#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ZNF33B	7582	broad.mit.edu	37	10	43090109	43090109	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr10:43090109C>A	ENST00000359467.3	-	5	403	c.289G>T	c.(289-291)Gaa>Taa	p.E97*	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						GATTGATTTTCTTGGCTCCTC	0.333																																					Melanoma(137;1247 1767 16772 25727 43810)	ENST00000359467.3	1.000000	0.370000	0.860000	0.500000	0.670000	0.687181	0.670000	1.000000																										0				29						c.(289-291)Gaa>Taa		zinc finger protein 33B							79.0	80.0	80.0					10																	43090109		2203	4298	6501	SO:0001587	stop_gained	7582	0	0					g.chr10:43090109C>A	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.289G>T	chr10.hg19:g.43090109C>A	ENSP00000352444:p.Glu97*	0					ZNF33B_ENST00000486187.1_RNA	p.E97*	NM_006955.1	NP_008886.1	0	1	1	1.981089	Q06732	ZN33B_HUMAN		5	403	-			Q06731|Q32MA2|Q86XY8|Q8NDW3	Nonsense_Mutation	SNP	ENST00000359467.3	0	1	hg19	c.289G>T	CCDS7198.1	0	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760951	0.89932	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	.	.	.	2.14	2.14	0.27477	2.14	2.14	0.27477	.	0.000000	0.37219	N	0.002190	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	10.4164	0.44325	0.0:1.0:0.0:0.0	.	.	.	.	X	97;63	.	ENSP00000352444:E97X	E	-	1	0	0	ZNF33B	42410115	42410115	0.000000	0.05858	0.708000	0.30435	0.654000	0.38779	0.237000	0.17985	1.526000	0.49068	0.416000	0.27883	GAA	0.079646		TCGA-XN-A8T5-01A-12D-A36O-08	0.333	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	0	2	2	2	2	0	0	0	0	108	108	108	106	1	2.010000	-3.696441	1	0.090000	NM_006955		0	13	13	0	417	410	1		1	1		0	0	108	0	0	0.999497	1.170268e-01	0	8	0	10	0	13	417
BICC1	80114	broad.mit.edu	37	10	60560029	60560029	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr10:60560029C>T	ENST00000373886.3	+	13	1805	c.1801C>T	c.(1801-1803)Ccg>Tcg	p.P601S	BICC1_ENST00000263103.1_Missense_Mutation_p.P227S	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	601					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TCACGGGGATCCGTCCATCCA	0.403																																						ENST00000373886.3	1.000000	0.610000	1.000000	0.870000	0.990000	0.950871	0.990000	1.000000																										0				44						c.(1801-1803)Ccg>Tcg		BicC family RNA binding protein 1							49.0	46.0	47.0					10																	60560029		2203	4300	6503	SO:0001583	missense	80114	0	0					g.chr10:60560029C>T	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.1801C>T	chr10.hg19:g.60560029C>T	ENSP00000362993:p.Pro601Ser	0					BICC1_ENST00000263103.1_Missense_Mutation_p.P227S	p.P601S	NM_001080512.1	NP_001073981.1	1	2	3	2.041757	Q9H694	BICC1_HUMAN		13	1805	+				Missense_Mutation	SNP	ENST00000373886.3	1	1	hg19	c.1801C>T	CCDS31206.1	1	.	.	.	.	.	.	.	.	.	.	C	5.695	0.312787	0.10789	.	.	ENSG00000122870	ENST00000373886;ENST00000263103	T;T	0.46451	1.74;0.87	6.02	6.02	0.97574	6.02	6.02	0.97574	.	0.159123	0.64402	D	0.000013	T	0.22399	0.0540	N	0.14661	0.345	0.27805	N	0.942355	B;B	0.17852	0.024;0.003	B;B	0.12156	0.007;0.003	T	0.19192	-1.0313	10	0.06891	T	0.86	-15.2366	10.2723	0.43489	0.0:0.6824:0.2487:0.0689	.	521;601	E7EU62;Q9H694	.;BICC1_HUMAN	S	601;227	ENSP00000362993:P601S;ENSP00000263103:P227S	ENSP00000263103:P227S	P	+	1	0	0	BICC1	60230035	60230035	0.935000	0.31712	1.000000	0.80357	0.353000	0.29299	0.429000	0.21412	2.865000	0.98341	0.655000	0.94253	CCG	0.105695		TCGA-XN-A8T5-01A-12D-A36O-08	0.403	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	1	0	1	2	2	2	2	0	0	0	0	39	39	39	37	1	2.010000	-12.675990	1	0.090000	NM_025044		0	10	10	0	194	194	1		1	1		0	0	39	0	0	0.997098	3.461205e-01	0	5	0	18	0	10	194
HMX3	340784	broad.mit.edu	37	10	124895877	124895877	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr10:124895877C>T	ENST00000357878.5	+	1	400	c.311C>T	c.(310-312)gCc>gTc	p.A104V		NM_001105574.1	NP_001099044.1	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	104					brain development (GO:0007420)|cell differentiation (GO:0030154)|embryo implantation (GO:0007566)|inner ear morphogenesis (GO:0042472)|maternal process involved in female pregnancy (GO:0060135)|neuromuscular process controlling balance (GO:0050885)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(4)	4		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		CAGAGGTTTGCCCTGCCCGCG	0.731																																						ENST00000357878.5	1.000000	0.410000	1.000000	0.740000	0.990000	0.912237	0.990000	1.000000																										0				4						c.(310-312)gCc>gTc		H6 family homeobox 3							11.0	15.0	14.0					10																	124895877		1956	4126	6082	SO:0001583	missense	340784	2	119904	15				g.chr10:124895877C>T		CCDS41575.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188620	ENSG00000188620		"""Homeoboxes / ANTP class : NKL subclass"""	5019	protein-coding gene	gene with protein product		613380	"""homeo box (H6 family) 3"""				Standard	NM_001105574		Approved	NKX5-1	uc010quc.2	A6NHT5	OTTHUMG00000019199	ENST00000357878.5:c.311C>T	chr10.hg19:g.124895877C>T	ENSP00000350549:p.Ala104Val	0						p.A104V	NM_001105574.1	NP_001099044.1	1	2	3	2.041757	A6NHT5	HMX3_HUMAN		1	400	+		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)	A8MU06	Missense_Mutation	SNP	ENST00000357878.5	0	1	hg19	c.311C>T	CCDS41575.1	1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331198	0.60853	.	.	ENSG00000188620	ENST00000357878	D	0.91843	-2.92	4.01	4.01	0.46588	4.01	4.01	0.46588	.	0.196683	0.42821	D	0.000649	D	0.86481	0.5943	N	0.24115	0.695	0.41786	D	0.989841	P	0.47762	0.9	B	0.42282	0.382	D	0.86231	0.1637	10	0.31617	T	0.26	.	15.6906	0.77450	0.0:1.0:0.0:0.0	.	104	A6NHT5	HMX3_HUMAN	V	104	ENSP00000350549:A104V	ENSP00000350549:A104V	A	+	2	0	0	HMX3	124885867	124885867	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.500000	0.53318	1.748000	0.51833	0.460000	0.39030	GCC	0.105695		TCGA-XN-A8T5-01A-12D-A36O-08	0.731	HMX3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050842.4	0	0	0	2	2	2	2	0	0	0	0	33	33	33	33	1	2.010000	-7.527364	1	0.090000	XM_291716		0	4	4	0	81	78	0		1	0		0	0	33	0	0	0.883428	0	0	0	0	1	0	4	81
OR52W1	120787	broad.mit.edu	37	11	6221254	6221254	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr11:6221254C>A	ENST00000311352.2	+	1	879	c.801C>A	c.(799-801)caC>caA	p.H267Q	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCTCACACACCGCTTTGGTC	0.547																																						ENST00000311352.2	0.270000	0.070000	0.210000	0.110000	0.150000	0.166018	0.150000	0.150000																										0				11						c.(799-801)caC>caA		olfactory receptor, family 52, subfamily W, member 1							456.0	417.0	430.0					11																	6221254		2201	4296	6497	SO:0001583	missense	120787	0	0					g.chr11:6221254C>A	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.801C>A	chr11.hg19:g.6221254C>A	ENSP00000309673:p.His267Gln	0					RP11-290F24.6_ENST00000600308.1_lincRNA	p.H267Q	NM_001005178.1	NP_001005178.1	0	1	1	1.995586	Q6IF63	O52W1_HUMAN		1	879	+		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)	Q8NH78	Missense_Mutation	SNP	ENST00000311352.2	0	1	hg19	c.801C>A	CCDS31407.1	0	.	.	.	.	.	.	.	.	.	.	C	8.476	0.858617	0.17178	.	.	ENSG00000175485	ENST00000311352	T	0.00084	8.75	5.11	-5.48	0.02592	5.11	-5.48	0.02592	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39985	N	0.001210	T	0.00073	0.0002	L	0.35249	1.045	0.21220	N	0.99975	B	0.29612	0.251	B	0.27076	0.076	T	0.47156	-0.9139	10	0.66056	D	0.02	.	5.0242	0.14376	0.0925:0.3018:0.0912:0.5146	.	267	Q6IF63	O52W1_HUMAN	Q	267	ENSP00000309673:H267Q	ENSP00000309673:H267Q	H	+	3	2	2	OR52W1	6177830	6177830	0.001000	0.12720	0.795000	0.32087	0.080000	0.17528	-0.139000	0.10358	-0.942000	0.03695	-1.012000	0.02466	CAC	0.082985		TCGA-XN-A8T5-01A-12D-A36O-08	0.547	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383758.1	0	0	0	2	15	2	2	1	1	1	1	363	363	363	361	1	2.010000	-5.255268	1	0.090000	NM_001005178		0	10	9	0	1438	1412	0		0			1	0	363	0	0	0.197161	0	0	0	0	0	0	10	1438
