#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
BTAF1	9044	broad.mit.edu	37	10	93786913	93786913	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr10:93786913G>T	ENST00000265990.6	+	37	5570	c.5262G>T	c.(5260-5262)ttG>ttT	p.L1754F	BTAF1_ENST00000544642.1_Missense_Mutation_p.L582F	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1754	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TATACCGATTGATAACCAGAG	0.378																																						ENST00000265990.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				59						c.(5260-5262)ttG>ttT		BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa							108.0	108.0	108.0					10																	93786913		2203	4300	6503	SO:0001583	missense	9044	0	0					g.chr10:93786913G>T	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.5262G>T	chr10.hg19:g.93786913G>T	ENSP00000265990:p.Leu1754Phe	0					BTAF1_ENST00000544642.1_Missense_Mutation_p.L582F	p.L1754F	NM_003972.2	NP_003963.1	1	2	3	1.931020	O14981	BTAF1_HUMAN		37	5570	+		Colorectal(252;0.0846)	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	1	1	hg19	c.5262G>T	CCDS7419.1	1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857996	0.71834	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	T;T	0.79033	-1.23;-1.23	5.52	2.63	0.31362	5.52	2.63	0.31362	Helicase, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.81754	0.4889	L	0.49350	1.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80139	-0.1507	10	0.62326	D	0.03	-8.1932	7.3657	0.26772	0.2012:0.1222:0.6766:0.0	.	1754	O14981	BTAF1_HUMAN	F	1754;582;604	ENSP00000265990:L1754F;ENSP00000439924:L582F	ENSP00000265990:L1754F	L	+	3	2	2	BTAF1	93776893	93776893	1.000000	0.71417	0.997000	0.53966	0.914000	0.54420	2.707000	0.47143	0.814000	0.34374	0.561000	0.74099	TTG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.378	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	1	0	0	2	2	2	2	0	0	0	0	91	91	91	90	1	3.530000	-20.000000	1	0.190000	NM_003972		0	68	67	0	373	368	1		1	1		0	0	91	0	0	1.000000	9.894300e-01	0	12	0	29	0	68	373
MYOF	26509	broad.mit.edu	37	10	95121227	95121227	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr10:95121227G>T	ENST00000359263.4	-	28	2955	c.2956C>A	c.(2956-2958)Cga>Aga	p.R986R	MYOF_ENST00000371501.4_Silent_p.R986R|MYOF_ENST00000371502.4_Silent_p.R986R|MYOF_ENST00000358334.5_Silent_p.R973R	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	986					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.R986G(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TCCACCGCTCGATTTATGTCA	0.483																																						ENST00000359263.4	0.760000	0.300000	0.640000	0.390000	0.500000	0.522749	0.500000	0.490000																										1	Substitution - Missense(1)	p.R986G(1)	endometrium(1)	67						c.(2956-2958)Cga>Aga		myoferlin							208.0	200.0	203.0					10																	95121227		2004	4189	6193	SO:0001819	synonymous_variant	26509	0	0					g.chr10:95121227G>T	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.2956C>A	chr10.hg19:g.95121227G>T		0					MYOF_ENST00000371501.4_Silent_p.R986R|MYOF_ENST00000371502.4_Silent_p.R986R|MYOF_ENST00000358334.5_Silent_p.R973R	p.R986R	NM_013451.3	NP_038479.1	1	2	3	1.931020	Q9NZM1	MYOF_HUMAN		28	2955	-			B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Silent	SNP	ENST00000359263.4	1	0	hg19	c.2956C>A	CCDS41551.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.483	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	1	0	1	2	2	2	2	0	0	0	0	81	81	81	78	1	3.530000	-4.024528	1	0.190000	NM_013451		0	17	17	0	375	367	0		1	0		0	0	81	0	0	0.999961	9.798764e-01	0	0	0	143	0	17	375
TRIM29	23650	broad.mit.edu	37	11	119993732	119993732	+	Silent	SNP	C	C	A	rs137882673		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:119993732C>A	ENST00000341846.5	-	5	1786	c.1365G>T	c.(1363-1365)acG>acT	p.T455T	TRIM29_ENST00000524816.3_Silent_p.T21T|TRIM29_ENST00000525887.1_5'Flank|TRIM29_ENST00000541857.1_Silent_p.T188T|TRIM29_ENST00000528870.1_5'UTR|TRIM29_ENST00000529044.1_Silent_p.T194T	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	455					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		CGAAGCTGTTCGTGTAGTTGT	0.577																																						ENST00000341846.5	0.710000	0.310000	0.600000	0.390000	0.490000	0.503266	0.490000	0.480000																										0				30						c.(1363-1365)acG>acT		tripartite motif containing 29							216.0	158.0	178.0					11																	119993732		2199	4295	6494	SO:0001819	synonymous_variant	23650	0	0					g.chr11:119993732C>A	AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1365G>T	chr11.hg19:g.119993732C>A		0					TRIM29_ENST00000528870.1_5'UTR|TRIM29_ENST00000524816.3_Silent_p.T21T|TRIM29_ENST00000541857.1_Silent_p.T188T|TRIM29_ENST00000529044.1_Silent_p.T194T|TRIM29_ENST00000525887.1_5'Flank	p.T455T	NM_012101.3	NP_036233.2	1	2	3	1.915771	Q14134	TRI29_HUMAN		5	1786	-		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	Q96AA9|Q9BZY7	Silent	SNP	ENST00000341846.5	1	0	hg19	c.1365G>T	CCDS8428.1	0	.	.	.	.	.	.	.	.	.	.	C	4.375	0.069135	0.08436	.	.	ENSG00000137699	ENST00000525327	.	.	.	4.12	-8.25	0.01025	4.12	-8.25	0.01025	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999985	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.2926	0.21069	0.0942:0.2723:0.4906:0.1429	.	.	.	.	X	48	.	.	E	-	1	0	0	TRIM29	119498942	119498942	0.000000	0.05858	0.001000	0.08648	0.690000	0.40134	-3.482000	0.00456	-4.073000	0.00076	-1.707000	0.00718	GAA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.577	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2	1	0	1	2	2	2	2	1	1	1	0	109	109	109	108	1	3.530000	-2.777613	1	0.190000	NM_012101		0	21	20	0	478	466	0		1	0		1	0	109	0	0	0.999997	2.357929e-01	0	0	0	21	0	21	478
TNNT3	7140	broad.mit.edu	37	11	1956113	1956113	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:1956113C>A	ENST00000397301.1	+	15	686	c.678C>A	c.(676-678)ttC>ttA	p.F226L	TNNT3_ENST00000493234.1_3'UTR|TNNT3_ENST00000381558.1_Missense_Mutation_p.F207L|TNNT3_ENST00000397304.2_Missense_Mutation_p.F196L|TNNT3_ENST00000381579.3_Missense_Mutation_p.F207L|TNNT3_ENST00000381589.3_Missense_Mutation_p.F213L|TNNT3_ENST00000381549.3_Missense_Mutation_p.F207L|TNNT3_ENST00000278317.6_Missense_Mutation_p.F215L|TNNT3_ENST00000446240.1_Missense_Mutation_p.F196L|TNNT3_ENST00000381561.4_Missense_Mutation_p.F218L|TNNT3_ENST00000360603.3_Missense_Mutation_p.F209L|TNNT3_ENST00000381548.3_Missense_Mutation_p.F217L			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	226					ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		TTGACAAGTTCGAGTTTGGGG	0.597																																						ENST00000397301.1	0.550000	0.250000	0.470000	0.310000	0.380000	0.399653	0.380000	0.390000																										0				19						c.(676-678)ttC>ttA		troponin T type 3 (skeletal, fast)							138.0	146.0	143.0					11																	1956113		2202	4299	6501	SO:0001583	missense	7140	0	0					g.chr11:1956113C>A	M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.678C>A	chr11.hg19:g.1956113C>A	ENSP00000380468:p.Phe226Leu	0					TNNT3_ENST00000381548.3_Missense_Mutation_p.F217L|TNNT3_ENST00000360603.3_Missense_Mutation_p.F209L|TNNT3_ENST00000397304.2_Missense_Mutation_p.F196L|TNNT3_ENST00000381561.4_Missense_Mutation_p.F218L|TNNT3_ENST00000446240.1_Missense_Mutation_p.F196L|TNNT3_ENST00000493234.1_3'UTR|TNNT3_ENST00000381589.3_Missense_Mutation_p.F213L|TNNT3_ENST00000381549.3_Missense_Mutation_p.F207L|TNNT3_ENST00000381579.3_Missense_Mutation_p.F207L|TNNT3_ENST00000381558.1_Missense_Mutation_p.F207L|TNNT3_ENST00000278317.6_Missense_Mutation_p.F215L	p.F226L			1	2	3	1.918179	P45378	TNNT3_HUMAN		15	686	+		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Missense_Mutation	SNP	ENST00000397301.1	1	0	hg19	c.678C>A		0	.	.	.	.	.	.	.	.	.	.	.	11.86	1.764327	0.31228	.	.	ENSG00000130595	ENST00000278317;ENST00000397309;ENST00000381561;ENST00000381548;ENST00000360603;ENST00000381549;ENST00000381589;ENST00000381579;ENST00000381557;ENST00000453458;ENST00000381563;ENST00000344578;ENST00000381558;ENST00000397301;ENST00000397304;ENST00000446240	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	4.28	-6.19	0.02078	4.28	-6.19	0.02078	.	0.210963	0.49916	D	0.000140	D	0.92648	0.7664	M	0.84219	2.685	0.50467	D	0.999874	D;P;D;D;P	0.53619	0.961;0.929;0.961;0.961;0.934	P;P;P;P;P	0.57152	0.814;0.748;0.748;0.745;0.656	D	0.91890	0.5523	10	0.54805	T	0.06	-1.9598	15.2622	0.73634	0.0:0.249:0.0:0.751	.	215;207;213;207;226	P45378-2;P45378-7;P45378-6;P45378-4;P45378	.;.;.;.;TNNT3_HUMAN	L	215;227;218;217;209;207;213;207;201;196;218;202;207;226;196;196	ENSP00000278317:F215L;ENSP00000370973:F218L;ENSP00000370960:F217L;ENSP00000353815:F209L;ENSP00000370961:F207L;ENSP00000371001:F213L;ENSP00000370991:F207L;ENSP00000370969:F201L;ENSP00000415614:F196L;ENSP00000370975:F218L;ENSP00000344870:F202L;ENSP00000370970:F207L;ENSP00000380468:F226L;ENSP00000380471:F196L;ENSP00000413203:F196L	ENSP00000278317:F215L	F	+	3	2	2	TNNT3	1912689	1912689	0.001000	0.12720	0.667000	0.29798	0.223000	0.24884	-2.010000	0.01454	-1.388000	0.02092	-0.657000	0.03884	TTC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.597	TNNT3-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000142920.3	1	0	1	2	2	2	2	0	0	0	0	196	196	196	194	1	3.530000	-2.950824	1	0.190000	NM_006757		0	25	25	0	720	709	0		1	0		0	0	196	0	0	1.000000	1.256362e-03	0	0	0	2	0	25	720
OR52E8	390079	broad.mit.edu	37	11	5878138	5878138	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:5878138C>A	ENST00000537935.1	-	1	826	c.795G>T	c.(793-795)ttG>ttT	p.L265F	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AACGATGTGTCAAGAATGAAA	0.428																																						ENST00000537935.1	0.560000	0.280000	0.490000	0.340000	0.410000	0.421602	0.410000	0.420000																										0				20						c.(793-795)ttG>ttT		olfactory receptor, family 52, subfamily E, member 8							105.0	119.0	114.0					11																	5878138		2144	4296	6440	SO:0001583	missense	390079	0	0					g.chr11:5878138C>A	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.795G>T	chr11.hg19:g.5878138C>A	ENSP00000444054:p.Leu265Phe	0					TRIM5_ENST00000380027.1_Intron	p.L265F	NM_001005168.1	NP_001005168.1	1	2	3	1.918179	Q6IFG1	O52E8_HUMAN		1	826	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)	B9EH38	Missense_Mutation	SNP	ENST00000537935.1	1	0	hg19	c.795G>T	CCDS31400.1	0	.	.	.	.	.	.	.	.	.	.	C	2.139	-0.397187	0.04899	.	.	ENSG00000183269	ENST00000537935	T	0.41758	0.99	4.12	-0.562	0.11781	4.12	-0.562	0.11781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37095	N	0.002256	T	0.19446	0.0467	N	0.20401	0.57	0.09310	N	0.999992	B	0.14805	0.011	B	0.27170	0.077	T	0.08848	-1.0702	10	0.16896	T	0.51	.	0.7785	0.01036	0.1481:0.3064:0.2193:0.3262	.	265	Q6IFG1	O52E8_HUMAN	F	265	ENSP00000444054:L265F	ENSP00000444054:L265F	L	-	3	2	2	OR52E8	5834714	5834714	0.000000	0.05858	0.988000	0.46212	0.083000	0.17756	-3.965000	0.00324	0.104000	0.17725	-0.235000	0.12190	TTG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.428	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	1	0	1	2	2	2	2	0	0	0	0	216	216	216	216	1	3.530000	-3.122021	1	0.190000	NM_001005168		0	31	31	0	839	832	0		1			0	0	216	0	0	1.000000	0	0	0	0	0	0	31	839
PIK3C2A	5286	broad.mit.edu	37	11	17190264	17190264	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:17190264C>A	ENST00000265970.7	-	1	1024	c.1025G>T	c.(1024-1026)cGa>cTa	p.R342L	PIK3C2A_ENST00000540361.1_Intron|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	342					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						CTGAGTTGTTCGAATATTTAA	0.373																																						ENST00000265970.7	0.650000	0.300000	0.560000	0.370000	0.450000	0.470953	0.450000	0.450000																										0				58						c.(1024-1026)cGa>cTa		phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha							93.0	98.0	96.0					11																	17190264		2200	4293	6493	SO:0001583	missense	5286	0	0					g.chr11:17190264C>A	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.1025G>T	chr11.hg19:g.17190264C>A	ENSP00000265970:p.Arg342Leu	0					PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Intron	p.R342L	NM_002645.2	NP_002636.2	1	2	3	1.918179	O00443	P3C2A_HUMAN		1	1024	-			B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	1	0	hg19	c.1025G>T	CCDS7824.1	0	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985990	0.35036	.	.	ENSG00000011405	ENST00000265970;ENST00000544896	T	0.64803	-0.12	5.39	2.39	0.29439	5.39	2.39	0.29439	.	0.787528	0.11900	N	0.518665	T	0.47746	0.1462	L	0.32530	0.975	0.80722	D	1	P;B	0.40302	0.712;0.36	B;B	0.34536	0.185;0.09	T	0.38329	-0.9666	10	0.46703	T	0.11	-0.7378	10.8495	0.46761	0.0:0.6901:0.2424:0.0675	.	342;342	F5H5W9;O00443	.;P3C2A_HUMAN	L	342	ENSP00000265970:R342L	ENSP00000265970:R342L	R	-	2	0	0	PIK3C2A	17146840	17146840	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.430000	0.52807	0.633000	0.30452	-0.300000	0.09419	CGA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.373	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	1	0	1	2	2	2	2	0	0	0	0	126	126	126	126	1	3.530000	-3.138803	1	0.190000	NM_002645		0	24	25	0	583	574	0		1	0		0	0	126	0	0	1.000000	6.171081e-02	0	0	0	10	0	24	583
PAX6	5080	broad.mit.edu	37	11	31815068	31815068	+	Missense_Mutation	SNP	C	C	A	rs75572362		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:31815068C>A	ENST00000379132.3	-	10	1230	c.950G>T	c.(949-951)cGa>cTa	p.R317L	PAX6_ENST00000379129.2_Missense_Mutation_p.R331L|PAX6_ENST00000379123.5_Missense_Mutation_p.R317L|PAX6_ENST00000379115.4_Missense_Mutation_p.R331L|PAX6_ENST00000379111.2_Missense_Mutation_p.R317L|PAX6_ENST00000241001.8_Missense_Mutation_p.R317L|PAX6_ENST00000419022.1_Missense_Mutation_p.R331L|PAX6_ENST00000379107.2_Missense_Mutation_p.R331L			P26367	PAX6_HUMAN	paired box 6	317	Pro/Ser/Thr-rich.			R -> L (in Ref. 1; AAA59962). {ECO:0000305}.	astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					TGTGTCTGTTCGGCCCAACAT	0.532									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																													ENST00000379132.3	0.620000	0.240000	0.520000	0.320000	0.410000	0.427898	0.410000	0.400000																										0				35						c.(949-951)cGa>cTa		paired box 6							134.0	137.0	136.0					11																	31815068		2202	4299	6501	SO:0001583	missense	5080	0	0		Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation	Familial Cancer Database	WAGR syndrome	g.chr11:31815068C>A	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.950G>T	chr11.hg19:g.31815068C>A	ENSP00000368427:p.Arg317Leu	0					PAX6_ENST00000419022.1_Missense_Mutation_p.R331L|PAX6_ENST00000379107.2_Missense_Mutation_p.R331L|PAX6_ENST00000379115.4_Missense_Mutation_p.R331L|PAX6_ENST00000241001.8_Missense_Mutation_p.R317L|PAX6_ENST00000379129.2_Missense_Mutation_p.R331L|PAX6_ENST00000379123.5_Missense_Mutation_p.R317L|PAX6_ENST00000379111.2_Missense_Mutation_p.R317L	p.R317L			1	2	3	1.918179	P26367	PAX6_HUMAN		10	1230	-	Lung SC(675;0.225)		Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	1	0	hg19	c.950G>T	CCDS31451.1	0	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497777	0.85069	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000531633;ENST00000379107;ENST00000464174;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000494377;ENST00000470027;ENST00000379109;ENST00000533333;ENST00000530373	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.93859	-3.3;-3.3;-3.3;-2.95;-3.3;-2.92;-3.3;-3.3;-3.3;-3.3;-2.72;-2.72;-3.3;-3.04;-2.91	5.77	4.85	0.62838	5.77	4.85	0.62838	.	0.209907	0.47093	D	0.000241	D	0.95918	0.8671	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.89917	1.0;0.985	D;P	0.87578	0.998;0.78	D	0.94084	0.7347	10	0.23891	T	0.37	.	15.2159	0.73267	0.0:0.9313:0.0:0.0687	.	331;317	F1T0F8;P26367	.;PAX6_HUMAN	L	331;317;331;146;331;116;317;331;317;317;181;181;317;272;116	ENSP00000404100:R331L;ENSP00000368427:R317L;ENSP00000368424:R331L;ENSP00000451885:R146L;ENSP00000368401:R331L;ENSP00000431961:R116L;ENSP00000241001:R317L;ENSP00000368410:R331L;ENSP00000368406:R317L;ENSP00000368418:R317L;ENSP00000451901:R181L;ENSP00000450775:R181L;ENSP00000368403:R317L;ENSP00000451372:R272L;ENSP00000452202:R116L	ENSP00000241001:R317L	R	-	2	0	0	PAX6	31771644	31771644	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.740000	0.68629	2.698000	0.92095	0.643000	0.83706	CGA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.532	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	1	0	1	2	2	2	2	0	0	0	0	72	72	72	70	1	3.530000	-2.798772	1	0.190000	NM_001604		0	17	17	0	463	456	0		1	0		0	0	72	0	0	0.999962	8.433578e-02	0	0	0	13	0	17	463
ZFP91	80829	broad.mit.edu	37	11	58379764	58379764	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:58379764C>T	ENST00000316059.6	+	7	1042	c.871C>T	c.(871-873)Cga>Tga	p.R291*	ZFP91-CNTF_ENST00000389919.4_Nonsense_Mutation_p.R291*|AP001350.1_ENST00000601906.1_5'Flank	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	291					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				AGGAAGAAGACGAAAAGATGA	0.418																																						ENST00000316059.6	1.000000	0.760000	1.000000	0.930000	0.990000	0.973301	0.990000	1.000000																										0				26						c.(871-873)Cga>Tga		ZFP91 zinc finger protein							101.0	92.0	95.0					11																	58379764		2201	4295	6496	SO:0001587	stop_gained	80829	0	0					g.chr11:58379764C>T	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.871C>T	chr11.hg19:g.58379764C>T	ENSP00000339030:p.Arg291*	0					ZFP91-CNTF_ENST00000389919.4_Nonsense_Mutation_p.R291*|AP001350.1_ENST00000601906.1_5'Flank	p.R291*	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	1	2	3	1.915771	Q96JP5	ZFP91_HUMAN		7	1042	+		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Nonsense_Mutation	SNP	ENST00000316059.6	0	1	hg19	c.871C>T	CCDS31553.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.963557	0.97967	.	.	ENSG00000186660	ENST00000316059;ENST00000389918	.	.	.	5.69	4.75	0.60458	5.69	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-6.2665	11.456	0.50183	0.3271:0.6729:0.0:0.0	.	.	.	.	X	291	.	ENSP00000374569:R291X	R	+	1	2	2	ZFP91	58136340	58136340	0.985000	0.35326	1.000000	0.80357	0.992000	0.81027	0.526000	0.22971	1.346000	0.45694	0.650000	0.86243	CGA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.418	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	51	1	3.530000	-10.591580	1	0.190000	NM_053023		0	26	26	0	240	237	0		1	0		0	0	53	0	0	1.000000	9.697699e-01	0	0	0	55	0	26	240
SLC22A12	116085	broad.mit.edu	37	11	64359303	64359303	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:64359303G>A	ENST00000377574.1	+	1	1022	c.275G>A	c.(274-276)cGc>cAc	p.R92H	SLC22A12_ENST00000336464.7_Missense_Mutation_p.R92H|SLC22A12_ENST00000377567.2_Missense_Mutation_p.R92H|SLC22A12_ENST00000473690.1_5'UTR|SLC22A12_ENST00000377572.1_Missense_Mutation_p.R92H	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	92			R -> C. {ECO:0000269|PubMed:16385546}.		cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	CGCCGCTTCCGCCAGCCACAG	0.677																																						ENST00000377574.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				27						c.(274-276)cGc>cAc		solute carrier family 22 (organic anion/urate transporter), member 12	Losartan(DB00678)|Probenecid(DB01032)						23.0	28.0	26.0					11																	64359303		2183	4271	6454	SO:0001583	missense	116085	9	121256	31				g.chr11:64359303G>A	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.275G>A	chr11.hg19:g.64359303G>A	ENSP00000366797:p.Arg92His	0					SLC22A12_ENST00000377572.1_Missense_Mutation_p.R92H|SLC22A12_ENST00000473690.1_5'UTR|SLC22A12_ENST00000377567.2_Missense_Mutation_p.R92H|SLC22A12_ENST00000336464.7_Missense_Mutation_p.R92H	p.R92H	NM_144585.2	NP_653186.2	1	2	3	1.915771	Q96S37	S22AC_HUMAN		1	1022	+			B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Missense_Mutation	SNP	ENST00000377574.1	1	0	hg19	c.275G>A	CCDS8075.1	1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593237	0.46214	.	.	ENSG00000197891	ENST00000377567;ENST00000377574;ENST00000377572;ENST00000336464	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	4.4	-0.511	0.11970	4.4	-0.511	0.11970	.	0.817974	0.10849	N	0.627391	T	0.40719	0.1128	M	0.88775	2.98	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;P;D	0.69479	0.964;0.964;0.898;0.964	T	0.15378	-1.0439	10	0.46703	T	0.11	.	6.9969	0.24786	0.0:0.2682:0.4327:0.2991	.	92;92;92;92	B5ME56;B3KV05;Q96S37-2;Q96S37	.;.;.;S22AC_HUMAN	H	92	ENSP00000366790:R92H;ENSP00000366797:R92H;ENSP00000366795:R92H;ENSP00000336836:R92H	ENSP00000336836:R92H	R	+	2	0	0	SLC22A12	64115879	64115879	0.000000	0.05858	0.977000	0.42913	0.296000	0.27459	-0.084000	0.11268	0.237000	0.21200	0.484000	0.47621	CGC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.677	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	1	0	1	2	2	2	2	0	0	0	0	48	48	48	47	1	3.530000	-1.133493	0	0.190000	NM_144585		0	35	34	0	152	147	1		1			0	0	48	0	0	1.000000	0	0	0	0	0	0	35	152
PPFIA1	8500	broad.mit.edu	37	11	70172768	70172768	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:70172768C>A	ENST00000253925.7	+	7	989	c.774C>A	c.(772-774)atC>atA	p.I258I	CTA-797E19.2_ENST00000526017.1_RNA|AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Silent_p.I258I	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	258					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TCCAAGAAATCATAAGTAAGC	0.433																																						ENST00000253925.7	0.340000	0.150000	0.290000	0.190000	0.230000	0.246347	0.230000	0.240000																										0				65						c.(772-774)atC>atA		protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1							191.0	201.0	197.0					11																	70172768		2200	4294	6494	SO:0001819	synonymous_variant	8500	0	0					g.chr11:70172768C>A	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.774C>A	chr11.hg19:g.70172768C>A		0					AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Silent_p.I258I|CTA-797E19.2_ENST00000526017.1_RNA	p.I258I	NM_003626.3	NP_003617.1	1	2	3	1.915771	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)	7	989	+			A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	ENST00000253925.7	0	1	hg19	c.774C>A	CCDS31627.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.433	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	0	0	1	2	2	2	2	0	0	0	0	297	297	297	296	1	3.530000	-2.675413	1	0.190000	NM_003626		0	28	25	0	1324	1309	0		1	0		0	0	297	0	0	1.000000	1.503440e-01	0	0	0	32	0	28	1324
NADSYN1	55191	broad.mit.edu	37	11	71189504	71189504	+	Silent	SNP	C	C	A	rs547470892	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:71189504C>A	ENST00000319023.2	+	10	1050	c.862C>A	c.(862-864)Cga>Aga	p.R288R	NADSYN1_ENST00000539574.1_Silent_p.R28R|NADSYN1_ENST00000530055.1_5'Flank	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	288	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	GATTTCATCTCGAAACCTGGC	0.577													C|||	2	0.000399361	0.0	0.0	5008	,	,		18967	0.0		0.0	False		,,,				2504	0.002				Ovarian(79;763 1781 6490 50276)	ENST00000319023.2	1.000000	0.360000	1.000000	0.590000	0.920000	0.836876	0.920000	1.000000																										0				25						c.(862-864)Cga>Aga		NAD synthetase 1	L-Glutamine(DB00130)						48.0	44.0	45.0					11																	71189504		2200	4294	6494	SO:0001819	synonymous_variant	55191	12	121288	40				g.chr11:71189504C>A	AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.862C>A	chr11.hg19:g.71189504C>A		0					NADSYN1_ENST00000530055.1_5'Flank|NADSYN1_ENST00000539574.1_Silent_p.R28R	p.R288R	NM_018161.4	NP_060631.2	1	2	3	1.915771	Q6IA69	NADE_HUMAN		10	1050	+			B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Silent	SNP	ENST00000319023.2	0	1	hg19	c.862C>A	CCDS8201.1	1																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.577	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394356.1	0	0	0	2	2	2	2	0	0	0	0	13	13	13	13	1	3.530000	-9.800195	1	0.190000	NM_018161		0	5	5	0	61	59	0		1	0		0	0	13	0	0	0.934978	9.232580e-01	0	0	0	60	0	5	61
DCPS	28960	broad.mit.edu	37	11	126208220	126208220	+	Silent	SNP	C	C	A	rs556401323	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr11:126208220C>A	ENST00000263579.4	+	4	891	c.562C>A	c.(562-564)Cgg>Agg	p.R188R	DCPS_ENST00000530860.1_Intron	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger	188					cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)			endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		TGAAGCGGACCGGATTGTTTT	0.502																																						ENST00000263579.4	0.780000	0.270000	0.640000	0.370000	0.490000	0.510782	0.490000	0.480000																										0				17						c.(562-564)Cgg>Agg		decapping enzyme, scavenger							159.0	134.0	143.0					11																	126208220		2201	4298	6499	SO:0001819	synonymous_variant	28960	0	0					g.chr11:126208220C>A	AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.562C>A	chr11.hg19:g.126208220C>A		0					DCPS_ENST00000530860.1_Intron	p.R188R	NM_014026.3	NP_054745.1	1	2	3	1.915771	Q96C86	DCPS_HUMAN		4	891	+	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)	Q8NHL8|Q9Y2S5	Silent	SNP	ENST00000263579.4	1	0	hg19	c.562C>A	CCDS8473.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.502	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386455.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	3.530000	-2.619992	1	0.190000	NM_014026		0	13	13	0	298	294	0		1	0		0	0	53	0	0	0.999522	7.123048e-01	0	0	0	58	0	13	298
NUP37	79023	broad.mit.edu	37	12	102505967	102505967	+	Missense_Mutation	SNP	C	C	A	rs371630269		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:102505967C>A	ENST00000552283.1	-	3	339	c.200G>T	c.(199-201)cGa>cTa	p.R67L	NUP37_ENST00000251074.1_Missense_Mutation_p.R67L|NUP37_ENST00000543021.1_5'UTR			Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	67					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)		p.R67L(1)		endometrium(3)|large_intestine(3)|lung(10)|ovary(1)	17						GTGAAATGTTCGAAGTGTTTT	0.368																																						ENST00000552283.1	1.000000	0.380000	0.820000	0.480000	0.620000	0.653585	0.620000	0.600000																										1	Substitution - Missense(1)	p.R67L(1)	lung(1)	17						c.(199-201)cGa>cTa		nucleoporin 37kDa							181.0	154.0	163.0					12																	102505967		2203	4300	6503	SO:0001583	missense	79023	0	0					g.chr12:102505967C>A	AF514994	CCDS9089.1	12q23.2	2014-08-12			ENSG00000075188	ENSG00000075188		"""WD repeat domain containing"""	29929	protein-coding gene	gene with protein product		609264				12196509	Standard	NM_024057		Approved	MGC5585, FLJ22618	uc001tjc.3	Q8NFH4	OTTHUMG00000170478	ENST00000552283.1:c.200G>T	chr12.hg19:g.102505967C>A	ENSP00000448054:p.Arg67Leu	1					NUP37_ENST00000251074.1_Missense_Mutation_p.R67L|NUP37_ENST00000543021.1_5'UTR	p.R67L			1	3	4	2.014333	Q8NFH4	NUP37_HUMAN		3	339	-			Q9H644	Missense_Mutation	SNP	ENST00000552283.1	1	0	hg19	c.200G>T	CCDS9089.1	0	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347250	0.61183	.	.	ENSG00000075188	ENST00000552283;ENST00000251074;ENST00000551744	T;T;T	0.29397	1.57;1.57;2.86	5.43	3.61	0.41365	5.43	3.61	0.41365	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.277784	0.35772	N	0.002997	T	0.30885	0.0779	M	0.71581	2.175	0.43965	D	0.996648	B;B	0.32203	0.36;0.36	B;B	0.31390	0.129;0.06	T	0.05550	-1.0878	10	0.34782	T	0.22	-2.6224	9.7045	0.40207	0.0:0.786:0.0:0.214	.	67;67	B4DKV8;Q8NFH4	.;NUP37_HUMAN	L	67	ENSP00000448054:R67L;ENSP00000251074:R67L;ENSP00000448086:R67L	ENSP00000251074:R67L	R	-	2	0	0	NUP37	101030097	101030097	1.000000	0.71417	0.871000	0.34182	0.884000	0.51177	2.501000	0.45389	0.775000	0.33450	0.585000	0.79938	CGA	0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.368	NUP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409330.1	1	0	0	2	20	2	2	0	0	0	1	67	67	67	67	1	3.530000	-4.624837	1	0.190000	NM_024057		0	20	21	0	394	386	0		1	0		0	0	67	0	0	0.539168	6.773461e-01	0	0	0	47	0	20	394
APPL2	55198	broad.mit.edu	37	12	105597519	105597519	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:105597519C>A	ENST00000258530.3	-	9	891	c.666G>T	c.(664-666)atG>atT	p.M222I	APPL2_ENST00000549573.1_5'UTR|APPL2_ENST00000551662.1_Missense_Mutation_p.M228I|APPL2_ENST00000539978.2_Missense_Mutation_p.M179I	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						AAAAGCTGTCCATACGTTTGG	0.418																																						ENST00000258530.3	1.000000	0.140000	0.330000	0.180000	0.240000	0.319412	0.240000	0.230000																										0				33						c.(664-666)atG>atT		adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2							169.0	169.0	169.0					12																	105597519		2203	4300	6503	SO:0001583	missense	55198	0	0					g.chr12:105597519C>A	AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.666G>T	chr12.hg19:g.105597519C>A	ENSP00000258530:p.Met222Ile	1					APPL2_ENST00000549573.1_5'UTR|APPL2_ENST00000551662.1_Missense_Mutation_p.M228I|APPL2_ENST00000539978.2_Missense_Mutation_p.M179I	p.M222I	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	1	3	4	2.014333	Q06481	APLP2_HUMAN		9	891	-			B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000258530.3	0	1	hg19	c.666G>T	CCDS9101.1	0	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301684	0.40694	.	.	ENSG00000136044	ENST00000258530;ENST00000539978;ENST00000551662	T;T;T	0.03920	3.76;3.76;3.76	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.037498	0.85682	D	0.000000	T	0.08714	0.0216	L	0.60455	1.87	0.58432	D	0.999999	B;B;B	0.31209	0.313;0.129;0.129	B;B;B	0.30251	0.113;0.053;0.048	T	0.04900	-1.0919	10	0.59425	D	0.04	-30.1684	17.7181	0.88343	0.0:1.0:0.0:0.0	.	228;179;222	F8W1P5;B7Z1Q8;Q8NEU8	.;.;DP13B_HUMAN	I	222;179;228	ENSP00000258530:M222I;ENSP00000444472:M179I;ENSP00000446917:M228I	ENSP00000258530:M222I	M	-	3	0	0	APPL2	104121649	104121649	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	5.448000	0.66612	2.620000	0.88729	0.655000	0.94253	ATG	0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.418	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406238.3	0	0	1	2	2	2	2	0	0	0	0	212	212	212	211	1	3.530000	-1.974054	0	0.190000	NM_018171		0	20	20	0	1022	1005	0		1	0		0	0	212	0	0	0.999994	2.444905e-01	0	0	0	47	0	20	1022
TAS2R14	50840	broad.mit.edu	37	12	11091286	11091286	+	Missense_Mutation	SNP	C	C	A	rs532448480		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:11091286C>A	ENST00000537503.1	-	1	576	c.521G>T	c.(520-522)cGa>cTa	p.R174L	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_023922.1	NP_076411.1	Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14	174					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						ACTGGAAAATCGTGTAAAGTT	0.348																																						ENST00000537503.1	1.000000	0.260000	0.610000	0.350000	0.460000	0.493964	0.460000	0.430000																										0				8						c.(520-522)cGa>cTa		taste receptor, type 2, member 14							91.0	94.0	93.0					12																	11091286		2203	4300	6503	SO:0001583	missense	50840	0	0					g.chr12:11091286C>A	AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000537503.1:c.521G>T	chr12.hg19:g.11091286C>A	ENSP00000441949:p.Arg174Leu	1					TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	p.R174L	NM_023922.1	NP_076411.1	1	3	4	2.016404	Q9NYV8	T2R14_HUMAN		1	576	-			Q645X3	Missense_Mutation	SNP	ENST00000537503.1	1	0	hg19	c.521G>T	CCDS8637.1	0	.	.	.	.	.	.	.	.	.	.	C	7.482	0.648867	0.14516	.	.	ENSG00000212127	ENST00000537503	T	0.34667	1.35	3.28	-3.63	0.04529	3.28	-3.63	0.04529	.	2.668170	0.02729	U	0.114892	T	0.08447	0.0210	N	0.00313	-1.665	0.09310	N	1	B	0.14805	0.011	B	0.24701	0.055	T	0.10941	-1.0608	10	0.14656	T	0.56	.	0.1052	0.00052	0.2579:0.2416:0.1753:0.3253	.	174	Q9NYV8	T2R14_HUMAN	L	174	ENSP00000441949:R174L	ENSP00000375094:R174L	R	-	2	0	0	TAS2R14	10982553	10982553	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.567000	0.05916	-0.650000	0.05423	-0.908000	0.02827	CGA	0.312744		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	TAS2R14-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370194.4	1	0	1	2	2	2	2	0	0	0	0	67	67	67	67	1	3.530000	-3.052249	1	0.190000	NM_023922		0	15	15	0	404	401	0		1	0		0	0	67	0	0	0.999870	1.530997e-03	0	0	0	2	0	15	404
GIT2	9815	broad.mit.edu	37	12	110421488	110421488	+	Silent	SNP	C	C	A	rs140917075		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:110421488C>A	ENST00000355312.3	-	5	416	c.417G>T	c.(415-417)tcG>tcT	p.S139S	GIT2_ENST00000343646.5_Silent_p.S139S|GIT2_ENST00000338373.5_Silent_p.S139S|TCHP_ENST00000550780.1_3'UTR|GIT2_ENST00000360185.4_Silent_p.S139S|GIT2_ENST00000551209.1_Silent_p.S139S|GIT2_ENST00000553118.1_Silent_p.S139S|GIT2_ENST00000354574.4_Silent_p.S139S|GIT2_ENST00000356259.4_Silent_p.S139S|GIT2_ENST00000361006.5_Silent_p.S139S|GIT2_ENST00000320063.9_Silent_p.S139S|GIT2_ENST00000457474.2_Silent_p.S139S|GIT2_ENST00000547815.1_Silent_p.S139S	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	139					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						TTCTCACGCTCGAATGGAGTT	0.393																																						ENST00000355312.3	1.000000	0.380000	0.840000	0.490000	0.630000	0.666354	0.630000	0.600000																										0				27						c.(415-417)tcG>tcT		G protein-coupled receptor kinase interacting ArfGAP 2							81.0	76.0	77.0					12																	110421488		2203	4300	6503	SO:0001819	synonymous_variant	9815	0	0					g.chr12:110421488C>A	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.417G>T	chr12.hg19:g.110421488C>A		1					GIT2_ENST00000551209.1_Silent_p.S139S|TCHP_ENST00000550780.1_3'UTR|GIT2_ENST00000356259.4_Silent_p.S139S|GIT2_ENST00000338373.5_Silent_p.S139S|GIT2_ENST00000360185.4_Silent_p.S139S|GIT2_ENST00000343646.5_Silent_p.S139S|GIT2_ENST00000354574.4_Silent_p.S139S|GIT2_ENST00000553118.1_Silent_p.S139S|GIT2_ENST00000547815.1_Silent_p.S139S|GIT2_ENST00000320063.9_Silent_p.S139S|GIT2_ENST00000361006.5_Silent_p.S139S|GIT2_ENST00000457474.2_Silent_p.S139S	p.S139S	NM_057169.3	NP_476510.1	1	3	4	2.014333	Q14161	GIT2_HUMAN		5	416	-			Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Silent	SNP	ENST00000355312.3	1	0	hg19	c.417G>T	CCDS9138.1	0																																																																																								0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	3.530000	-2.745973	1	0.190000	NM_057169		0	19	19	0	366	359	0		1	0		0	0	75	0	0	0.999990	3.882651e-01	0	0	0	26	0	19	366
RITA1	84934	broad.mit.edu	37	12	113624632	113624632	+	Silent	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:113624632C>T	ENST00000548278.1	+	3	773	c.81C>T	c.(79-81)gtC>gtT	p.V27V	RP11-545P7.4_ENST00000552525.1_RNA|DDX54_ENST00000306014.5_5'Flank|C12orf52_ENST00000549621.1_Silent_p.V27V|DDX54_ENST00000314045.7_5'Flank|C12orf52_ENST00000552495.1_Silent_p.V51V	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		27					negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)			large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						GCTACCGGGTCAAGGCCAGGA	0.652																																						ENST00000548278.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										0				5						c.(79-81)gtC>gtT									51.0	46.0	48.0					12																	113624632		2203	4300	6503	SO:0001819	synonymous_variant	0	0	0					g.chr12:113624632C>T																												ENST00000548278.1:c.81C>T	chr12.hg19:g.113624632C>T		1					DDX54_ENST00000306014.5_5'Flank|DDX54_ENST00000314045.7_5'Flank|C12orf52_ENST00000552495.1_Silent_p.V51V|RP11-545P7.4_ENST00000552525.1_RNA|C12orf52_ENST00000549621.1_Silent_p.V27V	p.V27V	NM_032848.1	NP_116237.1	1	3	4	2.014333	Q96K30	RITA1_HUMAN		3	773	+			B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Silent	SNP	ENST00000548278.1	1	1	hg19	c.81C>T	CCDS9166.1	1																																																																																								0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.652	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405239.1	1	0	1	2	2	2	2	0	0	0	0	33	33	33	33	1	3.530000	-20.000000	1	0.190000			0	27	26	0	115	111	1		1	1		0	0	33	0	0	1.000000	9.998859e-01	0	14	0	52	0	27	115
DCP1B	196513	broad.mit.edu	37	12	2062397	2062397	+	Missense_Mutation	SNP	T	T	C			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:2062397T>C	ENST00000280665.6	-	7	788	c.709A>G	c.(709-711)Aaa>Gaa	p.K237E	DCP1B_ENST00000540622.1_Missense_Mutation_p.K111E|DCP1B_ENST00000541700.1_5'UTR|DCP1B_ENST00000397173.4_Missense_Mutation_p.K135E	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	237					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			CATGTAGCTTTGTCCTGCTTC	0.488																																						ENST00000280665.6	1.000000	0.990000	1.000000	0.990000	0.990000	0.998291	0.990000	1.000000																										0				24						c.(709-711)Aaa>Gaa		decapping mRNA 1B							56.0	59.0	58.0					12																	2062397		2203	4300	6503	SO:0001583	missense	196513	0	0					g.chr12:2062397T>C	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.709A>G	chr12.hg19:g.2062397T>C	ENSP00000280665:p.Lys237Glu	1					DCP1B_ENST00000541700.1_5'UTR|DCP1B_ENST00000397173.4_Missense_Mutation_p.K135E|DCP1B_ENST00000540622.1_Missense_Mutation_p.K111E	p.K237E	NM_152640.3	NP_689853.3	1	3	4	2.016404	Q8IZD4	DCP1B_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00193)	7	788	-			B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	ENST00000280665.6	1	1	hg19	c.709A>G	CCDS31727.1	1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.579542	0.46006	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.19669	2.19;2.18;2.13	4.93	3.79	0.43588	4.93	3.79	0.43588	.	0.725582	0.14262	N	0.330731	T	0.29223	0.0727	M	0.67953	2.075	0.38015	D	0.934657	P;P	0.47762	0.884;0.9	P;B	0.46419	0.516;0.334	T	0.16041	-1.0416	10	0.62326	D	0.03	-2.4726	9.7109	0.40245	0.0:0.0816:0.0:0.9184	.	135;237	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	E	237;135;111	ENSP00000280665:K237E;ENSP00000380358:K135E;ENSP00000444374:K111E	ENSP00000280665:K237E	K	-	1	0	0	DCP1B	1932658	1932658	0.998000	0.40836	0.662000	0.29724	0.161000	0.22273	2.946000	0.49050	0.912000	0.36772	0.528000	0.53228	AAA	0.312744		TCGA-XN-A8T3-01A-11D-A36O-08	0.488	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	3.530000	-20.000000	1	0.190000	NM_152640		0	27	27	0	204	203	1		1	1		0	0	49	0	0	1.000000	8.218471e-01	0	5	0	21	0	27	204
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	1	3	4	2.014333	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	3.530000	-20.000000	1	0.190000	NM_033360		2417	79	77	5606	305	299	1	1	1	1	1	0	0	73	327	1	1.000000	6.393962e-01	1	4	64	6	277	79	305
STK38L	23012	broad.mit.edu	37	12	27461299	27461299	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:27461299C>A	ENST00000389032.3	+	4	383	c.214C>A	c.(214-216)Cgc>Agc	p.R72S	STK38L_ENST00000539577.1_Intron	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					ACAACACGCTCGCAAAGAAAC	0.368																																						ENST00000389032.3	1.000000	0.450000	0.800000	0.540000	0.650000	0.681334	0.650000	0.640000																										0				12						c.(214-216)Cgc>Agc		serine/threonine kinase 38 like							90.0	93.0	92.0					12																	27461299		2203	4300	6503	SO:0001583	missense	23012	0	0					g.chr12:27461299C>A	AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.214C>A	chr12.hg19:g.27461299C>A	ENSP00000373684:p.Arg72Ser	1					STK38L_ENST00000539577.1_Intron	p.R72S	NM_015000.3	NP_055815.1	1	3	4	2.014333				4	383	+	Colorectal(261;0.0847)			Missense_Mutation	SNP	ENST00000389032.3	1	0	hg19	c.214C>A	CCDS31761.1	0	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405421	0.62288	.	.	ENSG00000211455	ENST00000541191;ENST00000389032;ENST00000540996;ENST00000543246;ENST00000544969	T;T;T;T;T	0.49720	0.99;0.77;0.99;0.99;0.99	4.54	4.54	0.55810	4.54	4.54	0.55810	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46639	0.1403	L	0.56199	1.76	0.80722	D	1	B	0.10296	0.003	B	0.12837	0.008	T	0.46331	-0.9199	10	0.51188	T	0.08	.	17.29	0.87153	0.0:1.0:0.0:0.0	.	72	Q9Y2H1	ST38L_HUMAN	S	72	ENSP00000437856:R72S;ENSP00000373684:R72S;ENSP00000443838:R72S;ENSP00000442253:R72S;ENSP00000440279:R72S	ENSP00000373684:R72S	R	+	1	0	0	STK38L	27352566	27352566	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.515000	0.60489	2.257000	0.74773	0.460000	0.39030	CGC	0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.368	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403297.1	1	0	1	2	2	2	2	0	0	0	0	159	159	159	156	1	3.530000	-2.489390	0	0.190000	NM_015000		0	37	37	0	680	664	0		1	0		0	0	159	0	0	1.000000	8.402188e-01	0	0	0	63	0	37	680
