#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SPPL3	121665	broad.mit.edu	37	12	121221520	121221522	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			GGA	-	GGA	GGA		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr12:121221520_121221522delGGA	ENST00000353487.2	-	5	847_849	c.344_346delTCC	c.(343-348)ctcccg>ccg	p.L115del		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	116						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)					all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGGCACATCGGGAGGAGAAGAAA	0.325																																						ENST00000353487.2	1.000000	0.990000	1.000000	0.990000	0.990000	0.999996	0.990000	1.000000																										0										c.(343-348)ctcccg>ccg		signal peptide peptidase like 3																																				SO:0001651	inframe_deletion	121665	0	0					g.chr12:121221520_121221522delGGA		CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.344_346delTCC	chr12.hg19:g.121221523_121221525delGGA	ENSP00000288680:p.Leu115del	1						p.L115del	NM_139015.4	NP_620584.2	0	3	3	1.842395	Q8TCT6	SPPL3_HUMAN		5	847_849	-	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		Q3MJ04|Q8TAU4|Q96DD9	In_Frame_Del	DEL	ENST00000353487.2	1	1	hg19	c.344_346delTCC	CCDS9208.1	1																																																																																								0.286694		TCGA-YH-A8SY-01A-11D-A377-08	0.325	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402980.2	1	0	0		28	2		0	0	0	2	59	0	59	61	1	3.360000	-2.119162	0	0.220000	NM_139015		0	59	79	0	303	310	0	0	1	1	0	0	0	59	0	0	0.999972	9.999943e-01	0	17	0	76	0	59	303
CANX	821	broad.mit.edu	37	5	179151711	179151728	+	In_Frame_Del	DEL	GAAGGAAGAGGAAGAAGA	GAAGGAAGAGGAAGAAGA	-			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			GAAGGAAGAGGAAGAAGA	-	GAAGGAAGAGGAAGAAGA	GAAGGAAGAGGAAGAAGA		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:179151711_179151728delGAAGGAAGAGGAAGAAGA	ENST00000247461.4	+	13	1772_1789	c.1572_1589delGAAGGAAGAGGAAGAAGA	c.(1570-1590)gtgaaggaagaggaagaagag>gtg	p.KEEEEE525del	CANX_ENST00000452673.2_In_Frame_Del_p.KEEEEE525del|CANX_ENST00000504734.1_In_Frame_Del_p.KEEEEE525del|CANX_ENST00000415618.2_In_Frame_Del_p.KEEEEE560del|CANX_ENST00000512607.2_In_Frame_Del_p.KEEEEE417del	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	525	Sufficient to mediate interaction with SGIP1. {ECO:0000250}.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	AACCGGATGTGAaggaagaggaagaagagaaggaagag	0.413																																						ENST00000247461.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.998528	0.990000	1.000000																										0				22						c.(1570-1590)gtgaaggaagaggaagaagag>gtg		calnexin	Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)																																			SO:0001651	inframe_deletion	821	0	0					g.chr5:179151711_179151728delGAAGGAAGAGGAAGAAGA	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1572_1589delGAAGGAAGAGGAAGAAGA	chr5.hg19:g.179151711_179151728delGAAGGAAGAGGAAGAAGA	ENSP00000247461:p.Lys525_Glu530del	0					CANX_ENST00000415618.2_In_Frame_Del_p.KEEEEE560del|CANX_ENST00000452673.2_In_Frame_Del_p.KEEEEE525del|CANX_ENST00000504734.1_In_Frame_Del_p.KEEEEE525del|CANX_ENST00000512607.2_In_Frame_Del_p.KEEEEE417del	p.KEEEEE525del	NM_001746.3	NP_001737.1	1	2	3	1.949770	P27824	CALX_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	13	1772_1789	+	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	In_Frame_Del	DEL	ENST00000247461.4	1	1	hg19	c.1572_1589delGAAGGAAGAGGAAGAAGA	CCDS4447.1	1																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.413	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	1	0	1		85	2		0	0	0	11	44	0	44	56	1	3.360000	-20.000000	1	0.220000	NM_001024649		0	33	110	0	204	281	0	0	2	0	0	0	0	44	0	0	0.008683	1	0	0	0	519	0	33	204
ITIH2	3698	broad.mit.edu	37	10	7773950	7773950	+	Silent	SNP	G	G	A	rs150260189		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr10:7773950G>A	ENST00000358415.4	+	13	1804	c.1638G>A	c.(1636-1638)acG>acA	p.T546T	ITIH2_ENST00000379587.4_Silent_p.T535T	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	546					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						GCGTTATCACGGCGACTTCGG	0.438																																						ENST00000358415.4	1.000000	0.080000	0.300000	0.130000	0.190000	0.257374	0.190000	0.190000																										0				64						c.(1636-1638)acG>acA		inter-alpha-trypsin inhibitor heavy chain 2							127.0	119.0	122.0					10																	7773950		2203	4300	6503	SO:0001819	synonymous_variant	3698	1	121408	47				g.chr10:7773950G>A	X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.1638G>A	chr10.hg19:g.7773950G>A		0					ITIH2_ENST00000379587.4_Silent_p.T535T	p.T546T	NM_002216.2	NP_002207.2	2	2	4	2.086287	P19823	ITIH2_HUMAN		13	1804	+			Q14659|Q15484|Q5T986	Silent	SNP	ENST00000358415.4	0	1	hg19	c.1638G>A	CCDS31141.1	0																																																																																								0.351297		TCGA-YH-A8SY-01A-11D-A377-08	0.438	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046678.2	0	0	1	2	16	2	2	1	1	1	1	92	92	92	91	1	3.360000	-2.881760	1	0.220000	NM_002216		0	7	7	0	413	406	0		0	0		1	0	92	0	0	0.040124	4.033478e-04	0	0	0	2	0	7	413
OGDHL	55753	broad.mit.edu	37	10	50966564	50966564	+	Silent	SNP	C	C	T	rs149391137		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr10:50966564C>T	ENST00000374103.4	-	2	160	c.75G>A	c.(73-75)ccG>ccA	p.P25P	OGDHL_ENST00000432695.1_Intron|OGDHL_ENST00000419399.1_Silent_p.P25P	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	25					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						AGCCAAACACCGGGACGTCAT	0.627																																						ENST00000374103.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				61						c.(73-75)ccG>ccA		oxoglutarate dehydrogenase-like							48.0	48.0	48.0					10																	50966564		2203	4300	6503	SO:0001819	synonymous_variant	55753	0	0					g.chr10:50966564C>T	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.75G>A	chr10.hg19:g.50966564C>T		1					OGDHL_ENST00000432695.1_Intron|OGDHL_ENST00000419399.1_Silent_p.P25P	p.P25P	NM_018245.2	NP_060715.2	2	2	4	2.110973	Q9ULD0	OGDHL_HUMAN		2	160	-			A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Silent	SNP	ENST00000374103.4	1	1	hg19	c.75G>A	CCDS7234.1	1																																																																																								0.359501		TCGA-YH-A8SY-01A-11D-A377-08	0.627	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	1	0	1	2	2	2	2	0	0	0	0	29	29	29	28	1	3.360000	-3.323279	1	0.220000	NM_018245		0	43	43	0	199	193	1		1			0	0	29	0	0	1.000000	0	0	0	0	0	0	43	199
VWA2	340706	broad.mit.edu	37	10	116046089	116046089	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr10:116046089C>T	ENST00000392982.3	+	11	1639	c.1389C>T	c.(1387-1389)ggC>ggT	p.G463G	VWA2_ENST00000603594.1_Silent_p.G463G			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	463	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		AGGTTGCGGGCCCAGCGCGTC	0.657																																						ENST00000392982.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999551	0.990000	1.000000																										0				26						c.(1387-1389)ggC>ggT		von Willebrand factor A domain containing 2							72.0	63.0	66.0					10																	116046089		2203	4299	6502	SO:0001819	synonymous_variant	340706	0	0					g.chr10:116046089C>T	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1389C>T	chr10.hg19:g.116046089C>T		1					VWA2_ENST00000603594.1_Silent_p.G463G	p.G463G			2	2	4	2.114795	Q5GFL6	VWA2_HUMAN		11	1639	+			A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Silent	SNP	ENST00000392982.3	1	1	hg19	c.1389C>T		1																																																																																								0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.657	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	3.360000	-3.018321	1	0.220000	NM_198496		0	39	39	0	257	254	1		1	0		0	0	48	0	0	1.000000	4.974722e-02	0	1	0	2	0	39	257
MUC5B	727897	broad.mit.edu	37	11	1272055	1272055	+	Missense_Mutation	SNP	G	G	A	rs373476136		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr11:1272055G>A	ENST00000529681.1	+	31	14003	c.13945G>A	c.(13945-13947)Gcc>Acc	p.A4649T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.A4652T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4649	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.A4649T(1)|p.A4604T(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		cacccacaccgccagagtgct	0.612																																						ENST00000529681.1	1.000000	0.760000	1.000000	0.970000	0.990000	0.978461	0.990000	1.000000																										2	Substitution - Missense(2)	p.A4649T(1)|p.A4604T(1)	endometrium(2)	137						c.(13945-13947)Gcc>Acc		mucin 5B, oligomeric mucus/gel-forming		C	THR/ALA	1,4241		0,1,2120	123.0	151.0	141.0		13945	-0.8	0.0	11		141	0,8448		0,0,4224	no	missense	MUC5B	NM_002458.2	58	0,1,6344	AA,AG,GG		0.0,0.0236,0.0079		4649/5763	1272055	1,12689	2121	4224	6345	SO:0001583	missense	727897	5	120990	40				g.chr11:1272055G>A	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13945G>A	chr11.hg19:g.1272055G>A	ENSP00000436812:p.Ala4649Thr	0					MUC5B_ENST00000447027.1_Missense_Mutation_p.A4652T|RP11-532E4.2_ENST00000532061.2_RNA	p.A4649T	NM_002458.2	NP_002449.2	1	2	3	1.950487	Q9HC84	MUC5B_HUMAN		31	14003	+		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	1	1	hg19	c.13945G>A	CCDS44515.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	3.668|3.668	-0.068133|-0.068133	0.07228|0.07228	2.36E-4|2.36E-4	0.0|0.0	ENSG00000117983|ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637|ENST00000535652	T;T|.	0.15834|.	2.39;2.57|.	0.976|0.976	-0.754|-0.754	0.11065|0.11065	0.976|0.976	-0.754|-0.754	0.11065|0.11065	.|.	.|.	.|.	.|.	.|.	T|T	0.11623|0.11623	0.0283|0.0283	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	B|.	0.25235|.	0.121|.	B|.	0.12156|.	0.007|.	T|T	0.18366|0.18366	-1.0339|-1.0339	9|6	0.87932|0.45353	D|T	0|0.12	.|.	4.0397|4.0397	0.09745|0.09745	0.0:0.3403:0.4612:0.1985|0.0:0.3403:0.4612:0.1985	.|.	4652|.	E9PBJ0|.	.|.	T|H	4649;4652;4593|423	ENSP00000436812:A4649T;ENSP00000415793:A4652T|.	ENSP00000343037:A4593T|ENSP00000439776:R423H	A|R	+|+	1|2	0|0	0|0	MUC5B|MUC5B	1228631|1228631	1228631|1228631	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.014000|0.014000	0.08584|0.08584	-5.897000|-5.897000	0.00092|0.00092	-1.423000|-1.423000	0.02002|0.02002	-1.123000|-1.123000	0.02005|0.02005	GCC|CGC	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.612	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	0	0	1	2	2	2	2	0	0	0	0	53	53	53	52	1	3.360000	-3.077458	1	0.220000	XM_001126093		0	17	10	0	123	120	0		1	1		0	0	53	0	0	0.999954	8.501358e-01	0	6	0	21	0	17	123
OR51E1	143503	broad.mit.edu	37	11	4674426	4674426	+	Missense_Mutation	SNP	A	A	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr11:4674426A>T	ENST00000396952.5	+	2	1320	c.670A>T	c.(670-672)Att>Ttt	p.I224F	OR51E1_ENST00000530215.1_Intron	NM_152430.3	NP_689643.2	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATATCTGCTTATTCTTAAGAC	0.483																																						ENST00000396952.5	1.000000	0.630000	1.000000	0.770000	0.920000	0.897681	0.920000	1.000000																										0				30						c.(670-672)Att>Ttt		olfactory receptor, family 51, subfamily E, member 1							199.0	184.0	189.0					11																	4674426		2201	4298	6499	SO:0001583	missense	143503	0	0					g.chr11:4674426A>T	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000396952.5:c.670A>T	chr11.hg19:g.4674426A>T	ENSP00000380155:p.Ile224Phe	0					OR51E1_ENST00000530215.1_Intron	p.I224F	NM_152430.3	NP_689643.2	1	2	3	1.950487	Q8TCB6	O51E1_HUMAN		2	1320	+		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	ENST00000396952.5	1	1	hg19	c.670A>T	CCDS31358.2	1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.309349	0.81247	.	.	ENSG00000180785	ENST00000396952	T	0.57436	0.4	4.68	4.68	0.58851	4.68	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000021	T	0.81870	0.4914	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88235	0.2906	10	0.87932	D	0	.	13.3903	0.60821	1.0:0.0:0.0:0.0	.	223	Q8TCB6	O51E1_HUMAN	F	224	ENSP00000380155:I224F	ENSP00000380155:I224F	I	+	1	0	0	OR51E1	4631002	4631002	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.711000	0.91396	2.105000	0.64084	0.533000	0.62120	ATT	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.483	OR51E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347136.2	1	0	1	2	2	2	2	0	0	0	0	79	79	79	77	1	3.360000	-20.000000	1	0.220000	NM_152430		0	30	30	0	300	294	0		1			0	0	79	0	0	1.000000	0	0	0	0	0	0	30	300
KCNC1	3746	broad.mit.edu	37	11	17758047	17758047	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr11:17758047C>T	ENST00000379472.3	+	1	528	c.498C>T	c.(496-498)ggC>ggT	p.G166G	KCNC1_ENST00000265969.6_Silent_p.G166G	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	166					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	GCCGGCCTGGCGGCTTTTGGC	0.687																																						ENST00000379472.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999990	0.990000	1.000000																										0				33						c.(496-498)ggC>ggT		potassium voltage-gated channel, Shaw-related subfamily, member 1	Dalfampridine(DB06637)																																			SO:0001819	synonymous_variant	3746	0	0					g.chr11:17758047C>T	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.498C>T	chr11.hg19:g.17758047C>T		0					KCNC1_ENST00000265969.6_Silent_p.G166G	p.G166G	NM_004976.4	NP_004967.1	1	2	3	1.950487	P48547	KCNC1_HUMAN		1	528	+			K4DI87	Silent	SNP	ENST00000379472.3	1	1	hg19	c.498C>T	CCDS7827.1	1																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.687	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	3.360000	-20.000000	1	0.220000	NM_004976		0	21	21	0	72	71	0		1			0	0	23	0	0	0.999999	0	0	0	0	0	0	21	72
HIPK3	10114	broad.mit.edu	37	11	33373714	33373714	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr11:33373714G>A	ENST00000303296.4	+	16	3379	c.3074G>A	c.(3073-3075)cGa>cAa	p.R1025Q	HIPK3_ENST00000379016.3_Missense_Mutation_p.R1004Q|HIPK3_ENST00000456517.1_Missense_Mutation_p.R1004Q|AL122015.1_ENST00000411202.1_RNA|HIPK3_ENST00000525975.1_Missense_Mutation_p.R1004Q	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	1025					apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						ATAAAAGGACGATCTGCCCCT	0.378																																						ENST00000303296.4	0.220000	0.050000	0.170000	0.080000	0.120000	0.133401	0.120000	0.120000																										0				39						c.(3073-3075)cGa>cAa		homeodomain interacting protein kinase 3							129.0	131.0	130.0					11																	33373714		2202	4298	6500	SO:0001583	missense	10114	0	0					g.chr11:33373714G>A	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.3074G>A	chr11.hg19:g.33373714G>A	ENSP00000304226:p.Arg1025Gln	0					HIPK3_ENST00000525975.1_Missense_Mutation_p.R1004Q|AL122015.1_ENST00000411202.1_RNA|HIPK3_ENST00000379016.3_Missense_Mutation_p.R1004Q|HIPK3_ENST00000456517.1_Missense_Mutation_p.R1004Q	p.R1025Q	NM_005734.3	NP_005725.3	1	2	3	1.963246	Q9H422	HIPK3_HUMAN		16	3379	+			O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	0	1	hg19	c.3074G>A	CCDS7884.1	0	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880365	0.33162	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	5.62	4.7	0.59300	5.62	4.7	0.59300	.	0.145914	0.31872	N	0.006928	T	0.28267	0.0698	N	0.14661	0.345	0.49483	D	0.999795	B;B	0.14805	0.011;0.006	B;B	0.16289	0.015;0.006	T	0.08493	-1.0719	10	0.07325	T	0.83	.	13.6209	0.62136	0.0754:0.0:0.9246:0.0	.	1004;1025	Q9H422-2;Q9H422	.;HIPK3_HUMAN	Q	1004;1025;1004;1004	ENSP00000431710:R1004Q;ENSP00000304226:R1025Q;ENSP00000368301:R1004Q;ENSP00000398241:R1004Q	ENSP00000304226:R1025Q	R	+	2	0	0	HIPK3	33330290	33330290	1.000000	0.71417	0.617000	0.29091	0.818000	0.46254	4.652000	0.61454	1.359000	0.45940	0.655000	0.94253	CGA	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.378	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	0	0	1	2	2	2	2	0	0	0	0	170	170	170	166	1	3.360000	-2.665725	1	0.220000	NM_005734		0	9	9	0	743	734	0		1	0		0	0	170	0	0	0.993885	6.254984e-02	0	0	0	30	0	9	743
PVRL1	5818	broad.mit.edu	37	11	119535865	119535865	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr11:119535865C>T	ENST00000264025.3	-	6	1676	c.1146G>A	c.(1144-1146)cgG>cgA	p.R382R	PVRL1_ENST00000341398.2_Intron	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	382					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)	p.R382R(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		TGAAGGTGTGCCGGCGCCGAC	0.657																																						ENST00000264025.3	0.280000	0.040000	0.210000	0.080000	0.130000	0.153515	0.130000	0.120000																										1	Substitution - coding silent(1)	p.R382R(1)	kidney(1)	27						c.(1144-1146)cgG>cgA		poliovirus receptor-related 1 (herpesvirus entry mediator C)							135.0	96.0	109.0					11																	119535865		2199	4295	6494	SO:0001819	synonymous_variant	5818	1	121410	39				g.chr11:119535865C>T	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.1146G>A	chr11.hg19:g.119535865C>T		0					PVRL1_ENST00000341398.2_Intron	p.R382R	NM_002855.4	NP_002846.3	1	2	3	1.963246	Q15223	PVRL1_HUMAN		6	1676	-		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	O75465|Q2M3D3|Q9HBE6|Q9HBW2	Silent	SNP	ENST00000264025.3	0	1	hg19	c.1146G>A	CCDS8426.1	0																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.657	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388231.1	0	0	1	2	2	2	2	0	0	0	0	55	55	55	54	1	3.360000	-2.107250	0	0.220000			0	5	5	0	385	376	0		1	0		0	0	55	0	0	0.933587	6.844956e-02	0	0	0	27	0	5	385
UTP20	27340	broad.mit.edu	37	12	101755761	101755761	+	Missense_Mutation	SNP	G	G	A	rs76643734	byFrequency	TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr12:101755761G>A	ENST00000261637.4	+	44	5887	c.5713G>A	c.(5713-5715)Gtt>Att	p.V1905I		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1905					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GACTTTCACCGTTCACATGCT	0.413													G|||	6	0.00119808	0.003	0.0014	5008	,	,		16504	0.0		0.0	False		,,,				2504	0.001					ENST00000261637.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				88						c.(5713-5715)Gtt>Att		UTP20, small subunit (SSU) processome component, homolog (yeast)		G	ILE/VAL	22,4384	27.2+/-55.0	0,22,2181	241.0	232.0	235.0		5713	5.1	0.9	12	dbSNP_131	235	0,8600		0,0,4300	yes	missense	UTP20	NM_014503.2	29	0,22,6481	AA,AG,GG		0.0,0.4993,0.1692	benign	1905/2786	101755761	22,12984	2203	4300	6503	SO:0001583	missense	27340	90	121412	55				g.chr12:101755761G>A	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5713G>A	chr12.hg19:g.101755761G>A	ENSP00000261637:p.Val1905Ile	1						p.V1905I	NM_014503.2	NP_055318.2	0	3	3	1.842395	O75691	UTP20_HUMAN		44	5887	+			Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	1	0	hg19	c.5713G>A	CCDS9081.1	1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	13.14	2.148199	0.37923	0.004993	0.0	ENSG00000120800	ENST00000261637	T	0.40225	1.04	6.03	5.05	0.67936	6.03	5.05	0.67936	Armadillo-type fold (1);	0.179437	0.48767	D	0.000171	T	0.24392	0.0591	L	0.39633	1.23	0.48185	D	0.999606	B	0.26935	0.164	B	0.19148	0.024	T	0.03981	-1.0987	10	0.17832	T	0.49	-22.9366	13.7726	0.63036	0.099:0.0:0.901:0.0	.	1905	O75691	UTP20_HUMAN	I	1905	ENSP00000261637:V1905I	ENSP00000261637:V1905I	V	+	1	0	0	UTP20	100279892	100279892	1.000000	0.71417	0.860000	0.33809	0.458000	0.32498	4.835000	0.62781	2.854000	0.98071	0.655000	0.94253	GTT	0.286694		TCGA-YH-A8SY-01A-11D-A377-08	0.413	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	1	0	1	2	2	2	2	0	0	0	0	88	88	88	87	1	3.360000	-3.021590	1	0.220000	NM_014503		0	132	131	0	416	410	1		1	1		0	0	88	0	0	1.000000	3.490724e-01	0	4	0	1	0	132	416
PTPN11	5781	broad.mit.edu	37	12	112926259	112926259	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr12:112926259C>T	ENST00000351677.2	+	12	1590	c.1392C>T	c.(1390-1392)ggC>ggT	p.G464G		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	468	Substrate binding. {ECO:0000250}.|Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						CTGGAATTGGCCGGACAGGGA	0.443			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																													ENST00000351677.2	1.000000	0.050000	0.280000	0.090000	0.150000	0.259874	0.150000	0.140000				Dom	yes			Dom	yes		12	12q24.1	12q24.1	5781	Mis	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	yes	Noonan Syndrome	L	L			JMML, AML, MDS		0				451						c.(1390-1392)ggC>ggT		protein tyrosine phosphatase, non-receptor type 11							122.0	111.0	115.0					12																	112926259		2203	4300	6503	SO:0001819	synonymous_variant	5781	0	0		Noonan syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	g.chr12:112926259C>T	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1392C>T	chr12.hg19:g.112926259C>T		1						p.G464G	NM_002834.3	NP_002825.3	0	3	3	1.842395	Q06124	PTN11_HUMAN		12	1590	+			A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	0	1	hg19	c.1392C>T	CCDS9163.1	0																																																																																								0.286694		TCGA-YH-A8SY-01A-11D-A377-08	0.443	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2	0	0	1	2	21	3	2	1	1	1	1	53	53	53	53	1	3.360000	-1.960411	0	0.220000			0	5	5	0	363	354	0		0	0		1	0	53	0	0	0.000825	5.544371e-03	0	0	0	20	0	5	363