SLC5A12	159963	broad.mit.edu	37	11	26725427	26725427	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr11:26725427G>A	ENST00000396005.3	-	5	902	c.593C>T	c.(592-594)aCg>aTg	p.T198M	SLC5A12_ENST00000280467.6_Missense_Mutation_p.T198M	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	198					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AATGAGAACCGTTAAGAAGCC	0.403																																						ENST00000396005.3	0.440000	0.120000	0.350000	0.170000	0.250000	0.267879	0.250000	0.240000																										0				35						c.(592-594)aCg>aTg		solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12							235.0	215.0	222.0					11																	26725427		2203	4299	6502	SO:0001583	missense	159963	0	0					g.chr11:26725427G>A	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.593C>T	chr11.hg19:g.26725427G>A	ENSP00000379326:p.Thr198Met	0					SLC5A12_ENST00000280467.6_Missense_Mutation_p.T198M	p.T198M	NM_178498.3	NP_848593.2	0	1	1	1.995586	Q1EHB4	SC5AC_HUMAN		5	902	-			Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	0	1	hg19	c.593C>T	CCDS7860.2	0	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161956	0.78226	.	.	ENSG00000148942	ENST00000396005;ENST00000280467;ENST00000533617	D;D;D	0.88046	-2.33;-2.33;-2.33	5.16	5.16	0.70880	5.16	5.16	0.70880	.	0.058040	0.64402	D	0.000003	D	0.91212	0.7231	L	0.46670	1.46	0.39532	D	0.968674	D;D	0.69078	0.978;0.997	P;D	0.67725	0.707;0.953	D	0.92534	0.6036	10	0.72032	D	0.01	.	18.6369	0.91382	0.0:0.0:1.0:0.0	.	198;198	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	M	198;198;10	ENSP00000379326:T198M;ENSP00000280467:T198M;ENSP00000435053:T10M	ENSP00000280467:T198M	T	-	2	0	0	SLC5A12	26682003	26682003	1.000000	0.71417	0.936000	0.37596	0.978000	0.69477	7.957000	0.87870	2.412000	0.81896	0.484000	0.47621	ACG	0.082985		TCGA-XN-A8T5-01A-12D-A36O-08	0.403	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	0	0	1	2	2	2	2	0	0	0	0	183	183	183	182	1	2.010000	-2.135537	0	0.090000	NM_178498		0	9	8	0	801	797	0		1			0	0	183	0	0	0.994040	0	0	0	0	0	0	9	801
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.510000	1.000000	0.690000	0.940000	0.876443	0.940000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	1	2	3	2.001156	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.096909		TCGA-XN-A8T5-01A-12D-A36O-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	74	1	2.010000	-4.124952	1	0.090000	NM_033360		575	13	13	7447	316	311	0	1	1	1	1	0	0	75	360	1	0.999512	7.858898e-02	9.992947e-01	2	9	9	298	13	316
ARHGAP9	64333	broad.mit.edu	37	12	57871243	57871243	+	Splice_Site	SNP	G	G	A	rs147287939		TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr12:57871243G>A	ENST00000356411.2	-	4	893	c.755C>T	c.(754-756)aCg>aTg	p.T252M	ARHGAP9_ENST00000430041.2_Splice_Site_p.T68M|ARHGAP9_ENST00000393797.2_Splice_Site_p.T323M|ARHGAP9_ENST00000550454.1_5'UTR|ARHGAP9_ENST00000424809.2_Splice_Site_p.T252M|ARHGAP9_ENST00000393791.3_Splice_Site_p.T252M|ARHGAP9_ENST00000550288.1_Splice_Site_p.T331M			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	252					positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			AGGTCTCACCGTCTCGCTGCG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		16625	0.001		0.0	False		,,,				2504	0.0					ENST00000356411.2	1.000000	0.710000	1.000000	0.920000	0.990000	0.967702	0.990000	1.000000																										0				30						c.(754-756)aCg>aTg		Rho GTPase activating protein 9		G	MET/THR,MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	54.0	60.0	58.0		203,755,755	-2.7	0.0	12	dbSNP_134	58	2,8598	2.2+/-6.3	0,2,4298	yes	missense-near-splice,missense-near-splice,missense-near-splice	ARHGAP9	NM_001080156.1,NM_001080157.1,NM_032496.2	81,81,81	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	benign,benign,benign	68/548,252/641,252/732	57871243	3,13003	2203	4300	6503	SO:0001630	splice_region_variant	64333	24	121412	47				g.chr12:57871243G>A	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.756+1C>T	chr12.hg19:g.57871243G>A		0					ARHGAP9_ENST00000550288.1_Splice_Site_p.T331M|ARHGAP9_ENST00000430041.2_Splice_Site_p.T68M|ARHGAP9_ENST00000393791.3_Splice_Site_p.T252M|ARHGAP9_ENST00000550454.1_5'UTR|ARHGAP9_ENST00000393797.2_Splice_Site_p.T323M|ARHGAP9_ENST00000424809.2_Splice_Site_p.T252M	p.T252M			1	2	3	2.001156	Q9BRR9	RHG09_HUMAN	GBM - Glioblastoma multiforme(3;3.37e-34)	4	893	-			B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Splice_Site	SNP	ENST00000356411.2	1	0	hg19	c.755C>T		1	.	.	.	.	.	.	.	.	.	.	G	7.299	0.612678	0.14066	2.27E-4	2.33E-4	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000430041;ENST00000548139;ENST00000552604;ENST00000551452;ENST00000552066	T;T;T;T;T;T	0.48522	3.05;3.05;1.69;3.04;2.95;0.81	3.29	-2.65	0.06095	3.29	-2.65	0.06095	.	1.008660	0.07975	N	0.984731	T	0.28167	0.0695	N	0.25647	0.755	0.09310	N	1	B;B;B;B;B;B	0.25955	0.138;0.016;0.001;0.005;0.008;0.004	B;B;B;B;B;B	0.11329	0.004;0.004;0.001;0.006;0.002;0.003	T	0.11446	-1.0587	10	0.33940	T	0.23	.	5.1466	0.14989	0.4042:0.0:0.4589:0.1369	.	252;331;252;252;252;68	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9;B4DVI3	.;.;RHG09_HUMAN;.;.;.	M	252;252;252;323;301;68;68;68;105;68	ENSP00000377380:T252M;ENSP00000348782:T252M;ENSP00000394307:T252M;ENSP00000377386:T323M;ENSP00000397950:T68M;ENSP00000449829:T68M	ENSP00000344852:T301M	T	-	2	0	0	ARHGAP9	56157510	56157510	0.001000	0.12720	0.013000	0.15412	0.024000	0.10985	-0.850000	0.04317	-0.995000	0.03459	-0.797000	0.03246	ACG	0.096909		TCGA-XN-A8T5-01A-12D-A36O-08	0.577	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		1	0	1	2	16	2	2	0	0	0	1	70	70	70	70	1	2.010000	-5.210444	1	0.090000	NM_032496	Missense_Mutation	0	17	17	0	315	306	0		1	0		0	0	70	0	0	0.604906	7.806584e-01	0	0	0	55	0	17	315
GPC5	2262	broad.mit.edu	37	13	92101122	92101122	+	Missense_Mutation	SNP	A	A	G			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr13:92101122A>G	ENST00000377067.3	+	2	643	c.271A>G	c.(271-273)Acg>Gcg	p.T91A		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	91					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				GTTTCTTCAAACGTCCAGCTC	0.438																																						ENST00000377067.3	1.000000	0.700000	1.000000	0.880000	0.990000	0.957879	0.990000	1.000000																										0				69						c.(271-273)Acg>Gcg		glypican 5							134.0	123.0	127.0					13																	92101122		2203	4300	6503	SO:0001583	missense	2262	0	0					g.chr13:92101122A>G	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.271A>G	chr13.hg19:g.92101122A>G	ENSP00000366267:p.Thr91Ala	0						p.T91A	NM_004466.4	NP_004457.1	0	1	1	1.996288	P78333	GPC5_HUMAN		2	643	+	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	1	1	hg19	c.271A>G	CCDS9468.1	1	.	.	.	.	.	.	.	.	.	.	A	8.274	0.814030	0.16537	.	.	ENSG00000179399	ENST00000377067	T	0.47528	0.84	5.5	0.224	0.15297	5.5	0.224	0.15297	.	0.228421	0.44483	N	0.000455	T	0.31389	0.0795	L	0.42245	1.32	0.30752	N	0.745058	B	0.28470	0.213	B	0.28139	0.086	T	0.18304	-1.0341	10	0.22109	T	0.4	.	4.9471	0.13994	0.663:0.0:0.2116:0.1254	.	91	P78333	GPC5_HUMAN	A	91	ENSP00000366267:T91A	ENSP00000366267:T91A	T	+	1	0	0	GPC5	90899123	90899123	0.881000	0.30235	0.790000	0.31976	0.231000	0.25187	0.600000	0.24104	-0.165000	0.10908	0.383000	0.25322	ACG	0.082985		TCGA-XN-A8T5-01A-12D-A36O-08	0.438	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	1	0	1	2	2	2	2	0	0	0	0	111	111	111	110	1	2.010000	-19.998340	1	0.090000	NM_004466		0	21	21	0	400	394	0		1	0		0	0	111	0	0	0.999997	2.807991e-03	0	0	0	2	0	21	400
FANCA	2175	broad.mit.edu	37	16	89858476	89858476	+	Splice_Site	SNP	G	G	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr16:89858476G>T	ENST00000389301.3	-	13	1114	c.1084C>A	c.(1084-1086)Ctc>Atc	p.L362I	FANCA_ENST00000568369.1_Splice_Site_p.L362I	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	362					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		ATCACAAAGAGCTGAAATAAA	0.542			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													ENST00000389301.3	1.000000	0.170000	1.000000	0.290000	0.500000	0.586210	0.500000	0.390000			yes	Rec		Fanconi anaemia A	yes	Rec		Fanconi anaemia A	16	16q24.3	16q24.3	2175	D, Mis, N, F, S	"""Fanconi anemia, complementation group A"""				L	L		AML, leukemia			0				47						c.(1084-1086)Ctc>Atc	Involved in tolerance or repair of DNA crosslinks	Fanconi anemia, complementation group A							99.0	95.0	96.0					16																	89858476		2198	4300	6498	SO:0001630	splice_region_variant	2175	0	0		Fanconi Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	g.chr16:89858476G>T	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1084-1C>A	chr16.hg19:g.89858476G>T		0					FANCA_ENST00000568369.1_Splice_Site_p.L362I	p.L362I	NM_000135.2	NP_000126.2	1	2	3	2.048961	O15360	FANCA_HUMAN		13	1114	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Splice_Site	SNP	ENST00000389301.3	0	1	hg19	c.1084C>A	CCDS32515.1	0	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808175	0.50421	.	.	ENSG00000187741	ENST00000389301	T	0.67523	-0.27	5.64	3.65	0.41850	5.64	3.65	0.41850	.	0.456880	0.18430	N	0.141443	T	0.60958	0.2309	M	0.71581	2.175	0.80722	D	1	P;P	0.38788	0.647;0.639	B;B	0.30943	0.091;0.122	T	0.60347	-0.7281	10	0.44086	T	0.13	-13.4105	11.8401	0.52348	0.0:0.1373:0.7281:0.1346	.	362;362	B4DRI7;O15360	.;FANCA_HUMAN	I	362	ENSP00000373952:L362I	ENSP00000373952:L362I	L	-	1	0	0	FANCA	88385977	88385977	1.000000	0.71417	0.996000	0.52242	0.308000	0.27856	3.211000	0.51137	0.725000	0.32318	-0.139000	0.14373	CTC	0.107274		TCGA-XN-A8T5-01A-12D-A36O-08	0.542	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1	0	0	0	2	2	2	2	0	0	0	0	77	77	77	76	1	2.010000	-5.800718	1	0.090000		Missense_Mutation	0	5	3	0	281	276	0		1	0		0	0	77	0	0	0.933932	5.046136e-04	0	0	0	2	0	5	281