FGD4	121512	broad.mit.edu	37	12	32778699	32778699	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:32778699C>A	ENST00000427716.2	+	14	2171	c.1747C>A	c.(1747-1749)Cga>Aga	p.R583R	FGD4_ENST00000266482.3_Silent_p.R335R|FGD4_ENST00000525053.1_Silent_p.R695R|FGD4_ENST00000546442.1_Silent_p.R490R|FGD4_ENST00000534526.2_Silent_p.R720R|FGD4_ENST00000531134.1_Silent_p.R668R	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	583					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GCATCATTGTCGAGCATGTGG	0.383																																						ENST00000427716.2	1.000000	0.190000	0.440000	0.250000	0.320000	0.390956	0.320000	0.300000																										0				27						c.(1747-1749)Cga>Aga		FYVE, RhoGEF and PH domain containing 4							139.0	136.0	137.0					12																	32778699		2203	4300	6503	SO:0001819	synonymous_variant	121512	0	0					g.chr12:32778699C>A	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1747C>A	chr12.hg19:g.32778699C>A		1					FGD4_ENST00000546442.1_Silent_p.R490R|FGD4_ENST00000531134.1_Silent_p.R668R|FGD4_ENST00000525053.1_Silent_p.R695R|FGD4_ENST00000534526.2_Silent_p.R720R|FGD4_ENST00000266482.3_Silent_p.R335R	p.R583R	NM_139241.2	NP_640334.2	1	3	4	2.014333	Q96M96	FGD4_HUMAN		14	2171	+	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		Q6ULS2|Q8TCP6	Silent	SNP	ENST00000427716.2	0	1	hg19	c.1747C>A	CCDS8727.1	0																																																																																								0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.383	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	0	0	1	2	2	2	2	0	0	0	0	123	123	123	122	1	3.530000	-2.547133	1	0.190000	NM_139241		0	19	18	0	731	718	0		1	0		0	0	123	0	0	0.999989	1.171786e-01	0	0	0	22	0	19	731
KRT74	121391	broad.mit.edu	37	12	52967109	52967109	+	Missense_Mutation	SNP	G	G	T	rs531125952		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:52967109G>T	ENST00000305620.2	-	1	500	c.453C>A	c.(451-453)ttC>ttA	p.F151L	KRT74_ENST00000549343.1_Missense_Mutation_p.F151L	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	151	Coil 1A.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)	p.F151F(1)		kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		TGAAGGAGGCGAACTTGTCGT	0.592																																						ENST00000305620.2	1.000000	0.360000	0.770000	0.460000	0.580000	0.622349	0.580000	0.560000																										1	Substitution - coding silent(1)	p.F151F(1)	large_intestine(1)	28						c.(451-453)ttC>ttA		keratin 74							125.0	116.0	119.0					12																	52967109		2203	4300	6503	SO:0001583	missense	121391	0	0					g.chr12:52967109G>T	BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.453C>A	chr12.hg19:g.52967109G>T	ENSP00000307240:p.Phe151Leu	1					KRT74_ENST00000549343.1_Missense_Mutation_p.F151L	p.F151L	NM_175053.3	NP_778223.2	1	3	4	2.014333	Q7RTS7	K2C74_HUMAN		1	500	-			B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	1	0	hg19	c.453C>A	CCDS8832.1	0	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445032	0.63178	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;D	0.84589	-1.87;-1.87	4.4	-8.37	0.00976	4.4	-8.37	0.00976	Filament (1);	0.000000	0.36002	N	0.002856	D	0.90679	0.7076	M	0.84846	2.72	0.37092	D	0.899483	D	0.76494	0.999	D	0.74348	0.983	D	0.92064	0.5659	10	0.87932	D	0	.	18.0861	0.89457	0.3591:0.0:0.6409:0.0	.	151	Q7RTS7	K2C74_HUMAN	L	151	ENSP00000447447:F151L;ENSP00000307240:F151L	ENSP00000307240:F151L	F	-	3	2	2	KRT74	51253376	51253376	0.000000	0.05858	0.806000	0.32338	0.804000	0.45430	-2.453000	0.01005	-1.528000	0.01756	-0.459000	0.05422	TTC	0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.592	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	1	0	1	2	2	2	2	0	0	0	0	104	104	104	104	1	3.530000	-3.010565	1	0.190000	NM_175053		0	20	20	0	419	415	0		1			0	0	104	0	0	0.999995	0	0	0	0	0	0	20	419
PUS1	80324	broad.mit.edu	37	12	132426520	132426520	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr12:132426520G>A	ENST00000376649.3	+	5	1728	c.1228G>A	c.(1228-1230)Ggc>Agc	p.G410S	PUS1_ENST00000535067.1_Intron|PUS1_ENST00000542167.2_Missense_Mutation_p.G357S|PUS1_ENST00000443358.2_Missense_Mutation_p.G382S|PUS1_ENST00000440818.2_Missense_Mutation_p.G382S	NM_025215.5	NP_079491.2	Q9Y606	TRUA_HUMAN	pseudouridylate synthase 1	410					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|tRNA pseudouridine synthesis (GO:0031119)	mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|pseudouridylate synthase activity (GO:0004730)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	11	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		AGGTGGCACGGGCGCCAAGGT	0.612																																					Esophageal Squamous(102;671 2009 17384 45666)	ENST00000376649.3	1.000000	0.660000	1.000000	0.930000	0.990000	0.965953	0.990000	1.000000																										0				11						c.(1228-1230)Ggc>Agc		pseudouridylate synthase 1							21.0	16.0	18.0					12																	132426520		2196	4280	6476	SO:0001583	missense	80324	0	0					g.chr12:132426520G>A	AF116238	CCDS9275.2, CCDS31928.1	12q24	2004-05-17			ENSG00000177192	ENSG00000177192			15508	protein-coding gene	gene with protein product		608109				10094309	Standard	NM_001002019		Approved		uc001ujf.3	Q9Y606	OTTHUMG00000128507	ENST00000376649.3:c.1228G>A	chr12.hg19:g.132426520G>A	ENSP00000365837:p.Gly410Ser	1					PUS1_ENST00000535067.1_Intron|PUS1_ENST00000443358.2_Missense_Mutation_p.G382S|PUS1_ENST00000542167.2_Missense_Mutation_p.G357S|PUS1_ENST00000440818.2_Missense_Mutation_p.G382S	p.G410S	NM_025215.5	NP_079491.2	1	3	4	2.014333	Q9Y606	TRUA_HUMAN		5	1728	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		A8K877|B3KQC1|Q8WYT2|Q9BU44	Missense_Mutation	SNP	ENST00000376649.3	0	1	hg19	c.1228G>A	CCDS9275.2	1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378889	0.42207	.	.	ENSG00000177192	ENST00000443358;ENST00000376649;ENST00000322060;ENST00000440818;ENST00000542167	T;T;T;T;T	0.54279	0.62;0.6;0.58;0.62;0.62	4.58	3.69	0.42338	4.58	3.69	0.42338	.	0.639198	0.14819	N	0.296581	T	0.44265	0.1285	L	0.44542	1.39	0.09310	N	1	P;B	0.38078	0.617;0.005	B;B	0.37144	0.242;0.002	T	0.30416	-0.9979	10	0.49607	T	0.09	-10.2033	10.0242	0.42061	0.0981:0.0:0.9019:0.0	.	357;410	F5H1S9;Q9Y606	.;TRUA_HUMAN	S	382;410;382;382;357	ENSP00000392451:G382S;ENSP00000365837:G410S;ENSP00000324726:G382S;ENSP00000400032:G382S;ENSP00000438948:G357S	ENSP00000324726:G382S	G	+	1	0	0	PUS1	130992473	130992473	0.017000	0.18338	0.001000	0.08648	0.009000	0.06853	1.937000	0.40193	1.034000	0.39945	0.491000	0.48974	GGC	0.306032		TCGA-XN-A8T3-01A-11D-A36O-08	0.612	PUS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250313.2	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	3.530000	-16.927970	1	0.190000	NM_025215		0	10	7	0	91	84	0		1	1		0	0	22	0	0	0.995535	9.877420e-01	0	4	0	69	0	10	91
SGCG	6445	broad.mit.edu	37	13	23869565	23869565	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr13:23869565G>A	ENST00000218867.3	+	6	641	c.517G>A	c.(517-519)Gct>Act	p.A173T	SGCG_ENST00000537476.1_Missense_Mutation_p.A173T|SGCG_ENST00000545013.1_Missense_Mutation_p.A173T	NM_000231.2	NP_000222	Q13326	SGCG_HUMAN	sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)	173					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		GCCTGAAGGGGCTCTTTTTGA	0.373																																						ENST00000218867.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				22						c.(517-519)Gct>Act		sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)							155.0	158.0	157.0					13																	23869565		2203	4300	6503	SO:0001583	missense	6445	0	0					g.chr13:23869565G>A	U34976	CCDS9299.1	13q12-q13	2014-09-17	2002-08-29		ENSG00000102683	ENSG00000102683			10809	protein-coding gene	gene with protein product	"""Maghrebian myopathy (autosomal recessive)"", ""35kD dystrophin-associated glycoprotein"", ""limb girdle muscular dystrophy 2C (Duchenne-like muscular dystrophy, autosomal recessive)"", ""gamma sarcoglycan"""	608896	"""sarcoglycan, gamma (35kD dystrophin-associated glycoprotein)"""	DMDA1, MAM, LGMD2C		8968757	Standard	NM_000231		Approved	SCARMD2, DAGA4, SCG3, DMDA, TYPE, A4, MGC130048	uc001uom.2	Q13326	OTTHUMG00000016563	ENST00000218867.3:c.517G>A	chr13.hg19:g.23869565G>A	ENSP00000218867:p.Ala173Thr	0					SGCG_ENST00000537476.1_Missense_Mutation_p.A173T|SGCG_ENST00000545013.1_Missense_Mutation_p.A173T	p.A173T	NM_000231.2	NP_000222	2	2	4	2.073623	Q13326	SGCG_HUMAN		6	641	+		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)	Q32M32|Q5T9J6	Missense_Mutation	SNP	ENST00000218867.3	1	1	hg19	c.517G>A	CCDS9299.1	1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.182474	0.57800	.	.	ENSG00000102683	ENST00000218867;ENST00000537476;ENST00000545013	D;D;D	0.95307	-3.67;-3.67;-3.67	4.61	4.61	0.57282	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.96386	0.8821	M	0.75447	2.3	0.54753	D	0.999985	D	0.89917	1.0	D	0.91635	0.999	D	0.94976	0.8121	10	0.23891	T	0.37	-20.3547	13.2912	0.60272	0.0:0.0:1.0:0.0	.	173	Q13326	SGCG_HUMAN	T	173	ENSP00000218867:A173T;ENSP00000444100:A173T;ENSP00000442232:A173T	ENSP00000218867:A173T	A	+	1	0	0	SGCG	22767565	22767565	1.000000	0.71417	0.998000	0.56505	0.580000	0.36256	4.816000	0.62642	2.264000	0.75181	0.563000	0.77884	GCT	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.373	SGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044151.1	1	0	0	2	2	2	2	0	0	0	0	164	164	164	163	1	3.530000	-20.000000	1	0.190000	NM_000231		0	173	174	0	809	794	1		1			0	0	164	0	0	1.000000	0	0	0	0	0	0	173	809
ALOX5AP	241	broad.mit.edu	37	13	31330136	31330136	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr13:31330136C>A	ENST00000380490.3	+	4	395	c.297C>A	c.(295-297)gtC>gtA	p.V99V		NM_001204406.1|NM_001629.3	NP_001191335.1|NP_001620.2	P20292	AL5AP_HUMAN	arachidonate 5-lipoxygenase-activating protein	99					arachidonic acid metabolic process (GO:0019369)|cellular response to calcium ion (GO:0071277)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|positive regulation of acute inflammatory response (GO:0002675)|protein homotrimerization (GO:0070207)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	arachidonic acid binding (GO:0050544)|enzyme activator activity (GO:0008047)|protein N-terminus binding (GO:0047485)			endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0187)|Epithelial(112;0.0803)|OV - Ovarian serous cystadenocarcinoma(117;0.0864)		AGTACTTTGTCGGTTACCTAG	0.448																																						ENST00000380490.3	0.750000	0.280000	0.620000	0.370000	0.480000	0.500852	0.480000	0.480000																										0				4						c.(295-297)gtC>gtA		arachidonate 5-lipoxygenase-activating protein							175.0	148.0	157.0					13																	31330136		2203	4300	6503	SO:0001819	synonymous_variant	241	0	0					g.chr13:31330136C>A	AH001462	CCDS9337.1, CCDS73558.1	13q12	2008-07-18			ENSG00000132965	ENSG00000132965			436	protein-coding gene	gene with protein product	"""five-lipoxygenase activating protein"", ""MK-886-binding protein"""	603700				1673682, 10036194	Standard	NM_001629		Approved	FLAP	uc010tdr.2	P20292	OTTHUMG00000016677	ENST00000380490.3:c.297C>A	chr13.hg19:g.31330136C>A		0						p.V99V	NM_001204406.1|NM_001629.3	NP_001191335.1|NP_001620.2	2	2	4	2.073623	P20292	AL5AP_HUMAN		4	395	+		Lung SC(185;0.0257)|Breast(139;0.203)	Q5VV04	Silent	SNP	ENST00000380490.3	1	0	hg19	c.297C>A	CCDS9337.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.448	ALOX5AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044372.1	1	0	1	2	2	2	2	0	0	0	0	78	78	78	77	1	3.530000	-2.778627	1	0.190000	NM_001629		0	15	14	0	381	374	0		1	0		0	0	78	0	0	0.999857	9.971820e-01	0	0	0	247	0	15	381
DGKH	160851	broad.mit.edu	37	13	42773954	42773954	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr13:42773954G>T	ENST00000337343.4	+	20	2423	c.2402G>T	c.(2401-2403)cGa>cTa	p.R801L	DGKH_ENST00000540693.1_Missense_Mutation_p.R801L|DGKH_ENST00000538674.1_Missense_Mutation_p.R556L|DGKH_ENST00000261491.5_Missense_Mutation_p.R801L|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000379274.2_Missense_Mutation_p.R665L|DGKH_ENST00000536612.1_Missense_Mutation_p.R665L	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	801					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R801Q(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TTCAGGAGCCGAACTAAAAAC	0.348																																						ENST00000337343.4	0.840000	0.310000	0.700000	0.420000	0.540000	0.564112	0.540000	0.520000																										1	Substitution - Missense(1)	p.R801Q(1)	large_intestine(1)	43						c.(2401-2403)cGa>cTa		diacylglycerol kinase, eta							47.0	51.0	49.0					13																	42773954		2203	4300	6503	SO:0001583	missense	160851	0	0					g.chr13:42773954G>T	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2402G>T	chr13.hg19:g.42773954G>T	ENSP00000337572:p.Arg801Leu	0					DGKH_ENST00000540693.1_Missense_Mutation_p.R801L|DGKH_ENST00000261491.5_Missense_Mutation_p.R801L|DGKH_ENST00000379274.2_Missense_Mutation_p.R665L|DGKH_ENST00000536612.1_Missense_Mutation_p.R665L|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000538674.1_Missense_Mutation_p.R556L	p.R801L	NM_178009.3	NP_821077.1	2	2	4	2.073623	Q86XP1	DGKH_HUMAN		20	2423	+		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	1	0	hg19	c.2402G>T	CCDS9381.1	0	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871602	0.72065	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29	5.79	5.79	0.91817	5.79	5.79	0.91817	Diacylglycerol kinase, accessory domain (2);	0.073536	0.56097	D	0.000034	T	0.69033	0.3066	M	0.93678	3.445	0.80722	D	1	P;D;P;P	0.55172	0.844;0.97;0.5;0.951	P;P;B;P	0.59546	0.667;0.779;0.344;0.859	T	0.77189	-0.2679	10	0.87932	D	0	.	20.0367	0.97561	0.0:0.0:1.0:0.0	.	556;665;801;801	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	L	801;801;801;665;665;556	ENSP00000440823:R801L;ENSP00000337572:R801L;ENSP00000261491:R801L;ENSP00000368576:R665L;ENSP00000445114:R665L;ENSP00000441308:R556L	ENSP00000261491:R801L	R	+	2	0	0	DGKH	41671954	41671954	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.956000	0.87863	2.727000	0.93392	0.591000	0.81541	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	3.530000	-3.063285	1	0.190000	NM_178009		0	15	14	0	336	333	0		1	0		0	0	41	0	0	0.999869	0	0	0	0	1	0	15	336
HTR2A	3356	broad.mit.edu	37	13	47409499	47409499	+	Missense_Mutation	SNP	G	G	A	rs376305063		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr13:47409499G>A	ENST00000378688.4	-	3	1020	c.889C>T	c.(889-891)Cgg>Tgg	p.R297W	HTR2A_ENST00000542664.1_Missense_Mutation_p.R297W|HTR2A_ENST00000543956.1_Missense_Mutation_p.R213W			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	297					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TGGATCGACCGCTGGAAGAGC	0.502																																						ENST00000378688.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999998	0.990000	1.000000																										0				36						c.(889-891)Cgg>Tgg		5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	85.0	76.0	79.0		889,637	0.5	1.0	13		79	0,8600	1.2+/-3.3	0,0,4300	no	missense,missense	HTR2A	NM_000621.3,NM_001165947.1	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	297/472,213/388	47409499	1,13005	2203	4300	6503	SO:0001583	missense	3356	2	121398	35				g.chr13:47409499G>A	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.889C>T	chr13.hg19:g.47409499G>A	ENSP00000367959:p.Arg297Trp	0					HTR2A_ENST00000543956.1_Missense_Mutation_p.R213W|HTR2A_ENST00000542664.1_Missense_Mutation_p.R297W	p.R297W			2	2	4	2.073623	P28223	5HT2A_HUMAN		3	1020	-		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	1	1	hg19	c.889C>T	CCDS9405.1	1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180129	0.57800	2.27E-4	0.0	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.63417	0.27;-0.04;0.27	5.78	0.475	0.16774	5.78	0.475	0.16774	GPCR, rhodopsin-like superfamily (1);	0.124540	0.53938	D	0.000048	T	0.81536	0.4843	M	0.91872	3.25	0.45477	D	0.998448	D;D	0.89917	0.999;1.0	D;D	0.74348	0.94;0.983	D	0.84763	0.0763	10	0.62326	D	0.03	.	15.9291	0.79646	0.0:0.0:0.4023:0.5977	.	213;297	F5GWE8;P28223	.;5HT2A_HUMAN	W	297;213;297	ENSP00000367959:R297W;ENSP00000441861:R213W;ENSP00000437737:R297W	ENSP00000367959:R297W	R	-	1	2	2	HTR2A	46307500	46307500	1.000000	0.71417	0.984000	0.44739	0.974000	0.67602	3.113000	0.50376	-0.155000	0.11098	-0.293000	0.09583	CGG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.502	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	1	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	3.530000	-3.353918	1	0.190000	NM_000621		0	35	35	0	183	175	1		1			0	0	35	0	0	1.000000	0	0	0	0	0	0	35	183
ATP7B	540	broad.mit.edu	37	13	52548807	52548807	+	Silent	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr13:52548807G>A	ENST00000242839.4	-	2	705	c.549C>T	c.(547-549)gcC>gcT	p.A183A	ATP7B_ENST00000400370.3_Silent_p.A183A|ATP7B_ENST00000400366.3_Silent_p.A183A|ATP7B_ENST00000542656.1_Silent_p.A151A|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000344297.5_Silent_p.A183A|ATP7B_ENST00000418097.2_Silent_p.A183A|ATP7B_ENST00000448424.2_Silent_p.A183A	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	183	HMA 2. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AAGTGATGACGGCCTCTTGGT	0.512									Wilson disease																													ENST00000242839.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				55						c.(547-549)gcC>gcT		ATPase, Cu++ transporting, beta polypeptide	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)						59.0	62.0	61.0					13																	52548807		2083	4211	6294	SO:0001819	synonymous_variant	540	1	121044	33	Wilson disease	Familial Cancer Database		g.chr13:52548807G>A	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.549C>T	chr13.hg19:g.52548807G>A		0					ATP7B_ENST00000542656.1_Silent_p.A151A|ATP7B_ENST00000448424.2_Silent_p.A183A|ATP7B_ENST00000418097.2_Silent_p.A183A|ATP7B_ENST00000400370.3_Silent_p.A183A|ATP7B_ENST00000400366.3_Silent_p.A183A|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000344297.5_Silent_p.A183A	p.A183A	NM_000053.3	NP_000044.2	2	2	4	2.073623	P35670	ATP7B_HUMAN		2	705	-		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Silent	SNP	ENST00000242839.4	1	1	hg19	c.549C>T	CCDS41892.1	1																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.512	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	1	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	3.530000	-20.000000	1	0.190000	NM_000053		0	44	43	0	222	219	1		1	0		0	0	59	0	0	1.000000	0	0	0	0	1	0	44	222
TGDS	23483	broad.mit.edu	37	13	95246123	95246123	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr13:95246123G>T	ENST00000261296.5	-	2	245	c.125C>A	c.(124-126)cCa>cAa	p.P42Q	TGDS_ENST00000498294.1_5'UTR	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	42					nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CATATAGTTTGGATAATCTTC	0.274																																						ENST00000261296.5	0.370000	0.150000	0.310000	0.190000	0.240000	0.258596	0.240000	0.240000																										0				8						c.(124-126)cCa>cAa		TDP-glucose 4,6-dehydratase							103.0	108.0	107.0					13																	95246123		2200	4281	6481	SO:0001583	missense	23483	0	0					g.chr13:95246123G>T	AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.125C>A	chr13.hg19:g.95246123G>T	ENSP00000261296:p.Pro42Gln	0					TGDS_ENST00000498294.1_5'UTR	p.P42Q	NM_014305.2	NP_055120.1	2	2	4	2.073623	O95455	TGDS_HUMAN		2	245	-	all_neural(89;0.0684)|Medulloblastoma(90;0.163)		Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	Missense_Mutation	SNP	ENST00000261296.5	0	1	hg19	c.125C>A	CCDS9471.1	0	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204314	0.79127	.	.	ENSG00000088451	ENST00000261296	D	0.93019	-3.15	5.67	5.67	0.87782	5.67	5.67	0.87782	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.116101	0.64402	D	0.000014	D	0.96959	0.9007	M	0.88181	2.935	0.54753	D	0.999986	D	0.89917	1.0	D	0.91635	0.999	D	0.95736	0.8779	10	0.21014	T	0.42	.	17.5515	0.87878	0.0:0.0:1.0:0.0	.	42	O95455	TGDS_HUMAN	Q	42	ENSP00000261296:P42Q	ENSP00000261296:P42Q	P	-	2	0	0	TGDS	94044124	94044124	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.419000	0.59835	2.658000	0.90341	0.591000	0.81541	CCA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.274	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106904.2	0	0	1	2	2	2	2	0	0	0	0	185	185	185	183	1	3.530000	-2.151350	0	0.190000	NM_014305		0	22	22	0	1088	1080	0		1	0		0	0	185	0	0	0.999999	1.777944e-02	0	0	0	10	0	22	1088
PROZ	8858	broad.mit.edu	37	13	113826319	113826319	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr13:113826319C>T	ENST00000375547.2	+	8	1110	c.1103C>T	c.(1102-1104)aCg>aTg	p.T368M	PROZ_ENST00000342783.4_Missense_Mutation_p.T390M	NM_003891.2	NP_003882.1	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma glycoprotein	368	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(2)|skin(2)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	TGGTTTCTCACGGGGGTCCTG	0.562																																						ENST00000375547.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				16						c.(1102-1104)aCg>aTg		protein Z, vitamin K-dependent plasma glycoprotein	Menadione(DB00170)						36.0	34.0	35.0					13																	113826319		2203	4298	6501	SO:0001583	missense	8858	5	121378	37				g.chr13:113826319C>T	M55670	CCDS9531.1, CCDS58300.1	13q34	2008-07-18			ENSG00000126231	ENSG00000126231			9460	protein-coding gene	gene with protein product		176895				2244898, 2403355	Standard	NM_001256134		Approved	PZ	uc010agr.2	P22891	OTTHUMG00000017376	ENST00000375547.2:c.1103C>T	chr13.hg19:g.113826319C>T	ENSP00000364697:p.Thr368Met	0					PROZ_ENST00000342783.4_Missense_Mutation_p.T390M	p.T368M	NM_003891.2	NP_003882.1	2	2	4	2.073623	P22891	PROZ_HUMAN	all cancers(43;0.104)	8	1110	+	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	A6NMB4|Q15213|Q5JVF5|Q5JVF6	Missense_Mutation	SNP	ENST00000375547.2	1	1	hg19	c.1103C>T	CCDS9531.1	1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.282979	0.23392	.	.	ENSG00000126231	ENST00000375547;ENST00000342783	D;D	0.89050	-2.46;-2.46	3.96	2.78	0.32641	3.96	2.78	0.32641	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.303944	0.34986	N	0.003522	D	0.91720	0.7382	M	0.68593	2.085	0.39311	D	0.965077	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91267	0.5041	10	0.87932	D	0	.	6.4669	0.21987	0.0:0.6801:0.1745:0.1454	.	390;368	P22891-2;P22891	.;PROZ_HUMAN	M	368;390	ENSP00000364697:T368M;ENSP00000344458:T390M	ENSP00000344458:T390M	T	+	2	0	0	PROZ	112874320	112874320	0.916000	0.31088	0.503000	0.27626	0.030000	0.12068	1.723000	0.38053	1.891000	0.54761	0.313000	0.20887	ACG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.562	PROZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045845.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	59	1	3.530000	-20.000000	1	0.190000	NM_003891		0	54	53	0	222	216	1		1	0		0	0	63	0	0	1.000000	3.971017e-02	0	0	0	2	0	54	222
EFS	10278	broad.mit.edu	37	14	23829013	23829013	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr14:23829013C>A	ENST00000216733.3	-	4	1281	c.674G>T	c.(673-675)cGa>cTa	p.R225L	EFS_ENST00000429593.2_Intron|EFS_ENST00000351354.3_Missense_Mutation_p.R132L|RP11-124D2.3_ENST00000554010.1_RNA	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	225	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		GGCTGACGCTCGTTTCAGGTT	0.622																																						ENST00000216733.3	0.900000	0.420000	0.780000	0.520000	0.640000	0.656039	0.640000	0.640000																										0				16						c.(673-675)cGa>cTa		embryonal Fyn-associated substrate							46.0	55.0	52.0					14																	23829013		2203	4288	6491	SO:0001583	missense	10278	0	0					g.chr14:23829013C>A	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.674G>T	chr14.hg19:g.23829013C>A	ENSP00000216733:p.Arg225Leu	0					EFS_ENST00000351354.3_Missense_Mutation_p.R132L|RP11-124D2.3_ENST00000554010.1_RNA|EFS_ENST00000429593.2_Intron	p.R225L	NM_005864.2	NP_005855.1	2	2	4	2.088023	O43281	EFS_HUMAN		4	1281	-	all_cancers(95;7.12e-06)		B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	ENST00000216733.3	1	0	hg19	c.674G>T	CCDS9595.1	0	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149251	0.37923	.	.	ENSG00000100842	ENST00000216733;ENST00000351354	T;T	0.59364	0.27;0.8	4.88	3.98	0.46160	4.88	3.98	0.46160	.	0.541790	0.18247	N	0.147073	T	0.72495	0.3467	M	0.72894	2.215	0.80722	D	1	D;B	0.89917	1.0;0.023	D;B	0.87578	0.998;0.011	T	0.69446	-0.5143	10	0.25751	T	0.34	-15.8242	13.4706	0.61279	0.1582:0.8418:0.0:0.0	.	132;225	O43281-2;O43281	.;EFS_HUMAN	L	225;132	ENSP00000216733:R225L;ENSP00000340607:R132L	ENSP00000216733:R225L	R	-	2	0	0	EFS	22898853	22898853	0.998000	0.40836	0.958000	0.39756	0.003000	0.03518	2.042000	0.41222	1.271000	0.44313	-0.311000	0.09066	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.622	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2	1	0	1	2	2	2	2	0	0	0	0	97	97	97	97	1	3.530000	-2.876406	1	0.190000			0	25	25	0	467	461	0		1	0		0	0	97	0	0	1.000000	3.209916e-01	0	0	0	22	0	25	467
RABGGTA	5875	broad.mit.edu	37	14	24737795	24737795	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr14:24737795C>A	ENST00000399409.3	-	9	1414	c.931G>T	c.(931-933)Gac>Tac	p.D311Y	RABGGTA_ENST00000560777.1_Intron|RABGGTA_ENST00000559586.1_5'Flank|RABGGTA_ENST00000216840.6_Missense_Mutation_p.D311Y	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	311					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		GGCAACTGGTCGTTGAGGGAG	0.557																																						ENST00000399409.3	0.510000	0.160000	0.420000	0.230000	0.310000	0.329550	0.310000	0.320000																										0				12						c.(931-933)Gac>Tac		Rab geranylgeranyltransferase, alpha subunit							91.0	96.0	94.0					14																	24737795		2073	4208	6281	SO:0001583	missense	5875	0	0					g.chr14:24737795C>A		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.931G>T	chr14.hg19:g.24737795C>A	ENSP00000382341:p.Asp311Tyr	0					RABGGTA_ENST00000559586.1_5'Flank|RABGGTA_ENST00000216840.6_Missense_Mutation_p.D311Y|RABGGTA_ENST00000560777.1_Intron	p.D311Y	NM_004581.5	NP_004572.3	2	2	4	2.088023	Q92696	PGTA_HUMAN		9	1414	-			A8K5N2|D3DS69	Missense_Mutation	SNP	ENST00000399409.3	0	1	hg19	c.931G>T	CCDS45088.1	0	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269476	0.40095	.	.	ENSG00000100949	ENST00000216840;ENST00000399409;ENST00000543002	T;T	0.52057	0.68;0.68	5.11	4.22	0.49857	5.11	4.22	0.49857	Rab geranylgeranyltransferase, alpha subunit, insert-domain (4);	0.000000	0.85682	D	0.000000	T	0.61489	0.2351	L	0.55481	1.735	0.80722	D	1	D	0.76494	0.999	D	0.69654	0.965	T	0.63804	-0.6554	10	0.59425	D	0.04	-24.6605	13.0558	0.58980	0.0:0.9196:0.0:0.0804	.	311	Q92696	PGTA_HUMAN	Y	311;311;274	ENSP00000216840:D311Y;ENSP00000382341:D311Y	ENSP00000216840:D311Y	D	-	1	0	0	RABGGTA	23807635	23807635	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	4.232000	0.58645	1.292000	0.44672	-0.448000	0.05591	GAC	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.557	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	0	0	1	2	2	2	2	0	0	0	0	90	90	90	89	1	3.530000	-3.222634	1	0.190000	NM_182836		0	12	13	0	478	471	0		1	0		0	0	90	0	0	0.999067	5.093373e-01	0	0	0	66	0	12	478
EML5	161436	broad.mit.edu	37	14	89124675	89124675	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr14:89124675G>T	ENST00000380664.5	-	26	3732	c.3733C>A	c.(3733-3735)Cgc>Agc	p.R1245S	EML5_ENST00000352093.5_Missense_Mutation_p.R1207S|EML5_ENST00000554922.1_Missense_Mutation_p.R1245S			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1245						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TAAGTCCAGCGAACATTTGTG	0.398																																						ENST00000380664.5	0.780000	0.370000	0.670000	0.460000	0.550000	0.571941	0.550000	0.560000																										0				50						c.(3733-3735)Cgc>Agc		echinoderm microtubule associated protein like 5							145.0	130.0	135.0					14																	89124675		1885	4116	6001	SO:0001583	missense	161436	0	0					g.chr14:89124675G>T	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3733C>A	chr14.hg19:g.89124675G>T	ENSP00000370039:p.Arg1245Ser	0					EML5_ENST00000554922.1_Missense_Mutation_p.R1245S|EML5_ENST00000352093.5_Missense_Mutation_p.R1207S	p.R1245S			2	2	4	2.088023	Q05BV3	EMAL5_HUMAN		26	3732	-			B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	1	0	hg19	c.3733C>A	CCDS45148.1	0	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616462	0.87359	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.37411	1.2;1.7;1.2	4.61	4.61	0.57282	4.61	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58991	0.2161	M	0.73217	2.22	0.58432	D	0.999999	D;D	0.76494	0.999;0.966	D;P	0.74348	0.983;0.727	T	0.56768	-0.7924	10	0.33940	T	0.23	-10.3411	17.9931	0.89175	0.0:0.0:1.0:0.0	.	1245;1245	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	S	1245;1207;1245	ENSP00000451998:R1245S;ENSP00000298315:R1207S;ENSP00000370039:R1245S	ENSP00000298315:R1207S	R	-	1	0	0	EML5	88194428	88194428	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.606000	0.82863	2.550000	0.86006	0.557000	0.71058	CGC	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.398	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1	1	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	3.530000	-3.100434	1	0.190000			0	28	27	0	603	591	0		1			0	0	95	0	0	1.000000	0	0	0	0	0	0	28	603
PPP1R13B	23368	broad.mit.edu	37	14	104209072	104209072	+	Silent	SNP	C	C	A	rs12891833		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr14:104209072C>A	ENST00000202556.9	-	10	1521	c.1239G>T	c.(1237-1239)ccG>ccT	p.P413P	PPP1R13B_ENST00000423488.2_5'UTR|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	413					intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				CCTCCACGCTCGGATCCTTCC	0.552																																						ENST00000202556.9	0.730000	0.300000	0.610000	0.390000	0.490000	0.509654	0.490000	0.480000																										0				33						c.(1237-1239)ccG>ccT		protein phosphatase 1, regulatory subunit 13B							61.0	63.0	62.0					14																	104209072		1972	4148	6120	SO:0001819	synonymous_variant	23368	0	0					g.chr14:104209072C>A	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.1239G>T	chr14.hg19:g.104209072C>A		0					PPP1R13B_ENST00000555391.1_5'UTR|PPP1R13B_ENST00000423488.2_5'UTR	p.P413P	NM_015316.2	NP_056131.2	2	2	4	2.088023	Q96KQ4	ASPP1_HUMAN		10	1521	-		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)	B2RMX5|O94870	Silent	SNP	ENST00000202556.9	1	0	hg19	c.1239G>T	CCDS41997.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.552	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	1	0	1	2	2	2	2	0	0	0	0	113	113	113	109	1	3.530000	-2.796323	1	0.190000	NM_015316		0	20	20	0	492	487	0		1	0		0	0	113	0	0	0.999995	4.160658e-01	0	0	0	35	0	20	492
TMOD2	29767	broad.mit.edu	37	15	52069169	52069169	+	Missense_Mutation	SNP	C	C	A	rs372217308		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr15:52069169C>A	ENST00000249700.4	+	5	668	c.447C>A	c.(445-447)ttC>ttA	p.F149L	TMOD2_ENST00000435126.2_Missense_Mutation_p.F149L|TMOD2_ENST00000539962.2_Missense_Mutation_p.F105L	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	149					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		ATCCAAAGTTCGATGAAGAAA	0.413																																						ENST00000249700.4	0.890000	0.400000	0.760000	0.500000	0.610000	0.634088	0.610000	0.600000																										0				16						c.(445-447)ttC>ttA		tropomodulin 2 (neuronal)							154.0	134.0	141.0					15																	52069169		2195	4293	6488	SO:0001583	missense	29767	0	0					g.chr15:52069169C>A	AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.447C>A	chr15.hg19:g.52069169C>A	ENSP00000249700:p.Phe149Leu	0					TMOD2_ENST00000539962.2_Missense_Mutation_p.F105L|TMOD2_ENST00000435126.2_Missense_Mutation_p.F149L	p.F149L	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	1	2	3	1.919646	Q9NZR1	TMOD2_HUMAN		5	668	+			B4DEW6	Missense_Mutation	SNP	ENST00000249700.4	1	0	hg19	c.447C>A	CCDS10144.1	0	.	.	.	.	.	.	.	.	.	.	c	13.54	2.269001	0.40095	.	.	ENSG00000128872	ENST00000435126;ENST00000249700;ENST00000539962	T;T;T	0.13538	2.58;2.59;2.59	5.64	-0.654	0.11443	5.64	-0.654	0.11443	.	0.281791	0.34700	N	0.003757	T	0.05640	0.0148	N	0.08118	0	0.30050	N	0.811855	B;B	0.14438	0.01;0.002	B;B	0.20955	0.032;0.009	T	0.26710	-1.0095	10	0.30078	T	0.28	-10.1337	6.8693	0.24111	0.1035:0.2248:0.0:0.6717	.	149;149	Q9NZR1-2;Q9NZR1	.;TMOD2_HUMAN	L	149;149;105	ENSP00000404590:F149L;ENSP00000249700:F149L;ENSP00000437743:F105L	ENSP00000249700:F149L	F	+	3	2	2	TMOD2	49856461	49856461	1.000000	0.71417	0.991000	0.47740	0.824000	0.46624	0.535000	0.23114	-0.247000	0.09597	-1.128000	0.01989	TTC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.413	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2	1	0	1	2	2	2	2	0	0	0	0	77	77	77	77	1	3.530000	-3.221195	1	0.190000			0	22	21	0	391	388	0		1	0		0	0	77	0	0	0.999999	1.226083e-01	0	0	0	11	0	22	391
LRRK1	79705	broad.mit.edu	37	15	101550769	101550769	+	Missense_Mutation	SNP	C	C	A	rs375815703		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr15:101550769C>A	ENST00000388948.3	+	8	1463	c.1104C>A	c.(1102-1104)ttC>ttA	p.F368L	LRRK1_ENST00000284395.5_Missense_Mutation_p.F365L	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AAAAATTGTTCGAAGAAGAAA	0.343																																						ENST00000388948.3	0.800000	0.330000	0.680000	0.420000	0.540000	0.557365	0.540000	0.540000																										0				72						c.(1102-1104)ttC>ttA		leucine-rich repeat kinase 1							59.0	57.0	58.0					15																	101550769		1809	4072	5881	SO:0001583	missense	79705	0	0					g.chr15:101550769C>A	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1104C>A	chr15.hg19:g.101550769C>A	ENSP00000373600:p.Phe368Leu	0					LRRK1_ENST00000284395.5_Missense_Mutation_p.F365L	p.F368L	NM_024652.3	NP_078928.3	1	2	3	1.919646			OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)	8	1463	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)			Missense_Mutation	SNP	ENST00000388948.3	1	0	hg19	c.1104C>A	CCDS42086.1	0	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455231	0.63401	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.18174	2.23;2.23	5.67	-3.74	0.04385	5.67	-3.74	0.04385	.	0.149661	0.47852	D	0.000204	T	0.15089	0.0364	N	0.05351	-0.065	0.42164	D	0.991611	D	0.69078	0.997	P	0.60345	0.873	T	0.00710	-1.1599	10	0.48119	T	0.1	.	13.9495	0.64106	0.0:0.5923:0.0:0.4077	.	368	Q38SD2	LRRK1_HUMAN	L	368;365	ENSP00000373600:F368L;ENSP00000284395:F365L	ENSP00000284395:F365L	F	+	3	2	2	LRRK1	99368292	99368292	0.255000	0.24002	0.915000	0.36163	0.867000	0.49689	-0.694000	0.05115	-0.668000	0.05296	-0.290000	0.09829	TTC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.343	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	3.530000	-3.126996	1	0.190000	NM_024652		0	18	18	0	370	366	0		1	0		0	0	74	0	0	0.999982	7.172799e-03	0	0	0	3	0	18	370
KCTD13	253980	broad.mit.edu	37	16	29937241	29937241	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr16:29937241C>A	ENST00000568000.1	-	1	1115	c.114G>T	c.(112-114)ccG>ccT	p.P38P	KCTD13_ENST00000568721.1_5'UTR|KCTD13_ENST00000561540.1_Silent_p.P38P|CTD-2574D22.2_ENST00000450909.3_RNA	NM_178863.3	NP_849194.1	Q8WZ19	BACD1_HUMAN	potassium channel tetramerization domain containing 13	38					cell migration (GO:0016477)|DNA replication (GO:0006260)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)	GTP-Rho binding (GO:0017049)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	7						ATTTGCTGTTCGGGGTCAGCG	0.687																																						ENST00000568000.1	0.710000	0.220000	0.570000	0.320000	0.430000	0.452170	0.430000	0.420000																										0				7						c.(112-114)ccG>ccT		potassium channel tetramerization domain containing 13							68.0	48.0	55.0					16																	29937241		2197	4300	6497	SO:0001819	synonymous_variant	253980	0	0					g.chr16:29937241C>A	AF289573	CCDS10661.1	16p11.2	2013-06-20	2013-06-20		ENSG00000174943	ENSG00000174943			22234	protein-coding gene	gene with protein product	"""polymerase delta-interacting protein 1"", ""TNFAIP1-like"""	608947	"""potassium channel tetramerisation domain containing 13"""			11593007	Standard	NM_178863		Approved	PDIP1, FKSG86, POLDIP1	uc002duv.4	Q8WZ19	OTTHUMG00000132120	ENST00000568000.1:c.114G>T	chr16.hg19:g.29937241C>A		0					KCTD13_ENST00000561540.1_Silent_p.P38P|CTD-2574D22.2_ENST00000450909.3_RNA|KCTD13_ENST00000568721.1_5'UTR	p.P38P	NM_178863.3	NP_849194.1	1	2	3	1.938267	Q8WZ19	BACD1_HUMAN		1	1115	-			A8K0R5|Q96P93|Q96SA1	Silent	SNP	ENST00000568000.1	1	0	hg19	c.114G>T	CCDS10661.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.687	KCTD13-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255162.2	1	0	0	2	2	2	2	0	0	0	0	57	57	57	56	1	3.530000	-11.947390	1	0.190000	NM_178863		0	11	11	0	290	287	0		1	0		0	0	57	0	0	0.998324	1.338985e-01	0	0	0	16	0	11	290
STX4	6810	broad.mit.edu	37	16	31045573	31045573	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr16:31045573C>A	ENST00000313843.3	+	3	474	c.159C>A	c.(157-159)gtC>gtA	p.V53V	STX4_ENST00000493902.1_3'UTR|STX4_ENST00000394998.1_Silent_p.V51V	NM_004604.3	NP_004595.2	Q12846	STX4_HUMAN	syntaxin 4	53					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|neurotransmitter transport (GO:0006836)|platelet activation (GO:0030168)|post-Golgi vesicle-mediated transport (GO:0006892)|SNARE complex assembly (GO:0035493)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|membrane (GO:0016020)|myelin sheath adaxonal region (GO:0035749)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)				NS(2)|breast(1)|large_intestine(3)|lung(3)	9						AGACTATTGTCAAACTGGGGA	0.592																																						ENST00000313843.3	0.650000	0.320000	0.570000	0.390000	0.470000	0.483606	0.470000	0.480000																										0				9						c.(157-159)gtC>gtA		syntaxin 4							126.0	130.0	128.0					16																	31045573		2197	4300	6497	SO:0001819	synonymous_variant	6810	0	0					g.chr16:31045573C>A	AF026007	CCDS10700.1, CCDS61916.1	16p11.2	2008-02-05	2006-04-25	2006-04-25	ENSG00000103496	ENSG00000103496			11439	protein-coding gene	gene with protein product		186591	"""syntaxin 4A (placental)"""	STX4A		8206394, 16339081	Standard	NM_001272095		Approved	p35-2	uc002eak.4	Q12846	OTTHUMG00000132404	ENST00000313843.3:c.159C>A	chr16.hg19:g.31045573C>A		0					STX4_ENST00000493902.1_3'UTR|STX4_ENST00000394998.1_Silent_p.V51V	p.V53V	NM_004604.3	NP_004595.2	1	2	3	1.938267	Q12846	STX4_HUMAN		3	474	+			A8MXY0|Q15525|Q6FHE8	Silent	SNP	ENST00000313843.3	1	0	hg19	c.159C>A	CCDS10700.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.592	STX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255538.3	1	0	0	2	2	2	2	0	0	0	0	148	148	148	146	1	3.530000	-4.124451	1	0.190000	NM_004604		0	30	29	0	704	699	0		1	0		0	0	148	0	0	1.000000	9.797247e-01	0	0	0	147	0	30	704