C1RL	51279	broad.mit.edu	37	12	7254566	7254566	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr12:7254566G>A	ENST00000266542.4	-	3	510	c.418C>T	c.(418-420)Cgc>Tgc	p.R140C	C1RL_ENST00000544702.1_Missense_Mutation_p.R140C|C1RL_ENST00000545337.1_Missense_Mutation_p.R140C|C1RL_ENST00000545280.1_Intron	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	140	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGCTGTGTGCGGAAGGTCAGC	0.622																																						ENST00000266542.4	1.000000	0.030000	1.000000	0.080000	0.140000	0.286300	0.140000	0.130000																										0				16						c.(418-420)Cgc>Tgc		complement component 1, r subcomponent-like							118.0	108.0	111.0					12																	7254566		2203	4300	6503	SO:0001583	missense	51279	1	121412	35				g.chr12:7254566G>A	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.418C>T	chr12.hg19:g.7254566G>A	ENSP00000266542:p.Arg140Cys	1					C1RL_ENST00000545280.1_Intron|C1RL_ENST00000544702.1_Missense_Mutation_p.R140C|C1RL_ENST00000545337.1_Missense_Mutation_p.R140C	p.R140C	NM_016546.2	NP_057630.2	3	5	8	2.599697	Q9NZP8	C1RL_HUMAN		3	510	-			Q53GX9	Missense_Mutation	SNP	ENST00000266542.4	0	1	hg19	c.418C>T	CCDS8573.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.842|5.842	0.339585|0.339585	0.11069|0.11069	.|.	.|.	ENSG00000139178|ENSG00000139178	ENST00000534950|ENST00000266542;ENST00000396661;ENST00000544702;ENST00000543933;ENST00000545337	.|T;T;T;T	.|0.30448	.|1.53;1.53;1.53;1.53	3.76|3.76	-0.133|-0.133	0.13485|0.13485	3.76|3.76	-0.133|-0.133	0.13485|0.13485	.|CUB (5);	.|1.399260	.|0.04433	.|N	.|0.369511	T|T	0.35799|0.35799	0.0944|0.0944	M|M	0.88640|0.88640	2.97|2.97	0.24098|0.24098	N|N	0.995883|0.995883	.|B;B;B	.|0.33919	.|0.432;0.038;0.285	.|B;B;B	.|0.27887	.|0.051;0.007;0.084	T|T	0.30268|0.30268	-0.9984|-0.9984	5|10	.|0.45353	.|T	.|0.12	.|.	3.3529|3.3529	0.07159|0.07159	0.2989:0.0:0.5228:0.1783|0.2989:0.0:0.5228:0.1783	.|.	.|140;140;140	.|F5GWF3;F5H7C8;Q9NZP8	.|.;.;C1RL_HUMAN	L|C	39|140	.|ENSP00000266542:R140C;ENSP00000441885:R140C;ENSP00000437398:R140C;ENSP00000442611:R140C	.|ENSP00000266542:R140C	P|R	-|-	2|1	0|0	0|0	C1RL|C1RL	7145842|7145842	7145842|7145842	0.147000|0.147000	0.22687|0.22687	0.103000|0.103000	0.21229|0.21229	0.289000|0.289000	0.27227|0.27227	0.193000|0.193000	0.17116|0.17116	-0.034000|-0.034000	0.13713|0.13713	-1.529000|-1.529000	0.00923|0.00923	CCG|CGC	0.480554		TCGA-YH-A8SY-01A-11D-A377-08	0.622	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	0	0	1	2	2	2	2	0	0	0	0	96	96	96	95	1	3.360000	-2.133026	0	0.220000	NM_016546		0	7	6	0	793	780	0		1	0		0	0	96	0	0	0.979379	1.220433e-01	0	0	0	59	0	7	793
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	3	5	8	2.589570	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.475947		TCGA-YH-A8SY-01A-11D-A377-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	76	76	76	75	1	3.360000	-20.000000	1	0.220000	NM_033360		2275	74	74	5743	267	266	1	1	1	1	1	0	0	76	316	1	1.000000	8.377904e-01	1	6	86	8	314	74	267
NR2C1	7181	broad.mit.edu	37	12	95451597	95451597	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr12:95451597G>A	ENST00000333003.5	-	6	932	c.602C>T	c.(601-603)gCc>gTc	p.A201V	NR2C1_ENST00000330677.7_Missense_Mutation_p.A201V|NR2C1_ENST00000393101.3_Missense_Mutation_p.A201V|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	201					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						TGTTGAAGCGGCACAGTTGGA	0.343																																						ENST00000333003.5	1.000000	0.020000	0.180000	0.050000	0.090000	0.205853	0.090000	0.090000																										0				13						c.(601-603)gCc>gTc		nuclear receptor subfamily 2, group C, member 1							121.0	119.0	120.0					12																	95451597		2203	4300	6503	SO:0001583	missense	7181	0	0					g.chr12:95451597G>A	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.602C>T	chr12.hg19:g.95451597G>A	ENSP00000333275:p.Ala201Val	1					NR2C1_ENST00000330677.7_Missense_Mutation_p.A201V|NR2C1_ENST00000545833.1_5'UTR|NR2C1_ENST00000393101.3_Missense_Mutation_p.A201V	p.A201V	NM_003297.3	NP_003288.2	0	3	3	1.842395	P13056	NR2C1_HUMAN		6	932	-			A8K5K4|Q15625|Q15626	Missense_Mutation	SNP	ENST00000333003.5	0	1	hg19	c.602C>T	CCDS9051.1	0	.	.	.	.	.	.	.	.	.	.	G	28.6	4.934588	0.92458	.	.	ENSG00000120798	ENST00000333003;ENST00000393101;ENST00000330677	D;D;D	0.92149	-2.98;-2.7;-2.7	5.6	5.6	0.85130	5.6	5.6	0.85130	Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.95921	0.8672	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	0.998;0.998;1.0;0.997	D;D;D;D	0.80764	0.989;0.994;0.989;0.985	D	0.95074	0.8207	10	0.44086	T	0.13	.	19.6188	0.95647	0.0:0.0:1.0:0.0	.	201;201;201;201	B6ZGT7;P13056-3;P13056-2;P13056	.;.;.;NR2C1_HUMAN	V	201	ENSP00000333275:A201V;ENSP00000376813:A201V;ENSP00000328843:A201V	ENSP00000328843:A201V	A	-	2	0	0	NR2C1	93975728	93975728	1.000000	0.71417	0.966000	0.40874	0.889000	0.51656	9.385000	0.97223	2.646000	0.89796	0.655000	0.94253	GCC	0.286694		TCGA-YH-A8SY-01A-11D-A377-08	0.343	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	0	0	1	2	18	3	2	1	1	1	1	116	116	116	115	1	3.360000	-2.031101	0	0.220000	NM_003297		0	5	5	0	594	586	0		0	0		1	0	116	0	0	0.004459	3.835748e-03	0	0	0	28	0	5	594
GPR133	283383	broad.mit.edu	37	12	131622750	131622750	+	Silent	SNP	C	C	T	rs34765022		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr12:131622750C>T	ENST00000261654.5	+	24	3064	c.2505C>T	c.(2503-2505)aaC>aaT	p.N835N	GPR133_ENST00000540207.1_3'UTR|GPR133_ENST00000543617.1_Silent_p.N354N|GPR133_ENST00000376682.4_Silent_p.N521N|GPR133_ENST00000535015.1_Silent_p.N867N	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	835					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.N835N(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GCACCTCCAACGCGAAGCCCT	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		16580	0.0		0.001	False		,,,				2504	0.0					ENST00000261654.5	1.000000	0.990000	1.000000	0.990000	0.990000	0.999998	0.990000	1.000000																										1	Substitution - coding silent(1)	p.N835N(1)	large_intestine(1)	67						c.(2503-2505)aaC>aaT		G protein-coupled receptor 133		C		0,4406		0,0,2203	90.0	71.0	78.0		2505	-0.2	0.0	12	dbSNP_126	78	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous	GPR133	NM_198827.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		835/875	131622750	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	283383	62	121412	45				g.chr12:131622750C>T	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2505C>T	chr12.hg19:g.131622750C>T		1					GPR133_ENST00000535015.1_Silent_p.N867N|GPR133_ENST00000540207.1_3'UTR|GPR133_ENST00000376682.4_Silent_p.N521N|GPR133_ENST00000543617.1_Silent_p.N354N	p.N835N	NM_198827.3	NP_942122.2	0	3	3	1.842395	Q6QNK2	GP133_HUMAN		24	3064	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	1	1	hg19	c.2505C>T	CCDS9272.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	3.018	-0.202417	0.06219	0.0	2.33E-4	ENSG00000111452	ENST00000335486	.	.	.	4.46	-0.207	0.13189	4.46	-0.207	0.13189	.	.	.	.	.	T	0.31979	0.0814	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30090	-0.9990	4	.	.	.	.	8.0838	0.30760	0.0:0.47:0.0:0.53	rs34765022	.	.	.	M	189	.	.	T	+	2	0	0	GPR133	130188703	130188703	0.201000	0.23410	0.000000	0.03702	0.034000	0.12701	0.158000	0.16422	0.022000	0.15160	-0.254000	0.11334	ACG	0.286694		TCGA-YH-A8SY-01A-11D-A377-08	0.612	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	3.360000	-20.000000	1	0.220000	NM_198827		0	35	33	0	140	138	1		1	0		0	0	23	0	0	1.000000	1.088827e-01	0	0	0	3	0	35	140
ELF1	1997	broad.mit.edu	37	13	41523989	41523989	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr13:41523989G>A	ENST00000239882.3	-	5	796	c.482C>T	c.(481-483)gCa>gTa	p.A161V	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.A137V	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	161					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		CGGTGAGTCTGCATATTTTTC	0.473																																						ENST00000239882.3	0.180000	0.010000	0.130000	0.050000	0.080000	0.096851	0.080000	0.080000																										0				37						c.(481-483)gCa>gTa		E74-like factor 1 (ets domain transcription factor)							196.0	181.0	186.0					13																	41523989		2203	4300	6503	SO:0001583	missense	1997	0	0					g.chr13:41523989G>A	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.482C>T	chr13.hg19:g.41523989G>A	ENSP00000239882:p.Ala161Val	1					ELF1_ENST00000442101.1_Missense_Mutation_p.A137V|ELF1_ENST00000498824.1_5'UTR	p.A161V	NM_172373.3	NP_758961.1	2	2	4	2.119557	P32519	ELF1_HUMAN		5	796	-		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	0	1	hg19	c.482C>T	CCDS9374.1	0	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259936	0.23051	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.20332	2.11;2.08	5.84	-2.05	0.07321	5.84	-2.05	0.07321	.	0.767917	0.12353	N	0.476371	T	0.07369	0.0186	N	0.08118	0	0.09310	N	1	B;B	0.14012	0.004;0.009	B;B	0.09377	0.003;0.004	T	0.27971	-1.0058	10	0.33940	T	0.23	.	1.3405	0.02153	0.2585:0.0968:0.3523:0.2924	.	137;161	E9PDQ9;P32519	.;ELF1_HUMAN	V	137;161	ENSP00000405580:A137V;ENSP00000239882:A161V	ENSP00000239882:A161V	A	-	2	0	0	ELF1	40421989	40421989	0.001000	0.12720	0.033000	0.17914	0.656000	0.38851	0.096000	0.15147	-0.099000	0.12263	-0.282000	0.10007	GCA	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.473	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	0	0	1	2	2	2	2	0	0	0	0	101	101	101	100	1	3.360000	-1.969131	0	0.220000	NM_172373		0	6	7	0	791	778	0		1	0		0	0	101	0	0	0.963223	4.949738e-02	0	0	0	39	0	6	791
PCDH8	5100	broad.mit.edu	37	13	53420520	53420520	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr13:53420520G>A	ENST00000377942.3	-	1	2255	c.2052C>T	c.(2050-2052)cgC>cgT	p.R684R	PCDH8_ENST00000338862.4_Silent_p.R684R	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	684	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CCCTGAACACGCGACCGGGTG	0.706																																					GBM(36;25 841 9273 49207)	ENST00000377942.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				36						c.(2050-2052)cgC>cgT		protocadherin 8							7.0	10.0	9.0					13																	53420520		2101	4198	6299	SO:0001819	synonymous_variant	5100	0	0					g.chr13:53420520G>A	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2052C>T	chr13.hg19:g.53420520G>A		1					PCDH8_ENST00000338862.4_Silent_p.R684R	p.R684R	NM_002590.3	NP_002581.2	2	2	4	2.119557	O95206	PCDH8_HUMAN		1	2255	-		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Silent	SNP	ENST00000377942.3	1	1	hg19	c.2052C>T	CCDS9438.1	1																																																																																								0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.706	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	3.360000	-20.000000	1	0.220000	NM_002590		0	26	26	0	91	91	0		1			0	0	18	0	0	1.000000	0	0	0	0	0	0	26	91
PCDH17	27253	broad.mit.edu	37	13	58208913	58208913	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr13:58208913G>A	ENST00000377918.3	+	1	2259	c.2233G>A	c.(2233-2235)Gcc>Acc	p.A745T		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	745					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CTGCCGCATCGCCGAGTACAG	0.547																																					Melanoma(72;952 1291 1619 12849 33676)	ENST00000377918.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.998392	0.990000	1.000000																										0				120						c.(2233-2235)Gcc>Acc		protocadherin 17							77.0	73.0	74.0					13																	58208913		2203	4300	6503	SO:0001583	missense	27253	0	0					g.chr13:58208913G>A	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2233G>A	chr13.hg19:g.58208913G>A	ENSP00000367151:p.Ala745Thr	1						p.A745T	NM_001040429.2	NP_001035519.1	2	2	4	2.119557	O14917	PCD17_HUMAN		1	2259	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	1	1	hg19	c.2233G>A	CCDS31986.1	1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092421	0.55968	.	.	ENSG00000118946	ENST00000377918	T	0.56444	0.46	5.55	5.55	0.83447	5.55	5.55	0.83447	.	0.097709	0.64402	D	0.000001	T	0.58680	0.2139	M	0.69823	2.125	0.53005	D	0.999961	P;P	0.47302	0.835;0.893	B;B	0.43331	0.416;0.285	T	0.60835	-0.7184	9	.	.	.	.	19.5072	0.95124	0.0:0.0:1.0:0.0	.	745;745	O14917-2;O14917	.;PCD17_HUMAN	T	745	ENSP00000367151:A745T	.	A	+	1	0	0	PCDH17	57106914	57106914	1.000000	0.71417	0.992000	0.48379	0.917000	0.54804	7.968000	0.87980	2.607000	0.88179	0.591000	0.81541	GCC	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.547	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	1	0	0	2	2	2	2	0	0	0	0	53	53	53	52	1	3.360000	-13.396410	1	0.220000	NM_001040429		0	26	26	0	170	168	1		1	0		0	0	53	0	0	1.000000	5.199635e-02	0	0	0	3	0	26	170
RYR3	6263	broad.mit.edu	37	15	34040439	34040439	+	Missense_Mutation	SNP	G	G	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr15:34040439G>T	ENST00000389232.4	+	54	8184	c.8114G>T	c.(8113-8115)cGa>cTa	p.R2705L	RYR3_ENST00000415757.3_Missense_Mutation_p.R2705L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2705	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.R2705Q(2)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAGAAGCTTCGAAGTGTGTCC	0.577																																						ENST00000389232.4	1.000000	0.630000	1.000000	0.830000	0.990000	0.942475	0.990000	1.000000																										2	Substitution - Missense(2)	p.R2705Q(2)	large_intestine(2)	311						c.(8113-8115)cGa>cTa		ryanodine receptor 3							62.0	67.0	66.0					15																	34040439		1954	4150	6104	SO:0001583	missense	6263	0	0					g.chr15:34040439G>T		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8114G>T	chr15.hg19:g.34040439G>T	ENSP00000373884:p.Arg2705Leu	0					RYR3_ENST00000415757.3_Missense_Mutation_p.R2705L	p.R2705L	NM_001036.3	NP_001027.3	2	3	5	1.937316	Q15413	RYR3_HUMAN		54	8184	+		all_lung(180;7.18e-09)	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	1	1	hg19	c.8114G>T	CCDS45210.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410408	0.83340	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96830	-4.14;-4.14	5.18	5.18	0.71444	5.18	5.18	0.71444	.	0.071281	0.56097	D	0.000040	D	0.94155	0.8125	L	0.41492	1.28	0.58432	D	0.999992	B;B	0.32543	0.375;0.009	B;B	0.33392	0.163;0.018	D	0.93169	0.6564	10	0.49607	T	0.09	.	18.8778	0.92345	0.0:0.0:1.0:0.0	.	2705;2705	Q15413-2;Q15413	.;RYR3_HUMAN	L	2705	ENSP00000373884:R2705L;ENSP00000399610:R2705L	ENSP00000354735:R2705L	R	+	2	0	0	RYR3	31827731	31827731	1.000000	0.71417	0.991000	0.47740	0.897000	0.52465	7.158000	0.77470	2.679000	0.91253	0.655000	0.94253	CGA	0.300762		TCGA-YH-A8SY-01A-11D-A377-08	0.577	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	34	1	3.360000	-8.165503	1	0.220000			0	15	15	0	135	133	0		1			0	0	36	0	0	0.999883	0	0	0	0	0	0	15	135
CHST14	113189	broad.mit.edu	37	15	40764233	40764233	+	Missense_Mutation	SNP	G	G	A	rs397514706		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr15:40764233G>A	ENST00000306243.5	+	1	1074	c.821G>A	c.(820-822)cGc>cAc	p.R274H	CHST14_ENST00000559991.1_Missense_Mutation_p.R249H	NM_130468.3	NP_569735.1	Q8NCH0	CHSTE_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14	274					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|dermatan sulfate proteoglycan metabolic process (GO:0050655)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|phosphate ion binding (GO:0042301)			cervix(1)|large_intestine(1)|prostate(2)	4		all_cancers(109;2.34e-14)|all_epithelial(112;1.08e-11)|Lung NSC(122;2.95e-09)|all_lung(180;6.03e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0781)		GACCCTGAGCGCATGAATGAG	0.587																																						ENST00000306243.5	1.000000	0.030000	1.000000	0.070000	0.120000	0.311711	0.120000	0.090000																										0				4						c.(820-822)cGc>cAc		carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14							126.0	130.0	129.0					15																	40764233		2203	4300	6503	SO:0001583	missense	113189	0	0					g.chr15:40764233G>A	AF401222	CCDS10059.1	15q15.1	2014-09-17	2007-03-27	2007-03-27	ENSG00000169105	ENSG00000169105		"""Sulfotransferases, membrane-bound"""	24464	protein-coding gene	gene with protein product		608429	"""dermatan 4 sulfotransferase 1"""	D4ST1		11470797	Standard	NM_130468		Approved	HD4ST, D4ST-1	uc001zlw.3	Q8NCH0	OTTHUMG00000129985	ENST00000306243.5:c.821G>A	chr15.hg19:g.40764233G>A	ENSP00000307297:p.Arg274His	0					CHST14_ENST00000559991.1_Missense_Mutation_p.R249H	p.R274H	NM_130468.3	NP_569735.1	2	3	5	1.937316	Q8NCH0	CHSTE_HUMAN		1	1074	+		all_cancers(109;2.34e-14)|all_epithelial(112;1.08e-11)|Lung NSC(122;2.95e-09)|all_lung(180;6.03e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)	Q6PJ31|Q6UXA0|Q96P94	Missense_Mutation	SNP	ENST00000306243.5	0	1	hg19	c.821G>A	CCDS10059.1	0	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769808	0.49680	.	.	ENSG00000169105	ENST00000306243	T	0.75260	-0.92	4.92	3.02	0.34903	4.92	3.02	0.34903	.	0.133960	0.44097	N	0.000487	T	0.61714	0.2369	L	0.40543	1.245	0.43403	D	0.995531	B	0.09022	0.002	B	0.08055	0.003	T	0.52859	-0.8519	10	0.28530	T	0.3	-11.2791	8.6952	0.34291	0.1901:0.0:0.8099:0.0	.	274	Q8NCH0	CHSTE_HUMAN	H	274	ENSP00000307297:R274H	ENSP00000307297:R274H	R	+	2	0	0	CHST14	38551525	38551525	0.991000	0.36638	0.986000	0.45419	0.982000	0.71751	1.809000	0.38922	0.650000	0.30769	0.655000	0.94253	CGC	0.300762		TCGA-YH-A8SY-01A-11D-A377-08	0.587	CHST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252251.1	0	0	1	2	2	2	2	0	0	0	0	83	83	83	83	1	3.360000	-2.235578	0	0.220000	NM_130468		0	5	5	0	507	501	0		1	0		0	0	83	0	0	0.935871	4.053859e-01	0	0	0	123	0	5	507
CAPN3	825	broad.mit.edu	37	15	42695097	42695097	+	Missense_Mutation	SNP	C	C	T	rs375279877		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr15:42695097C>T	ENST00000397163.3	+	13	1861	c.1642C>T	c.(1642-1644)Cgc>Tgc	p.R548C	RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000569136.1_5'Flank|CAPN3_ENST00000357568.3_Missense_Mutation_p.R548C|CAPN3_ENST00000397204.4_5'Flank|CAPN3_ENST00000337571.4_5'Flank|CAPN3_ENST00000356316.3_Missense_Mutation_p.R461C|CAPN3_ENST00000397200.4_Missense_Mutation_p.R36C|CAPN3_ENST00000318023.7_Missense_Mutation_p.R548C|CAPN3_ENST00000349748.3_Missense_Mutation_p.R500C|CAPN3_ENST00000561817.1_5'Flank	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	548	Domain III.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CCAGCGCTTCCGCCTGCCTCC	0.592																																						ENST00000397163.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				47						c.(1642-1644)Cgc>Tgc		calpain 3, (p94)		C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	120.0	99.0	106.0		1642,1642,1498,106	4.9	1.0	15		106	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense,missense	CAPN3	NM_000070.2,NM_024344.1,NM_173087.1,NM_173088.1	180,180,180,180	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign	548/822,548/816,500/730,36/310	42695097	1,13003	2203	4299	6502	SO:0001583	missense	825	1	121412	41				g.chr15:42695097C>T	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.1642C>T	chr15.hg19:g.42695097C>T	ENSP00000380349:p.Arg548Cys	0					CAPN3_ENST00000397204.4_5'Flank|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000569136.1_5'Flank|CAPN3_ENST00000356316.3_Missense_Mutation_p.R461C|CAPN3_ENST00000349748.3_Missense_Mutation_p.R500C|CAPN3_ENST00000337571.4_5'Flank|CAPN3_ENST00000561817.1_5'Flank|CAPN3_ENST00000397200.4_Missense_Mutation_p.R36C|CAPN3_ENST00000318023.7_Missense_Mutation_p.R548C|CAPN3_ENST00000357568.3_Missense_Mutation_p.R548C	p.R548C	NM_000070.2	NP_000061.1	2	3	5	1.937316	P20807	CAN3_HUMAN		13	1861	+		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	1	1	hg19	c.1642C>T	CCDS45245.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987438	0.74589	0.0	1.16E-4	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200	D;D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33	4.87	4.87	0.63330	4.87	4.87	0.63330	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.000000	0.85682	U	0.000000	D	0.82481	0.5046	L	0.38649	1.16	0.80722	D	1	B;B;B;B;B;B	0.33857	0.102;0.208;0.083;0.206;0.429;0.053	B;B;B;B;B;B	0.31290	0.031;0.077;0.018;0.032;0.127;0.075	T	0.82752	-0.0302	10	0.49607	T	0.09	.	18.1939	0.89814	0.0:1.0:0.0:0.0	.	413;461;500;548;548;461	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	C	461;36;548;548;500;548;36	ENSP00000348667:R461C;ENSP00000380349:R548C;ENSP00000350181:R548C;ENSP00000183936:R500C;ENSP00000326281:R548C;ENSP00000380384:R36C	ENSP00000326281:R548C	R	+	1	0	0	CAPN3	40482389	40482389	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.733000	0.68571	2.527000	0.85204	0.455000	0.32223	CGC	0.300762		TCGA-YH-A8SY-01A-11D-A377-08	0.592	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1	1	0	1	2	2	2	2	0	0	0	0	75	75	75	75	1	3.360000	-2.722726	1	0.220000			0	80	78	0	418	415	1		1	0		0	0	75	0	0	1.000000	1.262146e-01	0	0	0	4	0	80	418
GLCE	26035	broad.mit.edu	37	15	69553616	69553616	+	Silent	SNP	G	G	A	rs377198684		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr15:69553616G>A	ENST00000261858.2	+	4	1005	c.777G>A	c.(775-777)gcG>gcA	p.A259A	GLCE_ENST00000559420.2_Silent_p.A195A|GLCE_ENST00000559500.1_3'UTR	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	259					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						GCTTTATGGCGAATGTGGCTG	0.393																																						ENST00000261858.2	1.000000	0.030000	1.000000	0.060000	0.110000	0.303882	0.110000	0.090000																										0				18						c.(775-777)gcG>gcA		glucuronic acid epimerase							155.0	151.0	152.0					15																	69553616		2200	4298	6498	SO:0001819	synonymous_variant	26035	0	0					g.chr15:69553616G>A	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.777G>A	chr15.hg19:g.69553616G>A		0					GLCE_ENST00000559420.2_Silent_p.A195A|GLCE_ENST00000559500.1_3'UTR	p.A259A	NM_015554.1	NP_056369.1	2	3	5	1.937316	O94923	GLCE_HUMAN		4	1005	+			Q6GUQ2	Silent	SNP	ENST00000261858.2	0	1	hg19	c.777G>A	CCDS32277.1	0																																																																																								0.300762		TCGA-YH-A8SY-01A-11D-A377-08	0.393	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	117	117	117	116	1	3.360000	-2.510514	1	0.220000	NM_015554		0	5	5	0	555	541	0		1	0		0	0	117	0	0	0.933860	1.327408e-04	0	0	0	2	0	5	555