TP53	7157	broad.mit.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.960000	0.240000	0.750000	0.360000	0.530000	0.561892	0.530000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	24185						c.(469-471)Gtc>Ttc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						50.0	52.0	51.0					17																	7578461		2202	4300	6502	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578461C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	chr17.hg19:g.7578461C>A	ENSP00000269305:p.Val157Phe	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F	p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	0	0	1.958755	P04637	P53_HUMAN		5	658	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.469G>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	0	TP53	7519186	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	0.064748		TCGA-XN-A8T5-01A-12D-A36O-08	0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	0	0	0	2	2	2	2	0	0	0	0	100	100	100	99	1	2.010000	-7.786348	1	0.090000	NM_000546		0	7	6	0	282	275	0		1	1	1	0	0	100	1431	0	0.978936	4.670161e-01	9.999880e-01	13	63	46	1166	7	282
GUCY2D	3000	broad.mit.edu	37	17	7915536	7915536	+	Silent	SNP	G	G	A	rs63749078		TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr17:7915536G>A	ENST00000254854.4	+	9	1974	c.1824G>A	c.(1822-1824)gcG>gcA	p.A608A		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	608	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				AAGGCCCTGCGGCCCTCTGGG	0.617																																						ENST00000254854.4	1.000000	0.340000	0.980000	0.510000	0.720000	0.732368	0.720000	1.000000																										0				1						c.(1822-1824)gcG>gcA		guanylate cyclase 2D, membrane (retina-specific)							38.0	43.0	42.0					17																	7915536		2203	4300	6503	SO:0001819	synonymous_variant	3000	4	121412	37				g.chr17:7915536G>A	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1824G>A	chr17.hg19:g.7915536G>A		0						p.A608A	NM_000180.3	NP_000171.1	0	0	0	1.958755	Q02846	GUC2D_HUMAN		9	1974	+		Prostate(122;0.157)	Q6LEA7	Silent	SNP	ENST00000254854.4	1	1	hg19	c.1824G>A	CCDS11127.1	0																																																																																								0.064748		TCGA-XN-A8T5-01A-12D-A36O-08	0.617	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2	0	0	1	2	2	2	2	0	0	0	0	56	56	56	55	1	2.010000	-3.371616	1	0.090000			0	8	8	0	230	227	0		1			0	0	56	0	0	0.988978	0	0	0	0	0	0	8	230
ZNF554	115196	broad.mit.edu	37	19	2834450	2834450	+	Missense_Mutation	SNP	A	A	G			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr19:2834450A>G	ENST00000317243.5	+	5	1415	c.1217A>G	c.(1216-1218)aAg>aGg	p.K406R		NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCGGGGAAAAGCCCTATAAA	0.522																																						ENST00000317243.5	1.000000	0.120000	0.910000	0.230000	0.400000	0.486694	0.400000	0.310000																										0				23						c.(1216-1218)aAg>aGg		zinc finger protein 554							44.0	49.0	47.0					19																	2834450		2184	4297	6481	SO:0001583	missense	115196	0	0					g.chr19:2834450A>G	AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.1217A>G	chr19.hg19:g.2834450A>G	ENSP00000321132:p.Lys406Arg	0						p.K406R	NM_001102651.1	NP_001096121.1	1	2	3	2.006785	Q86TJ5	ZN554_HUMAN		5	1415	+		Hepatocellular(1079;0.137)	Q8NAT3|Q9BWN3	Missense_Mutation	SNP	ENST00000317243.5	0	1	hg19	c.1217A>G	CCDS42462.1	0	.	.	.	.	.	.	.	.	.	.	A	16.85	3.236253	0.58886	.	.	ENSG00000172006	ENST00000317243	T	0.24908	1.83	2.76	2.76	0.32466	2.76	2.76	0.32466	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37376	0.1001	L	0.39514	1.22	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.10109	-1.0644	9	0.54805	T	0.06	.	8.9895	0.36014	1.0:0.0:0.0:0.0	.	406	Q86TJ5	ZN554_HUMAN	R	406	ENSP00000321132:K406R	ENSP00000321132:K406R	K	+	2	0	0	ZNF554	2785450	2785450	0.475000	0.25894	0.998000	0.56505	0.649000	0.38597	0.045000	0.14013	1.280000	0.44463	0.467000	0.42956	AAG	0.098117		TCGA-XN-A8T5-01A-12D-A36O-08	0.522	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3	0	0	0	2	2	2	2	0	0	0	0	69	69	69	68	1	2.010000	-5.110003	1	0.090000	NM_152303		0	4	4	0	268	267	0		1	0		0	0	69	0	0	0.890196	3.783801e-03	0	0	0	5	0	4	268
PLEKHG2	64857	broad.mit.edu	37	19	39907611	39907611	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr19:39907611C>T	ENST00000409794.3	+	7	1565	c.715C>T	c.(715-717)Cgc>Tgc	p.R239C	PLEKHG2_ENST00000409797.2_Missense_Mutation_p.R239C|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.R180C|PLEKHG2_ENST00000378550.1_Missense_Mutation_p.R239C|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.R239C	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	239	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ACCTGTCCAGCGCATTCTCAA	0.647																																						ENST00000409794.3	1.000000	0.250000	1.000000	0.390000	0.600000	0.644560	0.600000	1.000000																										0				40						c.(715-717)Cgc>Tgc		pleckstrin homology domain containing, family G (with RhoGef domain) member 2							29.0	30.0	30.0					19																	39907611		2199	4298	6497	SO:0001583	missense	64857	0	0					g.chr19:39907611C>T	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.715C>T	chr19.hg19:g.39907611C>T	ENSP00000386733:p.Arg239Cys	0					PLEKHG2_ENST00000409797.2_Missense_Mutation_p.R239C|PLEKHG2_ENST00000378550.1_Missense_Mutation_p.R239C|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.R239C|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.R180C	p.R239C	NM_022835.2	NP_073746.2	1	2	3	2.006785	Q9H7P9	PKHG2_HUMAN	Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)	7	1565	+	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	0	1	hg19	c.715C>T	CCDS33022.2	0	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230956	0.79688	.	.	ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000378550;ENST00000458508;ENST00000409797	D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34	4.8	4.8	0.61643	4.8	4.8	0.61643	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000003	D	0.96426	0.8834	H	0.98996	4.395	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.981;0.91;0.994;0.997	D	0.97972	1.0344	10	0.87932	D	0	.	17.1606	0.86802	0.0:1.0:0.0:0.0	.	239;239;180;239	Q9H7P9-3;Q9H7P9;E7ESZ3;Q9H7P9-2	.;PKHG2_HUMAN;.;.	C	239;239;239;180;239	ENSP00000386733:R239C;ENSP00000392906:R239C;ENSP00000367812:R239C;ENSP00000408857:R180C;ENSP00000386492:R239C	ENSP00000367812:R239C	R	+	1	0	0	PLEKHG2	44599451	44599451	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.587000	0.36622	2.670000	0.90874	0.407000	0.27541	CGC	0.098117		TCGA-XN-A8T5-01A-12D-A36O-08	0.647	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	0	0	0	2	2	2	2	0	0	0	0	68	68	68	68	1	2.010000	-7.534188	1	0.090000	NM_022835		0	7	8	0	288	283	0		1	0		0	0	68	0	0	0.979985	1.682233e-01	0	1	0	26	0	7	288