HYDIN	54768	broad.mit.edu	37	16	70843895	70843895	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr16:70843895C>A	ENST00000393567.2	-	85	14824	c.14674G>T	c.(14674-14676)Gaa>Taa	p.E4892*		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4892					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGCTGAAATTCAAATGAGAAC	0.483																																						ENST00000393567.2	0.550000	0.260000	0.480000	0.320000	0.390000	0.407838	0.390000	0.390000																										0				43						c.(14674-14676)Gaa>Taa		HYDIN, axonemal central pair apparatus protein							188.0	194.0	192.0					16																	70843895		1938	4135	6073	SO:0001587	stop_gained	54768	0	0					g.chr16:70843895C>A	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.14674G>T	chr16.hg19:g.70843895C>A	ENSP00000377197:p.Glu4892*	0						p.E4892*	NM_001270974.1	NP_001257903.1	1	2	3	1.939292	Q4G0P3	HYDIN_HUMAN		85	14824	-		Ovarian(137;0.0654)	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Nonsense_Mutation	SNP	ENST00000393567.2	0	1	hg19	c.14674G>T	CCDS59269.1	0	.	.	.	.	.	.	.	.	.	.	C	56	26.157347	0.99968	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	.	.	.	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.31797	U	0.007056	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	20.2585	0.98435	0.0:1.0:0.0:0.0	.	.	.	.	X	4892;4891	.	ENSP00000313052:E4891X	E	-	1	0	0	HYDIN	69401396	69401396	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.302000	0.78861	2.894000	0.99253	0.655000	0.94253	GAA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3	0	0	1	2	2	2	2	0	0	0	0	237	237	237	235	1	3.530000	-3.035857	1	0.190000			0	29	29	0	814	806	0		1	0		0	0	237	0	0	1.000000	7.401087e-03	0	0	0	4	0	29	814
SLC5A10	125206	broad.mit.edu	37	17	18872442	18872442	+	Silent	SNP	C	C	A	rs201314485		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:18872442C>A	ENST00000395645.3	+	6	549	c.531C>A	c.(529-531)ctC>ctA	p.L177L	SLC5A10_ENST00000417251.2_Silent_p.L177L|SLC5A10_ENST00000395643.2_Silent_p.L177L|SLC5A10_ENST00000395642.1_Silent_p.L121L|SLC5A10_ENST00000395647.2_Silent_p.L177L|SLC5A10_ENST00000317977.6_Silent_p.L121L|FAM83G_ENST00000388995.6_3'UTR	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	177					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						TCCTCACGCTCGGCATCACAG	0.622																																						ENST00000395645.3	1.000000	0.430000	0.920000	0.570000	0.730000	0.742269	0.730000	1.000000																										0				24						c.(529-531)ctC>ctA		solute carrier family 5 (sodium/sugar cotransporter), member 10							138.0	104.0	115.0					17																	18872442		2203	4300	6503	SO:0001819	synonymous_variant	125206	0	0					g.chr17:18872442C>A		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.531C>A	chr17.hg19:g.18872442C>A		1					SLC5A10_ENST00000395642.1_Silent_p.L121L|SLC5A10_ENST00000395643.2_Silent_p.L177L|FAM83G_ENST00000388995.6_3'UTR|SLC5A10_ENST00000317977.6_Silent_p.L121L|SLC5A10_ENST00000417251.2_Silent_p.L177L|SLC5A10_ENST00000395647.2_Silent_p.L177L	p.L177L	NM_001042450.2	NP_001035915.1	0	2	2	1.782824	A0PJK1	SC5AA_HUMAN		6	549	+			A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Silent	SNP	ENST00000395645.3	1	0	hg19	c.531C>A	CCDS42275.1	0																																																																																								0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.622	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132129.2	1	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	3.530000	-2.966721	1	0.190000	NM_152351		0	16	16	0	216	214	0		1	0		0	0	47	0	0	0.999938	9.331962e-01	0	0	0	65	0	16	216
FLOT2	2319	broad.mit.edu	37	17	27208342	27208342	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:27208342G>T	ENST00000394908.4	-	9	1070	c.966C>A	c.(964-966)atC>atA	p.I322I	FLOT2_ENST00000585169.1_Silent_p.I322I|FLOT2_ENST00000577789.1_5'UTR|FLOT2_ENST00000394906.2_Silent_p.I377I	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	322					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CCGCCTCCCCGATTTTGCGGA	0.612																																						ENST00000394908.4	0.870000	0.360000	0.730000	0.460000	0.580000	0.601563	0.580000	0.570000																										0				11						c.(964-966)atC>atA		flotillin 2							72.0	73.0	73.0					17																	27208342		2051	4191	6242	SO:0001819	synonymous_variant	2319	0	0					g.chr17:27208342G>T	M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.966C>A	chr17.hg19:g.27208342G>T		0					FLOT2_ENST00000394906.2_Silent_p.I377I|FLOT2_ENST00000577789.1_5'UTR|FLOT2_ENST00000585169.1_Silent_p.I322I	p.I322I	NM_004475.2	NP_004466.2	1	2	3	1.946416	Q14254	FLOT2_HUMAN	Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)	9	1070	-	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)			Silent	SNP	ENST00000394908.4	1	0	hg19	c.966C>A	CCDS11245.2	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.612	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255935.3	1	0	1	2	2	2	2	0	0	0	0	91	91	91	90	1	3.530000	-2.917909	1	0.190000	NM_004475		0	18	18	0	341	336	0		1	0		0	0	91	0	0	0.999981	9.996707e-01	0	0	0	250	0	18	341
CDC6	990	broad.mit.edu	37	17	38451686	38451686	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:38451686C>A	ENST00000209728.4	+	8	1633	c.1162C>A	c.(1162-1164)Cgc>Agc	p.R388S		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	388					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						AGGAGATGTTCGCAAAGCACT	0.393																																						ENST00000209728.4	0.630000	0.290000	0.540000	0.360000	0.440000	0.455544	0.440000	0.450000																										0				21						c.(1162-1164)Cgc>Agc		cell division cycle 6							207.0	186.0	193.0					17																	38451686		2203	4300	6503	SO:0001583	missense	990	0	0					g.chr17:38451686C>A	U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.1162C>A	chr17.hg19:g.38451686C>A	ENSP00000209728:p.Arg388Ser	0						p.R388S	NM_001254.3	NP_001245.1	1	2	3	1.938332	Q99741	CDC6_HUMAN		8	1633	+			Q8TB30	Missense_Mutation	SNP	ENST00000209728.4	1	0	hg19	c.1162C>A	CCDS11365.1	0	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039774	0.75732	.	.	ENSG00000094804	ENST00000209728	T	0.64438	-0.1	5.97	5.97	0.96955	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.87055	0.6082	H	0.96943	3.91	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.90538	0.4500	10	0.87932	D	0	-1.1769	19.185	0.93639	0.0:1.0:0.0:0.0	.	388	Q99741	CDC6_HUMAN	S	388	ENSP00000209728:R388S	ENSP00000209728:R388S	R	+	1	0	0	CDC6	35705212	35705212	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.941000	0.56607	2.835000	0.97688	0.591000	0.81541	CGC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257129.1	1	0	1	2	2	2	2	0	0	0	0	128	128	128	126	1	3.530000	-2.885708	1	0.190000			0	25	25	0	628	612	0		1	0		0	0	128	0	0	1.000000	1.059033e-01	0	0	0	14	0	25	628
KRT27	342574	broad.mit.edu	37	17	38938439	38938439	+	Silent	SNP	G	G	T	rs376178361		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:38938439G>T	ENST00000301656.3	-	1	347	c.307C>A	c.(307-309)Cga>Aga	p.R103R		NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TCTAGGGCTCGAACATTCTCC	0.542																																						ENST00000301656.3	0.690000	0.310000	0.590000	0.390000	0.480000	0.495877	0.480000	0.480000																										0				21						c.(307-309)Cga>Aga		keratin 27							160.0	142.0	148.0					17																	38938439		2203	4300	6503	SO:0001819	synonymous_variant	342574	0	0					g.chr17:38938439G>T	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.307C>A	chr17.hg19:g.38938439G>T		0						p.R103R	NM_181537.3	NP_853515.2	1	2	3	1.938332				1	347	-		Breast(137;0.000812)		Silent	SNP	ENST00000301656.3	1	0	hg19	c.307C>A	CCDS11375.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.542	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	1	0	1	2	2	2	2	0	0	0	0	155	155	155	153	1	3.530000	-3.034940	1	0.190000	NM_181537		0	23	22	0	530	523	0		1			0	0	155	0	0	0.999999	0	0	0	0	0	0	23	530
KRTAP9-9	81870	broad.mit.edu	37	17	39412064	39412064	+	Missense_Mutation	SNP	G	G	A	rs374673591	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:39412064G>A	ENST00000394008.1	+	1	429	c.427G>A	c.(427-429)Gcc>Acc	p.A143T		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	128	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CTGCCGCCCCGCCTGCTGTGA	0.612													.|||	2	0.000399361	0.0008	0.0	5008	,	,		19347	0.0		0.001	False		,,,				2504	0.0					ENST00000394008.1	1.000000	0.750000	1.000000	0.850000	0.960000	0.940455	0.960000	1.000000																										0				6						c.(427-429)Gcc>Acc		keratin associated protein 9-9		G	THR/ALA	0,4406		0,0,2203	153.0	161.0	158.0		427	-2.5	0.0	17		158	1,8599		0,1,4299	no	missense	KRTAP9-9	NM_030975.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	143/170	39412064	1,13005	2203	4300	6503	SO:0001583	missense	81870	9	121412	46				g.chr17:39412064G>A	AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.427G>A	chr17.hg19:g.39412064G>A	ENSP00000377576:p.Ala143Thr	0						p.A143T	NM_030975.2	NP_112237.2	1	2	3	1.938332	Q9BYP9	KRA99_HUMAN	STAD - Stomach adenocarcinoma(17;0.000397)	1	429	+		Breast(137;0.000496)	B5MDD6|Q9BYQ1	Missense_Mutation	SNP	ENST00000394008.1	1	1	hg19	c.427G>A	CCDS54127.1	1	.	.	.	.	.	.	.	.	.	.	.	14.35	2.507999	0.44558	0.0	1.16E-4	ENSG00000198083	ENST00000431129;ENST00000394008	T	0.01295	5.04	2.85	-2.54	0.06307	2.85	-2.54	0.06307	.	.	.	.	.	T	0.00524	0.0017	N	0.00879	-1.12	0.09310	N	1	B	0.17268	0.021	B	0.08055	0.003	T	0.44982	-0.9292	9	0.37606	T	0.19	.	3.7095	0.08414	0.5122:0.0:0.3091:0.1786	.	128	Q9BYP9	KRA99_HUMAN	T	149;143	ENSP00000377576:A143T	ENSP00000377576:A143T	A	+	1	0	0	KRTAP9-9	36665590	36665590	0.000000	0.05858	0.000000	0.03702	0.448000	0.32197	-1.026000	0.03596	-0.748000	0.04753	0.205000	0.17691	GCC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.612	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257710.1	0	0	0	2	12	2	2	1	1	1	1	232	232	232	234	1	3.530000	-14.632700	1	0.190000	NM_030975		0	62	61	0	676	660	0		1			1	0	232	0	0	1.000000	0	0	0	0	0	0	62	676
MPP3	4356	broad.mit.edu	37	17	41886383	41886383	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:41886383G>T	ENST00000398389.4	-	19	1687	c.1522C>A	c.(1522-1524)Cag>Aag	p.Q508K	MPP3_ENST00000398393.1_Missense_Mutation_p.Q533K	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	508	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CTTTTTTCCTGAATTGCAGGC	0.378																																						ENST00000398389.4	0.430000	0.150000	0.350000	0.210000	0.270000	0.286426	0.270000	0.270000																										0				26						c.(1522-1524)Cag>Aag		membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)							131.0	129.0	130.0					17																	41886383		1813	4072	5885	SO:0001583	missense	4356	0	0					g.chr17:41886383G>T		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1522C>A	chr17.hg19:g.41886383G>T	ENSP00000381425:p.Gln508Lys	0					MPP3_ENST00000398393.1_Missense_Mutation_p.Q533K	p.Q508K	NM_001932.4	NP_001923.2	1	2	3	1.938332	Q13368	MPP3_HUMAN		19	1687	-		Breast(137;0.00394)	B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Missense_Mutation	SNP	ENST00000398389.4	0	1	hg19	c.1522C>A	CCDS42344.1	0	.	.	.	.	.	.	.	.	.	.	G	8.912	0.959001	0.18507	.	.	ENSG00000161647	ENST00000398393;ENST00000398389	T;T	0.15603	2.41;2.41	5.36	5.36	0.76844	5.36	5.36	0.76844	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.278923	0.35291	N	0.003309	T	0.10937	0.0267	N	0.12471	0.22	0.29701	N	0.840156	B;B	0.18741	0.03;0.03	B;B	0.29440	0.071;0.102	T	0.13737	-1.0498	10	0.25751	T	0.34	.	11.4234	0.49996	0.0828:0.0:0.9172:0.0	.	508;533	Q13368;D3DX46	MPP3_HUMAN;.	K	533;508	ENSP00000381430:Q533K;ENSP00000381425:Q508K	ENSP00000381425:Q508K	Q	-	1	0	0	MPP3	39241909	39241909	0.999000	0.42202	0.988000	0.46212	0.988000	0.76386	3.512000	0.53407	2.782000	0.95742	0.655000	0.94253	CAG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.378	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	0	0	1	2	2	2	2	0	0	0	0	125	125	125	124	1	3.530000	-2.812601	1	0.190000	NM_001932		0	15	15	0	624	617	0		1	0		0	0	125	0	0	0.999863	9.014341e-02	0	0	0	20	0	15	624
MSI2	124540	broad.mit.edu	37	17	55339540	55339540	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:55339540G>T	ENST00000284073.2	+	5	508	c.299G>T	c.(298-300)cGa>cTa	p.R100L	MSI2_ENST00000322684.3_Missense_Mutation_p.R96L|MSI2_ENST00000416426.2_Missense_Mutation_p.R78L	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	100	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)	p.R96Q(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		TTTCCTCGTCGAGCGCAACCC	0.363			T	HOXA9	CML																																	ENST00000284073.2	0.720000	0.330000	0.620000	0.410000	0.510000	0.525888	0.510000	0.510000				Dom	yes			Dom	yes		17	17q23.2	17q23.2	124540	T	musashi homolog 2 (Drosophila)				L	L	HOXA9		CML		1	Substitution - Missense(1)	p.R96Q(1)	large_intestine(1)	7						c.(298-300)cGa>cTa		musashi RNA-binding protein 2							105.0	99.0	101.0					17																	55339540		2203	4300	6503	SO:0001583	missense	124540	0	0					g.chr17:55339540G>T	BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.299G>T	chr17.hg19:g.55339540G>T	ENSP00000284073:p.Arg100Leu	0					MSI2_ENST00000416426.2_Missense_Mutation_p.R78L|MSI2_ENST00000322684.3_Missense_Mutation_p.R96L	p.R100L	NM_138962.2	NP_620412.1	1	2	3	1.941427	Q96DH6	MSI2H_HUMAN		5	508	+	Breast(9;1.78e-08)		Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	ENST00000284073.2	1	0	hg19	c.299G>T	CCDS11596.1	0	.	.	.	.	.	.	.	.	.	.	G	16.99	3.275249	0.59649	.	.	ENSG00000153944	ENST00000416426;ENST00000284073;ENST00000322684	D;D;D	0.85702	-2.02;-2.02;-2.02	5.95	5.95	0.96441	5.95	5.95	0.96441	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.178825	0.34725	N	0.003737	D	0.89983	0.6873	L	0.39514	1.22	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.91635	0.968;0.999;0.983	D	0.90033	0.4136	10	0.66056	D	0.02	.	19.3906	0.94581	0.0:0.0:1.0:0.0	.	78;96;100	B4DHE8;Q96DH6-2;Q96DH6	.;.;MSI2H_HUMAN	L	78;100;96	ENSP00000414671:R78L;ENSP00000284073:R100L;ENSP00000313616:R96L	ENSP00000284073:R100L	R	+	2	0	0	MSI2	52694539	52694539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.454000	0.90352	2.827000	0.97445	0.650000	0.86243	CGA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.363	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1	1	0	1	2	2	2	2	0	0	0	0	111	111	111	109	1	3.530000	-2.873120	1	0.190000			0	25	22	0	540	524	0		1	0		0	0	111	0	0	1.000000	6.051497e-01	0	0	0	45	0	25	540
HEATR6	63897	broad.mit.edu	37	17	58125680	58125680	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:58125680G>T	ENST00000184956.6	-	17	2633	c.2617C>A	c.(2617-2619)Cga>Aga	p.R873R	HEATR6_ENST00000585976.1_Silent_p.R761R	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	873							poly(A) RNA binding (GO:0044822)	p.R873*(1)		NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GCTTTGGCTCGAACATTCAGA	0.453																																						ENST00000184956.6	1.000000	0.390000	0.860000	0.520000	0.670000	0.694429	0.670000	1.000000																										1	Substitution - Nonsense(1)	p.R873*(1)	large_intestine(1)	44						c.(2617-2619)Cga>Aga		HEAT repeat containing 6							144.0	100.0	115.0					17																	58125680		2203	4300	6503	SO:0001819	synonymous_variant	63897	0	0					g.chr17:58125680G>T	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.2617C>A	chr17.hg19:g.58125680G>T		0					HEATR6_ENST00000585976.1_Silent_p.R761R	p.R873R	NM_022070.4	NP_071353.4	1	2	3	1.941427	Q6AI08	HEAT6_HUMAN	BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)	17	2633	-	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Silent	SNP	ENST00000184956.6	1	0	hg19	c.2617C>A	CCDS11623.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.453	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	3.530000	-3.078274	1	0.190000	NM_022070		0	15	15	0	244	237	0		1	0		0	0	68	0	0	0.999859	3.685742e-01	0	0	0	21	0	15	244
HEATR6	63897	broad.mit.edu	37	17	58136792	58136792	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:58136792G>T	ENST00000184956.6	-	11	1730	c.1714C>A	c.(1714-1716)Cgc>Agc	p.R572S	HEATR6_ENST00000585976.1_Missense_Mutation_p.R572S	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	572							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			CCTTTGTGGCGAATATAAGGC	0.348																																						ENST00000184956.6	0.640000	0.210000	0.520000	0.290000	0.390000	0.415218	0.390000	0.390000																										0				44						c.(1714-1716)Cgc>Agc		HEAT repeat containing 6							108.0	99.0	102.0					17																	58136792		2203	4300	6503	SO:0001583	missense	63897	0	0					g.chr17:58136792G>T	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.1714C>A	chr17.hg19:g.58136792G>T	ENSP00000184956:p.Arg572Ser	0					HEATR6_ENST00000585976.1_Missense_Mutation_p.R572S	p.R572S	NM_022070.4	NP_071353.4	1	2	3	1.941427	Q6AI08	HEAT6_HUMAN	BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)	11	1730	-	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	1	0	hg19	c.1714C>A	CCDS11623.1	0	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334590	0.60853	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.62788	-0.0	5.62	4.65	0.58169	5.62	4.65	0.58169	Armadillo-like helical (1);Armadillo-type fold (1);	0.149427	0.64402	D	0.000008	T	0.45597	0.1350	L	0.39020	1.185	0.45883	D	0.998739	B;B	0.34241	0.088;0.444	B;B	0.29176	0.099;0.097	T	0.34576	-0.9823	10	0.12430	T	0.62	-3.339	10.4854	0.44719	0.1647:0.0:0.8353:0.0	.	419;572	E7ESB9;Q6AI08	.;HEAT6_HUMAN	S	572;419	ENSP00000184956:R572S	ENSP00000184956:R572S	R	-	1	0	0	HEATR6	55491574	55491574	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.291000	0.59025	1.532000	0.49169	0.585000	0.79938	CGC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	3.530000	-2.918380	1	0.190000	NM_022070		0	12	12	0	344	342	0		1	0		0	0	64	0	0	0.999124	1.283188e-01	0	0	0	17	0	12	344
ABCA9	10350	broad.mit.edu	37	17	67016572	67016572	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:67016572G>T	ENST00000340001.4	-	19	2768	c.2557C>A	c.(2557-2559)Cgc>Agc	p.R853S	ABCA9_ENST00000453985.2_Missense_Mutation_p.R853S|ABCA9_ENST00000370732.2_Missense_Mutation_p.R853S|ABCA9-AS1_ENST00000458677.1_RNA	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	853					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TTTAGGAAGCGAACTTTTGCT	0.398																																						ENST00000340001.4	0.750000	0.350000	0.650000	0.440000	0.530000	0.549002	0.530000	0.540000																										0				91						c.(2557-2559)Cgc>Agc		ATP-binding cassette, sub-family A (ABC1), member 9							89.0	89.0	89.0					17																	67016572		2203	4300	6503	SO:0001583	missense	10350	0	0					g.chr17:67016572G>T	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2557C>A	chr17.hg19:g.67016572G>T	ENSP00000342216:p.Arg853Ser	0					ABCA9_ENST00000370732.2_Missense_Mutation_p.R853S|ABCA9_ENST00000453985.2_Missense_Mutation_p.R853S|ABCA9-AS1_ENST00000458677.1_RNA	p.R853S	NM_080283.3	NP_525022.2	1	2	3	1.941427	Q8IUA7	ABCA9_HUMAN		19	2768	-	Breast(10;1.47e-12)		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	1	0	hg19	c.2557C>A	CCDS11681.1	0	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673732	0.88445	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	T;T	0.79653	-1.29;-1.29	5.08	5.08	0.68730	5.08	5.08	0.68730	.	0.000000	0.46442	D	0.000283	D	0.90007	0.6880	M	0.80982	2.52	0.40094	D	0.97629	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.973	D	0.91683	0.5360	10	0.87932	D	0	.	17.3792	0.87400	0.0:0.0:1.0:0.0	.	853;853	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	S	853;836;853;848	ENSP00000342216:R853S;ENSP00000359767:R853S	ENSP00000342216:R853S	R	-	1	0	0	ABCA9	64528167	64528167	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.216000	0.77974	2.525000	0.85131	0.543000	0.68304	CGC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.398	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	1	0	1	2	2	2	2	0	0	0	0	100	100	100	99	1	3.530000	-3.305096	1	0.190000	NM_172386		0	26	26	0	536	530	0		1	0		0	0	100	0	0	1.000000	6.850329e-03	0	0	0	3	0	26	536
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.998512	0.990000	1.000000	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	24185	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343	c.(817-819)Cgt>Tgt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						65.0	56.0	59.0					17																	7577121		2203	4300	6503	SO:0001583	missense	7157	1	121412	37	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577121G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	chr17.hg19:g.7577121G>A	ENSP00000269305:p.Arg273Cys	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron	p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.764039	P04637	P53_HUMAN		8	1006	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.817C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	0	TP53	7517846	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	3.530000	-20.000000	1	0.190000	NM_000546		0	18	16	0	94	89	1		1	1	1	0	0	24	930	0	0.999981	9.983940e-01	1	13	142	46	668	18	94
ST6GALNAC1	55808	broad.mit.edu	37	17	74625340	74625340	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr17:74625340G>T	ENST00000156626.7	-	2	784	c.585C>A	c.(583-585)ctC>ctA	p.L195L	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	195					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						TTTTGGGAATGAGCGTCTTGG	0.572																																						ENST00000156626.7	0.700000	0.340000	0.600000	0.410000	0.500000	0.515155	0.500000	0.510000																										0				22						c.(583-585)ctC>ctA		ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1							180.0	154.0	163.0					17																	74625340		2203	4300	6503	SO:0001819	synonymous_variant	55808	0	0					g.chr17:74625340G>T	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.585C>A	chr17.hg19:g.74625340G>T		0					ST6GALNAC1_ENST00000590878.1_5'UTR	p.L195L	NM_018414.3	NP_060884.1	1	2	3	1.941427	Q9NSC7	SIA7A_HUMAN		2	784	-			Q6UW90|Q9NSC6	Silent	SNP	ENST00000156626.7	1	0	hg19	c.585C>A	CCDS11748.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.572	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	1	0	0	2	2	2	2	0	0	0	0	152	152	152	151	1	3.530000	-4.159221	1	0.190000	NM_018414		0	28	28	0	616	609	0		1	0		0	0	152	0	0	1.000000	8.605182e-02	0	0	0	11	0	28	616
CDH2	1000	broad.mit.edu	37	18	25570308	25570308	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr18:25570308C>A	ENST00000269141.3	-	10	1774	c.1351G>T	c.(1351-1353)Gac>Tac	p.D451Y	CDH2_ENST00000399380.3_Missense_Mutation_p.D420Y	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	451	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTTTCAAAGTCGATTGGCTGG	0.393																																						ENST00000269141.3	1.000000	0.300000	1.000000	0.400000	0.550000	0.631141	0.550000	0.490000																										0				82						c.(1351-1353)Gac>Tac		cadherin 2, type 1, N-cadherin (neuronal)							55.0	56.0	56.0					18																	25570308		2203	4300	6503	SO:0001583	missense	1000	0	0					g.chr18:25570308C>A	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1351G>T	chr18.hg19:g.25570308C>A	ENSP00000269141:p.Asp451Tyr	1					CDH2_ENST00000399380.3_Missense_Mutation_p.D420Y	p.D451Y	NM_001792.3	NP_001783.2	2	2	4	1.864403	P19022	CADH2_HUMAN		10	1774	-			A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	1	0	hg19	c.1351G>T	CCDS11891.1	0	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555450	0.65425	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.65549	-0.16;-0.16	6.16	6.16	0.99307	6.16	6.16	0.99307	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.80369	0.4610	H	0.98005	4.125	0.80722	D	1	P;P	0.42649	0.786;0.72	B;B	0.41332	0.354;0.185	D	0.86547	0.1832	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	420;451	A8MWK3;P19022	.;CADH2_HUMAN	Y	451;420	ENSP00000269141:D451Y;ENSP00000382312:D420Y	ENSP00000269141:D451Y	D	-	1	0	0	CDH2	23824306	23824306	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	GAC	0.244544		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	1	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	3.530000	-15.252200	1	0.190000	NM_001792		0	14	13	0	305	299	0		1	0		0	0	64	0	0	0.999732	4.371911e-01	0	0	0	32	0	14	305
ZNF442	79973	broad.mit.edu	37	19	12461420	12461420	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:12461420C>A	ENST00000242804.4	-	6	1561	c.979G>T	c.(979-981)Ggg>Tgg	p.G327W	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Missense_Mutation_p.G258W	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						AATGCTTTCCCGCATTGCTTG	0.418																																						ENST00000242804.4	1.000000	0.050000	0.210000	0.080000	0.120000	0.246784	0.120000	0.110000																										0				31						c.(979-981)Ggg>Tgg		zinc finger protein 442							211.0	204.0	206.0					19																	12461420		2203	4300	6503	SO:0001583	missense	79973	0	0					g.chr19:12461420C>A	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.979G>T	chr19.hg19:g.12461420C>A	ENSP00000242804:p.Gly327Trp	0					CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Missense_Mutation_p.G258W	p.G327W	NM_030824.2	NP_110451.1	1	2	3	1.790940	Q9H7R0	ZN442_HUMAN		6	1561	-			B4DJ48	Missense_Mutation	SNP	ENST00000242804.4	0	1	hg19	c.979G>T	CCDS12271.1	0	.	.	.	.	.	.	.	.	.	.	C	13.91	2.379391	0.42207	.	.	ENSG00000198342	ENST00000242804;ENST00000438182	T;T	0.01051	5.4;5.4	0.832	-0.357	0.12579	0.832	-0.357	0.12579	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08358	0.0208	H	0.96080	3.765	0.34524	D	0.708446	D	0.89917	1.0	D	0.97110	1.0	T	0.05131	-1.0904	9	0.87932	D	0	.	5.1771	0.15141	0.0:0.7619:0.0:0.2381	.	327	Q9H7R0	ZN442_HUMAN	W	327;258	ENSP00000242804:G327W;ENSP00000388634:G258W	ENSP00000242804:G327W	G	-	1	0	0	ZNF442	12322420	12322420	0.009000	0.17119	0.000000	0.03702	0.227000	0.25037	0.946000	0.29069	-0.077000	0.12752	0.313000	0.20887	GGG	0.203618		TCGA-XN-A8T3-01A-11D-A36O-08	0.418	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	0	0	1	2	2	2	2	0	0	0	0	317	317	317	317	1	3.530000	-1.642139	0	0.190000	NM_030824		0	11	11	0	1010	996	0		1	0		0	0	317	0	0	0.998185	8.756327e-04	0	0	0	4	0	11	1010
ZNF14	7561	broad.mit.edu	37	19	19824904	19824904	+	Silent	SNP	G	G	T	rs573777738		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:19824904G>T	ENST00000344099.3	-	3	325	c.187C>A	c.(187-189)Cga>Aga	p.R63R		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	63	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R63*(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				ACTCACCTTCGATTTTTCCCC	0.368																																						ENST00000344099.3	1.000000	0.280000	0.650000	0.360000	0.460000	0.530255	0.460000	0.430000																										1	Substitution - Nonsense(1)	p.R63*(1)	large_intestine(1)	32						c.(187-189)Cga>Aga		zinc finger protein 14							111.0	103.0	105.0					19																	19824904		2203	4300	6503	SO:0001819	synonymous_variant	7561	0	0					g.chr19:19824904G>T	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.187C>A	chr19.hg19:g.19824904G>T		0						p.R63R	NM_021030.2	NP_066358.2	1	2	3	1.790940	P17017	ZNF14_HUMAN		3	325	-		Renal(1328;0.0474)	B9EGA4|Q9ULZ5	Silent	SNP	ENST00000344099.3	1	0	hg19	c.187C>A	CCDS12409.1	0																																																																																								0.203618		TCGA-XN-A8T3-01A-11D-A36O-08	0.368	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	1	0	1	2	2	2	2	0	0	0	0	109	109	109	106	1	3.530000	-2.884132	1	0.190000	NM_021030		0	22	20	0	514	509	0		1	0		0	0	109	0	0	0.999999	7.944101e-02	0	0	0	11	0	22	514
ZNF461	92283	broad.mit.edu	37	19	37130742	37130742	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:37130742G>T	ENST00000588268.1	-	6	732	c.505C>A	c.(505-507)Cat>Aat	p.H169N	ZNF461_ENST00000360357.4_Missense_Mutation_p.H146N|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ATGTTTTCATGGTTAATCATA	0.358																																						ENST00000588268.1	1.000000	0.100000	0.260000	0.140000	0.190000	0.225330	0.190000	0.200000																										0				29						c.(505-507)Cat>Aat		zinc finger protein 461							238.0	228.0	231.0					19																	37130742		1842	4102	5944	SO:0001583	missense	92283	0	0					g.chr19:37130742G>T	BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.505C>A	chr19.hg19:g.37130742G>T	ENSP00000467931:p.His169Asn	1					ZNF461_ENST00000540605.2_5'UTR|ZNF461_ENST00000360357.4_Missense_Mutation_p.H146N	p.H169N	NM_153257.2	NP_694989.2	2	3	5	2.226927	Q8TAF7	ZN461_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)	6	732	-	Esophageal squamous(110;0.198)		A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	ENST00000588268.1	0	1	hg19	c.505C>A	CCDS54257.1	0	.	.	.	.	.	.	.	.	.	.	G	0.120	-1.127098	0.01770	.	.	ENSG00000197808	ENST00000396893;ENST00000360357;ENST00000540605;ENST00000396892	T	0.05855	3.38	3.87	0.209	0.15226	3.87	0.209	0.15226	.	.	.	.	.	T	0.04679	0.0127	L	0.39898	1.24	0.09310	N	1	B;B;B	0.13145	0.004;0.007;0.007	B;B;B	0.08055	0.002;0.003;0.003	T	0.45056	-0.9287	9	0.19590	T	0.45	.	3.5785	0.07943	0.2434:0.2122:0.5444:0.0	.	146;91;169	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	N	169;146;42;104	ENSP00000353515:H146N	ENSP00000353515:H146N	H	-	1	0	0	ZNF461	41822582	41822582	0.004000	0.15560	0.001000	0.08648	0.041000	0.13682	0.721000	0.25911	0.399000	0.25367	-0.150000	0.13652	CAT	0.364008		TCGA-XN-A8T3-01A-11D-A36O-08	0.358	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453202.1	0	0	1	2	2	2	2	0	0	0	0	183	183	183	182	1	3.530000	-1.891827	0	0.190000	NM_153257		0	14	14	0	976	964	0		1	0		0	0	183	0	0	0.999728	2.436410e-04	0	0	0	2	0	14	976
DLL3	10683	broad.mit.edu	37	19	39998549	39998549	+	Silent	SNP	C	C	A	rs371433358		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:39998549C>A	ENST00000205143.4	+	8	1760	c.1753C>A	c.(1753-1755)Cgg>Agg	p.R585R	DLL3_ENST00000356433.5_Silent_p.R585R	NM_016941.3	NP_058637.1	Q9NYJ7	DLL3_HUMAN	delta-like 3 (Drosophila)	585					compartment pattern specification (GO:0007386)|negative regulation of neurogenesis (GO:0050768)|Notch signaling pathway (GO:0007219)|paraxial mesoderm development (GO:0048339)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)	integral component of membrane (GO:0016021)	Notch binding (GO:0005112)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)	19	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CATCTACGCTCGGGAGGTAGC	0.562																																						ENST00000205143.4	1.000000	0.370000	0.800000	0.490000	0.620000	0.645314	0.620000	0.590000																										0				19						c.(1753-1755)Cgg>Agg		delta-like 3 (Drosophila)							81.0	67.0	72.0					19																	39998549		2203	4300	6503	SO:0001819	synonymous_variant	10683	0	0					g.chr19:39998549C>A	AF241373	CCDS12537.1, CCDS12538.1	19q13.2	2008-05-14	2001-12-03			ENSG00000090932			2909	protein-coding gene	gene with protein product		602768	"""delta (Drosophila)-like 3"""			10364530, 10742114	Standard	NM_203486		Approved	SCDO1	uc002olx.2	Q9NYJ7		ENST00000205143.4:c.1753C>A	chr19.hg19:g.39998549C>A		1					DLL3_ENST00000356433.5_Silent_p.R585R	p.R585R	NM_016941.3	NP_058637.1	2	3	5	2.226927	Q9NYJ7	DLL3_HUMAN	Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)	8	1760	+	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		E9PFG2|Q8NBS4	Silent	SNP	ENST00000205143.4	1	0	hg19	c.1753C>A	CCDS12538.1	0																																																																																								0.364008		TCGA-XN-A8T3-01A-11D-A36O-08	0.562	DLL3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464958.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	3.530000	-3.090621	1	0.190000			0	18	16	0	379	374	0		1	0		0	0	75	0	0	0.999980	2.141656e-02	0	0	0	5	0	18	379
PPFIA3	8541	broad.mit.edu	37	19	49651448	49651448	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:49651448C>A	ENST00000334186.4	+	24	3293	c.2944C>A	c.(2944-2946)Cga>Aga	p.R982R	PPFIA3_ENST00000602351.1_Silent_p.R973R	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	982	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		GGTGGACGCTCGAATGTTAGA	0.592																																						ENST00000334186.4	1.000000	0.410000	1.000000	0.550000	0.740000	0.762736	0.740000	1.000000																										0				35						c.(2944-2946)Cga>Aga		protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3							58.0	57.0	57.0					19																	49651448		2203	4300	6503	SO:0001819	synonymous_variant	8541	0	0					g.chr19:49651448C>A	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.2944C>A	chr19.hg19:g.49651448C>A		1					PPFIA3_ENST00000602351.1_Silent_p.R973R	p.R982R	NM_003660.2	NP_003651.1	3	4	7	2.294134	O75145	LIPA3_HUMAN		24	3293	+		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Silent	SNP	ENST00000334186.4	1	0	hg19	c.2944C>A	CCDS12758.1	0																																																																																								0.385549		TCGA-XN-A8T3-01A-11D-A36O-08	0.592	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	3.530000	-2.933436	1	0.190000	NM_003660		0	15	15	0	297	294	0		1	0		0	0	62	0	0	0.999869	3.477715e-02	0	0	0	6	0	15	297
MYADM	91663	broad.mit.edu	37	19	54377360	54377360	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:54377360G>T	ENST00000391769.2	+	3	857	c.577G>T	c.(577-579)Gac>Tac	p.D193Y	MYADM_ENST00000391768.2_Missense_Mutation_p.D193Y|MYADM_ENST00000391771.1_Missense_Mutation_p.D193Y|MYADM_ENST00000391770.4_Missense_Mutation_p.D193Y|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000336967.3_Missense_Mutation_p.D193Y	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	193	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		GTTCATCAGCGACCCCAACCT	0.642																																						ENST00000391769.2	1.000000	0.430000	1.000000	0.520000	0.650000	0.707564	0.650000	0.600000																										0				12						c.(577-579)Gac>Tac		myeloid-associated differentiation marker							163.0	136.0	145.0					19																	54377360		2203	4300	6503	SO:0001583	missense	91663	0	0					g.chr19:54377360G>T	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.577G>T	chr19.hg19:g.54377360G>T	ENSP00000375649:p.Asp193Tyr	1					MYADM_ENST00000336967.3_Missense_Mutation_p.D193Y|MYADM_ENST00000391771.1_Missense_Mutation_p.D193Y|MYADM_ENST00000391770.4_Missense_Mutation_p.D193Y|MYADM_ENST00000391768.2_Missense_Mutation_p.D193Y|AC008440.5_ENST00000413496.2_RNA	p.D193Y	NM_001020821.1	NP_001018657.1	3	4	7	2.294134	Q96S97	MYADM_HUMAN		3	857	+	Ovarian(34;0.19)		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	ENST00000391769.2	1	0	hg19	c.577G>T	CCDS12866.1	0	.	.	.	.	.	.	.	.	.	.	G	3.909	-0.020465	0.07634	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82;1.82	4.21	-5.25	0.02781	4.21	-5.25	0.02781	Marvel (1);MARVEL-like domain (1);	1.023760	0.07811	N	0.958108	T	0.27098	0.0664	L	0.41710	1.295	0.09310	N	1	P	0.42941	0.794	P	0.46076	0.503	T	0.41431	-0.9509	10	0.56958	D	0.05	-2.8128	14.9568	0.71120	0.1028:0.0:0.8972:0.0	.	193	Q96S97	MYADM_HUMAN	Y	193;193;193;193;193;156;193;193	ENSP00000398269:D193Y;ENSP00000337222:D193Y;ENSP00000375650:D193Y;ENSP00000416919:D193Y;ENSP00000375651:D193Y;ENSP00000375649:D193Y;ENSP00000375648:D193Y	ENSP00000337222:D193Y	D	+	1	0	0	MYADM	59069172	59069172	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.121000	0.15667	-1.181000	0.02730	-0.657000	0.03884	GAC	0.385549		TCGA-XN-A8T3-01A-11D-A36O-08	0.642	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	1	0	1	2	2	2	2	0	0	0	0	114	114	114	114	1	3.530000	-3.279883	1	0.190000	NM_138373		0	30	30	0	651	644	0		1	0		0	0	114	0	0	1.000000	9.999941e-01	0	0	0	400	0	30	651
INSR	3643	broad.mit.edu	37	19	7163065	7163065	+	Missense_Mutation	SNP	G	G	T	rs2962	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:7163065G>T	ENST00000302850.5	-	9	2149	c.2007C>A	c.(2005-2007)ttC>ttA	p.F669L	AC010311.1_ENST00000581768.1_RNA|INSR_ENST00000341500.5_Missense_Mutation_p.F669L	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	669	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	AATCCAGCTCGAACAGCTCAC	0.537																																						ENST00000302850.5	1.000000	0.280000	0.700000	0.360000	0.470000	0.542793	0.470000	0.440000																										0				66						c.(2005-2007)ttC>ttA		insulin receptor	"""Insulin(DB00071)|""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"						150.0	118.0	129.0					19																	7163065		2203	4300	6503	SO:0001583	missense	3643	0	0					g.chr19:7163065G>T	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2007C>A	chr19.hg19:g.7163065G>T	ENSP00000303830:p.Phe669Leu	0					INSR_ENST00000341500.5_Missense_Mutation_p.F669L|AC010311.1_ENST00000581768.1_RNA	p.F669L	NM_000208.2	NP_000199.2	1	2	3	1.790940	P06213	INSR_HUMAN		9	2149	-			Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	1	0	hg19	c.2007C>A	CCDS12176.1	0	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193146	0.38707	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.71934	-0.61;-0.61	4.45	-4.7	0.03288	4.45	-4.7	0.03288	Fibronectin, type III (3);	0.184367	0.25804	U	0.028188	T	0.56001	0.1956	L	0.43152	1.355	0.33845	P	0.368139	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.08055	0.003;0.002;0.003	T	0.45366	-0.9266	9	0.62326	D	0.03	.	11.1006	0.48172	0.7214:0.0:0.2786:0.0	.	660;669;669	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	L	669	ENSP00000303830:F669L;ENSP00000342838:F669L	ENSP00000303830:F669L	F	-	3	2	2	INSR	7114065	7114065	0.967000	0.33354	0.091000	0.20842	0.524000	0.34500	0.178000	0.16820	-0.681000	0.05204	-0.140000	0.14226	TTC	0.203618		TCGA-XN-A8T3-01A-11D-A36O-08	0.537	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1	1	0	1	2	2	2	2	0	0	0	0	133	133	133	133	1	3.530000	-2.560141	1	0.190000			0	17	17	0	388	382	0		1	0		0	0	133	0	0	0.999963	4.396495e-01	0	0	0	34	0	17	388
C19orf18	147685	broad.mit.edu	37	19	58477954	58477954	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr19:58477954C>A	ENST00000314391.3	-	4	416	c.315G>T	c.(313-315)tcG>tcT	p.S105S		NM_152474.4	NP_689687.1	Q8NEA5	CS018_HUMAN	chromosome 19 open reading frame 18	105						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		AGGCTACGCTCGAAATTAAAA	0.348																																						ENST00000314391.3	1.000000	0.420000	0.910000	0.540000	0.670000	0.707614	0.670000	0.640000																										0				8						c.(313-315)tcG>tcT		chromosome 19 open reading frame 18							77.0	76.0	76.0					19																	58477954		2203	4300	6503	SO:0001819	synonymous_variant	147685	0	0					g.chr19:58477954C>A	BC033933	CCDS12967.1	19q13.43	2013-03-11			ENSG00000177025	ENSG00000177025			28642	protein-coding gene	gene with protein product						12477932	Standard	NM_152474		Approved	MGC41906	uc002qqv.3	Q8NEA5	OTTHUMG00000183450	ENST00000314391.3:c.315G>T	chr19.hg19:g.58477954C>A		1						p.S105S	NM_152474.4	NP_689687.1	3	3	6	2.304241	Q8NEA5	CS018_HUMAN		4	416	-		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		Silent	SNP	ENST00000314391.3	1	0	hg19	c.315G>T	CCDS12967.1	0																																																																																								0.387755		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	C19orf18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466704.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	60	1	3.530000	-2.750138	1	0.190000	NM_152474		0	23	23	0	473	467	0		1	0		0	0	63	0	0	0.999999	6.964828e-03	0	0	0	3	0	23	473