CASKIN1	57524	broad.mit.edu	37	16	2228602	2228602	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr16:2228602G>A	ENST00000343516.6	-	20	4337	c.4245C>T	c.(4243-4245)atC>atT	p.I1415I		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	1415					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						ACATGCTGCCGATGTCGTCCA	0.741																																						ENST00000343516.6	1.000000	0.410000	0.970000	0.560000	0.750000	0.756480	0.750000	1.000000																										0				28						c.(4243-4245)atC>atT		CASK interacting protein 1							23.0	28.0	26.0					16																	2228602		2147	4267	6414	SO:0001819	synonymous_variant	57524	0	0					g.chr16:2228602G>A	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.4245C>T	chr16.hg19:g.2228602G>A		0						p.I1415I	NM_020764.3	NP_065815.1	1	2	3	1.978101	Q8WXD9	CSKI1_HUMAN		20	4337	-			Q9P2P0	Silent	SNP	ENST00000343516.6	0	1	hg19	c.4245C>T	CCDS42103.1	0																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.741	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	1	0	1	2	2	2	2	0	0	0	0	14	14	14	13	1	3.360000	-3.319498	1	0.220000	NM_020764		0	12	12	0	153	151	0		1			0	0	14	0	0	0.999169	0	0	0	0	0	0	12	153
CREBBP	1387	broad.mit.edu	37	16	3823809	3823809	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr16:3823809G>A	ENST00000262367.5	-	13	3215	c.2406C>T	c.(2404-2406)tcC>tcT	p.S802S	CREBBP_ENST00000382070.3_Silent_p.S764S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	802					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCGCCCCGCTGGATGACGGGA	0.607			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															ENST00000262367.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000				Dom/Rec	yes			Dom/Rec	yes		16	16p13.3	16p13.3	1387	T, N, F, Mis, O	CREB binding protein (CBP)	yes	yes	Rubinstein-Taybi syndrome	L	L	MLL, MORF, RUNXBP2		ALL, AML, DLBCL, B-NHL 		0				295						c.(2404-2406)tcC>tcT		CREB binding protein							50.0	53.0	52.0					16																	3823809		2197	4300	6497	SO:0001819	synonymous_variant	1387	1	121406	33				g.chr16:3823809G>A	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2406C>T	chr16.hg19:g.3823809G>A		0					CREBBP_ENST00000382070.3_Silent_p.S764S	p.S802S	NM_004380.2	NP_004371.2	1	2	3	1.978101	Q92793	CBP_HUMAN		13	3215	-		Ovarian(90;0.0266)	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	1	1	hg19	c.2406C>T	CCDS10509.1	1																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.607	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	1	0	1	2	2	2	2	0	0	0	0	49	49	49	48	1	3.360000	-3.411199	1	0.220000	NM_004380		0	55	55	0	214	209	1		1	1		0	0	49	0	0	1.000000	9.046553e-01	0	6	0	12	0	55	214
GPT2	84706	broad.mit.edu	37	16	46943627	46943627	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr16:46943627G>A	ENST00000340124.4	+	6	720	c.608G>A	c.(607-609)gGc>gAc	p.G203D	GPT2_ENST00000440783.2_Missense_Mutation_p.G103D	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	203					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	TCCGGGGGCGGCAAGTCACGG	0.537																																						ENST00000340124.4	0.350000	0.040000	0.250000	0.090000	0.160000	0.178021	0.160000	0.150000																										0				23						c.(607-609)gGc>gAc		glutamic pyruvate transaminase (alanine aminotransferase) 2	L-Alanine(DB00160)|Phenelzine(DB00780)						60.0	59.0	59.0					16																	46943627		2203	4300	6503	SO:0001583	missense	84706	0	0					g.chr16:46943627G>A		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.608G>A	chr16.hg19:g.46943627G>A	ENSP00000345282:p.Gly203Asp	0					GPT2_ENST00000440783.2_Missense_Mutation_p.G103D	p.G203D	NM_133443.2	NP_597700.1	1	2	3	1.978101	Q8TD30	ALAT2_HUMAN		6	720	+		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)	Q8N9E2	Missense_Mutation	SNP	ENST00000340124.4	0	1	hg19	c.608G>A	CCDS10725.1	0	.	.	.	.	.	.	.	.	.	.	G	11.78	1.740372	0.30865	.	.	ENSG00000166123	ENST00000340124;ENST00000440783	T;T	0.22134	1.97;2.87	5.12	5.12	0.69794	5.12	5.12	0.69794	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.052137	0.85682	D	0.000000	T	0.15565	0.0375	N	0.21448	0.665	0.80722	D	1	B	0.15141	0.012	B	0.20767	0.031	T	0.06770	-1.0808	10	0.07813	T	0.8	.	18.7502	0.91810	0.0:0.0:1.0:0.0	.	203	Q8TD30	ALAT2_HUMAN	D	203;103	ENSP00000345282:G203D;ENSP00000413804:G103D	ENSP00000345282:G203D	G	+	2	0	0	GPT2	45501128	45501128	1.000000	0.71417	0.998000	0.56505	0.298000	0.27526	6.049000	0.71053	2.664000	0.90586	0.655000	0.94253	GGC	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.537	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255741.2	0	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	3.360000	-2.670567	1	0.220000			0	4	4	0	275	272	0		1	0		0	0	53	0	0	0.887642	7.272195e-03	0	0	0	7	0	4	275
CIRH1A	84916	broad.mit.edu	37	16	69197063	69197063	+	Silent	SNP	C	C	T	rs554592005		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr16:69197063C>T	ENST00000314423.7	+	14	1806	c.1629C>T	c.(1627-1629)atC>atT	p.I543I	CIRH1A_ENST00000352319.4_Silent_p.I428I|CIRH1A_ENST00000563094.1_Silent_p.I543I			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	543					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		ACCTTGTCATCGCTCATTCGG	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		18157	0.0		0.001	False		,,,				2504	0.0				Melanoma(69;1156 1278 4951 8715 52012)	ENST00000314423.7	1.000000	0.720000	1.000000	0.820000	0.950000	0.926942	0.950000	1.000000																										0				16						c.(1627-1629)atC>atT		cirrhosis, autosomal recessive 1A (cirhin)							218.0	187.0	198.0					16																	69197063		2198	4300	6498	SO:0001819	synonymous_variant	84916	12	121412	47				g.chr16:69197063C>T	AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1629C>T	chr16.hg19:g.69197063C>T		0					CIRH1A_ENST00000563094.1_Silent_p.I543I|CIRH1A_ENST00000352319.4_Silent_p.I428I	p.I543I			1	2	3	1.980475	Q969X6	CIR1A_HUMAN		14	1806	+			Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Silent	SNP	ENST00000314423.7	1	1	hg19	c.1629C>T	CCDS10872.1	1																																																																																								0.288126		TCGA-YH-A8SY-01A-11D-A377-08	0.498	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268950.2	1	0	1	2	2	2	2	0	0	0	0	126	126	126	126	1	3.360000	-16.039560	1	0.220000	NM_032830		0	57	57	0	551	546	0		1	1		0	0	126	0	0	1.000000	9.998553e-01	0	25	0	100	0	57	551
MTSS1L	92154	broad.mit.edu	37	16	70713713	70713713	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr16:70713713G>A	ENST00000338779.6	-	5	632	c.358C>T	c.(358-360)Cag>Tag	p.Q120*		NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	120	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						TTGTCCAGCTGGTTGGCCGCC	0.697																																						ENST00000338779.6	1.000000	0.770000	1.000000	0.990000	0.990000	0.983669	0.990000	1.000000																										0				7						c.(358-360)Cag>Tag		metastasis suppressor 1-like							40.0	38.0	38.0					16																	70713713		2198	4300	6498	SO:0001587	stop_gained	92154	0	0					g.chr16:70713713G>A		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.358C>T	chr16.hg19:g.70713713G>A	ENSP00000341171:p.Gln120*	0						p.Q120*	NM_138383.2	NP_612392.1	1	2	3	1.980475	Q765P7	MTSSL_HUMAN		5	632	-			A6NJI7|Q9BUA8	Nonsense_Mutation	SNP	ENST00000338779.6	0	1	hg19	c.358C>T	CCDS32476.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.394476	0.96009	.	.	ENSG00000132613	ENST00000254951;ENST00000338779	.	.	.	4.84	4.84	0.62591	4.84	4.84	0.62591	.	0.250943	0.41294	D	0.000908	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-5.8949	12.979	0.58554	0.0:0.0:0.8383:0.1617	.	.	.	.	X	120	.	ENSP00000254951:Q120X	Q	-	1	0	0	MTSS1L	69271214	69271214	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.575000	0.82447	2.250000	0.74265	0.393000	0.25936	CAG	0.288126		TCGA-YH-A8SY-01A-11D-A377-08	0.697	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434927.3	1	0	1	2	2	2	2	0	0	0	0	10	10	10	10	1	3.360000	-19.766950	1	0.220000	NM_138383		0	12	12	0	77	74	0		1	1		0	0	10	0	0	0.999185	9.929075e-01	0	5	0	53	0	12	77
ANKRD11	29123	broad.mit.edu	37	16	89347349	89347349	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr16:89347349G>A	ENST00000301030.4	-	9	6061	c.5601C>T	c.(5599-5601)tgC>tgT	p.C1867C	ANKRD11_ENST00000378330.2_Silent_p.C1867C	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1867	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CAGCCGGTGGGCAGTGCAAAG	0.622																																						ENST00000301030.4	1.000000	0.530000	1.000000	0.670000	0.830000	0.831076	0.830000	1.000000																										0				83						c.(5599-5601)tgC>tgT		ankyrin repeat domain 11							42.0	46.0	45.0					16																	89347349		2198	4300	6498	SO:0001819	synonymous_variant	29123	1	121362	29				g.chr16:89347349G>A	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.5601C>T	chr16.hg19:g.89347349G>A		0					ANKRD11_ENST00000378330.2_Silent_p.C1867C	p.C1867C	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	1	2	3	1.965588	Q6UB99	ANR11_HUMAN		9	6061	-		all_hematologic(23;0.00824)|Colorectal(91;0.0475)	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	1	1	hg19	c.5601C>T	CCDS32513.1	0																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.622	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	1	0	1	2	2	2	2	0	0	0	0	39	39	39	39	1	3.360000	-20.000000	1	0.220000	NM_013275		0	21	20	0	235	235	0		1	1		0	0	39	0	0	0.999998	8.797368e-01	0	6	0	38	0	21	235
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999997	0.990000	1.000000	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	24185	GRCh37	CM062017|CM951224	TP53	M	rs28934578	c.(523-525)cGc>cAc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	7157	1	121412	41	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578406C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	chr17.hg19:g.7578406C>T	ENSP00000269305:p.Arg175His	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.769858	P04637	P53_HUMAN		5	713	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.524G>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	0	TP53	7519131	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	8	0	0	0	0	32	32	32	31	1	3.360000	-3.134589	1	0.220000	NM_000546		0	56	56	0	251	249	1		1	1	1	0	2	32	779	0	1.000000	9.977413e-01	1	17	197	27	637	56	251
HOXB5	3215	broad.mit.edu	37	17	46670813	46670813	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr17:46670813C>T	ENST00000239151.5	-	1	510	c.232G>A	c.(232-234)Gcg>Acg	p.A78T	HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000460041.1_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000466037.2_RNA	NM_002147.3	NP_002138.1	P09067	HXB5_HUMAN	homeobox B5	78					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell differentiation (GO:0045446)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			large_intestine(1)|lung(2)	3						TGGGCGGGCGCGGGGAAGGCG	0.687																																						ENST00000239151.5	1.000000	0.850000	1.000000	0.990000	0.990000	0.991403	0.990000	1.000000																										0				3						c.(232-234)Gcg>Acg		homeobox B5							11.0	14.0	13.0					17																	46670813		2185	4244	6429	SO:0001583	missense	3215	0	0					g.chr17:46670813C>T		CCDS11530.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120075	ENSG00000120075		"""Homeoboxes / ANTP class : HOXL subclass"""	5116	protein-coding gene	gene with protein product		142960	"""homeo box B5"""	HOX2, HOX2A		1973146, 1358459	Standard	NM_002147		Approved		uc002inr.3	P09067	OTTHUMG00000159913	ENST00000239151.5:c.232G>A	chr17.hg19:g.46670813C>T	ENSP00000239151:p.Ala78Thr	1					HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000460041.1_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000467155.2_RNA	p.A78T	NM_002147.3	NP_002138.1	3	3	6	2.173455	P09067	HXB5_HUMAN		1	510	-			B2RC69|P09069|Q17RP4	Missense_Mutation	SNP	ENST00000239151.5	0	1	hg19	c.232G>A	CCDS11530.1	1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530435	0.27387	.	.	ENSG00000120075	ENST00000239151	D	0.92299	-3.01	5.44	0.916	0.19373	5.44	0.916	0.19373	.	0.579461	0.18522	N	0.138741	D	0.82545	0.5060	N	0.21282	0.65	0.29926	N	0.822337	B	0.15930	0.015	B	0.06405	0.002	T	0.72811	-0.4180	10	0.32370	T	0.25	.	6.425	0.21764	0.2685:0.5605:0.0977:0.0732	.	78	P09067	HXB5_HUMAN	T	78	ENSP00000239151:A78T	ENSP00000239151:A78T	A	-	1	0	0	HOXB5	44025812	44025812	0.126000	0.22350	0.998000	0.56505	0.904000	0.53231	0.035000	0.13797	0.663000	0.31027	-0.300000	0.09419	GCG	0.376399		TCGA-YH-A8SY-01A-11D-A377-08	0.687	HOXB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358148.2	1	0	1	2	2	2	2	0	0	0	0	18	18	18	18	1	3.360000	-19.984010	1	0.220000			0	13	13	0	92	88	0		1	1		0	0	18	0	0	0.999547	8.680183e-01	0	3	0	25	0	13	92
MALT1	10892	broad.mit.edu	37	18	56409220	56409220	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr18:56409220G>A	ENST00000348428.3	+	14	1985	c.1727G>A	c.(1726-1728)cGg>cAg	p.R576Q	MALT1_ENST00000345724.3_Missense_Mutation_p.R565Q|RP11-126O1.4_ENST00000588835.1_RNA	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	576					activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						TCTCTTGTGCGGAATCTACAG	0.378			T	BIRC3	MALT																																	ENST00000348428.3	0.280000	0.040000	0.200000	0.070000	0.120000	0.142560	0.120000	0.120000				Dom	yes			Dom	yes		18	18q21	18q21	10892	T	mucosa associated lymphoid tissue lymphoma translocation gene 1				L	L	BIRC3		MALT		0				12						c.(1726-1728)cGg>cAg		mucosa associated lymphoid tissue lymphoma translocation gene 1							103.0	97.0	99.0					18																	56409220		2203	4300	6503	SO:0001583	missense	10892	0	0					g.chr18:56409220G>A		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.1727G>A	chr18.hg19:g.56409220G>A	ENSP00000319279:p.Arg576Gln	1					MALT1_ENST00000345724.3_Missense_Mutation_p.R565Q|RP11-126O1.4_ENST00000588835.1_RNA	p.R576Q	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	0	1	1	1.564562	Q9UDY8	MALT1_HUMAN		14	1985	+			Q9NTB7|Q9ULX4	Missense_Mutation	SNP	ENST00000348428.3	0	1	hg19	c.1727G>A	CCDS11967.1	0	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587606	0.86851	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	T;T	0.14144	2.54;2.53	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.112546	0.64402	D	0.000012	T	0.35128	0.0921	L	0.59436	1.845	0.34914	D	0.747776	D;D	0.89917	1.0;0.999	D;P	0.67725	0.953;0.899	T	0.34551	-0.9824	10	0.62326	D	0.03	-17.4564	19.053	0.93053	0.0:0.0:1.0:0.0	.	565;576	Q9UDY8-2;Q9UDY8	.;MALT1_HUMAN	Q	576;565	ENSP00000319279:R576Q;ENSP00000304161:R565Q	ENSP00000304161:R565Q	R	+	2	0	0	MALT1	54560200	54560200	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.500000	0.60387	2.600000	0.87896	0.446000	0.29264	CGG	0.130047		TCGA-YH-A8SY-01A-11D-A377-08	0.378	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2	0	0	1	2	2	2	2	0	0	0	0	83	83	83	83	1	3.360000	-2.516217	1	0.220000			0	4	4	0	273	270	0		1	0		0	0	83	0	0	0.888482	4.992063e-02	0	0	0	19	0	4	273
ATP1A3	478	broad.mit.edu	37	19	42471441	42471441	+	Silent	SNP	G	G	A	rs372919447		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr19:42471441G>A	ENST00000302102.5	-	22	3123	c.2973C>T	c.(2971-2973)taC>taT	p.Y991Y	ATP1A3_ENST00000543770.1_Silent_p.Y1002Y|ATP1A3_ENST00000602133.1_Silent_p.Y961Y|ATP1A3_ENST00000545399.1_Silent_p.Y1004Y	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	991					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GGATTTCGTCGTAGACGAAGA	0.652																																						ENST00000302102.5	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				52						c.(2971-2973)taC>taT		ATPase, Na+/K+ transporting, alpha 3 polypeptide		G		1,4405	2.1+/-5.4	0,1,2202	41.0	41.0	41.0		2973	-3.5	0.9	19		41	0,8600		0,0,4300	no	coding-synonymous	ATP1A3	NM_152296.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		991/1014	42471441	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	478	5	121406	37				g.chr19:42471441G>A		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2973C>T	chr19.hg19:g.42471441G>A		1					ATP1A3_ENST00000602133.1_Silent_p.Y961Y|ATP1A3_ENST00000545399.1_Silent_p.Y1004Y|ATP1A3_ENST00000543770.1_Silent_p.Y1002Y	p.Y991Y	NM_152296.4	NP_689509.1	2	2	4	2.150199	P13637	AT1A3_HUMAN		22	3123	-			B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Silent	SNP	ENST00000302102.5	1	1	hg19	c.2973C>T	CCDS12594.1	1																																																																																								0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.652	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	1	0	1	2	2	2	2	0	0	0	0	20	20	20	20	1	3.360000	-20.000000	1	0.220000	NM_152296		0	37	37	0	154	152	1		1	1		0	0	20	0	0	1.000000	3.958122e-02	0	2	0	0	0	37	154
WDR77	79084	broad.mit.edu	37	1	111991320	111991320	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:111991320G>A	ENST00000235090.5	-	2	428	c.222C>T	c.(220-222)tcC>tcT	p.S74S	WDR77_ENST00000411751.2_Silent_p.S74S|WDR77_ENST00000497278.1_5'Flank|ATP5F1_ENST00000369722.3_5'Flank|Y_RNA_ENST00000363020.1_RNA|ATP5F1_ENST00000483994.1_5'Flank	NM_024102.2	NP_077007.1	Q9BQA1	MEP50_HUMAN	WD repeat domain 77	74					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA metabolic process (GO:0016070)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|methylosome (GO:0034709)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		GGACTCCGGCGGAGCAGAAGC	0.622																																						ENST00000235090.5	0.600000	0.080000	0.400000	0.150000	0.250000	0.283117	0.250000	0.230000																										0				10						c.(220-222)tcC>tcT		WD repeat domain 77							28.0	29.0	29.0					1																	111991320		2192	4268	6460	SO:0001819	synonymous_variant	79084	0	0					g.chr1:111991320G>A	BC016946	CCDS835.1	1p13.2	2013-01-09		2005-08-09	ENSG00000116455	ENSG00000116455		"""WD repeat domain containing"""	29652	protein-coding gene	gene with protein product		611734				11756452, 8619474	Standard	NM_024102		Approved	MEP50	uc001ebb.3	Q9BQA1	OTTHUMG00000011748	ENST00000235090.5:c.222C>T	chr1.hg19:g.111991320G>A		0					ATP5F1_ENST00000483994.1_5'Flank|Y_RNA_ENST00000363020.1_RNA|ATP5F1_ENST00000369722.3_5'Flank|WDR77_ENST00000411751.2_Silent_p.S74S|WDR77_ENST00000497278.1_5'Flank	p.S74S	NM_024102.2	NP_077007.1	1	2	3	1.963322	Q9BQA1	MEP50_HUMAN		2	428	-		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)	B3KMW6|B4DP38|Q3LID2|Q53FU2|Q6JZZ5|Q96GK4|Q9BWY3	Silent	SNP	ENST00000235090.5	0	1	hg19	c.222C>T	CCDS835.1	0	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880414	0.33255	.	.	ENSG00000116455	ENST00000449340	.	.	.	5.73	-1.3	0.09259	5.73	-1.3	0.09259	.	.	.	.	.	T	0.22898	0.0553	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30679	-0.9970	4	.	.	.	-18.7416	1.0705	0.01620	0.3009:0.1646:0.3524:0.1822	.	.	.	.	L	11	.	.	P	-	2	0	0	WDR77	111792843	111792843	0.818000	0.29161	0.995000	0.50966	0.991000	0.79684	-0.097000	0.11042	0.077000	0.16863	0.561000	0.74099	CCG	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.622	WDR77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032465.1	0	0	0	2	2	2	2	0	0	0	0	33	33	33	32	1	3.360000	-5.907009	1	0.220000	NM_024102		0	4	3	0	174	164	0		1	0		0	0	33	0	0	0.875641	2.260210e-01	0	0	0	32	0	4	174
NGF	4803	broad.mit.edu	37	1	115829176	115829176	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:115829176G>A	ENST00000369512.2	-	3	409	c.241C>T	c.(241-243)Cga>Tga	p.R81*	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	81					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	GAACGGAGTCGCCGCTTTTTA	0.642																																						ENST00000369512.2	1.000000	0.920000	1.000000	0.990000	0.990000	0.995616	0.990000	1.000000																										0				13						c.(241-243)Cga>Tga		nerve growth factor (beta polypeptide)	Clenbuterol(DB01407)						41.0	46.0	44.0					1																	115829176		2203	4300	6503	SO:0001587	stop_gained	4803	0	0					g.chr1:115829176G>A		CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.241C>T	chr1.hg19:g.115829176G>A	ENSP00000358525:p.Arg81*	0					RP4-663N10.1_ENST00000425449.1_RNA	p.R81*	NM_002506.2	NP_002497.2	1	2	3	1.963322	P01138	NGF_HUMAN		3	409	-	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)	A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Nonsense_Mutation	SNP	ENST00000369512.2	0	1	hg19	c.241C>T	CCDS882.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.640906	0.87859	.	.	ENSG00000134259	ENST00000369512	.	.	.	5.06	3.05	0.35203	5.06	3.05	0.35203	.	0.058013	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0674	11.9013	0.52685	0.0:0.0:0.5284:0.4716	.	.	.	.	X	81	.	ENSP00000358525:R81X	R	-	1	2	2	NGF	115630699	115630699	0.998000	0.40836	0.836000	0.33094	0.748000	0.42578	3.935000	0.56560	0.536000	0.28733	0.467000	0.42956	CGA	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.642	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032832.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	29	1	3.360000	-3.328489	1	0.220000	NM_002506		0	23	22	0	144	141	1		1	0		0	0	30	0	0	1.000000	2.088409e-02	0	1	0	1	0	23	144
KLHDC7A	127707	broad.mit.edu	37	1	18809344	18809344	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:18809344C>T	ENST00000400664.1	+	1	1921	c.1869C>T	c.(1867-1869)ttC>ttT	p.F623F		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	623						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GTGACACGTTCGCCCTGGCGC	0.667																																						ENST00000400664.1	1.000000	0.660000	1.000000	0.890000	0.990000	0.958633	0.990000	1.000000																										0				22						c.(1867-1869)ttC>ttT		kelch domain containing 7A							23.0	25.0	24.0					1																	18809344		2198	4292	6490	SO:0001819	synonymous_variant	127707	0	0					g.chr1:18809344C>T	AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.1869C>T	chr1.hg19:g.18809344C>T		0						p.F623F	NM_152375.2	NP_689588.2	1	2	3	1.984081	Q5VTJ3	KLD7A_HUMAN		1	1921	+		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)	Q8N8W6	Silent	SNP	ENST00000400664.1	1	1	hg19	c.1869C>T	CCDS185.2	1																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.667	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006923.3	1	0	1	2	2	2	2	0	0	0	0	28	28	28	24	1	3.360000	-19.863460	1	0.220000	NM_152375		0	13	11	0	101	96	1		1			0	0	28	0	0	0.999452	0	0	0	0	0	0	13	101
