4_Missense_Mutation_p.F1604S			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1603					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGGGGACACAAAATACGTTTC	0.423																																						ENST00000409435.1	1.000000	0.740000	1	8.700000e-01	0.990000	0.954575	0.990000	1.000000																										0				108						c.(4807-4809)tTt>tCt		sodium channel, voltage-gated, type IX, alpha subunit	Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)						112.0	120.0	117.0					2																	167056341		2203	4300	6503	SO:0001583	missense	6335	0	0					g.chr2:167056341A>G	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4808T>C	chr2.hg19:g.167056341A>G	ENSP00000386330:p.Phe1603Ser	0					AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.F1592S|SCN9A_ENST00000303354.6_Missense_Mutation_p.F1604S|SCN9A_ENST00000375387.4_Missense_Mutation_p.F1604S	p.F1603S			1	2	3	2.075048	Q15858	SCN9A_HUMAN		26	4807	-			A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	1	1	hg19	c.4808T>C	CCDS46441.1	1	.	.	.	.	.	.	.	.	.	.	A	19.39	3.817625	0.70912	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98296	-4.85;-4.85;-4.85;-4.85	5.74	5.74	0.90152	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000009	D	0.98425	0.9476	M	0.65498	2.005	0.80722	D	1	D	0.55172	0.97	P	0.58820	0.846	D	0.99548	1.0965	10	0.87932	D	0	.	16.0249	0.80536	1.0:0.0:0.0:0.0	.	1592	E7EUN6	.	S	1592;1604;1604;1603	ENSP00000386306:F1592S;ENSP00000364536:F1604S;ENSP00000304748:F1604S;ENSP00000386330:F1603S	ENSP00000304748:F1604S	F	-	2	0	0	SCN9A	166764587	166764587	1.000000	0.71417	0.998000	0.56505	0.855000	0.48748	9.157000	0.94714	2.181000	0.69327	0.528000	0.53228	TTT	0.223053		TCGA-XD-AAUI-01A-42D-A40W-08	0.423	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	1	0	1		2	2	2	0		0	0	89		89	88	1	1.910000	-20.000000	1	0.210000	NM_002977			43	43		373	364	0		1			0	0	89	0		1.000000	0	0	0	0	0	0	43	373
XIRP2	129446	broad.mit.edu	37	2	168103840	168103840	+	Missense_Mutation	SNP	A	A	C			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr2:168103840A>C	ENST00000409195.1	+	9	6027	c.5938A>C	c.(5938-5940)Aag>Cag	p.K1980Q	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.K1980Q|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.K1758Q|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1805					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TCTTCAGCCAAAGCCAGGTCC	0.468																																						ENST00000409195.1	1.000000	0.400000	9.800000e-01	5.300000e-01	0.690000	0.719264	0.690000	1.000000																										0				315						c.(5938-5940)Aag>Cag		xin actin-binding repeat containing 2							42.0	42.0	42.0					2																	168103840		1912	4124	6036	SO:0001583	missense	129446	0	0					g.chr2:168103840A>C	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5938A>C	chr2.hg19:g.168103840A>C	ENSP00000386840:p.Lys1980Gln	0					XIRP2_ENST00000295237.9_Missense_Mutation_p.K1980Q|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.K1758Q|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron	p.K1980Q	NM_152381.5	NP_689594.4	1	2	3	2.075048	A4UGR9	XIRP2_HUMAN		9	6027	+			A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	1	1	hg19	c.5938A>C	CCDS42769.1	0	.	.	.	.	.	.	.	.	.	.	A	0.052	-1.247707	0.01469	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02552	4.25;4.25;4.25	5.73	2.16	0.27623	5.73	2.16	0.27623	.	0.674670	0.15536	N	0.257239	T	0.01558	0.0050	N	0.14661	0.345	0.09310	N	1	B;B;B	0.26258	0.09;0.145;0.091	B;B;B	0.24541	0.024;0.054;0.034	T	0.48399	-0.9039	10	0.12766	T	0.61	-1.5086	3.3189	0.07043	0.5633:0.0:0.2707:0.1659	.	1805;1805;1758	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Q	1980;1980;1758	ENSP00000386840:K1980Q;ENSP00000295237:K1980Q;ENSP00000387255:K1758Q	ENSP00000295237:K1980Q	K	+	1	0	0	XIRP2	167812086	167812086	0.000000	0.05858	0.947000	0.38551	0.012000	0.07955	-0.097000	0.11042	0.465000	0.27167	-0.263000	0.10527	AAG	0.223053		TCGA-XD-AAUI-01A-42D-A40W-08	0.468	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	1	0	1		2	2	2	0		0	0	61		61	61	1	1.910000	-19.894760	1	0.210000	NM_152381			16	14		220	220	0		1			0	0	61	0		0.999938	0	0	0	0	0	0	16	220
SIX2	10736	broad.mit.edu	37	2	45233480	45233480	+	Silent	SNP	C	C	T	rs146943650	byFrequency	TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr2:45233480C>T	ENST00000303077.6	-	2	1024	c.705G>A	c.(703-705)ccG>ccA	p.P235P		NM_016932.4	NP_058628.3	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	235					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|kidney development (GO:0001822)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesenchymal stem cell proliferation (GO:0097168)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|middle ear morphogenesis (GO:0042474)|nephron development (GO:0072006)|nephron morphogenesis (GO:0072028)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus (GO:0006606)|regulation of branching involved in ureteric bud morphogenesis (GO:0090189)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P235P(1)		endometrium(6)|large_intestine(3)|lung(8)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	22		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CAGGGGGCGGCGGGCTGAGGA	0.706													C|||	5	0.000998403	0.0038	0.0	5008	,	,		16657	0.0		0.0	False		,,,				2504	0.0					ENST00000303077.6	1.000000	0.300000	7.500000e-01	4.000000e-01	0.520000	0.578975	0.520000	0.500000																										1	Substitution - coding silent(1)	p.P235P(1)	pancreas(1)	22						c.(703-705)ccG>ccA		SIX homeobox 2		C		11,4395	17.9+/-39.9	0,11,2192	57.0	63.0	61.0		705	3.0	1.0	2	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SIX2	NM_016932.4		0,12,6491	TT,TC,CC		0.0116,0.2497,0.0923		235/292	45233480	12,12994	2203	4300	6503	SO:0001819	synonymous_variant	10736	48	121410	49				g.chr2:45233480C>T	AF136939	CCDS1822.1	2p21	2011-06-20	2007-07-13		ENSG00000170577	ENSG00000170577		"""Homeoboxes / SINE class"""	10888	protein-coding gene	gene with protein product		604994	"""sine oculis homeobox (Drosophila) homolog 2"", ""sine oculis homeobox homolog 2 (Drosophila)"""				Standard	NM_016932		Approved		uc002ruo.3	Q9NPC8	OTTHUMG00000152421	ENST00000303077.6:c.705G>A	chr2.hg19:g.45233480C>T		0						p.P235P	NM_016932.4	NP_058628.3	1	2	3	2.075048	Q9NPC8	SIX2_HUMAN		2	1024	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Q9BXH7	Silent	SNP	ENST00000303077.6	1	1	hg19	c.705G>A	CCDS1822.1	0																																																																																								0.223053		TCGA-XD-AAUI-01A-42D-A40W-08	0.706	SIX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326188.2	0	0	1		2	2	2	0		0	0	106		106	105	1	1.910000	-3.317208	1	0.210000				16	16		296	286	0		1	0		0	0	106	0		0.999921	3.947501e-02	0	1	0	5	0	16	296
