#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
RELN	5649	broad.mit.edu	37	7	103180786	103180786	+	Frame_Shift_Del	DEL	T	T	-			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:103180786delT	ENST00000428762.1	-	44	6947	c.6788delA	c.(6787-6789)gagfs	p.E2263fs	RELN_ENST00000343529.5_Frame_Shift_Del_p.E2263fs|RELN_ENST00000424685.2_Frame_Shift_Del_p.E2263fs	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2263					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GAAAAGGAACTCCTGAAGAAG	0.542																																					NSCLC(146;835 1944 15585 22231 52158)	ENST00000428762.1	0.620000	3.300000e-01	0.550000	3.900000e-01	0.460000	0.475535	0.460000	0.480000																										0				227						c.(6787-6789)gagfs		reelin							103.0	100.0	101.0					7																	103180786		2203	4300	6503	SO:0001589	frameshift_variant	5649	0	0					g.chr7:103180786delT		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6788delA	chr7.hg19:g.103180786delT	ENSP00000392423:p.Glu2263fs	0					RELN_ENST00000343529.5_Frame_Shift_Del_p.E2263fs|RELN_ENST00000424685.2_Frame_Shift_Del_p.E2263fs	p.E2263fs	NM_005045.3	NP_005036.2	2	2	4	2.097417	P78509	RELN_HUMAN		44	6947	-			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Frame_Shift_Del	DEL	ENST00000428762.1	0	1	hg19	c.6788delA	CCDS47680.1	0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.542	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	1	0	1		2			0	0	0	0	94	0	94	90	1	3.730000	-3.017764	1	0.550000	NM_005045		0	37	37	0	411	405	0	0	1			0	0	94	0	0	1.000000			0	0	0	0	37	411
INA	9118	broad.mit.edu	37	10	105037160	105037160	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:105037160G>A	ENST00000369849.4	+	1	241	c.192G>A	c.(190-192)ctG>ctA	p.L64L		NM_032727.3	NP_116116.1	Q16352	AINX_HUMAN	internexin neuronal intermediate filament protein, alpha	64	Head.				cell differentiation (GO:0030154)|neurofilament cytoskeleton organization (GO:0060052)|substantia nigra development (GO:0021762)	cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular space (GO:0005615)|neurofilament (GO:0005883)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)	13				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		GCCTCGGCCTGGCCTATCGCC	0.741																																						ENST00000369849.4	1.000000	8.400000e-01	1.000000	9.900000e-01	0.990000	0.989482	0.990000	1.000000																										0				13						c.(190-192)ctG>ctA		internexin neuronal intermediate filament protein, alpha							8.0	10.0	9.0					10																	105037160		1987	4030	6017	SO:0001819	synonymous_variant	9118	0	0					g.chr10:105037160G>A	S78296	CCDS7545.1	10q24	2013-01-16			ENSG00000148798	ENSG00000148798		"""Intermediate filaments type IV"""	6057	protein-coding gene	gene with protein product		605338		NEF5		7769995	Standard	NM_032727		Approved	NF-66	uc001kws.3	Q16352	OTTHUMG00000018986	ENST00000369849.4:c.192G>A	chr10.hg19:g.105037160G>A		1						p.L64L	NM_032727.3	NP_116116.1	2	2	4	2.139192	Q16352	AINX_HUMAN		1	241	+			B1AQK0|Q9BRC5	Silent	SNP	ENST00000369849.4	1	1	hg19	c.192G>A	CCDS7545.1	1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.741	INA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050145.1	1	0	1	2	2	2	2	0	0	0	0	16	16	16	16	1	3.730000	-20.000000	1	0.550000	NM_032727		0	18	17	0	60	58	0		1			0	0	16	0	0	0.999989	0	0	0	0	0	0	18	60
ATRNL1	26033	broad.mit.edu	37	10	117226743	117226743	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:117226743G>A	ENST00000355044.3	+	23	3603	c.3477G>A	c.(3475-3477)acG>acA	p.T1159T	ATRNL1_ENST00000423111.2_Silent_p.T210T|ATRNL1_ENST00000303745.7_Intron	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1159					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TCAACATTACGTGGTCTGTCG	0.294																																						ENST00000355044.3	0.500000	2.100000e-01	0.420000	2.700000e-01	0.340000	0.351850	0.340000	0.330000																										0				95						c.(3475-3477)acG>acA		attractin-like 1							130.0	125.0	127.0					10																	117226743		2202	4296	6498	SO:0001819	synonymous_variant	26033	0	0					g.chr10:117226743G>A	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3477G>A	chr10.hg19:g.117226743G>A		1					ATRNL1_ENST00000303745.7_Intron|ATRNL1_ENST00000423111.2_Silent_p.T210T	p.T1159T	NM_207303.2	NP_997186.1	2	2	4	2.139192	Q5VV63	ATRN1_HUMAN		23	3603	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	1	1	hg19	c.3477G>A	CCDS7592.1	0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.294	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	1	0	1	2	15	2	2	0	0	0	1	80	80	80	78	1	3.730000	-19.999080	1	0.550000	XM_049349		0	20	19	0	314	307	0		1			0	0	80	0	0	0.831260	0	0	0	0	0	0	20	314
PNLIPRP3	119548	broad.mit.edu	37	10	118203960	118203960	+	Missense_Mutation	SNP	A	A	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:118203960A>C	ENST00000369230.3	+	4	537	c.391A>C	c.(391-393)Atc>Ctc	p.I131L		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	131					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		ACGGGAATACATCCATGCTGT	0.318																																						ENST00000369230.3	0.190000	4.000000e-02	0.150000	7.000000e-02	0.100000	0.113513	0.100000	0.120000																										0				50						c.(391-393)Atc>Ctc		pancreatic lipase-related protein 3							169.0	160.0	163.0					10																	118203960		2203	4300	6503	SO:0001583	missense	119548	0	0					g.chr10:118203960A>C	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.391A>C	chr10.hg19:g.118203960A>C	ENSP00000358232:p.Ile131Leu	1						p.I131L	NM_001011709.2	NP_001011709.2	2	2	4	2.139192	Q17RR3	LIPR3_HUMAN		4	537	+				Missense_Mutation	SNP	ENST00000369230.3	0	1	hg19	c.391A>C	CCDS31292.1	0	.	.	.	.	.	.	.	.	.	.	A	13.04	2.117608	0.37339	.	.	ENSG00000203837	ENST00000369230	D	0.90620	-2.7	5.28	-0.352	0.12598	5.28	-0.352	0.12598	Lipase, N-terminal (1);	0.753542	0.11427	N	0.565260	T	0.82070	0.4957	L	0.33668	1.02	0.09310	N	1	B	0.11235	0.004	B	0.15052	0.012	T	0.69435	-0.5146	10	0.66056	D	0.02	.	2.765	0.05317	0.6175:0.1526:0.1158:0.114	.	131	Q17RR3	LIPR3_HUMAN	L	131	ENSP00000358232:I131L	ENSP00000358232:I131L	I	+	1	0	0	PNLIPRP3	118193950	118193950	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	0.284000	0.18864	-0.211000	0.10124	0.482000	0.46254	ATC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.318	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	0	0	1	2	2	2	2	0	0	0	0	126	126	126	124	1	3.730000	-8.530329	1	0.550000	XM_058404		0	10	10	0	534	527	0		1			0	0	126	0	0	0.996720	0	0	0	0	0	0	10	534
RBP3	5949	broad.mit.edu	37	10	48388910	48388910	+	Silent	SNP	G	G	A	rs545131365		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:48388910G>A	ENST00000224600.4	-	1	2081	c.1968C>T	c.(1966-1968)gtC>gtT	p.V656V	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	656	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TCTGCCCCACGACCTCTGGCC	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		17624	0.001		0.0	False		,,,				2504	0.0					ENST00000224600.4	1.000000	5.200000e-01	1.000000	6.700000e-01	0.850000	0.842551	0.850000	1.000000																										0				59						c.(1966-1968)gtC>gtT		retinol binding protein 3, interstitial	Vitamin A(DB00162)						17.0	19.0	18.0					10																	48388910		2198	4286	6484	SO:0001819	synonymous_variant	5949	1	121162	26				g.chr10:48388910G>A	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1968C>T	chr10.hg19:g.48388910G>A		1					AL731561.2_ENST00000581861.1_RNA	p.V656V	NM_002900.2	NP_002891.1	2	2	4	2.135981	P10745	RET3_HUMAN		1	2081	-			Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	ENST00000224600.4	1	1	hg19	c.1968C>T	CCDS7218.1	1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.662	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	1	0	1	2	2	2	2	0	0	0	0	32	32	32	32	1	3.730000	-20.000000	1	0.550000	NM_002900		0	16	15	0	91	89	1		1			0	0	32	0	0	0.999946	0	0	0	0	0	0	16	91
C10orf53	282966	broad.mit.edu	37	10	50916592	50916592	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:50916592G>A	ENST00000374112.3	+	3	415	c.403G>A	c.(403-405)Gac>Aac	p.D135N	C10orf53_ENST00000535836.1_Missense_Mutation_p.D135N	NM_182554.2	NP_872360.2	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53	0										endometrium(1)|lung(6)	7		all_neural(218;0.107)				caatctttgtgacctgggttg	0.488																																						ENST00000374112.3	0.170000	2.000000e-02	0.130000	5.000000e-02	0.080000	0.095784	0.080000	0.080000																										0				7						c.(403-405)Gac>Aac		chromosome 10 open reading frame 53							126.0	126.0	126.0					10																	50916592		2203	4300	6503	SO:0001583	missense	282966	0	0					g.chr10:50916592G>A	BC028127	CCDS31202.1, CCDS41521.1	10q11.23	2012-05-24			ENSG00000178645	ENSG00000178645			27421	protein-coding gene	gene with protein product						12477932	Standard	NM_182554		Approved	Em:AC069546.1	uc001jid.1	Q8N6V4	OTTHUMG00000018199	ENST00000374112.3:c.403G>A	chr10.hg19:g.50916592G>A	ENSP00000363226:p.Asp135Asn	1					C10orf53_ENST00000535836.1_Missense_Mutation_p.D135N	p.D135N	NM_182554.2	NP_872360.2	2	2	4	2.135981	Q8N6V4	CJ053_HUMAN		3	415	+		all_neural(218;0.107)	A6NI81|A6NLE0|B9ZVK6	Missense_Mutation	SNP	ENST00000374112.3	0	1	hg19	c.403G>A	CCDS31202.1	0	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594908	0.28445	.	.	ENSG00000178645	ENST00000374112;ENST00000535836	.	.	.	1.65	1.65	0.23941	1.65	1.65	0.23941	.	.	.	.	.	T	0.12987	0.0315	N	0.08118	0	0.09310	N	1	P	0.41947	0.766	B	0.33521	0.165	T	0.10268	-1.0637	8	0.87932	D	0	.	6.7374	0.23417	0.0:0.0:1.0:0.0	.	135	B9ZVK6	.	N	135	.	ENSP00000363226:D135N	D	+	1	0	0	C10orf53	50586598	50586598	0.028000	0.19301	0.022000	0.16811	0.046000	0.14306	0.550000	0.23345	1.229000	0.43630	0.491000	0.48974	GAC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.488	C10orf53-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048006.1	0	0	1	2	2	2	2	0	0	0	0	166	166	166	166	1	3.730000	-2.976057	1	0.550000	NM_182554		0	8	8	0	521	514	0		1			0	0	166	0	0	0.988876	0	0	0	0	0	0	8	521
PCDH15	65217	broad.mit.edu	37	10	55849770	55849770	+	Silent	SNP	A	A	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:55849770A>G	ENST00000320301.6	-	16	2365	c.1971T>C	c.(1969-1971)ccT>ccC	p.P657P	PCDH15_ENST00000361849.3_Silent_p.P657P|PCDH15_ENST00000409834.1_Silent_p.P268P|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Silent_p.P635P|PCDH15_ENST00000395438.1_Silent_p.P657P|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000414778.1_Silent_p.P662P|PCDH15_ENST00000395433.1_Silent_p.P635P|PCDH15_ENST00000395432.2_Silent_p.P620P|PCDH15_ENST00000373965.2_Silent_p.P664P|PCDH15_ENST00000395430.1_Silent_p.P657P|PCDH15_ENST00000395445.1_Silent_p.P664P|PCDH15_ENST00000373955.1_Silent_p.P657P|PCDH15_ENST00000395446.1_Silent_p.P657P	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	657	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AAACTCTCTGAGGATCTCCAT	0.338										HNSCC(58;0.16)																												ENST00000320301.6	0.200000	5.000000e-02	0.160000	8.000000e-02	0.110000	0.126801	0.110000	0.120000																										0				237						c.(1969-1971)ccT>ccC		protocadherin-related 15							64.0	66.0	66.0					10																	55849770		2203	4298	6501	SO:0001819	synonymous_variant	65217	0	0					g.chr10:55849770A>G	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1971T>C	chr10.hg19:g.55849770A>G		1	HNSCC(58;0.16)				PCDH15_ENST00000395433.1_Silent_p.P635P|PCDH15_ENST00000373965.2_Silent_p.P664P|PCDH15_ENST00000395430.1_Silent_p.P657P|PCDH15_ENST00000373957.3_Silent_p.P635P|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395446.1_Silent_p.P657P|PCDH15_ENST00000409834.1_Silent_p.P268P|PCDH15_ENST00000395438.1_Silent_p.P657P|PCDH15_ENST00000361849.3_Silent_p.P657P|PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000395445.1_Silent_p.P664P|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395432.2_Silent_p.P620P|PCDH15_ENST00000373955.1_Silent_p.P657P|PCDH15_ENST00000414778.1_Silent_p.P662P	p.P657P	NM_033056.3	NP_149045.3	2	2	4	2.135981	Q96QU1	PCD15_HUMAN		16	2365	-		Melanoma(3;0.117)|Lung SC(717;0.238)	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	1	1	hg19	c.1971T>C	CCDS7248.1	0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.338	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	0	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	3.730000	-4.304782	1	0.550000	NM_033056		0	14	14	0	650	641	0		1			0	0	135	0	0	0.999731	0	0	0	0	0	0	14	650