ADAM30	11085	broad.mit.edu	37	1	120436918	120436918	+	Missense_Mutation	SNP	G	G	A	rs115551394	byFrequency	TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:120436918G>A	ENST00000369400.1	-	1	2200	c.2042C>T	c.(2041-2043)gCg>gTg	p.A681V		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	681					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		CGAGGGAATCGCCCCTCTGAG	0.473													G|||	13	0.00259585	0.0068	0.0043	5008	,	,		18357	0.0		0.0	False		,,,				2504	0.001					ENST00000369400.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				38						c.(2041-2043)gCg>gTg		ADAM metallopeptidase domain 30		G	VAL/ALA	24,4382	30.8+/-60.4	0,24,2179	64.0	64.0	64.0		2042	-5.8	0.0	1	dbSNP_133	64	8,8592	6.4+/-24.3	0,8,4292	yes	missense	ADAM30	NM_021794.3	64	0,32,6471	AA,AG,GG		0.093,0.5447,0.246	benign	681/791	120436918	32,12974	2203	4300	6503	SO:0001583	missense	11085	189	121412	55				g.chr1:120436918G>A	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.2042C>T	chr1.hg19:g.120436918G>A	ENSP00000358407:p.Ala681Val	0						p.A681V	NM_021794.3	NP_068566.2	1	2	3	1.963322	Q9UKF2	ADA30_HUMAN		1	2200	-	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	1	0	hg19	c.2042C>T	CCDS907.1	1	4	0.0018315018315018315	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	0	0.0	G	8.508	0.865747	0.17250	0.005447	9.3E-4	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.01178	5.22	5.05	-5.85	0.02311	5.05	-5.85	0.02311	.	0.692560	0.11763	U	0.531905	T	0.00144	0.0004	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41787	-0.9489	10	0.29301	T	0.29	.	0.2119	0.00157	0.2303:0.2226:0.2471:0.3	.	681	Q9UKF2	ADA30_HUMAN	V	681	ENSP00000358407:A681V	ENSP00000358407:A681V	A	-	2	0	0	ADAM30	120238441	120238441	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.486000	0.06513	-1.165000	0.02786	-2.744000	0.00126	GCG	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.473	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	1	0	1	2	2	2	2	0	0	0	0	103	103	103	103	1	3.360000	-2.865375	1	0.220000	NM_021794		0	60	58	0	246	245	1		1			0	0	103	0	0	1.000000	0	0	0	0	0	0	60	246
SYT2	127833	broad.mit.edu	37	1	202568444	202568444	+	Missense_Mutation	SNP	T	T	G			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:202568444T>G	ENST00000367267.1	-	8	1147	c.955A>C	c.(955-957)Aag>Cag	p.K319Q	SYT2_ENST00000367268.4_Missense_Mutation_p.K319Q	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	319	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	TTGAGCCTCTTGCCATTCTGC	0.532																																						ENST00000367267.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999919	0.990000	1.000000																										0				29						c.(955-957)Aag>Cag		synaptotagmin II	Botulinum Toxin Type B(DB00042)						271.0	256.0	261.0					1																	202568444		2203	4300	6503	SO:0001583	missense	127833	0	0					g.chr1:202568444T>G	AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.955A>C	chr1.hg19:g.202568444T>G	ENSP00000356236:p.Lys319Gln	1					SYT2_ENST00000367268.4_Missense_Mutation_p.K319Q	p.K319Q	NM_001136504.1	NP_001129976.1	3	3	6	2.322195	Q8N9I0	SYT2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.169)	8	1147	-			Q496K5|Q8NBE5	Missense_Mutation	SNP	ENST00000367267.1	1	1	hg19	c.955A>C	CCDS1427.1	1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.881455	0.91740	.	.	ENSG00000143858	ENST00000367268;ENST00000367267	T;T	0.72835	-0.69;-0.69	5.21	5.21	0.72293	5.21	5.21	0.72293	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.102327	0.64402	D	0.000003	T	0.72977	0.3528	N	0.25060	0.705	0.80722	D	1	D	0.60575	0.988	D	0.63192	0.912	T	0.76971	-0.2761	10	0.66056	D	0.02	.	14.7397	0.69445	0.0:0.0:0.0:1.0	.	319	Q8N9I0	SYT2_HUMAN	Q	319	ENSP00000356237:K319Q;ENSP00000356236:K319Q	ENSP00000356236:K319Q	K	-	1	0	0	SYT2	200835067	200835067	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.897000	0.87356	1.957000	0.56846	0.460000	0.39030	AAG	0.417389		TCGA-YH-A8SY-01A-11D-A377-08	0.532	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099157.1	1	0	1	2	2	2	2	0	0	0	0	108	108	108	107	1	3.360000	-19.993890	1	0.220000	NM_177402		0	58	58	0	429	425	1		1			0	0	108	0	0	1.000000	0	0	0	0	0	0	58	429
MECR	51102	broad.mit.edu	37	1	29543100	29543100	+	Splice_Site	SNP	C	C	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:29543100C>A	ENST00000263702.6	-	2	299	c.274G>T	c.(274-276)Gga>Tga	p.G92*	MECR_ENST00000373791.3_Splice_Site_p.G16*|MECR_ENST00000489248.1_5'UTR			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	92					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		CCAAGGTTACCTTGGATCATA	0.458																																						ENST00000263702.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				11						c.(274-276)Gga>Tga		mitochondrial trans-2-enoyl-CoA reductase							216.0	221.0	219.0					1																	29543100		2203	4300	6503	SO:0001630	splice_region_variant	51102	0	0					g.chr1:29543100C>A		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.274+1G>T	chr1.hg19:g.29543100C>A		0					MECR_ENST00000373791.3_Splice_Site_p.G16*|MECR_ENST00000489248.1_5'UTR	p.G92*			1	2	3	1.963322	Q9BV79	MECR_HUMAN		2	299	-		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Splice_Site	SNP	ENST00000263702.6	0	1	hg19	c.274G>T	CCDS30659.1	1	.	.	.	.	.	.	.	.	.	.	C	38	7.283297	0.98186	.	.	ENSG00000116353	ENST00000373791;ENST00000263702;ENST00000373792	.	.	.	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5119	0.67794	0.0:1.0:0.0:0.0	.	.	.	.	X	16;92;4	.	.	G	-	1	0	0	MECR	29415687	29415687	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.673000	0.74482	2.802000	0.96397	0.655000	0.94253	GGA	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.458	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	0	0	1	2	2	2	2	0	0	0	0	144	144	144	144	1	3.360000	-3.293877	1	0.220000	NM_016011	Nonsense_Mutation	0	169	166	0	710	704	0		1	0		0	0	144	0	0	1.000000	9.796430e-01	0	0	0	28	0	169	710
STK40	83931	broad.mit.edu	37	1	36807372	36807372	+	Missense_Mutation	SNP	C	C	T	rs372595502		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:36807372C>T	ENST00000373129.3	-	12	1698	c.1292G>A	c.(1291-1293)cGc>cAc	p.R431H	STK40_ENST00000373132.3_Missense_Mutation_p.R431H|STK40_ENST00000373130.3_Missense_Mutation_p.R436H|STK40_ENST00000359297.2_3'UTR	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	431					glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				CCGCAGGTAGCGCTGCGCCAG	0.672																																						ENST00000373129.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				13						c.(1291-1293)cGc>cAc		serine/threonine kinase 40		C	HIS/ARG	0,4406		0,0,2203	44.0	48.0	47.0		1292	4.3	1.0	1		47	1,8599	1.2+/-3.3	0,1,4299	no	missense	STK40	NM_032017.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	431/436	36807372	1,13005	2203	4300	6503	SO:0001583	missense	83931	2	121390	34				g.chr1:36807372C>T	BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.1292G>A	chr1.hg19:g.36807372C>T	ENSP00000362221:p.Arg431His	0					STK40_ENST00000373130.3_Missense_Mutation_p.R436H|STK40_ENST00000373132.3_Missense_Mutation_p.R431H|STK40_ENST00000359297.2_3'UTR	p.R431H	NM_032017.1	NP_114406.1	1	2	3	1.963322	Q8N2I9	STK40_HUMAN		12	1698	-		Myeloproliferative disorder(586;0.0393)	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Missense_Mutation	SNP	ENST00000373129.3	1	1	hg19	c.1292G>A	CCDS407.1	1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431035	0.62844	0.0	1.16E-4	ENSG00000196182	ENST00000373129;ENST00000373130;ENST00000373132	T;T;T	0.68765	-0.34;-0.35;-0.34	5.18	4.26	0.50523	5.18	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.70579	0.3240	L	0.27053	0.805	0.49051	D	0.999748	D;D	0.76494	0.999;0.998	D;D	0.74674	0.984;0.964	T	0.73895	-0.3838	10	0.87932	D	0	-21.1861	12.6841	0.56938	0.0:0.9199:0.0:0.0801	.	436;431	Q8N2I9-4;Q8N2I9	.;STK40_HUMAN	H	431;436;431	ENSP00000362221:R431H;ENSP00000362222:R436H;ENSP00000362224:R431H	ENSP00000362221:R431H	R	-	2	0	0	STK40	36579959	36579959	1.000000	0.71417	1.000000	0.80357	0.143000	0.21401	7.378000	0.79679	1.177000	0.42855	0.563000	0.77884	CGC	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.672	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022592.1	1	0	1	2	2	2	2	0	0	0	0	41	41	41	40	1	3.360000	-3.362224	1	0.220000	NM_032017		0	56	54	0	222	218	1		1	1		0	0	41	0	0	1.000000	9.997914e-01	0	10	0	43	0	56	222
PTCH2	8643	broad.mit.edu	37	1	45288266	45288266	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:45288266C>T	ENST00000372192.3	-	22	3563	c.3433G>A	c.(3433-3435)Gca>Aca	p.A1145T	PTCH2_ENST00000447098.2_Intron|RNU5E-6P_ENST00000365574.1_RNA	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	1145					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					GAGGAGGATGCCCCCCACCTA	0.627									Basal Cell Nevus syndrome																													ENST00000372192.3	0.270000	0.030000	0.190000	0.070000	0.120000	0.140044	0.120000	0.120000																										0				50						c.(3433-3435)Gca>Aca		patched 2							84.0	89.0	87.0					1																	45288266		2203	4300	6503	SO:0001583	missense	8643	0	0		Basal Cell Nevus syndrome	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	g.chr1:45288266C>T	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.3433G>A	chr1.hg19:g.45288266C>T	ENSP00000361266:p.Ala1145Thr	0					PTCH2_ENST00000447098.2_Intron|RNU5E-6P_ENST00000365574.1_RNA	p.A1145T	NM_003738.4	NP_003729.3	1	2	3	1.963322	Q9Y6C5	PTC2_HUMAN		22	3563	-	Acute lymphoblastic leukemia(166;0.155)		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	0	1	hg19	c.3433G>A	CCDS516.1	0	.	.	.	.	.	.	.	.	.	.	c	9.847	1.192670	0.21954	.	.	ENSG00000117425	ENST00000372192	D	0.92299	-3.01	3.92	-7.85	0.01192	3.92	-7.85	0.01192	.	3.801910	0.00674	N	0.000646	T	0.76371	0.3978	N	0.08118	0	0.19945	N	0.999941	B	0.06786	0.001	B	0.08055	0.003	T	0.72782	-0.4189	10	0.13470	T	0.59	6.7686	0.1418	0.00084	0.2555:0.2463:0.2154:0.2828	.	1145	Q9Y6C5	PTC2_HUMAN	T	1145	ENSP00000361266:A1145T	ENSP00000361266:A1145T	A	-	1	0	0	PTCH2	45060853	45060853	0.000000	0.05858	0.000000	0.03702	0.355000	0.29361	-3.348000	0.00503	-2.059000	0.00894	-0.921000	0.02739	GCA	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.627	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	0	0	1	2	21	2	2	1	1	1	1	67	67	67	66	1	3.360000	-1.947876	0	0.220000	NM_003738		0	5	5	0	450	445	0		0	0		1	0	67	0	0	0.000968	5.949946e-04	0	0	0	3	0	5	450
ELAVL4	1996	broad.mit.edu	37	1	50642759	50642759	+	Splice_Site	SNP	A	A	G			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:50642759A>G	ENST00000371823.4	+	3	474		c.e3-1		ELAVL4_ENST00000448907.2_Splice_Site|ELAVL4_ENST00000371819.1_Splice_Site|ELAVL4_ENST00000371821.1_Splice_Site|ELAVL4_ENST00000371827.1_Splice_Site|ELAVL4_ENST00000357083.4_Splice_Site|ELAVL4_ENST00000371824.1_Splice_Site|RP11-567C20.2_ENST00000442477.1_RNA|ELAVL4_ENST00000492299.1_Splice_Site	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4						mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						ATATTTCCACAGGACAGAGTT	0.403																																						ENST00000371823.4	1.000000	0.650000	1.000000	0.820000	0.990000	0.936548	0.990000	1.000000																										0				32						c.e3-1		ELAV like neuron-specific RNA binding protein 4							63.0	62.0	63.0					1																	50642759		2203	4300	6503	SO:0001630	splice_region_variant	1996	0	0					g.chr1:50642759A>G	AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.251-1A>G	chr1.hg19:g.50642759A>G		0					ELAVL4_ENST00000357083.4_Splice_Site|ELAVL4_ENST00000371821.1_Splice_Site|ELAVL4_ENST00000371824.1_Splice_Site|ELAVL4_ENST00000371819.1_Splice_Site|RP11-567C20.2_ENST00000442477.1_RNA|ELAVL4_ENST00000492299.1_Splice_Site|ELAVL4_ENST00000371827.1_Splice_Site|ELAVL4_ENST00000448907.2_Splice_Site		NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	1	2	3	1.963322	P26378	ELAV4_HUMAN		3	474	+			B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Splice_Site	SNP	ENST00000371823.4	1	1	hg19		CCDS553.1	1	.	.	.	.	.	.	.	.	.	.	A	17.24	3.339651	0.60963	.	.	ENSG00000162374	ENST00000448907;ENST00000371827;ENST00000357083;ENST00000371824;ENST00000371823;ENST00000371821;ENST00000371819	.	.	.	5.5	5.5	0.81552	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7759	0.78214	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	ELAVL4	50415346	50415346	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.703000	0.91344	2.308000	0.77769	0.533000	0.62120	.	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.403	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	3.360000	-9.262255	1	0.220000	NM_021952	Intron	0	20	20	0	178	171	1		1			0	0	34	0	0	0.999995	0	0	0	0	0	0	20	178
HFM1	164045	broad.mit.edu	37	1	91739306	91739306	+	Silent	SNP	T	T	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:91739306T>A	ENST00000370425.3	-	34	3833	c.3735A>T	c.(3733-3735)ggA>ggT	p.G1245G	HFM1_ENST00000370424.3_Silent_p.G924G|HFM1_ENST00000294696.5_Silent_p.G477G|HFM1_ENST00000462405.1_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	1245					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		GTCTAACTTTTCCATAGATTT	0.313																																						ENST00000370425.3	1.000000	0.660000	0.990000	0.750000	0.860000	0.865749	0.860000	1.000000																										0				75						c.(3733-3735)ggA>ggT		HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)							149.0	131.0	137.0					1																	91739306		2203	4298	6501	SO:0001819	synonymous_variant	164045	0	0					g.chr1:91739306T>A	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.3735A>T	chr1.hg19:g.91739306T>A		0					HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Silent_p.G477G|HFM1_ENST00000370424.3_Silent_p.G924G	p.G1245G	NM_001017975.3	NP_001017975.3	1	2	3	1.963322	A2PYH4	HFM1_HUMAN		34	3833	-		all_lung(203;0.00961)|Lung NSC(277;0.0351)	B1B0B6|Q8N9Q0	Silent	SNP	ENST00000370425.3	1	1	hg19	c.3735A>T	CCDS30769.2	1	.	.	.	.	.	.	.	.	.	.	T	2.695	-0.272273	0.05716	.	.	ENSG00000162669	ENST00000430465	.	.	.	5.75	2.13	0.27403	5.75	2.13	0.27403	.	.	.	.	.	T	0.10680	0.0261	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33007	-0.9885	4	.	.	.	.	4.7459	0.13036	0.0:0.1688:0.1611:0.6701	.	.	.	.	V	457	.	.	E	-	2	0	0	HFM1	91511894	91511894	0.000000	0.05858	0.000000	0.03702	0.490000	0.33462	0.682000	0.25335	0.105000	0.17753	0.533000	0.62120	GAA	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.313	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	1	0	1	2	2	2	2	0	0	0	0	129	129	129	129	1	3.360000	-14.863670	1	0.220000	NM_001017975		0	55	55	0	587	580	0		1			0	0	129	0	0	1.000000	0	0	0	0	0	0	55	587
HFM1	164045	broad.mit.edu	37	1	91846537	91846537	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:91846537C>T	ENST00000370425.3	-	7	903	c.805G>A	c.(805-807)Gca>Aca	p.A269T	HFM1_ENST00000370424.3_Intron|HFM1_ENST00000294696.5_5'UTR	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	269					resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.A269T(1)		breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CTAAATTTTGCCGCTTACAAT	0.219																																						ENST00000370425.3	0.300000	0.040000	0.200000	0.080000	0.130000	0.152466	0.130000	0.120000																										1	Substitution - Missense(1)	p.A269T(1)	kidney(1)	75						c.(805-807)Gca>Aca		HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)							54.0	63.0	60.0					1																	91846537		2194	4294	6488	SO:0001583	missense	164045	2	121328	31				g.chr1:91846537C>T	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.805G>A	chr1.hg19:g.91846537C>T	ENSP00000359454:p.Ala269Thr	0					HFM1_ENST00000294696.5_5'UTR|HFM1_ENST00000370424.3_Intron	p.A269T	NM_001017975.3	NP_001017975.3	1	2	3	1.963322	A2PYH4	HFM1_HUMAN		7	903	-		all_lung(203;0.00961)|Lung NSC(277;0.0351)	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	0	1	hg19	c.805G>A	CCDS30769.2	0	.	.	.	.	.	.	.	.	.	.	C	9.307	1.054465	0.19907	.	.	ENSG00000162669	ENST00000370425;ENST00000541820;ENST00000448819	T	0.58797	0.31	5.81	2.87	0.33458	5.81	2.87	0.33458	.	0.000000	0.45606	U	0.000360	T	0.29093	0.0723	L	0.54323	1.7	0.80722	D	1	B;B	0.15719	0.014;0.002	B;B	0.08055	0.003;0.003	T	0.09100	-1.0690	10	0.23891	T	0.37	.	8.468	0.32969	0.0:0.5885:0.0:0.4115	.	269;269	B7ZM16;A2PYH4	.;HFM1_HUMAN	T	269;302;128	ENSP00000359454:A269T	ENSP00000359454:A269T	A	-	1	0	0	HFM1	91619125	91619125	0.079000	0.21365	0.903000	0.35520	0.987000	0.75469	0.529000	0.23019	0.339000	0.23719	-0.136000	0.14681	GCA	0.295902		TCGA-YH-A8SY-01A-11D-A377-08	0.219	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	0	0	1	2	2	2	2	0	0	0	0	102	102	102	101	1	3.360000	-1.974416	0	0.220000	NM_001017975		0	5	5	0	410	407	0		1			0	0	102	0	0	0.936302	0	0	0	0	0	0	5	410
USH2A	7399	broad.mit.edu	37	1	215987140	215987140	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr1:215987140C>T	ENST00000307340.3	-	49	10063	c.9677G>A	c.(9676-9678)cGa>cAa	p.R3226Q	USH2A_ENST00000366943.2_Missense_Mutation_p.R3226Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3226					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCCTGTATTCGGCCACCACA	0.453										HNSCC(13;0.011)																												ENST00000307340.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				527						c.(9676-9678)cGa>cAa		Usher syndrome 2A (autosomal recessive, mild)							131.0	120.0	123.0					1																	215987140		2203	4300	6503	SO:0001583	missense	7399	0	0					g.chr1:215987140C>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9677G>A	chr1.hg19:g.215987140C>T	ENSP00000305941:p.Arg3226Gln	1	HNSCC(13;0.011)				USH2A_ENST00000366943.2_Missense_Mutation_p.R3226Q	p.R3226Q	NM_206933.2	NP_996816	2	3	5	2.302493	O75445	USH2A_HUMAN		49	10063	-			Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	1	1	hg19	c.9677G>A	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656431	0.47467	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12255	2.71;2.7	5.8	1.02	0.19986	5.8	1.02	0.19986	Fibronectin, type III (2);	0.228496	0.22457	U	0.059807	T	0.04318	0.0119	N	0.21240	0.645	0.09310	N	1	P	0.48503	0.911	B	0.31946	0.138	T	0.30621	-0.9972	10	0.08599	T	0.76	.	2.9934	0.05990	0.3129:0.3248:0.0:0.3623	.	3226	O75445	USH2A_HUMAN	Q	3226	ENSP00000305941:R3226Q;ENSP00000355910:R3226Q	ENSP00000305941:R3226Q	R	-	2	0	0	USH2A	214053763	214053763	0.340000	0.24792	0.341000	0.25589	0.810000	0.45777	0.862000	0.27899	0.596000	0.29794	-0.282000	0.10007	CGA	0.412075		TCGA-YH-A8SY-01A-11D-A377-08	0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	1	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	3.360000	-3.997968	1	0.220000	NM_007123		0	105	103	0	374	368	1		1			0	0	68	0	0	1.000000	0	0	0	0	0	0	105	374
NINL	22981	broad.mit.edu	37	20	25442226	25442226	+	Nonsense_Mutation	SNP	G	G	A	rs200555815		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr20:25442226G>A	ENST00000278886.6	-	21	3701	c.3628C>T	c.(3628-3630)Cag>Tag	p.Q1210*	NINL_ENST00000422516.1_Nonsense_Mutation_p.Q861*|NINL_ENST00000464285.1_5'Flank	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1210					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TGATGTTCCTGATTCAGGCAT	0.468																																						ENST00000278886.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				57						c.(3628-3630)Cag>Tag		ninein-like							190.0	161.0	171.0					20																	25442226		2203	4300	6503	SO:0001587	stop_gained	22981	2	121412	38				g.chr20:25442226G>A		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3628C>T	chr20.hg19:g.25442226G>A	ENSP00000278886:p.Gln1210*	1					NINL_ENST00000464285.1_5'Flank|NINL_ENST00000422516.1_Nonsense_Mutation_p.Q861*	p.Q1210*	NM_025176.4	NP_079452.3	2	2	4	2.126355	Q9Y2I6	NINL_HUMAN		21	3701	-			A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Nonsense_Mutation	SNP	ENST00000278886.6	0	1	hg19	c.3628C>T	CCDS33452.1	1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.593669	0.86953	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	.	.	.	4.69	0.163	0.14986	4.69	0.163	0.14986	.	0.257192	0.31673	N	0.007250	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-2.2951	7.9115	0.29793	0.0:0.2925:0.4189:0.2885	.	.	.	.	X	1210;861	.	ENSP00000278886:Q1210X	Q	-	1	0	0	NINL	25390226	25390226	0.990000	0.36364	0.013000	0.15412	0.104000	0.19210	0.957000	0.29215	-0.084000	0.12595	0.555000	0.69702	CAG	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.468	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	1	0	1	2	2	2	2	0	0	0	0	57	57	57	56	1	3.360000	-3.512475	1	0.220000	NM_025176		0	63	63	0	267	263	1		1	0		0	0	57	0	0	1.000000	5.985598e-01	0	0	0	10	0	63	267
MC3R	4159	broad.mit.edu	37	20	54824819	54824819	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr20:54824819G>A	ENST00000243911.2	+	1	1032	c.920G>A	c.(919-921)cGc>cAc	p.R307H		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	307					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			CTGGAATTGCGCAACACCTTT	0.517																																						ENST00000243911.2	0.190000	0.010000	0.140000	0.050000	0.080000	0.097547	0.080000	0.080000																										0				26						c.(919-921)cGc>cAc		melanocortin 3 receptor							168.0	160.0	163.0					20																	54824819		2203	4300	6503	SO:0001583	missense	4159	0	0					g.chr20:54824819G>A		CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.920G>A	chr20.hg19:g.54824819G>A	ENSP00000243911:p.Arg307His	1						p.R307H	NM_019888.3	NP_063941.3	2	2	4	2.126355	P41968	MC3R_HUMAN	Colorectal(105;0.202)	1	1032	+			Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	0	1	hg19	c.920G>A	CCDS13449.2	0	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520625	0.64747	.	.	ENSG00000124089	ENST00000243911	T	0.58358	0.34	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000014	D	0.82917	0.5141	H	0.97440	4.005	0.51767	D	0.99993	D	0.89917	1.0	D	0.83275	0.996	D	0.89536	0.3789	10	0.87932	D	0	.	18.1096	0.89530	0.0:0.0:1.0:0.0	.	344	P41968	MC3R_HUMAN	H	307	ENSP00000243911:R307H	ENSP00000243911:R307H	R	+	2	0	0	MC3R	54258226	54258226	1.000000	0.71417	0.990000	0.47175	0.182000	0.23217	9.731000	0.98807	2.362000	0.80069	0.555000	0.69702	CGC	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.517	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2	0	0	1	2	2	2	2	0	0	0	0	93	93	93	92	1	3.360000	-1.750945	0	0.220000			0	5	4	0	671	660	0		1			0	0	93	0	0	0.934759	0	0	0	0	0	0	5	671