FBXO11	80204	broad.mit.edu	37	2	48066031	48066031	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr2:48066031C>T	ENST00000403359.3	-	4	626	c.554G>A	c.(553-555)cGc>cAc	p.R185H	FBXO11_ENST00000378314.3_Missense_Mutation_p.R67H|FBXO11_ENST00000402508.1_Missense_Mutation_p.R101H|FBXO11_ENST00000316377.4_Missense_Mutation_p.R101H|FBXO11_ENST00000480038.1_5'UTR	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	185	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTCACTGAAGCGTTTACATAC	0.363			"""Mis, F, D"""		DLBCL																																	ENST00000403359.3	1.000000	0.880000	1	9.900000e-01	0.990000	0.992454	0.990000	1.000000				Rec	yes			Rec	yes		2	2p16.3	2p16.3	80204	Mis, F, D	F-box protein 11				L	L			DLBCL		2	Whole gene deletion(2)	p.0?(2)	haematopoietic_and_lymphoid_tissue(2)	26						c.(553-555)cGc>cAc		F-box protein 11							115.0	106.0	109.0					2																	48066031		2203	4300	6503	SO:0001583	missense	80204	0	0					g.chr2:48066031C>T	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.554G>A	chr2.hg19:g.48066031C>T	ENSP00000384823:p.Arg185His	0					FBXO11_ENST00000480038.1_5'UTR|FBXO11_ENST00000402508.1_Missense_Mutation_p.R101H|FBXO11_ENST00000378314.3_Missense_Mutation_p.R67H|FBXO11_ENST00000316377.4_Missense_Mutation_p.R101H	p.R185H	NM_001190274.1	NP_001177203.1	1	2	3	2.075048	Q86XK2	FBX11_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)	4	626	-		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	0	1	hg19	c.554G>A	CCDS54357.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.310469	0.95629	.	.	ENSG00000138081	ENST00000402508;ENST00000403359;ENST00000316377;ENST00000424163;ENST00000378314	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.5	5.5	0.81552	5.5	5.5	0.81552	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.69070	0.3070	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.71906	-0.4451	10	0.87932	D	0	-4.1684	19.3886	0.94570	0.0:1.0:0.0:0.0	.	185	Q86XK2	FBX11_HUMAN	H	101;185;101;101;67	ENSP00000385398:R101H;ENSP00000384823:R185H;ENSP00000323822:R101H;ENSP00000392272:R101H;ENSP00000367565:R67H	ENSP00000323822:R101H	R	-	2	0	0	FBXO11	47919535	47919535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.573000	0.86826	0.563000	0.77884	CGC	0.223053		TCGA-XD-AAUI-01A-42D-A40W-08	0.363	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	0	0	1		14	3	2	1		1	1	65		65	65	1	1.910000	-14.982660	1	0.210000	NM_012167, NM_018693, NM_025133			33	32		227	226	1		1	1		1	0	65	0		0.998886	3.817560e-01	0	6	0	11	0	33	227
ALS2CR12	130540	broad.mit.edu	37	2	202172323	202172323	+	Silent	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr2:202172323G>A	ENST00000286190.5	-	10	844	c.798C>T	c.(796-798)ttC>ttT	p.F266F	ALS2CR12_ENST00000392257.3_Silent_p.F266F|ALS2CR12_ENST00000439709.1_Silent_p.F266F|ALS2CR12_ENST00000405148.2_Silent_p.F266F|ALS2CR12_ENST00000448967.1_5'Flank			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	266					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)		p.F266F(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						ACTCCATTTCGAATTTTTTGG	0.383																																						ENST00000286190.5	1.000000	0.350000	7.000000e-01	4.300000e-01	0.530000	0.581268	0.530000	0.510000																										1	Substitution - coding silent(1)	p.F266F(1)	large_intestine(1)	21						c.(796-798)ttC>ttT		amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12							156.0	159.0	158.0					2																	202172323		2203	4298	6501	SO:0001819	synonymous_variant	130540	6	121404	41				g.chr2:202172323G>A	AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.798C>T	chr2.hg19:g.202172323G>A		0					ALS2CR12_ENST00000392257.3_Silent_p.F266F|ALS2CR12_ENST00000448967.1_5'Flank|ALS2CR12_ENST00000405148.2_Silent_p.F266F|ALS2CR12_ENST00000439709.1_Silent_p.F266F	p.F266F			1	2	3	2.067490	Q96Q35	AL2SB_HUMAN		10	844	-			G5E9S3|Q53TT6|Q8N1B6	Silent	SNP	ENST00000286190.5	1	1	hg19	c.798C>T	CCDS2346.1	0	.	.	.	.	.	.	.	.	.	.	G	0.508	-0.867740	0.02590	.	.	ENSG00000155749	ENST00000415745	.	.	.	5.53	-0.054	0.13816	5.53	-0.054	0.13816	.	.	.	.	.	T	0.50888	0.1642	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35919	-0.9769	4	.	.	.	-8.4115	5.6157	0.17430	0.6368:0.1427:0.2205:0.0	.	.	.	.	L	41	.	.	S	-	2	0	0	ALS2CR12	201880568	201880568	0.992000	0.36948	0.993000	0.49108	0.026000	0.11368	0.295000	0.19065	-0.114000	0.11936	-0.300000	0.09419	TCG	0.221445		TCGA-XD-AAUI-01A-42D-A40W-08	0.383	ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256286.1	1	0	1		2	2	2	0		0	0	137		137	137	1	1.910000	-5.217164	1	0.210000	NM_139163			26	26		462	458	0		1			0	0	137	0		1.000000	0	0	0	0	0	0	26	462
BOC	91653	broad.mit.edu	37	3	112998688	112998688	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr3:112998688C>T	ENST00000495514.1	+	13	2742	c.2038C>T	c.(2038-2040)Cga>Tga	p.R680*	BOC_ENST00000273395.4_Nonsense_Mutation_p.R681*|BOC_ENST00000355385.3_Nonsense_Mutation_p.R680*			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	680	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CTACAAGTTTCGAGTCCGGGC	0.622																																						ENST00000495514.1	1.000000	0.380000	7.500000e-01	4.700000e-01	0.580000	0.624300	0.580000	0.560000																										0				68						c.(2038-2040)Cga>Tga		BOC cell adhesion associated, oncogene regulated							71.0	78.0	76.0					3																	112998688		2203	4300	6503	SO:0001587	stop_gained	91653	0	0					g.chr3:112998688C>T	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2038C>T	chr3.hg19:g.112998688C>T	ENSP00000418663:p.Arg680*	0					BOC_ENST00000273395.4_Nonsense_Mutation_p.R681*|BOC_ENST00000355385.3_Nonsense_Mutation_p.R680*	p.R680*			1	2	3	2.064228	Q9BWV1	BOC_HUMAN	Epithelial(53;0.227)	13	2742	+			A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Nonsense_Mutation	SNP	ENST00000495514.1	0	1	hg19	c.2038C>T	CCDS2971.1	0	.	.	.	.	.	.	.	.	.	.	C	43	10.022862	0.99319	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	.	.	.	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.065151	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4493	0.94860	0.0:1.0:0.0:0.0	.	.	.	.	X	680;681;680	.	ENSP00000273395:R681X	R	+	1	2	2	BOC	114481378	114481378	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	5.444000	0.66587	2.593000	0.87608	0.563000	0.77884	CGA	0.220638		TCGA-XD-AAUI-01A-42D-A40W-08	0.622	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	1	0	1		2	2	2	0		0	0	95		95	91	1	1.910000	-6.147839	1	0.210000	NM_033254			27	24		433	425	0		1	0		0	0	95	0		1.000000	2.757958e-01	0	0	0	17	0	27	433