MUC16	94025	broad.mit.edu	37	19	9005718	9005718	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr19:9005718C>T	ENST00000397910.4	-	46	39891	c.39688G>A	c.(39688-39690)Gga>Aga	p.G13230R	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13232	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGCTACTCCATCCTTCTCA	0.562																																						ENST00000397910.4	1.000000	0.580000	1.000000	0.830000	0.990000	0.940583	0.990000	1.000000																										0				590						c.(39688-39690)Gga>Aga		mucin 16, cell surface associated							62.0	59.0	60.0					19																	9005718		2036	4177	6213	SO:0001583	missense	94025	0	0					g.chr19:9005718C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39688G>A	chr19.hg19:g.9005718C>T	ENSP00000381008:p.Gly13230Arg	0					MUC16_ENST00000380951.5_5'Flank	p.G13230R	NM_024690.2	NP_078966.2	1	2	3	2.006785	Q8WXI7	MUC16_HUMAN		46	39891	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.39688G>A	CCDS54212.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.57|11.57	1.678764|1.678764	0.29783|0.29783	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000441155|ENST00000542240	T|.	0.46451|.	0.87|.	3.51|3.51	2.45|2.45	0.29901|0.29901	3.51|3.51	2.45|2.45	0.29901|0.29901	SEA (1);|.	0.000000|.	0.31472|.	U|.	0.007590|.	T|T	0.55940|0.55940	0.1952|0.1952	M|M	0.68593|0.68593	2.085|2.085	.|.	.|.	.|.	D;D|.	0.76494|.	0.971;0.999|.	P;D|.	0.83275|.	0.625;0.996|.	T|T	0.63148|0.63148	-0.6702|-0.6702	9|4	0.87932|.	D|.	0|.	-11.7182|-11.7182	7.3243|7.3243	0.26547|0.26547	0.0:0.8661:0.0:0.1339|0.0:0.8661:0.0:0.1339	.|.	20875;13230|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	R|I	13230;361|69	ENSP00000381008:G13230R|.	ENSP00000381008:G13230R|.	G|M	-|-	1|3	0|0	0|0	MUC16|MUC16	8866718|8866718	8866718|8866718	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.002000|0.002000	0.02628|0.02628	0.611000|0.611000	0.24268|0.24268	0.742000|0.742000	0.32697|0.32697	0.455000|0.455000	0.32223|0.32223	GGA|ATG	0.098117		TCGA-XN-A8T5-01A-12D-A36O-08	0.562	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	2.010000	-3.097668	1	0.090000	NM_024690		0	10	9	0	196	189	0		1	1		0	0	48	0	0	0.996447	6.639808e-02	0	4	0	4	0	10	196
ZNF614	80110	broad.mit.edu	37	19	52520103	52520103	+	Silent	SNP	G	G	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr19:52520103G>A	ENST00000270649.6	-	5	1292	c.748C>T	c.(748-750)Ctg>Ttg	p.L250L	ZNF614_ENST00000356322.6_Intron	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	250				L -> P (in Ref. 1; BAC04966). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TTAGTTTTCAGATGCTTAGTG	0.368																																						ENST00000270649.6	1.000000	0.350000	1.000000	0.470000	0.630000	0.676864	0.630000	0.580000																										0				24						c.(748-750)Ctg>Ttg		zinc finger protein 614							73.0	70.0	71.0					19																	52520103		2203	4300	6503	SO:0001819	synonymous_variant	80110	0	0					g.chr19:52520103G>A	BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.748C>T	chr19.hg19:g.52520103G>A		0					ZNF614_ENST00000356322.6_Intron	p.L250L	NM_025040.3	NP_079316.2	1	2	3	2.008746	Q8N883	ZN614_HUMAN		5	1292	-		all_neural(266;0.0505)	Q494T8|Q8TCF4|Q9BSN8	Silent	SNP	ENST00000270649.6	1	1	hg19	c.748C>T	CCDS12847.1	0																																																																																								0.098519		TCGA-XN-A8T5-01A-12D-A36O-08	0.368	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462407.1	0	0	1	2	2	2	2	0	0	0	0	130	130	130	129	1	2.010000	-3.122460	1	0.090000	NM_025040		0	15	15	0	555	550	0		1	0		0	0	130	0	0	0.999865	1.564190e-02	0	0	0	7	0	15	555
ANKRD35	148741	broad.mit.edu	37	1	145567068	145567068	+	Silent	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr1:145567068C>T	ENST00000355594.4	+	12	3003	c.2916C>T	c.(2914-2916)taC>taT	p.Y972Y		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	972										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCTCCACCTACAGGAATCATC	0.478																																					Melanoma(9;127 754 22988 51047)	ENST00000355594.4	1.000000	0.710000	1.000000	0.890000	0.990000	0.960821	0.990000	1.000000																										0				47						c.(2914-2916)taC>taT		ankyrin repeat domain 35							174.0	160.0	164.0					1																	145567068		2203	4300	6503	SO:0001819	synonymous_variant	148741	0	0					g.chr1:145567068C>T	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2916C>T	chr1.hg19:g.145567068C>T		0						p.Y972Y	NM_144698.3	NP_653299.4	0	1	1	1.995454	Q8N283	ANR35_HUMAN		12	3003	+	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	ENST00000355594.4	1	1	hg19	c.2916C>T	CCDS919.1	1																																																																																								0.082985		TCGA-XN-A8T5-01A-12D-A36O-08	0.478	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	1	0	1	2	2	2	2	0	0	0	0	142	142	142	141	1	2.010000	-5.049620	1	0.090000	NM_144698		0	23	23	0	438	434	0		1	0		0	0	142	0	0	0.999999	2.780968e-01	0	0	0	19	0	23	438
CD1D	912	broad.mit.edu	37	1	158152716	158152716	+	Missense_Mutation	SNP	G	G	A	rs199860570		TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr1:158152716G>A	ENST00000368171.3	+	5	1155	c.656G>A	c.(655-657)cGt>cAt	p.R219H		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	219	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					GGCCCTGGCCGTCTGCTGCTG	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		17566	0.001		0.0	False		,,,				2504	0.0					ENST00000368171.3	1.000000	0.860000	1.000000	0.990000	0.990000	0.991173	0.990000	1.000000																										0				30						c.(655-657)cGt>cAt		CD1d molecule							85.0	85.0	85.0					1																	158152716		2203	4300	6503	SO:0001583	missense	912	10	121412	42				g.chr1:158152716G>A	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.656G>A	chr1.hg19:g.158152716G>A	ENSP00000357153:p.Arg219His	0						p.R219H	NM_001766.3	NP_001757.1	0	1	1	1.995454	P15813	CD1D_HUMAN		5	1155	+	all_hematologic(112;0.0378)		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	ENST00000368171.3	1	1	hg19	c.656G>A	CCDS1173.1	1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606585	0.28623	.	.	ENSG00000158473	ENST00000368171	T	0.13901	2.55	5.18	-0.738	0.11125	5.18	-0.738	0.11125	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (1);	0.528179	0.17322	N	0.178449	T	0.01592	0.0051	N	0.13043	0.29	0.26068	N	0.981252	B	0.21688	0.059	B	0.14578	0.011	T	0.46527	-0.9185	10	0.19147	T	0.46	-1.3462	4.2679	0.10771	0.4919:0.1772:0.3308:0.0	.	219	P15813	CD1D_HUMAN	H	219	ENSP00000357153:R219H	ENSP00000357153:R219H	R	+	2	0	0	CD1D	156419340	156419340	0.000000	0.05858	0.998000	0.56505	0.830000	0.47004	-1.412000	0.02476	0.204000	0.20548	-0.751000	0.03497	CGT	0.082985		TCGA-XN-A8T5-01A-12D-A36O-08	0.592	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	0	0	1	2	2	2	2	0	0	0	0	125	125	125	122	1	2.010000	-6.214394	1	0.090000	NM_001766		0	29	29	0	475	472	0		1	0		0	0	125	0	0	1.000000	2.445600e-01	0	0	0	16	0	29	475
ETNK2	55224	broad.mit.edu	37	1	204115868	204115868	+	Missense_Mutation	SNP	C	C	G			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr1:204115868C>G	ENST00000367202.4	-	3	693	c.543G>C	c.(541-543)aaG>aaC	p.K181N	ETNK2_ENST00000367198.2_Missense_Mutation_p.K3N|ETNK2_ENST00000367201.3_Missense_Mutation_p.K181N|ETNK2_ENST00000367199.2_Intron	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	181					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			TAGTATGAATCTTTGCCATTT	0.507																																						ENST00000367202.4	1.000000	0.210000	0.820000	0.360000	0.560000	0.589995	0.560000	1.000000																										0				7						c.(541-543)aaG>aaC		ethanolamine kinase 2							139.0	119.0	126.0					1																	204115868		2203	4300	6503	SO:0001583	missense	55224	0	0					g.chr1:204115868C>G	AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.543G>C	chr1.hg19:g.204115868C>G	ENSP00000356170:p.Lys181Asn	0					ETNK2_ENST00000367199.2_Intron|ETNK2_ENST00000367198.2_Missense_Mutation_p.K3N|ETNK2_ENST00000367201.3_Missense_Mutation_p.K181N	p.K181N	NM_018208.2	NP_060678.2	0	1	1	1.995454	Q9NVF9	EKI2_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)	3	693	-	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	ENST00000367202.4	0	1	hg19	c.543G>C	CCDS1442.2	0	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434087	0.62955	.	.	ENSG00000143845	ENST00000367201;ENST00000367202;ENST00000455266;ENST00000367198;ENST00000422699;ENST00000452983	T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15	5.34	3.33	0.38152	5.34	3.33	0.38152	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.225367	0.44902	D	0.000408	T	0.68238	0.2979	M	0.79926	2.475	0.36731	D	0.881739	P;D	0.56035	0.792;0.974	P;P	0.56343	0.542;0.796	T	0.75184	-0.3407	10	0.54805	T	0.06	-18.004	8.4404	0.32812	0.0:0.7574:0.0:0.2426	.	181;181	Q9NVF9;Q9NVF9-2	EKI2_HUMAN;.	N	181;181;47;3;47;38	ENSP00000356169:K181N;ENSP00000356170:K181N;ENSP00000356166:K3N;ENSP00000405497:K47N;ENSP00000398091:K38N	ENSP00000356166:K3N	K	-	3	2	2	ETNK2	202382491	202382491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.667000	0.25112	1.489000	0.48450	0.655000	0.94253	AAG	0.082985		TCGA-XN-A8T5-01A-12D-A36O-08	0.507	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087893.1	0	0	0	2	2	2	2	0	0	0	0	54	54	54	54	1	2.010000	-6.824276	1	0.090000	NM_018208		0	5	5	0	202	200	0		1	0		0	0	54	0	0	0.936704	8.866553e-03	0	0	0	5	0	5	202