KRTAP8-1	337879	broad.mit.edu	37	21	32185365	32185365	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr21:32185365C>T	ENST00000329621.4	-	1	205	c.174G>A	c.(172-174)tcG>tcA	p.S58S		NM_175857.3	NP_787053.1	Q8IUC2	KRA81_HUMAN	keratin associated protein 8-1	58						intermediate filament (GO:0005882)				central_nervous_system(1)|large_intestine(1)|lung(4)	6						GAGCAAATGGCGAGTATCTCC	0.562																																						ENST00000329621.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				6						c.(172-174)tcG>tcA		keratin associated protein 8-1							86.0	81.0	83.0					21																	32185365		2203	4300	6503	SO:0001819	synonymous_variant	337879	1	121412	36				g.chr21:32185365C>T	AJ457064	CCDS13607.1	21q22.1	2006-03-13			ENSG00000183640	ENSG00000183640		"""Keratin associated proteins"""	18935	protein-coding gene	gene with protein product						12359730	Standard	NM_175857		Approved	KAP8.1	uc002you.3	Q8IUC2	OTTHUMG00000057771	ENST00000329621.4:c.174G>A	chr21.hg19:g.32185365C>T		1						p.S58S	NM_175857.3	NP_787053.1	2	2	4	2.110881	Q8IUC2	KRA81_HUMAN		1	205	-			Q3LI57	Silent	SNP	ENST00000329621.4	1	1	hg19	c.174G>A	CCDS13607.1	1																																																																																								0.359501		TCGA-YH-A8SY-01A-11D-A377-08	0.562	KRTAP8-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128223.1	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	3.360000	-20.000000	1	0.220000			0	70	69	0	355	347	1		1			0	0	74	0	0	1.000000	0	0	0	0	0	0	70	355
KRTAP11-1	337880	broad.mit.edu	37	21	32253572	32253572	+	Missense_Mutation	SNP	C	C	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr21:32253572C>A	ENST00000332378.4	-	1	302	c.272G>T	c.(271-273)tGt>tTt	p.C91F		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	91						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						GTTGGAAATACAGGTAGTTTG	0.567																																						ENST00000332378.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999918	0.990000	1.000000																										0				18						c.(271-273)tGt>tTt		keratin associated protein 11-1							87.0	84.0	85.0					21																	32253572		2203	4300	6503	SO:0001583	missense	337880	0	0					g.chr21:32253572C>A	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.272G>T	chr21.hg19:g.32253572C>A	ENSP00000330720:p.Cys91Phe	1						p.C91F	NM_175858.2	NP_787054.1	2	2	4	2.110881	Q8IUC1	KR111_HUMAN		1	302	-			A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	1	1	hg19	c.272G>T	CCDS13608.1	1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.579810	0.46006	.	.	ENSG00000182591	ENST00000332378	T	0.03065	4.06	5.17	4.27	0.50696	5.17	4.27	0.50696	.	0.222920	0.39020	N	0.001497	T	0.16128	0.0388	M	0.79258	2.445	0.37098	D	0.899749	D	0.76494	0.999	D	0.74348	0.983	T	0.00907	-1.1519	10	0.49607	T	0.09	-6.145	12.4326	0.55583	0.0:0.9123:0.0:0.0877	.	91	Q8IUC1	KR111_HUMAN	F	91	ENSP00000330720:C91F	ENSP00000330720:C91F	C	-	2	0	0	KRTAP11-1	31175443	31175443	1.000000	0.71417	0.996000	0.52242	0.624000	0.37722	3.372000	0.52387	2.608000	0.88229	0.650000	0.86243	TGT	0.359501		TCGA-YH-A8SY-01A-11D-A377-08	0.567	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	3.360000	-20.000000	1	0.220000			0	37	37	0	215	209	1		1			0	0	53	0	0	1.000000	0	0	0	0	0	0	37	215
DOPEY2	9980	broad.mit.edu	37	21	37603002	37603002	+	Missense_Mutation	SNP	G	G	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr21:37603002G>T	ENST00000399151.3	+	14	2005	c.1920G>T	c.(1918-1920)aaG>aaT	p.K640N		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	640					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTGCCAGCAAGAACATTTTTG	0.547																																						ENST00000399151.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				58						c.(1918-1920)aaG>aaT		dopey family member 2							65.0	66.0	65.0					21																	37603002		2203	4300	6503	SO:0001583	missense	9980	0	0					g.chr21:37603002G>T	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.1920G>T	chr21.hg19:g.37603002G>T	ENSP00000382104:p.Lys640Asn	1						p.K640N	NM_005128.2	NP_005119.2	2	2	4	2.110881	Q9Y3R5	DOP2_HUMAN		14	2005	+			D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	1	1	hg19	c.1920G>T	CCDS13643.1	1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977714	0.53720	.	.	ENSG00000142197	ENST00000399151	T	0.14144	2.53	5.43	4.55	0.56014	5.43	4.55	0.56014	.	0.403370	0.29676	N	0.011497	T	0.24509	0.0594	M	0.63843	1.955	0.37959	D	0.932892	D;D	0.67145	0.996;0.992	D;P	0.65573	0.936;0.864	T	0.30679	-0.9970	10	0.09338	T	0.73	.	6.928	0.24426	0.296:0.0:0.704:0.0	.	640;640	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	N	640	ENSP00000382104:K640N	ENSP00000382104:K640N	K	+	3	2	2	DOPEY2	36524872	36524872	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	2.513000	0.45494	1.436000	0.47453	0.491000	0.48974	AAG	0.359501		TCGA-YH-A8SY-01A-11D-A377-08	0.547	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	1	0	1	2	2	2	2	0	0	0	0	80	80	80	78	1	3.360000	-20.000000	1	0.220000	NM_005128		0	60	59	0	270	267	1		1	1		0	0	80	0	0	1.000000	4.467231e-01	0	4	0	4	0	60	270
AFF3	3899	broad.mit.edu	37	2	100210257	100210257	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr2:100210257C>T	ENST00000409236.2	-	13	1978	c.1866G>A	c.(1864-1866)ccG>ccA	p.P622P	AFF3_ENST00000356421.2_Silent_p.P647P|AFF3_ENST00000317233.4_Silent_p.P622P|AFF3_ENST00000409579.1_Silent_p.P647P			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	622					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TGGTGGGCTCCGGGGGGACCA	0.736																																						ENST00000409236.2	1.000000	0.290000	0.800000	0.420000	0.590000	0.613214	0.590000	1.000000																										0				86						c.(1864-1866)ccG>ccA		AF4/FMR2 family, member 3							25.0	31.0	29.0					2																	100210257		2203	4294	6497	SO:0001819	synonymous_variant	3899	1	121154	20				g.chr2:100210257C>T	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1866G>A	chr2.hg19:g.100210257C>T		1					AFF3_ENST00000356421.2_Silent_p.P647P|AFF3_ENST00000409579.1_Silent_p.P647P|AFF3_ENST00000317233.4_Silent_p.P622P	p.P622P			2	2	4	2.140913	P51826	AFF3_HUMAN		13	1978	-			B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	ENST00000409236.2	1	1	hg19	c.1866G>A	CCDS42723.1	0																																																																																								0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.736	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	1	0	1	2	2	2	2	0	0	0	0	31	31	31	31	1	3.360000	-2.939472	1	0.220000	NM_002285		0	9	9	0	167	164	0		1			0	0	31	0	0	0.994146	0	0	0	0	0	0	9	167
PXDN	7837	broad.mit.edu	37	2	1643096	1643096	+	Missense_Mutation	SNP	T	T	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			T	A	T	T		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr2:1643096T>A	ENST00000252804.4	-	20	4101	c.4051A>T	c.(4051-4053)Aca>Tca	p.T1351S		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1351					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CGTGGTCTTGTTTTCTTGGTC	0.562																																						ENST00000252804.4	0.820000	0.180000	0.630000	0.290000	0.440000	0.468508	0.440000	0.410000																										0				112						c.(4051-4053)Aca>Tca		peroxidasin homolog (Drosophila)							123.0	127.0	125.0					2																	1643096		1982	4156	6138	SO:0001583	missense	7837	0	0					g.chr2:1643096T>A	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.4051A>T	chr2.hg19:g.1643096T>A	ENSP00000252804:p.Thr1351Ser	1						p.T1351S	NM_012293.1	NP_036425.1	0	2	2	1.757869	Q92626	PXDN_HUMAN		20	4101	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	0	1	hg19	c.4051A>T	CCDS46221.1	0	.	.	.	.	.	.	.	.	.	.	T	6.749	0.507109	0.12883	.	.	ENSG00000130508	ENST00000252804	T	0.59772	0.24	5.49	-5.44	0.02624	5.49	-5.44	0.02624	.	2.195000	0.01825	N	0.034285	T	0.28764	0.0713	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48636	-0.9018	10	0.02654	T	1	-4.7808	10.6794	0.45804	0.1126:0.5895:0.0:0.2979	.	1351	Q92626	PXDN_HUMAN	S	1351	ENSP00000252804:T1351S	ENSP00000252804:T1351S	T	-	1	0	0	PXDN	1622103	1622103	0.000000	0.05858	0.000000	0.03702	0.414000	0.31173	-1.513000	0.02256	-1.322000	0.02278	0.383000	0.25322	ACA	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.562	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	0	0	1	2	2	2	2	0	0	0	0	35	35	35	34	1	3.360000	-4.220467	1	0.220000	XM_056455		0	6	5	0	124	122	0		1	0		0	0	35	0	0	0.963555	9.977962e-01	0	0	0	266	0	6	124
DPYSL5	56896	broad.mit.edu	37	2	27150261	27150261	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr2:27150261C>T	ENST00000288699.6	+	4	719	c.561C>T	c.(559-561)atC>atT	p.I187I	DPYSL5_ENST00000401478.1_Silent_p.I187I	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	187					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGGGCAATCGCCCGCGTCC	0.527																																						ENST00000288699.6	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				27						c.(559-561)atC>atT		dihydropyrimidinase-like 5							106.0	81.0	90.0					2																	27150261		2203	4300	6503	SO:0001819	synonymous_variant	56896	1	121412	32				g.chr2:27150261C>T	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.561C>T	chr2.hg19:g.27150261C>T		1					DPYSL5_ENST00000401478.1_Silent_p.I187I	p.I187I	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	0	2	2	1.757869	Q9BPU6	DPYL5_HUMAN		4	719	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	ENST00000288699.6	1	1	hg19	c.561C>T	CCDS1730.1	1																																																																																								0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.527	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	1	0	1	2	2	2	2	0	0	0	0	42	42	42	41	1	3.360000	-4.656197	1	0.220000	NM_020134		0	53	53	0	163	162	1		1			0	0	42	0	0	1.000000	0	0	0	0	0	0	53	163
TLX2	3196	broad.mit.edu	37	2	74742813	74742813	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr2:74742813C>T	ENST00000233638.7	+	2	777	c.454C>T	c.(454-456)Cgg>Tgg	p.R152W		NM_016170.4	NP_057254.1	O43763	TLX2_HUMAN	T-cell leukemia homeobox 2	152					enteric nervous system development (GO:0048484)|mesoderm formation (GO:0001707)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|ovary(1)	2						CTACCAAAACCGGACCCCTCC	0.657																																					Esophageal Squamous(7;240 533 18610 24312)	ENST00000233638.7	1.000000	0.990000	1.000000	0.990000	0.990000	0.999998	0.990000	1.000000																										0				2						c.(454-456)Cgg>Tgg		T-cell leukemia homeobox 2							50.0	58.0	55.0					2																	74742813		2203	4300	6503	SO:0001583	missense	3196	1	121408	29				g.chr2:74742813C>T	AJ002607	CCDS1947.1	2p13.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000115297	ENSG00000115297		"""Homeoboxes / ANTP class : NKL subclass"""	5057	protein-coding gene	gene with protein product		604240	"""homeo box 11-like 1"", ""T-cell leukemia, homeobox 2"""	HOX11L1		10343123	Standard	NM_016170		Approved	Enx, Tlx2, NCX	uc002sma.2	O43763	OTTHUMG00000129960	ENST00000233638.7:c.454C>T	chr2.hg19:g.74742813C>T	ENSP00000233638:p.Arg152Trp	1						p.R152W	NM_016170.4	NP_057254.1	2	2	4	2.134063	O43763	TLX2_HUMAN		2	777	+			Q9UD56|Q9UQ48	Missense_Mutation	SNP	ENST00000233638.7	1	1	hg19	c.454C>T	CCDS1947.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191186	0.78902	.	.	ENSG00000115297	ENST00000233638	D	0.95756	-3.8	4.29	3.41	0.39046	4.29	3.41	0.39046	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.47093	D	0.000253	D	0.97204	0.9086	M	0.80982	2.52	0.54753	D	0.999983	D	0.89917	1.0	D	0.76575	0.988	D	0.97145	0.9827	10	0.87932	D	0	.	11.3327	0.49485	0.1828:0.8172:0.0:0.0	.	152	O43763	TLX2_HUMAN	W	152	ENSP00000233638:R152W	ENSP00000233638:R152W	R	+	1	2	2	TLX2	74596321	74596321	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.778000	0.62368	1.015000	0.39444	-0.152000	0.13540	CGG	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.657	TLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252224.3	1	0	1	2	2	2	2	0	0	0	0	38	38	38	37	1	3.360000	-20.000000	1	0.220000			0	55	54	0	303	300	1		1			0	0	38	0	0	1.000000	0	0	0	0	0	0	55	303
STEAP3	55240	broad.mit.edu	37	2	120005557	120005557	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr2:120005557G>A	ENST00000354888.5	+	4	1299	c.795G>A	c.(793-795)gtG>gtA	p.V265V	STEAP3_ENST00000425223.2_Silent_p.V265V|STEAP3_ENST00000409811.1_Silent_p.V265V|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000393110.2_Silent_p.V275V|STEAP3_ENST00000450943.2_Silent_p.V265V|STEAP3_ENST00000393106.2_Silent_p.V265V|STEAP3_ENST00000393107.2_Silent_p.V265V|STEAP3_ENST00000393108.2_Silent_p.V265V	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	265	Ferric oxidoreductase.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						TGGCCTACGTGCTGCTGTCAC	0.647																																						ENST00000354888.5	0.420000	0.100000	0.330000	0.160000	0.230000	0.251572	0.230000	0.240000																										0				17						c.(793-795)gtG>gtA		STEAP family member 3, metalloreductase							85.0	82.0	83.0					2																	120005557		2203	4300	6503	SO:0001819	synonymous_variant	55240	0	0					g.chr2:120005557G>A	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.795G>A	chr2.hg19:g.120005557G>A		1					STEAP3_ENST00000409811.1_Silent_p.V265V|STEAP3_ENST00000393106.2_Silent_p.V265V|STEAP3_ENST00000393107.2_Silent_p.V265V|STEAP3_ENST00000425223.2_Silent_p.V265V|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000450943.2_Silent_p.V265V|STEAP3_ENST00000393110.2_Silent_p.V275V|STEAP3_ENST00000393108.2_Silent_p.V265V	p.V265V	NM_182915.2	NP_878919.2	2	2	4	2.138506	Q658P3	STEA3_HUMAN		4	1299	+			A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	ENST00000354888.5	0	1	hg19	c.795G>A	CCDS2125.1	0																																																																																								0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.647	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	0	0	1	2	2	2	2	0	0	0	0	59	59	59	59	1	3.360000	-7.693234	1	0.220000	NM_018234		0	8	7	0	385	380	0		1	0		0	0	59	0	0	0.988857	6.593735e-02	0	1	0	17	0	8	385
UPK1B	7348	broad.mit.edu	37	3	118913171	118913171	+	Missense_Mutation	SNP	G	G	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr3:118913171G>T	ENST00000264234.3	+	6	723	c.574G>T	c.(574-576)Gtt>Ttt	p.V192F	UPK1B_ENST00000460625.1_Missense_Mutation_p.V184F|UPK1B_ENST00000497685.1_Missense_Mutation_p.V112F	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	192					epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		TCAATGCTGTGTTATGAACAA	0.463																																						ENST00000264234.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				14						c.(574-576)Gtt>Ttt		uroplakin 1B							158.0	142.0	147.0					3																	118913171		2203	4300	6503	SO:0001583	missense	7348	0	0					g.chr3:118913171G>T	AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.574G>T	chr3.hg19:g.118913171G>T	ENSP00000264234:p.Val192Phe	1					UPK1B_ENST00000497685.1_Missense_Mutation_p.V112F|UPK1B_ENST00000460625.1_Missense_Mutation_p.V184F	p.V192F	NM_006952.3	NP_008883.2	2	2	4	2.127073	O75841	UPK1B_HUMAN		6	723	+			O60753|Q9UIM2|Q9UNX6	Missense_Mutation	SNP	ENST00000264234.3	1	1	hg19	c.574G>T	CCDS2985.1	1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391863	0.83011	.	.	ENSG00000114638	ENST00000497685;ENST00000264234;ENST00000460625	D;D;D	0.87179	-2.22;-2.22;-2.22	5.92	5.04	0.67666	5.92	5.04	0.67666	Tetraspanin, EC2 domain (1);	0.270923	0.31847	N	0.006975	D	0.87676	0.6237	L	0.43152	1.355	0.41114	D	0.985767	P;P	0.50369	0.934;0.846	P;P	0.53593	0.73;0.452	D	0.86504	0.1805	10	0.39692	T	0.17	-20.5718	14.2934	0.66295	0.0733:0.0:0.9267:0.0	.	184;192	C9J9M7;O75841	.;UPK1B_HUMAN	F	112;192;184	ENSP00000418972:V112F;ENSP00000264234:V192F;ENSP00000418116:V184F	ENSP00000264234:V192F	V	+	1	0	0	UPK1B	120395861	120395861	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.124000	0.57924	2.809000	0.96659	0.467000	0.42956	GTT	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.463	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354883.2	1	0	1	2	2	2	2	0	0	0	0	76	76	76	74	1	3.360000	-20.000000	1	0.220000			0	71	71	0	367	363	1		1	1		0	0	76	0	0	1.000000	1	0	222	0	153	0	71	367
CLSTN2	64084	broad.mit.edu	37	3	140277663	140277663	+	Missense_Mutation	SNP	G	G	A	rs137889465		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr3:140277663G>A	ENST00000458420.3	+	12	2195	c.2005G>A	c.(2005-2007)Gcc>Acc	p.A669T		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	669					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.A669T(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GAGCACCTTCGCCAAAACCGA	0.532										HNSCC(16;0.037)			G|||	1	0.000199681	0.0	0.0014	5008	,	,		18296	0.0		0.0	False		,,,				2504	0.0				GBM(45;858 913 3709 36904 37282)	ENST00000458420.3	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.A669T(1)	large_intestine(1)	87						c.(2005-2007)Gcc>Acc		calsyntenin 2		G	THR/ALA	2,4404	4.2+/-10.8	0,2,2201	48.0	50.0	49.0		2005	2.5	0.0	3	dbSNP_134	49	0,8600		0,0,4300	no	missense	CLSTN2	NM_022131.2	58	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	669/956	140277663	2,13004	2203	4300	6503	SO:0001583	missense	64084	3	121412	36				g.chr3:140277663G>A	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2005G>A	chr3.hg19:g.140277663G>A	ENSP00000402460:p.Ala669Thr	1	HNSCC(16;0.037)					p.A669T	NM_022131.2	NP_071414.2	2	2	4	2.127073	Q9H4D0	CSTN2_HUMAN		12	2195	+			B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	1	1	hg19	c.2005G>A	CCDS3112.1	1	.	.	.	.	.	.	.	.	.	.	G	0.030	-1.341445	0.01277	4.54E-4	0.0	ENSG00000158258	ENST00000458420	T	0.29397	1.57	5.41	2.5	0.30297	5.41	2.5	0.30297	.	0.215482	0.46442	N	0.000281	T	0.08802	0.0218	N	0.01219	-0.95	0.23376	N	0.9978	B	0.09022	0.002	B	0.04013	0.001	T	0.33163	-0.9879	9	.	.	.	-0.0386	6.6275	0.22839	0.3845:0.0:0.6155:0.0	.	669	Q9H4D0	CSTN2_HUMAN	T	669	ENSP00000402460:A669T	.	A	+	1	0	0	CLSTN2	141760353	141760353	0.921000	0.31238	0.031000	0.17742	0.075000	0.17131	2.120000	0.41968	0.587000	0.29643	0.650000	0.86243	GCC	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.532	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	1	0	1	2	2	2	2	0	0	0	0	48	48	48	48	1	3.360000	-3.152367	1	0.220000	NM_022131		0	43	42	0	193	192	1		1	0		0	0	48	0	0	1.000000	1.593831e-01	0	0	0	4	0	43	193
SLC4A7	9497	broad.mit.edu	37	3	27431523	27431523	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr3:27431523G>A	ENST00000295736.5	-	22	3302	c.3232C>T	c.(3232-3234)Ccg>Tcg	p.P1078S	SLC4A7_ENST00000440156.1_Missense_Mutation_p.P1074S|SLC4A7_ENST00000428386.1_Missense_Mutation_p.P954S|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000435667.2_Missense_Mutation_p.P963S|SLC4A7_ENST00000446700.1_Missense_Mutation_p.P1070S|SLC4A7_ENST00000388777.4_Missense_Mutation_p.P628S|SLC4A7_ENST00000454389.1_Missense_Mutation_p.P1087S|SLC4A7_ENST00000455077.1_Missense_Mutation_p.P959S|SLC4A7_ENST00000437179.1_Missense_Mutation_p.P959S|SLC4A7_ENST00000445684.1_Missense_Mutation_p.P1074S	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1078					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	TTCCAGAGCGGCACATAACGG	0.373																																						ENST00000295736.5	0.170000	0.030000	0.130000	0.050000	0.080000	0.095599	0.080000	0.080000																										0				38						c.(3232-3234)Ccg>Tcg		solute carrier family 4, sodium bicarbonate cotransporter, member 7	Sodium bicarbonate(DB01390)						143.0	151.0	149.0					3																	27431523		2203	4300	6503	SO:0001583	missense	9497	0	0					g.chr3:27431523G>A	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3232C>T	chr3.hg19:g.27431523G>A	ENSP00000295736:p.Pro1078Ser	1					SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000428386.1_Missense_Mutation_p.P954S|SLC4A7_ENST00000437179.1_Missense_Mutation_p.P959S|SLC4A7_ENST00000445684.1_Missense_Mutation_p.P1074S|SLC4A7_ENST00000435667.2_Missense_Mutation_p.P963S|SLC4A7_ENST00000454389.1_Missense_Mutation_p.P1087S|SLC4A7_ENST00000440156.1_Missense_Mutation_p.P1074S|SLC4A7_ENST00000455077.1_Missense_Mutation_p.P959S|SLC4A7_ENST00000446700.1_Missense_Mutation_p.P1070S|SLC4A7_ENST00000388777.4_Missense_Mutation_p.P628S	p.P1078S	NM_003615.4	NP_003606.3	0	2	2	1.759364	Q9Y6M7	S4A7_HUMAN		22	3302	-			A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	0	1	hg19	c.3232C>T	CCDS33721.1	0	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790461	0.90367	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21	5.31	5.31	0.75309	5.31	5.31	0.75309	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87892	0.6292	M	0.72624	2.21	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.982;1.0;1.0;1.0	D	0.88424	0.3030	10	0.59425	D	0.04	.	18.9786	0.92747	0.0:0.0:1.0:0.0	.	1074;959;1070;1074;1087;628;954;1078;959	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	S	629;1078;954;1087;1074;959;1070;959;1074;963;628;974	ENSP00000411031:P629S;ENSP00000295736:P1078S;ENSP00000416368:P954S;ENSP00000390394:P1087S;ENSP00000414797:P1074S;ENSP00000394252:P959S;ENSP00000406605:P1070S;ENSP00000407382:P959S;ENSP00000406804:P1074S;ENSP00000395336:P963S;ENSP00000373429:P628S;ENSP00000388703:P974S	ENSP00000295736:P1078S	P	-	1	0	0	SLC4A7	27406527	27406527	1.000000	0.71417	0.995000	0.50966	0.770000	0.43624	9.869000	0.99810	2.479000	0.83701	0.650000	0.86243	CCG	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.373	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	0	0	1	2	2	2	2	0	0	0	0	125	125	125	124	1	3.360000	-1.875789	0	0.220000	NM_003615		0	6	6	0	654	648	0		1	0		0	0	125	0	0	0.964087	7.517827e-04	0	0	0	4	0	6	654