ANKRD2	26287	broad.mit.edu	37	10	99338074	99338074	+	Silent	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:99338074C>A	ENST00000307518.5	+	3	615	c.348C>A	c.(346-348)atC>atA	p.I116I	ANKRD2_ENST00000370655.1_Silent_p.I89I|ANKRD2_ENST00000455090.1_Silent_p.I89I|ANKRD2_ENST00000298808.5_Silent_p.I116I			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	116	May mediate interaction with PML, p53/TP53 and YBX1.				muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|euchromatin (GO:0000791)|I band (GO:0031674)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	protein kinase B binding (GO:0043422)|structural constituent of muscle (GO:0008307)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		AGAACCTCATCGAGCTGCGGA	0.662																																						ENST00000307518.5	1.000000	8.900000e-01	1.000000	9.900000e-01	0.990000	0.993634	0.990000	1.000000																										0				7						c.(346-348)atC>atA		ankyrin repeat domain 2 (stretch responsive muscle)							31.0	31.0	31.0					10																	99338074		2203	4300	6503	SO:0001819	synonymous_variant	26287	0	0					g.chr10:99338074C>A	AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887		"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734				10873377, 15136035, 15677738	Standard	NM_001129981		Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000307518.5:c.348C>A	chr10.hg19:g.99338074C>A		1					ANKRD2_ENST00000455090.1_Silent_p.I89I|ANKRD2_ENST00000370655.1_Silent_p.I89I|ANKRD2_ENST00000298808.5_Silent_p.I116I	p.I116I			2	2	4	2.139192	Q9GZV1	ANKR2_HUMAN		3	615	+		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)	Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	Silent	SNP	ENST00000307518.5	1	1	hg19	c.348C>A	CCDS7466.1	1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.662	ANKRD2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	50	50	50	48	1	3.730000	-20.000000	1	0.550000			0	40	39	0	147	145	1		1	0		0	0	50	0	0	1.000000	0	0	0	0	1	0	40	147
MKI67	4288	broad.mit.edu	37	10	129905212	129905212	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr10:129905212C>T	ENST00000368654.3	-	13	5267	c.4892G>A	c.(4891-4893)cGa>cAa	p.R1631Q	MKI67_ENST00000368653.3_Missense_Mutation_p.R1271Q	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1631	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTTGAGCCGTCGCTTGGAGCT	0.502																																						ENST00000368654.3	0.150000	4.000000e-02	0.120000	6.000000e-02	0.080000	0.095613	0.080000	0.080000																										0				159						c.(4891-4893)cGa>cAa		marker of proliferation Ki-67							218.0	218.0	218.0					10																	129905212		2203	4300	6503	SO:0001583	missense	4288	2	121412	43				g.chr10:129905212C>T	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4892G>A	chr10.hg19:g.129905212C>T	ENSP00000357643:p.Arg1631Gln	1					MKI67_ENST00000368653.3_Missense_Mutation_p.R1271Q	p.R1631Q	NM_002417.4	NP_002408.3	2	2	4	2.139192	P46013	KI67_HUMAN		13	5267	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	0	1	hg19	c.4892G>A	CCDS7659.1	0	.	.	.	.	.	.	.	.	.	.	C	8.711	0.912034	0.17907	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.03152	4.03;4.03	2.6	0.628	0.17681	2.6	0.628	0.17681	.	0.461817	0.16195	N	0.225197	T	0.02230	0.0069	L	0.34521	1.04	0.09310	N	1	B;P;B	0.34562	0.053;0.457;0.275	B;B;B	0.22753	0.007;0.041;0.033	T	0.47355	-0.9124	10	0.25751	T	0.34	.	4.3863	0.11318	0.0:0.5705:0.1925:0.237	.	1630;1271;1631	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	Q	1631;1271;1630	ENSP00000357643:R1631Q;ENSP00000357642:R1271Q	ENSP00000357642:R1271Q	R	-	2	0	0	MKI67	129795202	129795202	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	1.262000	0.32992	0.166000	0.19597	-0.244000	0.11960	CGA	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	0	0	1	2	14	2	2	1	1	1	1	300	300	300	294	1	3.730000	-2.430833	0	0.550000	NM_002417		0	17	17	0	1034	1023	0		1	0		1	0	300	0	0	0.755046	1.510390e-02	0	0	0	11	0	17	1034
MRVI1	10335	broad.mit.edu	37	11	10622527	10622527	+	Missense_Mutation	SNP	G	G	A	rs376317552	byFrequency	TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr11:10622527G>A	ENST00000436272.1	-	14	1952	c.1874C>T	c.(1873-1875)gCg>gTg	p.A625V	MRVI1_ENST00000541483.1_Missense_Mutation_p.A446V|MRVI1_ENST00000534266.2_Missense_Mutation_p.A337V|LYVE1_ENST00000531706.1_Intron|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000423302.2_Missense_Mutation_p.A652V|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000547195.1_Missense_Mutation_p.A561V|MRVI1_ENST00000527509.2_Missense_Mutation_p.A561V|MRVI1_ENST00000421747.1_Missense_Mutation_p.A643V|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000558540.1_Missense_Mutation_p.A337V|MRVI1_ENST00000531107.1_Missense_Mutation_p.A644V|MRVI1_ENST00000424001.1_Missense_Mutation_p.A337V|MRVI1_ENST00000545852.1_Missense_Mutation_p.A337V|MRVI1_ENST00000552103.1_Missense_Mutation_p.A561V			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	625					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CATGAGCTCCGCATGGTCCTT	0.517													G|||	2	0.000399361	0.0008	0.0	5008	,	,		21157	0.0		0.0	False		,,,				2504	0.001					ENST00000436272.1	1.000000	1.000000e-02	1.000000	4.000000e-02	0.080000	0.280792	0.080000	0.080000																										0				22						c.(1873-1875)gCg>gTg		murine retrovirus integration site 1 homolog		G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,3876		0,0,1938	191.0	186.0	187.0		1931,1682,1010,1337,1010,1955	5.4	1.0	11		187	1,8269		0,1,4134	no	missense,missense,missense,missense,missense,missense	MRVI1	NM_001098579.2,NM_001100163.2,NM_001100167.2,NM_001206880.1,NM_001206881.1,NM_130385.3	64,64,64,64,64,64	0,1,6072	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	644/905,561/822,337/598,446/707,337/598,652/913	10622527	1,12145	1938	4135	6073	SO:0001583	missense	10335	9	120882	46				g.chr11:10622527G>A	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1874C>T	chr11.hg19:g.10622527G>A	ENSP00000412229:p.Ala625Val	1					MRVI1_ENST00000534266.2_Missense_Mutation_p.A337V|MRVI1_ENST00000545852.1_Missense_Mutation_p.A337V|MRVI1_ENST00000531107.1_Missense_Mutation_p.A644V|MRVI1_ENST00000547195.1_Missense_Mutation_p.A561V|MRVI1_ENST00000423302.2_Missense_Mutation_p.A652V|MRVI1_ENST00000527509.2_Missense_Mutation_p.A561V|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000541483.1_Missense_Mutation_p.A446V|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000558540.1_Missense_Mutation_p.A337V|MRVI1_ENST00000552103.1_Missense_Mutation_p.A561V|MRVI1_ENST00000424001.1_Missense_Mutation_p.A337V|MRVI1_ENST00000421747.1_Missense_Mutation_p.A643V|LYVE1_ENST00000531706.1_Intron	p.A625V			2	3	5	2.070863	Q9Y6F6	MRVI1_HUMAN		14	1952	-			B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	0	1	hg19	c.1874C>T		0	.	.	.	.	.	.	.	.	.	.	G	35	5.484238	0.96307	0.0	1.21E-4	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71;1.71	5.44	5.44	0.79542	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.54351	0.1853	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.999;0.999;0.998	T	0.57075	-0.7873	10	0.72032	D	0.01	-10.4332	19.2679	0.93997	0.0:0.0:1.0:0.0	.	446;625;644;643	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	V	643;626;625;561;561;337;337;652;446;644;561	ENSP00000414598:A643V;ENSP00000412229:A625V;ENSP00000448278:A561V;ENSP00000446764:A561V;ENSP00000441971:A337V;ENSP00000401205:A337V;ENSP00000412130:A652V;ENSP00000437784:A446V;ENSP00000432436:A644V;ENSP00000432067:A561V	ENSP00000307885:A626V	A	-	2	0	0	MRVI1	10579103	10579103	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.476000	0.97823	2.557000	0.86248	0.557000	0.71058	GCG	0.707079		TCGA-YY-A8LH-01A-11D-A36O-08	0.517	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	202	202	202	200	1	3.730000	-2.353778	0	0.550000	NM_001098579		0	8	8	0	633	626	0		1	0		0	0	202	0	0	0.988944	2.166691e-04	0	0	0	2	0	8	633
FAM160A2	84067	broad.mit.edu	37	11	6235766	6235766	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr11:6235766G>A	ENST00000449352.2	-	11	2695	c.2432C>T	c.(2431-2433)gCg>gTg	p.A811V	FAM160A2_ENST00000529360.1_5'UTR|FAM160A2_ENST00000265978.4_Missense_Mutation_p.A825V			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	811					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTGGGAAGCCGCAAAGTTCTC	0.532																																						ENST00000449352.2	1.000000	1.000000e-02	1.000000	3.000000e-02	0.070000	0.292879	0.070000	0.070000																										0				42						c.(2431-2433)gCg>gTg		family with sequence similarity 160, member A2							117.0	119.0	118.0					11																	6235766		2201	4296	6497	SO:0001583	missense	84067	0	0					g.chr11:6235766G>A		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.2432C>T	chr11.hg19:g.6235766G>A	ENSP00000416918:p.Ala811Val	1					FAM160A2_ENST00000265978.4_Missense_Mutation_p.A825V|FAM160A2_ENST00000529360.1_5'UTR	p.A811V			2	4	6	2.051836	Q8N612	F16A2_HUMAN		11	2695	-			Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	ENST00000449352.2	0	1	hg19	c.2432C>T	CCDS44530.1	0	.	.	.	.	.	.	.	.	.	.	g	26.2	4.717264	0.89205	.	.	ENSG00000051009	ENST00000449352;ENST00000265978	T;T	0.11277	2.81;2.79	5.19	5.19	0.71726	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.28001	0.0690	L	0.51914	1.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.991;0.996	T	0.00731	-1.1590	10	0.30078	T	0.28	-9.5991	17.6957	0.88281	0.0:0.0:1.0:0.0	.	811;825	Q8N612;Q8N612-2	F16A2_HUMAN;.	V	811;825	ENSP00000416918:A811V;ENSP00000265978:A825V	ENSP00000265978:A825V	A	-	2	0	0	FAM160A2	6192342	6192342	1.000000	0.71417	0.993000	0.49108	0.967000	0.64934	9.136000	0.94489	2.391000	0.81399	0.457000	0.33378	GCG	0.701195		TCGA-YY-A8LH-01A-11D-A36O-08	0.532	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	0	0	1	2	19	10	2	1	1	1	2	151	151	151	148	1	3.730000	-1.717238	0	0.550000	NM_032127		0	6	6	0	542	540	0		0	0		1	0	151	0	0	0.006521	3.738182e-02	0	1	0	331	0	6	542
PPFIA1	8500	broad.mit.edu	37	11	70171012	70171012	+	Silent	SNP	C	C	A	rs144282210		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr11:70171012C>A	ENST00000253925.7	+	4	641	c.426C>A	c.(424-426)acC>acA	p.T142T	AP000487.6_ENST00000528607.1_RNA|CTA-797E19.2_ENST00000526017.1_RNA|PPFIA1_ENST00000389547.3_Silent_p.T142T	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	142					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.T142T(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TTAGGATGACCGTGGTGAAGA	0.473																																						ENST00000253925.7	0.130000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.072539	0.060000	0.080000																										1	Substitution - coding silent(1)	p.T142T(1)	lung(1)	65						c.(424-426)acC>acA		protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1							132.0	137.0	135.0					11																	70171012		2200	4294	6494	SO:0001819	synonymous_variant	8500	0	0					g.chr11:70171012C>A	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.426C>A	chr11.hg19:g.70171012C>A		1					AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Silent_p.T142T|CTA-797E19.2_ENST00000526017.1_RNA	p.T142T	NM_003626.3	NP_003617.1	2	2	4	2.108094	Q13136	LIPA1_HUMAN	BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)	4	641	+			A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	ENST00000253925.7	0	1	hg19	c.426C>A	CCDS31627.1	0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.473	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	0	0	1	2	2	2	2	0	0	0	0	200	200	200	198	1	3.730000	-1.744953	0	0.550000	NM_003626		0	9	8	0	765	757	0		1	0		0	0	200	0	0	0.993928	7.544369e-03	0	1	0	9	0	9	765
RDX	5962	broad.mit.edu	37	11	110108333	110108333	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr11:110108333G>A	ENST00000343115.4	-	11	1454	c.1135C>T	c.(1135-1137)Cga>Tga	p.R379*	RDX_ENST00000528900.1_Nonsense_Mutation_p.R32*|RDX_ENST00000544551.1_Nonsense_Mutation_p.R243*|RDX_ENST00000530301.1_Intron|RDX_ENST00000405097.1_Nonsense_Mutation_p.R379*|RDX_ENST00000528498.1_Nonsense_Mutation_p.R379*	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	379	Glu-rich.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		GCTCGTTTTCGTTCTTGATCC	0.423																																					Esophageal Squamous(55;25 1062 11040 28755 44273)	ENST00000343115.4	0.590000	3.400000e-01	0.530000	3.900000e-01	0.450000	0.464007	0.450000	0.450000																										0				18						c.(1135-1137)Cga>Tga		radixin							183.0	175.0	177.0					11																	110108333		2201	4298	6499	SO:0001587	stop_gained	5962	0	0					g.chr11:110108333G>A	BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.1135C>T	chr11.hg19:g.110108333G>A	ENSP00000342830:p.Arg379*	0					RDX_ENST00000544551.1_Nonsense_Mutation_p.R243*|RDX_ENST00000405097.1_Nonsense_Mutation_p.R379*|RDX_ENST00000528498.1_Nonsense_Mutation_p.R379*|RDX_ENST00000530301.1_Intron|RDX_ENST00000528900.1_Nonsense_Mutation_p.R32*	p.R379*	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	2	2	4	2.085219	P35241	RADI_HUMAN		11	1454	-		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Nonsense_Mutation	SNP	ENST00000343115.4	0	1	hg19	c.1135C>T	CCDS8343.1	0	.	.	.	.	.	.	.	.	.	.	G	41	8.635797	0.98895	.	.	ENSG00000137710	ENST00000528498;ENST00000405097;ENST00000528900;ENST00000343115;ENST00000544551;ENST00000530085	.	.	.	5.78	3.73	0.42828	5.78	3.73	0.42828	.	0.148841	0.44688	D	0.000430	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	14.0536	0.64754	0.0:0.0:0.6747:0.3253	.	.	.	.	X	379;379;32;379;243;49	.	ENSP00000342830:R379X	R	-	1	2	2	RDX	109613543	109613543	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.822000	0.48073	2.730000	0.93505	0.650000	0.86243	CGA	0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.423	RDX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390535.2	1	0	1	2	2	2	2	0	0	0	0	177	177	177	174	1	3.730000	-12.955910	1	0.550000	NM_002906		0	51	50	0	576	570	0		1	0		0	0	177	0	0	1.000000	1.379818e-01	0	0	0	8	0	51	576