S1PR1	1901	broad.mit.edu	37	1	101705326	101705326	+	Silent	SNP	G	G	T	rs200330463		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:101705326G>T	ENST00000305352.6	+	2	1161	c.786G>T	c.(784-786)ctG>ctT	p.L262L		NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	262					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						TTATCGTCCTGAGCGTCTTCA	0.592																																						ENST00000305352.6	0.760000	0.380000	0.660000	0.460000	0.550000	0.568464	0.550000	0.560000																										0				43						c.(784-786)ctG>ctT		sphingosine-1-phosphate receptor 1							106.0	106.0	106.0					1																	101705326		2203	4300	6503	SO:0001819	synonymous_variant	1901	0	0					g.chr1:101705326G>T	M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.786G>T	chr1.hg19:g.101705326G>T		0						p.L262L	NM_001400.4	NP_001391.2	2	2	4	2.091950	P21453	S1PR1_HUMAN		2	1161	+			D3DT66|Q9BYY4|Q9NYN8	Silent	SNP	ENST00000305352.6	1	0	hg19	c.786G>T	CCDS777.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.592	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	1	0	1	2	2	2	2	0	0	0	0	171	171	171	170	1	3.530000	-2.803092	1	0.190000	NM_001400		0	31	31	0	670	661	0		1	0		0	0	171	0	0	1.000000	5.547806e-01	0	0	0	41	0	31	670
KCNA3	3738	broad.mit.edu	37	1	111215758	111215758	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:111215758C>A	ENST00000369769.2	-	1	1897	c.1674G>T	c.(1672-1674)acG>acT	p.T558T		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	558					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	GATTATTGTTCGTGGTGCAGG	0.458																																						ENST00000369769.2	0.650000	0.300000	0.560000	0.370000	0.450000	0.471236	0.450000	0.440000																										0				38						c.(1672-1674)acG>acT		potassium voltage-gated channel, shaker-related subfamily, member 3	Dalfampridine(DB06637)						179.0	165.0	170.0					1																	111215758		2203	4300	6503	SO:0001819	synonymous_variant	3738	0	0					g.chr1:111215758C>A	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1674G>T	chr1.hg19:g.111215758C>A		0						p.T558T	NM_002232.3	NP_002223.3	2	2	4	2.091950	P22001	KCNA3_HUMAN		1	1897	-		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)	Q5VWN2	Silent	SNP	ENST00000369769.2	1	0	hg19	c.1674G>T	CCDS828.2	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.458	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	1	0	1	2	2	2	2	0	0	0	0	148	148	148	144	1	3.530000	-2.894383	1	0.190000	NM_002232		0	25	25	0	662	647	0		1	0		0	0	148	0	0	1.000000	0	0	0	0	1	0	25	662
ST7L	54879	broad.mit.edu	37	1	113098534	113098534	+	Missense_Mutation	SNP	C	C	A	rs6658555	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:113098534C>A	ENST00000358039.4	-	12	1656	c.1352G>T	c.(1351-1353)cGa>cTa	p.R451L	ST7L_ENST00000369669.1_Missense_Mutation_p.R268L|ST7L_ENST00000369666.1_Missense_Mutation_p.R434L|ST7L_ENST00000490067.1_Missense_Mutation_p.R434L|ST7L_ENST00000538187.1_Missense_Mutation_p.R395L|ST7L_ENST00000360743.4_Missense_Mutation_p.R451L|ST7L_ENST00000463235.1_5'UTR|ST7L_ENST00000369668.2_Missense_Mutation_p.R451L|ST7L_ENST00000544629.1_Missense_Mutation_p.R386L|ST7L_ENST00000543570.1_Intron|ST7L_ENST00000343210.7_Missense_Mutation_p.R451L	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	451			R -> Q (in dbSNP:rs6658555). {ECO:0000269|PubMed:14702039}.		negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)		p.R451Q(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCTTCTATTCGTTTCCAGTG	0.363																																						ENST00000358039.4	0.740000	0.300000	0.620000	0.390000	0.490000	0.513222	0.490000	0.480000																										1	Substitution - Missense(1)	p.R451Q(1)	stomach(1)	15						c.(1351-1353)cGa>cTa		suppression of tumorigenicity 7 like							135.0	127.0	130.0					1																	113098534		2203	4300	6503	SO:0001583	missense	54879	0	0					g.chr1:113098534C>A	AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.1352G>T	chr1.hg19:g.113098534C>A	ENSP00000350734:p.Arg451Leu	0					ST7L_ENST00000360743.4_Missense_Mutation_p.R451L|ST7L_ENST00000369669.1_Missense_Mutation_p.R268L|ST7L_ENST00000369666.1_Missense_Mutation_p.R434L|ST7L_ENST00000538187.1_Missense_Mutation_p.R395L|ST7L_ENST00000343210.7_Missense_Mutation_p.R451L|ST7L_ENST00000369668.2_Missense_Mutation_p.R451L|ST7L_ENST00000544629.1_Missense_Mutation_p.R386L|ST7L_ENST00000463235.1_5'UTR|ST7L_ENST00000543570.1_Intron|ST7L_ENST00000490067.1_Missense_Mutation_p.R434L	p.R451L	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	2	2	4	2.091950	Q8TDW4	ST7L_HUMAN		12	1656	-	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Missense_Mutation	SNP	ENST00000358039.4	1	0	hg19	c.1352G>T	CCDS848.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.158765|5.158765	0.94686|0.94686	.|.	.|.	ENSG00000007341|ENSG00000007341	ENST00000418497|ENST00000358039;ENST00000360743;ENST00000369673;ENST00000544629;ENST00000369669;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187	.|T;T;T;T;T;T;T;T;T	.|0.22336	.|1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.59|5.59	5.59|5.59	0.84812|0.84812	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.43942	.|0.1270	M|M	0.79475|0.79475	2.455|2.455	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D;D;D;D;D;D	.|0.89917	.|0.994;1.0;0.974;0.996;0.993;0.993;0.998;0.994	.|P;D;D;D;P;D;D;D	.|0.91635	.|0.855;0.999;0.917;0.951;0.822;0.958;0.972;0.975	.|T	.|0.42783	.|-0.9431	.|9	.|0.72032	.|D	.|0.01	-6.2202|-6.2202	19.1881|19.1881	0.93653|0.93653	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|395;386;386;451;434;434;451;451	.|B7Z7D4;B7Z3J2;F5H2P3;Q8TDW4-5;Q8TDW4-6;Q8TDW4-3;Q8TDW4-2;Q8TDW4	.|.;.;.;.;.;.;.;ST7L_HUMAN	X|L	226|451;451;232;386;268;434;451;451;434;395	.|ENSP00000350734:R451L;ENSP00000353972:R451L;ENSP00000445499:R386L;ENSP00000358683:R268L;ENSP00000417140:R434L;ENSP00000358682:R451L;ENSP00000345312:R451L;ENSP00000358680:R434L;ENSP00000444021:R395L	.|ENSP00000345312:R451L	E|R	-|-	1|2	0|0	0|0	ST7L|ST7L	112900057|112900057	112900057|112900057	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.968000|0.968000	0.65278|0.65278	6.086000|6.086000	0.71352|0.71352	2.625000|2.625000	0.88918|0.88918	0.585000|0.585000	0.79938|0.79938	GAA|CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.363	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3	1	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	3.530000	-2.285200	0	0.190000			0	19	20	0	465	459	0		1	0		0	0	78	0	0	0.999990	7.460477e-02	0	0	0	11	0	19	465
LRIG2	9860	broad.mit.edu	37	1	113653034	113653034	+	Missense_Mutation	SNP	C	C	A	rs201326654		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:113653034C>A	ENST00000361127.5	+	13	1846	c.1648C>A	c.(1648-1650)Cgt>Agt	p.R550S	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	550	Ig-like C2-type 1.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		GAATTTTGTTCGTTATTGGCA	0.418																																						ENST00000361127.5	0.670000	0.320000	0.580000	0.390000	0.480000	0.492810	0.480000	0.480000																										0				31						c.(1648-1650)Cgt>Agt		leucine-rich repeats and immunoglobulin-like domains 2							185.0	177.0	180.0					1																	113653034		2203	4300	6503	SO:0001583	missense	9860	0	0					g.chr1:113653034C>A	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1648C>A	chr1.hg19:g.113653034C>A	ENSP00000355396:p.Arg550Ser	0					LRIG2_ENST00000492207.1_3'UTR	p.R550S	NM_014813.1	NP_055628.1	2	2	4	2.091950	O94898	LRIG2_HUMAN		13	1846	+	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	1	0	hg19	c.1648C>A	CCDS30808.1	0	.	.	.	.	.	.	.	.	.	.	c	14.42	2.530545	0.45073	.	.	ENSG00000198799	ENST00000361127	T	0.37752	1.18	5.89	4.93	0.64822	5.89	4.93	0.64822	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.053044	0.64402	D	0.000001	T	0.18425	0.0442	L	0.43701	1.375	0.53005	D	0.999965	B	0.23540	0.087	B	0.30401	0.115	T	0.02844	-1.1103	10	0.14656	T	0.56	.	14.3328	0.66569	0.2175:0.7825:0.0:0.0	.	550	O94898	LRIG2_HUMAN	S	550	ENSP00000355396:R550S	ENSP00000355396:R550S	R	+	1	0	0	LRIG2	113454557	113454557	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.514000	0.53422	2.793000	0.96121	0.655000	0.94253	CGT	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.418	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	1	0	1	2	2	2	2	0	0	0	0	139	139	139	139	1	3.530000	-2.915294	1	0.190000	NM_014813		0	28	27	0	705	695	0		1	0		0	0	139	0	0	1.000000	1.178861e-01	0	0	0	15	0	28	705
MAGI3	260425	broad.mit.edu	37	1	114184571	114184571	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:114184571G>T	ENST00000307546.9	+	10	1474	c.1399G>T	c.(1399-1401)Ggt>Tgt	p.G467C	MAGI3_ENST00000369617.4_Missense_Mutation_p.G492C|MAGI3_ENST00000369611.4_Missense_Mutation_p.G467C|MAGI3_ENST00000369615.1_Missense_Mutation_p.G467C	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	492	Interaction with PTEN.|PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGTGTCCTCGGTCACACTCA	0.358																																						ENST00000307546.9	0.390000	0.110000	0.310000	0.170000	0.230000	0.246771	0.230000	0.240000																										0				41						c.(1399-1401)Ggt>Tgt		membrane associated guanylate kinase, WW and PDZ domain containing 3							171.0	152.0	158.0					1																	114184571		2203	4300	6503	SO:0001583	missense	260425	1	121412	31				g.chr1:114184571G>T	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1399G>T	chr1.hg19:g.114184571G>T	ENSP00000304604:p.Gly467Cys	0					MAGI3_ENST00000369617.4_Missense_Mutation_p.G492C|MAGI3_ENST00000369615.1_Missense_Mutation_p.G467C|MAGI3_ENST00000369611.4_Missense_Mutation_p.G467C	p.G467C	NM_001142782.1	NP_001136254.1	2	2	4	2.091950	Q5TCQ9	MAGI3_HUMAN		10	1474	+	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	0	1	hg19	c.1399G>T	CCDS44196.1	0	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456418	0.84317	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.83317	0.5228	H	0.98918	4.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89889	0.4036	10	0.87932	D	0	-28.5003	19.4992	0.95086	0.0:0.0:1.0:0.0	.	467;467;492	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	C	492;467;467;467	ENSP00000358630:G492C;ENSP00000304604:G467C;ENSP00000358628:G467C;ENSP00000358624:G467C	ENSP00000304604:G467C	G	+	1	0	0	MAGI3	113986094	113986094	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.420000	0.97426	2.689000	0.91719	0.655000	0.94253	GGT	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.358	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	3.530000	-2.560730	1	0.190000	NM_152900		0	11	10	0	594	582	0		1	0		0	0	107	0	0	0.998142	8.195098e-03	0	0	0	7	0	11	594
PHTF1	10745	broad.mit.edu	37	1	114280825	114280825	+	Silent	SNP	G	G	T	rs78000844		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:114280825G>T	ENST00000369604.1	-	5	721	c.238C>A	c.(238-240)Cga>Aga	p.R80R	PHTF1_ENST00000369600.1_Intron|PHTF1_ENST00000369598.1_Silent_p.R80R|PHTF1_ENST00000393357.2_Silent_p.R80R|PHTF1_ENST00000357783.2_Silent_p.R80R|PHTF1_ENST00000447664.2_Silent_p.R80R|PHTF1_ENST00000369596.2_Intron			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	80					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATACAACTCGAACAAGCCCC	0.358																																						ENST00000369604.1	0.890000	0.350000	0.750000	0.460000	0.590000	0.611940	0.590000	0.590000																										0				27						c.(238-240)Cga>Aga		putative homeodomain transcription factor 1							97.0	98.0	98.0					1																	114280825		2203	4300	6503	SO:0001819	synonymous_variant	10745	0	0					g.chr1:114280825G>T	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.238C>A	chr1.hg19:g.114280825G>T		0					PHTF1_ENST00000393357.2_Silent_p.R80R|PHTF1_ENST00000447664.2_Silent_p.R80R|PHTF1_ENST00000369596.2_Intron|PHTF1_ENST00000357783.2_Silent_p.R80R|PHTF1_ENST00000369598.1_Silent_p.R80R|PHTF1_ENST00000369600.1_Intron	p.R80R			2	2	4	2.091950	Q9UMS5	PHTF1_HUMAN		5	721	-	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Silent	SNP	ENST00000369604.1	1	0	hg19	c.238C>A	CCDS861.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.358	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	3.530000	-4.614483	1	0.190000	NM_006608		0	17	17	0	347	338	0		1	0		0	0	64	0	0	0.999960	3.651310e-01	0	0	0	26	0	17	347
CRNN	49860	broad.mit.edu	37	1	152383339	152383339	+	Silent	SNP	T	T	C			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:152383339T>C	ENST00000271835.3	-	3	281	c.219A>G	c.(217-219)gaA>gaG	p.E73E	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	73	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACCAGGAATTCCTTGAATT	0.537																																						ENST00000271835.3	0.980000	0.470000	0.850000	0.580000	0.700000	0.719105	0.700000	1.000000																										0				35						c.(217-219)gaA>gaG		cornulin							60.0	64.0	63.0					1																	152383339		2200	4299	6499	SO:0001819	synonymous_variant	49860	1	121404	32				g.chr1:152383339T>C	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.219A>G	chr1.hg19:g.152383339T>C		0					RP1-91G5.3_ENST00000411804.1_RNA	p.E73E	NM_016190.2	NP_057274.1	2	2	4	2.085565	Q9UBG3	CRNN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	281	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		B2RE60|Q8N613	Silent	SNP	ENST00000271835.3	1	1	hg19	c.219A>G	CCDS1010.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.537	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	1	0	0	2	2	2	2	0	0	0	0	110	110	110	110	1	3.530000	-20.000000	1	0.190000	NM_016190		0	26	26	0	439	435	0		1			0	0	110	0	0	1.000000	0	0	0	0	0	0	26	439
GON4L	54856	broad.mit.edu	37	1	155736404	155736404	+	Silent	SNP	G	G	T	rs143360629		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:155736404G>T	ENST00000368331.1	-	21	2908	c.2860C>A	c.(2860-2862)Cga>Aga	p.R954R	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000271883.5_Silent_p.R954R|GON4L_ENST00000437809.1_Silent_p.R954R|GON4L_ENST00000361040.5_Silent_p.R954R	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	954					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCTAGGCTTCGATCTGAGTTG	0.502																																						ENST00000368331.1	0.760000	0.310000	0.640000	0.400000	0.510000	0.525205	0.510000	0.510000																										0				45						c.(2860-2862)Cga>Aga		gon-4-like (C. elegans)							139.0	130.0	133.0					1																	155736404		2203	4300	6503	SO:0001819	synonymous_variant	54856	0	0					g.chr1:155736404G>T	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.2860C>A	chr1.hg19:g.155736404G>T		0					GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Silent_p.R954R|GON4L_ENST00000361040.5_Silent_p.R954R|GON4L_ENST00000271883.5_Silent_p.R954R	p.R954R	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	2	2	4	2.075565	Q3T8J9	GON4L_HUMAN		21	2908	-	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)		B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	1	0	hg19	c.2860C>A		0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.502	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	90	90	90	91	1	3.530000	-3.744091	1	0.190000	NM_032292		0	18	18	0	431	427	0		1	0		0	0	90	0	0	0.999981	3.447741e-01	0	0	0	29	0	18	431
PYHIN1	149628	broad.mit.edu	37	1	158908227	158908227	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:158908227C>A	ENST00000368140.1	+	3	551	c.306C>A	c.(304-306)atC>atA	p.I102I	PYHIN1_ENST00000392254.2_Silent_p.I102I|PYHIN1_ENST00000368138.3_Silent_p.I93I|PYHIN1_ENST00000392252.3_Silent_p.I93I|PYHIN1_ENST00000368135.4_Silent_p.I102I	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	102					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AAGGAATAATCCCATCTAAAA	0.443																																						ENST00000368140.1	0.410000	0.110000	0.330000	0.160000	0.230000	0.249959	0.230000	0.240000																										0				60						c.(304-306)atC>atA		pyrin and HIN domain family, member 1							114.0	110.0	112.0					1																	158908227		2203	4300	6503	SO:0001819	synonymous_variant	149628	0	0					g.chr1:158908227C>A	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.306C>A	chr1.hg19:g.158908227C>A		0					PYHIN1_ENST00000392254.2_Silent_p.I102I|PYHIN1_ENST00000392252.3_Silent_p.I93I|PYHIN1_ENST00000368138.3_Silent_p.I93I|PYHIN1_ENST00000368135.4_Silent_p.I102I	p.I102I	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	2	2	4	2.075565	Q6K0P9	IFIX_HUMAN		3	551	+	all_hematologic(112;0.0378)		Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Silent	SNP	ENST00000368140.1	0	1	hg19	c.306C>A	CCDS1178.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.443	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	0	0	1	2	19	2	2	1	1	1	1	88	88	88	87	1	3.530000	-2.936063	1	0.190000	NM_152501		0	9	8	0	488	485	0		0	0		1	0	88	0	0	0.039016	4.408818e-04	0	0	0	2	0	9	488
ARHGEF10L	55160	broad.mit.edu	37	1	17958842	17958842	+	Silent	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:17958842G>A	ENST00000361221.3	+	16	1770	c.1611G>A	c.(1609-1611)ctG>ctA	p.L537L	ARHGEF10L_ENST00000375420.3_Silent_p.L295L|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000434513.1_Silent_p.L537L|ARHGEF10L_ENST00000375415.1_Silent_p.L498L|ARHGEF10L_ENST00000167825.4_Silent_p.L245L|ARHGEF10L_ENST00000375408.3_Silent_p.L315L|ARHGEF10L_ENST00000452522.1_Silent_p.L498L	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	537						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		AGCGGCAGCTGCTCCTGTGTG	0.627																																						ENST00000361221.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				43						c.(1609-1611)ctG>ctA		Rho guanine nucleotide exchange factor (GEF) 10-like							77.0	78.0	78.0					1																	17958842		2203	4300	6503	SO:0001819	synonymous_variant	55160	0	0					g.chr1:17958842G>A	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.1611G>A	chr1.hg19:g.17958842G>A		1					ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Silent_p.L245L|ARHGEF10L_ENST00000375415.1_Silent_p.L498L|ARHGEF10L_ENST00000434513.1_Silent_p.L537L|ARHGEF10L_ENST00000375408.3_Silent_p.L315L|ARHGEF10L_ENST00000452522.1_Silent_p.L498L|ARHGEF10L_ENST00000375420.3_Silent_p.L295L	p.L537L	NM_018125.3	NP_060595	2	2	4	2.117161	Q9HCE6	ARGAL_HUMAN		16	1770	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Silent	SNP	ENST00000361221.3	1	1	hg19	c.1611G>A	CCDS182.1	1																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.627	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	1	0	1	2	2	2	2	0	0	0	0	128	128	128	125	1	3.530000	-3.222839	1	0.190000	NM_018125		0	86	84	0	477	470	1		1	1		0	0	128	0	0	1.000000	9.927308e-01	0	5	0	39	0	86	477
SLAMF6	114836	broad.mit.edu	37	1	160458917	160458917	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:160458917C>A	ENST00000368057.3	-	6	900	c.840G>T	c.(838-840)acG>acT	p.T280T	SLAMF6_ENST00000368055.1_Silent_p.T169T|SLAMF6_ENST00000368059.3_Silent_p.T279T			Q96DU3	SLAF6_HUMAN	SLAM family member 6	280						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			CAGTGTTGTTCGTTGGAGACA	0.443																																						ENST00000368057.3	0.670000	0.280000	0.570000	0.350000	0.450000	0.468156	0.450000	0.440000																										0				22						c.(838-840)acG>acT		SLAM family member 6							256.0	202.0	220.0					1																	160458917		2203	4300	6503	SO:0001819	synonymous_variant	114836	0	0					g.chr1:160458917C>A	AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.840G>T	chr1.hg19:g.160458917C>A		0					SLAMF6_ENST00000368055.1_Silent_p.T169T|SLAMF6_ENST00000368059.3_Silent_p.T279T	p.T280T			2	2	4	2.075565	Q96DU3	SLAF6_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0923)	6	900	-	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Silent	SNP	ENST00000368057.3	1	0	hg19	c.840G>T	CCDS53394.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.443	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059010.1	1	0	1	2	2	2	2	0	0	0	0	102	102	102	101	1	3.530000	-2.848300	1	0.190000	NM_052931		0	19	19	0	512	509	0		1	0		0	0	102	0	0	0.999990	1.358139e-02	0	0	0	5	0	19	512
TPR	7175	broad.mit.edu	37	1	186304589	186304589	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:186304589G>T	ENST00000367478.4	-	34	5088	c.4792C>A	c.(4792-4794)Cgc>Agc	p.R1598S		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1598					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GCAGTAATGCGAACATCCAAT	0.423			T	NTRK1	papillary thyroid																																	ENST00000367478.4	0.660000	0.310000	0.570000	0.390000	0.470000	0.486866	0.470000	0.480000				Dom	yes			Dom	yes		1	1q25	1q25	7175	T	translocated promoter region				E	E	NTRK1		papillary thyroid		0				123						c.(4792-4794)Cgc>Agc		translocated promoter region, nuclear basket protein							171.0	153.0	158.0					1																	186304589		1878	4112	5990	SO:0001583	missense	7175	0	0					g.chr1:186304589G>T	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.4792C>A	chr1.hg19:g.186304589G>T	ENSP00000356448:p.Arg1598Ser	0						p.R1598S	NM_003292.2	NP_003283.2	2	2	4	2.082668	P12270	TPR_HUMAN		34	5088	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	1	0	hg19	c.4792C>A	CCDS41446.1	0	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989888	0.93106	.	.	ENSG00000047410	ENST00000367478	T	0.26518	1.73	5.14	5.14	0.70334	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.54498	0.1862	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.53585	-0.8418	10	0.36615	T	0.2	.	18.9661	0.92697	0.0:0.0:1.0:0.0	.	1598	P12270	TPR_HUMAN	S	1598	ENSP00000356448:R1598S	ENSP00000356448:R1598S	R	-	1	0	0	TPR	184571212	184571212	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.065000	0.93941	2.545000	0.85829	0.650000	0.86243	CGC	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.423	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	1	0	1	2	2	2	2	0	0	0	0	143	143	143	142	1	3.530000	-2.856187	1	0.190000	NM_003292		0	28	28	0	714	708	0		1	0		0	0	143	0	0	1.000000	7.972226e-01	0	0	0	78	0	28	714
ASPM	259266	broad.mit.edu	37	1	197102510	197102510	+	Silent	SNP	G	G	T	rs145489194		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:197102510G>T	ENST00000367409.4	-	6	2645	c.2389C>A	c.(2389-2391)Cga>Aga	p.R797R	ASPM_ENST00000294732.7_Silent_p.R797R|ASPM_ENST00000367408.1_Silent_p.R47R	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	797					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CTATCTTTTCGAACAATTAAC	0.348																																						ENST00000367409.4	0.930000	0.440000	0.810000	0.540000	0.660000	0.682340	0.660000	0.670000																										0				165						c.(2389-2391)Cga>Aga		asp (abnormal spindle) homolog, microcephaly associated (Drosophila)							68.0	68.0	68.0					1																	197102510		2203	4300	6503	SO:0001819	synonymous_variant	259266	0	0					g.chr1:197102510G>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2389C>A	chr1.hg19:g.197102510G>T		0					ASPM_ENST00000294732.7_Silent_p.R797R|ASPM_ENST00000367408.1_Silent_p.R47R	p.R797R	NM_018136.4	NP_060606.3	2	2	4	2.082668	Q8IZT6	ASPM_HUMAN		6	2645	-			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	1	0	hg19	c.2389C>A	CCDS1389.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	1	0	1	2	2	2	2	0	0	0	0	80	80	80	79	1	3.530000	-3.142371	1	0.190000	NM_018136		0	26	26	0	465	461	0		1	0		0	0	80	0	0	1.000000	1.707018e-02	0	0	0	4	0	26	465
USH2A	7399	broad.mit.edu	37	1	215844624	215844624	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:215844624C>A	ENST00000307340.3	-	64	14209	c.13823G>T	c.(13822-13824)cGa>cTa	p.R4608L	USH2A_ENST00000366943.2_Missense_Mutation_p.R4608L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4608	Fibronectin type-III 31. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CGCTTGAATTCGTATTTCATA	0.418										HNSCC(13;0.011)																												ENST00000307340.3	0.850000	0.300000	0.700000	0.400000	0.530000	0.557892	0.530000	0.520000																										0				527						c.(13822-13824)cGa>cTa		Usher syndrome 2A (autosomal recessive, mild)							78.0	78.0	78.0					1																	215844624		2203	4300	6503	SO:0001583	missense	7399	0	0					g.chr1:215844624C>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13823G>T	chr1.hg19:g.215844624C>A	ENSP00000305941:p.Arg4608Leu	0	HNSCC(13;0.011)				USH2A_ENST00000366943.2_Missense_Mutation_p.R4608L	p.R4608L	NM_206933.2	NP_996816	2	2	4	2.082668	O75445	USH2A_HUMAN		64	14209	-			Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	1	0	hg19	c.13823G>T	CCDS31025.1	0	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485952	0.63962	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.60920	0.15;0.15	4.94	3.03	0.35002	4.94	3.03	0.35002	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.214025	0.23633	N	0.046103	T	0.66157	0.2761	M	0.84326	2.69	0.37088	D	0.899288	P	0.52842	0.956	P	0.53912	0.737	T	0.71377	-0.4611	10	0.59425	D	0.04	.	5.2652	0.15595	0.0:0.5939:0.0:0.4061	.	4608	O75445	USH2A_HUMAN	L	4608	ENSP00000305941:R4608L;ENSP00000355910:R4608L	ENSP00000305941:R4608L	R	-	2	0	0	USH2A	213911247	213911247	0.982000	0.34865	0.193000	0.23327	0.855000	0.48748	2.517000	0.45529	1.202000	0.43218	0.650000	0.86243	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	1	0	1	2	2	2	2	0	0	0	0	49	49	49	49	1	3.530000	-3.022593	1	0.190000	NM_007123		0	13	13	0	297	294	0		1			0	0	49	0	0	0.999533	0	0	0	0	0	0	13	297
RAB3GAP2	25782	broad.mit.edu	37	1	220356177	220356177	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:220356177G>T	ENST00000358951.2	-	20	2211	c.2095C>A	c.(2095-2097)Cga>Aga	p.R699R		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	699					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TCAGAAAATCGAACATTTGTC	0.348																																						ENST00000358951.2	0.800000	0.340000	0.680000	0.440000	0.550000	0.564511	0.550000	0.550000																										0				39						c.(2095-2097)Cga>Aga		RAB3 GTPase activating protein subunit 2 (non-catalytic)							110.0	107.0	108.0					1																	220356177		2203	4300	6503	SO:0001819	synonymous_variant	25782	0	0					g.chr1:220356177G>T	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2095C>A	chr1.hg19:g.220356177G>T		0						p.R699R	NM_012414.3	NP_036546.2	2	2	4	2.082668	Q9H2M9	RBGPR_HUMAN		20	2211	-			A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	ENST00000358951.2	1	0	hg19	c.2095C>A	CCDS31028.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	1	0	1	2	2	2	2	0	0	0	0	82	82	82	82	1	3.530000	-3.126318	1	0.190000	NM_012414		0	21	21	0	463	457	0		1	0		0	0	82	0	0	0.999997	6.119469e-02	0	0	0	9	0	21	463
OBSCN	84033	broad.mit.edu	37	1	228432014	228432014	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:228432014G>T	ENST00000422127.1	+	11	3267	c.3223G>T	c.(3223-3225)Gca>Tca	p.A1075S	OBSCN_ENST00000570156.2_Missense_Mutation_p.A1167S|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A1075S|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1075	Ig-like 11.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GATGATGTTTGCAAAGGAGCA	0.572																																						ENST00000422127.1	1.000000	0.840000	1.000000	0.980000	0.990000	0.985728	0.990000	1.000000																										0				223						c.(3223-3225)Gca>Tca		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							97.0	93.0	94.0					1																	228432014		2033	4185	6218	SO:0001583	missense	84033	0	0					g.chr1:228432014G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3223G>T	chr1.hg19:g.228432014G>T	ENSP00000409493:p.Ala1075Ser	0					OBSCN_ENST00000284548.11_Missense_Mutation_p.A1075S|OBSCN_ENST00000570156.2_Missense_Mutation_p.A1167S|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR	p.A1075S	NM_001098623.2	NP_001092093.2	2	2	4	2.082668	Q5VST9	OBSCN_HUMAN		11	3267	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	1	1	hg19	c.3223G>T	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	2.395	-0.338872	0.05243	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04551	3.6;3.6	3.69	2.78	0.32641	3.69	2.78	0.32641	Immunoglobulin-like (1);	0.317255	0.27060	N	0.021125	T	0.04363	0.0120	L	0.39147	1.195	0.80722	D	1	P;B	0.37985	0.613;0.169	B;B	0.41466	0.358;0.049	T	0.40664	-0.9551	10	0.06891	T	0.86	.	6.4866	0.22093	0.3275:0.0:0.6725:0.0	.	1075;1075	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	1075	ENSP00000284548:A1075S;ENSP00000409493:A1075S	ENSP00000284548:A1075S	A	+	1	0	0	OBSCN	226498637	226498637	0.000000	0.05858	0.991000	0.47740	0.025000	0.11179	-0.621000	0.05559	0.757000	0.33036	0.455000	0.32223	GCA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.572	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	115	115	115	99	1	3.530000	-13.593880	1	0.190000	NM_052843		0	44	33	0	442	392	0		1	0		0	0	115	0	0	1.000000	0	0	0	0	1	0	44	442
EGLN1	54583	broad.mit.edu	37	1	231506425	231506425	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:231506425C>A	ENST00000366641.3	-	3	4186	c.1031G>T	c.(1030-1032)cGa>cTa	p.R344L	EGLN1_ENST00000476717.1_5'UTR	NM_022051.2	NP_071334.1			egl-9 family hypoxia-inducible factor 1									p.R344Q(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	16		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)				TGGAAAAATTCGAAGTATACC	0.393																																						ENST00000366641.3	0.830000	0.330000	0.700000	0.430000	0.550000	0.571900	0.550000	0.550000																										1	Substitution - Missense(1)	p.R344Q(1)	large_intestine(1)	16						c.(1030-1032)cGa>cTa		egl-9 family hypoxia-inducible factor 1							108.0	108.0	108.0					1																	231506425		2203	4300	6503	SO:0001583	missense	54583	0	0					g.chr1:231506425C>A	AJ310543	CCDS1595.1	1q42.1	2013-08-21	2013-08-21	2001-08-24	ENSG00000135766	ENSG00000135766		"""Zinc fingers, MYND-type"""	1232	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 2"""	606425	"""EGL nine (C.elegans) homolog 1"", ""egl nine homolog 1 (C. elegans)"""	C1orf12		11056053	Standard	NM_022051		Approved	SM-20, PHD2, ZMYND6, HIFPH2	uc001huv.2	Q9GZT9	OTTHUMG00000038027	ENST00000366641.3:c.1031G>T	chr1.hg19:g.231506425C>A	ENSP00000355601:p.Arg344Leu	0					EGLN1_ENST00000476717.1_5'UTR	p.R344L	NM_022051.2	NP_071334.1	2	2	4	2.082668				3	4186	-		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)		Missense_Mutation	SNP	ENST00000366641.3	1	0	hg19	c.1031G>T	CCDS1595.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.219054	0.95104	.	.	ENSG00000135766	ENST00000366641	T	0.59083	0.29	5.73	5.73	0.89815	5.73	5.73	0.89815	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.79441	0.4446	M	0.86178	2.8	0.80722	D	1	D	0.69078	0.997	D	0.69824	0.966	T	0.79688	-0.1699	10	0.46703	T	0.11	-4.6704	19.9155	0.97058	0.0:1.0:0.0:0.0	.	344	Q9GZT9	EGLN1_HUMAN	L	344	ENSP00000355601:R344L	ENSP00000355601:R344L	R	-	2	0	0	EGLN1	229573048	229573048	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.008000	0.70739	2.699000	0.92147	0.650000	0.86243	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	EGLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092879.1	1	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	3.530000	-3.128328	1	0.190000	NM_022051		0	17	17	0	373	369	0		1	0		0	0	82	0	0	0.999964	8.488680e-01	0	0	0	77	0	17	373
KMO	8564	broad.mit.edu	37	1	241714324	241714324	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:241714324C>A	ENST00000366559.4	+	4	603	c.292C>A	c.(292-294)Ccc>Acc	p.P98T	KMO_ENST00000484628.1_3'UTR|KMO_ENST00000366558.3_Missense_Mutation_p.P98T|KMO_ENST00000366557.4_Missense_Mutation_p.P98T	NM_003679.4	NP_003670.2			kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)											NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)			GTCTGCAATTCCCTATGGGAC	0.413																																						ENST00000366559.4	0.350000	0.100000	0.280000	0.140000	0.200000	0.217494	0.200000	0.200000																										0				33						c.(292-294)Ccc>Acc		kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)							162.0	158.0	159.0					1																	241714324		2203	4300	6503	SO:0001583	missense	8564	0	0					g.chr1:241714324C>A	AF056032	CCDS1618.1	1q42-q44	2010-11-23			ENSG00000117009	ENSG00000117009	1.14.13.9		6381	protein-coding gene	gene with protein product		603538				9237672	Standard	NM_003679		Approved		uc009xgp.3	O15229	OTTHUMG00000039635	ENST00000366559.4:c.292C>A	chr1.hg19:g.241714324C>A	ENSP00000355517:p.Pro98Thr	0					KMO_ENST00000484628.1_3'UTR|KMO_ENST00000366558.3_Missense_Mutation_p.P98T|KMO_ENST00000366557.4_Missense_Mutation_p.P98T	p.P98T	NM_003679.4	NP_003670.2	2	2	4	2.082668			OV - Ovarian serous cystadenocarcinoma(106;0.0176)	4	603	+	Ovarian(103;0.103)|all_lung(81;0.23)			Missense_Mutation	SNP	ENST00000366559.4	0	1	hg19	c.292C>A	CCDS1618.1	0	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580937	0.65992	.	.	ENSG00000117009	ENST00000366559;ENST00000366558;ENST00000366557	T;T;T	0.49432	0.78;0.78;0.78	6.17	6.17	0.99709	6.17	6.17	0.99709	Monooxygenase, FAD-binding (1);	0.000000	0.85682	D	0.000000	T	0.72391	0.3454	M	0.87456	2.885	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73708	0.981;0.981;0.977	T	0.72312	-0.4331	10	0.40728	T	0.16	.	16.3795	0.83443	0.0:1.0:0.0:0.0	.	98;98;98	O15229;A8K693;O15229-2	KMO_HUMAN;.;.	T	98	ENSP00000355517:P98T;ENSP00000355516:P98T;ENSP00000355515:P98T	ENSP00000355515:P98T	P	+	1	0	0	KMO	239780947	239780947	1.000000	0.71417	1.000000	0.80357	0.447000	0.32167	2.444000	0.44890	2.941000	0.99782	0.655000	0.94253	CCC	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.413	KMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095612.1	0	0	1	2	2	2	2	0	0	0	0	146	146	146	145	1	3.530000	-2.927144	1	0.190000	NM_003679		0	11	11	0	676	667	0		1	0		0	0	146	0	0	0.998220	0	0	0	0	1	0	11	676
OR2M2	391194	broad.mit.edu	37	1	248344093	248344093	+	Missense_Mutation	SNP	C	C	T	rs149761766		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:248344093C>T	ENST00000359682.2	+	1	806	c.806C>T	c.(805-807)aCg>aTg	p.T269M		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CACTCCCCAACGCAGGACAAG	0.502																																						ENST00000359682.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				70						c.(805-807)aCg>aTg		olfactory receptor, family 2, subfamily M, member 2		T	MET/THR	0,4406		0,0,2203	212.0	189.0	197.0		806	-4.1	0.0	1	dbSNP_134	197	1,8599	819.2+/-406.8	0,1,4299	no	missense	OR2M2	NM_001004688.1	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	269/348	248344093	1,13005	2203	4300	6503	SO:0001583	missense	391194	1	121412	41				g.chr1:248344093C>T	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.806C>T	chr1.hg19:g.248344093C>T	ENSP00000352710:p.Thr269Met	0						p.T269M	NM_001004688.1	NP_001004688.1	2	2	4	2.082668	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)	1	806	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	1	1	hg19	c.806C>T	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	t	1.263	-0.615211	0.03663	0.0	1.16E-4	ENSG00000198601	ENST00000359682	T	0.00123	8.7	2.03	-4.06	0.03986	2.03	-4.06	0.03986	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00178	0.0005	M	0.70275	2.135	0.09310	N	1	B	0.28439	0.212	B	0.29598	0.104	T	0.38178	-0.9673	9	0.51188	T	0.08	.	10.6476	0.45630	0.2235:0.6609:0.0:0.1157	.	269	Q96R28	OR2M2_HUMAN	M	269	ENSP00000352710:T269M	ENSP00000352710:T269M	T	+	2	0	0	OR2M2	246410716	246410716	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-7.426000	0.00036	-3.968000	0.00086	-3.185000	0.00055	ACG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.502	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	1	0	1	2	2	2	2	0	0	0	0	246	246	246	249	1	3.530000	-20.000000	1	0.190000	NM_001004688		0	167	165	0	801	786	1		1			0	0	246	0	0	1.000000	0	0	0	0	0	0	167	801
VAMP3	9341	broad.mit.edu	37	1	7837333	7837333	+	Silent	SNP	G	G	T	rs114336504	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:7837333G>T	ENST00000054666.6	+	3	301	c.186G>T	c.(184-186)acG>acT	p.T62T	VAMP3_ENST00000470357.1_Silent_p.T34T|RP3-467L1.6_ENST00000602406.1_RNA	NM_004781.3	NP_004772.1	Q15836	VAMP3_HUMAN	vesicle-associated membrane protein 3	62	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				calcium ion-dependent exocytosis (GO:0017156)|exocytosis (GO:0006887)|Golgi to plasma membrane protein transport (GO:0043001)|membrane fusion (GO:0061025)|positive regulation of receptor recycling (GO:0001921)|protein complex assembly (GO:0006461)|retrograde transport, endosome to Golgi (GO:0042147)|SNARE complex assembly (GO:0035493)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)|SNARE complex (GO:0031201)|synapse (GO:0045202)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;6.33e-69)|GBM - Glioblastoma multiforme(8;2.07e-34)|Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.38e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000805)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		AATTTGAAACGAGCGCAGCCA	0.463																																						ENST00000054666.6	1.000000	0.260000	1.000000	0.350000	0.490000	0.587646	0.490000	0.440000																										0				6						c.(184-186)acG>acT		vesicle-associated membrane protein 3							80.0	79.0	79.0					1																	7837333		2203	4300	6503	SO:0001819	synonymous_variant	9341	0	0					g.chr1:7837333G>T	BC003570	CCDS88.1	1p36.23	2013-02-13	2012-10-17		ENSG00000049245	ENSG00000049245		"""Vesicle-associated membrane proteins"""	12644	protein-coding gene	gene with protein product	"""cellubrevin"""	603657				9885218	Standard	NM_004781		Approved	CEB	uc001aol.3	Q15836	OTTHUMG00000001225	ENST00000054666.6:c.186G>T	chr1.hg19:g.7837333G>T		1					VAMP3_ENST00000470357.1_Silent_p.T34T|RP3-467L1.6_ENST00000602406.1_RNA	p.T62T	NM_004781.3	NP_004772.1	3	3	6	2.138687	Q15836	VAMP3_HUMAN		3	301	+	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)	Q9BRV4	Silent	SNP	ENST00000054666.6	1	0	hg19	c.186G>T	CCDS88.1	0																																																																																								0.340391		TCGA-XN-A8T3-01A-11D-A36O-08	0.463	VAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003625.1	1	0	1	2	2	2	2	0	0	0	0	90	90	90	90	1	3.530000	-3.455922	1	0.190000	NM_004781		0	14	14	0	401	398	0		1	0		0	0	90	0	0	0.999752	9.171974e-01	0	1	0	125	0	14	401
ZMYM4	9202	broad.mit.edu	37	1	35859318	35859318	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:35859318C>A	ENST00000314607.6	+	18	2969	c.2889C>A	c.(2887-2889)acC>acA	p.T963T	ZMYM4_ENST00000373297.2_Silent_p.T874T	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	963					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AACCACATACCCAAAACAAAG	0.393																																						ENST00000314607.6	0.350000	0.100000	0.280000	0.150000	0.200000	0.221011	0.200000	0.200000																										0				54						c.(2887-2889)acC>acA		zinc finger, MYM-type 4							118.0	106.0	110.0					1																	35859318		2203	4300	6503	SO:0001819	synonymous_variant	9202	0	0					g.chr1:35859318C>A	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2889C>A	chr1.hg19:g.35859318C>A		1					ZMYM4_ENST00000373297.2_Silent_p.T874T	p.T963T	NM_005095.2	NP_005086.2	2	2	4	2.117161	Q5VZL5	ZMYM4_HUMAN		18	2969	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Silent	SNP	ENST00000314607.6	0	1	hg19	c.2889C>A	CCDS389.1	0	.	.	.	.	.	.	.	.	.	.	C	9.029	0.986755	0.18889	.	.	ENSG00000146463	ENST00000457946	.	.	.	5.18	-1.85	0.07784	5.18	-1.85	0.07784	.	.	.	.	.	T	0.39989	0.1099	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32134	-0.9918	4	.	.	.	-0.0487	1.9559	0.03376	0.4888:0.1835:0.1729:0.1547	.	.	.	.	T	623	.	.	P	+	1	0	0	ZMYM4	35631905	35631905	0.666000	0.27475	0.994000	0.49952	0.990000	0.78478	-0.302000	0.08221	0.016000	0.14998	0.585000	0.79938	CCA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	0	0	1	2	2	2	2	0	0	0	0	98	98	98	95	1	3.530000	-2.619821	1	0.190000	NM_005095		0	11	11	0	665	657	0		1	1		0	0	98	0	0	0.998233	2.611405e-01	0	2	0	54	0	11	665