FBXL2	25827	broad.mit.edu	37	3	33400492	33400492	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr3:33400492C>T	ENST00000484457.1	+	3	190	c.99C>T	c.(97-99)tgC>tgT	p.C33C	FBXL2_ENST00000283627.6_Intron|FBXL2_ENST00000446237.3_5'UTR|FBXL2_ENST00000538892.1_Silent_p.C33C|FBXL2_ENST00000538181.1_Intron|FBXL2_ENST00000542085.1_5'UTR|FBXL2_ENST00000507198.1_Silent_p.C33C	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2									p.C33C(2)		endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						TAACTTTGTGCCGATGTGCAC	0.289																																						ENST00000484457.1	0.260000	0.040000	0.200000	0.080000	0.120000	0.142553	0.120000	0.120000																										2	Substitution - coding silent(2)	p.C33C(2)	prostate(2)	15						c.(97-99)tgC>tgT		F-box and leucine-rich repeat protein 2							46.0	46.0	46.0					3																	33400492		2200	4296	6496	SO:0001819	synonymous_variant	25827	9	121374	19				g.chr3:33400492C>T	AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.99C>T	chr3.hg19:g.33400492C>T		1					FBXL2_ENST00000507198.1_Silent_p.C33C|FBXL2_ENST00000538892.1_Silent_p.C33C|FBXL2_ENST00000542085.1_5'UTR|FBXL2_ENST00000538181.1_Intron|FBXL2_ENST00000446237.3_5'UTR|FBXL2_ENST00000283627.6_Intron	p.C33C	NM_012157.3	NP_036289.3	0	2	2	1.759364				3	190	+				Silent	SNP	ENST00000484457.1	0	1	hg19	c.99C>T	CCDS2658.1	0																																																																																								0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.289	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253245.2	0	0	1	2	2	2	2	0	0	0	0	57	57	57	57	1	3.360000	-2.572614	1	0.220000	NM_012157		0	5	5	0	372	370	0		1	0		0	0	57	0	0	0.936624	7.471398e-03	0	0	0	8	0	5	372
CACNA1D	776	broad.mit.edu	37	3	53810001	53810001	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr3:53810001G>T	ENST00000350061.5	+	35	4802	c.4291G>T	c.(4291-4293)Gag>Tag	p.E1431*	CACNA1D_ENST00000422281.2_Nonsense_Mutation_p.E1416*|CACNA1D_ENST00000288139.4_Nonsense_Mutation_p.E1451*|CACNA1D_ENST00000540742.1_Nonsense_Mutation_p.E323*	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1431	Dihydropyridine binding. {ECO:0000250}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAACCCCGGGGAGGAGTATAC	0.507																																						ENST00000350061.5	0.520000	0.230000	0.440000	0.290000	0.360000	0.371314	0.360000	0.360000																										0				90						c.(4291-4293)Gag>Tag		calcium channel, voltage-dependent, L type, alpha 1D subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						174.0	184.0	181.0					3																	53810001		2203	4300	6503	SO:0001587	stop_gained	776	0	0					g.chr3:53810001G>T	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4291G>T	chr3.hg19:g.53810001G>T	ENSP00000288133:p.Glu1431*	1					CACNA1D_ENST00000288139.4_Nonsense_Mutation_p.E1451*|CACNA1D_ENST00000540742.1_Nonsense_Mutation_p.E323*|CACNA1D_ENST00000422281.2_Nonsense_Mutation_p.E1416*	p.E1431*	NM_001128840.1	NP_001122312.1	0	2	2	1.759364	Q01668	CAC1D_HUMAN		35	4802	+			B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Nonsense_Mutation	SNP	ENST00000350061.5	0	1	hg19	c.4291G>T	CCDS46848.1	0	.	.	.	.	.	.	.	.	.	.	G	45	11.508490	0.99570	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000540742	.	.	.	5.06	5.06	0.68205	5.06	5.06	0.68205	.	0.136428	0.46758	D	0.000261	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	18.6072	0.91271	0.0:0.0:1.0:0.0	.	.	.	.	X	1431;1451;1416;1124;323	.	ENSP00000288139:E1451X	E	+	1	0	0	CACNA1D	53785041	53785041	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.657000	0.98554	2.624000	0.88883	0.650000	0.86243	GAG	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.507	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	0	0	1	2	2	2	2	0	0	0	0	123	123	123	123	1	3.360000	-3.442191	1	0.220000	NM_000720		0	23	22	0	559	550	0		1			0	0	123	0	0	0.999999	0	0	0	0	0	0	23	559
WNT5A	7474	broad.mit.edu	37	3	55504434	55504434	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr3:55504434G>A	ENST00000474267.1	-	6	1350	c.829C>T	c.(829-831)Cgg>Tgg	p.R277W	WNT5A_ENST00000493406.1_5'Flank|WNT5A_ENST00000264634.4_Missense_Mutation_p.R277W|WNT5A_ENST00000497027.1_Missense_Mutation_p.R262W			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	277					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		CTGTTGAGCCGCATGGCCGCC	0.612																																						ENST00000474267.1	0.710000	0.110000	0.520000	0.200000	0.340000	0.370328	0.340000	0.300000																										0				13						c.(829-831)Cgg>Tgg		wingless-type MMTV integration site family, member 5A							31.0	38.0	35.0					3																	55504434		2190	4298	6488	SO:0001583	missense	7474	0	0					g.chr3:55504434G>A	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.829C>T	chr3.hg19:g.55504434G>A	ENSP00000417310:p.Arg277Trp	1					WNT5A_ENST00000264634.4_Missense_Mutation_p.R277W|WNT5A_ENST00000497027.1_Missense_Mutation_p.R262W|WNT5A_ENST00000493406.1_5'Flank	p.R277W			0	2	2	1.759364	P41221	WNT5A_HUMAN		6	1350	-			A8K4A4|Q6P278	Missense_Mutation	SNP	ENST00000474267.1	0	1	hg19	c.829C>T	CCDS46850.1	0	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789736	0.70337	.	.	ENSG00000114251	ENST00000474267;ENST00000264634;ENST00000536765;ENST00000497027	T;T;T	0.76709	-1.04;-1.04;-1.04	5.82	2.59	0.31030	5.82	2.59	0.31030	.	0.138509	0.49916	D	0.000133	D	0.89121	0.6625	M	0.90542	3.125	0.49915	D	0.999835	D	0.65815	0.995	D	0.76575	0.988	D	0.90846	0.4727	10	0.87932	D	0	.	13.8804	0.63678	0.0:0.0:0.465:0.535	.	277	P41221	WNT5A_HUMAN	W	277;277;188;262	ENSP00000417310:R277W;ENSP00000264634:R277W;ENSP00000420104:R262W	ENSP00000264634:R277W	R	-	1	2	2	WNT5A	55479474	55479474	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.813000	0.38962	0.716000	0.32124	0.655000	0.94253	CGG	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.612	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350793.3	0	0	1	2	2	2	2	0	0	0	0	28	28	28	25	1	3.360000	-6.472079	1	0.220000	NM_003392		0	4	4	0	113	112	0		1	0		0	0	28	0	0	0.889632	5.085514e-01	0	0	0	43	0	4	113
ATP11B	23200	broad.mit.edu	37	3	182591715	182591715	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr3:182591715C>T	ENST00000323116.5	+	19	2424	c.2164C>T	c.(2164-2166)Cat>Tat	p.H722Y		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	722					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			ATCATGTGGCCATTTTCATAG	0.398																																						ENST00000323116.5	1.000000	0.990000	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										0				41						c.(2164-2166)Cat>Tat		ATPase, class VI, type 11B							113.0	100.0	105.0					3																	182591715		2203	4300	6503	SO:0001583	missense	23200	0	0					g.chr3:182591715C>T	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.2164C>T	chr3.hg19:g.182591715C>T	ENSP00000321195:p.His722Tyr	1						p.H722Y	NM_014616.2	NP_055431.1	2	2	4	2.127073	Q9Y2G3	AT11B_HUMAN	all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)	19	2424	+	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	1	1	hg19	c.2164C>T	CCDS33896.1	1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883120	0.91740	.	.	ENSG00000058063	ENST00000323116	T	0.62639	0.01	5.78	5.78	0.91487	5.78	5.78	0.91487	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.84124	0.5403	M	0.89904	3.07	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.985	D	0.86566	0.1844	10	0.87932	D	0	.	19.9991	0.97403	0.0:1.0:0.0:0.0	.	296;722	B3KSJ2;Q9Y2G3	.;AT11B_HUMAN	Y	722	ENSP00000321195:H722Y	ENSP00000321195:H722Y	H	+	1	0	0	ATP11B	184074409	184074409	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.440000	0.80464	2.724000	0.93272	0.655000	0.94253	CAT	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.398	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	1	0	1	2	2	2	2	0	0	0	0	72	72	72	72	1	3.360000	-20.000000	1	0.220000	NM_014616		0	54	51	0	283	281	1		1	1		0	0	72	0	0	1.000000	9.412088e-01	0	4	0	23	0	54	283
EPHA5	2044	broad.mit.edu	37	4	66230893	66230893	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr4:66230893C>T	ENST00000273854.3	-	12	2678	c.2078G>A	c.(2077-2079)cGt>cAt	p.R693H	EPHA5_ENST00000511294.1_Missense_Mutation_p.R694H|EPHA5_ENST00000432638.2_Missense_Mutation_p.R530H|EPHA5_ENST00000354839.4_Missense_Mutation_p.R671H	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	693	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)	p.R693H(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TAGTTTCAAACGTCCACTACA	0.358										TSP Lung(17;0.13)																												ENST00000273854.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999981	0.990000	1.000000																										2	Substitution - Missense(2)	p.R693H(2)	upper_aerodigestive_tract(1)|large_intestine(1)	142						c.(2077-2079)cGt>cAt		EPH receptor A5							131.0	137.0	135.0					4																	66230893		2203	4300	6503	SO:0001583	missense	2044	2	121406	36				g.chr4:66230893C>T	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2078G>A	chr4.hg19:g.66230893C>T	ENSP00000273854:p.Arg693His	0	TSP Lung(17;0.13)				EPHA5_ENST00000511294.1_Missense_Mutation_p.R694H|EPHA5_ENST00000354839.4_Missense_Mutation_p.R671H|EPHA5_ENST00000432638.2_Missense_Mutation_p.R530H	p.R693H	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	2	2	4	2.089236	P54756	EPHA5_HUMAN		12	2678	-			Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	1	1	hg19	c.2078G>A	CCDS3513.1	1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722513	0.89298	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.97	5.97	0.96955	5.97	5.97	0.96955	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000017	T	0.71609	0.3360	L	0.35341	1.055	0.53688	D	0.999971	D;B;D;D	0.89917	0.996;0.033;0.995;1.0	D;B;P;D	0.66497	0.942;0.047;0.903;0.944	T	0.70364	-0.4892	10	0.49607	T	0.09	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	672;694;671;693	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	H	693;530;671;694	ENSP00000273854:R693H;ENSP00000389208:R530H;ENSP00000346899:R671H;ENSP00000427638:R694H	ENSP00000273854:R693H	R	-	2	0	0	EPHA5	65913488	65913488	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.308000	0.51896	2.834000	0.97654	0.650000	0.86243	CGT	0.352482		TCGA-YH-A8SY-01A-11D-A377-08	0.358	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	1	0	1	2	2	2	2	0	0	0	0	88	88	88	86	1	3.360000	-19.999990	1	0.220000	NM_004439		0	57	56	0	347	345	1		1			0	0	88	0	0	1.000000	0	0	0	0	0	0	57	347
THAP9	79725	broad.mit.edu	37	4	83827666	83827666	+	Missense_Mutation	SNP	G	G	A	rs571856861		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr4:83827666G>A	ENST00000302236.5	+	3	517	c.466G>A	c.(466-468)Gta>Ata	p.V156I		NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	156					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				ACTTATCTCCGTAAAGAACTA	0.388																																						ENST00000302236.5	1.000000	0.040000	0.200000	0.070000	0.120000	0.181925	0.120000	0.120000																										0				33						c.(466-468)Gta>Ata		THAP domain containing 9							80.0	76.0	77.0					4																	83827666		2203	4300	6503	SO:0001583	missense	79725	1	121410	39				g.chr4:83827666G>A	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.466G>A	chr4.hg19:g.83827666G>A	ENSP00000305533:p.Val156Ile	0						p.V156I	NM_024672.4	NP_078948.3	2	2	4	2.089236	Q9H5L6	THAP9_HUMAN		3	517	+		Hepatocellular(203;0.114)	B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	0	1	hg19	c.466G>A	CCDS3598.1	0	.	.	.	.	.	.	.	.	.	.	G	7.115	0.576724	0.13686	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	T	0.35605	1.3	3.87	2.05	0.26809	3.87	2.05	0.26809	.	1.248910	0.05868	N	0.624116	T	0.18841	0.0452	N	0.08118	0	0.09310	N	1	B	0.23806	0.091	B	0.17433	0.018	T	0.24584	-1.0156	10	0.21540	T	0.41	-1.8827	6.5895	0.22639	0.0:0.2004:0.5924:0.2072	.	156	Q9H5L6	THAP9_HUMAN	I	156	ENSP00000305533:V156I	ENSP00000305533:V156I	V	+	1	0	0	THAP9	84046690	84046690	0.002000	0.14202	0.015000	0.15790	0.903000	0.53119	0.939000	0.28978	0.556000	0.29098	0.591000	0.81541	GTA	0.352482		TCGA-YH-A8SY-01A-11D-A377-08	0.388	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	131	1	3.360000	-2.456386	0	0.220000	NM_024672		0	6	6	0	564	559	0		1	0		0	0	131	0	0	0.964163	1.708588e-04	0	0	0	2	0	6	564
TIGD4	201798	broad.mit.edu	37	4	153691293	153691293	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr4:153691293C>T	ENST00000304337.2	-	2	1684	c.864G>A	c.(862-864)gaG>gaA	p.E288E		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	288	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					CTGGAAAAGACTCAACAAAAA	0.398																																						ENST00000304337.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				26						c.(862-864)gaG>gaA		tigger transposable element derived 4							127.0	135.0	133.0					4																	153691293		2203	4299	6502	SO:0001819	synonymous_variant	201798	0	0					g.chr4:153691293C>T	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.864G>A	chr4.hg19:g.153691293C>T		0						p.E288E	NM_145720.3	NP_663772.1	2	2	4	2.089236	Q8IY51	TIGD4_HUMAN		2	1684	-	all_hematologic(180;0.093)		Q96LP5	Silent	SNP	ENST00000304337.2	1	1	hg19	c.864G>A	CCDS34079.1	1																																																																																								0.352482		TCGA-YH-A8SY-01A-11D-A377-08	0.398	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	1	0	1	2	2	2	2	0	0	0	0	128	128	128	125	1	3.360000	-20.000000	1	0.220000	NM_145720		0	92	91	0	472	466	0		1			0	0	128	0	0	1.000000	0	0	0	0	0	0	92	472
PCDHB3	56132	broad.mit.edu	37	5	140481563	140481563	+	Missense_Mutation	SNP	G	G	A	rs558026324		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:140481563G>A	ENST00000231130.2	+	1	1330	c.1330G>A	c.(1330-1332)Gtc>Atc	p.V444I	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	444	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTCTCCGACGTCAATGACAA	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		18391	0.0		0.0	False		,,,				2504	0.001					ENST00000231130.2	0.920000	0.480000	0.810000	0.570000	0.680000	0.698457	0.680000	0.690000																										0				72						c.(1330-1332)Gtc>Atc		protocadherin beta 3							101.0	96.0	98.0					5																	140481563		2203	4300	6503	SO:0001583	missense	56132	1	121412	37				g.chr5:140481563G>A	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1330G>A	chr5.hg19:g.140481563G>A	ENSP00000231130:p.Val444Ile	0					AC005754.7_ENST00000607216.1_RNA	p.V444I	NM_018937.2	NP_061760.1	1	2	3	1.953850	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	1330	+			B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	1	1	hg19	c.1330G>A	CCDS4245.1	0	.	.	.	.	.	.	.	.	.	.	G	8.241	0.806788	0.16467	.	.	ENSG00000113205	ENST00000231130	T	0.01258	5.09	4.39	1.49	0.22878	4.39	1.49	0.22878	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.01061	0.0035	N	0.21324	0.655	0.26614	N	0.972776	B	0.20459	0.045	B	0.17098	0.017	T	0.45877	-0.9231	9	0.06625	T	0.88	.	7.9304	0.29899	0.1567:0.1339:0.7094:0.0	.	444	Q9Y5E6	PCDB3_HUMAN	I	444	ENSP00000231130:V444I	ENSP00000231130:V444I	V	+	1	0	0	PCDHB3	140461747	140461747	0.948000	0.32251	0.995000	0.50966	0.908000	0.53690	1.507000	0.35758	0.397000	0.25310	0.655000	0.94253	GTC	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.562	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	1	0	1	2	2	2	2	0	0	0	0	112	112	112	112	1	3.360000	-8.119044	1	0.220000	NM_018937		0	34	34	0	467	438	0		1	0		0	0	112	0	0	1.000000	6.094947e-02	0	0	0	6	0	34	467
PCDHGA1	56114	broad.mit.edu	37	5	140712177	140712177	+	Silent	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:140712177C>T	ENST00000517417.1	+	1	1926	c.1926C>T	c.(1924-1926)ctC>ctT	p.L642L	PCDHGA1_ENST00000378105.3_Silent_p.L642L	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	642	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCAGAGTCTCGTGGTGGCCG	0.701																																						ENST00000517417.1	1.000000	0.620000	1.000000	0.760000	0.910000	0.892797	0.910000	1.000000																										0				78						c.(1924-1926)ctC>ctT		protocadherin gamma subfamily A, 1							40.0	46.0	44.0					5																	140712177		2200	4297	6497	SO:0001819	synonymous_variant	56114	0	0					g.chr5:140712177C>T	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1926C>T	chr5.hg19:g.140712177C>T		0					PCDHGA1_ENST00000378105.3_Silent_p.L642L	p.L642L	NM_018912.2	NP_061735.1	1	2	3	1.953850	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1926	+			Q2M273|Q9Y5D6	Silent	SNP	ENST00000517417.1	1	1	hg19	c.1926C>T	CCDS54922.1	1																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.701	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	1	0	1	2	2	2	2	0	0	0	0	77	77	77	79	1	3.360000	-3.221884	1	0.220000	NM_018912		0	28	19	0	282	256	1		1			0	0	77	0	0	1.000000	0	0	0	0	0	0	28	282
ZNF622	90441	broad.mit.edu	37	5	16453182	16453182	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:16453182G>A	ENST00000308683.2	-	5	1372	c.1246C>T	c.(1246-1248)Cgg>Tgg	p.R416W		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	416					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						ACGGCCTTCCGATTTTTGGCA	0.498																																						ENST00000308683.2	0.380000	0.090000	0.300000	0.150000	0.210000	0.231388	0.210000	0.200000																										0				25						c.(1246-1248)Cgg>Tgg		zinc finger protein 622							78.0	77.0	77.0					5																	16453182		2203	4300	6503	SO:0001583	missense	90441	0	0					g.chr5:16453182G>A	AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.1246C>T	chr5.hg19:g.16453182G>A	ENSP00000310042:p.Arg416Trp	1						p.R416W	NM_033414.2	NP_219482.1	1	4	5	2.326018	Q969S3	ZN622_HUMAN		5	1372	-				Missense_Mutation	SNP	ENST00000308683.2	0	1	hg19	c.1246C>T	CCDS3886.1	0	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739888	0.69304	.	.	ENSG00000173545	ENST00000308683	.	.	.	5.7	3.8	0.43715	5.7	3.8	0.43715	.	0.533295	0.20075	N	0.099768	T	0.41236	0.1150	M	0.63843	1.955	0.24481	N	0.994344	D	0.56968	0.978	B	0.40410	0.328	T	0.44329	-0.9335	9	0.72032	D	0.01	-6.7854	14.3331	0.66572	0.0:0.0:0.5622:0.4378	.	416	Q969S3	ZN622_HUMAN	W	416	.	ENSP00000310042:R416W	R	-	1	2	2	ZNF622	16506182	16506182	1.000000	0.71417	0.795000	0.32087	0.980000	0.70556	2.028000	0.41088	1.336000	0.45506	0.655000	0.94253	CGG	0.413534		TCGA-YH-A8SY-01A-11D-A377-08	0.498	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	0	0	1	2	2	2	2	0	0	0	0	92	92	92	91	1	3.360000	-2.780967	1	0.220000	NM_033414		0	9	9	0	510	505	0		1	0		0	0	92	0	0	0.993983	7.071678e-01	0	1	0	137	0	9	510
MYOZ3	91977	broad.mit.edu	37	5	150050154	150050154	+	Missense_Mutation	SNP	G	G	A	rs374803714		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:150050154G>A	ENST00000297130.4	+	3	369	c.170G>A	c.(169-171)cGc>cAc	p.R57H	CTC-345K18.2_ENST00000511626.2_RNA|MYOZ3_ENST00000517768.1_Missense_Mutation_p.R57H|MYOZ3_ENST00000520112.1_5'Flank	NM_001122853.2|NM_133371.4	NP_001116325.1|NP_588612.2			myozenin 3											large_intestine(2)|lung(1)|skin(2)	5		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGAGGCAGCGCCGTGTGCAG	0.582																																						ENST00000297130.4	1.000000	0.740000	1.000000	0.990000	0.990000	0.979165	0.990000	1.000000																										0				5						c.(169-171)cGc>cAc		myozenin 3		G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	54.0	43.0	47.0		170,170	4.0	1.0	5		47	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MYOZ3	NM_001122853.1,NM_133371.3	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	57/252,57/252	150050154	1,13005	2203	4300	6503	SO:0001583	missense	91977	1	121406	28				g.chr5:150050154G>A	AF480443	CCDS4309.1	5q33.2	2008-07-18			ENSG00000164591	ENSG00000164591			18565	protein-coding gene	gene with protein product	"""calsarcin 3"", ""FATZ related protein 3"""	610735				11842093	Standard	NM_001122853		Approved	CS-3, CS3, FRP3	uc003lsr.3	Q8TDC0	OTTHUMG00000130077	ENST00000297130.4:c.170G>A	chr5.hg19:g.150050154G>A	ENSP00000297130:p.Arg57His	0					CTC-345K18.2_ENST00000511626.2_RNA|MYOZ3_ENST00000517768.1_Missense_Mutation_p.R57H|MYOZ3_ENST00000520112.1_5'Flank	p.R57H	NM_001122853.2|NM_133371.4	NP_001116325.1|NP_588612.2	1	2	3	1.949770			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	3	369	+		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)		Missense_Mutation	SNP	ENST00000297130.4	0	1	hg19	c.170G>A	CCDS4309.1	1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300097	0.81136	0.0	1.16E-4	ENSG00000164591	ENST00000517768;ENST00000297130	T;T	0.66099	-0.19;-0.19	4.89	4.0	0.46444	4.89	4.0	0.46444	.	0.165666	0.29185	N	0.012897	T	0.74504	0.3725	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.76187	-0.3051	10	0.72032	D	0.01	-8.5437	8.1756	0.31281	0.1697:0.0:0.8303:0.0	.	57	Q8TDC0	MYOZ3_HUMAN	H	57	ENSP00000428815:R57H;ENSP00000297130:R57H	ENSP00000297130:R57H	R	+	2	0	0	MYOZ3	150030347	150030347	0.991000	0.36638	1.000000	0.80357	0.985000	0.73830	1.895000	0.39778	2.416000	0.81992	0.555000	0.69702	CGC	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.582	MYOZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252369.1	1	0	1	2	2	2	2	0	0	0	0	12	12	12	12	1	3.360000	-19.033250	1	0.220000	NM_001122853		0	11	11	0	72	69	1		1			0	0	12	0	0	0.998420	0	0	0	0	0	0	11	72