OR2W5	441932	broad.mit.edu	37	1	247655131	247655131	+	RNA	SNP	G	G	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr1:247655131G>A	ENST00000522351.1	+	0	762							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GCAGCAGGGCGAAAGAAAGCC	0.587																																						ENST00000522351.1	1.000000	0.570000	1.000000	0.710000	0.890000	0.870304	0.890000	1.000000																										0				39								olfactory receptor, family 2, subfamily W, member 5							135.0	123.0	127.0					1																	247655131		2203	4300	6503			441932	1	121412	35				g.chr1:247655131G>A			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		chr1.hg19:g.247655131G>A		0									0	1	1	1.995454	A6NFC9	OR2W5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0188)	0	762	+	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	B9EH85	RNA	SNP	ENST00000522351.1	1	1	hg19			1																																																																																								0.082985		TCGA-XN-A8T5-01A-12D-A36O-08	0.587	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	0	0	1	2	2	2	2	0	0	0	0	127	127	127	127	1	2.010000	-3.199595	1	0.090000	NM_001004698		0	21	21	0	498	496	0		1			0	0	127	0	0	0.999997	0	0	0	0	0	0	21	498
RALGAPA2	57186	broad.mit.edu	37	20	20493737	20493737	+	Missense_Mutation	SNP	G	G	C			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr20:20493737G>C	ENST00000202677.7	-	32	4283	c.4276C>G	c.(4276-4278)Ctg>Gtg	p.L1426V		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1426					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						AACAGCTGCAGGTTTGGACTT	0.537																																						ENST00000202677.7	1.000000	0.320000	1.000000	0.500000	0.760000	0.752628	0.760000	1.000000																										0				54						c.(4276-4278)Ctg>Gtg		Ral GTPase activating protein, alpha subunit 2 (catalytic)							53.0	51.0	52.0					20																	20493737		1935	4138	6073	SO:0001583	missense	57186	0	0					g.chr20:20493737G>C	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.4276C>G	chr20.hg19:g.20493737G>C	ENSP00000202677:p.Leu1426Val	0						p.L1426V	NM_020343.3	NP_065076.2	0	1	1	1.980871	Q2PPJ7	RGPA2_HUMAN		32	4283	-			Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	ENST00000202677.7	0	1	hg19	c.4276C>G	CCDS46584.1	0	.	.	.	.	.	.	.	.	.	.	G	9.998	1.232569	0.22626	.	.	ENSG00000188559	ENST00000202677	D	0.95518	-3.73	5.62	1.44	0.22558	5.62	1.44	0.22558	.	0.000000	0.64402	D	0.000003	D	0.95831	0.8643	L	0.57536	1.79	0.39079	D	0.960872	B;D;B	0.76494	0.119;0.999;0.34	B;D;B	0.87578	0.074;0.998;0.241	D	0.93616	0.6943	9	.	.	.	.	6.8563	0.24042	0.2006:0.0:0.6743:0.1251	.	1264;1426;1426	A8MSM5;Q2PPJ7-2;Q2PPJ7	.;.;RGPA2_HUMAN	V	1426	ENSP00000202677:L1426V	.	L	-	1	2	2	RALGAPA2	20441737	20441737	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.455000	0.35190	0.394000	0.25230	0.591000	0.81541	CTG	0.079227		TCGA-XN-A8T5-01A-12D-A36O-08	0.537	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	0	0	0	2	2	2	2	0	0	0	0	42	42	42	40	1	2.010000	-8.432201	1	0.090000	NM_020343		0	6	6	0	171	167	0		1	1		0	0	42	0	0	0.963252	6.019338e-02	0	4	0	6	0	6	171
ZBED4	9889	broad.mit.edu	37	22	50278645	50278645	+	Silent	SNP	C	C	T	rs141708563	byFrequency	TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr22:50278645C>T	ENST00000216268.5	+	2	1812	c.1335C>T	c.(1333-1335)gcC>gcT	p.A445A		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	445						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		AATCTGGCGCCATCTTCCAGC	0.557																																						ENST00000216268.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				44						c.(1333-1335)gcC>gcT		zinc finger, BED-type containing 4		C		0,4406		0,0,2203	66.0	71.0	69.0		1335	-10.6	0.0	22	dbSNP_134	69	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ZBED4	NM_014838.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		445/1172	50278645	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	9889	12	121412	44				g.chr22:50278645C>T	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.1335C>T	chr22.hg19:g.50278645C>T		1						p.A445A	NM_014838.2	NP_055653.2	1	2	3	2.045362	O75132	ZBED4_HUMAN		2	1812	+		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)	B2RZH1|Q1ECU0|Q9UGG8	Silent	SNP	ENST00000216268.5	1	1	hg19	c.1335C>T	CCDS33677.1	1																																																																																								0.129187		TCGA-XN-A8T5-01A-12D-A36O-08	0.557	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	1	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	2.010000	-3.142702	1	0.090000	NM_014838		0	46	46	0	417	412	1		1	0		0	0	112	0	0	1.000000	1.174264e-01	0	1	0	5	0	46	417
PLXNB2	23654	broad.mit.edu	37	22	50720348	50720348	+	Missense_Mutation	SNP	C	C	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr22:50720348C>A	ENST00000449103.1	-	20	3420	c.3280G>T	c.(3280-3282)Gac>Tac	p.D1094Y	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_Missense_Mutation_p.D1094Y			O15031	PLXB2_HUMAN	plexin B2	1094					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AAGGTGGGGTCAGGCACGTAC	0.637																																						ENST00000449103.1	1.000000	0.690000	1.000000	0.940000	0.990000	0.968855	0.990000	1.000000																										0				66						c.(3280-3282)Gac>Tac		plexin B2							49.0	56.0	54.0					22																	50720348		2045	4174	6219	SO:0001583	missense	23654	0	0					g.chr22:50720348C>A		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3280G>T	chr22.hg19:g.50720348C>A	ENSP00000409171:p.Asp1094Tyr	0					PLXNB2_ENST00000359337.4_Missense_Mutation_p.D1094Y|PLXNB2_ENST00000496720.1_5'Flank	p.D1094Y			1	2	3	2.029719	O15031	PLXB2_HUMAN		20	3420	-		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	1	1	hg19	c.3280G>T	CCDS43035.1	1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508777	0.44660	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.63744	-0.06;-0.06	4.63	4.63	0.57726	4.63	4.63	0.57726	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.257954	0.27554	N	0.018860	T	0.77579	0.4151	M	0.72353	2.195	0.58432	D	0.999993	D	0.76494	0.999	D	0.65443	0.935	T	0.80991	-0.1135	10	0.87932	D	0	.	17.6605	0.88192	0.0:1.0:0.0:0.0	.	1094	O15031	PLXB2_HUMAN	Y	1094	ENSP00000409171:D1094Y;ENSP00000352288:D1094Y	ENSP00000352288:D1094Y	D	-	1	0	0	PLXNB2	49062475	49062475	0.989000	0.36119	0.992000	0.48379	0.767000	0.43475	2.830000	0.48136	2.410000	0.81850	0.313000	0.20887	GAC	0.106090		TCGA-XN-A8T5-01A-12D-A36O-08	0.637	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	1	0	1	2	2	2	2	0	0	0	0	66	66	66	64	1	2.010000	-15.533900	1	0.090000	NM_012401		0	13	13	0	238	233	1		1	1	1	0	0	66	181	0	0.999512	9.946422e-01	9.892075e-01	83	9	79	132	13	238
ARHGAP15	55843	broad.mit.edu	37	2	144525606	144525606	+	Silent	SNP	G	G	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr2:144525606G>T	ENST00000295095.6	+	14	1460	c.1293G>T	c.(1291-1293)ggG>ggT	p.G431G	CTD-2252P21.1_ENST00000548756.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	431	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		AAAGCTTGGGGATTGTATTTG	0.453																																						ENST00000295095.6	1.000000	0.520000	1.000000	0.660000	0.860000	0.847564	0.860000	1.000000																										0				34						c.(1291-1293)ggG>ggT		Rho GTPase activating protein 15							132.0	128.0	130.0					2																	144525606		2203	4300	6503	SO:0001819	synonymous_variant	55843	0	0					g.chr2:144525606G>T	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.1293G>T	chr2.hg19:g.144525606G>T		0					CTD-2252P21.1_ENST00000548756.1_RNA	p.G431G	NM_018460.3	NP_060930.3	1	2	3	2.039555	Q53QZ3	RHG15_HUMAN		14	1460	+			Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	1	1	hg19	c.1293G>T	CCDS2184.1	1																																																																																								0.105299		TCGA-XN-A8T5-01A-12D-A36O-08	0.453	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	0	0	1	2	2	2	2	0	0	0	0	141	141	141	141	1	2.010000	-3.623381	1	0.090000	NM_018460		0	20	20	0	549	545	0		1	0		0	0	141	0	0	0.999995	9.705079e-01	0	0	0	160	0	20	549