KSR2	283455	broad.mit.edu	37	12	118405988	118405988	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr12:118405988C>A	ENST00000339824.5	-	1	800	c.73G>T	c.(73-75)Gaa>Taa	p.E25*	KSR2_ENST00000425217.1_5'UTR			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	25					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGACCAGTTCGCACTGCTGT	0.507																																						ENST00000339824.5	1.000000	3.000000e-02	0.140000	5.000000e-02	0.080000	0.166381	0.080000	0.080000																										0				67						c.(73-75)Gaa>Taa		kinase suppressor of ras 2							192.0	170.0	177.0					12																	118405988		1568	3582	5150	SO:0001587	stop_gained	283455	0	0					g.chr12:118405988C>A	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.73G>T	chr12.hg19:g.118405988C>A	ENSP00000339952:p.Glu25*	0					KSR2_ENST00000425217.1_5'UTR	p.E25*			2	2	4	2.022142	Q6VAB6	KSR2_HUMAN		1	800	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		A0PJT2|Q3B828|Q8N775	Nonsense_Mutation	SNP	ENST00000339824.5	0	1	hg19	c.73G>T		0	.	.	.	.	.	.	.	.	.	.	C	46	12.515743	0.99674	.	.	ENSG00000171435	ENST00000339824	.	.	.	4.74	4.74	0.60224	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	15.2228	0.73327	0.0:1.0:0.0:0.0	.	.	.	.	X	25	.	ENSP00000339952:E25X	E	-	1	0	0	KSR2	116890371	116890371	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.802000	0.75175	2.158000	0.67659	0.491000	0.48974	GAA	0.698997		TCGA-YY-A8LH-01A-11D-A36O-08	0.507	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	0	0	1	2	2	2	2	0	0	0	0	152	152	152	151	1	3.730000	-2.273934	0	0.550000	NM_173598		0	10	10	0	633	614	0		1	0		0	0	152	0	0	0.996409	0	0	0	0	1	0	10	633
TMEM132D	121256	broad.mit.edu	37	12	129822360	129822360	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr12:129822360G>A	ENST00000422113.2	-	4	1444	c.1118C>T	c.(1117-1119)gCg>gTg	p.A373V		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	373					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GGCGCCATCCGCACTGGAGAG	0.592																																						ENST00000422113.2	1.000000	8.000000e-02	0.260000	1.200000e-01	0.170000	0.248988	0.170000	0.160000																										0				152						c.(1117-1119)gCg>gTg		transmembrane protein 132D							76.0	72.0	73.0					12																	129822360		2203	4300	6503	SO:0001583	missense	121256	0	0					g.chr12:129822360G>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1118C>T	chr12.hg19:g.129822360G>A	ENSP00000408581:p.Ala373Val	0						p.A373V	NM_133448.2	NP_597705.2	2	2	4	2.022142	Q14C87	T132D_HUMAN		4	1444	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	1	1	hg19	c.1118C>T	CCDS9266.1	0	.	.	.	.	.	.	.	.	.	.	G	7.293	0.611470	0.14066	.	.	ENSG00000151952	ENST00000422113	T	0.13657	2.57	5.15	-9.46	0.00597	5.15	-9.46	0.00597	.	1.098670	0.06965	N	0.817048	T	0.05547	0.0146	N	0.05230	-0.09	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44251	-0.9340	9	.	.	.	-7.6336	13.872	0.63624	0.2209:0.0943:0.6848:0.0	.	373	Q14C87	T132D_HUMAN	V	373	ENSP00000408581:A373V	.	A	-	2	0	0	TMEM132D	128388313	128388313	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.065000	0.11617	-2.151000	0.00795	-0.889000	0.02933	GCG	0.698997		TCGA-YY-A8LH-01A-11D-A36O-08	0.592	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	0	0	1	2	15	2	2	1	1	1	1	92	92	92	91	1	3.730000	-2.788778	1	0.550000	NM_133448		0	12	12	0	372	366	0		0	0		1	0	92	0	0	0.330087	0	0	0	0	1	0	12	372
ACRBP	84519	broad.mit.edu	37	12	6753307	6753307	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr12:6753307C>T	ENST00000229243.2	-	5	1033	c.940G>A	c.(940-942)Ggc>Agc	p.G314S	ACRBP_ENST00000536350.1_Missense_Mutation_p.G314S|ACRBP_ENST00000414226.2_Missense_Mutation_p.G281S|ACRBP_ENST00000542357.1_5'Flank	NM_032489.2	NP_115878.2			acrosin binding protein											NS(1)|breast(1)|central_nervous_system(1)|large_intestine(8)|lung(5)|ovary(1)	17						CTATACCTGCCAGGGTTTTGG	0.463																																						ENST00000229243.2	1.000000	4.000000e-02	0.170000	7.000000e-02	0.110000	0.174193	0.110000	0.110000																										0				17						c.(940-942)Ggc>Agc		acrosin binding protein							69.0	70.0	70.0					12																	6753307		2203	4299	6502	SO:0001583	missense	84519	0	0					g.chr12:6753307C>T	AB051833	CCDS8554.1	12p13.31	2009-03-12			ENSG00000111644	ENSG00000111644			17195	protein-coding gene	gene with protein product	"""proacrosin binding protein sp32"", ""cancer/testis antigen 23"""	608352				11248070	Standard	NM_032489		Approved	SP32, OY-TES-1, CT23	uc001qpu.1	Q8NEB7	OTTHUMG00000168715	ENST00000229243.2:c.940G>A	chr12.hg19:g.6753307C>T	ENSP00000229243:p.Gly314Ser	0					ACRBP_ENST00000414226.2_Missense_Mutation_p.G281S|ACRBP_ENST00000536350.1_Missense_Mutation_p.G314S|ACRBP_ENST00000542357.1_5'Flank	p.G314S	NM_032489.2	NP_115878.2	2	2	4	2.040923				5	1033	-				Missense_Mutation	SNP	ENST00000229243.2	0	1	hg19	c.940G>A	CCDS8554.1	0	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612970	0.46631	.	.	ENSG00000111644	ENST00000229243;ENST00000414226;ENST00000536350	T;T	0.44881	0.92;0.91	4.25	2.41	0.29592	4.25	2.41	0.29592	.	0.596770	0.15767	N	0.245645	T	0.29914	0.0748	L	0.50919	1.6	0.21325	N	0.999725	P;P	0.37525	0.598;0.598	B;B	0.31614	0.133;0.133	T	0.14504	-1.0470	10	0.41790	T	0.15	.	5.855	0.18714	0.0:0.767:0.0:0.233	.	281;314	E7EP66;Q8NEB7	.;ACRBP_HUMAN	S	314;281;314	ENSP00000229243:G314S;ENSP00000402725:G281S	ENSP00000229243:G314S	G	-	1	0	0	ACRBP	6623568	6623568	0.505000	0.26131	0.620000	0.29132	0.535000	0.34838	0.691000	0.25467	1.135000	0.42183	0.561000	0.74099	GGC	0.701195		TCGA-YY-A8LH-01A-11D-A36O-08	0.463	ACRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400703.1	0	0	1	2	2	2	2	0	0	0	0	103	103	103	102	1	3.730000	-6.898041	1	0.550000	NM_032489		0	7	7	0	364	363	0		1	0		0	0	103	0	0	0.980661	2.987832e-03	0	0	0	4	0	7	364
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	2	2	4	2.022142	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.698997		TCGA-YY-A8LH-01A-11D-A36O-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	2	2	2	2	0	0	0	0	95	95	95	93	1	3.730000	-20.000000	1	0.550000	NM_033360		3123	97	96	4899	237	235	1	1	1	1	1	0	0	95	353	1	1.000000	9.980131e-01	1	16	72	10	221	97	237
LARP4	113251	broad.mit.edu	37	12	50847262	50847262	+	Missense_Mutation	SNP	A	A	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr12:50847262A>G	ENST00000398473.2	+	9	936	c.824A>G	c.(823-825)aAt>aGt	p.N275S	LARP4_ENST00000518444.1_Missense_Mutation_p.N274S|LARP4_ENST00000293618.8_Missense_Mutation_p.N275S|LARP4_ENST00000522085.1_Missense_Mutation_p.N275S|LARP4_ENST00000518561.1_Missense_Mutation_p.N205S|LARP4_ENST00000347328.5_Intron|LARP4_ENST00000429001.3_Missense_Mutation_p.N281S	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	275	RRM.				cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						AAAGCCATCAATACATTTTTT	0.308																																						ENST00000398473.2	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				23						c.(823-825)aAt>aGt		La ribonucleoprotein domain family, member 4							109.0	96.0	100.0					12																	50847262		1848	4091	5939	SO:0001583	missense	113251	0	0					g.chr12:50847262A>G	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.824A>G	chr12.hg19:g.50847262A>G	ENSP00000381490:p.Asn275Ser	0					LARP4_ENST00000429001.3_Missense_Mutation_p.N281S|LARP4_ENST00000347328.5_Intron|LARP4_ENST00000293618.8_Missense_Mutation_p.N275S|LARP4_ENST00000518561.1_Missense_Mutation_p.N205S|LARP4_ENST00000522085.1_Missense_Mutation_p.N275S|LARP4_ENST00000518444.1_Missense_Mutation_p.N274S	p.N275S	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	2	2	4	2.022142	Q71RC2	LARP4_HUMAN		9	936	+			A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	1	1	hg19	c.824A>G	CCDS41782.1	1	.	.	.	.	.	.	.	.	.	.	A	19.98	3.926632	0.73327	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000522085;ENST00000398464;ENST00000518444;ENST00000518561;ENST00000520064	T;T;T;T;T;T	0.57595	1.24;0.94;0.92;0.39;0.89;0.5	3.89	3.89	0.44902	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.74258	2.255	0.80722	D	1	D;D;D;D;P	0.69078	0.997;0.957;0.996;0.995;0.553	D;D;D;D;P	0.77557	0.985;0.914;0.99;0.956;0.627	T	0.72899	-0.4152	10	0.49607	T	0.09	.	13.3994	0.60874	1.0:0.0:0.0:0.0	.	176;274;275;275;281	Q71RC2-2;Q71RC2-3;G3XAA8;Q71RC2;Q71RC2-4	.;.;.;LARP4_HUMAN;.	S	275;281;275;275;275;274;205;176	ENSP00000293618:N275S;ENSP00000415464:N281S;ENSP00000381490:N275S;ENSP00000429781:N275S;ENSP00000429077:N274S;ENSP00000430851:N205S	ENSP00000293618:N275S	N	+	2	0	0	LARP4	49133529	49133529	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.707000	0.91367	1.724000	0.51502	0.260000	0.18958	AAT	0.698997		TCGA-YY-A8LH-01A-11D-A36O-08	0.308	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	1	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	3.730000	-20.000000	1	0.550000	NM_052879		0	93	93	0	214	211	1		1	1		0	0	95	0	0	1.000000	4.797068e-01	0	2	0	3	0	93	214
RNF41	10193	broad.mit.edu	37	12	56600246	56600246	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr12:56600246G>A	ENST00000345093.4	-	7	1308	c.939C>T	c.(937-939)ggC>ggT	p.G313G	RNF41_ENST00000394013.2_Silent_p.G242G|RNF41_ENST00000552656.1_Silent_p.G313G	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	Q9H4P4	RNF41_HUMAN	ring finger protein 41, E3 ubiquitin protein ligase	313					extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|proteasomal protein catabolic process (GO:0010498)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|regulation of establishment of cell polarity (GO:2000114)|regulation of lymphocyte differentiation (GO:0045619)|regulation of MAPK cascade (GO:0043408)|regulation of myeloid cell differentiation (GO:0045637)|regulation of protein kinase B signaling (GO:0051896)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytosol (GO:0005829)	acid-amino acid ligase activity (GO:0016881)|protein tag (GO:0031386)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	11						TCTCTTCCACGCCATGCGCAA	0.522											OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000345093.4	1.000000	2.800000e-01	0.470000	3.300000e-01	0.390000	0.441890	0.390000	0.380000																										0				11						c.(937-939)ggC>ggT		ring finger protein 41, E3 ubiquitin protein ligase							173.0	167.0	169.0					12																	56600246		2203	4300	6503	SO:0001819	synonymous_variant	10193	4	121412	42				g.chr12:56600246G>A	AF077599	CCDS8909.1, CCDS8910.1	12q13.13	2014-03-24	2014-03-24		ENSG00000181852	ENSG00000181852		"""RING-type (C3HC4) zinc fingers"""	18401	protein-coding gene	gene with protein product			"""ring finger protein 41"""				Standard	NM_005785		Approved	SBBI03, NRDP1	uc001skg.2	Q9H4P4	OTTHUMG00000170328	ENST00000345093.4:c.939C>T	chr12.hg19:g.56600246G>A		0		OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1016	RNF41_ENST00000394013.2_Silent_p.G242G|RNF41_ENST00000552656.1_Silent_p.G313G	p.G313G	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	2	2	4	2.022142	Q9H4P4	RNF41_HUMAN		7	1308	-			A6NFW0|B2RBT8|O75598	Silent	SNP	ENST00000345093.4	1	1	hg19	c.939C>T	CCDS8909.1	0																																																																																								0.698997		TCGA-YY-A8LH-01A-11D-A36O-08	0.522	RNF41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408525.1	0	0	1	2	2	2	2	0	0	0	0	226	226	226	222	1	3.730000	-10.535360	1	0.550000	NM_005785		0	53	52	0	692	686	0		1	1		0	0	226	0	0	1.000000	9.525136e-01	0	5	0	62	0	53	692