RLF	6018	broad.mit.edu	37	1	40668129	40668129	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:40668129G>T	ENST00000372771.4	+	5	680	c.653G>T	c.(652-654)cGa>cTa	p.R218L		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	218					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			CTGCAAATGCGAATAAAACAT	0.333																																						ENST00000372771.4	0.800000	0.350000	0.680000	0.440000	0.550000	0.568066	0.550000	0.560000																										0				68						c.(652-654)cGa>cTa		rearranged L-myc fusion							77.0	76.0	77.0					1																	40668129		2203	4300	6503	SO:0001583	missense	6018	0	0					g.chr1:40668129G>T		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.653G>T	chr1.hg19:g.40668129G>T	ENSP00000361857:p.Arg218Leu	1						p.R218L	NM_012421.3	NP_036553.2	2	2	4	2.117161	Q13129	RLF_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)	5	680	+	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	Q14CQ1|Q9NU60	Missense_Mutation	SNP	ENST00000372771.4	1	0	hg19	c.653G>T	CCDS448.1	0	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438077	0.83885	.	.	ENSG00000117000	ENST00000372771	T	0.52754	0.65	4.94	4.94	0.65067	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.70675	0.3251	M	0.79258	2.445	0.53688	D	0.999978	D	0.76494	0.999	D	0.81914	0.995	T	0.75328	-0.3356	10	0.87932	D	0	-7.763	18.5314	0.90993	0.0:0.0:1.0:0.0	.	218	Q13129	RLF_HUMAN	L	218	ENSP00000361857:R218L	ENSP00000361857:R218L	R	+	2	0	0	RLF	40440716	40440716	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.076000	0.76806	2.462000	0.83206	0.313000	0.20887	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.333	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	55	1	3.530000	-4.197773	1	0.190000	NM_012421		0	22	20	0	481	477	0		1	0		0	0	57	0	0	0.999999	1.179004e-01	0	0	0	13	0	22	481
CCDC30	728621	broad.mit.edu	37	1	43047064	43047064	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:43047064C>A	ENST00000340612.4	+	7	1099	c.1099C>A	c.(1099-1101)Cat>Aat	p.H367N	CCDC30_ENST00000342022.4_Missense_Mutation_p.H367N|CCDC30_ENST00000507855.1_Missense_Mutation_p.H156N|CCDC30_ENST00000390640.4_Missense_Mutation_p.H156N|CCDC30_ENST00000428554.2_Missense_Mutation_p.H367N			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	367						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						AGAACATGCTCATAAAGTCTG	0.348																																						ENST00000340612.4	0.410000	0.140000	0.330000	0.190000	0.250000	0.267608	0.250000	0.240000																										0				30						c.(1099-1101)Cat>Aat		coiled-coil domain containing 30							91.0	94.0	93.0					1																	43047064		2203	4300	6503	SO:0001583	missense	728621	0	0					g.chr1:43047064C>A	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1099C>A	chr1.hg19:g.43047064C>A	ENSP00000340378:p.His367Asn	1					CCDC30_ENST00000342022.4_Missense_Mutation_p.H367N|CCDC30_ENST00000507855.1_Missense_Mutation_p.H156N|CCDC30_ENST00000390640.4_Missense_Mutation_p.H156N|CCDC30_ENST00000428554.2_Missense_Mutation_p.H367N	p.H367N			2	2	4	2.117161	Q5VVM6	CCD30_HUMAN		7	1099	+			Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	0	1	hg19	c.1099C>A	CCDS30690.1	0	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701346	0.30142	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.65	1.32	0.21799	5.65	1.32	0.21799	.	0.550040	0.19977	N	0.101853	T	0.32194	0.0821	L	0.38838	1.175	0.09310	N	1	B;B;B	0.22003	0.002;0.0;0.063	B;B;B	0.15870	0.001;0.001;0.014	T	0.16070	-1.0415	10	0.24483	T	0.36	.	8.5805	0.33626	0.3756:0.5512:0.0:0.0732	.	367;151;156	Q5VVM6;Q6N081;Q5VVM6-2	CCD30_HUMAN;.;.	N	367;156;367;367;156	ENSP00000397035:H367N;ENSP00000426711:H156N;ENSP00000340378:H367N;ENSP00000339280:H367N;ENSP00000375051:H156N	ENSP00000340378:H367N	H	+	1	0	0	CCDC30	42819651	42819651	0.497000	0.26067	0.064000	0.19789	0.955000	0.61496	0.970000	0.29383	0.377000	0.24735	0.650000	0.86243	CAT	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	0	0	1	2	2	2	2	0	0	0	0	121	121	121	121	1	3.530000	-2.527275	1	0.190000	NM_025030		0	14	15	0	684	675	0		1	0		0	0	121	0	0	0.999734	9.473108e-03	0	0	0	7	0	14	684
LRRC7	57554	broad.mit.edu	37	1	70446077	70446077	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:70446077C>A	ENST00000035383.5	+	7	643	c.613C>A	c.(613-615)Caa>Aaa	p.Q205K	LRRC7_ENST00000415775.2_5'UTR|LRRC7_ENST00000310961.5_Missense_Mutation_p.Q210K	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	205						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.Q205K(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AGTTCTGGATCAAATACAAAA	0.328																																						ENST00000035383.5	0.420000	0.170000	0.360000	0.230000	0.280000	0.298518	0.280000	0.280000																										1	Substitution - Missense(1)	p.Q205K(1)	lung(1)	162						c.(613-615)Caa>Aaa		leucine rich repeat containing 7							162.0	167.0	165.0					1																	70446077		2203	4300	6503	SO:0001583	missense	57554	0	0					g.chr1:70446077C>A		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.613C>A	chr1.hg19:g.70446077C>A	ENSP00000035383:p.Gln205Lys	1					LRRC7_ENST00000310961.5_Missense_Mutation_p.Q210K|LRRC7_ENST00000415775.2_5'UTR	p.Q205K	NM_020794.2	NP_065845.1	2	2	4	2.117161	Q96NW7	LRRC7_HUMAN		7	643	+			Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	0	1	hg19	c.613C>A	CCDS645.1	0	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679363	0.68042	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.23950	1.88;1.9	5.25	5.25	0.73442	5.25	5.25	0.73442	.	0.059688	0.64402	D	0.000002	T	0.11153	0.0272	N	0.13168	0.305	0.80722	D	1	P	0.40197	0.706	B	0.43623	0.425	T	0.11299	-1.0593	10	0.25751	T	0.34	.	16.3726	0.83370	0.0:1.0:0.0:0.0	.	205	Q96NW7	LRRC7_HUMAN	K	210;205;28	ENSP00000309245:Q210K;ENSP00000035383:Q205K	ENSP00000035383:Q205K	Q	+	1	0	0	LRRC7	70218665	70218665	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.238000	0.78173	2.608000	0.88229	0.650000	0.86243	CAA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.328	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	0	0	1	2	2	2	2	0	0	0	0	138	138	138	137	1	3.530000	-2.693470	1	0.190000	NM_020794		0	22	23	0	939	921	0		1			0	0	138	0	0	0.999998	0	0	0	0	0	0	22	939
ZZZ3	26009	broad.mit.edu	37	1	78047706	78047706	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:78047706G>T	ENST00000370801.3	-	7	2225	c.1750C>A	c.(1750-1752)Cgt>Agt	p.R584S	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.R90S	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	584					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TGTCTTTTACGATTTTTAAAT	0.323																																						ENST00000370801.3	0.780000	0.350000	0.670000	0.440000	0.540000	0.560062	0.540000	0.530000																										0				39						c.(1750-1752)Cgt>Agt		zinc finger, ZZ-type containing 3							61.0	70.0	67.0					1																	78047706		2200	4299	6499	SO:0001583	missense	26009	0	0					g.chr1:78047706G>T	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.1750C>A	chr1.hg19:g.78047706G>T	ENSP00000359837:p.Arg584Ser	1					ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.R90S	p.R584S	NM_015534.4	NP_056349.1	2	2	4	2.117161	Q8IYH5	ZZZ3_HUMAN		7	2225	-			B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	ENST00000370801.3	1	0	hg19	c.1750C>A	CCDS677.1	0	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886661	0.51908	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	.	.	.	5.33	4.41	0.53225	5.33	4.41	0.53225	.	0.132552	0.51477	D	0.000085	T	0.32734	0.0839	L	0.40543	1.245	0.48901	D	0.999723	B;P;P	0.44877	0.369;0.845;0.841	B;B;B	0.44108	0.197;0.256;0.441	T	0.08126	-1.0737	9	0.25106	T	0.35	.	14.2206	0.65823	0.0726:0.0:0.9274:0.0	.	90;584;584	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	S	584;90	.	ENSP00000359834:R90S	R	-	1	0	0	ZZZ3	77820294	77820294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.551000	0.67274	1.373000	0.46208	0.655000	0.94253	CGT	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.323	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	1	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	3.530000	-2.768866	1	0.190000	NM_015534		0	24	24	0	531	522	0		1	0		0	0	92	0	0	1.000000	3.241572e-01	0	0	0	26	0	24	531
WDR63	126820	broad.mit.edu	37	1	85595745	85595745	+	Missense_Mutation	SNP	C	C	A	rs143304188		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:85595745C>A	ENST00000294664.6	+	22	2662	c.2482C>A	c.(2482-2484)Cgt>Agt	p.R828S	WDR63_ENST00000326813.8_Missense_Mutation_p.R789S|WDR63_ENST00000370596.1_Missense_Mutation_p.R789S	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	828										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		CAAAAAAATTCGTGAGCAAGA	0.368																																						ENST00000294664.6	0.760000	0.350000	0.650000	0.440000	0.540000	0.552507	0.540000	0.520000																										0				36						c.(2482-2484)Cgt>Agt		WD repeat domain 63							93.0	102.0	99.0					1																	85595745		2203	4300	6503	SO:0001583	missense	126820	1	121412	38				g.chr1:85595745C>A		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.2482C>A	chr1.hg19:g.85595745C>A	ENSP00000294664:p.Arg828Ser	0					WDR63_ENST00000326813.8_Missense_Mutation_p.R789S|WDR63_ENST00000370596.1_Missense_Mutation_p.R789S	p.R828S	NM_145172.3	NP_660155.2	2	2	4	2.091950	Q8IWG1	WDR63_HUMAN		22	2662	+			A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	ENST00000294664.6	1	0	hg19	c.2482C>A	CCDS702.1	0	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313546	0.40996	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664;ENST00000484007	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.43	4.48	0.54585	5.43	4.48	0.54585	.	0.207201	0.42053	D	0.000774	T	0.59169	0.2174	M	0.85041	2.73	0.39974	D	0.974832	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.954	T	0.62129	-0.6919	10	0.44086	T	0.13	-16.1661	13.8453	0.63463	0.2776:0.7224:0.0:0.0	.	789;828	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	S	789;789;828;110	ENSP00000359628:R789S;ENSP00000317463:R789S;ENSP00000294664:R828S;ENSP00000435544:R110S	ENSP00000294664:R828S	R	+	1	0	0	WDR63	85368333	85368333	0.974000	0.33945	0.995000	0.50966	0.030000	0.12068	1.142000	0.31540	2.546000	0.85860	0.655000	0.94253	CGT	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.368	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	1	0	1	2	2	2	2	0	0	0	0	122	122	122	122	1	3.530000	-3.760306	1	0.190000	NM_145172		0	26	26	0	582	578	0		1	0		0	0	122	0	0	1.000000	2.015162e-03	0	0	0	2	0	26	582
ABCA4	24	broad.mit.edu	37	1	94466426	94466426	+	Nonsense_Mutation	SNP	G	G	A	rs61750654		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:94466426G>A	ENST00000370225.3	-	47	6531	c.6445C>T	c.(6445-6447)Cga>Tga	p.R2149*	ABCA4_ENST00000536513.1_Nonsense_Mutation_p.R419*|ABCA4_ENST00000465352.1_5'Flank|ABCA4_ENST00000535881.1_Nonsense_Mutation_p.R268*	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	2149	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> L (in STGD1).		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CCCATACATCGAAAGGCGCCC	0.562																																						ENST00000370225.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999975	0.990000	1.000000																										0				147	GRCh37	CM990078	ABCA4	M	rs140142529	c.(6445-6447)Cga>Tga		ATP-binding cassette, sub-family A (ABC1), member 4		G	stop/ARG	0,4406		0,0,2203	159.0	124.0	136.0		6445	5.8	1.0	1	dbSNP_134	136	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	ABCA4	NM_000350.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		2149/2274	94466426	1,13005	2203	4300	6503	SO:0001587	stop_gained	24	2	121412	37				g.chr1:94466426G>A	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.6445C>T	chr1.hg19:g.94466426G>A	ENSP00000359245:p.Arg2149*	0					ABCA4_ENST00000535881.1_Nonsense_Mutation_p.R268*|ABCA4_ENST00000465352.1_5'Flank|ABCA4_ENST00000536513.1_Nonsense_Mutation_p.R419*	p.R2149*	NM_000350.2	NP_000341.2	2	2	4	2.091950	P78363	ABCA4_HUMAN		47	6531	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	O15112|O60438|O60915|Q0QD48|Q4LE31	Nonsense_Mutation	SNP	ENST00000370225.3	0	1	hg19	c.6445C>T	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.739809	0.97801	0.0	1.16E-4	ENSG00000198691	ENST00000546054;ENST00000370225;ENST00000536513;ENST00000535881	.	.	.	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.166997	0.50627	D	0.000112	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0922	0.59172	0.0:0.0:0.7351:0.2649	rs61750654	.	.	.	X	941;2149;419;268	.	ENSP00000359245:R2149X	R	-	1	2	2	ABCA4	94239014	94239014	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.696000	0.68287	2.779000	0.95612	0.655000	0.94253	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.562	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	3.530000	-19.610750	1	0.190000	NM_000350		0	48	47	0	326	324	1		1	1		0	0	72	0	0	1.000000	8.518733e-02	0	2	0	2	0	48	326
OR2T4	127074	broad.mit.edu	37	1	248524891	248524891	+	Silent	SNP	C	C	T	rs200949727		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr1:248524891C>T	ENST00000366475.1	+	1	9	c.9C>T	c.(7-9)aaC>aaT	p.N3N		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCATGGACAACATCACCTGGA	0.468													c|||	1	0.000199681	0.0	0.0014	5008	,	,		19293	0.0		0.0	False		,,,				2504	0.0					ENST00000366475.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999911	0.990000	1.000000																										0				56						c.(7-9)aaC>aaT		olfactory receptor, family 2, subfamily T, member 4							71.0	68.0	69.0					1																	248524891		2203	4300	6503	SO:0001819	synonymous_variant	127074	0	0					g.chr1:248524891C>T	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.9C>T	chr1.hg19:g.248524891C>T		0						p.N3N	NM_001004696.1	NP_001004696.1	2	2	4	2.082668	Q8NH00	OR2T4_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)	1	9	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		Q6IEZ8	Silent	SNP	ENST00000366475.1	1	1	hg19	c.9C>T	CCDS31113.1	1																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.468	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	1	0	1	2	2	2	2	0	0	0	0	67	67	67	60	1	3.530000	-3.318880	1	0.190000	NM_001004696		0	42	41	0	293	283	1		1			0	0	67	0	0	1.000000	0	0	0	0	0	0	42	293
SALL4	57167	broad.mit.edu	37	20	50401200	50401200	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr20:50401200C>A	ENST00000217086.4	-	4	2877	c.2766G>T	c.(2764-2766)gcG>gcT	p.A922A	SALL4_ENST00000371539.3_Silent_p.A145A|SALL4_ENST00000395997.3_Silent_p.A485A	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	922					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGTTATTGTTCGCCCCGTGTG	0.473																																						ENST00000217086.4	0.740000	0.280000	0.620000	0.370000	0.480000	0.502579	0.480000	0.480000																										0				63						c.(2764-2766)gcG>gcT		spalt-like transcription factor 4							83.0	73.0	77.0					20																	50401200		2203	4300	6503	SO:0001819	synonymous_variant	57167	0	0					g.chr20:50401200C>A	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2766G>T	chr20.hg19:g.50401200C>A		0					SALL4_ENST00000395997.3_Silent_p.A485A|SALL4_ENST00000371539.3_Silent_p.A145A	p.A922A	NM_020436.3	NP_065169.1	1	2	3	1.915087	Q9UJQ4	SALL4_HUMAN		4	2877	-			A2A2D8|Q540H3|Q6Y8G6	Silent	SNP	ENST00000217086.4	1	0	hg19	c.2766G>T	CCDS13438.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.473	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3	1	0	1	2	2	2	2	0	0	0	0	87	87	87	86	1	3.530000	-2.930996	1	0.190000			0	16	16	0	369	362	0		1	0		0	0	87	0	0	0.999925	1.402038e-01	0	0	0	14	0	16	369
DSCAM	1826	broad.mit.edu	37	21	41423897	41423897	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr21:41423897G>T	ENST00000400454.1	-	30	5650	c.5173C>A	c.(5173-5175)Cgg>Agg	p.R1725R		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1725					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GTTCCCGGCCGAGCGTCTGAA	0.483																																					Melanoma(134;970 1778 1785 21664 32388)	ENST00000400454.1	0.610000	0.260000	0.520000	0.330000	0.410000	0.430632	0.410000	0.410000																										0				142						c.(5173-5175)Cgg>Agg		Down syndrome cell adhesion molecule							133.0	135.0	134.0					21																	41423897		1950	4151	6101	SO:0001819	synonymous_variant	1826	0	0					g.chr21:41423897G>T	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5173C>A	chr21.hg19:g.41423897G>T		1						p.R1725R	NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	0	2	2	1.761989	O60469	DSCAM_HUMAN		30	5650	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	O60468	Silent	SNP	ENST00000400454.1	1	0	hg19	c.5173C>A	CCDS42929.1	0																																																																																								0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.483	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	1	0	1	2	2	2	2	0	0	0	0	133	133	133	133	1	3.530000	-2.737967	1	0.190000	NM_001389		0	20	19	0	487	480	0		1			0	0	133	0	0	0.999995	0	0	0	0	0	0	20	487
TUBA8	51807	broad.mit.edu	37	22	18606952	18606952	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr22:18606952C>T	ENST00000330423.3	+	3	329	c.256C>T	c.(256-258)Ctc>Ttc	p.L86F	TUBA8_ENST00000316027.6_Missense_Mutation_p.L20F	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	86					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						CTACCGCCAGCTCTTCCATCC	0.582																																						ENST00000330423.3	1.000000	0.590000	1.000000	0.770000	0.990000	0.913576	0.990000	1.000000																										0				14						c.(256-258)Ctc>Ttc		tubulin, alpha 8							65.0	60.0	62.0					22																	18606952		2203	4300	6503	SO:0001583	missense	51807	0	0					g.chr22:18606952C>T	AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.256C>T	chr22.hg19:g.18606952C>T	ENSP00000333326:p.Leu86Phe	0					TUBA8_ENST00000316027.6_Missense_Mutation_p.L20F	p.L86F	NM_018943.2	NP_061816.1	1	2	3	1.942683	Q9NY65	TBA8_HUMAN		3	329	+			B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	ENST00000330423.3	1	1	hg19	c.256C>T	CCDS13751.1	1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.565399	0.65651	.	.	ENSG00000183785	ENST00000426208;ENST00000316027;ENST00000330423;ENST00000416740	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.11	5.11	0.69529	5.11	5.11	0.69529	Tubulin/FtsZ, GTPase domain (4);	0.065611	0.64402	N	0.000012	D	0.88599	0.6480	H	0.95224	3.64	0.54753	D	0.999981	P;D;P	0.76494	0.767;0.999;0.767	B;D;B	0.67103	0.356;0.949;0.36	D	0.91998	0.5608	10	0.87932	D	0	.	17.8832	0.88846	0.0:1.0:0.0:0.0	.	110;86;85	C9J2C0;Q9NY65;Q7Z3M3	.;TBA8_HUMAN;.	F	20;20;86;110	ENSP00000407624:L20F;ENSP00000318575:L20F;ENSP00000333326:L86F;ENSP00000412646:L110F	ENSP00000318575:L20F	L	+	1	0	0	TUBA8	16986952	16986952	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.554000	0.86153	0.462000	0.41574	CTC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.582	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	1	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	3.530000	-3.318846	1	0.190000	NM_018943		0	15	15	0	161	156	0		1	1		0	0	45	0	0	0.999875	3.601247e-01	0	2	0	12	0	15	161
SNAP29	9342	broad.mit.edu	37	22	21242113	21242113	+	Silent	SNP	C	C	A	rs148156702		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr22:21242113C>A	ENST00000215730.7	+	5	894	c.766C>A	c.(766-768)Cga>Aga	p.R256R	AC007308.7_ENST00000608856.1_RNA	NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa	256	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)	p.R256*(2)		breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			AAGAAAAGTTCGACAACTCTG	0.353																																						ENST00000215730.7	0.850000	0.330000	0.710000	0.430000	0.560000	0.581392	0.560000	0.540000																										2	Substitution - Nonsense(2)	p.R256*(2)	large_intestine(1)|endometrium(1)	9						c.(766-768)Cga>Aga		synaptosomal-associated protein, 29kDa							115.0	103.0	107.0					22																	21242113		2203	4300	6503	SO:0001819	synonymous_variant	9342	0	0					g.chr22:21242113C>A	AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.766C>A	chr22.hg19:g.21242113C>A		0					AC007308.7_ENST00000608856.1_RNA	p.R256R	NM_004782.3	NP_004773.1	1	2	3	1.942683	O95721	SNP29_HUMAN	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)	5	894	+	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)		Silent	SNP	ENST00000215730.7	1	0	hg19	c.766C>A	CCDS13784.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.353	SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320000.4	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	3.530000	-3.139115	1	0.190000	NM_004782		0	16	16	0	316	310	0		1	0		0	0	56	0	0	0.999928	9.185550e-01	0	0	0	88	0	16	316
CCDC157	550631	broad.mit.edu	37	22	30766541	30766541	+	Missense_Mutation	SNP	C	C	T	rs536552530		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr22:30766541C>T	ENST00000405659.1	+	5	1356	c.647C>T	c.(646-648)aCg>aTg	p.T216M	CCDC157_ENST00000338306.3_Missense_Mutation_p.T216M			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	216										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						ACCATTGAGACGGCCCTGGTG	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20139	0.0		0.0	False		,,,				2504	0.0					ENST00000405659.1	1.000000	0.780000	1.000000	0.950000	0.990000	0.977408	0.990000	1.000000																										0				15						c.(646-648)aCg>aTg		coiled-coil domain containing 157							92.0	81.0	84.0					22																	30766541		2203	4300	6503	SO:0001583	missense	550631	6	121412	40				g.chr22:30766541C>T	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.647C>T	chr22.hg19:g.30766541C>T	ENSP00000385357:p.Thr216Met	0					CCDC157_ENST00000338306.3_Missense_Mutation_p.T216M	p.T216M			1	2	3	1.942683	Q569K6	CC157_HUMAN		5	1356	+			Q0VD76|Q9BYA4	Missense_Mutation	SNP	ENST00000405659.1	1	1	hg19	c.647C>T	CCDS33632.2	1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961385	0.92791	.	.	ENSG00000187860	ENST00000405659;ENST00000338306	T;T	0.32515	1.45;1.45	5.54	5.54	0.83059	5.54	5.54	0.83059	.	0.129526	0.53938	D	0.000060	T	0.55273	0.1910	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.54490	-0.8286	10	0.87932	D	0	-22.7807	19.2866	0.94077	0.0:1.0:0.0:0.0	.	216	Q569K6	CC157_HUMAN	M	216	ENSP00000385357:T216M;ENSP00000343087:T216M	ENSP00000343087:T216M	T	+	2	0	0	CCDC157	29096541	29096541	1.000000	0.71417	0.959000	0.39883	0.856000	0.48823	7.005000	0.76323	2.884000	0.98904	0.655000	0.94253	ACG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.622	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320936.1	1	0	1	2	14	2	2	0	0	0	1	72	72	72	70	1	3.530000	-8.628704	1	0.190000	NM_001017437		0	27	27	0	245	242	0		1	0		0	0	72	0	0	0.987529	0	0	0	0	1	0	27	245
CSF2RB	1439	broad.mit.edu	37	22	37333569	37333569	+	Silent	SNP	G	G	A	rs140662059		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr22:37333569G>A	ENST00000403662.3	+	14	1941	c.1719G>A	c.(1717-1719)ccG>ccA	p.P573P	CSF2RB_ENST00000406230.1_Silent_p.P579P|CSF2RB_ENST00000262825.5_Silent_p.P579P|CSF2RB_ENST00000536485.1_Silent_p.P520P			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	573					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	AGCCAGGCCCGCCTGCCGCCT	0.647																																						ENST00000403662.3	1.000000	0.970000	1.000000	0.990000	0.990000	0.997053	0.990000	1.000000																										0				42						c.(1717-1719)ccG>ccA		colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	Sargramostim(DB00020)	G		0,4404		0,0,2202	21.0	24.0	23.0		1719	-10.7	0.0	22	dbSNP_134	23	2,8592		0,2,4295	no	coding-synonymous	CSF2RB	NM_000395.2		0,2,6497	AA,AG,GG		0.0233,0.0,0.0154		573/898	37333569	2,12996	2202	4297	6499	SO:0001819	synonymous_variant	1439	4	121378	33				g.chr22:37333569G>A	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1719G>A	chr22.hg19:g.37333569G>A		0					CSF2RB_ENST00000262825.5_Silent_p.P579P|CSF2RB_ENST00000536485.1_Silent_p.P520P|CSF2RB_ENST00000406230.1_Silent_p.P579P	p.P573P			1	2	3	1.942683	P32927	IL3RB_HUMAN		14	1941	+			Q5JZI1|Q6ICE0	Silent	SNP	ENST00000403662.3	1	1	hg19	c.1719G>A	CCDS13936.1	1																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.647	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	0	0	1	2	2	2	2	0	0	0	0	34	34	34	28	1	3.530000	-20.000000	1	0.190000	NM_000395		0	16	16	0	100	92	1		1	0		0	0	34	0	0	0.999920	5.847458e-02	0	0	0	3	0	16	100
CYB5R3	1727	broad.mit.edu	37	22	43026970	43026970	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr22:43026970C>A	ENST00000352397.5	-	4	503	c.251G>T	c.(250-252)cGa>cTa	p.R84L	CYB5R3_ENST00000407623.3_Missense_Mutation_p.R61L|CYB5R3_ENST00000402438.1_Missense_Mutation_p.R61L|CYB5R3_ENST00000361740.4_Missense_Mutation_p.R117L|CYB5R3_ENST00000396303.3_Missense_Mutation_p.R61L|CYB5R3_ENST00000407332.1_Missense_Mutation_p.R61L	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	84	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	TCCATCAATTCGAGCCGAGAG	0.587																																						ENST00000352397.5	0.880000	0.300000	0.720000	0.410000	0.550000	0.571528	0.550000	0.540000																										0				6						c.(250-252)cGa>cTa		cytochrome b5 reductase 3	Flavin adenine dinucleotide(DB03147)						118.0	97.0	104.0					22																	43026970		2203	4300	6503	SO:0001583	missense	1727	0	0					g.chr22:43026970C>A	M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.251G>T	chr22.hg19:g.43026970C>A	ENSP00000338461:p.Arg84Leu	0					CYB5R3_ENST00000407623.3_Missense_Mutation_p.R61L|CYB5R3_ENST00000361740.4_Missense_Mutation_p.R117L|CYB5R3_ENST00000402438.1_Missense_Mutation_p.R61L|CYB5R3_ENST00000396303.3_Missense_Mutation_p.R61L|CYB5R3_ENST00000407332.1_Missense_Mutation_p.R61L	p.R84L	NM_000398.6	NP_000389.1	1	2	3	1.942683	P00387	NB5R3_HUMAN		4	503	-			B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Missense_Mutation	SNP	ENST00000352397.5	1	0	hg19	c.251G>T	CCDS33658.1	0	.	.	.	.	.	.	.	.	.	.	C	12.04	1.818274	0.32145	.	.	ENSG00000100243	ENST00000361740;ENST00000396303;ENST00000352397;ENST00000407623;ENST00000407332;ENST00000402438;ENST00000438270	D;D;D;D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95	3.73	0.507	0.16967	3.73	0.507	0.16967	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);Oxidoreductase, FAD-binding domain (1);	0.257317	0.35495	N	0.003177	T	0.81508	0.4837	M	0.73962	2.25	0.09310	N	0.999999	P;B	0.35493	0.505;0.013	B;B	0.34138	0.176;0.01	T	0.73553	-0.3946	10	0.62326	D	0.03	-6.1245	8.6969	0.34301	0.0:0.7335:0.0:0.2665	.	117;84	B7Z7L3;P00387	.;NB5R3_HUMAN	L	117;61;84;61;61;61;61	ENSP00000354468:R117L;ENSP00000379597:R61L;ENSP00000338461:R84L;ENSP00000384834:R61L;ENSP00000384457:R61L;ENSP00000385679:R61L;ENSP00000403439:R61L	ENSP00000338461:R84L	R	-	2	0	0	CYB5R3	41356914	41356914	0.739000	0.28196	0.001000	0.08648	0.613000	0.37349	2.646000	0.46630	0.202000	0.20498	-0.362000	0.07510	CGA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.587	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320439.1	1	0	1	2	2	2	2	0	0	0	0	63	63	63	62	1	3.530000	-2.933916	1	0.190000			0	12	12	0	245	240	0		1	0		0	0	63	0	0	0.999074	9.999998e-01	0	0	0	759	0	12	245
WNT7B	7477	broad.mit.edu	37	22	46327040	46327040	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr22:46327040G>T	ENST00000339464.4	-	3	882	c.508C>A	c.(508-510)Cgg>Agg	p.R170R	WNT7B_ENST00000409496.3_Silent_p.R174R|WNT7B_ENST00000410058.1_Silent_p.R170R|WNT7B_ENST00000410089.1_Silent_p.R154R	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	170					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TTGATCTCCCGAGCGTCCACG	0.657																																						ENST00000339464.4	1.000000	0.580000	1.000000	0.730000	0.910000	0.883986	0.910000	1.000000																										0				19						c.(508-510)Cgg>Agg		wingless-type MMTV integration site family, member 7B							42.0	44.0	44.0					22																	46327040		2203	4300	6503	SO:0001819	synonymous_variant	7477	2	121324	34				g.chr22:46327040G>T	AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.508C>A	chr22.hg19:g.46327040G>T		0					WNT7B_ENST00000410089.1_Silent_p.R154R|WNT7B_ENST00000410058.1_Silent_p.R170R|WNT7B_ENST00000409496.3_Silent_p.R174R	p.R170R	NM_058238.2	NP_478679.1	1	2	3	1.942683	P56706	WNT7B_HUMAN		3	882	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	B8A596|Q96Q12	Silent	SNP	ENST00000339464.4	1	0	hg19	c.508C>A	CCDS33667.1	1																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.657	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	55	1	3.530000	-2.966627	1	0.190000	NM_058238		0	20	20	0	234	232	0		1	0		0	0	57	0	0	0.999996	3.777756e-01	0	0	0	16	0	20	234
MYCN	4613	broad.mit.edu	37	2	16086208	16086208	+	Silent	SNP	C	C	A	rs144531796	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr2:16086208C>A	ENST00000281043.3	+	3	1681	c.1384C>A	c.(1384-1386)Cgg>Agg	p.R462R		NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	462					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			TGAACACGCTCGGACTTGCTA	0.428			A		neuroblastoma																																	ENST00000281043.3	1.000000	0.520000	0.900000	0.620000	0.750000	0.765249	0.750000	1.000000				Dom	yes			Dom	yes		2	2p24.1	2p24.1	4613	A	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""				O	O			neuroblastoma		0				31						c.(1384-1386)Cgg>Agg		v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog							59.0	67.0	64.0					2																	16086208		2202	4300	6502	SO:0001819	synonymous_variant	4613	6	121406	42				g.chr2:16086208C>A	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.1384C>A	chr2.hg19:g.16086208C>A		0						p.R462R	NM_005378.4	NP_005369.2	2	2	4	2.081774	P04198	MYCN_HUMAN	GBM - Glioblastoma multiforme(3;0.000332)	3	1681	+	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		Q53XS5|Q6LDT9	Silent	SNP	ENST00000281043.3	1	0	hg19	c.1384C>A	CCDS1687.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.428	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	1	0	1	2	2	2	2	0	0	0	0	109	109	109	109	1	3.530000	-2.522905	1	0.190000	NM_005378		0	30	29	0	471	463	0		1	0		0	0	109	0	0	1.000000	1.118422e-02	0	0	0	3	0	30	471
SPOPL	339745	broad.mit.edu	37	2	139326586	139326586	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr2:139326586G>T	ENST00000280098.4	+	11	1494	c.1115G>T	c.(1114-1116)cGa>cTa	p.R372L	AC092620.2_ENST00000458007.2_RNA	NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	372					negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GAAGCCTTTCGAGCACTAGCA	0.423																																						ENST00000280098.4	1.000000	0.160000	0.320000	0.200000	0.250000	0.302109	0.250000	0.240000																										0				21						c.(1114-1116)cGa>cTa		speckle-type POZ protein-like							260.0	260.0	260.0					2																	139326586		2203	4300	6503	SO:0001583	missense	339745	0	0					g.chr2:139326586G>T		CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.1115G>T	chr2.hg19:g.139326586G>T	ENSP00000280098:p.Arg372Leu	0					AC092620.2_ENST00000458007.2_RNA	p.R372L	NM_001001664.2	NP_001001664.1	2	2	4	2.042778	Q6IQ16	SPOPL_HUMAN		11	1494	+				Missense_Mutation	SNP	ENST00000280098.4	0	1	hg19	c.1115G>T	CCDS33298.1	0	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933375	0.92458	.	.	ENSG00000144228	ENST00000280098	T	0.71461	-0.57	5.97	5.97	0.96955	5.97	5.97	0.96955	.	0.058159	0.64402	D	0.000001	T	0.79953	0.4535	L	0.58810	1.83	0.80722	D	1	D	0.58268	0.982	P	0.57057	0.812	T	0.76812	-0.2821	9	.	.	.	-11.9914	20.428	0.99075	0.0:0.0:1.0:0.0	.	372	Q6IQ16	SPOPL_HUMAN	L	372	ENSP00000280098:R372L	.	R	+	2	0	0	SPOPL	139043056	139043056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.837000	0.97791	0.655000	0.94253	CGA	0.310521		TCGA-XN-A8T3-01A-11D-A36O-08	0.423	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331897.1	0	0	1	2	2	2	2	0	0	0	0	273	273	273	269	1	3.530000	-1.876711	0	0.190000			0	28	28	0	1379	1360	0		1	0		0	0	273	0	0	1.000000	8.744944e-02	0	0	0	24	0	28	1379
TTN	7273	broad.mit.edu	37	2	179583118	179583118	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr2:179583118C>T	ENST00000591111.1	-	83	23988	c.23764G>A	c.(23764-23766)Gca>Aca	p.A7922T	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A8239T|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A6995T|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12113	Ig-like 61.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTACTGTGCATAATCCTCT	0.398																																						ENST00000591111.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999995	0.990000	1.000000																										0				1448						c.(23764-23766)Gca>Aca		titin							138.0	132.0	134.0					2																	179583118		1887	4115	6002	SO:0001583	missense	7273	0	0					g.chr2:179583118C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23764G>A	chr2.hg19:g.179583118C>T	ENSP00000465570:p.Ala7922Thr	0					TTN_ENST00000342992.6_Missense_Mutation_p.A6995T|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A8239T|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron	p.A7922T			2	2	4	2.042778	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	83	23988	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.23764G>A		1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626923	0.46840	.	.	ENSG00000155657	ENST00000342992	T	0.45276	0.9	6.16	6.16	0.99307	6.16	6.16	0.99307	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55433	0.1920	M	0.79926	2.475	0.80722	D	1	B	0.31459	0.324	B	0.36418	0.224	T	0.56823	-0.7915	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	7922	Q8WZ42	TITIN_HUMAN	T	6995	ENSP00000343764:A6995T	ENSP00000343764:A6995T	A	-	1	0	0	TTN	179291363	179291363	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.607000	0.61133	2.937000	0.99478	0.650000	0.86243	GCA	0.310521		TCGA-XN-A8T3-01A-11D-A36O-08	0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	44	44	44	43	1	3.530000	-19.921240	1	0.190000	NM_133378		0	45	45	0	273	270	0		1			0	0	44	0	0	1.000000	0	0	0	0	0	0	45	273
STAT1	6772	broad.mit.edu	37	2	191847210	191847210	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr2:191847210C>T	ENST00000361099.3	-	18	1868	c.1481G>A	c.(1480-1482)cGa>cAa	p.R494Q	STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Missense_Mutation_p.R494Q|STAT1_ENST00000392322.3_Missense_Mutation_p.R494Q|STAT1_ENST00000392323.2_Missense_Mutation_p.R496Q	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	494					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CTGAGCCCATCGTGCACATGG	0.463																																						ENST00000361099.3	1.000000	0.790000	1.000000	0.930000	0.990000	0.974466	0.990000	1.000000																										0				39						c.(1480-1482)cGa>cAa		signal transducer and activator of transcription 1, 91kDa							101.0	101.0	101.0					2																	191847210		2203	4300	6503	SO:0001583	missense	6772	0	0					g.chr2:191847210C>T		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1481G>A	chr2.hg19:g.191847210C>T	ENSP00000354394:p.Arg494Gln	0					STAT1_ENST00000392322.3_Missense_Mutation_p.R494Q|STAT1_ENST00000409465.1_Missense_Mutation_p.R494Q|STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000392323.2_Missense_Mutation_p.R496Q	p.R494Q	NM_007315.3	NP_009330.1	2	2	4	2.042778	P42224	STAT1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)	18	1868	-			A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	1	1	hg19	c.1481G>A	CCDS2309.1	1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.112096	0.37242	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.31	3.15	0.36227	5.31	3.15	0.36227	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.310219	0.34932	N	0.003580	T	0.61986	0.2391	L	0.31664	0.95	0.18873	N	0.999986	B;B	0.20780	0.048;0.005	B;B	0.17098	0.016;0.017	T	0.41945	-0.9480	10	0.12766	T	0.61	-3.6255	10.1437	0.42751	0.0:0.7608:0.0:0.2392	.	494;494	P42224-2;P42224	.;STAT1_HUMAN	Q	494;494;494;496	ENSP00000354394:R494Q;ENSP00000386244:R494Q;ENSP00000376136:R494Q;ENSP00000376137:R496Q	ENSP00000354394:R494Q	R	-	2	0	0	STAT1	191555455	191555455	0.002000	0.14202	0.932000	0.37286	0.981000	0.71138	0.290000	0.18975	1.304000	0.44892	0.655000	0.94253	CGA	0.310521		TCGA-XN-A8T3-01A-11D-A36O-08	0.463	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	1	0	1	2	2	2	2	0	0	0	0	92	92	92	92	1	3.530000	-12.316120	1	0.190000	NM_007315		0	44	44	0	465	459	0		1	1		0	0	92	0	0	1.000000	9.999954e-01	0	9	0	183	0	44	465
ALS2CR11	151254	broad.mit.edu	37	2	202466489	202466489	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr2:202466489G>T	ENST00000286195.3	-	4	533	c.489C>A	c.(487-489)ttC>ttA	p.F163L	ALS2CR11_ENST00000439140.1_Missense_Mutation_p.F163L|ALS2CR11_ENST00000439802.1_Missense_Mutation_p.F163L|ALS2CR11_ENST00000450242.1_Missense_Mutation_p.F163L	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	163								p.F163F(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TCACTTCATCGAACTTAATTA	0.313																																						ENST00000286195.3	1.000000	0.340000	0.780000	0.450000	0.590000	0.620800	0.590000	0.570000																										2	Substitution - coding silent(2)	p.F163F(2)	large_intestine(2)	33						c.(487-489)ttC>ttA		amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11							109.0	102.0	104.0					2																	202466489		2201	4290	6491	SO:0001583	missense	151254	0	0					g.chr2:202466489G>T	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.489C>A	chr2.hg19:g.202466489G>T	ENSP00000286195:p.Phe163Leu	0					ALS2CR11_ENST00000450242.1_Missense_Mutation_p.F163L|ALS2CR11_ENST00000439140.1_Missense_Mutation_p.F163L|ALS2CR11_ENST00000439802.1_Missense_Mutation_p.F163L	p.F163L	NM_152525.5	NP_689738.3	2	2	4	2.042778	Q53TS8	AL2SA_HUMAN		4	533	-			C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	ENST00000286195.3	1	0	hg19	c.489C>A	CCDS2349.1	0	.	.	.	.	.	.	.	.	.	.	G	16.32	3.090430	0.55968	.	.	ENSG00000155754	ENST00000286195;ENST00000439802;ENST00000439140;ENST00000450242	D;D;D;D	0.97066	-4.23;-4.23;-4.23;-4.23	5.02	2.58	0.30949	5.02	2.58	0.30949	.	0.263401	0.27406	N	0.019510	D	0.96981	0.9014	L	0.55481	1.735	0.29814	N	0.831439	D;B;P	0.89917	1.0;0.389;0.818	D;B;B	0.87578	0.998;0.081;0.186	D	0.92906	0.6343	10	0.42905	T	0.14	.	6.5355	0.22350	0.8033:0.0:0.1967:0.0	.	163;163;163	Q53TS8-2;E9PGG4;Q53TS8	.;.;AL2SA_HUMAN	L	163	ENSP00000286195:F163L;ENSP00000400672:F163L;ENSP00000409937:F163L;ENSP00000399016:F163L	ENSP00000286195:F163L	F	-	3	2	2	ALS2CR11	202174734	202174734	0.997000	0.39634	0.927000	0.36925	0.768000	0.43524	1.854000	0.39368	0.374000	0.24650	-0.474000	0.04947	TTC	0.310521		TCGA-XN-A8T3-01A-11D-A36O-08	0.313	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	1	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	3.530000	-4.747922	1	0.190000	NM_152525		0	16	16	0	333	325	0		1			0	0	54	0	0	0.999925	0	0	0	0	0	0	16	333