ZSWIM2	151112	broad.mit.edu	37	2	187702250	187702250	+	Missense_Mutation	SNP	A	A	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr2:187702250A>T	ENST00000295131.2	-	5	565	c.526T>A	c.(526-528)Tgc>Agc	p.C176S		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	176					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			ATCTTCATGCATTTTATATGA	0.318																																						ENST00000295131.2	1.000000	0.380000	1.000000	0.550000	0.820000	0.795797	0.820000	1.000000																										0				52						c.(526-528)Tgc>Agc		zinc finger, SWIM-type containing 2							66.0	68.0	67.0					2																	187702250		2203	4300	6503	SO:0001583	missense	151112	0	0					g.chr2:187702250A>T	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.526T>A	chr2.hg19:g.187702250A>T	ENSP00000295131:p.Cys176Ser	0						p.C176S	NM_182521.2	NP_872327.2	1	2	3	2.039555	Q8NEG5	ZSWM2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)	5	565	-			B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	1	1	hg19	c.526T>A	CCDS33348.1	0	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228314	0.79576	.	.	ENSG00000163012	ENST00000295131	D	0.99701	-6.45	5.97	5.97	0.96955	5.97	5.97	0.96955	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.64402	D	0.000014	D	0.99729	0.9894	M	0.90542	3.125	0.51233	D	0.999915	D	0.89917	1.0	D	0.85130	0.997	D	0.97371	0.9976	10	0.87932	D	0	-6.639	13.9615	0.64182	1.0:0.0:0.0:0.0	.	176	Q8NEG5	ZSWM2_HUMAN	S	176	ENSP00000295131:C176S	ENSP00000295131:C176S	C	-	1	0	0	ZSWIM2	187410495	187410495	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	6.756000	0.74919	2.287000	0.76781	0.482000	0.46254	TGC	0.105299		TCGA-XN-A8T5-01A-12D-A36O-08	0.318	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	0	0	1	2	2	2	2	0	0	0	0	59	59	59	56	1	2.010000	-10.211660	1	0.090000	NM_182521		0	9	9	0	278	273	0		1			0	0	59	0	0	0.993950	0	0	0	0	0	0	9	278
ITPR1	3708	broad.mit.edu	37	3	4744532	4744532	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr3:4744532G>T	ENST00000443694.2	+	33	4510	c.4510G>T	c.(4510-4512)Gtg>Ttg	p.V1504L	ITPR1_ENST00000354582.6_Missense_Mutation_p.V1519L|ITPR1_ENST00000423119.2_Missense_Mutation_p.V1510L|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000302640.8_Missense_Mutation_p.V1504L|ITPR1_ENST00000357086.4_Missense_Mutation_p.V1510L|ITPR1_ENST00000456211.2_Missense_Mutation_p.V1495L			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1519					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GCCTGTCTTTGTGCAACTGCT	0.473																																						ENST00000443694.2	1.000000	0.450000	1.000000	0.670000	0.930000	0.867575	0.930000	1.000000																										0				106						c.(4510-4512)Gtg>Ttg		inositol 1,4,5-trisphosphate receptor, type 1	Caffeine(DB00201)						63.0	65.0	64.0					3																	4744532		1988	4167	6155	SO:0001583	missense	3708	0	0					g.chr3:4744532G>T	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4510G>T	chr3.hg19:g.4744532G>T	ENSP00000401671:p.Val1504Leu	0					ITPR1_ENST00000354582.6_Missense_Mutation_p.V1519L|ITPR1_ENST00000357086.4_Missense_Mutation_p.V1510L|ITPR1_ENST00000423119.2_Missense_Mutation_p.V1510L|ITPR1_ENST00000456211.2_Missense_Mutation_p.V1495L|ITPR1_ENST00000302640.8_Missense_Mutation_p.V1504L|ITPR1_ENST00000544951.1_Intron	p.V1504L			0	0	0	1.952113	Q14643	ITPR1_HUMAN		33	4510	+			E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	1	1	hg19	c.4510G>T	CCDS54551.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429619	0.83776	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.03	5.03	0.67393	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.74405	0.3712	M	0.85542	2.76	0.80722	D	1	B;P	0.35700	0.193;0.516	B;B	0.34652	0.126;0.187	T	0.75408	-0.3328	10	0.28530	T	0.3	.	18.3935	0.90491	0.0:0.0:1.0:0.0	.	1519;1510	Q14643;G5E9P1	ITPR1_HUMAN;.	L	1519;1504;1519;1510;1510;1495;1504	ENSP00000306253:V1504L;ENSP00000346595:V1519L;ENSP00000405934:V1510L;ENSP00000349597:V1510L;ENSP00000397885:V1495L;ENSP00000401671:V1504L	ENSP00000306253:V1504L	V	+	1	0	0	ITPR1	4719532	4719532	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.768000	0.98965	2.320000	0.78422	0.563000	0.77884	GTG	0.061275		TCGA-XN-A8T5-01A-12D-A36O-08	0.473	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	1	0	1	2	2	2	2	0	0	0	0	41	41	41	41	1	2.010000	-10.317830	1	0.090000	NM_002222		0	7	7	0	134	133	0		1	0		0	0	41	0	0	0.980983	7.439534e-02	0	0	0	8	0	7	134
NCKIPSD	51517	broad.mit.edu	37	3	48716527	48716527	+	Missense_Mutation	SNP	A	A	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr3:48716527A>T	ENST00000294129.2	-	10	1779	c.1660T>A	c.(1660-1662)Tgc>Agc	p.C554S	NCKIPSD_ENST00000341520.4_Missense_Mutation_p.C554S|NCKIPSD_ENST00000416649.2_Missense_Mutation_p.C547S	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain	554	Leu-rich.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGGTTCACGCAGAGGTCCGGC	0.652																																						ENST00000294129.2	1.000000	0.570000	1.000000	0.770000	0.990000	0.916130	0.990000	1.000000																										0				11						c.(1660-1662)Tgc>Agc		NCK interacting protein with SH3 domain							54.0	57.0	56.0					3																	48716527		2203	4300	6503	SO:0001583	missense	51517	0	0					g.chr3:48716527A>T	AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.1660T>A	chr3.hg19:g.48716527A>T	ENSP00000294129:p.Cys554Ser	0					NCKIPSD_ENST00000416649.2_Missense_Mutation_p.C547S|NCKIPSD_ENST00000341520.4_Missense_Mutation_p.C554S	p.C554S	NM_016453.2	NP_057537.1	0	0	0	1.952113	Q9NZQ3	SPN90_HUMAN		10	1779	-			B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Missense_Mutation	SNP	ENST00000294129.2	1	1	hg19	c.1660T>A	CCDS2776.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.2|24.2	4.504546|4.504546	0.85176|0.85176	.|.	.|.	ENSG00000213672|ENSG00000213672	ENST00000341520;ENST00000416649;ENST00000294129;ENST00000413374|ENST00000415281	T;T;T;T|T	0.65549|0.58797	1.04;-0.16;-0.16;1.04|0.31	5.37|5.37	5.37|5.37	0.77165|0.77165	5.37|5.37	5.37|5.37	0.77165|0.77165	Domain of unknown function DUF2013 (1);|.	0.062767|.	0.64402|.	U|.	0.000005|.	T|T	0.58452|0.58452	0.2123|0.2123	L|L	0.29908|0.29908	0.895|0.895	0.37845|0.37845	D|D	0.929171|0.929171	P;P|.	0.52316|.	0.952;0.94|.	P;P|.	0.50270|.	0.636;0.503|.	T|T	0.67007|0.67007	-0.5779|-0.5779	10|7	0.44086|0.87932	T|D	0.13|0	.|.	15.3635|15.3635	0.74499|0.74499	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	554;547|.	Q9NZQ3;Q9NZQ3-3|.	SPN90_HUMAN;.|.	S|Q	554;547;554;10|262	ENSP00000342621:C554S;ENSP00000389059:C547S;ENSP00000294129:C554S;ENSP00000396683:C10S|ENSP00000406442:L262Q	ENSP00000294129:C554S|ENSP00000406442:L262Q	C|L	-|-	1|2	0|0	0|0	NCKIPSD|NCKIPSD	48691531|48691531	48691531|48691531	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.952000|0.952000	0.60782|0.60782	8.804000|8.804000	0.91921|0.91921	2.020000|2.020000	0.59435|0.59435	0.528000|0.528000	0.53228|0.53228	TGC|CTG	0.061275		TCGA-XN-A8T5-01A-12D-A36O-08	0.652	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257520.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	63	1	2.010000	-14.130940	1	0.090000	NM_016453		0	11	9	0	198	195	0		1	1		0	0	64	0	0	0.998246	5.792641e-01	0	4	0	31	0	11	198
RNF13	11342	broad.mit.edu	37	3	149570341	149570341	+	Silent	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr3:149570341C>T	ENST00000344229.3	+	4	855	c.153C>T	c.(151-153)ctC>ctT	p.L51L	RNF13_ENST00000392894.3_Silent_p.L51L|ANKUB1_ENST00000473672.1_5'Flank	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	51					protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TTGATGACCTCCCTGCAAGAT	0.274																																						ENST00000344229.3	1.000000	0.710000	1.000000	0.940000	0.990000	0.971194	0.990000	1.000000																										0				11						c.(151-153)ctC>ctT		ring finger protein 13							63.0	62.0	62.0					3																	149570341		2203	4295	6498	SO:0001819	synonymous_variant	11342	0	0					g.chr3:149570341C>T	AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.153C>T	chr3.hg19:g.149570341C>T		0					ANKUB1_ENST00000473672.1_5'Flank|RNF13_ENST00000392894.3_Silent_p.L51L	p.L51L	NM_007282.4	NP_009213.1	0	1	1	1.998857	O43567	RNF13_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)	4	855	+		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	A6NC87|B3KR12|Q05D66|Q6IBJ9	Silent	SNP	ENST00000344229.3	1	1	hg19	c.153C>T	CCDS3146.1	1																																																																																								0.075015		TCGA-XN-A8T5-01A-12D-A36O-08	0.274	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356876.1	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	2.010000	-5.307373	1	0.090000	NM_183384		0	13	13	0	205	202	1		1	1		0	0	39	0	0	0.999542	9.220506e-01	0	19	0	53	0	13	205