KCNMB1	3779	broad.mit.edu	37	5	169812420	169812420	+	Missense_Mutation	SNP	C	C	T	rs201275787	byFrequency	TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:169812420C>T	ENST00000274629.4	-	2	474	c.32G>A	c.(31-33)cGg>cAg	p.R11Q	KCNMB1_ENST00000521859.1_Missense_Mutation_p.R11Q|KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000518527.1_Intron	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	11					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	TGTCTCTCCCCGCTTCTGGGC	0.537													C|||	3	0.000599042	0.0	0.0043	5008	,	,		18770	0.0		0.0	False		,,,				2504	0.0					ENST00000274629.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				11						c.(31-33)cGg>cAg		potassium large conductance calcium-activated channel, subfamily M, beta member 1	Miconazole(DB01110)|Procaine(DB00721)	C	,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	137.0	113.0	121.0		,32	5.1	1.0	5		121	9,8591	7.1+/-27.0	0,9,4291	yes	intron,missense	KCNMB1,KCNIP1	NM_001034838.1,NM_004137.2	,43	0,11,6492	TT,TC,CC		0.1047,0.0454,0.0846	,probably-damaging	,11/192	169812420	11,12995	2203	4300	6503	SO:0001583	missense	3779	80	121412	50				g.chr5:169812420C>T	AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.32G>A	chr5.hg19:g.169812420C>T	ENSP00000274629:p.Arg11Gln	0					KCNMB1_ENST00000521859.1_Missense_Mutation_p.R11Q|KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000518527.1_Intron	p.R11Q	NM_004137.3	NP_004128.1	1	2	3	1.949770	Q16558	KCMB1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	2	474	-	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Missense_Mutation	SNP	ENST00000274629.4	1	1	hg19	c.32G>A	CCDS4373.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	20.7	4.030060	0.75504	4.54E-4	0.001047	ENSG00000145936	ENST00000274629;ENST00000521859	T;T	0.09630	2.96;2.96	5.14	5.14	0.70334	5.14	5.14	0.70334	.	0.193157	0.46145	D	0.000307	T	0.28665	0.0710	L	0.57536	1.79	0.35602	D	0.807915	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.11991	-1.0565	9	.	.	.	.	14.4764	0.67548	0.0:1.0:0.0:0.0	.	11;11	Q16558-2;Q16558	.;KCMB1_HUMAN	Q	11	ENSP00000274629:R11Q;ENSP00000427940:R11Q	.	R	-	2	0	0	KCNMB1	169744998	169744998	1.000000	0.71417	0.998000	0.56505	0.652000	0.38707	2.535000	0.45685	2.545000	0.85829	0.655000	0.94253	CGG	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.537	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252830.3	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	3.360000	-2.525824	1	0.220000			0	67	66	0	293	288	1		1	0		0	0	61	0	0	1.000000	5.817372e-01	0	0	0	10	0	67	293
HK3	3101	broad.mit.edu	37	5	176308805	176308805	+	Missense_Mutation	SNP	G	G	A	rs190052913		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:176308805G>A	ENST00000292432.5	-	17	2372	c.2281C>T	c.(2281-2283)Cgc>Tgc	p.R761C		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	761	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGATGTGGCGGACGATCTCC	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		20033	0.001		0.0	False		,,,				2504	0.0					ENST00000292432.5	1.000000	0.820000	1.000000	0.950000	0.990000	0.981769	0.990000	1.000000																										0				47						c.(2281-2283)Cgc>Tgc		hexokinase 3 (white cell)							111.0	115.0	114.0					5																	176308805		2203	4300	6503	SO:0001583	missense	3101	3	121412	36				g.chr5:176308805G>A		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2281C>T	chr5.hg19:g.176308805G>A	ENSP00000292432:p.Arg761Cys	0						p.R761C	NM_002115.2	NP_002106.2	1	2	3	1.949770	P52790	HXK3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	17	2372	-	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	1	1	hg19	c.2281C>T	CCDS4407.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	17.39	3.377756	0.61735	.	.	ENSG00000160883	ENST00000292432	D	0.98987	-5.3	4.82	3.95	0.45737	4.82	3.95	0.45737	Hexokinase, C-terminal (1);	0.000000	0.53938	D	0.000048	D	0.99597	0.9854	H	0.99090	4.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97583	1.0112	10	0.87932	D	0	.	13.13	0.59375	0.0786:0.0:0.9214:0.0	.	761	P52790	HXK3_HUMAN	C	761	ENSP00000292432:R761C	ENSP00000292432:R761C	R	-	1	0	0	HK3	176241411	176241411	1.000000	0.71417	0.996000	0.52242	0.628000	0.37860	2.855000	0.48333	1.389000	0.46526	0.561000	0.74099	CGC	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.562	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	77	1	3.360000	-3.142702	1	0.220000			0	46	45	0	374	370	1		1	0		0	0	79	0	0	1.000000	5.054404e-01	0	0	0	15	0	46	374
HTR1A	3350	broad.mit.edu	37	5	63257304	63257304	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:63257304G>A	ENST00000323865.3	-	1	476	c.243C>T	c.(241-243)acC>acT	p.T81T	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	81					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	CCATGAGGTCGGTGACCGCCA	0.612																																						ENST00000323865.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										0				56						c.(241-243)acC>acT		5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)						42.0	47.0	45.0					5																	63257304		2203	4300	6503	SO:0001819	synonymous_variant	3350	1	121408	29				g.chr5:63257304G>A	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.243C>T	chr5.hg19:g.63257304G>A		0					RP11-158J3.2_ENST00000502882.1_RNA	p.T81T	NM_000524.3	NP_000515.2	1	2	3	1.953850	P08908	5HT1A_HUMAN		1	476	-		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)	Q6LAE7	Silent	SNP	ENST00000323865.3	1	1	hg19	c.243C>T	CCDS34168.1	1																																																																																								0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.612	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	3.360000	-20.000000	1	0.220000	NM_000524		0	26	26	0	87	84	1		1			0	0	34	0	0	1.000000	0	0	0	0	0	0	26	87
RASA1	5921	broad.mit.edu	37	5	86672813	86672813	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:86672813C>A	ENST00000274376.6	+	17	2864	c.2300C>A	c.(2299-2301)tCg>tAg	p.S767*	RASA1_ENST00000506290.1_Nonsense_Mutation_p.S601*|CTC-428H11.2_ENST00000607486.1_RNA|RASA1_ENST00000456692.2_Nonsense_Mutation_p.S590*|RASA1_ENST00000512763.1_Nonsense_Mutation_p.S600*	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	767	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		AAGCTTGAATCGTTGTTGTTA	0.383																																						ENST00000274376.6	1.000000	0.990000	1.000000	0.990000	0.990000	0.999946	0.990000	1.000000																										0				48						c.(2299-2301)tCg>tAg		RAS p21 protein activator (GTPase activating protein) 1							153.0	142.0	146.0					5																	86672813		2203	4300	6503	SO:0001587	stop_gained	5921	0	0					g.chr5:86672813C>A		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2300C>A	chr5.hg19:g.86672813C>A	ENSP00000274376:p.Ser767*	0					RASA1_ENST00000512763.1_Nonsense_Mutation_p.S600*|RASA1_ENST00000456692.2_Nonsense_Mutation_p.S590*|RASA1_ENST00000506290.1_Nonsense_Mutation_p.S601*|CTC-428H11.2_ENST00000607486.1_RNA	p.S767*	NM_002890.2	NP_002881.1	1	2	3	1.953850	P20936	RASA1_HUMAN		17	2864	+		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)	B2R6W3|Q9UDI1	Nonsense_Mutation	SNP	ENST00000274376.6	0	1	hg19	c.2300C>A	CCDS34200.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.861260	0.98531	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	.	.	.	5.52	5.52	0.82312	5.52	5.52	0.82312	.	0.056401	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	19.8119	0.96549	0.0:1.0:0.0:0.0	.	.	.	.	X	767;800;590;600;601	.	ENSP00000274376:S767X	S	+	2	0	0	RASA1	86708569	86708569	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.050000	0.71063	2.756000	0.94617	0.563000	0.77884	TCG	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.383	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	1	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	3.360000	-3.143560	1	0.220000	NM_002890		0	61	61	0	360	352	1		1	1		0	0	103	0	0	1.000000	9.250679e-01	0	5	0	23	0	61	360
GFPT2	9945	broad.mit.edu	37	5	179763567	179763567	+	Missense_Mutation	SNP	G	G	C			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			G	C	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr5:179763567G>C	ENST00000253778.8	-	3	295	c.126C>G	c.(124-126)atC>atG	p.I42M		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	42	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	TATTCCCATCGATCGCCACAC	0.473																																						ENST00000253778.8	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				34						c.(124-126)atC>atG		glutamine-fructose-6-phosphate transaminase 2	L-Glutamine(DB00130)						199.0	206.0	204.0					5																	179763567		2040	4201	6241	SO:0001583	missense	9945	0	0					g.chr5:179763567G>C	AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.126C>G	chr5.hg19:g.179763567G>C	ENSP00000253778:p.Ile42Met	0						p.I42M	NM_005110.2	NP_005101.1	1	2	3	1.949770	O94808	GFPT2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	3	295	-	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Q53XM2|Q9BWS4	Missense_Mutation	SNP	ENST00000253778.8	1	1	hg19	c.126C>G	CCDS43411.1	1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.910022	0.33721	.	.	ENSG00000131459	ENST00000253778	T	0.77489	-1.1	6.17	-5.21	0.02815	6.17	-5.21	0.02815	Glutamine amidotransferase, type II (1);Glutamine amidotransferase, class-II (1);	0.051024	0.85682	D	0.000000	D	0.83147	0.5191	M	0.79011	2.435	0.40542	D	0.981037	P	0.51449	0.945	P	0.57324	0.818	D	0.83771	0.0220	9	.	.	.	-28.7535	18.0332	0.89291	0.7778:0.0:0.2222:0.0	.	42	O94808	GFPT2_HUMAN	M	42	ENSP00000253778:I42M	.	I	-	3	3	3	GFPT2	179696173	179696173	0.002000	0.14202	0.243000	0.24186	0.061000	0.15899	-1.368000	0.02580	-1.095000	0.03050	-0.150000	0.13652	ATC	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.473	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	1	0	1	2	2	2	2	0	0	0	0	201	201	201	200	1	3.360000	-3.459961	1	0.220000	NM_005110		0	180	179	0	758	751	1		1	0		0	0	201	0	0	1.000000	9.986316e-01	0	0	0	43	0	180	758
COL11A2	1302	broad.mit.edu	37	6	33143391	33143391	+	Missense_Mutation	SNP	G	G	A	rs150877886	byFrequency	TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr6:33143391G>A	ENST00000374708.4	-	28	2336	c.2078C>T	c.(2077-2079)cCg>cTg	p.P693L	COL11A2_ENST00000361917.1_Missense_Mutation_p.P672L|COL11A2_ENST00000341947.2_Missense_Mutation_p.P779L|COL11A2_ENST00000374713.1_Missense_Mutation_p.P732L|COL11A2_ENST00000395197.1_Missense_Mutation_p.P719L|COL11A2_ENST00000374714.1_Missense_Mutation_p.P753L|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000357486.1_Missense_Mutation_p.P758L|COL11A2_ENST00000374712.1_Missense_Mutation_p.P698L	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	779	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GTCTCCAGTCGGTCCAGTGCG	0.647													G|||	11	0.00219649	0.0008	0.0	5008	,	,		19300	0.0		0.001	False		,,,				2504	0.0092				Melanoma(1;90 116 3946 5341 17093)	ENST00000374708.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				68						c.(2077-2079)cCg>cTg		collagen, type XI, alpha 2		G	LEU/PRO,LEU/PRO,LEU/PRO	2,3018		0,2,1508	108.0	93.0	98.0		2015,2336,2078	3.4	1.0	6	dbSNP_134	98	10,5408		0,10,2699	yes	missense,missense,missense	COL11A2	NM_080679.2,NM_080680.2,NM_080681.2	98,98,98	0,12,4207	AA,AG,GG		0.1846,0.0662,0.1422	probably-damaging,probably-damaging,probably-damaging	672/1630,779/1737,693/1651	33143391	12,8426	1510	2709	4219	SO:0001583	missense	1302	359	118344	58				g.chr6:33143391G>A	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2078C>T	chr6.hg19:g.33143391G>A	ENSP00000363840:p.Pro693Leu	0					COL11A2_ENST00000341947.2_Missense_Mutation_p.P779L|COL11A2_ENST00000374712.1_Missense_Mutation_p.P698L|COL11A2_ENST00000374714.1_Missense_Mutation_p.P753L|COL11A2_ENST00000395197.1_Missense_Mutation_p.P719L|COL11A2_ENST00000361917.1_Missense_Mutation_p.P672L|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000374713.1_Missense_Mutation_p.P732L|COL11A2_ENST00000357486.1_Missense_Mutation_p.P758L	p.P693L	NM_080681.2	NP_542412.2	1	2	3	1.971587	P13942	COBA2_HUMAN		28	2336	-			A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	ENST00000374708.4	1	0	hg19	c.2078C>T	CCDS43452.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.05	2.418368	0.42918	6.62E-4	0.001846	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	4.3	3.44	0.39384	4.3	3.44	0.39384	.	0.067235	0.64402	D	0.000012	D	0.83936	0.5362	L	0.37466	1.105	0.80722	D	1	P;P;P	0.50443	0.87;0.758;0.935	B;B;B	0.43867	0.434;0.307;0.334	T	0.81760	-0.0785	10	0.26408	T	0.33	.	10.4953	0.44775	0.0961:0.0:0.9039:0.0	.	672;693;779	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	L	693;779;758;753;732;719;698;672	ENSP00000363840:P693L;ENSP00000339915:P779L;ENSP00000350079:P758L;ENSP00000363846:P753L;ENSP00000363845:P732L;ENSP00000378623:P719L;ENSP00000363844:P698L;ENSP00000355123:P672L	ENSP00000339915:P779L	P	-	2	0	0	COL11A2	33251369	33251369	0.999000	0.42202	0.992000	0.48379	0.889000	0.51656	3.017000	0.49615	1.201000	0.43203	-0.350000	0.07774	CCG	0.297297		TCGA-YH-A8SY-01A-11D-A377-08	0.647	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2	1	0	1	2	2	2	2	0	0	0	0	25	25	25	25	1	3.360000	-2.441409	0	0.220000			0	50	50	0	164	161	1		1	0		0	0	25	0	0	1.000000	5.657962e-02	0	0	0	2	0	50	164
ACHE	43	broad.mit.edu	37	7	100491685	100491685	+	Missense_Mutation	SNP	C	C	T	rs17234982	byFrequency	TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr7:100491685C>T	ENST00000412389.1	-	1	324	c.169G>A	c.(169-171)Ggg>Agg	p.G57R	ACHE_ENST00000241069.5_Missense_Mutation_p.G57R|ACHE_ENST00000497647.1_5'Flank|ACHE_ENST00000411582.1_Missense_Mutation_p.G57R|ACHE_ENST00000419336.2_Missense_Mutation_p.G57R|ACHE_ENST00000302913.4_Missense_Mutation_p.G57R|ACHE_ENST00000428317.1_Missense_Mutation_p.G57R			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	57					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	ACAGGGCCCCCGGGGGTCTTC	0.701													C|||	14	0.00279553	0.0	0.0	5008	,	,		14079	0.001		0.0	False		,,,				2504	0.0133					ENST00000412389.1	1.000000	0.990000	1.000000	0.990000	0.990000	0.999957	0.990000	1.000000																										0				16						c.(169-171)Ggg>Agg		acetylcholinesterase (Yt blood group)	Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	C	ARG/GLY,ARG/GLY	0,4402		0,0,2201	19.0	24.0	22.0		169,169	4.0	0.0	7	dbSNP_123	22	2,8586		0,2,4292	yes	missense,missense	ACHE	NM_000665.3,NM_015831.2	125,125	0,2,6493	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	57/615,57/618	100491685	2,12988	2201	4294	6495	SO:0001583	missense	43	239	120996	48				g.chr7:100491685C>T		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.169G>A	chr7.hg19:g.100491685C>T	ENSP00000394976:p.Gly57Arg	1					ACHE_ENST00000497647.1_5'Flank|ACHE_ENST00000241069.5_Missense_Mutation_p.G57R|ACHE_ENST00000411582.1_Missense_Mutation_p.G57R|ACHE_ENST00000428317.1_Missense_Mutation_p.G57R|ACHE_ENST00000302913.4_Missense_Mutation_p.G57R|ACHE_ENST00000419336.2_Missense_Mutation_p.G57R	p.G57R			2	2	4	2.136248	P22303	ACES_HUMAN		1	324	-	Lung NSC(181;0.041)|all_lung(186;0.0581)		A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	ENST00000412389.1	1	1	hg19	c.169G>A	CCDS5709.1	1	3	0.0013736263736263737	2	0.0040650406504065045	0	0.0	1	0.0017482517482517483	0	0.0	c	9.302	1.053449	0.19907	0.0	2.33E-4	ENSG00000087085	ENST00000419336;ENST00000241069;ENST00000428317;ENST00000302913;ENST00000412389;ENST00000426415;ENST00000430554;ENST00000411582;ENST00000422451;ENST00000441605	T;T;T;T;T;T;T;T;T	0.67865	1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;-0.29	4.85	3.97	0.46021	4.85	3.97	0.46021	Carboxylesterase, type B (1);	0.245457	0.40222	N	0.001147	T	0.57902	0.2085	M	0.63169	1.94	0.34490	D	0.704821	B;B;B;B	0.28552	0.02;0.215;0.028;0.002	B;B;B;B	0.17433	0.004;0.018;0.004;0.003	T	0.66400	-0.5933	10	0.66056	D	0.02	.	6.5296	0.22320	0.1779:0.7276:0.0:0.0944	rs17234982	57;57;57;57	B7WPI6;P22303-3;P22303-2;P22303	.;.;.;ACES_HUMAN	R	57	ENSP00000403474:G57R;ENSP00000241069:G57R;ENSP00000414858:G57R;ENSP00000303211:G57R;ENSP00000394976:G57R;ENSP00000397143:G57R;ENSP00000399725:G57R;ENSP00000404865:G57R;ENSP00000396360:G57R	ENSP00000241069:G57R	G	-	1	0	0	ACHE	100329621	100329621	0.005000	0.15991	0.042000	0.18584	0.166000	0.22503	0.103000	0.15292	1.162000	0.42619	0.556000	0.70494	GGG	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.701	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	1	0	1	2	2	2	2	0	0	0	0	22	22	22	22	1	3.360000	-3.080742	1	0.220000	NM_015831		0	19	18	0	79	77	1		1	1		0	0	22	0	0	0.999994	2.606560e-01	0	2	0	3	0	19	79
COL28A1	340267	broad.mit.edu	37	7	7570984	7570984	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr7:7570984G>A	ENST00000399429.3	-	3	816	c.676C>T	c.(676-678)Cgt>Tgt	p.R226C		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	226	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CCTACCAGACGATCTTGAATT	0.373																																						ENST00000399429.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999992	0.990000	1.000000																										0				42						c.(676-678)Cgt>Tgt		collagen, type XXVIII, alpha 1							69.0	61.0	64.0					7																	7570984		1841	4088	5929	SO:0001583	missense	340267	2	120684	28				g.chr7:7570984G>A	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.676C>T	chr7.hg19:g.7570984G>A	ENSP00000382356:p.Arg226Cys	1						p.R226C	NM_001037763.2	NP_001032852.2	2	2	4	2.129864	Q2UY09	COSA1_HUMAN		3	816	-		Ovarian(82;0.0789)	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	1	1	hg19	c.676C>T	CCDS43553.1	1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239447	0.22711	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	T	0.55760	0.5	3.88	3.88	0.44766	3.88	3.88	0.44766	von Willebrand factor, type A (2);	0.303428	0.24176	U	0.040860	T	0.43366	0.1244	N	0.08118	0	0.18873	N	0.999983	D	0.64830	0.994	P	0.54965	0.765	T	0.30592	-0.9973	10	0.59425	D	0.04	-0.8455	10.5423	0.45039	0.0:0.0:0.8065:0.1935	.	226	Q2UY09	COSA1_HUMAN	C	226	ENSP00000382356:R226C	ENSP00000382347:R226C	R	-	1	0	0	COL28A1	7537509	7537509	0.326000	0.24669	0.825000	0.32803	0.038000	0.13279	0.862000	0.27899	2.183000	0.69458	0.655000	0.94253	CGT	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.373	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	3.360000	-20.000000	1	0.220000	NM_001037763		0	41	41	0	217	213	1		1			0	0	56	0	0	1.000000	0	0	0	0	0	0	41	217
GARS	2617	broad.mit.edu	37	7	30656770	30656770	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr7:30656770G>A	ENST00000389266.3	+	10	1476	c.1235G>A	c.(1234-1236)cGc>cAc	p.R412H		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	412					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.R412H(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	TTCATTGGCCGCATCTACCTC	0.433																																						ENST00000389266.3	0.240000	0.040000	0.180000	0.070000	0.120000	0.134416	0.120000	0.120000																										1	Substitution - Missense(1)	p.R412H(1)	large_intestine(1)	24						c.(1234-1236)cGc>cAc		glycyl-tRNA synthetase	Glycine(DB00145)						179.0	167.0	171.0					7																	30656770		1932	4138	6070	SO:0001583	missense	2617	0	0					g.chr7:30656770G>A	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.1235G>A	chr7.hg19:g.30656770G>A	ENSP00000373918:p.Arg412His	1						p.R412H	NM_002047.2	NP_002038.2	2	2	4	2.129864	P41250	SYG_HUMAN		10	1476	+			B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	0	1	hg19	c.1235G>A	CCDS43564.1	0	.	.	.	.	.	.	.	.	.	.	G	34	5.303525	0.95601	.	.	ENSG00000106105	ENST00000389266	T	0.79247	-1.25	5.22	5.22	0.72569	5.22	5.22	0.72569	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.89525	0.6740	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91138	0.4943	10	0.87932	D	0	-10.2399	16.6573	0.85232	0.0:0.0:1.0:0.0	.	412	P41250	SYG_HUMAN	H	412	ENSP00000373918:R412H	ENSP00000373918:R412H	R	+	2	0	0	GARS	30623295	30623295	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.827000	0.99397	2.603000	0.88011	0.557000	0.71058	CGC	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.433	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	0	0	1	2	2	2	2	0	0	0	0	109	109	109	108	1	3.360000	-1.956203	0	0.220000	NM_002047		0	6	5	0	568	564	0		1	0		0	0	109	0	0	0.964168	4.950395e-01	0	0	0	143	0	6	568
SEMA3E	9723	broad.mit.edu	37	7	83029563	83029563	+	Missense_Mutation	SNP	C	C	T	rs373711827		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr7:83029563C>T	ENST00000307792.3	-	11	1614	c.1147G>A	c.(1147-1149)Gcc>Acc	p.A383T	SEMA3E_ENST00000427262.1_Missense_Mutation_p.A323T	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	383	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				ACTTTGCTGGCACACTGAAAA	0.373																																						ENST00000307792.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999997	0.990000	1.000000																										0				51						c.(1147-1149)Gcc>Acc		sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E							132.0	123.0	126.0					7																	83029563		2203	4300	6503	SO:0001583	missense	9723	0	0					g.chr7:83029563C>T	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1147G>A	chr7.hg19:g.83029563C>T	ENSP00000303212:p.Ala383Thr	1					SEMA3E_ENST00000427262.1_Missense_Mutation_p.A323T	p.A383T	NM_012431.2	NP_036563.1	2	2	4	2.129864	O15041	SEM3E_HUMAN		11	1614	-		Medulloblastoma(109;0.109)	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	1	1	hg19	c.1147G>A	CCDS34674.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038932	0.75617	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.22945	1.93;1.93	5.52	4.62	0.57501	5.52	4.62	0.57501	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.42899	0.1223	L	0.58354	1.805	0.58432	D	0.999999	P	0.50617	0.937	P	0.56865	0.808	T	0.32693	-0.9897	10	0.49607	T	0.09	.	16.1726	0.81828	0.0:0.8664:0.1336:0.0	.	383	O15041	SEM3E_HUMAN	T	383;323;383	ENSP00000303212:A383T;ENSP00000405052:A323T	ENSP00000303212:A383T	A	-	1	0	0	SEMA3E	82867499	82867499	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	2.836000	0.48183	1.282000	0.44496	0.585000	0.79938	GCC	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.373	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	1	0	1	2	2	2	2	0	0	0	0	115	115	115	114	1	3.360000	-20.000000	1	0.220000	NM_012431		0	54	54	0	300	298	0		1			0	0	115	0	0	1.000000	0	0	0	0	0	0	54	300