MPP4	58538	broad.mit.edu	37	2	202512489	202512489	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr2:202512489C>A	ENST00000409474.3	-	21	1851	c.1644G>T	c.(1642-1644)tcG>tcT	p.S548S	MPP4_ENST00000447335.2_Silent_p.S541S|MPP4_ENST00000359962.5_Silent_p.S548S|RNU6-651P_ENST00000411040.1_RNA|MPP4_ENST00000428900.2_Silent_p.S524S|MPP4_ENST00000315506.7_Silent_p.S504S|MPP4_ENST00000409143.1_Silent_p.S490S|MPP4_ENST00000396886.3_Silent_p.S473S	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	548	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						ACCTCATATTCGATGGCTTTA	0.348																																						ENST00000409474.3	1.000000	0.350000	0.910000	0.490000	0.660000	0.686171	0.660000	1.000000																										0				12						c.(1642-1644)tcG>tcT		membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)							138.0	130.0	132.0					2																	202512489		1847	4099	5946	SO:0001819	synonymous_variant	58538	0	0					g.chr2:202512489C>A	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1644G>T	chr2.hg19:g.202512489C>A		0					MPP4_ENST00000359962.5_Silent_p.S548S|MPP4_ENST00000315506.7_Silent_p.S504S|MPP4_ENST00000428900.2_Silent_p.S524S|RNU6-651P_ENST00000411040.1_RNA|MPP4_ENST00000447335.2_Silent_p.S541S|MPP4_ENST00000409143.1_Silent_p.S490S|MPP4_ENST00000396886.3_Silent_p.S473S	p.S548S	NM_033066.2	NP_149055	2	2	4	2.042778	Q96JB8	MPP4_HUMAN		21	1851	-			C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Silent	SNP	ENST00000409474.3	1	0	hg19	c.1644G>T	CCDS46491.1	0																																																																																								0.310521		TCGA-XN-A8T3-01A-11D-A36O-08	0.348	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	3.530000	-3.283854	1	0.190000			0	12	12	0	224	220	0		1			0	0	41	0	0	0.999097	0	0	0	0	0	0	12	224
CYP20A1	57404	broad.mit.edu	37	2	204154519	204154519	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr2:204154519C>A	ENST00000356079.4	+	10	1126	c.1003C>A	c.(1003-1005)Cga>Aga	p.R335R	CYP20A1_ENST00000429815.2_Silent_p.R343R|CYP20A1_ENST00000461371.1_3'UTR	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	335						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						TGAAACTGTTCGAACTGCCAA	0.323																																						ENST00000356079.4	1.000000	0.310000	0.650000	0.400000	0.500000	0.540820	0.500000	0.500000																										0				11						c.(1003-1005)Cga>Aga		cytochrome P450, family 20, subfamily A, polypeptide 1							66.0	63.0	64.0					2																	204154519		2203	4300	6503	SO:0001819	synonymous_variant	57404	0	0					g.chr2:204154519C>A	AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.1003C>A	chr2.hg19:g.204154519C>A		0					CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Silent_p.R343R	p.R335R	NM_177538.2	NP_803882.1	2	2	4	2.042778	Q6UW02	CP20A_HUMAN		10	1126	+			Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Silent	SNP	ENST00000356079.4	1	0	hg19	c.1003C>A	CCDS2357.1	0																																																																																								0.310521		TCGA-XN-A8T3-01A-11D-A36O-08	0.323	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	1	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	3.530000	-2.847844	1	0.190000	NM_020674		0	21	21	0	509	498	0		1	0		0	0	62	0	0	0.999997	3.663424e-01	0	0	0	31	0	21	509
SENP7	57337	broad.mit.edu	37	3	101044840	101044840	+	Silent	SNP	G	G	T	rs144603399		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:101044840G>T	ENST00000394095.2	-	24	3153	c.3100C>A	c.(3100-3102)Cga>Aga	p.R1034R	SENP7_ENST00000358203.3_Silent_p.R870R|SENP7_ENST00000314261.7_Silent_p.R968R|SENP7_ENST00000394091.1_Silent_p.R870R|SENP7_ENST00000394085.3_Silent_p.R222R|SENP7_ENST00000348610.3_Silent_p.R1001R|SENP7_ENST00000394094.2_Silent_p.R969R	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	1034	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						ATGAGCTCTCGAATATCTTCC	0.373																																						ENST00000394095.2	0.690000	0.280000	0.580000	0.360000	0.460000	0.477780	0.460000	0.440000																										0				44						c.(3100-3102)Cga>Aga		SUMO1/sentrin specific peptidase 7							157.0	139.0	145.0					3																	101044840		2203	4300	6503	SO:0001819	synonymous_variant	57337	0	0					g.chr3:101044840G>T		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.3100C>A	chr3.hg19:g.101044840G>T		0					SENP7_ENST00000348610.3_Silent_p.R1001R|SENP7_ENST00000358203.3_Silent_p.R870R|SENP7_ENST00000314261.7_Silent_p.R968R|SENP7_ENST00000394094.2_Silent_p.R969R|SENP7_ENST00000394091.1_Silent_p.R870R|SENP7_ENST00000394085.3_Silent_p.R222R	p.R1034R	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	2	2	4	2.085353	Q9BQF6	SENP7_HUMAN		24	3153	-			A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Silent	SNP	ENST00000394095.2	1	0	hg19	c.3100C>A	CCDS2941.2	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.373	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	3.530000	-3.193771	1	0.190000	NM_020654		0	18	18	0	476	466	0		1	0		0	0	93	0	0	0.999979	3.324091e-01	0	0	0	31	0	18	476
MRPL3	11222	broad.mit.edu	37	3	131219286	131219286	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:131219286G>T	ENST00000264995.3	-	3	504	c.357C>A	c.(355-357)gtC>gtA	p.V119V	MRPL3_ENST00000425847.2_Silent_p.V146V|MRPL3_ENST00000506946.1_5'UTR	NM_007208.3	NP_009139.1	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	119					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						GAAGTAATGTGACCACATGCT	0.398																																						ENST00000264995.3	0.420000	0.170000	0.350000	0.220000	0.280000	0.292199	0.280000	0.280000																										0				10						c.(355-357)gtC>gtA		mitochondrial ribosomal protein L3							156.0	121.0	133.0					3																	131219286		2203	4300	6503	SO:0001819	synonymous_variant	11222	0	0					g.chr3:131219286G>T	X06323	CCDS3071.1	3q21-q23	2012-09-13			ENSG00000114686	ENSG00000114686		"""Mitochondrial ribosomal proteins / large subunits"""	10379	protein-coding gene	gene with protein product		607118		RPML3		2891103	Standard	NM_007208		Approved	MRL3	uc003eoh.3	P09001	OTTHUMG00000159607	ENST00000264995.3:c.357C>A	chr3.hg19:g.131219286G>T		0					MRPL3_ENST00000506946.1_5'UTR|MRPL3_ENST00000425847.2_Silent_p.V146V	p.V119V	NM_007208.3	NP_009139.1	2	2	4	2.085353	P09001	RM03_HUMAN		3	504	-			Q6IBT2	Silent	SNP	ENST00000264995.3	0	1	hg19	c.357C>A	CCDS3071.1	0	.	.	.	.	.	.	.	.	.	.	G	3.702	-0.061285	0.07317	.	.	ENSG00000114686	ENST00000511168	.	.	.	5.62	4.73	0.59995	5.62	4.73	0.59995	.	.	.	.	.	T	0.71099	0.3300	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70498	-0.4855	4	.	.	.	-2.7541	15.3528	0.74402	0.0:0.1405:0.8595:0.0	.	.	.	.	N	134	.	.	H	-	1	0	0	MRPL3	132701976	132701976	1.000000	0.71417	0.999000	0.59377	0.354000	0.29330	4.626000	0.61269	1.340000	0.45581	0.555000	0.69702	CAC	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.398	MRPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356471.3	0	0	1	2	2	2	2	0	0	0	0	166	166	166	165	1	3.530000	-3.186564	1	0.190000	NM_007208		0	21	20	0	918	910	0		1	0		0	0	166	0	0	0.999997	6.651004e-01	0	0	0	100	0	21	918
EPHB1	2047	broad.mit.edu	37	3	134873104	134873104	+	Silent	SNP	C	C	A	rs202048188		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:134873104C>A	ENST00000398015.3	+	6	1778	c.1408C>A	c.(1408-1410)Cgg>Agg	p.R470R	EPHB1_ENST00000493838.1_Silent_p.R31R	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	470	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CTATGAGATCCGGTACTATGA	0.542																																						ENST00000398015.3	0.530000	0.140000	0.420000	0.210000	0.300000	0.321071	0.300000	0.280000																										0				130						c.(1408-1410)Cgg>Agg		EPH receptor B1							102.0	106.0	105.0					3																	134873104		2187	4299	6486	SO:0001819	synonymous_variant	2047	0	0					g.chr3:134873104C>A	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1408C>A	chr3.hg19:g.134873104C>A		0					EPHB1_ENST00000493838.1_Silent_p.R31R	p.R470R	NM_004441.4	NP_004432.1	2	2	4	2.085353	P54762	EPHB1_HUMAN		6	1778	+			A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	ENST00000398015.3	0	1	hg19	c.1408C>A	CCDS46921.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.542	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	0	0	1	2	2	2	2	0	0	0	0	83	83	83	80	1	3.530000	-2.980051	1	0.190000	NM_004441		0	9	8	0	377	371	0		1			0	0	83	0	0	0.993853	0	0	0	0	0	0	9	377
PAQR9	344838	broad.mit.edu	37	3	142681266	142681266	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:142681266C>A	ENST00000340634.3	-	1	912	c.913G>T	c.(913-915)Gac>Tac	p.D305Y	RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	305						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						CCGATAATGTCGAAAAGACCC	0.577																																						ENST00000340634.3	0.940000	0.360000	0.780000	0.480000	0.620000	0.637980	0.620000	0.600000																										0				22						c.(913-915)Gac>Tac		progestin and adipoQ receptor family member IX							65.0	68.0	67.0					3																	142681266		2203	4300	6503	SO:0001583	missense	344838	0	0					g.chr3:142681266C>A	AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.913G>T	chr3.hg19:g.142681266C>A	ENSP00000341564:p.Asp305Tyr	0					RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA	p.D305Y	NM_198504.2	NP_940906.1	2	2	4	2.085353	Q6ZVX9	PAQR9_HUMAN		1	912	-			Q147T6	Missense_Mutation	SNP	ENST00000340634.3	1	0	hg19	c.913G>T	CCDS3128.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.51|18.51	3.639348|3.639348	0.67244|0.67244	.|.	.|.	ENSG00000188582|ENSG00000188582	ENST00000340634|ENST00000492509	T|.	0.38887|.	1.11|.	5.62|5.62	3.73|3.73	0.42828|0.42828	5.62|5.62	3.73|3.73	0.42828|0.42828	.|.	0.060822|.	0.64402|.	D|.	0.000005|.	T|T	0.73241|0.73241	0.3562|0.3562	M|M	0.81239|0.81239	2.535|2.535	0.51012|0.51012	D|D	0.999907|0.999907	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.74654|0.74654	-0.3593|-0.3593	10|5	0.87932|.	D|.	0|.	-44.4143|-44.4143	11.0086|11.0086	0.47649|0.47649	0.0:0.8011:0.1293:0.0696|0.0:0.8011:0.1293:0.0696	.|.	305|.	Q6ZVX9|.	PAQR9_HUMAN|.	Y|L	305|45	ENSP00000341564:D305Y|.	ENSP00000341564:D305Y|.	D|R	-|-	1|2	0|0	0|0	PAQR9|PAQR9	144163956|144163956	144163956|144163956	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.979000|0.979000	0.70002|0.70002	3.966000|3.966000	0.56795|0.56795	1.381000|1.381000	0.46364|0.46364	0.650000|0.650000	0.86243|0.86243	GAC|CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.577	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	71	1	3.530000	-4.858763	1	0.190000	NM_198504		0	16	14	0	313	308	0		1			0	0	72	0	0	0.999927	0	0	0	0	0	0	16	313
SPATA16	83893	broad.mit.edu	37	3	172634107	172634107	+	Splice_Site	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:172634107C>A	ENST00000351008.3	-	9	1686	c.1503G>T	c.(1501-1503)ttG>ttT	p.L501F		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	501					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			AAATACTTACCAATTCTGCCT	0.408																																						ENST00000351008.3	0.310000	0.100000	0.260000	0.140000	0.190000	0.204875	0.190000	0.200000																										0				43						c.(1501-1503)ttG>ttT		spermatogenesis associated 16							154.0	153.0	153.0					3																	172634107		2203	4300	6503	SO:0001630	splice_region_variant	83893	0	0					g.chr3:172634107C>A	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1503+1G>T	chr3.hg19:g.172634107C>A		0						p.L501F	NM_031955.5	NP_114161.3	2	2	4	2.085353	Q9BXB7	SPT16_HUMAN	LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)	9	1686	-	Ovarian(172;0.00319)|Breast(254;0.197)		Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Splice_Site	SNP	ENST00000351008.3	0	1	hg19	c.1503G>T	CCDS3221.1	0	.	.	.	.	.	.	.	.	.	.	C	17.85	3.491014	0.64074	.	.	ENSG00000144962	ENST00000351008	T	0.26660	1.72	6.16	6.16	0.99307	6.16	6.16	0.99307	.	0.109181	0.40908	D	0.000983	T	0.40546	0.1121	L	0.32530	0.975	0.44871	D	0.997886	D	0.63046	0.992	P	0.62298	0.9	T	0.01130	-1.1442	9	.	.	.	-5.1947	20.8598	0.99761	0.0:1.0:0.0:0.0	.	501	Q9BXB7	SPT16_HUMAN	F	501	ENSP00000341765:L501F	.	L	-	3	2	2	SPATA16	174116801	174116801	1.000000	0.71417	0.998000	0.56505	0.184000	0.23303	3.061000	0.49963	2.937000	0.99478	0.650000	0.86243	TTG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.408	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	0	0	1	2	2	2	2	0	0	0	0	168	168	168	166	1	3.530000	-1.905127	0	0.190000	NM_031955	Missense_Mutation	0	14	12	0	899	885	0		1			0	0	168	0	0	0.999718	0	0	0	0	0	0	14	899
NLGN1	22871	broad.mit.edu	37	3	173998609	173998609	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:173998609G>A	ENST00000457714.1	+	7	2417	c.1988G>A	c.(1987-1989)aGt>aAt	p.S663N	NLGN1_ENST00000401917.3_Missense_Mutation_p.S703N|NLGN1_ENST00000545397.1_Missense_Mutation_p.S663N|NLGN1_ENST00000361589.4_Missense_Mutation_p.S663N	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	680					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CAACAACCAAGTCCATTTTCA	0.468																																						ENST00000457714.1	1.000000	0.600000	1.000000	0.720000	0.860000	0.863504	0.860000	1.000000																										0				83						c.(1987-1989)aGt>aAt		neuroligin 1							108.0	110.0	109.0					3																	173998609		2203	4300	6503	SO:0001583	missense	22871	0	0					g.chr3:173998609G>A	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1988G>A	chr3.hg19:g.173998609G>A	ENSP00000392500:p.Ser663Asn	0					NLGN1_ENST00000401917.3_Missense_Mutation_p.S703N|NLGN1_ENST00000545397.1_Missense_Mutation_p.S663N|NLGN1_ENST00000361589.4_Missense_Mutation_p.S663N	p.S663N	NM_014932.2	NP_055747.1	2	2	4	2.085353	Q8N2Q7	NLGN1_HUMAN	LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)	7	2417	+	Ovarian(172;0.0025)		Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	1	1	hg19	c.1988G>A	CCDS3222.1	1	.	.	.	.	.	.	.	.	.	.	G	9.582	1.123955	0.20959	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.59	5.59	0.84812	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.50803	0.1637	N	0.24115	0.695	0.44694	D	0.997688	B	0.06786	0.001	B	0.06405	0.002	T	0.39482	-0.9612	10	0.21014	T	0.42	.	19.9651	0.97262	0.0:0.0:1.0:0.0	.	663	Q8N2Q7-2	.	N	663;663;663;703	ENSP00000392500:S663N;ENSP00000354541:S663N;ENSP00000441108:S663N;ENSP00000385750:S703N	ENSP00000354541:S663N	S	+	2	0	0	NLGN1	175481303	175481303	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.166000	0.64965	2.793000	0.96121	0.655000	0.94253	AGT	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.468	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	1	0	1	2	2	2	2	0	0	0	0	86	86	86	85	1	3.530000	-20.000000	1	0.190000	NM_014932		0	31	31	0	418	413	0		1	0		0	0	86	0	0	1.000000	5.180229e-03	0	1	0	1	0	31	418
MCF2L2	23101	broad.mit.edu	37	3	182925517	182925517	+	Missense_Mutation	SNP	C	C	A	rs143903251		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:182925517C>A	ENST00000328913.3	-	23	2888	c.2591G>T	c.(2590-2592)cGa>cTa	p.R864L	MCF2L2_ENST00000473233.1_Missense_Mutation_p.R864L|MCF2L2_ENST00000468976.1_5'Flank	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	864	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R864L(1)|p.R864Q(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGGTTTAAATCGAATCAAATC	0.438																																						ENST00000328913.3	0.820000	0.330000	0.690000	0.430000	0.550000	0.567721	0.550000	0.550000																										2	Substitution - Missense(2)	p.R864L(1)|p.R864Q(1)	ovary(1)|prostate(1)	72						c.(2590-2592)cGa>cTa		MCF.2 cell line derived transforming sequence-like 2		C	LEU/ARG	0,4406		0,0,2203	144.0	141.0	142.0		2591	4.8	1.0	3	dbSNP_134	142	1,8599	1.2+/-3.3	0,1,4299	no	missense	MCF2L2	NM_015078.2	102	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging	864/1115	182925517	1,13005	2203	4300	6503	SO:0001583	missense	23101	0	0					g.chr3:182925517C>A	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2591G>T	chr3.hg19:g.182925517C>A	ENSP00000328118:p.Arg864Leu	0					MCF2L2_ENST00000468976.1_5'Flank|MCF2L2_ENST00000473233.1_Missense_Mutation_p.R864L	p.R864L	NM_015078.2	NP_055893	2	2	4	2.085353	Q86YR7	MF2L2_HUMAN	all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)	23	2888	-	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	1	0	hg19	c.2591G>T	CCDS3243.1	0	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669066	0.88348	0.0	1.16E-4	ENSG00000053524	ENST00000328913;ENST00000473233	T;T	0.02525	4.26;4.26	4.8	4.8	0.61643	4.8	4.8	0.61643	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	T	0.11665	0.0284	L	0.58583	1.82	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.00585	-1.1658	10	0.54805	T	0.06	.	13.7009	0.62608	0.0:1.0:0.0:0.0	.	864	Q86YR7	MF2L2_HUMAN	L	864	ENSP00000328118:R864L;ENSP00000420070:R864L	ENSP00000328118:R864L	R	-	2	0	0	MCF2L2	184408211	184408211	0.985000	0.35326	0.987000	0.45799	0.991000	0.79684	5.629000	0.67798	2.370000	0.80446	0.491000	0.48974	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.438	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	1	0	0	2	2	2	2	0	0	0	0	101	101	101	101	1	3.530000	-4.155578	1	0.190000	NM_015078		0	18	17	0	397	393	0		1			0	0	101	0	0	0.999981	0	0	0	0	0	0	18	397
EIF4A2	1974	broad.mit.edu	37	3	186503747	186503747	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:186503747C>A	ENST00000323963.5	+	5	488	c.424C>A	c.(424-426)Cga>Aga	p.R142R	SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363548.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000440191.2_Silent_p.R143R|RP11-573D15.9_ENST00000577781.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363450.1_RNA|EIF4A2_ENST00000356531.5_Silent_p.R47R			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	142	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		AACAAATGTTCGAAATGAAAT	0.398			T	BCL6	NHL																																	ENST00000323963.5	0.950000	0.490000	0.830000	0.590000	0.700000	0.720121	0.700000	0.710000				Dom	yes			Dom	yes		3	3q27.3	3q27.3	1974	T	"""eukaryotic translation initiation factor 4A, isoform 2"""				L	L	BCL6		NHL		0				28						c.(424-426)Cga>Aga		eukaryotic translation initiation factor 4A2							95.0	88.0	91.0					3																	186503747		2203	4300	6503	SO:0001819	synonymous_variant	1974	0	0					g.chr3:186503747C>A	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.424C>A	chr3.hg19:g.186503747C>A		0					SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA|EIF4A2_ENST00000440191.2_Silent_p.R143R|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000356531.5_Silent_p.R47R|SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363548.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA	p.R142R			2	2	4	2.085353	Q14240	IF4A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	5	488	+	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		D3DNU9|Q53XJ6|Q96B90|Q96EA8	Silent	SNP	ENST00000323963.5	1	0	hg19	c.424C>A	CCDS3282.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.398	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	1	0	1	2	2	2	2	0	0	0	0	112	112	112	111	1	3.530000	-6.421663	1	0.190000	NM_001967		0	34	33	0	570	557	0		1	0		0	0	112	0	0	1.000000	1	0	1	0	506	0	34	570
THUMPD3	25917	broad.mit.edu	37	3	9416208	9416208	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:9416208G>T	ENST00000345094.3	+	5	1150	c.816G>T	c.(814-816)ttG>ttT	p.L272F	THUMPD3_ENST00000452837.2_Missense_Mutation_p.L272F|THUMPD3_ENST00000515662.2_Missense_Mutation_p.L272F|SETD5-AS1_ENST00000468186.1_RNA	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	272	THUMP. {ECO:0000255|PROSITE- ProRule:PRU00529}.					cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		AGGTTCTTTTGAACATCCATG	0.393																																						ENST00000345094.3	0.620000	0.280000	0.530000	0.350000	0.430000	0.447927	0.430000	0.440000																										0				19						c.(814-816)ttG>ttT		THUMP domain containing 3							160.0	150.0	153.0					3																	9416208		2203	4300	6503	SO:0001583	missense	25917	0	0					g.chr3:9416208G>T	AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.816G>T	chr3.hg19:g.9416208G>T	ENSP00000339532:p.Leu272Phe	0					THUMPD3_ENST00000515662.2_Missense_Mutation_p.L272F|SETD5-AS1_ENST00000468186.1_RNA|THUMPD3_ENST00000452837.2_Missense_Mutation_p.L272F	p.L272F	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	2	2	4	2.085353	Q9BV44	THUM3_HUMAN		5	1150	+	Medulloblastoma(99;0.227)		Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	ENST00000345094.3	1	1	hg19	c.816G>T	CCDS2573.1	0	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.68|16.68|16.68	3.190198|3.190198|3.190198	0.58017|0.58017|0.58017	.|.|.	.|.|.	ENSG00000134077|ENSG00000134077|ENSG00000134077	ENST00000416603|ENST00000452837;ENST00000345094;ENST00000515662|ENST00000441127	.|T;T;T|.	.|0.52526|.	.|0.66;0.66;0.66|.	5.57|5.57|5.57	4.7|4.7|4.7	0.59300|0.59300|0.59300	5.57|5.57|5.57	4.7|4.7|4.7	0.59300|0.59300|0.59300	.|THUMP (3);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	.|T|.	.|0.77624|.	.|0.4158|.	M|M|M	0.88570|0.88570|0.88570	2.965|2.965|2.965	0.58432|0.58432|0.58432	D|D|D	0.999997|0.999997|0.999997	.|D|.	.|0.76494|.	.|0.999|.	.|D|.	.|0.83275|.	.|0.996|.	.|T|.	.|0.80111|.	.|-0.1519|.	.|10|.	.|0.40728|.	.|T|.	.|0.16|.	-16.9958|-16.9958|-16.9958	10.3831|10.3831|10.3831	0.44123|0.44123|0.44123	0.0738:0.1354:0.7908:0.0|0.0738:0.1354:0.7908:0.0|0.0738:0.1354:0.7908:0.0	.|.|.	.|272|.	.|Q9BV44|.	.|THUM3_HUMAN|.	X|F|L	105|272|129	.|ENSP00000395893:L272F;ENSP00000339532:L272F;ENSP00000424064:L272F|.	.|ENSP00000339532:L272F|.	E|L|X	+|+|+	1|3|2	0|2|2	0|2|2	THUMPD3|THUMPD3|THUMPD3	9391208|9391208|9391208	9391208|9391208|9391208	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.698000|0.698000|0.698000	0.40448|0.40448|0.40448	1.299000|1.299000|1.299000	0.33424|0.33424|0.33424	1.347000|1.347000|1.347000	0.45714|0.45714|0.45714	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	GAA|TTG|TGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214127.1	0	0	1	2	2	2	2	0	0	0	0	151	151	151	148	1	3.530000	-3.282933	1	0.190000	NM_015453		0	24	22	0	671	663	0		1	0		0	0	151	0	0	1.000000	2.923036e-01	0	0	0	30	0	24	671
DNAH1	25981	broad.mit.edu	37	3	52398935	52398935	+	Silent	SNP	C	C	A	rs199597694		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:52398935C>A	ENST00000420323.2	+	34	5679	c.5418C>A	c.(5416-5418)tcC>tcA	p.S1806S		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1806					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCATCGTGTCCGACCTGTTTC	0.607																																						ENST00000420323.2	0.620000	0.190000	0.500000	0.270000	0.370000	0.395419	0.370000	0.360000																										0				62						c.(5416-5418)tcC>tcA		dynein, axonemal, heavy chain 1							83.0	89.0	87.0					3																	52398935		2158	4256	6414	SO:0001819	synonymous_variant	25981	0	0					g.chr3:52398935C>A	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5418C>A	chr3.hg19:g.52398935C>A		0						p.S1806S	NM_015512.4	NP_056327	2	2	4	2.085353	Q9P2D7	DYH1_HUMAN		34	5679	+			B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	1	1	hg19	c.5418C>A	CCDS46842.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.607	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	0	0	1	2	2	2	2	0	0	0	0	86	86	86	84	1	3.530000	-2.623419	1	0.190000	NM_015512		0	11	10	0	365	363	0		1	0		0	0	86	0	0	0.998292	3.153512e-03	0	0	0	3	0	11	365
PROK2	60675	broad.mit.edu	37	3	71821900	71821900	+	Missense_Mutation	SNP	C	C	A	rs371819884		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:71821900C>A	ENST00000295619.3	-	4	373	c.365G>T	c.(364-366)cGa>cTa	p.R122L	PROK2_ENST00000353065.3_Missense_Mutation_p.R101L	NM_001126128.1	NP_001119600.1	Q9HC23	PROK2_HUMAN	prokineticin 2	122					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of smooth muscle contraction (GO:0045987)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	G-protein coupled receptor binding (GO:0001664)	p.R101Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.89e-05)|Epithelial(33;0.000173)|LUSC - Lung squamous cell carcinoma(21;0.00168)|Lung(16;0.00306)		ACAAATAAATCGGTTAAATGA	0.408																																						ENST00000295619.3	0.800000	0.350000	0.690000	0.450000	0.550000	0.573713	0.550000	0.560000																										1	Substitution - Missense(1)	p.R101Q(1)	haematopoietic_and_lymphoid_tissue(1)	6						c.(364-366)cGa>cTa		prokineticin 2							80.0	87.0	85.0					3																	71821900		2203	4300	6503	SO:0001583	missense	60675	0	0					g.chr3:71821900C>A	AF333025	CCDS2916.1, CCDS46868.1	3p21.1	2013-02-28			ENSG00000163421	ENSG00000163421		"""Endogenous ligands"""	18455	protein-coding gene	gene with protein product	"""protein Bv8 homolog"""	607002				11054548, 11259612	Standard	NM_021935		Approved	PK2, BV8, MIT1, KAL4	uc003dpa.4	Q9HC23	OTTHUMG00000158809	ENST00000295619.3:c.365G>T	chr3.hg19:g.71821900C>A	ENSP00000295619:p.Arg122Leu	0					PROK2_ENST00000353065.3_Missense_Mutation_p.R101L	p.R122L	NM_001126128.1	NP_001119600.1	2	2	4	2.085353	Q9HC23	PROK2_HUMAN		4	373	-		Prostate(10;0.00899)	Q53Z79|Q6ISR0	Missense_Mutation	SNP	ENST00000295619.3	1	0	hg19	c.365G>T	CCDS46868.1	0	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286476	0.59867	.	.	ENSG00000163421	ENST00000353065;ENST00000295619	T;T	0.66638	-0.22;-0.22	5.67	3.88	0.44766	5.67	3.88	0.44766	Prokineticin domain (2);	0.167345	0.36519	N	0.002560	T	0.57095	0.2030	L	0.55481	1.735	0.35060	D	0.761469	B;P	0.39665	0.449;0.682	B;B	0.36922	0.202;0.236	T	0.68727	-0.5332	10	0.66056	D	0.02	-16.0798	6.6965	0.23201	0.0:0.7429:0.0:0.2571	.	122;101	Q9HC23;Q6ISR0	PROK2_HUMAN;.	L	101;122	ENSP00000295618:R101L;ENSP00000295619:R122L	ENSP00000295619:R122L	R	-	2	0	0	PROK2	71904590	71904590	0.998000	0.40836	0.948000	0.38648	0.980000	0.70556	0.952000	0.29149	1.404000	0.46819	0.655000	0.94253	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.408	PROK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352302.1	1	0	1	2	2	2	2	0	0	0	0	73	73	73	73	1	3.530000	-3.041735	1	0.190000	NM_001126128		0	22	21	0	476	474	0		1			0	0	73	0	0	0.999999	0	0	0	0	0	0	22	476
PDZRN3	23024	broad.mit.edu	37	3	73432928	73432928	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:73432928G>A	ENST00000263666.4	-	10	2903	c.2789C>T	c.(2788-2790)aCg>aTg	p.T930M	PDZRN3_ENST00000462146.2_Missense_Mutation_p.T587M|PDZRN3_ENST00000466780.1_Missense_Mutation_p.T587M|PDZRN3_ENST00000479530.1_Missense_Mutation_p.T647M|PDZRN3_ENST00000535920.1_Missense_Mutation_p.T652M|PDZRN3_ENST00000466348.1_5'Flank	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	930					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GATGTAGCGCGTCCCGTCGCT	0.672																																						ENST00000263666.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999704	0.990000	1.000000																										0				69						c.(2788-2790)aCg>aTg		PDZ domain containing ring finger 3							35.0	35.0	35.0					3																	73432928		2203	4300	6503	SO:0001583	missense	23024	1	121400	23				g.chr3:73432928G>A	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2789C>T	chr3.hg19:g.73432928G>A	ENSP00000263666:p.Thr930Met	0					PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Missense_Mutation_p.T652M|PDZRN3_ENST00000466780.1_Missense_Mutation_p.T587M|PDZRN3_ENST00000479530.1_Missense_Mutation_p.T647M|PDZRN3_ENST00000462146.2_Missense_Mutation_p.T587M	p.T930M	NM_015009.1	NP_055824.1	2	2	4	2.085353	Q9UPQ7	PZRN3_HUMAN		10	2903	-		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	1	1	hg19	c.2789C>T	CCDS33789.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.162279|4.162279	0.78226|0.78226	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000494559|ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530	.|T;T;T;T;T	.|0.45276	.|0.9;0.9;0.9;0.9;0.9	5.4|5.4	5.4|5.4	0.78164|0.78164	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.150407	.|0.64402	.|D	.|0.000015	T|T	0.68274|0.68274	0.2983|0.2983	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;P;D;D	.|0.75484	.|0.986;0.874;0.957;0.911	T|T	0.72717|0.72717	-0.4209|-0.4209	5|10	.|0.87932	.|D	.|0	.|.	18.7949|18.7949	0.91990|0.91990	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|652;647;647;930	.|F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.|.;.;.;PZRN3_HUMAN	C|M	246|930;652;587;587;647	.|ENSP00000263666:T930M;ENSP00000442026:T652M;ENSP00000418168:T587M;ENSP00000418484:T587M;ENSP00000418624:T647M	.|ENSP00000263666:T930M	R|T	-|-	1|2	0|0	0|0	PDZRN3|PDZRN3	73515618|73515618	73515618|73515618	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.915000|0.915000	0.54546|0.54546	7.532000|7.532000	0.81985|0.81985	2.522000|2.522000	0.85027|0.85027	0.655000|0.655000	0.94253|0.94253	CGC|ACG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.672	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	3.530000	-20.000000	1	0.190000	XM_041363		0	31	31	0	213	208	1		1	0		0	0	64	0	0	1.000000	7.659549e-01	0	0	0	21	0	31	213
IQCG	84223	broad.mit.edu	37	3	197665429	197665429	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr3:197665429G>T	ENST00000265239.6	-	5	929	c.505C>A	c.(505-507)Cag>Aag	p.Q169K	IQCG_ENST00000453254.1_Missense_Mutation_p.Q169K|IQCG_ENST00000455191.1_Missense_Mutation_p.Q169K|IQCG_ENST00000480302.1_5'Flank	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	169						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CTATCAATCTGAATTTTCTTC	0.453																																						ENST00000265239.6	0.390000	0.140000	0.320000	0.190000	0.240000	0.258707	0.240000	0.240000																										0				21						c.(505-507)Cag>Aag		IQ motif containing G							210.0	201.0	204.0					3																	197665429		2203	4300	6503	SO:0001583	missense	84223	0	0					g.chr3:197665429G>T	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.505C>A	chr3.hg19:g.197665429G>T	ENSP00000265239:p.Gln169Lys	0					IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000455191.1_Missense_Mutation_p.Q169K|IQCG_ENST00000453254.1_Missense_Mutation_p.Q169K	p.Q169K	NM_032263.3	NP_115639.1	2	2	4	2.085353	Q9H095	IQCG_HUMAN	Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	5	929	-	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Q9BST2|Q9HAG8	Missense_Mutation	SNP	ENST00000265239.6	0	1	hg19	c.505C>A	CCDS3331.1	0	.	.	.	.	.	.	.	.	.	.	G	22.2	4.251946	0.80135	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254;ENST00000416896	T;T;T;T	0.57107	0.66;0.66;0.96;0.42	5.5	5.5	0.81552	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.73560	0.3602	M	0.81341	2.54	0.46927	D	0.999252	P;D	0.89917	0.911;1.0	P;D	0.71656	0.558;0.974	T	0.75764	-0.3203	10	0.59425	D	0.04	-21.4276	16.5383	0.84377	0.0:0.0:1.0:0.0	.	169;169	C9JKX8;Q9H095	.;IQCG_HUMAN	K	169;169;169;150	ENSP00000265239:Q169K;ENSP00000407736:Q169K;ENSP00000389897:Q169K;ENSP00000406411:Q150K	ENSP00000265239:Q169K	Q	-	1	0	0	IQCG	199149826	199149826	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	3.181000	0.50903	2.759000	0.94783	0.558000	0.71614	CAG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.453	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339730.1	0	0	1	2	2	2	2	0	0	0	0	193	193	193	193	1	3.530000	-2.492374	0	0.190000	NM_032263		0	16	16	0	803	793	0		1	0		0	0	193	0	0	0.999925	7.145390e-02	0	0	0	21	0	16	803
DNAJB14	79982	broad.mit.edu	37	4	100830014	100830014	+	Missense_Mutation	SNP	T	T	C			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:100830014T>C	ENST00000442697.2	-	4	645	c.491A>G	c.(490-492)aAg>aGg	p.K164R		NM_001031723.2|NM_001278310.1	NP_001026893.1|NP_001265239.1	Q8TBM8	DJB14_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 14	164	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(123;4.59e-09)		CTGTTTTCGCTTTTCTGGATT	0.353																																						ENST00000442697.2	1.000000	0.800000	1.000000	0.940000	0.990000	0.977599	0.990000	1.000000																										0				5						c.(490-492)aAg>aGg		DnaJ (Hsp40) homolog, subfamily B, member 14							95.0	90.0	92.0					4																	100830014		2202	4299	6501	SO:0001583	missense	79982	0	0					g.chr4:100830014T>C	BC022248	CCDS34035.1, CCDS75171.1	4q23	2011-09-02			ENSG00000164031	ENSG00000164031		"""Heat shock proteins / DNAJ (HSP40)"""	25881	protein-coding gene	gene with protein product							Standard	NM_001031723		Approved	FLJ14281	uc003hvl.4	Q8TBM8	OTTHUMG00000131049	ENST00000442697.2:c.491A>G	chr4.hg19:g.100830014T>C	ENSP00000404381:p.Lys164Arg	0						p.K164R	NM_001031723.2|NM_001278310.1	NP_001026893.1|NP_001265239.1	2	2	4	2.088030	Q8TBM8	DJB14_HUMAN		4	645	-			Q6UXN1|Q7Z3P0|Q86TA7|Q86TM0|Q9GZU9	Missense_Mutation	SNP	ENST00000442697.2	1	1	hg19	c.491A>G	CCDS34035.1	1	.	.	.	.	.	.	.	.	.	.	T	31	5.079506	0.94050	.	.	ENSG00000164031	ENST00000442697	T	0.35973	1.28	5.8	5.8	0.92144	5.8	5.8	0.92144	Heat shock protein DnaJ, N-terminal (5);Heat shock protein DnaJ, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.46483	0.1395	N	0.20685	0.6	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.78314	0.954;0.991	T	0.50608	-0.8808	10	0.62326	D	0.03	.	16.1549	0.81657	0.0:0.0:0.0:1.0	.	164;79	Q8TBM8;Q8TBM8-2	DJB14_HUMAN;.	R	164	ENSP00000404381:K164R	ENSP00000404381:K164R	K	-	2	0	0	DNAJB14	101049037	101049037	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.490000	0.81461	2.209000	0.71365	0.533000	0.62120	AAG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.353	DNAJB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253696.2	1	0	0	2	2	2	2	0	0	0	0	76	76	76	79	1	3.530000	-11.297400	1	0.190000	NM_001031723.2		0	37	36	0	382	375	0		1	1		0	0	76	0	0	1.000000	4.589017e-01	0	2	0	15	0	37	382
PRDM5	11107	broad.mit.edu	37	4	121739540	121739540	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:121739540C>A	ENST00000264808.3	-	5	858	c.618G>T	c.(616-618)aaG>aaT	p.K206N	PRDM5_ENST00000428209.2_Missense_Mutation_p.K206N|PRDM5_ENST00000515109.1_Missense_Mutation_p.K206N	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	206					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CTGGGAATTTCTTCCCACAGT	0.373																																						ENST00000264808.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999997	0.990000	1.000000																										0				34						c.(616-618)aaG>aaT		PR domain containing 5							91.0	86.0	88.0					4																	121739540		2203	4300	6503	SO:0001583	missense	11107	0	0					g.chr4:121739540C>A	AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.618G>T	chr4.hg19:g.121739540C>A	ENSP00000264808:p.Lys206Asn	0					PRDM5_ENST00000428209.2_Missense_Mutation_p.K206N|PRDM5_ENST00000515109.1_Missense_Mutation_p.K206N	p.K206N	NM_018699.2	NP_061169.2	2	2	4	2.088030	Q9NQX1	PRDM5_HUMAN		5	858	-			Q0VAI9|Q0VAJ0|Q6NXQ7	Missense_Mutation	SNP	ENST00000264808.3	1	1	hg19	c.618G>T	CCDS3716.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358729	0.82243	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	T;T;T	0.61158	0.13;0.13;0.13	5.32	5.32	0.75619	5.32	5.32	0.75619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.79257	0.4415	M	0.84219	2.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	T	0.82165	-0.0592	10	0.72032	D	0.01	-32.109	19.0126	0.92879	0.0:1.0:0.0:0.0	.	206;206;206	Q0VAI9;Q9NQX1-2;Q9NQX1	.;.;PRDM5_HUMAN	N	206	ENSP00000264808:K206N;ENSP00000422309:K206N;ENSP00000404832:K206N	ENSP00000264808:K206N	K	-	3	2	2	PRDM5	121958990	121958990	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.395000	0.59678	2.498000	0.84270	0.555000	0.69702	AAG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.373	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256528.2	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	3.530000	-20.000000	1	0.190000			0	69	66	0	479	472	1		1	0		0	0	87	0	0	1.000000	4.492156e-02	0	0	0	3	0	69	479
FAT4	79633	broad.mit.edu	37	4	126370128	126370128	+	Nonsense_Mutation	SNP	G	G	T	rs556536853	byFrequency	TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:126370128G>T	ENST00000394329.3	+	9	7970	c.7957G>T	c.(7957-7959)Gag>Tag	p.E2653*	FAT4_ENST00000335110.5_Nonsense_Mutation_p.E951*	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2653	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ctCCTCTTACGAGAAACTTGA	0.373																																						ENST00000394329.3	0.610000	0.180000	0.480000	0.260000	0.360000	0.377357	0.360000	0.360000																										0				355						c.(7957-7959)Gag>Tag		FAT atypical cadherin 4							54.0	57.0	56.0					4																	126370128		2203	4300	6503	SO:0001587	stop_gained	79633	0	0					g.chr4:126370128G>T	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7957G>T	chr4.hg19:g.126370128G>T	ENSP00000377862:p.Glu2653*	0					FAT4_ENST00000335110.5_Nonsense_Mutation_p.E951*	p.E2653*	NM_024582.4	NP_078858.4	2	2	4	2.088030	Q6V0I7	FAT4_HUMAN		9	7970	+			A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Nonsense_Mutation	SNP	ENST00000394329.3	0	1	hg19	c.7957G>T	CCDS3732.3	0	.	.	.	.	.	.	.	.	.	.	G	49	15.050129	0.99820	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	.	.	.	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.214766	0.22554	U	0.058541	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	13.5378	0.61655	0.0799:0.0:0.9201:0.0	.	.	.	.	X	2653;951	.	ENSP00000335169:E951X	E	+	1	0	0	FAT4	126589578	126589578	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	5.431000	0.66507	2.686000	0.91538	0.650000	0.86243	GAG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.373	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	0	0	1	2	2	2	2	0	0	0	0	107	107	107	105	1	3.530000	-2.943021	1	0.190000	NM_024582		0	10	10	0	351	349	0		1			0	0	107	0	0	0.996894	0	0	0	0	0	0	10	351
DDX60	55601	broad.mit.edu	37	4	169227778	169227778	+	Silent	SNP	G	G	T	rs199887468		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:169227778G>T	ENST00000393743.3	-	5	649	c.358C>A	c.(358-360)Cga>Aga	p.R120R		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	120					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		AATGTTGTTCGAACATCAATG	0.408																																						ENST00000393743.3	0.910000	0.430000	0.790000	0.530000	0.650000	0.667736	0.650000	0.640000																										0				63						c.(358-360)Cga>Aga		DEAD (Asp-Glu-Ala-Asp) box polypeptide 60							83.0	84.0	84.0					4																	169227778		2203	4300	6503	SO:0001819	synonymous_variant	55601	0	0					g.chr4:169227778G>T	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.358C>A	chr4.hg19:g.169227778G>T		0						p.R120R	NM_017631.5	NP_060101.3	2	2	4	2.088030	Q8IY21	DDX60_HUMAN		5	649	-		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)	Q6PK35|Q9NVE3	Silent	SNP	ENST00000393743.3	1	0	hg19	c.358C>A	CCDS34097.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.408	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	1	0	0	2	2	2	2	0	0	0	0	90	90	90	89	1	3.530000	-5.316327	1	0.190000	NM_017631		0	26	26	0	476	472	0		1	0		0	0	90	0	0	1.000000	1.334524e-01	0	0	0	12	0	26	476
GPR125	166647	broad.mit.edu	37	4	22389706	22389706	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:22389706C>A	ENST00000334304.5	-	19	3857	c.3588G>T	c.(3586-3588)acG>acT	p.T1196T	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1196					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CTTCCACGCTCGTTGGGACAT	0.517																																						ENST00000334304.5	0.950000	0.530000	0.850000	0.620000	0.720000	0.739078	0.720000	0.720000																										0				56						c.(3586-3588)acG>acT		G protein-coupled receptor 125							95.0	88.0	91.0					4																	22389706		2203	4300	6503	SO:0001819	synonymous_variant	166647	0	0					g.chr4:22389706C>A	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3588G>T	chr4.hg19:g.22389706C>A		0					GPR125_ENST00000282943.5_5'UTR	p.T1196T	NM_145290.3	NP_660333.2	2	2	4	2.088030	Q8IWK6	GP125_HUMAN		19	3857	-		Breast(46;0.198)	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	1	0	hg19	c.3588G>T	CCDS33964.1	0																																																																																								0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.517	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3	1	0	1	2	2	2	2	0	0	0	0	129	129	129	128	1	3.530000	-2.774725	1	0.190000			0	41	41	0	666	655	0		1	0		0	0	129	0	0	1.000000	9.985448e-01	0	0	0	158	0	41	666