ANK2	287	broad.mit.edu	37	4	114203916	114203916	+	Missense_Mutation	SNP	A	A	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr4:114203916A>T	ENST00000357077.4	+	18	2020	c.1967A>T	c.(1966-1968)aAc>aTc	p.N656I	ANK2_ENST00000506722.1_Missense_Mutation_p.N635I|ANK2_ENST00000394537.3_Missense_Mutation_p.N656I|ANK2_ENST00000264366.6_Missense_Mutation_p.N656I	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	656					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCAGAGACAAACATTGTGACA	0.448																																						ENST00000357077.4	1.000000	0.340000	1.000000	0.510000	0.740000	0.748133	0.740000	1.000000																										0				248						c.(1966-1968)aAc>aTc		ankyrin 2, neuronal							131.0	105.0	114.0					4																	114203916		2203	4300	6503	SO:0001583	missense	287	0	0					g.chr4:114203916A>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1967A>T	chr4.hg19:g.114203916A>T	ENSP00000349588:p.Asn656Ile	0					ANK2_ENST00000264366.6_Missense_Mutation_p.N656I|ANK2_ENST00000394537.3_Missense_Mutation_p.N656I|ANK2_ENST00000506722.1_Missense_Mutation_p.N635I	p.N656I	NM_001148.4	NP_001139.3	0	1	1	1.990221	Q01484	ANK2_HUMAN		18	2020	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	0	1	hg19	c.1967A>T	CCDS3702.1	0	.	.	.	.	.	.	.	.	.	.	A	25.6	4.654034	0.88056	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.71461	-0.57;2.06;-0.57;-0.57;-0.57;-0.57;-0.57	5.13	5.13	0.70059	5.13	5.13	0.70059	Ankyrin repeat-containing domain (3);	0.099795	0.43579	D	0.000555	D	0.85435	0.5696	M	0.87682	2.9	0.80722	D	1	D;D;D;D;P	0.76494	0.996;0.999;0.995;0.989;0.857	D;D;D;D;P	0.69824	0.964;0.966;0.939;0.917;0.66	D	0.88380	0.3001	10	0.87932	D	0	.	15.2245	0.73339	1.0:0.0:0.0:0.0	.	656;656;656;635;635	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	I	635;602;635;671;656;656;656;635	ENSP00000423799:N635I;ENSP00000421011:N602I;ENSP00000421067:N635I;ENSP00000424722:N671I;ENSP00000378044:N656I;ENSP00000349588:N656I;ENSP00000264366:N656I	ENSP00000264366:N656I	N	+	2	0	0	ANK2	114423365	114423365	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	7.405000	0.80007	2.031000	0.59945	0.533000	0.62120	AAC	0.081736		TCGA-XN-A8T5-01A-12D-A36O-08	0.448	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	0	0	0	2	2	2	2	0	0	0	0	51	51	51	50	1	2.010000	-9.293501	1	0.090000	NM_001148		0	7	6	0	203	202	0		1	0		0	0	51	0	0	0.980475	3.705515e-02	0	0	0	8	0	7	203
PANK3	79646	broad.mit.edu	37	5	167995848	167995848	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr5:167995848C>T	ENST00000239231.6	-	2	500	c.184G>A	c.(184-186)Ggc>Agc	p.G62S	PANK3_ENST00000520504.1_5'Flank	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	62					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TCCCGAATGCCGGTGGATCCA	0.418																																						ENST00000239231.6	1.000000	0.800000	1.000000	0.960000	0.990000	0.980923	0.990000	1.000000																										0				16						c.(184-186)Ggc>Agc		pantothenate kinase 3							144.0	138.0	140.0					5																	167995848		2203	4300	6503	SO:0001583	missense	79646	0	0					g.chr5:167995848C>T	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.184G>A	chr5.hg19:g.167995848C>T	ENSP00000239231:p.Gly62Ser	0					PANK3_ENST00000520504.1_5'Flank	p.G62S	NM_024594.3	NP_078870.1	1	2	3	2.002054	Q9H999	PANK3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	2	500	-	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	1	1	hg19	c.184G>A	CCDS4368.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.205975	0.95033	.	.	ENSG00000120137	ENST00000239231;ENST00000522176	D;D	0.98419	-4.92;-4.92	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.99187	0.9718	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99271	1.0893	10	0.46703	T	0.11	-14.8448	19.0666	0.93114	0.0:1.0:0.0:0.0	.	62	Q9H999	PANK3_HUMAN	S	62;47	ENSP00000239231:G62S;ENSP00000428631:G47S	ENSP00000239231:G62S	G	-	1	0	0	PANK3	167928426	167928426	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.818000	0.86416	2.736000	0.93811	0.655000	0.94253	GGC	0.096909		TCGA-XN-A8T5-01A-12D-A36O-08	0.418	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	0	0	1	2	15	2	2	1	1	1	1	155	155	155	153	1	2.010000	-3.015555	1	0.090000	NM_024594		0	33	32	0	620	609	1		1	1		1	0	155	0	0	0.997082	2.786271e-01	0	7	0	13	0	33	620
BDP1	55814	broad.mit.edu	37	5	70805902	70805902	+	Silent	SNP	A	A	C			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr5:70805902A>C	ENST00000358731.4	+	17	3246	c.2983A>C	c.(2983-2985)Agg>Cgg	p.R995R	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	995	9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AATATCCCCAAGGGAAAATGG	0.458																																						ENST00000358731.4	1.000000	0.640000	1.000000	0.830000	0.990000	0.939239	0.990000	1.000000																										0				72						c.(2983-2985)Agg>Cgg		B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB							69.0	71.0	70.0					5																	70805902		1825	4077	5902	SO:0001819	synonymous_variant	55814	0	0					g.chr5:70805902A>C	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.2983A>C	chr5.hg19:g.70805902A>C		0					BDP1_ENST00000380675.2_5'UTR	p.R995R	NM_018429.2	NP_060899.2	1	2	3	2.002054	A6H8Y1	BDP1_HUMAN		17	3246	+		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Silent	SNP	ENST00000358731.4	1	0	hg19	c.2983A>C	CCDS43328.1	1																																																																																								0.096909		TCGA-XN-A8T5-01A-12D-A36O-08	0.458	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	1	0	1	2	2	2	2	0	0	0	0	108	108	108	106	1	2.010000	-2.875430	1	0.090000	NM_018429		0	19	19	0	400	397	0		1	0		0	0	108	0	0	0.999991	1.322063e-02	0	0	0	4	0	19	400
RPL26L1	51121	broad.mit.edu	37	5	172386920	172386920	+	Missense_Mutation	SNP	G	G	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr5:172386920G>T	ENST00000521476.1	+	2	168	c.44G>T	c.(43-45)cGc>cTc	p.R15L	RPL26L1_ENST00000519239.1_Missense_Mutation_p.R15L|CTC-308K20.2_ENST00000519755.1_lincRNA|RPL26L1_ENST00000519974.1_Missense_Mutation_p.R15L|CTC-308K20.1_ENST00000518894.1_RNA|CTC-308K20.1_ENST00000518818.1_RNA|CTC-308K20.1_ENST00000520067.1_RNA|RPL26L1_ENST00000265100.2_Missense_Mutation_p.R15L			Q9UNX3	RL26L_HUMAN	ribosomal protein L26-like 1	15					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|large ribosomal subunit (GO:0015934)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	7	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGTAAAAACCGCAAACGTCAC	0.562																																						ENST00000521476.1	1.000000	0.210000	0.620000	0.300000	0.400000	0.481861	0.400000	0.380000																										0				7						c.(43-45)cGc>cTc		ribosomal protein L26-like 1							221.0	190.0	200.0					5																	172386920		2203	4300	6503	SO:0001583	missense	51121	1	121412	33				g.chr5:172386920G>T	AF083248	CCDS4382.1	5q35.2	2008-03-14	2001-12-07	2001-12-14	ENSG00000037241	ENSG00000037241		"""L ribosomal proteins"""	17050	protein-coding gene	gene with protein product			"""ribosomal protein L26 pseudogene 1"""	RPL26P1		11042152	Standard	NM_016093		Approved		uc003mcc.3	Q9UNX3	OTTHUMG00000130517	ENST00000521476.1:c.44G>T	chr5.hg19:g.172386920G>T	ENSP00000428223:p.Arg15Leu	0					RPL26L1_ENST00000519239.1_Missense_Mutation_p.R15L|CTC-308K20.1_ENST00000520067.1_RNA|CTC-308K20.1_ENST00000518894.1_RNA|CTC-308K20.1_ENST00000518818.1_RNA|RPL26L1_ENST00000519974.1_Missense_Mutation_p.R15L|RPL26L1_ENST00000265100.2_Missense_Mutation_p.R15L|CTC-308K20.2_ENST00000519755.1_lincRNA	p.R15L			1	2	3	2.002054	Q9UNX3	RL26L_HUMAN	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	2	168	+	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	B3KY82|D3DQM0	Missense_Mutation	SNP	ENST00000521476.1	0	1	hg19	c.44G>T	CCDS4382.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.634145	0.96682	.	.	ENSG00000037241	ENST00000519974;ENST00000521476;ENST00000265100;ENST00000519239;ENST00000519522;ENST00000519156	.	.	.	4.75	3.85	0.44370	4.75	3.85	0.44370	Translation protein SH3-like (1);Ribosomal protein L24, SH3-like (1);	0.000000	0.85682	D	0.000000	D	0.84106	0.5399	H	0.94462	3.54	0.80722	D	1	P	0.48694	0.914	P	0.58721	0.844	D	0.88380	0.3001	9	0.87932	D	0	.	13.8993	0.63792	0.0:0.0:0.8418:0.1582	.	15	Q9UNX3	RL26L_HUMAN	L	15	.	ENSP00000265100:R15L	R	+	2	0	0	RPL26L1	172319526	172319526	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.313000	0.78978	1.168000	0.42723	0.549000	0.68633	CGC	0.096909		TCGA-XN-A8T5-01A-12D-A36O-08	0.562	RPL26L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372559.1	0	0	0	2	2	2	2	0	0	0	0	208	208	208	207	1	2.010000	-1.863349	0	0.090000	NM_016093		0	13	13	0	754	743	1		1	1		0	0	208	0	0	0.999486	4.665530e-01	0	12	0	76	0	13	754