DHX36	170506	broad.mit.edu	37	3	154018839	154018839	+	Missense_Mutation	SNP	T	T	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr3:154018839T>A	ENST00000496811.1	-	10	1375	c.1295A>T	c.(1294-1296)aAa>aTa	p.K432I	DHX36_ENST00000329463.5_Missense_Mutation_p.K432I|DHX36_ENST00000308361.6_Missense_Mutation_p.K432I|DHX36_ENST00000544526.1_Missense_Mutation_p.K432I	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	432					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTTTCTTCTTTTTCTTGTCT	0.353																																						ENST00000496811.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.998838	0.990000	1.000000																										0				35						c.(1294-1296)aAa>aTa		DEAH (Asp-Glu-Ala-His) box polypeptide 36							118.0	123.0	122.0					3																	154018839		2203	4300	6503	SO:0001583	missense	170506	0	0					g.chr3:154018839T>A	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.1295A>T	chr3.hg19:g.154018839T>A	ENSP00000417078:p.Lys432Ile	0					DHX36_ENST00000308361.6_Missense_Mutation_p.K432I|DHX36_ENST00000329463.5_Missense_Mutation_p.K432I|DHX36_ENST00000544526.1_Missense_Mutation_p.K432I	p.K432I	NM_020865.2	NP_065916.2	1	2	3	2.064228	Q9H2U1	DHX36_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)	10	1375	-			B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	1	1	hg19	c.1295A>T	CCDS3171.1	1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.813041	0.70912	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.03801	3.98;3.9;3.81;3.8;3.99	5.73	5.73	0.89815	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.12475	0.0303	L	0.60845	1.875	0.54753	D	0.999989	P;P;B	0.42456	0.78;0.78;0.27	P;P;B	0.48400	0.576;0.576;0.092	T	0.00240	-1.1887	10	0.72032	D	0.01	.	16.0307	0.80574	0.0:0.0:0.0:1.0	.	432;432;432	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	I	432;432;432;432;346	ENSP00000417078:K432I;ENSP00000309296:K432I;ENSP00000444247:K432I;ENSP00000330113:K432I;ENSP00000419862:K346I	ENSP00000309296:K432I	K	-	2	0	0	DHX36	155501533	155501533	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.502000	0.73695	2.190000	0.69967	0.455000	0.32223	AAA	0.220638		TCGA-XD-AAUI-01A-42D-A40W-08	0.353	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	1	0	0		2	2	2	0		0	0	97		97	97	1	1.910000	-20.000000	1	0.210000	NM_020865			61	60		402	400	1		1	1		0	0	97	0		1.000000	9.072670e-01	0	3	0	26	0	61	402
ANKRD28	23243	broad.mit.edu	37	3	15720986	15720986	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr3:15720986G>A	ENST00000399451.2	-	22	2751	c.2384C>T	c.(2383-2385)gCc>gTc	p.A795V	ANKRD28_ENST00000497037.1_5'UTR|ANKRD28_ENST00000383777.1_Missense_Mutation_p.A828V	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	795						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						TACTTACACGGCACAATGCAA	0.378																																						ENST00000399451.2	1.000000	0.100000	5.000000e-01	1.800000e-01	0.290000	0.373596	0.290000	0.250000																										0				6						c.(2383-2385)gCc>gTc		ankyrin repeat domain 28							110.0	99.0	102.0					3																	15720986		1893	4119	6012	SO:0001583	missense	23243	0	0					g.chr3:15720986G>A	AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.2384C>T	chr3.hg19:g.15720986G>A	ENSP00000382379:p.Ala795Val	0					ANKRD28_ENST00000497037.1_5'UTR|ANKRD28_ENST00000383777.1_Missense_Mutation_p.A828V	p.A795V	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	1	2	3	2.064228	O15084	ANR28_HUMAN		22	2751	-			B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	ENST00000399451.2	0	1	hg19	c.2384C>T	CCDS46769.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.755213	0.96898	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.79653	-1.29;-1.29;-1.29	6.06	6.06	0.98353	6.06	6.06	0.98353	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.91751	0.7391	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91917	0.5544	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	795	O15084	ANR28_HUMAN	V	795;828;795	ENSP00000382379:A795V;ENSP00000373287:A828V;ENSP00000397341:A795V	ENSP00000373287:A828V	A	-	2	0	0	ANKRD28	15695990	15695990	1.000000	0.71417	0.997000	0.53966	0.919000	0.55068	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	GCC	0.220638		TCGA-XD-AAUI-01A-42D-A40W-08	0.378	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339758.1	0	0	1		2	2	2	0		0	0	47		47	47	1	1.910000	-3.019073	1	0.210000	NM_015199			5	5		182	179	0		1	0		0	0	47	0		0.935712	1.484274e-01	0	0	0	21	0	5	182
TLR9	54106	broad.mit.edu	37	3	52257685	52257685	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr3:52257685C>T	ENST00000360658.2	-	2	1280	c.647G>A	c.(646-648)cGc>cAc	p.R216H	TLR9_ENST00000597542.1_Missense_Mutation_p.R240H|TLR9_ENST00000494383.1_Silent_p.P369P	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	216					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.R216H(1)		endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	AGGCAGGTTGCGGGGCACCAC	0.632																																						ENST00000360658.2	1.000000	0.200000	8.100000e-01	3.200000e-01	0.500000	0.552728	0.500000	0.440000																										1	Substitution - Missense(1)	p.R216H(1)	large_intestine(1)	30						c.(646-648)cGc>cAc		toll-like receptor 9	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)						39.0	33.0	35.0					3																	52257685		2203	4300	6503	SO:0001583	missense	54106	1	121364	23				g.chr3:52257685C>T	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.647G>A	chr3.hg19:g.52257685C>T	ENSP00000353874:p.Arg216His	0					TLR9_ENST00000494383.1_Silent_p.P369P|TLR9_ENST00000597542.1_Missense_Mutation_p.R240H	p.R216H	NM_017442.3	NP_059138.1	1	2	3	2.064228	Q9NR96	TLR9_HUMAN		2	1280	-			B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	0	1	hg19	c.647G>A	CCDS2848.1	0	.	.	.	.	.	.	.	.	.	.	C	15.78	2.934649	0.52866	.	.	ENSG00000239732	ENST00000360658	T	0.57273	0.41	5.57	1.0	0.19881	5.57	1.0	0.19881	.	0.000000	0.37012	N	0.002294	T	0.45955	0.1368	N	0.11870	0.19	0.09310	N	1	P;D	0.89917	0.476;1.0	B;D	0.76575	0.057;0.988	T	0.23655	-1.0182	10	0.52906	T	0.07	.	3.8792	0.09071	0.3023:0.4532:0.0:0.2445	.	313;216	B4E0A1;Q9NR96	.;TLR9_HUMAN	H	216	ENSP00000353874:R216H	ENSP00000353874:R216H	R	-	2	0	0	TLR9	52232725	52232725	0.000000	0.05858	0.326000	0.25389	0.560000	0.35617	-0.644000	0.05415	0.263000	0.21812	0.655000	0.94253	CGC	0.220638		TCGA-XD-AAUI-01A-42D-A40W-08	0.632	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1	1	0	1		2	2	2	0		0	0	32		32	32	1	1.910000	-3.149805	1	0.210000				6	5		123	120	0		1	0		0	0	32	0		0.962635	0	0	0	0	1	0	6	123