FZD10	11211	broad.mit.edu	37	12	130648711	130648711	+	Silent	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr12:130648711C>T	ENST00000229030.4	+	1	1708	c.1224C>T	c.(1222-1224)atC>atT	p.I408I	FZD10_ENST00000539839.1_Missense_Mutation_p.R376W|FZD10-AS1_ENST00000505807.2_RNA			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	408					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		ACCTGGTCATCGGCACGTCCT	0.642																																						ENST00000229030.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.998965	0.990000	1.000000																										0				35						c.(1222-1224)atC>atT		frizzled class receptor 10							146.0	133.0	137.0					12																	130648711		2203	4300	6503	SO:0001819	synonymous_variant	11211	0	0					g.chr12:130648711C>T	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1224C>T	chr12.hg19:g.130648711C>T		0					FZD10_ENST00000539839.1_Missense_Mutation_p.R376W|FZD10-AS1_ENST00000505807.2_RNA	p.I408I			2	2	4	2.022142	Q9ULW2	FZD10_HUMAN		1	1708	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Silent	SNP	ENST00000229030.4	1	1	hg19	c.1224C>T	CCDS9267.1	1	.	.	.	.	.	.	.	.	.	.	C	8.505	0.865101	0.17250	.	.	ENSG00000111432	ENST00000539839	.	.	.	5.21	-2.84	0.05751	5.21	-2.84	0.05751	.	.	.	.	.	T	0.68888	0.3050	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72903	-0.4151	5	0.87932	D	0	.	12.273	0.54716	0.0:0.2908:0.5973:0.1119	.	.	.	.	W	376	.	ENSP00000438460:R376W	R	+	1	2	2	FZD10	129214664	129214664	0.038000	0.19896	0.092000	0.20876	0.725000	0.41563	-0.798000	0.04565	-0.407000	0.07576	-0.305000	0.09177	CGG	0.698997		TCGA-YY-A8LH-01A-11D-A36O-08	0.642	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1	2	14	2	2	1	1	1	1	73	73	73	73	1	3.730000	-20.000000	1	0.550000			0	64	64	0	214	210	1		1			1	0	73	0	0	1.000000	0	0	0	0	0	0	64	214
FNDC3A	22862	broad.mit.edu	37	13	49775956	49775956	+	Missense_Mutation	SNP	G	G	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr13:49775956G>C	ENST00000492622.2	+	24	3313	c.3008G>C	c.(3007-3009)gGa>gCa	p.G1003A	FNDC3A_ENST00000398316.3_Missense_Mutation_p.G947A|FNDC3A_ENST00000541916.1_Missense_Mutation_p.G1003A	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1003	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		CTATACAGAGGACCATGTCAT	0.328																																						ENST00000492622.2	0.160000	1.000000e-02	0.120000	4.000000e-02	0.070000	0.087277	0.070000	0.080000																										0				41						c.(3007-3009)gGa>gCa		fibronectin type III domain containing 3A							81.0	81.0	81.0					13																	49775956		2202	4300	6502	SO:0001583	missense	22862	0	0					g.chr13:49775956G>C	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.3008G>C	chr13.hg19:g.49775956G>C	ENSP00000417257:p.Gly1003Ala	1					FNDC3A_ENST00000398316.3_Missense_Mutation_p.G947A|FNDC3A_ENST00000541916.1_Missense_Mutation_p.G1003A	p.G1003A	NM_001079673.1	NP_001073141.1	2	2	4	2.108966	Q9Y2H6	FND3A_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	24	3313	+		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	0	1	hg19	c.3008G>C	CCDS41886.1	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833531	0.91036	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.56611	0.45;0.45;0.45	6.16	6.16	0.99307	6.16	6.16	0.99307	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.78723	0.4328	M	0.90082	3.085	0.80722	D	1	D;P	0.89917	1.0;0.936	D;P	0.91635	0.999;0.908	T	0.76822	-0.2817	10	0.33141	T	0.24	-24.3933	19.848	0.96722	0.0:0.0:1.0:0.0	.	947;1003	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	A	1003;939;1003;947	ENSP00000417257:G1003A;ENSP00000441831:G1003A;ENSP00000381362:G947A	ENSP00000338579:G939A	G	+	2	0	0	FNDC3A	48673957	48673957	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.414000	0.97362	2.937000	0.99478	0.650000	0.86243	GGA	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.328	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	0	0	1	2	2	2	2	0	0	0	0	102	102	102	102	1	3.730000	-4.870415	1	0.550000	NM_014923		0	6	6	0	442	439	0		1	0		0	0	102	0	0	0.964476	2.022002e-01	0	0	0	53	0	6	442
CCDC70	83446	broad.mit.edu	37	13	52439534	52439534	+	Missense_Mutation	SNP	G	G	T	rs141731440		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr13:52439534G>T	ENST00000242819.4	+	2	316	c.20G>T	c.(19-21)cGg>cTg	p.R7L		NM_031290.2	NP_112580.2	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70	7						extracellular region (GO:0005576)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(7)|skin(2)|urinary_tract(1)	15		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		CCGCCATTCCGGCTGATAAGG	0.577																																						ENST00000242819.4	0.280000	5.000000e-02	0.210000	9.000000e-02	0.140000	0.156340	0.140000	0.130000																										0				15						c.(19-21)cGg>cTg		coiled-coil domain containing 70							46.0	46.0	46.0					13																	52439534		2203	4300	6503	SO:0001583	missense	83446	0	0					g.chr13:52439534G>T		CCDS9431.1	13q14.3	2006-02-07			ENSG00000123171	ENSG00000123171			25303	protein-coding gene	gene with protein product						11230166	Standard	NM_031290		Approved	DKFZP434K1172, FLJ25853	uc001vfu.4	Q6NSX1	OTTHUMG00000016950	ENST00000242819.4:c.20G>T	chr13.hg19:g.52439534G>T	ENSP00000242819:p.Arg7Leu	1						p.R7L	NM_031290.2	NP_112580.2	2	2	4	2.108966	Q6NSX1	CCD70_HUMAN		2	316	+		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)	Q8N7A8|Q9H097	Missense_Mutation	SNP	ENST00000242819.4	0	1	hg19	c.20G>T	CCDS9431.1	0	.	.	.	.	.	.	.	.	.	.	G	3.641	-0.073442	0.07184	.	.	ENSG00000123171	ENST00000242819	T	0.35789	1.29	4.67	1.94	0.25998	4.67	1.94	0.25998	.	1.136360	0.06681	N	0.767977	T	0.25827	0.0629	N	0.24115	0.695	0.09310	N	1	B	0.23185	0.081	B	0.23275	0.045	T	0.29488	-1.0010	10	0.46703	T	0.11	-2.2162	6.8951	0.24251	0.2994:0.0:0.7006:0.0	.	7	Q6NSX1	CCD70_HUMAN	L	7	ENSP00000242819:R7L	ENSP00000242819:R7L	R	+	2	0	0	CCDC70	51337535	51337535	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	0.745000	0.26259	0.143000	0.18926	-0.672000	0.03802	CGG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.577	CCDC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045033.2	0	0	1	2	2	2	2	0	0	0	0	54	54	54	52	1	3.730000	-3.190722	1	0.550000	NM_031290		0	6	6	0	244	238	0		1			0	0	54	0	0	0.962808	0	0	0	0	0	0	6	244
ATP7B	540	broad.mit.edu	37	13	52585461	52585461	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr13:52585461C>A	ENST00000242839.4	-	1	169	c.13G>T	c.(13-15)Gag>Tag	p.E5*	ALG11_ENST00000521508.1_5'Flank|ATP7B_ENST00000400370.3_Nonsense_Mutation_p.E5*|ATP7B_ENST00000418097.2_Nonsense_Mutation_p.E5*|ATP7B_ENST00000344297.5_Nonsense_Mutation_p.E5*|ATP7B_ENST00000400366.3_Nonsense_Mutation_p.E5*|ALG11_ENST00000523764.1_5'Flank|ATP7B_ENST00000448424.2_Nonsense_Mutation_p.E5*	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	5					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	ATCTGTCTCTCCTGCTCAGGC	0.592									Wilson disease																													ENST00000242839.4	1.000000	9.400000e-01	1.000000	9.900000e-01	0.990000	0.996829	0.990000	1.000000																										0				55						c.(13-15)Gag>Tag		ATPase, Cu++ transporting, beta polypeptide	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)						70.0	84.0	79.0					13																	52585461		2054	4209	6263	SO:0001587	stop_gained	540	0	0		Wilson disease	Familial Cancer Database		g.chr13:52585461C>A	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.13G>T	chr13.hg19:g.52585461C>A	ENSP00000242839:p.Glu5*	1					ALG11_ENST00000521508.1_5'Flank|ATP7B_ENST00000448424.2_Nonsense_Mutation_p.E5*|ATP7B_ENST00000418097.2_Nonsense_Mutation_p.E5*|ATP7B_ENST00000400370.3_Nonsense_Mutation_p.E5*|ALG11_ENST00000523764.1_5'Flank|ATP7B_ENST00000400366.3_Nonsense_Mutation_p.E5*|ATP7B_ENST00000344297.5_Nonsense_Mutation_p.E5*	p.E5*	NM_000053.3	NP_000044.2	2	2	4	2.108966	P35670	ATP7B_HUMAN		1	169	-		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Nonsense_Mutation	SNP	ENST00000242839.4	0	1	hg19	c.13G>T	CCDS41892.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225575	0.79576	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000448424;ENST00000400370;ENST00000418097	.	.	.	3.89	1.0	0.19881	3.89	1.0	0.19881	.	0.976046	0.08296	U	0.967727	.	.	.	.	.	.	0.19945	N	0.999943	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-0.074	2.4796	0.04584	0.1932:0.5103:0.1876:0.1088	.	.	.	.	X	5	.	ENSP00000242839:E5X	E	-	1	0	0	ATP7B	51483462	51483462	0.002000	0.14202	0.001000	0.08648	0.037000	0.13140	0.524000	0.22940	0.051000	0.15978	-0.378000	0.06908	GAG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.592	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	1	0	1	2	2	2	2	0	0	0	0	82	82	82	80	1	3.730000	-20.000000	1	0.550000	NM_000053		0	64	63	0	239	235	0		1	0		0	0	82	0	0	1.000000	2.888312e-01	0	0	0	5	0	64	239
COL4A1	1282	broad.mit.edu	37	13	110857736	110857736	+	Silent	SNP	G	G	A	rs138809869		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr13:110857736G>A	ENST00000375820.4	-	17	1042	c.921C>T	c.(919-921)ccC>ccT	p.P307P	COL4A1_ENST00000543140.1_Silent_p.P307P	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	307	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CTGGGTACCCGGGTTCACCAG	0.512																																						ENST00000375820.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999923	0.990000	1.000000																										0				105						c.(919-921)ccC>ccT		collagen, type IV, alpha 1		G		0,4406		0,0,2203	91.0	103.0	99.0		921	-10.1	0.0	13	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	COL4A1	NM_001845.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		307/1670	110857736	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1282	2	121412	36				g.chr13:110857736G>A	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.921C>T	chr13.hg19:g.110857736G>A		1					COL4A1_ENST00000543140.1_Silent_p.P307P	p.P307P	NM_001845.4	NP_001836.2	2	2	4	2.108966	P02462	CO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)	17	1042	-	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Silent	SNP	ENST00000375820.4	1	1	hg19	c.921C>T	CCDS9511.1	1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.512	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3	1	0	1	2	2	2	2	0	0	0	0	119	119	119	117	1	3.730000	-3.752635	1	0.550000			0	96	96	0	318	311	1		1	1		0	0	119	0	0	1.000000	9.999999e-01	0	8	0	71	0	96	318
MDGA2	161357	broad.mit.edu	37	14	47426671	47426671	+	Silent	SNP	G	G	A	rs368219229		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr14:47426671G>A	ENST00000399232.2	-	9	2152	c.1788C>T	c.(1786-1788)taC>taT	p.Y596Y	SNORA25_ENST00000515926.1_RNA|MDGA2_ENST00000439988.3_Silent_p.Y665Y|MDGA2_ENST00000426342.1_Silent_p.Y367Y|MDGA2_ENST00000357362.3_Silent_p.Y367Y	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	596	Ig-like 6.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCTTCACAGCGTACTCTGTGT	0.443																																						ENST00000399232.2	0.310000	9.000000e-02	0.250000	1.400000e-01	0.190000	0.201607	0.190000	0.200000																										0				76						c.(1786-1788)taC>taT		MAM domain containing glycosylphosphatidylinositol anchor 2		G	,	0,3798		0,0,1899	98.0	96.0	97.0		1995,1101	2.7	1.0	14		97	1,8243		0,1,4121	no	coding-synonymous,coding-synonymous	MDGA2	NM_001113498.2,NM_182830.3	,	0,1,6020	AA,AG,GG		0.0121,0.0,0.0083	,	665/1026,367/728	47426671	1,12041	1899	4122	6021	SO:0001819	synonymous_variant	161357	10	120838	42				g.chr14:47426671G>A	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1788C>T	chr14.hg19:g.47426671G>A		1					MDGA2_ENST00000357362.3_Silent_p.Y367Y|MDGA2_ENST00000426342.1_Silent_p.Y367Y|MDGA2_ENST00000439988.3_Silent_p.Y665Y|SNORA25_ENST00000515926.1_RNA	p.Y596Y	NM_001113498.2	NP_001106970.3	2	2	4	2.105174	Q7Z553	MDGA2_HUMAN		9	2152	-			F6W3S7|J3KPX6	Silent	SNP	ENST00000399232.2	1	1	hg19	c.1788C>T		0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.443	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	0	0	1	2	2	2	2	0	0	0	0	79	79	79	77	1	3.730000	-3.687590	1	0.550000	NM_182830		0	13	12	0	376	373	0		1			0	0	79	0	0	0.999520	0	0	0	0	0	0	13	376
RPS6KA5	9252	broad.mit.edu	37	14	91372565	91372565	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr14:91372565C>T	ENST00000261991.3	-	8	1058	c.885G>A	c.(883-885)atG>atA	p.M295I	RPS6KA5_ENST00000418736.2_Missense_Mutation_p.M295I|RPS6KA5_ENST00000536315.2_Missense_Mutation_p.M216I|RPS6KA5_ENST00000556304.1_5'UTR	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	295	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		TGGGATCTTTCATCAAAAGAC	0.383																																						ENST00000261991.3	0.170000	1.000000e-02	0.130000	5.000000e-02	0.080000	0.094387	0.080000	0.080000																										0				24						c.(883-885)atG>atA		ribosomal protein S6 kinase, 90kDa, polypeptide 5							114.0	106.0	108.0					14																	91372565		2203	4300	6503	SO:0001583	missense	9252	0	0					g.chr14:91372565C>T	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.885G>A	chr14.hg19:g.91372565C>T	ENSP00000261991:p.Met295Ile	1					RPS6KA5_ENST00000536315.2_Missense_Mutation_p.M216I|RPS6KA5_ENST00000556304.1_5'UTR|RPS6KA5_ENST00000418736.2_Missense_Mutation_p.M295I	p.M295I	NM_004755.2	NP_004746.2	2	2	4	2.105174	O75582	KS6A5_HUMAN		8	1058	-		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)	O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	0	1	hg19	c.885G>A	CCDS9893.1	0	.	.	.	.	.	.	.	.	.	.	C	12.75	2.031697	0.35797	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	T;T;T	0.52983	0.64;0.64;0.64	5.33	5.33	0.75918	5.33	5.33	0.75918	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.239079	0.49916	D	0.000136	T	0.24812	0.0602	N	0.03999	-0.3	0.41859	D	0.990216	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.09292	-1.0681	10	0.35671	T	0.21	.	9.9904	0.41868	0.0:0.8486:0.0:0.1514	.	295;295	O75582-2;O75582	.;KS6A5_HUMAN	I	295;216;295	ENSP00000261991:M295I;ENSP00000442803:M216I;ENSP00000402787:M295I	ENSP00000261991:M295I	M	-	3	0	0	RPS6KA5	90442318	90442318	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.240000	0.32731	2.640000	0.89533	0.585000	0.79938	ATG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.383	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	0	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	3.730000	-3.031096	1	0.550000	NM_004755		0	6	6	0	409	403	0		1	0		0	0	105	0	0	0.963634	0	0	0	0	1	0	6	409