RNF19A	25897	broad.mit.edu	37	8	101299991	101299991	+	Missense_Mutation	SNP	G	G	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr8:101299991G>A	ENST00000519449.1	-	3	728	c.412C>T	c.(412-414)Cgg>Tgg	p.R138W	RNF19A_ENST00000341084.2_Missense_Mutation_p.R138W	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	138					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			TTAGAATGCCGCAAAAGGCAC	0.373																																						ENST00000519449.1	1.000000	0.090000	1.000000	0.150000	0.250000	0.408627	0.250000	0.210000																										0				30						c.(412-414)Cgg>Tgg		ring finger protein 19A, RBR E3 ubiquitin protein ligase							107.0	108.0	107.0					8																	101299991		2203	4300	6503	SO:0001583	missense	25897	5	121412	39				g.chr8:101299991G>A	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.412C>T	chr8.hg19:g.101299991G>A	ENSP00000428968:p.Arg138Trp	0					RNF19A_ENST00000341084.2_Missense_Mutation_p.R138W	p.R138W	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	1	2	3	2.037026	Q9NV58	RN19A_HUMAN	Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	3	728	-	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	0	1	hg19	c.412C>T	CCDS6286.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139684	0.77775	.	.	ENSG00000034677	ENST00000519449;ENST00000341084;ENST00000519527;ENST00000523167	D;D	0.84146	-1.81;-1.81	5.57	3.77	0.43336	5.57	3.77	0.43336	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.056803	0.64402	D	0.000001	D	0.88123	0.6352	M	0.76002	2.32	0.80722	D	1	D	0.63880	0.993	P	0.53490	0.727	D	0.87527	0.2450	10	0.66056	D	0.02	.	10.4328	0.44417	0.07:0.0:0.7955:0.1345	.	138	Q9NV58	RN19A_HUMAN	W	138	ENSP00000428968:R138W;ENSP00000342667:R138W	ENSP00000342667:R138W	R	-	1	2	2	RNF19A	101369167	101369167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.654000	0.67974	0.707000	0.31934	-0.142000	0.14014	CGG	0.104903		TCGA-XN-A8T5-01A-12D-A36O-08	0.373	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	0	0	1	2	2	2	2	0	0	0	0	176	176	176	174	1	2.010000	-1.807905	0	0.090000	NM_015435		0	6	6	0	652	649	0		1	0		0	0	176	0	0	0.964593	4.621547e-02	0	0	0	31	0	6	652
PHF2	5253	broad.mit.edu	37	9	96418827	96418827	+	Missense_Mutation	SNP	T	T	A			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr9:96418827T>A	ENST00000359246.4	+	9	1464	c.1097T>A	c.(1096-1098)tTt>tAt	p.F366Y	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	366					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TTTCCCAACTTTGAAACTGCG	0.547																																						ENST00000359246.4	1.000000	0.360000	1.000000	0.560000	0.850000	0.808059	0.850000	1.000000																										0				40						c.(1096-1098)tTt>tAt		PHD finger protein 2							132.0	142.0	139.0					9																	96418827		2203	4300	6503	SO:0001583	missense	5253	0	0					g.chr9:96418827T>A	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.1097T>A	chr9.hg19:g.96418827T>A	ENSP00000352185:p.Phe366Tyr	0					PHF2_ENST00000375376.4_Intron	p.F366Y	NM_005392.3	NP_005383.3	1	2	3	2.013038	O75151	PHF2_HUMAN		9	1464	+		Myeloproliferative disorder(762;0.0255)	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	0	1	hg19	c.1097T>A	CCDS35069.1	1	.	.	.	.	.	.	.	.	.	.	T	16.13	3.036665	0.54896	.	.	ENSG00000197724	ENST00000359246	T	0.57107	0.42	4.47	4.47	0.54385	4.47	4.47	0.54385	.	0.049864	0.85682	D	0.000000	T	0.42040	0.1185	L	0.37466	1.105	0.80722	D	1	B	0.21309	0.054	B	0.18263	0.021	T	0.41142	-0.9525	10	0.66056	D	0.02	-15.2641	10.4792	0.44682	0.145:0.0:0.0:0.855	.	366	O75151	PHF2_HUMAN	Y	366	ENSP00000352185:F366Y	ENSP00000352185:F366Y	F	+	2	0	0	PHF2	95458648	95458648	1.000000	0.71417	0.994000	0.49952	0.839000	0.47603	4.898000	0.63238	1.864000	0.54056	0.254000	0.18369	TTT	0.099322		TCGA-XN-A8T5-01A-12D-A36O-08	0.547	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	0	0	0	2	2	2	2	0	0	0	0	45	45	45	45	1	2.010000	-9.292869	1	0.090000	NM_005392		0	7	6	0	201	199	0		1	1		0	0	45	0	0	0.980130	2.477122e-01	0	4	0	21	0	7	201
KCNT1	57582	broad.mit.edu	37	9	138651632	138651632	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chr9:138651632C>T	ENST00000263604.3	+	11	905	c.905C>T	c.(904-906)aCg>aTg	p.T302M	KCNT1_ENST00000490355.2_Missense_Mutation_p.T302M|KCNT1_ENST00000486577.2_Missense_Mutation_p.T282M|KCNT1_ENST00000491806.2_Missense_Mutation_p.T288M|KCNT1_ENST00000487664.1_Missense_Mutation_p.T276M|KCNT1_ENST00000488444.2_Missense_Mutation_p.T302M|KCNT1_ENST00000298480.5_Missense_Mutation_p.T321M|KCNT1_ENST00000371757.2_Missense_Mutation_p.T321M			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	302					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GGTGACGTCACGCCCAAGATC	0.647																																						ENST00000263604.3	1.000000	0.220000	1.000000	0.380000	0.620000	0.655578	0.620000	1.000000																										0				50						c.(904-906)aCg>aTg		potassium channel, subfamily T, member 1							139.0	100.0	113.0					9																	138651632		2203	4300	6503	SO:0001583	missense	57582	0	0					g.chr9:138651632C>T	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.905C>T	chr9.hg19:g.138651632C>T	ENSP00000263604:p.Thr302Met	0					KCNT1_ENST00000486577.2_Missense_Mutation_p.T282M|KCNT1_ENST00000488444.2_Missense_Mutation_p.T302M|KCNT1_ENST00000298480.5_Missense_Mutation_p.T321M|KCNT1_ENST00000371757.2_Missense_Mutation_p.T321M|KCNT1_ENST00000491806.2_Missense_Mutation_p.T288M|KCNT1_ENST00000487664.1_Missense_Mutation_p.T276M|KCNT1_ENST00000490355.2_Missense_Mutation_p.T302M	p.T302M			1	2	3	2.013038	Q5JUK3	KCNT1_HUMAN		11	905	+		Myeloproliferative disorder(178;0.0821)	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	0	1	hg19	c.905C>T		0	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407869	0.83340	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;D;T	0.97598	1.69;1.69;1.69;-4.45;1.69	5.05	5.05	0.67936	5.05	5.05	0.67936	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	D	0.98645	0.9546	M	0.89658	3.05	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.75020	0.985;0.978;0.963;0.978	D	0.99387	1.0924	10	0.54805	T	0.06	-17.2905	17.3952	0.87443	0.0:1.0:0.0:0.0	.	288;321;276;302	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	M	276;321;321;268;282;288;302;302;302	ENSP00000417851:T276M;ENSP00000298480:T321M;ENSP00000360822:T321M;ENSP00000420764:T268M;ENSP00000263604:T302M	ENSP00000263604:T302M	T	+	2	0	0	KCNT1	137791453	137791453	1.000000	0.71417	0.322000	0.25334	0.907000	0.53573	5.820000	0.69250	2.354000	0.79902	0.591000	0.81541	ACG	0.099322		TCGA-XN-A8T5-01A-12D-A36O-08	0.647	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	0	2	2	2	2	0	0	0	0	48	48	48	48	1	2.010000	-6.555897	1	0.090000	NM_020822		0	5	4	0	210	207	0		1	0		0	0	48	0	0	0.935164	0	0	0	0	1	0	5	210
GABRQ	55879	broad.mit.edu	37	X	151821056	151821056	+	Missense_Mutation	SNP	C	C	T			TCGA-XN-A8T5-01A-12D-A36O-08	TCGA-XN-A8T5-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	68e58ead-3fcd-4072-a3be-7e7cb85bdd1b	7675d2ec-b443-4165-840c-260d72e921e9	g.chrX:151821056C>T	ENST00000370306.2	+	9	1231	c.1211C>T	c.(1210-1212)gCg>gTg	p.A404V		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	404					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATCACCCCAGCGCAGGCCCCC	0.582																																						ENST00000370306.2	1.000000	0.780000	1.000000	0.980000	0.990000	0.981237	0.990000	1.000000																										0				52						c.(1210-1212)gCg>gTg		gamma-aminobutyric acid (GABA) A receptor, theta	Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)						67.0	64.0	65.0					X																	151821056		2203	4300	6503	SO:0001583	missense	55879	0	0					g.chrX:151821056C>T	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1211C>T	chrX.hg19:g.151821056C>T	ENSP00000359329:p.Ala404Val							p.A404V	NM_018558.2	NP_061028.3	0	1	1		Q9UN88	GBRT_HUMAN		9	1231	+	Acute lymphoblastic leukemia(192;6.56e-05)		A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	1	1	hg19	c.1211C>T	CCDS14707.1	1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.155193	0.38021	.	.	ENSG00000147402	ENST00000370306	D	0.85556	-2.0	4.59	-3.96	0.04106	4.59	-3.96	0.04106	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.728271	0.11312	N	0.577006	T	0.63271	0.2497	N	0.14661	0.345	0.09310	N	1	B	0.14805	0.011	B	0.15052	0.012	T	0.50651	-0.8803	10	0.18276	T	0.48	.	1.1737	0.01831	0.1361:0.3019:0.2665:0.2954	.	404	Q9UN88	GBRT_HUMAN	V	404	ENSP00000359329:A404V	ENSP00000359329:A404V	A	+	2	0	0	GABRQ	151571712	151571712	0.000000	0.05858	0.000000	0.03702	0.905000	0.53344	0.022000	0.13511	-0.993000	0.03467	0.600000	0.82982	GCG	0.090000		TCGA-XN-A8T5-01A-12D-A36O-08	0.582	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	0	0	1	2	16	2	2	1	1	1	1	87	87	87	85	1	2.010000	-5.875165	1	0.090000	NM_018558		0	22	22	0	379	375	0		1	0		1	0	87	0	0	0.869637	0	0	0	0	1	0	22	379