ITIH3	3699	broad.mit.edu	37	3	52829637	52829637	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr3:52829637G>A	ENST00000449956.2	+	2	118	c.112G>A	c.(112-114)Ggg>Agg	p.G38R	ITIH3_ENST00000416872.2_Missense_Mutation_p.G38R	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	38	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CCTCCCGGAAGGGGTAAGAAC	0.567																																						ENST00000449956.2	1.000000	0.950000	1	9.900000e-01	0.990000	0.996052	0.990000	1.000000																										0				25						c.(112-114)Ggg>Agg		inter-alpha-trypsin inhibitor heavy chain 3							26.0	32.0	30.0					3																	52829637		2090	4213	6303	SO:0001583	missense	3699	0	0					g.chr3:52829637G>A		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.112G>A	chr3.hg19:g.52829637G>A	ENSP00000415769:p.Gly38Arg	0					ITIH3_ENST00000416872.2_Missense_Mutation_p.G38R	p.G38R	NM_002217.3	NP_002208.3	1	2	3	2.064228	Q06033	ITIH3_HUMAN		2	118	+			Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	ENST00000449956.2	1	1	hg19	c.112G>A	CCDS46845.1	1	.	.	.	.	.	.	.	.	.	.	G	9.970	1.225261	0.22457	.	.	ENSG00000162267	ENST00000398670;ENST00000536431;ENST00000273291;ENST00000416872;ENST00000449956	T;T	0.02631	4.22;4.88	4.17	2.37	0.29283	4.17	2.37	0.29283	Vault protein inter-alpha-trypsin (1);Vault protein inter-alpha-trypsin, metazoa (1);	0.950075	0.08821	N	0.888844	T	0.01489	0.0048	N	0.03608	-0.345	0.34715	D	0.728176	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.001	T	0.40327	-0.9569	10	0.16420	T	0.52	-9.1591	6.4221	0.21750	0.2186:0.0:0.7814:0.0	.	38;38	E7ET33;Q06033	.;ITIH3_HUMAN	R	38;38;33;38;38	ENSP00000413922:G38R;ENSP00000415769:G38R	ENSP00000273291:G33R	G	+	1	0	0	ITIH3	52804677	52804677	0.984000	0.35163	0.991000	0.47740	0.958000	0.62258	0.768000	0.26590	0.716000	0.32124	0.591000	0.81541	GGG	0.220638		TCGA-XD-AAUI-01A-42D-A40W-08	0.567	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	1	0	1		2	2	2	0		0	0	16		16	15	1	1.910000	-19.991840	1	0.210000	NM_002217			12	12		56	55	1		1	0		0	0	16	0		0.999354	7.369483e-01	0	0	0	14	0	12	56
DHX36	170506	broad.mit.edu	37	3	154018849	154018849	+	Missense_Mutation	SNP	T	T	C	rs201175580		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr3:154018849T>C	ENST00000496811.1	-	10	1365	c.1285A>G	c.(1285-1287)Aga>Gga	p.R429G	DHX36_ENST00000329463.5_Missense_Mutation_p.R429G|DHX36_ENST00000308361.6_Missense_Mutation_p.R429G|DHX36_ENST00000544526.1_Missense_Mutation_p.R429G	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	429					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTTCTTGTCTATTTACATGC	0.343																																						ENST00000496811.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999196	0.990000	1.000000																										0				35						c.(1285-1287)Aga>Gga		DEAH (Asp-Glu-Ala-His) box polypeptide 36		T	GLY/ARG,GLY/ARG	0,4406		0,0,2203	110.0	115.0	113.0		1285,1285	3.3	0.9	3		113	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DHX36	NM_001114397.1,NM_020865.2	125,125	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging	429/995,429/1009	154018849	1,13005	2203	4300	6503	SO:0001583	missense	170506	18	121408	47				g.chr3:154018849T>C	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.1285A>G	chr3.hg19:g.154018849T>C	ENSP00000417078:p.Arg429Gly	0					DHX36_ENST00000308361.6_Missense_Mutation_p.R429G|DHX36_ENST00000329463.5_Missense_Mutation_p.R429G|DHX36_ENST00000544526.1_Missense_Mutation_p.R429G	p.R429G	NM_020865.2	NP_065916.2	1	2	3	2.064228	Q9H2U1	DHX36_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)	10	1365	-			B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	ENST00000496811.1	1	1	hg19	c.1285A>G	CCDS3171.1	1	.	.	.	.	.	.	.	.	.	.	T	11.26	1.587020	0.28268	0.0	1.16E-4	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.03635	4.04;3.97;3.86;3.86;4.05	5.73	3.31	0.37934	5.73	3.31	0.37934	.	0.050847	0.85682	D	0.000000	T	0.05502	0.0145	L	0.60455	1.87	0.42665	D	0.993495	B;P;B	0.47106	0.002;0.89;0.001	B;B;B	0.44224	0.011;0.444;0.004	T	0.48937	-0.8990	10	0.28530	T	0.3	.	8.1451	0.31106	0.1262:0.0:0.2626:0.6112	.	429;429;429	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	G	429;429;429;429;343	ENSP00000417078:R429G;ENSP00000309296:R429G;ENSP00000444247:R429G;ENSP00000330113:R429G;ENSP00000419862:R343G	ENSP00000309296:R429G	R	-	1	2	2	DHX36	155501543	155501543	1.000000	0.71417	0.935000	0.37517	0.661000	0.39034	2.751000	0.47508	0.425000	0.26087	-1.580000	0.00857	AGA	0.220638		TCGA-XD-AAUI-01A-42D-A40W-08	0.343	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	1	0	0		2	2	2	0		0	0	90		90	90	1	1.910000	-6.888420	1	0.210000	NM_020865			60	60		386	384	1		1	1		0	0	90	0		1.000000	9.446982e-01	0	6	0	27	0	60	386
CDH18	1016	broad.mit.edu	37	5	19838947	19838947	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr5:19838947C>T	ENST00000507958.1	-	5	1139	c.149G>A	c.(148-150)cGt>cAt	p.R50H	CDH18_ENST00000274170.4_Missense_Mutation_p.R50H|CDH18_ENST00000502796.1_Missense_Mutation_p.R50H|CDH18_ENST00000511273.1_Missense_Mutation_p.R50H|CDH18_ENST00000382275.1_Missense_Mutation_p.R50H|CDH18_ENST00000506372.1_Missense_Mutation_p.R50H			Q13634	CAD18_HUMAN	cadherin 18, type 2	50					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCTTTTGGGACGATGATGGAC	0.418																																						ENST00000507958.1	0.990000	0.460000	8.500000e-01	5.700000e-01	0.700000	0.720265	0.700000	1.000000																										0				138						c.(148-150)cGt>cAt		cadherin 18, type 2							189.0	158.0	168.0					5																	19838947		2203	4300	6503	SO:0001583	missense	1016	0	0					g.chr5:19838947C>T	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.149G>A	chr5.hg19:g.19838947C>T	ENSP00000425093:p.Arg50His	0					CDH18_ENST00000506372.1_Missense_Mutation_p.R50H|CDH18_ENST00000274170.4_Missense_Mutation_p.R50H|CDH18_ENST00000382275.1_Missense_Mutation_p.R50H|CDH18_ENST00000511273.1_Missense_Mutation_p.R50H|CDH18_ENST00000502796.1_Missense_Mutation_p.R50H	p.R50H			0	0	0	1.939433	Q13634	CAD18_HUMAN		5	1139	-	Lung NSC(1;0.00734)|all_lung(1;0.0197)		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	1	1	hg19	c.149G>A	CCDS3889.