VRK1	7443	broad.mit.edu	37	14	97319216	97319216	+	Missense_Mutation	SNP	A	A	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr14:97319216A>G	ENST00000216639.3	+	6	572	c.423A>G	c.(421-423)atA>atG	p.I141M		NM_003384.2	NP_003375.1	Q99986	VRK1_HUMAN	vaccinia related kinase 1	141	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Golgi disassembly (GO:0090166)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-T3 phosphorylation (GO:0072355)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi stack (GO:0005795)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H3-S10 specific) (GO:0035175)|histone kinase activity (H3-T3 specific) (GO:0072354)|nucleosomal histone binding (GO:0031493)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(1)|stomach(1)	12		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		TTCAGAAAATATATGAAGCAA	0.328																																						ENST00000216639.3	0.570000	2.600000e-01	0.490000	3.200000e-01	0.400000	0.411529	0.400000	0.400000																										0				12						c.(421-423)atA>atG		vaccinia related kinase 1							90.0	88.0	89.0					14																	97319216		2203	4300	6503	SO:0001583	missense	7443	0	0					g.chr14:97319216A>G	AB000449	CCDS9947.1	14q32.2	2012-07-05			ENSG00000100749	ENSG00000100749			12718	protein-coding gene	gene with protein product		602168				9344656	Standard	XM_006720247		Approved		uc001yft.3	Q99986	OTTHUMG00000171459	ENST00000216639.3:c.423A>G	chr14.hg19:g.97319216A>G	ENSP00000216639:p.Ile141Met	1						p.I141M	NM_003384.2	NP_003375.1	2	2	4	2.105174	Q99986	VRK1_HUMAN		6	572	+		Melanoma(154;0.155)	Q3SYL2	Missense_Mutation	SNP	ENST00000216639.3	1	1	hg19	c.423A>G	CCDS9947.1	0	.	.	.	.	.	.	.	.	.	.	A	13.20	2.165260	0.38217	.	.	ENSG00000100749	ENST00000216639	T	0.21191	2.02	5.76	3.01	0.34805	5.76	3.01	0.34805	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.418609	0.30446	N	0.009607	T	0.18509	0.0444	M	0.65498	2.005	0.41806	D	0.989943	P	0.44734	0.842	B	0.39876	0.312	T	0.07462	-1.0771	10	0.72032	D	0.01	-21.5458	1.8397	0.03147	0.4436:0.3034:0.106:0.1471	.	141	Q99986	VRK1_HUMAN	M	141	ENSP00000216639:I141M	ENSP00000216639:I141M	I	+	3	3	3	VRK1	96388969	96388969	0.957000	0.32711	1.000000	0.80357	0.997000	0.91878	0.138000	0.16016	0.978000	0.38470	0.482000	0.46254	ATA	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.328	VRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413520.1	1	0	1	2	2	2	2	0	0	0	0	57	57	57	55	1	3.730000	-20.000000	1	0.550000	NM_003384		0	24	24	0	316	313	0		1	1		0	0	57	0	0	1.000000	4.795262e-01	0	3	0	19	0	24	316
NIPA1	123606	broad.mit.edu	37	15	23049053	23049053	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr15:23049053C>T	ENST00000337435.4	-	5	790	c.766G>A	c.(766-768)Gac>Aac	p.D256N	NIPA1_ENST00000437912.2_Missense_Mutation_p.D181N|NIPA1_ENST00000538684.1_Missense_Mutation_p.D86N|NIPA1_ENST00000561183.1_Missense_Mutation_p.D181N	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	256					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		ACCGAGGAGTCGAAGCACTCC	0.612																																						ENST00000337435.4	0.530000	1.200000e-01	0.390000	1.900000e-01	0.270000	0.295742	0.270000	0.260000																										0				15						c.(766-768)Gac>Aac		non imprinted in Prader-Willi/Angelman syndrome 1							124.0	89.0	101.0					15																	23049053		2203	4300	6503	SO:0001583	missense	123606	0	0					g.chr15:23049053C>T	BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.766G>A	chr15.hg19:g.23049053C>T	ENSP00000337452:p.Asp256Asn	0					NIPA1_ENST00000437912.2_Missense_Mutation_p.D181N|NIPA1_ENST00000538684.1_Missense_Mutation_p.D86N|NIPA1_ENST00000561183.1_Missense_Mutation_p.D181N	p.D256N	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	2	2	4	2.074351	Q7RTP0	NIPA1_HUMAN		5	790	-		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)	B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Missense_Mutation	SNP	ENST00000337435.4	1	1	hg19	c.766G>A	CCDS10011.1	0	.	.	.	.	.	.	.	.	.	.	C	8.788	0.929927	0.18131	.	.	ENSG00000170113	ENST00000337435;ENST00000437912;ENST00000538684	D;D;D	0.87887	-2.31;-2.31;-2.31	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.090329	0.85682	D	0.000000	T	0.78394	0.4276	N	0.04880	-0.145	0.47737	D	0.999502	D	0.67145	0.996	P	0.49561	0.615	T	0.76677	-0.2871	10	0.02654	T	1	-31.8615	19.2935	0.94112	0.0:1.0:0.0:0.0	.	256	Q7RTP0	NIPA1_HUMAN	N	256;181;86	ENSP00000337452:D256N;ENSP00000393962:D181N;ENSP00000440957:D86N	ENSP00000337452:D256N	D	-	1	0	0	NIPA1	20600494	20600494	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.979000	0.56888	2.572000	0.86782	0.591000	0.81541	GAC	0.707602		TCGA-YY-A8LH-01A-11D-A36O-08	0.612	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251135.2	1	0	1	2	2	2	2	0	0	0	0	54	54	54	54	1	3.730000	-10.684450	1	0.550000	NM_144599		0	8	8	0	164	162	0		1	1		0	0	54	0	0	0.989394	3.115840e-01	0	4	0	18	0	8	164
MYO9A	4649	broad.mit.edu	37	15	72300289	72300289	+	Missense_Mutation	SNP	A	A	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr15:72300289A>G	ENST00000356056.5	-	8	1730	c.1258T>C	c.(1258-1260)Ttc>Ctc	p.F420L	RP11-390D11.1_ENST00000568391.1_RNA|MYO9A_ENST00000444904.1_Missense_Mutation_p.F401L|MYO9A_ENST00000564571.1_Missense_Mutation_p.F420L|MYO9A_ENST00000424560.1_Missense_Mutation_p.F420L|MYO9A_ENST00000566885.1_Missense_Mutation_p.F15L|MYO9A_ENST00000563542.1_5'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	420	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGAAGAGAGAAAATCCTGGGA	0.343																																						ENST00000356056.5	0.210000	2.000000e-02	0.150000	5.000000e-02	0.090000	0.109849	0.090000	0.080000																										0				88						c.(1258-1260)Ttc>Ctc		myosin IXA							90.0	92.0	91.0					15																	72300289		2199	4296	6495	SO:0001583	missense	4649	0	0					g.chr15:72300289A>G	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.1258T>C	chr15.hg19:g.72300289A>G	ENSP00000348349:p.Phe420Leu	1					MYO9A_ENST00000444904.1_Missense_Mutation_p.F401L|MYO9A_ENST00000563542.1_5'UTR|RP11-390D11.1_ENST00000568391.1_RNA|MYO9A_ENST00000424560.1_Missense_Mutation_p.F420L|MYO9A_ENST00000564571.1_Missense_Mutation_p.F420L|MYO9A_ENST00000566885.1_Missense_Mutation_p.F15L	p.F420L	NM_006901.3	NP_008832.2	2	2	4	2.138324	B2RTY4	MYO9A_HUMAN		8	1730	-			B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	0	1	hg19	c.1258T>C	CCDS10239.1	0	.	.	.	.	.	.	.	.	.	.	A	25.6	4.657601	0.88154	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864;ENST00000446448	D;D;D	0.87256	-2.23;-2.23;-2.23	5.28	5.28	0.74379	5.28	5.28	0.74379	Myosin head, motor domain (2);	.	.	.	.	D	0.89966	0.6868	L	0.59436	1.845	0.80722	D	1	D;P;P;P	0.69078	0.997;0.474;0.794;0.859	P;P;P;P	0.59643	0.861;0.523;0.523;0.781	D	0.90607	0.4549	9	0.72032	D	0.01	.	11.2077	0.48780	0.8465:0.1535:0.0:0.0	.	401;420;401;420	B2RTY4-2;B2RTY4-3;B7WP69;B2RTY4	.;.;.;MYO9A_HUMAN	L	420;420;401;401;420	ENSP00000348349:F420L;ENSP00000399162:F420L;ENSP00000398250:F401L	ENSP00000261864:F401L	F	-	1	0	0	MYO9A	70087343	70087343	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.834000	0.75339	2.107000	0.64212	0.460000	0.39030	TTC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.343	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257308.1	0	0	1	2	2	2	2	0	0	0	0	68	68	68	67	1	3.730000	-6.393507	1	0.550000	NM_006901		0	5	5	0	300	298	0		1	0		0	0	68	0	0	0.936960	4.441812e-04	0	0	0	2	0	5	300
BLM	641	broad.mit.edu	37	15	91303899	91303899	+	Silent	SNP	T	T	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr15:91303899T>C	ENST00000355112.3	+	7	1414	c.1296T>C	c.(1294-1296)ccT>ccC	p.P432P	BLM_ENST00000560509.1_Silent_p.P432P	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	432	Necessary for interaction with SPIDR.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GATACAGGCCTGATTCACTTG	0.418			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													ENST00000355112.3	0.100000	0	0.070000	2.000000e-02	0.040000	0.049176	0.040000	0.040000			yes	Rec		Bloom Syndrome	yes	Rec		Bloom Syndrome	15	15q26.1	15q26.1	641	Mis, N, F	Bloom Syndrome				"""L, E"""	L, E		leukemia, lymphoma, skin squamous cell , other cancers			0				51						c.(1294-1296)ccT>ccC	Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome, RecQ helicase-like							121.0	122.0	122.0					15																	91303899		2198	4298	6496	SO:0001819	synonymous_variant	641	0	0		Bloom syndrome	Familial Cancer Database		g.chr15:91303899T>C	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.1296T>C	chr15.hg19:g.91303899T>C		1					BLM_ENST00000560509.1_Silent_p.P432P	p.P432P	NM_000057.2	NP_000048.1	2	2	4	2.138324	P54132	BLM_HUMAN	Lung(145;0.189)	7	1414	+	Lung NSC(78;0.0875)|all_lung(78;0.109)		Q52M96	Silent	SNP	ENST00000355112.3	0	1	hg19	c.1296T>C	CCDS10363.1	0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.418	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1	0	0	1	2	2	2	2	0	0	0	0	213	213	213	210	1	3.730000	-2.454305	0	0.550000			0	7	7	0	856	849	0		1			0	0	213	0	0	0.980056	0	0	0	0	0	0	7	856
APRT	353	broad.mit.edu	37	16	88877975	88877975	+	Missense_Mutation	SNP	C	C	T	rs370646722		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr16:88877975C>T	ENST00000378364.3	-	2	214	c.170G>A	c.(169-171)cGc>cAc	p.R57H	APRT_ENST00000563655.1_Missense_Mutation_p.R57H|APRT_ENST00000426324.2_Missense_Mutation_p.R57H	NM_000485.2	NP_000476.1	P07741	APT_HUMAN	adenine phosphoribosyltransferase	57					adenine salvage (GO:0006168)|AMP salvage (GO:0044209)|cellular response to insulin stimulus (GO:0032869)|grooming behavior (GO:0007625)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	adenine binding (GO:0002055)|adenine phosphoribosyltransferase activity (GO:0003999)|AMP binding (GO:0016208)			cervix(1)|endometrium(1)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(80;0.0477)	Adenine(DB00173)|Adenosine monophosphate(DB00131)	GTAGTCGATGCGGCCCCCGTG	0.716																																						ENST00000378364.3	0.920000	1.500000e-01	0.690000	2.800000e-01	0.450000	0.488478	0.450000	1.000000																										0				3						c.(169-171)cGc>cAc		adenine phosphoribosyltransferase	Adenine(DB00173)|Adenosine monophosphate(DB00131)						8.0	8.0	8.0					16																	88877975		2116	4182	6298	SO:0001583	missense	353	0	0					g.chr16:88877975C>T		CCDS32511.1, CCDS45546.1	16q24	2012-10-02				ENSG00000198931	2.4.2.7		626	protein-coding gene	gene with protein product		102600					Standard	NM_000485		Approved		uc002flv.3	P07741		ENST00000378364.3:c.170G>A	chr16.hg19:g.88877975C>T	ENSP00000367615:p.Arg57His	1					APRT_ENST00000426324.2_Missense_Mutation_p.R57H|APRT_ENST00000563655.1_Missense_Mutation_p.R57H	p.R57H	NM_000485.2	NP_000476.1	2	2	4	2.139844	P07741	APT_HUMAN		2	214	-			G5E9J2|Q3KP55|Q68DF9	Missense_Mutation	SNP	ENST00000378364.3	0	1	hg19	c.170G>A	CCDS32511.1	0	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610499	0.46527	.	.	ENSG00000198931	ENST00000378364;ENST00000426324	D;D	0.99369	-3.3;-5.78	4.63	-0.359	0.12571	4.63	-0.359	0.12571	Phosphoribosyltransferase (1);	0.950123	0.08812	N	0.890115	D	0.95510	0.8541	N	0.03891	-0.335	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	D	0.90882	0.4754	10	0.72032	D	0.01	-3.3317	9.307	0.37881	0.0:0.5341:0.0:0.4659	.	57;57	G5E9J2;P07741	.;APT_HUMAN	H	57	ENSP00000367615:R57H;ENSP00000397007:R57H	ENSP00000367615:R57H	R	-	2	0	0	APRT	87405476	87405476	0.001000	0.12720	0.026000	0.17262	0.926000	0.56050	0.200000	0.17257	-0.387000	0.07809	0.313000	0.20887	CGC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.716	APRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430000.2	0	0	1	2	2	2	2	0	0	0	0	17	17	17	17	1	3.730000	-8.347408	1	0.550000	NM_000485		0	4	4	0	51	49	0		1	0		0	0	17	0	0	0.884115	9.999972e-01	0	1	0	945	0	4	51