HSD17B11	51170	broad.mit.edu	37	4	88258508	88258508	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:88258508C>A	ENST00000358290.4	-	7	1138	c.823G>T	c.(823-825)Gag>Tag	p.E275*	HSD17B11_ENST00000507518.1_5'UTR|HSD17B11_ENST00000507286.1_Nonsense_Mutation_p.E231*|RP11-529H2.2_ENST00000508163.1_RNA	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	275					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		AGGAAACGCTCAGGAAGGATC	0.294																																						ENST00000358290.4	0.600000	0.250000	0.510000	0.330000	0.410000	0.425849	0.410000	0.400000																										0				11						c.(823-825)Gag>Tag		hydroxysteroid (17-beta) dehydrogenase 11							86.0	87.0	86.0					4																	88258508		2203	4299	6502	SO:0001587	stop_gained	51170	0	0					g.chr4:88258508C>A	AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.823G>T	chr4.hg19:g.88258508C>A	ENSP00000351035:p.Glu275*	0					HSD17B11_ENST00000507286.1_Nonsense_Mutation_p.E231*|RP11-529H2.2_ENST00000508163.1_RNA|HSD17B11_ENST00000507518.1_5'UTR	p.E275*	NM_016245.3	NP_057329.2	2	2	4	2.088030	Q8NBQ5	DHB11_HUMAN		7	1138	-		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	Q96HF6|Q9UKU4	Nonsense_Mutation	SNP	ENST00000358290.4	0	1	hg19	c.823G>T	CCDS3619.1	0	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214804	0.39102	.	.	ENSG00000198189	ENST00000358290;ENST00000507286	.	.	.	5.49	4.64	0.57946	5.49	4.64	0.57946	.	0.079681	0.51477	D	0.000087	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	13.4986	0.61440	0.0:0.8429:0.1571:0.0	.	.	.	.	X	275;231	.	ENSP00000351035:E275X	E	-	1	0	0	HSD17B11	88477532	88477532	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	3.940000	0.56599	1.307000	0.44944	0.563000	0.77884	GAG	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.294	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253041.1	0	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	3.530000	-2.821360	1	0.190000	NM_016245		0	21	21	0	622	607	0		1	0		0	0	102	0	0	0.999997	9.940142e-01	0	1	0	240	0	21	622
HERC5	51191	broad.mit.edu	37	4	89400623	89400623	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:89400623C>A	ENST00000264350.3	+	13	1855	c.1702C>A	c.(1702-1704)Caa>Aaa	p.Q568K	HERC5_ENST00000508159.1_Missense_Mutation_p.Q206K	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	568					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TGGTAATGTTCAAGCTCTCCT	0.418																																					Esophageal Squamous(39;887 1012 34045 50514)	ENST00000264350.3	0.840000	0.360000	0.710000	0.450000	0.570000	0.590805	0.570000	0.560000																										0				53						c.(1702-1704)Caa>Aaa		HECT and RLD domain containing E3 ubiquitin protein ligase 5							120.0	117.0	118.0					4																	89400623		2203	4300	6503	SO:0001583	missense	51191	0	0					g.chr4:89400623C>A	AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1702C>A	chr4.hg19:g.89400623C>A	ENSP00000264350:p.Gln568Lys	0					HERC5_ENST00000508159.1_Missense_Mutation_p.Q206K	p.Q568K	NM_016323.3	NP_057407.2	2	2	4	2.088030	Q9UII4	HERC5_HUMAN		13	1855	+		Hepatocellular(203;0.114)	B2RTQ1|Q69G20	Missense_Mutation	SNP	ENST00000264350.3	1	0	hg19	c.1702C>A	CCDS3630.1	0	.	.	.	.	.	.	.	.	.	.	C	0.159	-1.083120	0.01888	.	.	ENSG00000138646	ENST00000264350;ENST00000508159	T;T	0.34859	1.34;1.41	4.59	-1.37	0.09056	4.59	-1.37	0.09056	.	0.494741	0.17118	N	0.186342	T	0.07999	0.0200	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33727	-0.9857	10	0.02654	T	1	.	5.0553	0.14529	0.3925:0.4185:0.189:0.0	.	568	Q9UII4	HERC5_HUMAN	K	568;206	ENSP00000264350:Q568K;ENSP00000424129:Q206K	ENSP00000264350:Q568K	Q	+	1	0	0	HERC5	89619646	89619646	0.005000	0.15991	0.001000	0.08648	0.243000	0.25628	0.216000	0.17585	-0.352000	0.08237	-0.484000	0.04775	CAA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.418	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	1	0	1	2	2	2	2	0	0	0	0	73	73	73	72	1	3.530000	-4.697256	1	0.190000	NM_016323		0	20	20	0	421	411	0		1	0		0	0	73	0	0	0.999994	4.148375e-02	0	0	0	7	0	20	421
GALNT7	51809	broad.mit.edu	37	4	174213298	174213298	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr4:174213298G>T	ENST00000265000.4	+	3	710	c.627G>T	c.(625-627)tcG>tcT	p.S209S	GALNT7_ENST00000502407.1_3'UTR|GALNT7_ENST00000512285.1_Silent_p.S209S	NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	209	Catalytic subdomain A.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TGCTCACTTCGAGCGTTGTCA	0.368																																						ENST00000265000.4	0.680000	0.290000	0.580000	0.370000	0.460000	0.479906	0.460000	0.450000																										0				19						c.(625-627)tcG>tcT		polypeptide N-acetylgalactosaminyltransferase 7							93.0	94.0	94.0					4																	174213298		2203	4300	6503	SO:0001819	synonymous_variant	51809	0	0					g.chr4:174213298G>T	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.627G>T	chr4.hg19:g.174213298G>T		0					GALNT7_ENST00000502407.1_3'UTR|GALNT7_ENST00000512285.1_Silent_p.S209S	p.S209S	NM_017423.2	NP_059119.2	2	2	4	2.088030	Q86SF2	GALT7_HUMAN		3	710	+		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)	B3KQU3|Q7Z5W7|Q9UJ28	Silent	SNP	ENST00000265000.4	1	0	hg19	c.627G>T	CCDS3815.1	0	.	.	.	.	.	.	.	.	.	.	G	0.308	-0.969448	0.02232	.	.	ENSG00000109586	ENST00000505308	.	.	.	5.76	1.61	0.23674	5.76	1.61	0.23674	.	.	.	.	.	T	0.60792	0.2296	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54768	-0.8244	4	.	.	.	.	11.4461	0.50125	0.1701:0.6473:0.1826:0.0	.	.	.	.	L	6	.	.	R	+	2	0	0	GALNT7	174449873	174449873	0.998000	0.40836	0.901000	0.35422	0.029000	0.11900	0.733000	0.26087	0.063000	0.16370	-2.258000	0.00281	CGA	0.319328		TCGA-XN-A8T3-01A-11D-A36O-08	0.368	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	1	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	3.530000	-2.660457	1	0.190000	NM_017423		0	20	20	0	524	520	0		1	0		0	0	103	0	0	0.999995	3.343032e-01	0	0	0	31	0	20	524
HSD17B4	3295	broad.mit.edu	37	5	118844936	118844936	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:118844936C>A	ENST00000256216.6	+	16	1567	c.1434C>A	c.(1432-1434)gtC>gtA	p.V478V	HSD17B4_ENST00000510025.1_Silent_p.V454V|HSD17B4_ENST00000509514.1_Silent_p.V216V|HSD17B4_ENST00000504811.1_Silent_p.V503V|HSD17B4_ENST00000515320.1_Silent_p.V460V|HSD17B4_ENST00000522415.1_3'UTR|HSD17B4_ENST00000513628.1_Silent_p.V341V|HSD17B4_ENST00000414835.2_Silent_p.V338V	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	478	Enoyl-CoA hydratase 2.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		CAGACAAAGTCAAGGTAAGCC	0.393																																					Colon(35;490 801 34689 41394 43344)	ENST00000256216.6	0.690000	0.300000	0.590000	0.380000	0.470000	0.488719	0.470000	0.480000																										0				25						c.(1432-1434)gtC>gtA		hydroxysteroid (17-beta) dehydrogenase 4							134.0	135.0	134.0					5																	118844936		2202	4300	6502	SO:0001819	synonymous_variant	3295	0	0					g.chr5:118844936C>A		CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1434C>A	chr5.hg19:g.118844936C>A		0					HSD17B4_ENST00000510025.1_Silent_p.V454V|HSD17B4_ENST00000515320.1_Silent_p.V460V|HSD17B4_ENST00000513628.1_Silent_p.V341V|HSD17B4_ENST00000414835.2_Silent_p.V338V|HSD17B4_ENST00000509514.1_Silent_p.V216V|HSD17B4_ENST00000522415.1_3'UTR|HSD17B4_ENST00000504811.1_Silent_p.V503V	p.V478V	NM_000414.3	NP_000405.1	1	2	3	1.926416	P51659	DHB4_HUMAN		16	1567	+		all_cancers(142;0.0206)|Prostate(80;0.0322)	B4DNV1|B4DVS5|E9PB82|F5HE57	Silent	SNP	ENST00000256216.6	1	0	hg19	c.1434C>A	CCDS4126.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250863.3	1	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	3.530000	-3.146762	1	0.190000	NM_000414		0	21	21	0	493	484	0		1	0		0	0	107	0	0	0.999997	9.839130e-01	0	0	0	157	0	21	493
SLC12A2	6558	broad.mit.edu	37	5	127487009	127487009	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:127487009C>A	ENST00000262461.2	+	14	2373	c.2184C>A	c.(2182-2184)ttC>ttA	p.F728L	SLC12A2_ENST00000343225.4_Missense_Mutation_p.F728L	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	728					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TAGTAATGTTCGTCATTAACT	0.358																																						ENST00000262461.2	0.670000	0.280000	0.570000	0.360000	0.450000	0.469217	0.450000	0.450000																										0				48						c.(2182-2184)ttC>ttA		solute carrier family 12 (sodium/potassium/chloride transporter), member 2	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)						225.0	213.0	217.0					5																	127487009		2203	4300	6503	SO:0001583	missense	6558	0	0					g.chr5:127487009C>A		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.2184C>A	chr5.hg19:g.127487009C>A	ENSP00000262461:p.Phe728Leu	0					SLC12A2_ENST00000343225.4_Missense_Mutation_p.F728L	p.F728L	NM_001046.2	NP_001037.1	1	2	3	1.926416	P55011	S12A2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	14	2373	+		all_cancers(142;0.0972)|Prostate(80;0.151)	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	1	0	hg19	c.2184C>A	CCDS4144.1	0	.	.	.	.	.	.	.	.	.	.	C	16.04	3.010041	0.54361	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98747	-5.11;-5.11	4.7	-0.669	0.11388	4.7	-0.669	0.11388	Amino acid permease domain (1);	0.115149	0.64402	D	0.000013	D	0.97470	0.9172	M	0.70903	2.155	0.80722	D	1	P;P	0.49635	0.909;0.926	B;P	0.47251	0.407;0.542	D	0.94969	0.8115	10	0.87932	D	0	.	9.3862	0.38345	0.0:0.2836:0.0:0.7164	.	728;728	P55011-3;P55011	.;S12A2_HUMAN	L	728	ENSP00000262461:F728L;ENSP00000340878:F728L	ENSP00000262461:F728L	F	+	3	2	2	SLC12A2	127514908	127514908	0.988000	0.35896	0.997000	0.53966	0.988000	0.76386	0.178000	0.16820	-0.167000	0.10871	-0.294000	0.09567	TTC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.358	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	1	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	3.530000	-3.083980	1	0.190000	NM_001046		0	20	17	0	491	485	0		1	0		0	0	102	0	0	0.999995	3.178234e-01	0	0	0	28	0	20	491
DDX46	9879	broad.mit.edu	37	5	134109505	134109505	+	Silent	SNP	C	C	A	rs140064519		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:134109505C>A	ENST00000354283.4	+	5	702	c.567C>A	c.(565-567)atC>atA	p.I189I	DDX46_ENST00000452510.2_Silent_p.I189I			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	189					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAAAGGAAATCGAAGAGATGA	0.353																																					Colon(13;391 453 4901 21675 24897)	ENST00000354283.4	0.900000	0.360000	0.760000	0.470000	0.600000	0.620783	0.600000	0.600000																										0				30						c.(565-567)atC>atA		DEAD (Asp-Glu-Ala-Asp) box polypeptide 46							134.0	134.0	134.0					5																	134109505		2203	4300	6503	SO:0001819	synonymous_variant	9879	0	0					g.chr5:134109505C>A		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.567C>A	chr5.hg19:g.134109505C>A		0					DDX46_ENST00000452510.2_Silent_p.I189I	p.I189I			1	2	3	1.926416	Q7L014	DDX46_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	5	702	+			O94894|Q96EI0|Q9Y658	Silent	SNP	ENST00000354283.4	1	0	hg19	c.567C>A	CCDS34240.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.353	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	3.530000	-3.139300	1	0.190000	NM_014829		0	17	17	0	312	309	0		1	0		0	0	37	0	0	0.999966	6.439212e-01	0	0	0	41	0	17	312
PCDHA11	56138	broad.mit.edu	37	5	140250312	140250312	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:140250312C>T	ENST00000398640.2	+	1	1624	c.1624C>T	c.(1624-1626)Ccg>Tcg	p.P542S	PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGGGCGTGCCGCCTCTGAG	0.692																																						ENST00000398640.2	0.220000	0.040000	0.170000	0.070000	0.110000	0.123967	0.110000	0.120000																										0				2						c.(1624-1626)Ccg>Tcg		protocadherin alpha 11							73.0	81.0	78.0					5																	140250312		2202	4298	6500	SO:0001583	missense	56138	0	0					g.chr5:140250312C>T	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1624C>T	chr5.hg19:g.140250312C>T	ENSP00000381636:p.Pro542Ser	0					PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron	p.P542S	NM_018902.3	NP_061725.1	1	2	3	1.926416	Q9Y5I1	PCDAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1624	+			B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	0	1	hg19	c.1624C>T	CCDS47284.1	0	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788483	0.70337	.	.	ENSG00000249158	ENST00000398640	T	0.56776	0.44	5.15	5.15	0.70609	5.15	5.15	0.70609	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.78698	0.4324	M	0.92026	3.265	0.35643	D	0.811176	D;D	0.89917	1.0;1.0	D;D	0.71414	0.969;0.973	D	0.87476	0.2417	9	0.87932	D	0	.	18.2779	0.90089	0.0:1.0:0.0:0.0	.	542;542	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	S	542	ENSP00000381636:P542S	ENSP00000381636:P542S	P	+	1	0	0	PCDHA11	140230496	140230496	0.999000	0.42202	0.994000	0.49952	0.949000	0.60115	5.585000	0.67497	2.398000	0.81561	0.556000	0.70494	CCG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.692	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	0	0	1	2	13	2	2	1	1	1	1	227	227	227	224	1	3.530000	-2.017182	0	0.190000	NM_018902		0	7	8	0	732	716	0		0	0		1	0	227	0	0	0.119184	0	0	0	0	1	0	7	732
GLRA1	2741	broad.mit.edu	37	5	151208531	151208531	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:151208531C>A	ENST00000455880.2	-	8	1296	c.1010G>T	c.(1009-1011)cGg>cTg	p.R337L	GLRA1_ENST00000274576.4_Missense_Mutation_p.R337L|GLRA1_ENST00000545569.1_Missense_Mutation_p.R254L			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	337					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTTATGTTGCCGAGACACAAA	0.478																																						ENST00000455880.2	0.290000	0.080000	0.230000	0.120000	0.170000	0.181783	0.170000	0.180000																										0				23						c.(1009-1011)cGg>cTg		glycine receptor, alpha 1	Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						137.0	134.0	135.0					5																	151208531		2203	4300	6503	SO:0001583	missense	2741	0	0					g.chr5:151208531C>A		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.1010G>T	chr5.hg19:g.151208531C>A	ENSP00000411593:p.Arg337Leu	0					GLRA1_ENST00000545569.1_Missense_Mutation_p.R254L|GLRA1_ENST00000274576.4_Missense_Mutation_p.R337L	p.R337L			1	2	3	1.926416	P23415	GLRA1_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	8	1296	-		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	0	1	hg19	c.1010G>T	CCDS54942.1	0	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369025	0.82463	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.85411	-1.98;-1.98;-1.98	5.07	5.07	0.68467	5.07	5.07	0.68467	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90428	0.7003	M	0.79693	2.465	0.80722	D	1	P;P;P	0.36789	0.57;0.493;0.514	P;P;B	0.47376	0.545;0.545;0.313	D	0.91347	0.5101	10	0.72032	D	0.01	.	18.826	0.92119	0.0:1.0:0.0:0.0	.	337;254;337	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	L	337;337;254	ENSP00000274576:R337L;ENSP00000411593:R337L;ENSP00000445913:R254L	ENSP00000274576:R337L	R	-	2	0	0	GLRA1	151188724	151188724	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.557000	0.82243	2.524000	0.85096	0.650000	0.86243	CGG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.478	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1	0	0	1	2	2	2	2	0	0	0	0	167	167	167	166	1	3.530000	-1.949272	0	0.190000			0	11	11	0	745	736	0		1			0	0	167	0	0	0.998227	0	0	0	0	0	0	11	745
ITK	3702	broad.mit.edu	37	5	156608060	156608060	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:156608060G>T	ENST00000422843.3	+	1	224	c.72G>T	c.(70-72)tcG>tcT	p.S24S		NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	24	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.S24S(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CTTCTCCCTCGAACTTTAAAG	0.423			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	ENST00000422843.3	0.640000	0.280000	0.550000	0.360000	0.440000	0.458104	0.440000	0.450000				Dom	yes			Dom	yes		5	5q31-q32	5q31-q32	3702	T	IL2-inducible T-cell kinase				L	L	SYK		peripheral T-cell lymphoma		1	Substitution - coding silent(1)	p.S24S(1)	large_intestine(1)	70						c.(70-72)tcG>tcT		IL2-inducible T-cell kinase	Pazopanib(DB06589)						115.0	107.0	110.0					5																	156608060		2203	4300	6503	SO:0001819	synonymous_variant	3702	0	0					g.chr5:156608060G>T	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.72G>T	chr5.hg19:g.156608060G>T		0						p.S24S	NM_005546.3	NP_005537.3	1	2	3	1.926416	Q08881	ITK_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)	1	224	+	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	B2R752|Q32ML7	Silent	SNP	ENST00000422843.3	1	0	hg19	c.72G>T	CCDS4336.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.423	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2	1	0	1	2	2	2	2	0	0	0	0	107	107	107	107	1	3.530000	-3.374308	1	0.190000			0	23	24	0	576	564	0		1	0		0	0	107	0	0	0.999999	1.658366e-03	0	0	0	2	0	23	576
CENPH	64946	broad.mit.edu	37	5	68490517	68490517	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:68490517C>A	ENST00000283006.2	+	3	321	c.234C>A	c.(232-234)atC>atA	p.I78I	CENPH_ENST00000515001.1_Silent_p.I78I	NM_022909.3	NP_075060.1			centromere protein H									p.I78I(1)		kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		AAAAGCAAATCGAAGCGTATG	0.279																																						ENST00000283006.2	0.860000	0.320000	0.710000	0.430000	0.560000	0.579827	0.560000	0.540000																										1	Substitution - coding silent(1)	p.I78I(1)	large_intestine(1)	20						c.(232-234)atC>atA		centromere protein H							41.0	45.0	44.0					5																	68490517		2201	4300	6501	SO:0001819	synonymous_variant	64946	0	0					g.chr5:68490517C>A	AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.234C>A	chr5.hg19:g.68490517C>A		0					CENPH_ENST00000515001.1_Silent_p.I78I	p.I78I	NM_022909.3	NP_075060.1	1	2	3	1.924566				3	321	+		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		Silent	SNP	ENST00000283006.2	1	0	hg19	c.234C>A	CCDS3998.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.279	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215083.1	1	0	1	2	2	2	2	0	0	0	0	58	58	58	57	1	3.530000	-16.599580	1	0.190000			0	15	15	0	298	294	0		1	0		0	0	58	0	0	0.999869	4.472482e-01	0	0	0	30	0	15	298
CMYA5	202333	broad.mit.edu	37	5	79025398	79025398	+	Silent	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:79025398G>A	ENST00000446378.2	+	2	841	c.810G>A	c.(808-810)gaG>gaA	p.E270E		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	270					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTAGTCTAGAGCCAGATTTGG	0.353																																						ENST00000446378.2	1.000000	0.510000	1.000000	0.650000	0.810000	0.816180	0.810000	1.000000																										0				128						c.(808-810)gaG>gaA		cardiomyopathy associated 5							51.0	48.0	49.0					5																	79025398		1857	4091	5948	SO:0001819	synonymous_variant	202333	0	0					g.chr5:79025398G>A	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.810G>A	chr5.hg19:g.79025398G>A		0						p.E270E	NM_153610.3	NP_705838.3	1	2	3	1.926416	Q8N3K9	CMYA5_HUMAN		2	841	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	ENST00000446378.2	1	1	hg19	c.810G>A	CCDS47238.1	0																																																																																								0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.353	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	1	0	0	2	2	2	2	0	0	0	0	53	53	53	53	1	3.530000	-19.999970	1	0.190000	NM_153610		0	20	20	0	265	263	0		1			0	0	53	0	0	0.999996	0	0	0	0	0	0	20	265
RUFY1	80230	broad.mit.edu	37	5	179016622	179016622	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr5:179016622C>A	ENST00000319449.4	+	9	1114	c.1102C>A	c.(1102-1104)Cga>Aga	p.R368R	RUFY1_ENST00000437570.2_Silent_p.R260R|RUFY1_ENST00000393438.2_Silent_p.R260R|RUFY1_ENST00000377001.2_3'UTR	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	368					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGAATTAATTCGAGAAAGAAG	0.388										HNSCC(44;0.11)																												ENST00000319449.4	0.760000	0.350000	0.650000	0.430000	0.530000	0.551106	0.530000	0.540000																										0				26						c.(1102-1104)Cga>Aga		RUN and FYVE domain containing 1							103.0	101.0	102.0					5																	179016622		2203	4300	6503	SO:0001819	synonymous_variant	80230	0	0					g.chr5:179016622C>A	AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1102C>A	chr5.hg19:g.179016622C>A		0	HNSCC(44;0.11)				RUFY1_ENST00000393438.2_Silent_p.R260R|RUFY1_ENST00000377001.2_3'UTR|RUFY1_ENST00000437570.2_Silent_p.R260R	p.R368R	NM_025158.4	NP_079434.3	1	2	3	1.926416	Q96T51	RUFY1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	9	1114	+	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Q59FF3|Q71S93|Q9H6I3	Silent	SNP	ENST00000319449.4	1	0	hg19	c.1102C>A	CCDS4445.2	0	.	.	.	.	.	.	.	.	.	.	C	10.33	1.321386	0.23994	.	.	ENSG00000176783	ENST00000508609	.	.	.	5.47	5.47	0.80525	5.47	5.47	0.80525	.	.	.	.	.	T	0.75384	0.3842	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73597	-0.3932	4	.	.	.	-12.448	19.3849	0.94553	0.0:1.0:0.0:0.0	.	.	.	.	L	156	.	.	F	+	3	2	2	RUFY1	178949228	178949228	1.000000	0.71417	0.960000	0.40013	0.990000	0.78478	4.156000	0.58138	2.581000	0.87130	0.549000	0.68633	TTC	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.388	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	1	0	1	2	2	2	2	0	0	0	0	109	109	109	108	1	3.530000	-2.868109	1	0.190000	NM_001040451		0	24	24	0	494	489	0		1	0		0	0	109	0	0	1.000000	8.437151e-01	0	0	0	71	0	24	494
MCM9	254394	broad.mit.edu	37	6	119238766	119238766	+	Missense_Mutation	SNP	G	G	T	rs564191556		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr6:119238766G>T	ENST00000316316.6	-	5	1150	c.864C>A	c.(862-864)ttC>ttA	p.F288L	MCM9_ENST00000316068.3_Missense_Mutation_p.F288L	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	288					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		AAAAATCTTCGAATTCCTTTT	0.378																																						ENST00000316316.6	0.570000	0.270000	0.490000	0.330000	0.400000	0.417763	0.400000	0.400000																										0				18						c.(862-864)ttC>ttA		minichromosome maintenance complex component 9							118.0	111.0	113.0					6																	119238766		2203	4300	6503	SO:0001583	missense	254394	0	0					g.chr6:119238766G>T	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.864C>A	chr6.hg19:g.119238766G>T	ENSP00000314505:p.Phe288Leu	1					MCM9_ENST00000316068.3_Missense_Mutation_p.F288L	p.F288L	NM_017696.2	NP_060166.2	0	2	2	1.748141	Q9NXL9	MCM9_HUMAN		5	1150	-		all_cancers(87;0.122)|all_epithelial(87;0.179)	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	ENST00000316316.6	1	0	hg19	c.864C>A	CCDS56447.1	0	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454336	0.84209	.	.	ENSG00000111877	ENST00000316316;ENST00000316068	T;T	0.06142	3.73;3.34	5.81	4.65	0.58169	5.81	4.65	0.58169	.	.	.	.	.	T	0.16085	0.0387	M	0.87682	2.9	0.52099	D	0.999949	D	0.89917	1.0	D	0.70016	0.967	T	0.02098	-1.1214	9	0.36615	T	0.2	.	11.7956	0.52098	0.9314:0.0:0.0686:0.0	.	288	Q9NXL9-2	.	L	288	ENSP00000314505:F288L;ENSP00000312870:F288L	ENSP00000312870:F288L	F	-	3	2	2	MCM9	119280465	119280465	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.102000	0.57776	1.044000	0.40200	-0.251000	0.11542	TTC	0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.378	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	1	0	1	2	2	2	2	0	0	0	0	130	130	130	128	1	3.530000	-3.493684	1	0.190000	NM_153255		0	26	24	0	648	638	0		1	0		0	0	130	0	0	1.000000	3.896453e-02	0	0	0	8	0	26	648
ENPP3	5169	broad.mit.edu	37	6	131979467	131979467	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr6:131979467G>T	ENST00000414305.1	+	7	797	c.469G>T	c.(469-471)Gac>Tac	p.D157Y	ENPP3_ENST00000358229.5_Missense_Mutation_p.D157Y|ENPP3_ENST00000470930.1_3'UTR|ENPP3_ENST00000543135.1_Missense_Mutation_p.D123Y|ENPP3_ENST00000357639.3_Missense_Mutation_p.D157Y|ENPP3_ENST00000427148.2_Missense_Mutation_p.D123Y			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	157	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TTTCAGGTTTGACCTGCCACC	0.328																																						ENST00000414305.1	0.530000	0.140000	0.420000	0.210000	0.300000	0.318600	0.300000	0.280000																										0				53						c.(469-471)Gac>Tac		ectonucleotide pyrophosphatase/phosphodiesterase 3							137.0	133.0	134.0					6																	131979467		2202	4300	6502	SO:0001583	missense	5169	0	0					g.chr6:131979467G>T	AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.469G>T	chr6.hg19:g.131979467G>T	ENSP00000406261:p.Asp157Tyr	1					ENPP3_ENST00000543135.1_Missense_Mutation_p.D123Y|ENPP3_ENST00000470930.1_3'UTR|ENPP3_ENST00000427148.2_Missense_Mutation_p.D123Y|ENPP3_ENST00000357639.3_Missense_Mutation_p.D157Y|ENPP3_ENST00000358229.5_Missense_Mutation_p.D157Y	p.D157Y			0	2	2	1.748141	O14638	ENPP3_HUMAN		7	797	+	Breast(56;0.0753)		Q5JTL3	Missense_Mutation	SNP	ENST00000414305.1	0	1	hg19	c.469G>T	CCDS5148.1	0	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432322	0.62844	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000427148;ENST00000358229	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88	5.46	5.46	0.80206	5.46	5.46	0.80206	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.726895	0.12959	N	0.425153	T	0.77032	0.4071	M	0.73962	2.25	0.38009	D	0.934463	P	0.47545	0.897	P	0.49561	0.615	T	0.79536	-0.1763	10	0.66056	D	0.02	-12.1846	16.5792	0.84710	0.0:0.0:1.0:0.0	.	157	O14638	ENPP3_HUMAN	Y	157;157;123;123;157	ENSP00000406261:D157Y;ENSP00000350265:D157Y;ENSP00000440810:D123Y;ENSP00000399269:D123Y;ENSP00000350964:D157Y	ENSP00000350265:D157Y	D	+	1	0	0	ENPP3	132021160	132021160	1.000000	0.71417	0.998000	0.56505	0.671000	0.39405	2.644000	0.46613	2.722000	0.93159	0.650000	0.86243	GAC	0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.328	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043627.2	0	0	1	2	2	2	2	0	0	0	0	62	62	62	61	1	3.530000	-3.607918	1	0.190000			0	8	8	0	283	283	0		1			0	0	62	0	0	0.989634	0	0	0	0	0	0	8	283
TRIM38	10475	broad.mit.edu	37	6	25972146	25972146	+	Missense_Mutation	SNP	T	T	G			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr6:25972146T>G	ENST00000357085.3	+	5	1033	c.557T>G	c.(556-558)cTc>cGc	p.L186R	TRIM38_ENST00000349458.3_Missense_Mutation_p.L186R	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	186					negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						TTTAAGAATCTCCAGTGTTTC	0.438																																						ENST00000357085.3	1.000000	0.610000	1.000000	0.760000	0.940000	0.903557	0.940000	1.000000																										0				23						c.(556-558)cTc>cGc		tripartite motif containing 38							63.0	63.0	63.0					6																	25972146		2203	4300	6503	SO:0001583	missense	10475	0	0					g.chr6:25972146T>G	U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.557T>G	chr6.hg19:g.25972146T>G	ENSP00000349596:p.Leu186Arg	1					TRIM38_ENST00000349458.3_Missense_Mutation_p.L186R	p.L186R	NM_006355.3	NP_006346.1	0	2	2	1.736554	O00635	TRI38_HUMAN		5	1033	+			B2R862	Missense_Mutation	SNP	ENST00000357085.3	1	1	hg19	c.557T>G	CCDS4568.1	1	.	.	.	.	.	.	.	.	.	.	t	8.516	0.867585	0.17250	.	.	ENSG00000112343	ENST00000540262;ENST00000349458;ENST00000357085	T;T;T	0.07216	3.21;3.21;3.21	4.55	3.37	0.38596	4.55	3.37	0.38596	.	0.000000	0.39985	N	0.001212	T	0.07999	0.0200	M	0.80746	2.51	0.09310	N	0.999999	P	0.52316	0.952	P	0.52267	0.694	T	0.16188	-1.0411	10	0.27082	T	0.32	.	7.6274	0.28220	0.1881:0.0:0.0:0.8119	.	186	O00635	TRI38_HUMAN	R	186	ENSP00000443976:L186R;ENSP00000230099:L186R;ENSP00000349596:L186R	ENSP00000230099:L186R	L	+	2	0	0	TRIM38	26080125	26080125	0.041000	0.20044	0.012000	0.15200	0.001000	0.01503	2.090000	0.41682	1.047000	0.40274	-0.327000	0.08410	CTC	0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.438	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040076.2	1	0	1	2	15	2	2	0	0	0	1	57	57	57	56	1	3.530000	-9.032588	1	0.190000			0	22	22	0	223	217	1		1	1		0	0	57	0	0	0.899604	8.179919e-01	0	5	0	29	0	22	223
TNXB	7148	broad.mit.edu	37	6	32049954	32049954	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr6:32049954G>A	ENST00000375244.3	-	9	3796	c.3595C>T	c.(3595-3597)Cgg>Tgg	p.R1199W	TNXB_ENST00000375247.2_Missense_Mutation_p.R1199W			P22105	TENX_HUMAN	tenascin XB	1286	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						ACCTGGGGCCGTCCATCCCTG	0.562																																						ENST00000375244.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				8						c.(3595-3597)Cgg>Tgg		tenascin XB							45.0	40.0	42.0					6																	32049954		1266	2540	3806	SO:0001583	missense	7148	0	0					g.chr6:32049954G>A	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3595C>T	chr6.hg19:g.32049954G>A	ENSP00000364393:p.Arg1199Trp	1					TNXB_ENST00000375247.2_Missense_Mutation_p.R1199W	p.R1199W			2	10	12	3.031716	P22105	TENX_HUMAN		9	3796	-			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	1	1	hg19	c.3595C>T		1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278036	0.59758	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.57273	0.41;0.41	4.74	4.74	0.60224	4.74	4.74	0.60224	.	0.905187	0.09249	N	0.828076	T	0.53867	0.1823	M	0.61703	1.905	0.09310	N	1	D	0.64830	0.994	P	0.61397	0.888	T	0.41698	-0.9494	10	0.39692	T	0.17	.	10.3406	0.43875	0.0:0.0:0.804:0.196	.	1199	P22105-3	.	W	1199	ENSP00000364393:R1199W;ENSP00000364396:R1199W	ENSP00000364393:R1199W	R	-	1	2	2	TNXB	32157932	32157932	0.003000	0.15002	0.035000	0.18076	0.930000	0.56654	1.320000	0.33666	2.461000	0.83175	0.407000	0.27541	CGG	0.537275		TCGA-XN-A8T3-01A-11D-A36O-08	0.562	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	3.530000	-20.000000	1	0.190000	NM_019105		0	44	43	0	130	129	1		1	0		0	0	20	0	0	1.000000	0	0	0	0	1	0	44	130
EFHC1	114327	broad.mit.edu	37	6	52357122	52357122	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr6:52357122C>A	ENST00000371068.5	+	11	2009	c.1906C>A	c.(1906-1908)Cgt>Agt	p.R636S	EFHC1_ENST00000538167.1_Missense_Mutation_p.R617S|EFHC1_ENST00000433625.2_Intron	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	636						axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					TAACTTTGTTCGTGCTTTCTC	0.393																																						ENST00000371068.5	0.820000	0.400000	0.690000	0.480000	0.580000	0.594379	0.580000	0.590000																										0				27						c.(1906-1908)Cgt>Agt		EF-hand domain (C-terminal) containing 1							113.0	98.0	103.0					6																	52357122		2203	4300	6503	SO:0001583	missense	114327	0	0					g.chr6:52357122C>A	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1906C>A	chr6.hg19:g.52357122C>A	ENSP00000360107:p.Arg636Ser	1					EFHC1_ENST00000538167.1_Missense_Mutation_p.R617S|EFHC1_ENST00000433625.2_Intron	p.R636S	NM_018100.3	NP_060570.2	2	4	6	2.398453	Q5JVL4	EFHC1_HUMAN		11	2009	+	Lung NSC(77;0.109)		B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	1	0	hg19	c.1906C>A	CCDS4942.1	0	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992193	0.74703	.	.	ENSG00000096093	ENST00000371068;ENST00000538167	T;T	0.42131	0.98;0.98	4.72	3.78	0.43462	4.72	3.78	0.43462	EF-hand-like domain (1);	0.235946	0.38381	N	0.001710	T	0.33000	0.0848	L	0.59436	1.845	0.80722	D	1	D;P	0.54964	0.969;0.947	P;P	0.54460	0.753;0.571	T	0.08617	-1.0713	10	0.11794	T	0.64	-7.7181	9.6159	0.39692	0.2083:0.7917:0.0:0.0	.	617;636	F5GZD8;Q5JVL4	.;EFHC1_HUMAN	S	636;617	ENSP00000360107:R636S;ENSP00000444521:R617S	ENSP00000360107:R636S	R	+	1	0	0	EFHC1	52465081	52465081	0.627000	0.27129	0.946000	0.38457	0.995000	0.86356	1.315000	0.33608	2.612000	0.88384	0.591000	0.81541	CGT	0.409793		TCGA-XN-A8T3-01A-11D-A36O-08	0.393	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	1	0	1	2	2	2	2	0	0	0	0	147	147	147	146	1	3.530000	-4.691567	1	0.190000	NM_018100		0	34	35	0	819	814	0		1	0		0	0	147	0	0	1.000000	7.143613e-01	0	0	0	61	0	34	819
GFRAL	389400	broad.mit.edu	37	6	55216353	55216353	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr6:55216353C>T	ENST00000340465.2	+	5	759	c.673C>T	c.(673-675)Cgc>Tgc	p.R225C		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	225					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CAGTGTAATTCGCAGCTGCCA	0.428																																						ENST00000340465.2	1.000000	0.580000	1.000000	0.760000	0.960000	0.904320	0.960000	1.000000																										0				48						c.(673-675)Cgc>Tgc		GDNF family receptor alpha like							64.0	65.0	65.0					6																	55216353		2203	4300	6503	SO:0001583	missense	389400	0	0					g.chr6:55216353C>T	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.673C>T	chr6.hg19:g.55216353C>T	ENSP00000343636:p.Arg225Cys	1						p.R225C	NM_207410.2	NP_997293.2	2	4	6	2.398453	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)	5	759	+	Lung NSC(77;0.0875)|Renal(3;0.122)		Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	1	1	hg19	c.673C>T	CCDS4957.1	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588449	0.86851	.	.	ENSG00000187871	ENST00000340465	T	0.64991	-0.13	6.05	6.05	0.98169	6.05	6.05	0.98169	GDNF/GAS1 (2);	0.376195	0.29424	N	0.012190	T	0.62551	0.2437	L	0.34521	1.04	0.43014	D	0.994552	D	0.67145	0.996	P	0.56788	0.806	T	0.64084	-0.6490	10	0.62326	D	0.03	-2.3631	20.6087	0.99469	0.0:1.0:0.0:0.0	.	225	Q6UXV0	GFRAL_HUMAN	C	225	ENSP00000343636:R225C	ENSP00000343636:R225C	R	+	1	0	0	GFRAL	55324312	55324312	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	3.954000	0.56708	2.866000	0.98385	0.650000	0.86243	CGC	0.409793		TCGA-XN-A8T3-01A-11D-A36O-08	0.428	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	1	0	0	2	2	2	2	0	0	0	0	47	47	47	44	1	3.530000	-19.885110	1	0.190000	NM_207410		0	17	16	0	243	240	0		1			0	0	47	0	0	0.999966	0	0	0	0	0	0	17	243
HBS1L	10767	broad.mit.edu	37	6	135318671	135318671	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr6:135318671C>A	ENST00000367837.5	-	6	869	c.663G>T	c.(661-663)acG>acT	p.T221T	HBS1L_ENST00000527578.1_Silent_p.T57T|HBS1L_ENST00000415177.2_Silent_p.T156T|HBS1L_ENST00000367824.4_Silent_p.T57T|HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000367826.2_Silent_p.T179T	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase	221					signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		ATGCTTGAATCGTGTGGGGTG	0.493																																						ENST00000367837.5	0.700000	0.290000	0.590000	0.370000	0.470000	0.491507	0.470000	0.470000																										0				20						c.(661-663)acG>acT		HBS1-like translational GTPase							129.0	120.0	123.0					6																	135318671		2203	4300	6503	SO:0001819	synonymous_variant	10767	0	0					g.chr6:135318671C>A	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.663G>T	chr6.hg19:g.135318671C>A		1					HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000367826.2_Silent_p.T179T|HBS1L_ENST00000527578.1_Silent_p.T57T|HBS1L_ENST00000415177.2_Silent_p.T156T|HBS1L_ENST00000367824.4_Silent_p.T57T	p.T221T	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	0	2	2	1.748141	Q9Y450	HBS1L_HUMAN		6	869	-	Colorectal(23;0.221)		B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Silent	SNP	ENST00000367837.5	1	0	hg19	c.663G>T	CCDS5173.1	0																																																																																								0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.493	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2	1	0	1	2	2	2	2	0	0	0	0	115	115	115	112	1	3.530000	-4.045674	1	0.190000			0	19	18	0	403	396	0		1	0		0	0	115	0	0	0.999989	5.029439e-01	0	0	0	36	0	19	403
CROT	54677	broad.mit.edu	37	7	86978419	86978419	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr7:86978419G>T	ENST00000331536.3	+	3	220	c.35G>T	c.(34-36)cGa>cTa	p.R12L	CROT_ENST00000442291.1_Missense_Mutation_p.R12L|CROT_ENST00000412227.2_Missense_Mutation_p.R12L|CROT_ENST00000419147.2_Missense_Mutation_p.R12L	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	12					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	ACTGAAGAACGAACATTTCAG	0.338																																						ENST00000331536.3	0.730000	0.340000	0.630000	0.420000	0.510000	0.530296	0.510000	0.510000																										0				37						c.(34-36)cGa>cTa		carnitine O-octanoyltransferase	L-Carnitine(DB00583)						84.0	84.0	84.0					7																	86978419		2203	4300	6503	SO:0001583	missense	54677	0	0					g.chr7:86978419G>T		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.35G>T	chr7.hg19:g.86978419G>T	ENSP00000331981:p.Arg12Leu	1					CROT_ENST00000419147.2_Missense_Mutation_p.R12L|CROT_ENST00000412227.2_Missense_Mutation_p.R12L|CROT_ENST00000442291.1_Missense_Mutation_p.R12L	p.R12L	NM_021151.3	NP_066974.2	0	3	3	1.919343	Q9UKG9	OCTC_HUMAN		3	220	+	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	1	0	hg19	c.35G>T	CCDS5604.1	0	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371237	0.82573	.	.	ENSG00000005469	ENST00000419147;ENST00000412227;ENST00000331536;ENST00000442291	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	5.85	5.85	0.93711	5.85	5.85	0.93711	.	0.303544	0.31167	N	0.008131	D	0.91185	0.7223	L	0.41961	1.31	0.58432	D	0.999997	D;D;P	0.64830	0.994;0.991;0.953	P;P;P	0.59487	0.858;0.618;0.748	D	0.88293	0.2944	10	0.25106	T	0.35	-13.5987	19.7758	0.96391	0.0:0.0:1.0:0.0	.	12;12;12	E7EQF2;Q9UKG9;Q86V17	.;OCTC_HUMAN;.	L	12	ENSP00000413575:R12L;ENSP00000404867:R12L;ENSP00000331981:R12L;ENSP00000411983:R12L	ENSP00000331981:R12L	R	+	2	0	0	CROT	86816355	86816355	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.489000	0.81451	2.782000	0.95742	0.655000	0.94253	CGA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.338	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	1	0	1	2	2	2	2	0	0	0	0	107	107	107	106	1	3.530000	-2.942352	1	0.190000	NM_021151		0	26	26	0	556	547	0		1	0		0	0	107	0	0	1.000000	6.323854e-02	0	0	0	9	0	26	556
GTPBP10	85865	broad.mit.edu	37	7	90006865	90006865	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr7:90006865G>T	ENST00000222511.6	+	7	702	c.636G>T	c.(634-636)atG>atT	p.M212I	GTPBP10_ENST00000257659.8_Missense_Mutation_p.M133I	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	212	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						GAGCACATATGAACAAAGGAA	0.318																																						ENST00000222511.6	0.580000	0.310000	0.510000	0.370000	0.430000	0.446240	0.430000	0.430000																										0				10						c.(634-636)atG>atT		GTP-binding protein 10 (putative)							96.0	97.0	97.0					7																	90006865		2203	4293	6496	SO:0001583	missense	85865	0	0					g.chr7:90006865G>T		CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.636G>T	chr7.hg19:g.90006865G>T	ENSP00000222511:p.Met212Ile	1					GTPBP10_ENST00000257659.8_Missense_Mutation_p.M133I	p.M212I	NM_033107.3	NP_149098.2	0	3	3	1.919343	A4D1E9	GTPBA_HUMAN		7	702	+			B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	ENST00000222511.6	1	0	hg19	c.636G>T	CCDS5617.1	0	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025864	0.35701	.	.	ENSG00000105793	ENST00000426366;ENST00000450619;ENST00000257659;ENST00000222511;ENST00000417207	T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32	5.89	5.89	0.94794	5.89	5.89	0.94794	GTP1/OBG (1);GTP-binding domain, HSR1-related (1);	0.624103	0.18956	N	0.126524	T	0.18882	0.0453	L	0.58583	1.82	0.39265	D	0.964286	B;B;B;B	0.20988	0.05;0.015;0.04;0.034	B;B;B;B	0.23852	0.013;0.049;0.048;0.026	T	0.04281	-1.0963	9	.	.	.	-9.5889	10.8413	0.46718	0.0697:0.1307:0.7995:0.0	.	133;212;203;229	A4D1E9-2;A4D1E9;C9J8R7;C9JNI1	.;GTPBA_HUMAN;.;.	I	203;229;133;212;139	ENSP00000405697:M203I;ENSP00000389510:M229I;ENSP00000257659:M133I;ENSP00000222511:M212I;ENSP00000416596:M139I	.	M	+	3	0	0	GTPBP10	89844801	89844801	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.153000	0.42282	2.787000	0.95880	0.650000	0.86243	ATG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.318	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	1	0	1	2	2	2	2	0	0	0	0	205	205	205	203	1	3.530000	-3.685974	1	0.190000	NM_033107		0	41	41	0	1039	1016	0		1	0		0	0	205	0	0	1.000000	4.193923e-01	0	0	0	37	0	41	1039