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.262701	0.95399	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000511273	T;T;T;T;T;T	0.00585	6.39;6.39;6.39;6.39;6.39;6.39	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.04003	0.0112	M	0.87900	2.915	0.49582	D	0.999802	D;D	0.89917	1.0;1.0	D;D	0.91635	0.987;0.999	T	0.23013	-1.0200	9	.	.	.	.	18.9006	0.92440	0.0:1.0:0.0:0.0	.	50;50	B4DHG6;Q13634	.;CAD18_HUMAN	H	50	ENSP00000371710:R50H;ENSP00000425093:R50H;ENSP00000274170:R50H;ENSP00000424931:R50H;ENSP00000422138:R50H;ENSP00000425854:R50H	.	R	-	2	0	0	CDH18	19874704	19874704	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.452000	0.80683	2.805000	0.96524	0.655000	0.94253	CGT	0.175365		TCGA-XD-AAUI-01A-42D-A40W-08	0.418	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	1	0	1		2	2	2	0		0	0	99		99	99	1	1.910000	-8.080602	1	0.210000	NM_004934			24	24		285	282	0		1			0	0	99	0		1.000000	0	0	0	0	0	0	24	285
DDX43	55510	broad.mit.edu	37	6	74104815	74104815	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr6:74104815G>A	ENST00000370336.4	+	1	345	c.187G>A	c.(187-189)Gct>Act	p.A63T	snoU13_ENST00000459178.1_RNA|OOEP_ENST00000370363.1_5'UTR|DDX43_ENST00000539829.1_Missense_Mutation_p.A63T	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	63					ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						GGCCGTGGCCGCTGGTCACGA	0.617											OREG0003900	type=REGULATORY REGION|Gene=BC024931|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										ENST00000370336.4	0.860000	0.280000	7.000000e-01	3.900000e-01	0.530000	0.549996	0.530000	0.520000																										0				24						c.(187-189)Gct>Act		DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							54.0	47.0	49.0					6																	74104815		2203	4300	6503	SO:0001583	missense	55510	0	0					g.chr6:74104815G>A		CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.187G>A	chr6.hg19:g.74104815G>A	ENSP00000359361:p.Ala63Thr	0		OREG0003900	type=REGULATORY REGION|Gene=BC024931|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1150	OOEP_ENST00000370363.1_5'UTR|snoU13_ENST00000459178.1_RNA|DDX43_ENST00000539829.1_Missense_Mutation_p.A63T	p.A63T	NM_018665.2	NP_061135.2	0	0	0	1.974494	Q9NXZ2	DDX43_HUMAN		1	345	+			B4E0C8|Q6NXR1	Missense_Mutation	SNP	ENST00000370336.4	0	1	hg19	c.187G>A	CCDS4977.1	0	.	.	.	.	.	.	.	.	.	.	G	10.38	1.335280	0.24253	.	.	ENSG00000080007	ENST00000370336;ENST00000539829	T;T	0.47528	2.45;0.84	3.78	-0.215	0.13157	3.78	-0.215	0.13157	.	1.510900	0.04111	N	0.314678	T	0.14013	0.0339	L	0.50333	1.59	0.09310	N	1	P	0.41420	0.749	B	0.28385	0.089	T	0.15150	-1.0447	10	0.48119	T	0.1	.	1.0278	0.01531	0.2122:0.1786:0.4258:0.1834	.	63	Q9NXZ2	DDX43_HUMAN	T	63	ENSP00000359361:A63T;ENSP00000441636:A63T	ENSP00000359361:A63T	A	+	1	0	0	DDX43	74161536	74161536	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.092000	0.15066	-0.064000	0.13043	-0.391000	0.06502	GCT	0.189577		TCGA-XD-AAUI-01A-42D-A40W-08	0.617	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	0	0	1		2	2	2	1		1	0	40		40	40	1	1.910000	-13.957130	1	0.210000	NM_018665			11	10		185	174	0		1			1	0	40	0		0.997904	0	0	0	0	0	0	11	185
TRRAP	8295	broad.mit.edu	37	7	98533290	98533290	+	Missense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr7:98533290C>T	ENST00000359863.4	+	28	4312	c.4103C>T	c.(4102-4104)gCg>gTg	p.A1368V	TRRAP_ENST00000446306.3_Missense_Mutation_p.A1367V|TRRAP_ENST00000355540.3_Missense_Mutation_p.A1368V	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1368					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTACGAATTGCGGCATTAAGT	0.393																																						ENST00000359863.4	1.000000	0.080000	4.100000e-01	1.400000e-01	0.230000	0.320778	0.230000	0.210000																										0				176						c.(4102-4104)gCg>gTg		transformation/transcription domain-associated protein							64.0	60.0	61.0					7																	98533290		2203	4300	6503	SO:0001583	missense	8295	3	121410	25				g.chr7:98533290C>T	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.4103C>T	chr7.hg19:g.98533290C>T	ENSP00000352925:p.Ala1368Val	0					TRRAP_ENST00000446306.3_Missense_Mutation_p.A1367V|TRRAP_ENST00000355540.3_Missense_Mutation_p.A1368V	p.A1368V	NM_001244580.1	NP_001231509.1	1	2	3	2.061193	Q9Y4A5	TRRAP_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)	28	4312	+	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	0	1	hg19	c.4103C>T	CCDS59066.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.2|24.2	4.501952|4.501952	0.85176|0.85176	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.66280|.	-0.2;-0.2|.	6.17|6.17	6.17|6.17	0.99709|0.99709	6.17|6.17	6.17|6.17	0.99709|0.99709	Armadillo-type fold (1);|.	0.051888|.	0.85682|.	D|.	0.000000|.	T|T	0.43166|0.43166	0.1235|0.1235	N|N	0.02751|0.02751	-0.505|-0.505	0.80722|0.80722	D|D	1|1	D;D;D|.	0.62365|.	0.991;0.975;0.987|.	P;B;P|.	0.48654|.	0.585;0.335;0.461|.	T|T	0.40831|0.40831	-0.9542|-0.9542	10|5	0.32370|.	T|.	0.25|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1368;1082;1368|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	V|W	1368;1368;1366|1083	ENSP00000352925:A1368V;ENSP00000347733:A1368V|.	ENSP00000347733:A1368V|.	A|R	+|+	2|1	0|2	0|2	TRRAP|TRRAP	98371226|98371226	98371226|98371226	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.393000|0.393000	0.30537|0.30537	7.622000|7.622000	0.83099|0.83099	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCG|CGG	0.220638		TCGA-XD-AAUI-01A-42D-A40W-08	0.393	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	0	0	1		2	2	2	0		0	0	70		70	70	1	1.910000	-2.972344	1	0.210000	NM_003496			5	5		229	225	0		1	0		0	0	70	0		0.935348	4.306397e-03	0	0	0	4	0	5	229