MYH4	4622	broad.mit.edu	37	17	10350494	10350494	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:10350494C>T	ENST00000255381.2	-	35	5115	c.5005G>A	c.(5005-5007)Gat>Aat	p.D1669N	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1669					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.D1669N(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TTAAGGTCATCTTGGCCTCTG	0.478																																						ENST00000255381.2	0.580000	2.600000e-01	0.500000	3.300000e-01	0.400000	0.419218	0.400000	0.400000																										1	Substitution - Missense(1)	p.D1669N(1)	central_nervous_system(1)	149						c.(5005-5007)Gat>Aat		myosin, heavy chain 4, skeletal muscle							129.0	106.0	113.0					17																	10350494		2203	4300	6503	SO:0001583	missense	4622	0	0					g.chr17:10350494C>T		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5005G>A	chr17.hg19:g.10350494C>T	ENSP00000255381:p.Asp1669Asn	1					RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	p.D1669N	NM_017533.2	NP_060003.2	0	2	2	1.436748	Q9Y623	MYH4_HUMAN		35	5115	-				Missense_Mutation	SNP	ENST00000255381.2	1	1	hg19	c.5005G>A	CCDS11154.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.200015	0.94997	.	.	ENSG00000141048	ENST00000255381	T	0.79845	-1.31	5.29	5.29	0.74685	5.29	5.29	0.74685	Myosin tail (1);	0.189171	0.25052	U	0.033501	D	0.86226	0.5882	M	0.85197	2.74	0.52099	D	0.999943	P	0.37781	0.608	B	0.42462	0.388	D	0.88012	0.2763	10	0.72032	D	0.01	.	19.286	0.94069	0.0:1.0:0.0:0.0	.	1669	Q9Y623	MYH4_HUMAN	N	1669	ENSP00000255381:D1669N	ENSP00000255381:D1669N	D	-	1	0	0	MYH4	10291219	10291219	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.763000	0.85283	2.646000	0.89796	0.563000	0.77884	GAT	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.478	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	1	0	1	2	2	2	2	0	0	0	0	61	61	61	60	1	3.730000	-20.000000	1	0.550000	NM_017533		0	21	21	0	167	167	1		1	0		0	0	61	0	0	0.999998	1.905298e-01	0	0	0	7	0	21	167
MYO1D	4642	broad.mit.edu	37	17	31094737	31094737	+	Missense_Mutation	SNP	C	C	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:31094737C>G	ENST00000318217.5	-	7	1052	c.748G>C	c.(748-750)Gtt>Ctt	p.V250L	MYO1D_ENST00000579584.1_Missense_Mutation_p.V250L|MYO1D_ENST00000394649.4_Missense_Mutation_p.V162L|MYO1D_ENST00000583621.1_Missense_Mutation_p.V250L	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	250	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GCATCAGCAACAACTCTGAAT	0.388																																						ENST00000318217.5	0.190000	1.000000e-02	0.140000	5.000000e-02	0.090000	0.100544	0.090000	0.080000																										0				39						c.(748-750)Gtt>Ctt		myosin ID							100.0	84.0	90.0					17																	31094737		2203	4300	6503	SO:0001583	missense	4642	0	0					g.chr17:31094737C>G	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.748G>C	chr17.hg19:g.31094737C>G	ENSP00000324527:p.Val250Leu	1					MYO1D_ENST00000583621.1_Missense_Mutation_p.V250L|MYO1D_ENST00000394649.4_Missense_Mutation_p.V162L|MYO1D_ENST00000579584.1_Missense_Mutation_p.V250L	p.V250L	NM_015194.1	NP_056009.1	2	2	4	2.137762	O94832	MYO1D_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0362)	7	1052	-			A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	0	1	hg19	c.748G>C	CCDS32615.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.288156	0.95517	.	.	ENSG00000176658	ENST00000318217	D	0.86627	-2.15	6.0	6.0	0.97389	6.0	6.0	0.97389	Myosin head, motor domain (2);	0.000000	0.35646	U	0.003065	D	0.89329	0.6684	L	0.45698	1.435	0.58432	D	0.999999	P;P	0.51933	0.949;0.913	P;P	0.53760	0.734;0.649	D	0.89435	0.3719	10	0.62326	D	0.03	.	17.9887	0.89162	0.0:1.0:0.0:0.0	.	161;250	Q7Z3N6;O94832	.;MYO1D_HUMAN	L	250	ENSP00000324527:V250L	ENSP00000324527:V250L	V	-	1	0	0	MYO1D	28118850	28118850	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	7.487000	0.81328	2.848000	0.98002	0.655000	0.94253	GTT	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.388	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1	0	0	1	2	2	2	2	0	0	0	0	86	86	86	85	1	3.730000	-5.827601	1	0.550000			0	5	5	0	328	321	0		1	0		0	0	86	0	0	0.934451	2.711816e-01	0	0	0	57	0	5	328
CNTNAP1	8506	broad.mit.edu	37	17	40839935	40839935	+	Silent	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:40839935C>A	ENST00000264638.4	+	8	1459	c.1242C>A	c.(1240-1242)ctC>ctA	p.L414L	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	414	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		AGCTGACGCTCAGCGAAGGGC	0.637																																						ENST00000264638.4	1.000000	8.000000e-02	1.000000	1.200000e-01	0.180000	0.369384	0.180000	0.170000																										0				49						c.(1240-1242)ctC>ctA		contactin associated protein 1							58.0	57.0	57.0					17																	40839935		2203	4300	6503	SO:0001819	synonymous_variant	8506	0	0					g.chr17:40839935C>A	U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1242C>A	chr17.hg19:g.40839935C>A		1					CTD-3193K9.3_ENST00000592440.1_RNA	p.L414L	NM_003632.2	NP_003623.1	3	4	7	2.171898	P78357	CNTP1_HUMAN		8	1459	+		Breast(137;0.000143)		Silent	SNP	ENST00000264638.4	0	1	hg19	c.1242C>A	CCDS11436.1	0																																																																																								0.719626		TCGA-YY-A8LH-01A-11D-A36O-08	0.637	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	0	0	1	2	2	2	2	0	0	0	0	105	105	105	104	1	3.730000	-2.948390	1	0.550000	NM_003632		0	11	11	0	395	387	0		1	0		0	0	105	0	0	0.998194	1.751589e-02	0	0	0	7	0	11	395
RNF43	54894	broad.mit.edu	37	17	56434978	56434978	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:56434978G>A	ENST00000584437.1	-	8	4114	c.2159C>T	c.(2158-2160)tCa>tTa	p.S720L	RNF43_ENST00000407977.2_Missense_Mutation_p.S720L|RNF43_ENST00000583753.1_Missense_Mutation_p.S679L|RNF43_ENST00000577625.1_Missense_Mutation_p.S593L|RNF43_ENST00000577716.1_Missense_Mutation_p.S720L|RNF43_ENST00000500597.2_Missense_Mutation_p.S679L|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000581868.1_Missense_Mutation_p.S593L			Q68DV7	RNF43_HUMAN	ring finger protein 43	720	Pro-rich.				negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGTGAATTTGAGTAACAGGG	0.592																																						ENST00000584437.1	1.000000	3.600000e-01	1.000000	4.400000e-01	0.520000	0.603510	0.520000	0.500000																										0				60						c.(2158-2160)tCa>tTa		ring finger protein 43							83.0	88.0	86.0					17																	56434978		2203	4300	6503	SO:0001583	missense	54894	0	0					g.chr17:56434978G>A		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.2159C>T	chr17.hg19:g.56434978G>A	ENSP00000463069:p.Ser720Leu	1					RNF43_ENST00000407977.2_Missense_Mutation_p.S720L|RNF43_ENST00000583753.1_Missense_Mutation_p.S679L|RNF43_ENST00000500597.2_Missense_Mutation_p.S679L|RNF43_ENST00000581868.1_Missense_Mutation_p.S593L|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Missense_Mutation_p.S720L|RNF43_ENST00000577625.1_Missense_Mutation_p.S593L	p.S720L			0	3	3	1.475516	Q68DV7	RNF43_HUMAN		8	4114	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	1	1	hg19	c.2159C>T	CCDS11607.1	0	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720039	0.48728	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.08807	3.19;3.05	5.71	5.71	0.89125	5.71	5.71	0.89125	.	0.652107	0.13771	N	0.363914	T	0.10337	0.0253	N	0.19112	0.55	0.25753	N	0.985036	B;P;B	0.41131	0.13;0.739;0.079	B;P;B	0.45232	0.149;0.474;0.071	T	0.20940	-1.0260	10	0.66056	D	0.02	-8.0908	15.33	0.74200	0.0:0.0:1.0:0.0	.	679;720;720	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	L	720;679	ENSP00000385328:S720L;ENSP00000441969:S679L	ENSP00000385328:S720L	S	-	2	0	0	RNF43	53789977	53789977	1.000000	0.71417	0.989000	0.46669	0.968000	0.65278	3.986000	0.56937	2.698000	0.92095	0.511000	0.50034	TCA	0.626091		TCGA-YY-A8LH-01A-11D-A36O-08	0.592	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	1	0	1	2	2	2	2	0	0	0	0	126	126	126	126	1	3.730000	-3.142717	1	0.550000	NM_017763		0	37	37	0	284	282	1		1	1	1	0	0	126	462	0	1.000000	9.873056e-01	1	5	24	50	196	37	284
RNF43	54894	broad.mit.edu	37	17	56435359	56435359	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:56435359G>A	ENST00000584437.1	-	8	3733	c.1778C>T	c.(1777-1779)tCt>tTt	p.S593F	RNF43_ENST00000407977.2_Missense_Mutation_p.S593F|RNF43_ENST00000583753.1_Missense_Mutation_p.S552F|RNF43_ENST00000577625.1_Missense_Mutation_p.S466F|RNF43_ENST00000577716.1_Missense_Mutation_p.S593F|RNF43_ENST00000500597.2_Missense_Mutation_p.S552F|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000581868.1_Missense_Mutation_p.S466F			Q68DV7	RNF43_HUMAN	ring finger protein 43	593	Pro-rich.				negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGATCAGGAGAAGGTGGCTC	0.652																																						ENST00000584437.1	1.000000	3.900000e-01	1.000000	4.500000e-01	0.530000	0.611441	0.530000	0.520000																										0				60						c.(1777-1779)tCt>tTt		ring finger protein 43							66.0	78.0	74.0					17																	56435359		2201	4300	6501	SO:0001583	missense	54894	0	0					g.chr17:56435359G>A		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1778C>T	chr17.hg19:g.56435359G>A	ENSP00000463069:p.Ser593Phe	1					RNF43_ENST00000407977.2_Missense_Mutation_p.S593F|RNF43_ENST00000583753.1_Missense_Mutation_p.S552F|RNF43_ENST00000500597.2_Missense_Mutation_p.S552F|RNF43_ENST00000581868.1_Missense_Mutation_p.S466F|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Missense_Mutation_p.S593F|RNF43_ENST00000577625.1_Missense_Mutation_p.S466F	p.S593F			0	3	3	1.475516	Q68DV7	RNF43_HUMAN		8	3733	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	1	0	hg19	c.1778C>T	CCDS11607.1	0	.	.	.	.	.	.	.	.	.	.	G	5.168	0.216617	0.09810	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.21031	2.03;2.03	4.66	3.65	0.41850	4.66	3.65	0.41850	.	1.839710	0.02178	N	0.060263	T	0.17280	0.0415	N	0.24115	0.695	0.09310	N	1	B;B;B	0.14012	0.001;0.009;0.0	B;B;B	0.14023	0.005;0.01;0.002	T	0.19224	-1.0312	10	0.59425	D	0.04	-13.7741	5.2898	0.15721	0.1836:0.0:0.8164:0.0	.	552;593;593	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	F	593;552	ENSP00000385328:S593F;ENSP00000441969:S552F	ENSP00000385328:S593F	S	-	2	0	0	RNF43	53790358	53790358	0.633000	0.27181	0.009000	0.14445	0.257000	0.26127	3.840000	0.55843	1.049000	0.40321	0.205000	0.17691	TCT	0.626091		TCGA-YY-A8LH-01A-11D-A36O-08	0.652	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	1	0	0	2	2	2	4	0	0	0	0	143	143	143	143	1	3.730000	-18.988750	1	0.550000	NM_017763		0	51	51	0	381	374	0		1	1	1	0	1	143	513	0	1.000000	9.872006e-01	1	3	29	50	236	51	381
RNF43	54894	broad.mit.edu	37	17	56448366	56448366	+	Missense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:56448366C>A	ENST00000584437.1	-	2	2236	c.281G>T	c.(280-282)aGt>aTt	p.S94I	RNF43_ENST00000407977.2_Missense_Mutation_p.S94I|RNF43_ENST00000583753.1_Intron|RNF43_ENST00000577625.1_5'UTR|RNF43_ENST00000577716.1_Missense_Mutation_p.S94I|RNF43_ENST00000500597.2_Intron|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000581868.1_5'UTR			Q68DV7	RNF43_HUMAN	ring finger protein 43	94					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTCGTCATCACTGGCATTGCA	0.582																																						ENST00000584437.1	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999996	0.990000	1.000000																										0				60						c.(280-282)aGt>aTt		ring finger protein 43							86.0	71.0	76.0					17																	56448366		2203	4300	6503	SO:0001583	missense	54894	0	0					g.chr17:56448366C>A		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.281G>T	chr17.hg19:g.56448366C>A	ENSP00000463069:p.Ser94Ile	1					RNF43_ENST00000407977.2_Missense_Mutation_p.S94I|RNF43_ENST00000583753.1_Intron|RNF43_ENST00000500597.2_Intron|RNF43_ENST00000581868.1_5'UTR|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577716.1_Missense_Mutation_p.S94I|RNF43_ENST00000577625.1_5'UTR	p.S94I			0	3	3	1.475516	Q68DV7	RNF43_HUMAN		2	2236	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	1	1	hg19	c.281G>T	CCDS11607.1	1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006071	0.93287	.	.	ENSG00000108375	ENST00000407977	T	0.47177	0.85	5.45	5.45	0.79879	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.52597	0.1744	L	0.27053	0.805	0.80722	D	1	D	0.57257	0.979	P	0.60415	0.874	T	0.41787	-0.9489	10	0.22706	T	0.39	-22.6639	18.2765	0.90085	0.0:1.0:0.0:0.0	.	94	Q68DV7	RNF43_HUMAN	I	94	ENSP00000385328:S94I	ENSP00000385328:S94I	S	-	2	0	0	RNF43	53803365	53803365	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.495000	0.73665	2.555000	0.86185	0.655000	0.94253	AGT	0.626091		TCGA-YY-A8LH-01A-11D-A36O-08	0.582	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	1	0	1	2	2	2	2	0	0	0	0	66	66	66	65	1	3.730000	-20.000000	1	0.550000	NM_017763		0	60	59	0	112	111	1		1	1	1	0	0	66	596	0	1.000000	9.999600e-01	1	21	115	12	197	60	112