WEE2	494551	broad.mit.edu	37	7	141418884	141418884	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr7:141418884C>T	ENST00000397541.2	+	4	1004	c.598C>T	c.(598-600)Cga>Tga	p.R200*	WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000459753.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	200					female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					ATGTGTTTTACGAGAAACCAA	0.343																																						ENST00000397541.2	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				31						c.(598-600)Cga>Tga		WEE1 homolog 2 (S. pombe)							90.0	88.0	88.0					7																	141418884		1797	4063	5860	SO:0001587	stop_gained	494551	3	120776	37				g.chr7:141418884C>T	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.598C>T	chr7.hg19:g.141418884C>T	ENSP00000380675:p.Arg200*	1					WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000488785.1_RNA	p.R200*	NM_001105558.1	NP_001099028.1	2	2	4	2.136248	P0C1S8	WEE2_HUMAN		4	1004	+	Melanoma(164;0.0171)			Nonsense_Mutation	SNP	ENST00000397541.2	0	1	hg19	c.598C>T	CCDS43660.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.074404	0.98640	.	.	ENSG00000214102	ENST00000397541	.	.	.	5.52	4.53E-4	0.14042	5.52	4.53E-4	0.14042	.	0.719074	0.11076	U	0.602382	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8902	0.58068	0.3292:0.5127:0.1582:0.0	.	.	.	.	X	200	.	ENSP00000380675:R200X	R	+	1	2	2	WEE2	141065353	141065353	0.837000	0.29446	0.491000	0.27477	0.937000	0.57800	0.581000	0.23819	0.007000	0.14760	-1.367000	0.01198	CGA	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.343	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	1	0	1	2	2	2	2	0	0	0	0	132	132	132	131	1	3.360000	-20.000000	1	0.220000	NM_001105558		0	116	115	0	529	524	1		1			0	0	132	0	0	1.000000	0	0	0	0	0	0	116	529
ZFHX4	79776	broad.mit.edu	37	8	77617904	77617904	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr8:77617904G>A	ENST00000521891.2	+	2	2029	c.1581G>A	c.(1579-1581)gcG>gcA	p.A527A	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Silent_p.A527A|ZFHX4_ENST00000455469.2_Silent_p.A527A|ZFHX4_ENST00000050961.6_Silent_p.A527A	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CCTCCTCGGCGACTGTTTCTG	0.433										HNSCC(33;0.089)																												ENST00000521891.2	1.000000	0.810000	1.000000	0.990000	0.990000	0.984429	0.990000	1.000000																										0				432						c.(1579-1581)gcG>gcA		zinc finger homeobox 4							40.0	40.0	40.0					8																	77617904		1963	4156	6119	SO:0001819	synonymous_variant	79776	0	0					g.chr8:77617904G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1581G>A	chr8.hg19:g.77617904G>A		1	HNSCC(33;0.089)				ZFHX4_ENST00000518282.1_Silent_p.A527A|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Silent_p.A527A|ZFHX4_ENST00000455469.2_Silent_p.A527A	p.A527A	NM_024721.4	NP_078997.4	2	2	4	2.150082	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)	2	2029	+			G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	1	1	hg19	c.1581G>A	CCDS47878.2	1																																																																																								0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.433	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	1	0	1	2	2	2	2	0	0	0	0	45	45	45	45	1	3.360000	-3.142725	1	0.220000	NM_024721		0	27	27	0	225	222	1		1			0	0	45	0	0	1.000000	0	0	0	0	0	0	27	225
PLEC	5339	broad.mit.edu	37	8	144994097	144994097	+	Missense_Mutation	SNP	G	G	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr8:144994097G>T	ENST00000322810.4	-	32	10472	c.10303C>A	c.(10303-10305)Ctg>Atg	p.L3435M	PLEC_ENST00000398774.2_Missense_Mutation_p.L3266M|PLEC_ENST00000354589.3_Missense_Mutation_p.L3298M|PLEC_ENST00000357649.2_Missense_Mutation_p.L3302M|PLEC_ENST00000354958.2_Missense_Mutation_p.L3276M|PLEC_ENST00000527096.1_Missense_Mutation_p.L3321M|PLEC_ENST00000436759.2_Missense_Mutation_p.L3325M|PLEC_ENST00000356346.3_Missense_Mutation_p.L3284M|PLEC_ENST00000345136.3_Missense_Mutation_p.L3298M	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3435	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TCCTGCCGCAGGGTCTCCACC	0.637																																						ENST00000322810.4	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				137						c.(10303-10305)Ctg>Atg		plectin							58.0	67.0	64.0					8																	144994097		2162	4256	6418	SO:0001583	missense	5339	0	0					g.chr8:144994097G>T	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10303C>A	chr8.hg19:g.144994097G>T	ENSP00000323856:p.Leu3435Met	1					PLEC_ENST00000436759.2_Missense_Mutation_p.L3325M|PLEC_ENST00000354589.3_Missense_Mutation_p.L3298M|PLEC_ENST00000527096.1_Missense_Mutation_p.L3321M|PLEC_ENST00000357649.2_Missense_Mutation_p.L3302M|PLEC_ENST00000354958.2_Missense_Mutation_p.L3276M|PLEC_ENST00000345136.3_Missense_Mutation_p.L3298M|PLEC_ENST00000356346.3_Missense_Mutation_p.L3284M|PLEC_ENST00000398774.2_Missense_Mutation_p.L3266M	p.L3435M	NM_201380.2	NP_958782.1	2	2	4	2.169004	Q15149	PLEC_HUMAN		32	10472	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	1	1	hg19	c.10303C>A	CCDS43772.1	1	.	.	.	.	.	.	.	.	.	.	G	8.254	0.809766	0.16537	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76968	-1.02;-1.02;-1.06;-1.05;-1.04;-1.02;-1.02;-1.02;-1.02	4.81	-4.87	0.03123	4.81	-4.87	0.03123	.	1.138360	0.06912	U	0.807848	T	0.57636	0.2067	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B	0.23591	0.088;0.088;0.088;0.053;0.088;0.088;0.088;0.088	B;B;B;B;B;B;B;B	0.29598	0.086;0.104;0.104;0.039;0.104;0.086;0.086;0.086	T	0.52200	-0.8607	10	0.52906	T	0.07	.	8.9149	0.35576	0.0:0.121:0.2943:0.5847	.	3325;3284;3276;3435;3266;3298;3302;3298	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	M	3298;3302;3298;3266;3435;3276;3284;3325;3321	ENSP00000344848:L3298M;ENSP00000350277:L3302M;ENSP00000346602:L3298M;ENSP00000381756:L3266M;ENSP00000323856:L3435M;ENSP00000347044:L3276M;ENSP00000348702:L3284M;ENSP00000388180:L3325M;ENSP00000434583:L3321M	ENSP00000323856:L3435M	L	-	1	2	2	PLEC	145066085	145066085	0.000000	0.05858	0.000000	0.03702	0.944000	0.59088	0.834000	0.27518	-0.457000	0.07033	0.448000	0.29417	CTG	0.360656		TCGA-YH-A8SY-01A-11D-A377-08	0.637	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	1	0	1	2	2	2	2	0	0	0	0	64	64	64	64	1	3.360000	-3.394676	1	0.220000	NM_000445		0	78	77	0	320	317	1		1	1		0	0	64	0	0	1.000000	1	0	98	0	242	0	78	320
CD72	971	broad.mit.edu	37	9	35616044	35616044	+	Missense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr9:35616044G>A	ENST00000396757.1	-	6	748	c.584C>T	c.(583-585)aCg>aTg	p.T195M	CD72_ENST00000259633.4_Missense_Mutation_p.T195M|CD72_ENST00000490239.1_5'UTR			P21854	CD72_HUMAN	CD72 molecule	195					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGTCTCCTTCGTCTTCTGTCT	0.577																																						ENST00000396757.1	0.200000	0.030000	0.150000	0.060000	0.090000	0.109606	0.090000	0.100000																										0				12						c.(583-585)aCg>aTg		CD72 molecule							212.0	182.0	192.0					9																	35616044		2203	4300	6503	SO:0001583	missense	971	3	121412	40				g.chr9:35616044G>A		CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.584C>T	chr9.hg19:g.35616044G>A	ENSP00000379980:p.Thr195Met	1					CD72_ENST00000259633.4_Missense_Mutation_p.T195M|CD72_ENST00000490239.1_5'UTR	p.T195M			0	2	2	1.772823	P21854	CD72_HUMAN	Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)	6	748	-				Missense_Mutation	SNP	ENST00000396757.1	0	1	hg19	c.584C>T	CCDS6581.1	0	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709706	0.48517	.	.	ENSG00000137101	ENST00000396757;ENST00000396759;ENST00000259633	T;T	0.61627	0.09;0.09	5.14	2.28	0.28536	5.14	2.28	0.28536	.	0.467428	0.19886	N	0.103850	T	0.68357	0.2992	M	0.69823	2.125	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.68765	0.96;0.96	T	0.56511	-0.7967	10	0.59425	D	0.04	-5.2731	6.2975	0.21095	0.3715:0.0:0.6285:0.0	.	195;195	Q5TLG3;P21854	.;CD72_HUMAN	M	195	ENSP00000379980:T195M;ENSP00000259633:T195M	ENSP00000259633:T195M	T	-	2	0	0	CD72	35606044	35606044	0.001000	0.12720	0.056000	0.19401	0.029000	0.11900	0.385000	0.20685	0.569000	0.29329	0.491000	0.48974	ACG	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.577	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052336.1	0	0	1	2	2	2	2	0	0	0	0	96	96	96	94	1	3.360000	-2.799745	1	0.220000	NM_001782		0	5	5	0	487	481	0		1	0		0	0	96	0	0	0.935803	1.662923e-03	0	0	0	5	0	5	487
PHF19	26147	broad.mit.edu	37	9	123636876	123636876	+	Silent	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chr9:123636876G>A	ENST00000373896.3	-	2	396	c.144C>T	c.(142-144)tgC>tgT	p.C48C	PHF19_ENST00000312189.6_Silent_p.C48C	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	48	Tudor.				chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTGTCCACCGGCACAGCACAT	0.557																																						ENST00000373896.3	0.270000	0.040000	0.200000	0.080000	0.130000	0.146379	0.130000	0.120000																										0				19						c.(142-144)tgC>tgT		PHD finger protein 19							108.0	100.0	103.0					9																	123636876		2203	4300	6503	SO:0001819	synonymous_variant	26147	0	0					g.chr9:123636876G>A	BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.144C>T	chr9.hg19:g.123636876G>A		1					PHF19_ENST00000312189.6_Silent_p.C48C	p.C48C	NM_015651.1	NP_056466.1	0	2	2	1.772823	Q5T6S3	PHF19_HUMAN		2	396	-			Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Silent	SNP	ENST00000373896.3	0	1	hg19	c.144C>T	CCDS35116.1	0																																																																																								0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.557	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053838.3	0	0	1	2	2	2	2	0	0	0	0	79	79	79	76	1	3.360000	-2.550046	1	0.220000	XM_045308		0	5	5	0	362	355	0		1	0		0	0	79	0	0	0.934742	1.768193e-01	0	0	0	46	0	5	362
AMOT	154796	broad.mit.edu	37	X	112048243	112048243	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chrX:112048243G>A	ENST00000524145.1	-	6	1782	c.1708C>T	c.(1708-1710)Cga>Tga	p.R570*	AMOT_ENST00000371962.1_Nonsense_Mutation_p.R338*|AMOT_ENST00000304758.1_Nonsense_Mutation_p.R161*|AMOT_ENST00000371959.3_Nonsense_Mutation_p.R570*|AMOT_ENST00000371958.1_Nonsense_Mutation_p.R338*			Q4VCS5	AMOT_HUMAN	angiomotin	570					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TCGATGTGTCGTCTTTGGTCC	0.512																																						ENST00000524145.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				43						c.(1708-1710)Cga>Tga		angiomotin							282.0	234.0	250.0					X																	112048243		2203	4300	6503	SO:0001587	stop_gained	154796	0	0					g.chrX:112048243G>A	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1708C>T	chrX.hg19:g.112048243G>A	ENSP00000429013:p.Arg570*						AMOT_ENST00000304758.1_Nonsense_Mutation_p.R161*|AMOT_ENST00000371962.1_Nonsense_Mutation_p.R338*|AMOT_ENST00000371959.3_Nonsense_Mutation_p.R570*|AMOT_ENST00000371958.1_Nonsense_Mutation_p.R338*	p.R570*			0	1	1		Q4VCS5	AMOT_HUMAN		6	1782	-			Q504X5|Q9HD27|Q9UPT1	Nonsense_Mutation	SNP	ENST00000524145.1	0	1	hg19	c.1708C>T	CCDS48154.1	1	.	.	.	.	.	.	.	.	.	.	g	39	7.434134	0.98282	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	.	.	.	5.96	4.17	0.49024	5.96	4.17	0.49024	.	0.054811	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.5027	12.9983	0.58660	0.0:0.0:0.4395:0.5605	.	.	.	.	X	161;570;338;570;338	.	ENSP00000305557:R161X	R	-	1	2	2	AMOT	111934899	111934899	0.999000	0.42202	0.985000	0.45067	0.996000	0.88848	2.872000	0.48467	0.623000	0.30267	0.597000	0.82753	CGA	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.512	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	1	0	1	2	2	2	2	0	0	0	0	150	150	150	148	1	3.360000	-20.000000	1	0.220000	NM_133265		0	167	165	0	881	870	0		1	0		0	0	150	0	0	1.000000	1.229260e-01	0	0	0	4	0	167	881
FRMPD4	9758	broad.mit.edu	37	X	12516909	12516909	+	Missense_Mutation	SNP	T	T	C			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chrX:12516909T>C	ENST00000380682.1	+	2	658	c.152T>C	c.(151-153)tTc>tCc	p.F51S		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	51	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						CGAGACTACTTCATCAAGTAG	0.488																																						ENST00000380682.1	1.000000	0.970000	1.000000	0.990000	0.990000	0.997869	0.990000	1.000000																										0				22						c.(151-153)tTc>tCc		FERM and PDZ domain containing 4							80.0	69.0	73.0					X																	12516909		2203	4300	6503	SO:0001583	missense	9758	0	0					g.chrX:12516909T>C	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.152T>C	chrX.hg19:g.12516909T>C	ENSP00000370057:p.Phe51Ser							p.F51S	NM_014728.3	NP_055543.2	0	1	1		Q14CM0	FRPD4_HUMAN		2	658	+			A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	1	1	hg19	c.152T>C	CCDS35201.1	1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.981669	0.53827	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.13657	2.57	5.13	5.13	0.70059	5.13	5.13	0.70059	WW/Rsp5/WWP (2);PDZ/DHR/GLGF (1);	0.281292	0.34200	N	0.004165	T	0.25865	0.0630	M	0.89287	3.02	0.42617	D	0.993335	B;B	0.18013	0.025;0.025	B;B	0.18561	0.022;0.022	T	0.10451	-1.0629	10	0.87932	D	0	.	14.3389	0.66611	0.0:0.0:0.0:1.0	.	43;51	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	S	51;42;40	ENSP00000370057:F51S	ENSP00000304583:F40S	F	+	2	0	0	FRMPD4	12426830	12426830	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.718000	0.54919	1.834000	0.53371	0.486000	0.48141	TTC	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.488	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	1	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	3.360000	-20.000000	1	0.220000	XM_045712		0	42	42	0	249	247	1		1			0	0	30	0	0	1.000000	0	0	0	0	0	0	42	249
NKRF	55922	broad.mit.edu	37	X	118725258	118725258	+	Nonsense_Mutation	SNP	T	T	A			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chrX:118725258T>A	ENST00000371527.1	-	2	782	c.130A>T	c.(130-132)Aaa>Taa	p.K44*	NKRF_ENST00000542113.1_Nonsense_Mutation_p.K59*|NKRF_ENST00000487600.1_5'UTR|NKRF_ENST00000304449.5_Nonsense_Mutation_p.K44*	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	44	Active repression domain.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						GCTTGCTTTTTAGGAGGATTT	0.353																																						ENST00000371527.1	1.000000	0.990000	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										0				30						c.(130-132)Aaa>Taa		NFKB repressing factor							62.0	62.0	62.0					X																	118725258		2203	4300	6503	SO:0001587	stop_gained	55922	0	0					g.chrX:118725258T>A	AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.130A>T	chrX.hg19:g.118725258T>A	ENSP00000360582:p.Lys44*						NKRF_ENST00000542113.1_Nonsense_Mutation_p.K59*|NKRF_ENST00000487600.1_5'UTR|NKRF_ENST00000304449.5_Nonsense_Mutation_p.K44*	p.K44*	NM_001173488.1	NP_001166959.1	0	1	1		O15226	NKRF_HUMAN		2	782	-			G3V1N1|Q4VC41|Q9UJ91	Nonsense_Mutation	SNP	ENST00000371527.1	0	1	hg19	c.130A>T	CCDS35375.1	1	.	.	.	.	.	.	.	.	.	.	T	38	6.702982	0.97776	.	.	ENSG00000186416	ENST00000371527;ENST00000304449;ENST00000542113	.	.	.	5.41	5.41	0.78517	5.41	5.41	0.78517	.	0.288673	0.39020	N	0.001490	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.1562	12.1414	0.54000	0.0:0.0:0.0:1.0	.	.	.	.	X	44;44;59	.	ENSP00000304803:K44X	K	-	1	0	0	NKRF	118609286	118609286	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.298000	0.59067	1.800000	0.52685	0.486000	0.48141	AAA	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.353	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058044.1	1	0	1	2	2	2	2	0	0	0	0	133	133	133	129	1	3.360000	-20.000000	1	0.220000	NM_017544		0	100	98	0	497	489	1		1	0		0	0	133	0	0	1.000000	6.673818e-01	0	0	0	13	0	100	497
TFDP3	51270	broad.mit.edu	37	X	132351883	132351883	+	Silent	SNP	G	G	A	rs369336277		TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chrX:132351883G>A	ENST00000310125.4	-	1	493	c.405C>T	c.(403-405)ggC>ggT	p.G135G		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	135					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G135G(1)|p.G75G(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					CGACCAGCTCGCCCACCACTT	0.552																																						ENST00000310125.4	1.000000	0.990000	1.000000	0.990000	0.990000	0.999999	0.990000	1.000000																										2	Substitution - coding silent(2)	p.G135G(1)|p.G75G(1)	kidney(2)	19						c.(403-405)ggC>ggT		transcription factor Dp family, member 3							83.0	77.0	79.0					X																	132351883		2200	4298	6498	SO:0001819	synonymous_variant	51270	2	121394	36				g.chrX:132351883G>A	AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.405C>T	chrX.hg19:g.132351883G>A								p.G135G	NM_016521.2	NP_057605.3	0	1	1		Q5H9I0	TFDP3_HUMAN		1	493	-	Acute lymphoblastic leukemia(192;0.000127)		Q6DK49|Q9NZ54	Silent	SNP	ENST00000310125.4	1	1	hg19	c.405C>T	CCDS14636.2	1																																																																																								0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.552	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	1	0	1	2	2	2	2	0	0	0	0	70	70	70	68	1	3.360000	-20.000000	1	0.220000	NM_016521		0	75	74	0	354	336	1		1			0	0	70	0	0	1.000000	0	0	0	0	0	0	75	354
DUSP9	1852	broad.mit.edu	37	X	152915638	152915638	+	Missense_Mutation	SNP	C	C	T			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chrX:152915638C>T	ENST00000342782.3	+	4	1298	c.1033C>T	c.(1033-1035)Cgg>Tgg	p.R345W	DUSP9_ENST00000370167.4_Missense_Mutation_p.R345W			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	345	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCGCAGCTTGCGGCTGGAGGA	0.612																																						ENST00000342782.3	0.140000	0.020000	0.110000	0.040000	0.070000	0.080391	0.070000	0.070000																										0				16						c.(1033-1035)Cgg>Tgg		dual specificity phosphatase 9							139.0	123.0	128.0					X																	152915638		2203	4300	6503	SO:0001583	missense	1852	0	0					g.chrX:152915638C>T	Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.1033C>T	chrX.hg19:g.152915638C>T	ENSP00000345853:p.Arg345Trp						DUSP9_ENST00000370167.4_Missense_Mutation_p.R345W	p.R345W			0	1	1		Q99956	DUS9_HUMAN		4	1298	+	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		D3DWU5	Missense_Mutation	SNP	ENST00000342782.3	0	1	hg19	c.1033C>T	CCDS14724.1	0	.	.	.	.	.	.	.	.	.	.	c	13.51	2.258205	0.39896	.	.	ENSG00000130829	ENST00000370167;ENST00000342782	T;T	0.61274	0.12;0.12	4.53	2.62	0.31277	4.53	2.62	0.31277	Dual specificity phosphatase, subgroup, catalytic domain (1);	1.080270	0.07212	N	0.859447	T	0.55705	0.1937	M	0.73319	2.225	0.40260	D	0.978167	D	0.58268	0.982	B	0.41412	0.356	T	0.55192	-0.8179	10	0.66056	D	0.02	.	5.9303	0.19134	0.4195:0.3277:0.2528:0.0	.	345	Q99956	DUS9_HUMAN	W	345	ENSP00000359186:R345W;ENSP00000345853:R345W	ENSP00000345853:R345W	R	+	1	2	2	DUSP9	152568832	152568832	1.000000	0.71417	0.272000	0.24630	0.422000	0.31414	2.428000	0.44749	0.422000	0.26005	-0.263000	0.10527	CGG	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.612	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061022.3	0	0	1	2	2	2	2	0	0	0	0	136	136	136	131	1	3.360000	-2.041577	0	0.220000	NM_001395		0	7	7	0	892	878	0		1	0		0	0	136	0	0	0.979502	2.373203e-03	0	0	0	8	0	7	892
FLNA	2316	broad.mit.edu	37	X	153593084	153593084	+	Missense_Mutation	SNP	A	A	G			TCGA-YH-A8SY-01A-11D-A377-08	TCGA-YH-A8SY-10A-01D-A37A-08			A	G	A	A		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3dc82cb2-1730-46ca-b5e1-4dbb57bd5f75	20866917-ab2f-4c68-9874-ea8be01bd72b	g.chrX:153593084A>G	ENST00000369850.3	-	13	2068	c.1832T>C	c.(1831-1833)tTc>tCc	p.F611S	FLNA_ENST00000360319.4_Missense_Mutation_p.F611S|FLNA_ENST00000344736.4_Missense_Mutation_p.F611S|FLNA_ENST00000422373.1_Missense_Mutation_p.F611S	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	611					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTCCACCGAGAAGCCTGACAA	0.642																																						ENST00000369850.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999610	0.990000	1.000000																										0				6						c.(1831-1833)tTc>tCc		filamin A, alpha							80.0	89.0	86.0					X																	153593084		2162	4231	6393	SO:0001583	missense	2316	0	0					g.chrX:153593084A>G	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1832T>C	chrX.hg19:g.153593084A>G	ENSP00000358866:p.Phe611Ser						FLNA_ENST00000422373.1_Missense_Mutation_p.F611S|FLNA_ENST00000344736.4_Missense_Mutation_p.F611S|FLNA_ENST00000360319.4_Missense_Mutation_p.F611S	p.F611S	NM_001110556.1	NP_001104026.1	0	1	1		P21333	FLNA_HUMAN		13	2068	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	1	1	hg19	c.1832T>C	CCDS48194.1	1	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750803	0.69533	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.91843	-1.86;-1.86;-2.92;-2.92	4.86	4.86	0.63082	4.86	4.86	0.63082	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	D	0.96519	0.8864	M	0.90252	3.1	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.97110	1.0;0.955	D	0.97193	0.9859	10	0.87932	D	0	.	13.6752	0.62449	1.0:0.0:0.0:0.0	.	611;611	P21333-2;P21333	.;FLNA_HUMAN	S	611;584;611;611;611	ENSP00000353467:F611S;ENSP00000416926:F611S;ENSP00000358866:F611S;ENSP00000358863:F611S	ENSP00000358863:F611S	F	-	2	0	0	FLNA	153246278	153246278	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	9.336000	0.96533	1.602000	0.50124	0.427000	0.28365	TTC	0.220000		TCGA-YH-A8SY-01A-11D-A377-08	0.642	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3	1	0	1	2	2	2	2	0	0	0	0	100	100	100	98	1	3.360000	-20.000000	1	0.220000			0	65	65	0	379	372	1		1	0		0	0	100	0	0	1.000000	1	0	0	0	323	0	65	379