COL14A1	7373	broad.mit.edu	37	8	121243763	121243763	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr8:121243763G>A	ENST00000297848.3	+	19	2525	c.2255G>A	c.(2254-2256)cGg>cAg	p.R752Q	COL14A1_ENST00000247781.3_Missense_Mutation_p.R657Q|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.R752Q	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TCTAGCCTGCGGGTAAAATGG	0.438																																						ENST00000297848.3	0.680000	0.220000	5.500000e-01	3.000000e-01	0.410000	0.432199	0.410000	0.400000																										0				119						c.(2254-2256)cGg>cAg		collagen, type XIV, alpha 1							119.0	109.0	113.0					8																	121243763		2203	4300	6503	SO:0001583	missense	7373	3	121410	32				g.chr8:121243763G>A		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2255G>A	chr8.hg19:g.121243763G>A	ENSP00000297848:p.Arg752Gln	0					COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000247781.3_Missense_Mutation_p.R657Q|COL14A1_ENST00000309791.4_Missense_Mutation_p.R752Q|COL14A1_ENST00000432943.2_3'UTR	p.R752Q	NM_021110.1	NP_066933.1	0	0	0	1.976688			OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)	19	2525	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)			Missense_Mutation	SNP	ENST00000297848.3	1	1	hg19	c.2255G>A	CCDS34938.1	0	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636123	0.29068	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.55	4.68	0.58851	5.55	4.68	0.58851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.400288	0.24985	N	0.034030	T	0.43322	0.1242	L	0.33093	0.98	0.80722	D	1	B;P	0.40794	0.189;0.729	B;B	0.42798	0.03;0.398	T	0.25467	-1.0131	10	0.31617	T	0.26	.	9.6977	0.40167	0.1605:0.0:0.8395:0.0	.	752;752	Q05707-2;Q05707	.;COEA1_HUMAN	Q	752;752;657;565	ENSP00000311809:R752Q;ENSP00000297848:R752Q;ENSP00000247781:R657Q;ENSP00000409461:R565Q	ENSP00000247781:R657Q	R	+	2	0	0	COL14A1	121312944	121312944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.599000	0.46231	1.365000	0.46057	0.561000	0.74099	CGG	0.191319		TCGA-XD-AAUI-01A-42D-A40W-08	0.438	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	1	0	1		2	2	2	0		0	0	54		54	54	1	1.910000	-2.558700	1	0.210000	NM_021110			11	11		241	238	0		1	0		0	0	54	0		0.998330	8.081325e-01	0	0	0	69	0	11	241
KIAA1045	23349	broad.mit.edu	37	9	34971545	34971545	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chr9:34971545G>A	ENST00000242315.3	+	2	332	c.250G>A	c.(250-252)Gat>Aat	p.D84N	KIAA1045_ENST00000476115.2_Intron|KIAA1045_ENST00000544237.1_Missense_Mutation_p.D84N	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	84							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			GCGGCTCCGAGATGGGCGCGG	0.632																																						ENST00000242315.3	0.660000	0.320000	5.700000e-01	3.900000e-01	0.470000	0.488410	0.470000	0.470000																										0				19						c.(250-252)Gat>Aat		KIAA1045							70.0	86.0	81.0					9																	34971545		2016	4158	6174	SO:0001583	missense	23349	0	0					g.chr9:34971545G>A	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.250G>A	chr9.hg19:g.34971545G>A	ENSP00000242315:p.Asp84Asn	1					KIAA1045_ENST00000544237.1_Missense_Mutation_p.D84N|KIAA1045_ENST00000476115.2_Intron	p.D84N	NM_015297.1	NP_056112.1	0	1	1	1.878350	Q9UPV7	K1045_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00575)	2	332	+			B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	1	1	hg19	c.250G>A	CCDS43796.1	0	.	.	.	.	.	.	.	.	.	.	g	36	5.915546	0.97099	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	6.03	6.03	0.97812	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.78240	0.4252	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75127	-0.3427	8	.	.	.	-3.6405	19.545	0.95291	0.0:0.0:1.0:0.0	.	84	Q9UPV7	K1045_HUMAN	N	84	.	.	D	+	1	0	0	KIAA1045	34961545	34961545	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.258000	0.95555	2.861000	0.98227	0.655000	0.94253	GAT	0.117318		TCGA-XD-AAUI-01A-42D-A40W-08	0.632	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	1	0	1		2	2	2	0		0	0	137		137	136	1	1.910000	-20.000000	1	0.210000	XM_048592			27	25		452	436	0		1			0	0	137	0		1.000000	0	0	0	0	0	0	27	452
NRK	203447	broad.mit.edu	37	X	105150491	105150491	+	Missense_Mutation	SNP	C	C	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:105150491C>G	ENST00000243300.9	+	11	1233	c.930C>G	c.(928-930)caC>caG	p.H310Q	NRK_ENST00000428173.2_Missense_Mutation_p.H310Q	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	310	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TGCTTCAACACCCATTTGTTC	0.343										HNSCC(51;0.14)																												ENST00000243300.9	1.000000	0.280000	9.400000e-01	4.400000e-01	0.660000	0.681621	0.660000	1.000000																										0				76						c.(928-930)caC>caG		Nik related kinase							63.0	52.0	55.0					X																	105150491		1832	4074	5906	SO:0001583	missense	203447	0	0					g.chrX:105150491C>G	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.930C>G	chrX.hg19:g.105150491C>G	ENSP00000434830:p.His310Gln		HNSCC(51;0.14)				NRK_ENST00000428173.2_Missense_Mutation_p.H310Q	p.H310Q	NM_198465.2	NP_940867.2	0	1	1		Q7Z2Y5	NRK_HUMAN		11	1233	+			Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	0	1	hg19	c.930C>G		0	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093751	0.36952	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.34275	1.37;1.37	5.27	-2.09	0.07232	5.27	-2.09	0.07232	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45126	D	0.000386	T	0.57961	0.2089	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61734	-0.7002	10	0.87932	D	0	.	11.5948	0.50966	0.0:0.2133:0.0:0.7867	.	310	Q7Z2Y5	NRK_HUMAN	Q	310	ENSP00000434830:H310Q;ENSP00000438378:H310Q	ENSP00000434830:H310Q	H	+	3	2	2	NRK	105037147	105037147	0.998000	0.40836	0.981000	0.43875	0.125000	0.20455	0.774000	0.26675	-0.459000	0.07013	-0.192000	0.12808	CAC	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.343	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	0	0	1		2	2	2	0		0	0	19		19	19	1	1.910000	-10.721740	1	0.210000	NM_198465			6	6		83	83	0		1			0	0	19	0		0.966713	0	0	0	0	0	0	6	83
FRMPD4	9758	broad.mit.edu	37	X	12704277	12704277	+	Missense_Mutation	SNP	A	A	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:12704277A>G	ENST00000380682.1	+	7	1141	c.635A>G	c.(634-636)aAt>aGt	p.N212S		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	212	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TATCTGGAAAATGGGCAGACC	0.398																																						ENST00000380682.1	0.440000	0.130000	3.500000e-01	1.800000e-01	0.250000	0.273651	0.250000	0.250000																										0				22						c.(634-636)aAt>aGt		FERM and PDZ domain containing 4							135.0	118.0	124.0					X																	12704277		2203	4300	6503	SO:0001583	missense	9758	0	0					g.chrX:12704277A>G	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.635A>G	chrX.hg19:g.12704277A>G	ENSP00000370057:p.Asn212Ser							p.N212S	NM_014728.3	NP_055543.2	0	1	1		Q14CM0	FRPD4_HUMAN		7	1141	+			A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	0	1	hg19	c.635A>G	CCDS35201.1	0	.	.	.	.	.	.	.	.	.	.	A	22.8	4.335472	0.81801	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.76060	-0.99	5.33	5.33	0.75918	5.33	5.33	0.75918	Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.85106	0.5621	M	0.78456	2.415	0.47905	D	0.999546	P;P	0.51537	0.946;0.869	D;P	0.64506	0.926;0.805	D	0.86474	0.1787	10	0.56958	D	0.05	.	14.4062	0.67083	1.0:0.0:0.0:0.0	.	204;212	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	S	212;203;201	ENSP00000370057:N212S	ENSP00000304583:N201S	N	+	2	0	0	FRMPD4	12614198	12614198	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.850000	0.92190	1.781000	0.52344	0.486000	0.48141	AAT	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.398	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	0	0	1		2	2	2	0		0	0	72		72	72	1	1.910000	-3.456681	1	0.210000	XM_045712			10	10		367	361	0		1			0	0	72	0		0.996672	0	0	0	0	0	0	10	367