POLR2A	5430	broad.mit.edu	37	17	7416998	7416998	+	Silent	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:7416998C>T	ENST00000322644.6	+	29	5814	c.5415C>T	c.(5413-5415)tcC>tcT	p.S1805S		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1805	C-terminal domain (CTD); 52 X 7 AA approximate tandem repeats of Y-[ST]-P- [STQ]-[ST]-P-[SRTEVKGN].				7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CAAGTTACTCCCCTTCCAGCC	0.572																																						ENST00000322644.6	0.550000	3.800000e-01	0.510000	4.200000e-01	0.460000	0.472772	0.460000	0.470000																										0				50						c.(5413-5415)tcC>tcT		polymerase (RNA) II (DNA directed) polypeptide A, 220kDa							468.0	447.0	454.0					17																	7416998		2203	4300	6503	SO:0001819	synonymous_variant	5430	0	0					g.chr17:7416998C>T			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.5415C>T	chr17.hg19:g.7416998C>T		1						p.S1805S	NM_000937.4	NP_000928	0	2	2	1.436748	P24928	RPB1_HUMAN		29	5814	+		Prostate(122;0.173)	A6NN93|B9EH88|Q6NX41	Silent	SNP	ENST00000322644.6	1	1	hg19	c.5415C>T	CCDS32548.1	0																																																																																								0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.572	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	1	0	1	2	2	2	2	0	0	0	0	429	429	429	423	1	3.730000	-20.000000	1	0.550000	NM_000937		0	113	109	0	761	739	1		1	1		0	0	429	0	0	1.000000	1	0	59	0	253	0	113	761
ARHGEF15	22899	broad.mit.edu	37	17	8216367	8216367	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:8216367G>A	ENST00000361926.3	+	3	839	c.729G>A	c.(727-729)ccG>ccA	p.P243P	ARHGEF15_ENST00000421050.1_Silent_p.P243P	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	243					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GGGCCTCCCCGCTGCGGACCT	0.697																																						ENST00000361926.3	0.260000	8.000000e-02	0.210000	1.100000e-01	0.150000	0.165375	0.150000	0.160000																										0				37						c.(727-729)ccG>ccA		Rho guanine nucleotide exchange factor (GEF) 15							50.0	56.0	54.0					17																	8216367		2203	4299	6502	SO:0001819	synonymous_variant	22899	1	121406	33				g.chr17:8216367G>A	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.729G>A	chr17.hg19:g.8216367G>A		1					ARHGEF15_ENST00000421050.1_Silent_p.P243P	p.P243P	NM_173728.3	NP_776089.2	0	2	2	1.436748	O94989	ARHGF_HUMAN		3	839	+			A8K6G1|Q8N449|Q9H8B4	Silent	SNP	ENST00000361926.3	1	1	hg19	c.729G>A	CCDS11139.1	0																																																																																								0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.697	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	0	0	1	2	2	2	2	0	0	0	0	137	137	137	132	1	3.730000	-3.273029	1	0.550000	NM_173728		0	12	12	0	271	265	0		1	0		0	0	137	0	0	0.999055	6.465165e-03	0	0	0	3	0	12	271
HSF5	124535	broad.mit.edu	37	17	56557381	56557381	+	Silent	SNP	G	G	A	rs115372024	byFrequency	TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr17:56557381G>A	ENST00000323777.3	-	2	907	c.798C>T	c.(796-798)acC>acT	p.T266T		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	266					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCAGTGTATAGGTAACCTCAG	0.478													G|||	16	0.00319489	0.0113	0.0014	5008	,	,		18766	0.0		0.0	False		,,,				2504	0.0					ENST00000323777.3	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				16						c.(796-798)acC>acT		heat shock transcription factor family member 5		G		44,4362	46.7+/-81.2	0,44,2159	277.0	240.0	253.0		798	-0.4	1.0	17	dbSNP_132	253	0,8600		0,0,4300	no	coding-synonymous	HSF5	NM_001080439.1		0,44,6459	AA,AG,GG		0.0,0.9986,0.3383		266/597	56557381	44,12962	2203	4300	6503	SO:0001819	synonymous_variant	124535	104	121412	55				g.chr17:56557381G>A	BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.798C>T	chr17.hg19:g.56557381G>A		1						p.T266T	NM_001080439.1	NP_001073908.1	0	3	3	1.475516	Q4G112	HSF5_HUMAN		2	907	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		Q08EH7|Q8N7V2	Silent	SNP	ENST00000323777.3	1	1	hg19	c.798C>T	CCDS32690.1	1																																																																																								0.626091		TCGA-YY-A8LH-01A-11D-A36O-08	0.478	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1	1	0	1	2	2	2	2	0	0	0	0	185	185	185	182	1	3.730000	-2.920853	1	0.550000	XM_064190		0	135	134	0	277	274	1		1			0	0	185	0	0	1.000000	0	0	0	0	0	0	135	277
LAMA3	3909	broad.mit.edu	37	18	21355821	21355821	+	Missense_Mutation	SNP	C	C	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr18:21355821C>G	ENST00000313654.9	+	10	1580	c.1339C>G	c.(1339-1341)Cca>Gca	p.P447A	LAMA3_ENST00000399516.3_Missense_Mutation_p.P447A	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	447	Domain V.|Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TCACTGCAAGCCAAATTTCCA	0.498																																						ENST00000313654.9	1.000000	2.000000e-02	1.000000	6.000000e-02	0.110000	0.321365	0.110000	0.090000																										0				128						c.(1339-1341)Cca>Gca		laminin, alpha 3							78.0	75.0	76.0					18																	21355821		1972	4163	6135	SO:0001583	missense	3909	0	0					g.chr18:21355821C>G	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1339C>G	chr18.hg19:g.21355821C>G	ENSP00000324532:p.Pro447Ala	1					LAMA3_ENST00000399516.3_Missense_Mutation_p.P447A	p.P447A	NM_198129.1	NP_937762.1	3	3	6	2.191191	Q16787	LAMA3_HUMAN		10	1580	+	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	0	1	hg19	c.1339C>G	CCDS42419.1	0	.	.	.	.	.	.	.	.	.	.	C	7.523	0.657060	0.14580	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669;ENST00000538801	T;T	0.62105	0.05;0.05	4.76	1.88	0.25563	4.76	1.88	0.25563	EGF-like, laminin (4);EGF-like region, conserved site (1);	.	.	.	.	T	0.53158	0.1779	L	0.58510	1.815	0.48288	D	0.99962	B;B;B	0.34399	0.452;0.216;0.064	B;B;B	0.36567	0.228;0.069;0.069	T	0.37596	-0.9699	9	0.18710	T	0.47	.	7.7107	0.28675	0.0:0.7066:0.1346:0.1588	.	447;447;447	F5H8G3;Q6VU67;Q16787	.;.;LAMA3_HUMAN	A	447;447;445;447	ENSP00000324532:P447A;ENSP00000382432:P447A	ENSP00000324532:P447A	P	+	1	0	0	LAMA3	19609819	19609819	0.034000	0.19679	0.358000	0.25811	0.709000	0.40893	0.580000	0.23803	0.603000	0.29913	-0.186000	0.12905	CCA	0.721535		TCGA-YY-A8LH-01A-11D-A36O-08	0.498	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	0	0	1	2	2	2	2	0	0	0	0	89	89	89	89	1	3.730000	-4.506028	1	0.550000	NM_000227, NM_198129		0	6	6	0	371	366	0		1	0		0	0	89	0	0	0.963808	7.547252e-03	0	0	0	7	0	6	371
TCEB3B	51224	broad.mit.edu	37	18	44559687	44559687	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr18:44559687G>A	ENST00000332567.4	-	1	2301	c.1949C>T	c.(1948-1950)aCg>aTg	p.T650M	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	650	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						ATCATAAGGCGTCTTGGCCAC	0.537																																						ENST00000332567.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				58						c.(1948-1950)aCg>aTg		transcription elongation factor B polypeptide 3B (elongin A2)							132.0	133.0	133.0					18																	44559687		2203	4300	6503	SO:0001583	missense	51224	0	0					g.chr18:44559687G>A	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1949C>T	chr18.hg19:g.44559687G>A	ENSP00000331302:p.Thr650Met	1					KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron	p.T650M	NM_016427.2	NP_057511.2	3	4	7	2.256128	Q8IYF1	ELOA2_HUMAN		1	2301	-			Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	1	1	hg19	c.1949C>T	CCDS11932.1	1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307100	0.23821	.	.	ENSG00000206181	ENST00000332567	T	0.07216	3.21	1.4	-0.709	0.11237	1.4	-0.709	0.11237	.	0.754074	0.11156	U	0.593616	T	0.16471	0.0396	L	0.44542	1.39	0.09310	N	1	D	0.71674	0.998	D	0.71414	0.973	T	0.15636	-1.0430	10	0.62326	D	0.03	-1.8221	6.9376	0.24474	0.0:0.5733:0.4267:0.0	.	650	Q8IYF1	ELOA2_HUMAN	M	650	ENSP00000331302:T650M	ENSP00000331302:T650M	T	-	2	0	0	TCEB3B	42813685	42813685	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.276000	0.18716	-0.250000	0.09555	-0.222000	0.12452	ACG	0.728916		TCGA-YY-A8LH-01A-11D-A36O-08	0.537	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	1	0	1	2	2	2	2	0	0	0	0	280	280	280	279	1	3.730000	-20.000000	1	0.550000	NM_016427		0	261	259	0	598	585	1		1			0	0	280	0	0	1.000000	0	0	0	0	0	0	261	598
ZNF709	163051	broad.mit.edu	37	19	12575884	12575884	+	Silent	SNP	T	T	C	rs200559980		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:12575884T>C	ENST00000397732.3	-	4	1023	c.852A>G	c.(850-852)caA>caG	p.Q284Q	ZNF709_ENST00000428311.1_Silent_p.Q284Q|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	284					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						CTTTACCACATTGCTTACACT	0.373													T|||	1	0.000199681	0.0	0.0	5008	,	,		20833	0.001		0.0	False		,,,				2504	0.0				GBM(33;565 669 12371 29134 51667)	ENST00000397732.3	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				6						c.(850-852)caA>caG		zinc finger protein 709							32.0	34.0	34.0					19																	12575884		2160	4279	6439	SO:0001819	synonymous_variant	163051	1	121280	35				g.chr19:12575884T>C	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.852A>G	chr19.hg19:g.12575884T>C		1					ZNF709_ENST00000428311.1_Silent_p.Q284Q|CTD-3105H18.18_ENST00000598753.1_Intron	p.Q284Q	NM_152601.3	NP_689814.1	2	2	4	2.124233	Q8N972	ZN709_HUMAN		4	1023	-			A8K4E6	Silent	SNP	ENST00000397732.3	1	1	hg19	c.852A>G	CCDS42504.1	1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.373	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	1	0	1	2	2	2	2	0	0	0	0	108	108	108	104	1	3.730000	-20.000000	1	0.550000	NM_152601		0	142	140	0	268	266	0		1			0	0	108	0	0	1.000000	0	0	0	0	0	0	142	268
FARSA	2193	broad.mit.edu	37	19	13039582	13039582	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:13039582C>T	ENST00000314606.4	-	5	601	c.583G>A	c.(583-585)Gag>Aag	p.E195K	CTC-425F1.2_ENST00000592636.1_RNA|FARSA_ENST00000423140.2_Intron|FARSA_ENST00000588025.1_Missense_Mutation_p.E235K	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	195					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	GAGATCATCTCTGGGCTCAGC	0.627																																						ENST00000314606.4	1.000000	9.200000e-01	1.000000	9.900000e-01	0.990000	0.995726	0.990000	1.000000																										0				20						c.(583-585)Gag>Aag		phenylalanyl-tRNA synthetase, alpha subunit	L-Phenylalanine(DB00120)						114.0	96.0	103.0					19																	13039582		2203	4300	6503	SO:0001583	missense	2193	0	0					g.chr19:13039582C>T	U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.583G>A	chr19.hg19:g.13039582C>T	ENSP00000320309:p.Glu195Lys	1					FARSA_ENST00000588025.1_Missense_Mutation_p.E235K|CTC-425F1.2_ENST00000592636.1_RNA|FARSA_ENST00000423140.2_Intron	p.E195K	NM_004461.2	NP_004452.1	2	2	4	2.124233	Q9Y285	SYFA_HUMAN		5	601	-			B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	ENST00000314606.4	1	1	hg19	c.583G>A	CCDS12287.1	1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517058	0.85495	.	.	ENSG00000179115	ENST00000314606	T	0.68903	-0.36	4.94	4.94	0.65067	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.82342	0.5016	M	0.91872	3.25	0.80722	D	1	D;D	0.57571	0.98;0.98	P;P	0.55222	0.771;0.771	D	0.87035	0.2137	10	0.87932	D	0	-15.1624	17.0788	0.86593	0.0:1.0:0.0:0.0	.	195;195	Q6IBR2;Q9Y285	.;SYFA_HUMAN	K	195	ENSP00000320309:E195K	ENSP00000320309:E195K	E	-	1	0	0	FARSA	12900582	12900582	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.952000	0.75989	2.563000	0.86464	0.563000	0.77884	GAG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.627	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451935.1	1	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	3.730000	-3.497112	1	0.550000	NM_004461		0	61	61	0	231	228	1		1	1		0	0	91	0	0	1.000000	1	0	80	0	135	0	61	231