FASTK	10922	broad.mit.edu	37	7	150775665	150775665	+	Missense_Mutation	SNP	G	G	A	rs377740282		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr7:150775665G>A	ENST00000297532.6	-	4	886	c.809C>T	c.(808-810)aCg>aTg	p.T270M	FASTK_ENST00000482571.1_Missense_Mutation_p.T243M|FASTK_ENST00000540185.1_Intron|FASTK_ENST00000353841.2_Missense_Mutation_p.T129M|RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000489884.1_5'UTR	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	270					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		GCTGAGTTGCGTTTCCTGAAC	0.642																																						ENST00000297532.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				6						c.(808-810)aCg>aTg		Fas-activated serine/threonine kinase		G	MET/THR,MET/THR	0,4406		0,0,2203	58.0	60.0	59.0		809,386	0.7	1.0	7		59	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FASTK	NM_006712.3,NM_033015.2	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	270/550,129/409	150775665	1,13005	2203	4300	6503	SO:0001583	missense	10922	3	121402	35				g.chr7:150775665G>A		CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.809C>T	chr7.hg19:g.150775665G>A	ENSP00000297532:p.Thr270Met	1					RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000482571.1_Missense_Mutation_p.T243M|FASTK_ENST00000540185.1_Intron|FASTK_ENST00000353841.2_Missense_Mutation_p.T129M|FASTK_ENST00000489884.1_5'UTR	p.T270M	NM_006712.4	NP_006703.1	0	3	3	1.935171	Q14296	FASTK_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00989)	4	886	-			A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	ENST00000297532.6	1	1	hg19	c.809C>T	CCDS5918.1	1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.657389	0.29425	0.0	1.16E-4	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000353841;ENST00000297532;ENST00000482571	T;T;T	0.30448	1.94;1.94;1.53	4.75	0.664	0.17890	4.75	0.664	0.17890	.	0.729997	0.12332	N	0.478305	T	0.11793	0.0287	N	0.08118	0	0.80722	D	1	P;B;B	0.47545	0.897;0.002;0.0	B;B;B	0.37091	0.241;0.001;0.0	T	0.10660	-1.0620	10	0.56958	D	0.05	6.7165	3.399	0.07316	0.0809:0.2673:0.3781:0.2737	.	243;129;270	F8VTW9;Q8IVA0;Q14296	.;.;FASTK_HUMAN	M	270;270;129;270;243	ENSP00000324817:T129M;ENSP00000297532:T270M;ENSP00000418516:T243M	ENSP00000297530:T270M	T	-	2	0	0	FASTK	150406598	150406598	1.000000	0.71417	0.964000	0.40570	0.859000	0.49053	1.929000	0.40114	0.003000	0.14656	-0.152000	0.13540	ACG	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.642	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351832.2	1	0	0	2	2	2	2	0	0	0	0	48	48	48	47	1	3.530000	-20.000000	1	0.190000	NM_006712		0	40	39	0	138	136	1		1	1		0	0	48	0	0	1.000000	1	0	60	0	82	0	40	138
RIMS2	9699	broad.mit.edu	37	8	105257203	105257203	+	Missense_Mutation	SNP	G	G	A	rs377163259		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr8:105257203G>A	ENST00000436393.2	+	24	3689	c.3448G>A	c.(3448-3450)Gtg>Atg	p.V1150M	RIMS2_ENST00000339750.2_Missense_Mutation_p.V68M|RIMS2_ENST00000507740.1_Missense_Mutation_p.V946M|RIMS2_ENST00000406091.3_Missense_Mutation_p.V1132M|RIMS2_ENST00000262231.10_Missense_Mutation_p.V971M			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1194					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGGCCTGGCCGTGGAAATGAG	0.463										HNSCC(12;0.0054)																												ENST00000436393.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				144						c.(3448-3450)Gtg>Atg		regulating synaptic membrane exocytosis 2		G	MET/VAL,MET/VAL	0,4038		0,0,2019	129.0	136.0	133.0		2836,3394	5.1	1.0	8		133	1,8363		0,1,4181	no	missense,missense	RIMS2	NM_014677.4,NM_001100117.2	21,21	0,1,6200	AA,AG,GG		0.012,0.0,0.0081	benign,benign	946/1164,1132/1350	105257203	1,12401	2019	4182	6201	SO:0001583	missense	9699	2	120954	39				g.chr8:105257203G>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3448G>A	chr8.hg19:g.105257203G>A	ENSP00000390665:p.Val1150Met	1	HNSCC(12;0.0054)				RIMS2_ENST00000507740.1_Missense_Mutation_p.V946M|RIMS2_ENST00000406091.3_Missense_Mutation_p.V1132M|RIMS2_ENST00000339750.2_Missense_Mutation_p.V68M|RIMS2_ENST00000262231.10_Missense_Mutation_p.V971M	p.V1150M			2	3	5	2.222887	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)	24	3689	+			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	1	1	hg19	c.3448G>A		1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166677	0.57476	0.0	1.2E-4	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T;T	0.21361	2.58;2.28;2.27;2.03;2.48;2.02;2.01	5.05	5.05	0.67936	5.05	5.05	0.67936	.	.	.	.	.	T	0.28797	0.0714	L	0.43152	1.355	0.58432	D	0.999996	D;P;D;B;B	0.56035	0.974;0.669;0.966;0.161;0.161	P;B;P;B;B	0.49047	0.499;0.032;0.599;0.024;0.024	T	0.01051	-1.1468	9	0.44086	T	0.13	.	18.5918	0.91215	0.0:0.0:1.0:0.0	.	1194;1150;971;946;1132	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	M	1169;1132;1194;971;946;1139;1150;68;68	ENSP00000384892:V1132M;ENSP00000262231:V971M;ENSP00000423559:V946M;ENSP00000386228:V1139M;ENSP00000390665:V1150M;ENSP00000428478:V68M;ENSP00000342051:V68M	ENSP00000262231:V971M	V	+	1	0	0	RIMS2	105326379	105326379	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.807000	0.86032	2.623000	0.88846	0.650000	0.86243	GTG	0.366841		TCGA-XN-A8T3-01A-11D-A36O-08	0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	1	0	1	2	2	2	2	0	0	0	0	132	132	132	131	1	3.530000	-20.000000	1	0.190000	NM_001100117		0	109	108	0	616	613	1		1	0		0	0	132	0	0	1.000000	0	0	0	0	1	0	109	616
CSMD3	114788	broad.mit.edu	37	8	113599442	113599442	+	Silent	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr8:113599442C>A	ENST00000297405.5	-	23	3982	c.3738G>T	c.(3736-3738)acG>acT	p.T1246T	CSMD3_ENST00000343508.3_Silent_p.T1206T|CSMD3_ENST00000455883.2_Silent_p.T1142T|CSMD3_ENST00000352409.3_Silent_p.T1246T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1246	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTCATTATTCGTTGCAGATG	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												ENST00000297405.5	0.700000	0.270000	0.560000	0.350000	0.440000	0.463835	0.440000	0.440000																										0				646						c.(3736-3738)acG>acT		CUB and Sushi multiple domains 3							113.0	108.0	110.0					8																	113599442		2203	4299	6502	SO:0001819	synonymous_variant	114788	0	0					g.chr8:113599442C>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3738G>T	chr8.hg19:g.113599442C>A		1	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_ENST00000352409.3_Silent_p.T1246T|CSMD3_ENST00000455883.2_Silent_p.T1142T|CSMD3_ENST00000343508.3_Silent_p.T1206T	p.T1246T	NM_198123.1	NP_937756.1	2	3	5	2.222887	Q7Z407	CSMD3_HUMAN		23	3982	-			Q96PZ3	Silent	SNP	ENST00000297405.5	1	0	hg19	c.3738G>T	CCDS6315.1	0																																																																																								0.366841		TCGA-XN-A8T3-01A-11D-A36O-08	0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	1	0	1	2	2	2	2	0	0	0	0	78	78	78	78	1	3.530000	-2.866560	1	0.190000	NM_052900		0	20	20	0	593	584	0		1			0	0	78	0	0	0.999995	0	0	0	0	0	0	20	593
PCM1	5108	broad.mit.edu	37	8	17814853	17814853	+	Missense_Mutation	SNP	G	G	T	rs376432143		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr8:17814853G>T	ENST00000519253.1	+	12	1978	c.1727G>T	c.(1726-1728)cGa>cTa	p.R576L	PCM1_ENST00000524226.1_Missense_Mutation_p.R576L|PCM1_ENST00000325083.8_Missense_Mutation_p.R576L			Q15154	PCM1_HUMAN	pericentriolar material 1	576					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AGAGATGGGCGAACAGTTAAT	0.363			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																	ENST00000519253.1	0.670000	0.290000	0.570000	0.360000	0.450000	0.471456	0.450000	0.450000				Dom	yes			Dom	yes		8	8p22-p21.3	8p22-p21.3	5108	T	pericentriolar material 1  (PTC4)				"""E, L"""	E, L	RET, JAK2		papillary thyroid, CML, MPD	PCM1/JAK2(30)	0				48						c.(1726-1728)cGa>cTa		pericentriolar material 1							137.0	132.0	134.0					8																	17814853		1890	4112	6002	SO:0001583	missense	5108	0	0					g.chr8:17814853G>T		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.1727G>T	chr8.hg19:g.17814853G>T	ENSP00000431099:p.Arg576Leu	1					PCM1_ENST00000325083.8_Missense_Mutation_p.R576L|PCM1_ENST00000524226.1_Missense_Mutation_p.R576L	p.R576L			0	3	3	1.948911	Q15154	PCM1_HUMAN		12	1978	+			Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	1	0	hg19	c.1727G>T		0	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247804	0.80024	.	.	ENSG00000078674	ENST00000325083;ENST00000517730;ENST00000519253;ENST00000524226	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.15	5.15	0.70609	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.76494	0.997;0.998;0.999;0.997	D;D;D;D	0.77557	0.986;0.99;0.923;0.986	T	0.63047	-0.6724	10	0.52906	T	0.07	-16.4836	19.5116	0.95144	0.0:0.0:1.0:0.0	.	576;615;576;576	E7ETA6;E7EV93;E7EV56;Q15154	.;.;.;PCM1_HUMAN	L	576;615;576;576	ENSP00000327077:R576L;ENSP00000428131:R615L;ENSP00000431099:R576L;ENSP00000430521:R576L	ENSP00000327077:R576L	R	+	2	0	0	PCM1	17859133	17859133	1.000000	0.71417	0.561000	0.28357	0.360000	0.29518	8.857000	0.92250	2.787000	0.95880	0.585000	0.79938	CGA	0.260274		TCGA-XN-A8T3-01A-11D-A36O-08	0.363	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	1	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	3.530000	-2.849753	1	0.190000	NM_006197		0	21	21	0	512	506	0		1	0		0	0	84	0	0	0.999997	2.891131e-01	0	0	0	26	0	21	512
RB1CC1	9821	broad.mit.edu	37	8	53558288	53558288	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr8:53558288G>T	ENST00000025008.5	-	16	4484	c.3961C>A	c.(3961-3963)Cga>Aga	p.R1321R	RB1CC1_ENST00000539297.1_Silent_p.R1321R|RB1CC1_ENST00000435644.2_Silent_p.R1321R|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1321					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				AAAGATGTTCGAACATTTTGC	0.313																																					GBM(180;1701 2102 13475 42023 52570)	ENST00000025008.5	1.000000	0.480000	0.920000	0.600000	0.750000	0.759499	0.750000	1.000000																										0				60						c.(3961-3963)Cga>Aga		RB1-inducible coiled-coil 1							87.0	81.0	83.0					8																	53558288		2203	4300	6503	SO:0001819	synonymous_variant	9821	0	0					g.chr8:53558288G>T	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3961C>A	chr8.hg19:g.53558288G>T		1					RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Silent_p.R1321R|RB1CC1_ENST00000435644.2_Silent_p.R1321R	p.R1321R	NM_014781.4	NP_055596.3	2	3	5	2.222887	Q8TDY2	RBCC1_HUMAN		16	4484	-		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)	Q86YR4|Q8WVU9|Q92601	Silent	SNP	ENST00000025008.5	1	0	hg19	c.3961C>A	CCDS34892.1	0																																																																																								0.366841		TCGA-XN-A8T3-01A-11D-A36O-08	0.313	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	1	0	0	2	2	2	2	0	0	0	0	63	63	63	63	1	3.530000	-5.842960	1	0.190000	NM_014781		0	23	23	0	397	395	0		1	0		0	0	63	0	0	0.999999	8.377993e-01	0	0	0	59	0	23	397
C8orf34	116328	broad.mit.edu	37	8	69552683	69552683	+	Missense_Mutation	SNP	G	G	A	rs548341726		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr8:69552683G>A	ENST00000539993.1	+	8	1469	c.920G>A	c.(919-921)cGt>cAt	p.R307H	C8orf34_ENST00000337103.4_Missense_Mutation_p.R282H|C8orf34_ENST00000518698.1_Missense_Mutation_p.R393H|C8orf34_ENST00000325233.3_Missense_Mutation_p.R51H			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	307										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			AACCAAGGCCGTCCTACTTAC	0.413													G|||	1	0.000199681	0.0	0.0	5008	,	,		16058	0.001		0.0	False		,,,				2504	0.0					ENST00000539993.1	1.000000	0.760000	1.000000	0.900000	0.990000	0.964698	0.990000	1.000000																										0				36						c.(919-921)cGt>cAt		chromosome 8 open reading frame 34							98.0	90.0	92.0					8																	69552683		2203	4300	6503	SO:0001583	missense	116328	5	121404	38				g.chr8:69552683G>A	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.920G>A	chr8.hg19:g.69552683G>A	ENSP00000438159:p.Arg307His	1					C8orf34_ENST00000337103.4_Missense_Mutation_p.R282H|C8orf34_ENST00000518698.1_Missense_Mutation_p.R393H|C8orf34_ENST00000325233.3_Missense_Mutation_p.R51H	p.R307H			2	3	5	2.222887	Q49A92	CH034_HUMAN	Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)	8	1469	+			A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	ENST00000539993.1	1	1	hg19	c.920G>A		1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691944	0.88735	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103;ENST00000325233	T;T;T;T	0.63913	0.66;0.71;0.7;-0.07	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.77157	0.4089	L	0.56769	1.78	0.52099	D	0.999942	D	0.89917	1.0	D	0.83275	0.996	T	0.75158	-0.3416	9	.	.	.	-10.9267	19.3134	0.94202	0.0:0.0:1.0:0.0	.	307	Q49A92	CH034_HUMAN	H	393;307;282;51	ENSP00000427820:R393H;ENSP00000438159:R307H;ENSP00000337174:R282H;ENSP00000319532:R51H	.	R	+	2	0	0	C8orf34	69715237	69715237	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.376000	0.97181	2.567000	0.86603	0.585000	0.79938	CGT	0.366841		TCGA-XN-A8T3-01A-11D-A36O-08	0.413	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	83	83	83	82	1	3.530000	-3.318793	1	0.190000	NM_052958		0	39	38	0	462	460	0		1			0	0	83	0	0	1.000000	0	0	0	0	0	0	39	462
FER1L6	654463	broad.mit.edu	37	8	124989741	124989741	+	Silent	SNP	C	C	A	rs199728149		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr8:124989741C>A	ENST00000522917.1	+	10	1161	c.955C>A	c.(955-957)Cgg>Agg	p.R319R	FER1L6_ENST00000399018.1_Silent_p.R319R	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	319	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCCCTTGTGTCGGAGGGTGAA	0.502																																						ENST00000522917.1	0.780000	0.310000	0.630000	0.390000	0.500000	0.517319	0.500000	0.490000																										0				118						c.(955-957)Cgg>Agg		fer-1-like family member 6							148.0	150.0	149.0					8																	124989741		2038	4189	6227	SO:0001819	synonymous_variant	654463	0	0					g.chr8:124989741C>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.955C>A	chr8.hg19:g.124989741C>A		1					FER1L6_ENST00000399018.1_Silent_p.R319R	p.R319R	NM_001039112.2	NP_001034201.2	2	3	5	2.222887	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)	10	1161	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)			Silent	SNP	ENST00000522917.1	1	0	hg19	c.955C>A	CCDS43767.1	0																																																																																								0.366841		TCGA-XN-A8T3-01A-11D-A36O-08	0.502	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	76	1	3.530000	-3.471697	1	0.190000	NM_001039112		0	20	20	0	528	526	0		1	0		0	0	77	0	0	0.999995	0	0	0	0	1	0	20	528
OR2K2	26248	broad.mit.edu	37	9	114090194	114090194	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr9:114090194C>A	ENST00000374428.1	-	1	606	c.607G>T	c.(607-609)Gat>Tat	p.D203Y	OR2K2_ENST00000302681.1_Missense_Mutation_p.D174Y			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						GTGAAGTGATCGATGAGATTC	0.537																																						ENST00000374428.1	1.000000	0.280000	1.000000	0.390000	0.550000	0.627595	0.550000	0.500000																										0				20						c.(607-609)Gat>Tat		olfactory receptor, family 2, subfamily K, member 2							78.0	73.0	75.0					9																	114090194		2203	4300	6503	SO:0001583	missense	26248	0	0					g.chr9:114090194C>A	X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.607G>T	chr9.hg19:g.114090194C>A	ENSP00000363550:p.Asp203Tyr	1					OR2K2_ENST00000302681.1_Missense_Mutation_p.D174Y	p.D203Y			3	4	7	2.239264	Q8NGT1	OR2K2_HUMAN		1	606	-			Q2TA61|Q5VYK4|Q6IFI5	Missense_Mutation	SNP	ENST00000374428.1	1	0	hg19	c.607G>T		0	.	.	.	.	.	.	.	.	.	.	C	10.85	1.467826	0.26335	.	.	ENSG00000171133	ENST00000302681;ENST00000374428	T;T	0.00193	8.58;8.58	4.92	2.01	0.26516	4.92	2.01	0.26516	GPCR, rhodopsin-like superfamily (1);	0.361129	0.19488	U	0.113053	T	0.00412	0.0013	M	0.71920	2.185	0.09310	N	1	D	0.71674	0.998	D	0.67900	0.954	T	0.47100	-0.9143	10	0.72032	D	0.01	.	7.2851	0.26333	0.0:0.6995:0.1395:0.161	.	203	Q8NGT1	OR2K2_HUMAN	Y	174;203	ENSP00000305055:D174Y;ENSP00000363550:D203Y	ENSP00000305055:D174Y	D	-	1	0	0	OR2K2	113130015	113130015	0.000000	0.05858	0.082000	0.20525	0.386000	0.30323	-0.200000	0.09478	0.350000	0.24002	0.591000	0.81541	GAT	0.369650		TCGA-XN-A8T3-01A-11D-A36O-08	0.537	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	3.530000	-3.235573	1	0.190000	NM_205859		0	13	13	0	351	345	0		1	0		0	0	82	0	0	0.999503	4.505699e-03	0	0	0	3	0	13	351
RABGAP1	23637	broad.mit.edu	37	9	125861826	125861826	+	Silent	SNP	C	C	A	rs199744049		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr9:125861826C>A	ENST00000373647.4	+	24	3021	c.2887C>A	c.(2887-2889)Cgg>Agg	p.R963R	RABGAP1_ENST00000373643.5_Silent_p.R302R	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	963					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)	p.R963W(1)|p.R891W(1)		breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						TGAGAAAATTCGGGTAAGACT	0.353																																						ENST00000373647.4	1.000000	0.360000	1.000000	0.490000	0.650000	0.690100	0.650000	0.610000																										2	Substitution - Missense(2)	p.R963W(1)|p.R891W(1)	large_intestine(2)	41						c.(2887-2889)Cgg>Agg		RAB GTPase activating protein 1							98.0	98.0	98.0					9																	125861826		2203	4300	6503	SO:0001819	synonymous_variant	23637	0	0					g.chr9:125861826C>A	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.2887C>A	chr9.hg19:g.125861826C>A		1					RABGAP1_ENST00000373643.5_Silent_p.R302R	p.R963R	NM_012197.3	NP_036329.3	3	3	6	2.263265	Q9Y3P9	RBGP1_HUMAN		24	3021	+			B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	1	0	hg19	c.2887C>A	CCDS6848.2	0																																																																																								0.377019		TCGA-XN-A8T3-01A-11D-A36O-08	0.353	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	1	0	1	2	2	2	2	0	0	0	0	60	60	60	60	1	3.530000	-3.082850	1	0.190000	NM_012197		0	15	15	0	327	328	0		1	0		0	0	60	0	0	0.999883	9.602939e-01	0	0	0	120	0	15	327
DENND1A	57706	broad.mit.edu	37	9	126146178	126146178	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr9:126146178C>A	ENST00000373624.2	-	21	1793	c.1592G>T	c.(1591-1593)cGg>cTg	p.R531L	DENND1A_ENST00000542603.1_Missense_Mutation_p.R316L|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Missense_Mutation_p.R542L	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	531					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CCTGAGTGTCCGATACGGCTG	0.662																																						ENST00000373624.2	1.000000	0.100000	0.510000	0.160000	0.240000	0.357247	0.240000	0.210000																										0				43						c.(1591-1593)cGg>cTg		DENN/MADD domain containing 1A							60.0	60.0	60.0					9																	126146178		2203	4300	6503	SO:0001583	missense	57706	0	0					g.chr9:126146178C>A	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1592G>T	chr9.hg19:g.126146178C>A	ENSP00000362727:p.Arg531Leu	1					DENND1A_ENST00000542603.1_Missense_Mutation_p.R316L|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Missense_Mutation_p.R542L	p.R531L	NM_020946.1	NP_065997.1	3	3	6	2.263265	Q8TEH3	DEN1A_HUMAN		21	1793	-			A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	0	1	hg19	c.1592G>T	CCDS35133.1	0	.	.	.	.	.	.	.	.	.	.	C	13.62	2.290799	0.40494	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219	T;T;T	0.30714	3.13;1.52;2.83	4.89	4.89	0.63831	4.89	4.89	0.63831	.	0.188343	0.45361	D	0.000366	T	0.51822	0.1697	M	0.72118	2.19	0.80722	D	1	P;P;P;D	0.65815	0.738;0.612;0.478;0.995	B;B;B;P	0.59357	0.38;0.253;0.129;0.856	T	0.52373	-0.8584	10	0.41790	T	0.15	-6.3349	18.1242	0.89581	0.0:1.0:0.0:0.0	.	542;532;531;394	Q8TEH3-6;Q8TEH3-7;Q8TEH3;Q9HCG4	.;.;DEN1A_HUMAN;.	L	531;316;542	ENSP00000362727:R531L;ENSP00000437457:R316L;ENSP00000377766:R542L	ENSP00000362727:R531L	R	-	2	0	0	DENND1A	125185999	125185999	1.000000	0.71417	0.972000	0.41901	0.158000	0.22134	1.211000	0.32382	2.265000	0.75225	0.555000	0.69702	CGG	0.377019		TCGA-XN-A8T3-01A-11D-A36O-08	0.662	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	0	0	1	2	2	2	2	0	0	0	0	107	107	107	93	1	3.530000	-2.643874	1	0.190000	NM_024820		0	8	8	0	508	457	0		1	0		0	0	107	0	0	0.984078	7.808229e-02	0	0	0	26	0	8	508
RNF38	152006	broad.mit.edu	37	9	36339793	36339793	+	Missense_Mutation	SNP	T	T	C	rs200434728		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr9:36339793T>C	ENST00000259605.6	-	12	1611	c.1504A>G	c.(1504-1506)Att>Gtt	p.I502V	RNF38_ENST00000377877.4_Missense_Mutation_p.I426V|RNF38_ENST00000357058.3_Missense_Mutation_p.I419V|RNF38_ENST00000353739.4_Missense_Mutation_p.I452V|RNF38_ENST00000377885.2_Missense_Mutation_p.I419V|RNF38_ENST00000350199.4_Missense_Mutation_p.I419V	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	502					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			GCTCGGCAAATTGGGCAAGTA	0.378																																						ENST00000259605.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				11						c.(1504-1506)Att>Gtt		ring finger protein 38							107.0	81.0	90.0					9																	36339793		2203	4300	6503	SO:0001583	missense	152006	3	121408	33				g.chr9:36339793T>C		CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.1504A>G	chr9.hg19:g.36339793T>C	ENSP00000259605:p.Ile502Val	1					RNF38_ENST00000377885.2_Missense_Mutation_p.I419V|RNF38_ENST00000350199.4_Missense_Mutation_p.I419V|RNF38_ENST00000353739.4_Missense_Mutation_p.I452V|RNF38_ENST00000357058.3_Missense_Mutation_p.I419V|RNF38_ENST00000377877.4_Missense_Mutation_p.I426V	p.I502V	NM_022781.4	NP_073618.3	3	4	7	2.239264	Q9H0F5	RNF38_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)	12	1611	-			A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	ENST00000259605.6	1	1	hg19	c.1504A>G	CCDS6603.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	14.75	2.629377	0.46944	.	.	ENSG00000137075	ENST00000259605;ENST00000353739;ENST00000377885;ENST00000357058;ENST00000350199;ENST00000377876;ENST00000377870;ENST00000377877	T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05	5.55	5.55	0.83447	5.55	5.55	0.83447	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.000000	0.85682	D	0.000000	T	0.39545	0.1082	N	0.03948	-0.315	0.80722	D	1	P;B;P	0.48911	0.917;0.124;0.904	D;B;D	0.64321	0.924;0.344;0.924	T	0.52275	-0.8597	10	0.48119	T	0.1	-7.5111	13.6403	0.62246	0.0:0.0:0.0:1.0	.	426;452;502	B1AM81;Q9H0F5-2;Q9H0F5	.;.;RNF38_HUMAN	V	502;452;419;419;419;319;426;426	ENSP00000259605:I502V;ENSP00000335239:I452V;ENSP00000367117:I419V;ENSP00000349566:I419V;ENSP00000343947:I419V;ENSP00000367109:I426V	ENSP00000259605:I502V	I	-	1	0	0	RNF38	36329793	36329793	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.381000	0.79718	2.096000	0.63516	0.533000	0.62120	ATT	0.369650		TCGA-XN-A8T3-01A-11D-A36O-08	0.378	RNF38-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052422.3	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	3.530000	-20.000000	1	0.190000	NM_022781		0	47	47	0	214	212	1		1	1		0	0	36	0	0	1.000000	9.504272e-01	0	4	0	21	0	47	214
MAMDC2	256691	broad.mit.edu	37	9	72785470	72785470	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr9:72785470G>A	ENST00000377182.4	+	11	2191	c.1574G>A	c.(1573-1575)cGg>cAg	p.R525Q	MAMDC2-AS1_ENST00000448377.3_RNA|MAMDC2-AS1_ENST00000420573.1_RNA|MAMDC2_ENST00000460688.1_3'UTR|MAMDC2-AS1_ENST00000377178.3_RNA|MAMDC2-AS1_ENST00000591368.1_RNA|MAMDC2-AS1_ENST00000535188.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	525	MAM 4. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						AAAAGAAACCGGAGCAGCTGG	0.498																																						ENST00000377182.4	1.000000	0.090000	1.000000	0.150000	0.260000	0.416974	0.260000	0.200000																										0				14						c.(1573-1575)cGg>cAg		MAM domain containing 2							80.0	76.0	78.0					9																	72785470		2203	4300	6503	SO:0001583	missense	256691	0	0					g.chr9:72785470G>A	BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1574G>A	chr9.hg19:g.72785470G>A	ENSP00000366387:p.Arg525Gln	1					MAMDC2-AS1_ENST00000535188.1_RNA|MAMDC2-AS1_ENST00000420573.1_RNA|MAMDC2-AS1_ENST00000448377.3_RNA|MAMDC2_ENST00000460688.1_3'UTR|MAMDC2-AS1_ENST00000377178.3_RNA|MAMDC2-AS1_ENST00000591368.1_RNA	p.R525Q	NM_153267.4	NP_694999.3	3	4	7	2.239264	Q7Z304	MAMC2_HUMAN		11	2191	+			Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	ENST00000377182.4	0	1	hg19	c.1574G>A	CCDS6631.1	0	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995045	0.74703	.	.	ENSG00000165072	ENST00000377182	T	0.01963	4.53	5.25	4.33	0.51752	5.25	4.33	0.51752	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.500904	0.21233	N	0.077953	T	0.02767	0.0083	N	0.16478	0.41	0.43118	D	0.994837	P	0.40602	0.723	B	0.44315	0.446	T	0.67799	-0.5577	10	0.25106	T	0.35	-12.7011	15.9892	0.80188	0.0:0.1352:0.8648:0.0	.	525	Q7Z304	MAMC2_HUMAN	Q	525	ENSP00000366387:R525Q	ENSP00000366387:R525Q	R	+	2	0	0	MAMDC2	71975290	71975290	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.458000	0.66679	1.297000	0.44761	0.491000	0.48974	CGG	0.369650		TCGA-XN-A8T3-01A-11D-A36O-08	0.498	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	0	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	3.530000	-3.249916	1	0.190000	NM_153267		0	6	6	0	384	378	0		1	0		0	0	66	0	0	0.963260	1.442244e-02	0	0	0	10	0	6	384
OSTF1	26578	broad.mit.edu	37	9	77761608	77761608	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr9:77761608G>T	ENST00000346234.6	+	10	746	c.596G>T	c.(595-597)cGa>cTa	p.R199L		NM_012383.4	NP_036515.4	Q92882	OSTF1_HUMAN	osteoclast stimulating factor 1	199					ossification (GO:0001503)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)				endometrium(1)|skin(1)	2						GATGCAGTTCGAACATTAAGC	0.343																																						ENST00000346234.6	1.000000	0.430000	1.000000	0.530000	0.680000	0.727714	0.680000	0.610000																										0				2						c.(595-597)cGa>cTa		osteoclast stimulating factor 1							129.0	126.0	127.0					9																	77761608		2203	4300	6503	SO:0001583	missense	26578	1	121412	34				g.chr9:77761608G>T	U63717	CCDS6651.1	9q13-q21.2	2013-01-10			ENSG00000134996	ENSG00000134996		"""Ankyrin repeat domain containing"""	8510	protein-coding gene	gene with protein product		610180				10092216	Standard	NM_012383		Approved	SH3P2, OSF, bA235O14.1	uc004ajv.4	Q92882	OTTHUMG00000020033	ENST00000346234.6:c.596G>T	chr9.hg19:g.77761608G>T	ENSP00000340836:p.Arg199Leu	1						p.R199L	NM_012383.4	NP_036515.4	3	4	7	2.239264	Q92882	OSTF1_HUMAN		10	746	+			Q5W126|Q96IJ4	Missense_Mutation	SNP	ENST00000346234.6	1	0	hg19	c.596G>T	CCDS6651.1	0	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208427	0.79240	.	.	ENSG00000134996	ENST00000346234	T	0.46063	0.88	5.84	5.84	0.93424	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.62454	0.2429	M	0.63428	1.95	0.80722	D	1	B;D	0.60160	0.234;0.987	B;D	0.65010	0.039;0.931	T	0.61292	-0.7092	10	0.56958	D	0.05	-12.0759	18.9168	0.92508	0.0:0.0:1.0:0.0	.	199;199	A8K646;Q92882	.;OSTF1_HUMAN	L	199	ENSP00000340836:R199L	ENSP00000340836:R199L	R	+	2	0	0	OSTF1	76951428	76951428	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	6.005000	0.70716	2.748000	0.94277	0.650000	0.86243	CGA	0.369650		TCGA-XN-A8T3-01A-11D-A36O-08	0.343	OSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052704.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	90	1	3.530000	-2.918079	1	0.190000	NM_012383		0	26	26	0	536	527	0		1	0		0	0	91	0	0	1.000000	9.998741e-01	0	0	0	287	0	26	536
LCN8	138307	broad.mit.edu	37	9	139650984	139650984	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chr9:139650984G>T	ENST00000371688.3	-	3	511	c.216C>A	c.(214-216)ttC>ttA	p.F72L	LCN8_ENST00000482893.1_5'UTR	NM_178469.3	NP_848564.2	Q6JVE9	LCN8_HUMAN	lipocalin 8	95					response to hormone (GO:0009725)|transport (GO:0006810)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	10	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		CAGGAAAAGCGAATTTTCCCG	0.517																																						ENST00000371688.3	0.830000	0.360000	0.700000	0.460000	0.570000	0.588294	0.570000	0.550000																										0				10						c.(214-216)ttC>ttA		lipocalin 8							224.0	196.0	205.0					9																	139650984		2203	4300	6503	SO:0001583	missense	138307	0	0					g.chr9:139650984G>T	AK124003	CCDS35183.1	9q34.3	2011-10-24	2005-01-11		ENSG00000204001	ENSG00000204001		"""Lipocalins"""	27038	protein-coding gene	gene with protein product		612902	"""chromosome 9 open reading frame 137"", ""lipocalin 5"""	LCN5			Standard	XM_005266058		Approved		uc004cjb.1	Q6JVE9	OTTHUMG00000020942	ENST00000371688.3:c.216C>A	chr9.hg19:g.139650984G>T	ENSP00000360753:p.Phe72Leu	1					LCN8_ENST00000482893.1_5'UTR	p.F72L	NM_178469.3	NP_848564.2	2	3	5	2.276796	Q6JVE9	LCN8_HUMAN		3	511	-	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)	A1L4A8|A6NMN9|Q5T5R4	Missense_Mutation	SNP	ENST00000371688.3	1	0	hg19	c.216C>A	CCDS35183.1	0	.	.	.	.	.	.	.	.	.	.	G	13.59	2.281328	0.40394	.	.	ENSG00000204001	ENST00000371688	T	0.14391	2.51	3.55	-7.1	0.01547	3.55	-7.1	0.01547	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	.	.	.	.	T	0.29423	0.0733	M	0.62723	1.935	0.09310	N	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.992	T	0.32188	-0.9916	9	0.72032	D	0.01	.	13.594	0.61978	0.2986:0.0:0.7014:0.0	.	95;72	Q6JVE9;Q6JVE9-2	LCN8_HUMAN;.	L	72	ENSP00000360753:F72L	ENSP00000360753:F72L	F	-	3	2	2	LCN8	138770805	138770805	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.446000	0.06837	-1.525000	0.01762	-1.564000	0.00881	TTC	0.369650		TCGA-XN-A8T3-01A-11D-A36O-08	0.517	LCN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055109.1	1	0	1	2	2	2	2	0	0	0	0	87	87	87	87	1	3.530000	-3.674093	1	0.190000	NM_178469		0	22	22	0	503	496	0		1			0	0	87	0	0	0.999999	0	0	0	0	0	0	22	503
LUZP4	51213	broad.mit.edu	37	X	114540856	114540856	+	Silent	SNP	G	G	A	rs148942179		TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chrX:114540856G>A	ENST00000371920.3	+	4	436	c.429G>A	c.(427-429)ccG>ccA	p.P143P	LUZP4_ENST00000451986.2_Silent_p.P61P	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	143						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						AAGGAAATCCGGACAAATCAG	0.473																																						ENST00000371920.3	1.000000	0.670000	0.970000	0.770000	0.880000	0.874520	0.880000	0.940000																										0				14						c.(427-429)ccG>ccA		leucine zipper protein 4		G		0,3835		0,0,1632,571	85.0	80.0	82.0		429	-2.5	0.0	X	dbSNP_134	82	2,6726		0,2,2426,1872	no	coding-synonymous	LUZP4	NM_016383.3		0,2,4058,2443	AA,AG,GG,G		0.0297,0.0,0.0189		143/314	114540856	2,10561	2203	4300	6503	SO:0001819	synonymous_variant	51213	5	121410	39				g.chrX:114540856G>A	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.429G>A	chrX.hg19:g.114540856G>A							LUZP4_ENST00000451986.2_Silent_p.P61P	p.P143P	NM_016383.3	NP_057467.1	0	1	1		Q9P127	LUZP4_HUMAN		4	436	+			B3KSD6	Silent	SNP	ENST00000371920.3	1	1	hg19	c.429G>A	CCDS14567.1	1																																																																																								0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.473	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	1	0	1	2	2	2	2	0	0	0	0	35	35	35	35	1	3.530000	-2.987853	1	0.190000	NM_016383		0	37	37	0	166	162	1		1			0	0	35	0	0	1.000000	0	0	0	0	0	0	37	166
STS	412	broad.mit.edu	37	X	7268006	7268006	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chrX:7268006G>A	ENST00000217961.4	+	10	1676	c.1456G>A	c.(1456-1458)Gtg>Atg	p.V486M		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	486					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	TGCCACACACGTGTGCTTCTG	0.488									Ichthyosis																													ENST00000217961.4	0.980000	0.630000	0.920000	0.720000	0.820000	0.823812	0.820000	0.830000																										0				27						c.(1456-1458)Gtg>Atg		steroid sulfatase (microsomal), isozyme S	Norelgestromin(DB06713)						111.0	97.0	102.0					X																	7268006		2203	4299	6502	SO:0001583	missense	412	0	0		Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chrX:7268006G>A	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1456G>A	chrX.hg19:g.7268006G>A	ENSP00000217961:p.Val486Met							p.V486M	NM_000351.4	NP_000342.2	0	1	1		P08842	STS_HUMAN		10	1676	+		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	1	1	hg19	c.1456G>A	CCDS14127.1	0	.	.	.	.	.	.	.	.	.	.	G	12.41	1.928468	0.34002	.	.	ENSG00000101846	ENST00000217961	D	0.91068	-2.78	4.22	4.22	0.49857	4.22	4.22	0.49857	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.186047	0.33023	N	0.005369	D	0.91432	0.7296	M	0.85630	2.765	0.35164	D	0.770921	P	0.51147	0.942	B	0.43301	0.415	D	0.94820	0.7986	10	0.49607	T	0.09	.	14.6151	0.68541	0.0:0.0:1.0:0.0	.	486	P08842	STS_HUMAN	M	486	ENSP00000217961:V486M	ENSP00000217961:V486M	V	+	1	0	0	STS	7278006	7278006	0.997000	0.39634	0.494000	0.27515	0.029000	0.11900	2.447000	0.44917	1.720000	0.51447	0.600000	0.82982	GTG	0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.488	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	61	1	3.530000	-20.000000	1	0.190000	NM_000351		0	50	48	0	263	261	1		1	0		0	0	61	0	0	1.000000	8.288955e-01	0	1	0	18	0	50	263
SCML1	6322	broad.mit.edu	37	X	17767568	17767568	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chrX:17767568C>A	ENST00000380041.3	+	5	575	c.247C>A	c.(247-249)Cgt>Agt	p.R83S	SCML1_ENST00000380043.3_Missense_Mutation_p.R56S|SCML1_ENST00000380045.3_5'UTR|SCML1_ENST00000398080.1_5'UTR	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	83					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					TGATGTGATTCGTAGAAAGGT	0.303																																						ENST00000380041.3	0.500000	0.170000	0.410000	0.230000	0.310000	0.323693	0.310000	0.300000																										0				10						c.(247-249)Cgt>Agt		sex comb on midleg-like 1 (Drosophila)							101.0	92.0	95.0					X																	17767568		2203	4300	6503	SO:0001583	missense	6322	0	0					g.chrX:17767568C>A		CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.247C>A	chrX.hg19:g.17767568C>A	ENSP00000369380:p.Arg83Ser						SCML1_ENST00000380043.3_Missense_Mutation_p.R56S|SCML1_ENST00000398080.1_5'UTR|SCML1_ENST00000380045.3_5'UTR	p.R83S	NM_001037540.1	NP_001032629.1	0	1	1		Q9UN30	SCML1_HUMAN		5	575	+	Hepatocellular(33;0.183)		B0FZN6|B2RA08|Q5H968|Q5H969	Missense_Mutation	SNP	ENST00000380041.3	1	0	hg19	c.247C>A	CCDS35210.1	0	.	.	.	.	.	.	.	.	.	.	C	12.48	1.949167	0.34377	.	.	ENSG00000047634	ENST00000380041;ENST00000380043;ENST00000419185	.	.	.	4.96	-1.83	0.07833	4.96	-1.83	0.07833	.	1.225180	0.05738	N	0.600913	T	0.15825	0.0381	N	0.03608	-0.345	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.08055	0.002;0.003	T	0.25745	-1.0123	9	0.18710	T	0.47	-9.9658	8.3928	0.32540	0.4512:0.3997:0.1491:0.0	.	56;83	Q9UN30-2;Q9UN30	.;SCML1_HUMAN	S	83;56;56	.	ENSP00000369380:R83S	R	+	1	0	0	SCML1	17677489	17677489	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.395000	0.07287	-0.672000	0.05266	-1.059000	0.02297	CGT	0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.303	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	1	0	1	2	2	2	2	0	0	0	0	41	41	41	40	1	3.530000	-3.138427	1	0.190000	NM_006746		0	12	11	0	193	191	0		1	0		0	0	41	0	0	0.999127	2.666017e-01	0	0	0	16	0	12	193
DIAPH2	1730	broad.mit.edu	37	X	96013193	96013193	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chrX:96013193G>T	ENST00000324765.8	+	4	730	c.383G>T	c.(382-384)cGa>cTa	p.R128L	DIAPH2_ENST00000373049.4_Missense_Mutation_p.R128L|DIAPH2_ENST00000373054.4_Missense_Mutation_p.R117L|DIAPH2_ENST00000355827.4_Missense_Mutation_p.R128L|DIAPH2_ENST00000373061.3_Missense_Mutation_p.R128L			O60879	DIAP2_HUMAN	diaphanous-related formin 2	128	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						GCTCCTTTACGAAACAAAGAC	0.383																																						ENST00000324765.8	0.580000	0.250000	0.500000	0.320000	0.400000	0.413412	0.400000	0.400000																										0				51						c.(382-384)cGa>cTa		diaphanous-related formin 2							116.0	94.0	102.0					X																	96013193		2203	4300	6503	SO:0001583	missense	1730	0	0					g.chrX:96013193G>T	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.383G>T	chrX.hg19:g.96013193G>T	ENSP00000321348:p.Arg128Leu						DIAPH2_ENST00000355827.4_Missense_Mutation_p.R128L|DIAPH2_ENST00000373061.3_Missense_Mutation_p.R128L|DIAPH2_ENST00000373054.4_Missense_Mutation_p.R117L|DIAPH2_ENST00000373049.4_Missense_Mutation_p.R128L	p.R128L			0	1	1		O60879	DIAP2_HUMAN		4	730	+			A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	1	0	hg19	c.383G>T	CCDS14467.1	0	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760417	0.69763	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15;-2.15	5.73	4.87	0.63330	5.73	4.87	0.63330	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.49305	D	0.000141	D	0.89546	0.6746	L	0.55103	1.725	0.46927	D	0.999257	D;P;D	0.89917	1.0;0.951;0.999	D;B;D	0.91635	0.999;0.438;0.997	D	0.86292	0.1674	10	0.02654	T	1	.	13.361	0.60657	0.0783:0.0:0.9217:0.0	.	128;128;128	O60879;O60879-2;B7ZLJ0	DIAP2_HUMAN;.;.	L	128;117;128;128;128;128	ENSP00000362152:R128L;ENSP00000362145:R117L;ENSP00000348082:R128L;ENSP00000362140:R128L;ENSP00000321348:R128L	ENSP00000321348:R128L	R	+	2	0	0	DIAPH2	95899849	95899849	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	9.239000	0.95389	1.175000	0.42826	0.600000	0.82982	CGA	0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.383	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	1	0	1	2	2	2	2	0	0	0	0	40	40	40	39	1	3.530000	-3.318788	1	0.190000	NM_006729, NM_007309		0	20	19	0	241	238	0		1	0		0	0	40	0	0	0.999995	1.880924e-01	0	0	0	10	0	20	241
SLITRK4	139065	broad.mit.edu	37	X	142716900	142716900	+	Silent	SNP	G	G	T			TCGA-XN-A8T3-01A-11D-A36O-08	TCGA-XN-A8T3-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5cf08adf-ece6-4625-8279-2994b8acb873	165d0321-64d0-4625-be7b-5c3403120bd9	g.chrX:142716900G>T	ENST00000381779.4	-	2	2250	c.2025C>A	c.(2023-2025)acC>acA	p.T675T	SLITRK4_ENST00000338017.4_Silent_p.T675T|SLITRK4_ENST00000356928.1_Silent_p.T675T	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	675						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTTTTATTGGTTTTGTGGT	0.483																																						ENST00000381779.4	0.200000	0.050000	0.160000	0.080000	0.110000	0.123739	0.110000	0.110000																										0				60						c.(2023-2025)acC>acA		SLIT and NTRK-like family, member 4							123.0	125.0	124.0					X																	142716900		2203	4300	6503	SO:0001819	synonymous_variant	139065	0	0					g.chrX:142716900G>T	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2025C>A	chrX.hg19:g.142716900G>T							SLITRK4_ENST00000356928.1_Silent_p.T675T|SLITRK4_ENST00000338017.4_Silent_p.T675T	p.T675T	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	0	1	1		Q8IW52	SLIK4_HUMAN		2	2250	-	Acute lymphoblastic leukemia(192;6.56e-05)		Q5JXG3|Q8TCM8|Q96DL3	Silent	SNP	ENST00000381779.4	0	1	hg19	c.2025C>A	CCDS14679.1	0																																																																																								0.190000		TCGA-XN-A8T3-01A-11D-A36O-08	0.483	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	0	0	1	2	2	2	2	0	0	0	0	102	102	102	100	1	3.530000	-2.414136	0	0.190000	NM_173078		0	9	9	0	410	405	0		1	0		0	0	102	0	0	0.993945	8.569361e-03	0	0	0	6	0	9	410