MORC4	79710	broad.mit.edu	37	X	106229348	106229348	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:106229348G>A	ENST00000355610.4	-	4	665	c.391C>T	c.(391-393)Cgg>Tgg	p.R131W	MORC4_ENST00000535534.1_Intron|MORC4_ENST00000255495.7_Missense_Mutation_p.R131W	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	131						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						TTTCCTAGCCGCATGGAGCCT	0.473																																						ENST00000355610.4	0.260000	0.070000	2.100000e-01	1.100000e-01	0.150000	0.165666	0.150000	0.160000																										0				28						c.(391-393)Cgg>Tgg		MORC family CW-type zinc finger 4							178.0	168.0	171.0					X																	106229348		1889	4099	5988	SO:0001583	missense	79710	0	0					g.chrX:106229348G>A	AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.391C>T	chrX.hg19:g.106229348G>A	ENSP00000347821:p.Arg131Trp						MORC4_ENST00000535534.1_Intron|MORC4_ENST00000255495.7_Missense_Mutation_p.R131W	p.R131W	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	0	1	1		Q8TE76	MORC4_HUMAN		4	665	-			A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	ENST00000355610.4	0	1	hg19	c.391C>T	CCDS14525.2	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.835024	0.91117	.	.	ENSG00000133131	ENST00000355610;ENST00000255495	T;T	0.74315	-0.83;-0.83	5.35	5.35	0.76521	5.35	5.35	0.76521	ATPase-like, ATP-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.87834	0.6277	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89717	0.3916	10	0.87932	D	0	-9.9831	15.875	0.79154	0.0:0.0:1.0:0.0	.	131;131	A1YR23;Q8TE76	.;MORC4_HUMAN	W	131	ENSP00000347821:R131W;ENSP00000255495:R131W	ENSP00000255495:R131W	R	-	1	2	2	MORC4	106116004	106116004	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.562000	0.82300	2.565000	0.86533	0.600000	0.82982	CGG	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.473	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057816.3	0	0	1		2	2	2	0		0	0	163		163	159	1	1.910000	-2.046025	0	0.210000	NM_024657			11	11		673	661	0		1	0		0	0	163	0		0.998175	6.494867e-03	0	0	0	7	0	11	673
F8	2157	broad.mit.edu	37	X	154134766	154134766	+	Missense_Mutation	SNP	G	G	A			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:154134766G>A	ENST00000360256.4	-	15	5502	c.5302C>T	c.(5302-5304)Cgt>Tgt	p.R1768C		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1768	F5/8 type A 3.|Plastocyanin-like 5.		R -> H (in HEMA). {ECO:0000269|PubMed:12871415}.		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AGTTCTCCACGGTATAAGGGC	0.423																																						ENST00000360256.4	0.710000	0.360000	6.200000e-01	4.400000e-01	0.520000	0.534513	0.520000	0.520000																										0				120	GRCh37	CM055192	F8	M		c.(5302-5304)Cgt>Tgt		coagulation factor VIII, procoagulant component	Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)						114.0	109.0	110.0					X																	154134766		2203	4300	6503	SO:0001583	missense	2157	0	0					g.chrX:154134766G>A	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.5302C>T	chrX.hg19:g.154134766G>A	ENSP00000353393:p.Arg1768Cys							p.R1768C	NM_000132.3	NP_000123.1	0	1	1		P00451	FA8_HUMAN		15	5502	-	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	1	1	hg19	c.5302C>T	CCDS35457.1	0	.	.	.	.	.	.	.	.	.	.	G	19.82	3.899120	0.72754	.	.	ENSG00000185010	ENST00000360256	D	0.99287	-5.69	5.6	5.6	0.85130	5.6	5.6	0.85130	Cupredoxin (2);	0.161419	0.53938	D	0.000042	D	0.99471	0.9812	M	0.87971	2.92	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.98619	1.0666	10	0.87932	D	0	-8.5673	17.091	0.86622	0.0:0.0:1.0:0.0	.	1768	P00451	FA8_HUMAN	C	1768	ENSP00000353393:R1768C	ENSP00000353393:R1768C	R	-	1	0	0	F8	153787960	153787960	0.963000	0.33076	1.000000	0.80357	0.988000	0.76386	3.384000	0.52478	2.350000	0.79820	0.600000	0.82982	CGT	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.423	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4	1	0	1		2	2	2	0		0	0	138		138	136	1	1.910000	-2.239660	0	0.210000				33	33		567	558	0		1			0	0	138	0		1.000000	0	0	0	0	0	0	33	567
USP9X	8239	broad.mit.edu	37	X	41029282	41029282	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:41029282C>T	ENST00000324545.8	+	19	3304	c.2671C>T	c.(2671-2673)Cga>Tga	p.R891*	USP9X_ENST00000378308.2_Nonsense_Mutation_p.R891*	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	891					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TTTTGTAGTTCGATTTCCAAA	0.408																																					Ovarian(172;1807 2695 35459 49286)	ENST00000324545.8	0.830000	0.450000	7.300000e-01	5.300000e-01	0.620000	0.640451	0.620000	0.620000																										0				87						c.(2671-2673)Cga>Tga		ubiquitin specific peptidase 9, X-linked							162.0	153.0	156.0					X																	41029282		2178	4292	6470	SO:0001587	stop_gained	8239	0	0					g.chrX:41029282C>T	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.2671C>T	chrX.hg19:g.41029282C>T	ENSP00000316357:p.Arg891*						USP9X_ENST00000378308.2_Nonsense_Mutation_p.R891*	p.R891*	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	0	1	1		Q93008	USP9X_HUMAN		19	3304	+			O75550|Q8WWT3|Q8WX12	Nonsense_Mutation	SNP	ENST00000324545.8	0	1	hg19	c.2671C>T	CCDS43930.1	0	.	.	.	.	.	.	.	.	.	.	c	41	8.770551	0.98948	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	.	.	.	5.85	4.05	0.47172	5.85	4.05	0.47172	.	0.104565	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.21	0.31478	0.2778:0.6494:0.0:0.0728	.	.	.	.	X	891	.	ENSP00000316357:R891X	R	+	1	2	2	USP9X	40914226	40914226	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.205000	0.51090	0.575000	0.29434	-0.178000	0.13098	CGA	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.408	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	1	0	1		2	2	2	0		0	0	127		127	126	1	1.910000	-3.142698	1	0.210000	NM_004652			39	39		550	537	0		1	0		0	0	127	0		1.000000	1.690497e-01	0	0	0	11	0	39	550
CYSLTR1	10800	broad.mit.edu	37	X	77528527	77528527	+	Silent	SNP	G	G	T	rs201634768		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:77528527G>T	ENST00000373304.3	-	3	1009	c.717C>A	c.(715-717)acC>acA	p.T239T		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	239					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	AAAAGGCAGCGGTCACGACCA	0.338																																						ENST00000373304.3	0.560000	0.190000	4.600000e-01	2.600000e-01	0.350000	0.365405	0.350000	0.340000																										0				14						c.(715-717)acC>acA		cysteinyl leukotriene receptor 1	Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)						104.0	94.0	97.0					X																	77528527		2202	4300	6502	SO:0001819	synonymous_variant	10800	0	0					g.chrX:77528527G>T	AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.717C>A	chrX.hg19:g.77528527G>T								p.T239T	NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	0	1	1		Q9Y271	CLTR1_HUMAN		3	1009	-			B2R954|D3DTE4|Q5JS94|Q8IV19	Silent	SNP	ENST00000373304.3	1	1	hg19	c.717C>A	CCDS14439.1	0																																																																																								0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.338	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057315.1	0	0	1		2	2	2	0		0	0	63		63	62	1	1.910000	-2.695737	1	0.210000				12	12		321	314	0		1	0		0	0	63	0		0.999042	9.083371e-03	0	0	0	4	0	12	321
PCDH19	57526	broad.mit.edu	37	X	99551638	99551638	+	Missense_Mutation	SNP	C	C	G			TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:99551638C>G	ENST00000373034.4	-	6	4759	c.3084G>C	c.(3082-3084)gaG>gaC	p.E1028D	PCDH19_ENST00000420881.2_Missense_Mutation_p.E980D|PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000255531.7_Missense_Mutation_p.E981D	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1028					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TAGGCCTCTCCTCAGCCGGGT	0.577																																						ENST00000373034.4	0.670000	0.200000	5.400000e-01	2.900000e-01	0.400000	0.419303	0.400000	0.380000																										0				68						c.(3082-3084)gaG>gaC		protocadherin 19							75.0	74.0	74.0					X																	99551638		2147	4227	6374	SO:0001583	missense	57526	0	0					g.chrX:99551638C>G	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3084G>C	chrX.hg19:g.99551638C>G	ENSP00000362125:p.Glu1028Asp						PCDH19_ENST00000255531.7_Missense_Mutation_p.E981D|PCDH19_ENST00000420881.2_Missense_Mutation_p.E980D|PCDH19_ENST00000464981.1_5'Flank	p.E1028D	NM_001184880.1	NP_001171809.1	0	1	1		Q8TAB3	PCD19_HUMAN		6	4759	-			B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	1	1	hg19	c.3084G>C	CCDS55462.1	0	.	.	.	.	.	.	.	.	.	.	C	4.652	0.121262	0.08881	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.54071	0.59;0.64;0.6	5.73	3.95	0.45737	5.73	3.95	0.45737	.	0.115763	0.56097	D	0.000025	T	0.34279	0.0892	L	0.34521	1.04	0.47862	D	0.999531	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.09377	0.003;0.004;0.002	T	0.10382	-1.0632	10	0.14656	T	0.56	.	5.4949	0.16797	0.14:0.6354:0.0:0.2245	.	1028;981;980	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	D	980;1028;981	ENSP00000400327:E980D;ENSP00000362125:E1028D;ENSP00000255531:E981D	ENSP00000255531:E981D	E	-	3	2	2	PCDH19	99438294	99438294	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.647000	0.24812	1.181000	0.42912	0.600000	0.82982	GAG	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.577	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	1	0	1		2	2	2	0		0	0	45		45	44	1	1.910000	-3.199164	1	0.210000	NM_020766			10	9		234	232	0		1			0	0	45	0		0.996862	0	0	0	0	0	0	10	234
TMLHE	55217	broad.mit.edu	37	X	154741370	154741370	+	Missense_Mutation	SNP	C	C	T	rs201701235		TCGA-XD-AAUI-01A-42D-A40W-08	TCGA-XD-AAUI-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8c4cafb-cf40-4343-9fab-78b2e1914ad1	768e3081-1fbc-418f-9000-9721e854cc35	g.chrX:154741370C>T	ENST00000334398.3	-	5	867	c.722G>A	c.(721-723)cGg>cAg	p.R241Q	TMLHE_ENST00000369439.4_Missense_Mutation_p.R241Q|TMLHE-AS1_ENST00000452506.1_RNA	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	241					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)			breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	GTCAGTGTGCCGATCCAGAGC	0.413													C|||	1	0.000264901	0.0	0.0	3775	,	,		13009	0.0		0.001	False		,,,				2504	0.0					ENST00000334398.3	0.240000	0.050000	1.900000e-01	8.000000e-02	0.130000	0.141130	0.130000	0.120000																										0				20						c.(721-723)cGg>cAg		trimethyllysine hydroxylase, epsilon	Succinic acid(DB00139)|Vitamin C(DB00126)		GLN/ARG,GLN/ARG	0,3835		0,0,1632,571	189.0	151.0	164.0		722,722	2.8	1.0	X		164	3,6725		0,3,2425,1872	no	missense,missense	TMLHE	NM_001184797.1,NM_018196.3	43,43	0,3,4057,2443	TT,TC,CC,C		0.0446,0.0,0.0284	probably-damaging,probably-damaging	241/377,241/422	154741370	3,10560	2203	4300	6503	SO:0001583	missense	55217	25	121384	48				g.chrX:154741370C>T	AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.722G>A	chrX.hg19:g.154741370C>T	ENSP00000335261:p.Arg241Gln						TMLHE-AS1_ENST00000452506.1_RNA|TMLHE_ENST00000369439.4_Missense_Mutation_p.R241Q	p.R241Q	NM_018196.3	NP_060666.1	0	1	1		Q9NVH6	TMLH_HUMAN		5	867	-	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	Missense_Mutation	SNP	ENST00000334398.3	0	1	hg19	c.722G>A	CCDS14768.1	0	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	17.79	3.476247	0.63737	0.0	4.46E-4	ENSG00000185973	ENST00000334398;ENST00000369439	D;D	0.82081	-1.57;-1.57	3.64	2.77	0.32553	3.64	2.77	0.32553	.	0.125013	0.53938	N	0.000049	D	0.82318	0.5011	L	0.44542	1.39	0.47949	D	0.999558	D;D;D	0.71674	0.997;0.998;0.998	P;P;P	0.57960	0.756;0.83;0.778	T	0.77275	-0.2648	10	0.29301	T	0.29	-7.3997	8.53	0.33329	0.0:0.8754:0.0:0.1246	.	241;241;241	Q9NVH6-2;A8K6M9;Q9NVH6	.;.;TMLH_HUMAN	Q	241	ENSP00000335261:R241Q;ENSP00000358447:R241Q	ENSP00000335261:R241Q	R	-	2	0	0	TMLHE	154394564	154394564	0.999000	0.42202	0.989000	0.46669	0.855000	0.48748	4.043000	0.57354	0.507000	0.28148	-0.322000	0.08575	CGG	0.210000		TCGA-XD-AAUI-01A-42D-A40W-08	0.413	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058817.1	0	0	1		2	2	2	0		0	0	94		94	93	1	1.910000	-2.391118	0	0.210000	NM_018196			7	7		527	518	0		1	0		0	0	94	0		0.979521	1.542070e-01	0	0	0	46	0	7	527