ZNF555	148254	broad.mit.edu	37	19	2852530	2852530	+	Missense_Mutation	SNP	G	G	A	rs370507327		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:2852530G>A	ENST00000334241.4	+	4	605	c.467G>A	c.(466-468)cGc>cAc	p.R156H	ZNF555_ENST00000591539.1_Missense_Mutation_p.R155H|AC006130.3_ENST00000589365.1_RNA	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGCATCGCCGCACATCCCTC	0.468																																						ENST00000334241.4	0.170000	1.000000e-02	0.120000	4.000000e-02	0.070000	0.086682	0.070000	0.080000																										0				23						c.(466-468)cGc>cAc		zinc finger protein 555							157.0	138.0	145.0					19																	2852530		2203	4300	6503	SO:0001583	missense	148254	2	121412	36				g.chr19:2852530G>A	AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.467G>A	chr19.hg19:g.2852530G>A	ENSP00000334853:p.Arg156His	1					ZNF555_ENST00000591539.1_Missense_Mutation_p.R155H|AC006130.3_ENST00000589365.1_RNA	p.R156H	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	2	2	4	2.124233	Q8NEP9	ZN555_HUMAN		4	605	+			A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	ENST00000334241.4	0	1	hg19	c.467G>A	CCDS12096.1	0	.	.	.	.	.	.	.	.	.	.	G	7.901	0.734449	0.15574	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.76448	-1.02	3.4	-6.8	0.01709	3.4	-6.8	0.01709	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.54062	0.1835	N	0.20685	0.6	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42965	-0.9420	9	0.12430	T	0.62	.	7.4147	0.27038	0.2247:0.2852:0.4901:0.0	.	156;155	Q8NEP9;A8KA89	ZN555_HUMAN;.	H	156;155	ENSP00000334853:R156H	ENSP00000334853:R156H	R	+	2	0	0	ZNF555	2803530	2803530	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.082000	0.14847	-1.664000	0.01479	-1.567000	0.00876	CGC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.468	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451637.3	0	0	1	2	2	2	2	0	0	0	0	91	91	91	91	1	3.730000	-2.200178	0	0.550000	NM_152791		0	5	5	0	380	376	0		1	0		0	0	91	0	0	0.936204	3.971434e-03	0	1	0	5	0	5	380
ZNF208	7757	broad.mit.edu	37	19	22171676	22171676	+	Missense_Mutation	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:22171676G>T	ENST00000397126.4	-	2	187	c.39C>A	c.(37-39)ttC>ttA	p.F13L	ZNF208_ENST00000601773.1_Missense_Mutation_p.F13L|ZNF208_ENST00000599916.1_Missense_Mutation_p.F13L|ZNF208_ENST00000597040.1_5'UTR	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	13	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCTCCAGAGAGAATTCTATGG	0.408																																						ENST00000397126.4	0.220000	8.000000e-02	0.180000	1.000000e-01	0.140000	0.150196	0.140000	0.160000																										0				113						c.(37-39)ttC>ttA		zinc finger protein 208							121.0	131.0	128.0					19																	22171676		2203	4300	6503	SO:0001583	missense	7757	0	0					g.chr19:22171676G>T	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.39C>A	chr19.hg19:g.22171676G>T	ENSP00000380315:p.Phe13Leu	1					ZNF208_ENST00000601773.1_Missense_Mutation_p.F13L|ZNF208_ENST00000599916.1_Missense_Mutation_p.F13L|ZNF208_ENST00000597040.1_5'UTR	p.F13L	NM_007153.3	NP_009084.2	2	2	4	2.124233	O43345	ZN208_HUMAN		2	187	-		all_lung(12;0.0961)|Lung NSC(12;0.103)		Missense_Mutation	SNP	ENST00000397126.4	1	1	hg19	c.39C>A	CCDS54240.1	0	.	.	.	.	.	.	.	.	.	.	G	12.00	1.805557	0.31961	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.12879	2.64	1.32	-0.37	0.12530	1.32	-0.37	0.12530	Krueppel-associated box (4);	.	.	.	.	T	0.22742	0.0549	.	.	.	0.09310	N	1	D;B	0.57571	0.98;0.087	P;B	0.60012	0.867;0.084	T	0.12785	-1.0534	8	0.72032	D	0.01	.	3.7697	0.08636	0.0:0.0:0.5735:0.4265	.	13;13	O43345;F8WEA0	ZN208_HUMAN;.	L	13	ENSP00000380315:F13L	ENSP00000380315:F13L	F	-	3	2	2	ZNF208	21963516	21963516	0.005000	0.15991	0.009000	0.14445	0.601000	0.36947	-0.135000	0.10420	0.636000	0.30508	0.281000	0.19383	TTC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.408	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	0	0	1	2	2	2	2	0	0	0	0	237	237	237	235	1	3.730000	-3.006749	1	0.550000	NM_007153		0	23	23	0	875	791	0		1	0		0	0	237	0	0	0.999998	0	0	0	0	1	0	23	875
ZNF536	9745	broad.mit.edu	37	19	30936183	30936183	+	Missense_Mutation	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:30936183G>T	ENST00000355537.3	+	2	1861	c.1714G>T	c.(1714-1716)Gat>Tat	p.D572Y		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	572					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGTGGGAGCAGATGGCTCCAA	0.527																																						ENST00000355537.3	0.650000	3.200000e-01	0.570000	3.900000e-01	0.470000	0.487515	0.470000	0.480000																										0				182						c.(1714-1716)Gat>Tat		zinc finger protein 536							82.0	87.0	85.0					19																	30936183		2203	4300	6503	SO:0001583	missense	9745	0	0					g.chr19:30936183G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1714G>T	chr19.hg19:g.30936183G>T	ENSP00000347730:p.Asp572Tyr	1						p.D572Y	NM_014717.1	NP_055532.1	2	2	4	2.124233	O15090	ZN536_HUMAN		2	1861	+	Esophageal squamous(110;0.0834)		A2RU18	Missense_Mutation	SNP	ENST00000355537.3	1	1	hg19	c.1714G>T	CCDS32984.1	0	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973891	0.34848	.	.	ENSG00000198597	ENST00000355537	T	0.46819	0.86	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.51450	-0.8704	10	0.08599	T	0.76	-22.8705	19.4573	0.94900	0.0:0.0:1.0:0.0	.	572;572	A7E228;O15090	.;ZN536_HUMAN	Y	572	ENSP00000347730:D572Y	ENSP00000347730:D572Y	D	+	1	0	0	ZNF536	35628023	35628023	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.435000	0.97529	2.582000	0.87167	0.655000	0.94253	GAT	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.527	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	1	0	1	2	2	2	2	0	0	0	0	108	108	108	106	1	3.730000	-20.000000	1	0.550000	NM_014717		0	30	30	0	326	320	0		1			0	0	108	0	0	1.000000	0	0	0	0	0	0	30	326
ZNF585B	92285	broad.mit.edu	37	19	37677796	37677796	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:37677796C>T	ENST00000532828.2	-	5	894	c.643G>A	c.(643-645)Gaa>Aaa	p.E215K	ZNF585B_ENST00000527838.1_Silent_p.*158*|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_5'UTR|ZNF585B_ENST00000531805.1_Missense_Mutation_p.E160K	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCACTACATTCATATAGTTTT	0.388																																					Melanoma(93;882 1454 18863 28917 48427)	ENST00000532828.2	0.150000	1.000000e-02	0.110000	4.000000e-02	0.070000	0.083343	0.070000	0.080000																										0				29						c.(643-645)Gaa>Aaa		zinc finger protein 585B							112.0	113.0	113.0					19																	37677796		2203	4300	6503	SO:0001583	missense	92285	0	0					g.chr19:37677796C>T	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.643G>A	chr19.hg19:g.37677796C>T	ENSP00000433773:p.Glu215Lys	1					ZNF585B_ENST00000531805.1_Missense_Mutation_p.E160K|ZNF585B_ENST00000312908.5_5'UTR|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_Silent_p.*158*	p.E215K	NM_152279.3	NP_689492.3	2	2	4	2.124233	Q52M93	Z585B_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	894	-			Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	0	1	hg19	c.643G>A	CCDS12500.1	0	.	.	.	.	.	.	.	.	.	.	C	0.207	-1.040081	0.02013	.	.	ENSG00000245680	ENST00000531805;ENST00000532828	T;T	0.19250	2.16;2.16	2.78	0.507	0.16967	2.78	0.507	0.16967	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.683944	0.12041	N	0.505100	T	0.06280	0.0162	N	0.04148	-0.265	0.09310	N	0.999998	B;B	0.14438	0.006;0.01	B;B	0.12156	0.007;0.007	T	0.37267	-0.9713	10	0.08599	T	0.76	.	0.6148	0.00767	0.1968:0.3698:0.1925:0.2409	.	160;215	E9PQH3;Q52M93	.;Z585B_HUMAN	K	160;215	ENSP00000436774:E160K;ENSP00000433773:E215K	ENSP00000436774:E160K	E	-	1	0	0	ZNF585B	42369636	42369636	0.000000	0.05858	0.080000	0.20451	0.159000	0.22180	-2.725000	0.00808	0.069000	0.16605	-0.384000	0.06662	GAA	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.388	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	0	0	1	2	2	2	2	0	0	0	0	171	171	171	171	1	3.730000	-3.077771	1	0.550000	NM_152279		0	8	8	0	600	592	0		1	0		0	0	171	0	0	0.988851	2.329209e-03	0	0	0	5	0	8	600
RYR1	6261	broad.mit.edu	37	19	39070714	39070714	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:39070714G>A	ENST00000359596.3	+	100	14457	c.14457G>A	c.(14455-14457)atG>atA	p.M4819I	RYR1_ENST00000355481.4_Missense_Mutation_p.M4814I|RYR1_ENST00000360985.3_Missense_Mutation_p.M4814I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4819					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACATCGCCATGGGGGTCAAGA	0.597																																						ENST00000359596.3	0.200000	2.000000e-02	0.150000	5.000000e-02	0.090000	0.105002	0.090000	0.080000																										0				285						c.(14455-14457)atG>atA		ryanodine receptor 1 (skeletal)	Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)						134.0	93.0	107.0					19																	39070714		2203	4300	6503	SO:0001583	missense	6261	0	0					g.chr19:39070714G>A	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14457G>A	chr19.hg19:g.39070714G>A	ENSP00000352608:p.Met4819Ile	1					RYR1_ENST00000360985.3_Missense_Mutation_p.M4814I|RYR1_ENST00000355481.4_Missense_Mutation_p.M4814I	p.M4819I			2	2	4	2.124233	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	100	14457	+	all_cancers(60;7.91e-06)		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	0	1	hg19	c.14457G>A	CCDS33011.1	0	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962210	0.53400	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98400	-4.91;-4.91;-4.91	4.57	4.57	0.56435	4.57	4.57	0.56435	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.98040	0.9354	L	0.38953	1.18	0.58432	D	0.999997	D;D	0.54964	0.962;0.969	D;D	0.70227	0.946;0.968	D	0.98600	1.0658	10	0.46703	T	0.11	.	17.129	0.86722	0.0:0.0:1.0:0.0	.	4814;4819	P21817-2;P21817	.;RYR1_HUMAN	I	4819;4814;4814	ENSP00000352608:M4819I;ENSP00000347667:M4814I;ENSP00000354254:M4814I	ENSP00000347667:M4814I	M	+	3	0	0	RYR1	43762554	43762554	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.612000	0.98347	2.357000	0.79964	0.462000	0.41574	ATG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.597	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1	0	0	1	2	2	2	2	0	0	0	0	80	80	80	80	1	3.730000	-2.795017	1	0.550000			0	5	5	0	314	308	0		1	0		0	0	80	0	0	0.934858	0	0	0	0	1	0	5	314
PSG6	5675	broad.mit.edu	37	19	43411250	43411250	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:43411250G>A	ENST00000292125.2	-	5	1108	c.1064C>T	c.(1063-1065)gCg>gTg	p.A355V	PSG6_ENST00000187910.2_Missense_Mutation_p.A355V|PSG6_ENST00000402603.4_Missense_Mutation_p.A262V	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	355	Ig-like C2-type 3.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GTTAGAGTCCGCAAAGCAGGA	0.448																																						ENST00000292125.2	1.000000	0	1.000000	2.000000e-02	0.040000	0.271785	0.040000	0.040000																										0				44						c.(1063-1065)gCg>gTg		pregnancy specific beta-1-glycoprotein 6							185.0	196.0	192.0					19																	43411250		2201	4299	6500	SO:0001583	missense	5675	3	121350	44				g.chr19:43411250G>A		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.1064C>T	chr19.hg19:g.43411250G>A	ENSP00000292125:p.Ala355Val	1					PSG6_ENST00000187910.2_Missense_Mutation_p.A355V|PSG6_ENST00000402603.4_Missense_Mutation_p.A262V	p.A355V	NM_002782.4	NP_002773.1	3	3	6	2.212610	Q00889	PSG6_HUMAN		5	1108	-		Prostate(69;0.00899)	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	0	1	hg19	c.1064C>T	CCDS12613.1	0	.	.	.	.	.	.	.	.	.	.	N	9.184	1.024244	0.19433	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125	T;T;T	0.14144	2.53;2.53;2.53	1.54	1.54	0.23209	1.54	1.54	0.23209	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.13500	0.0327	L	0.50847	1.595	0.09310	N	0.999998	B;B;B	0.34372	0.132;0.292;0.451	B;B;B	0.36244	0.184;0.22;0.185	T	0.20840	-1.0263	9	0.59425	D	0.04	.	6.5495	0.22425	0.0:0.0:1.0:0.0	.	355;355;262	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	V	355;262;355	ENSP00000187910:A355V;ENSP00000385736:A262V;ENSP00000292125:A355V	ENSP00000187910:A355V	A	-	2	0	0	PSG6	48103090	48103090	0.001000	0.12720	0.002000	0.10522	0.014000	0.08584	0.729000	0.26028	0.854000	0.35336	0.134000	0.15878	GCG	0.725275		TCGA-YY-A8LH-01A-11D-A36O-08	0.448	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	0	0	1	2	2	2	2	0	0	0	0	307	307	307	305	1	3.730000	-1.713217	0	0.550000	NM_002782		0	8	7	0	1085	1068	0		1			0	0	307	0	0	0.988613	0	0	0	0	0	0	8	1085
GPR4	2828	broad.mit.edu	37	19	46094142	46094142	+	Missense_Mutation	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:46094142G>T	ENST00000323040.4	-	2	1927	c.983C>A	c.(982-984)aCc>aAc	p.T328N	GPR4_ENST00000591614.1_5'Flank|OPA3_ENST00000544371.1_Intron	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	328					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		CCTCTTGGAGGTGAGTGGGGT	0.652																																					Esophageal Squamous(117;181 1612 1673 14956 42937)	ENST00000323040.4	1.000000	8.000000e-02	1.000000	1.300000e-01	0.190000	0.378109	0.190000	0.170000																										0				23						c.(982-984)aCc>aAc		G protein-coupled receptor 4							95.0	85.0	88.0					19																	46094142		2203	4300	6503	SO:0001583	missense	2828	0	0					g.chr19:46094142G>T	BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.983C>A	chr19.hg19:g.46094142G>T	ENSP00000319744:p.Thr328Asn	1					GPR4_ENST00000591614.1_5'Flank|OPA3_ENST00000544371.1_Intron	p.T328N	NM_005282.2	NP_005273.1	3	6	9	2.722969	P46093	GPR4_HUMAN		2	1927	-			A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000323040.4	1	1	hg19	c.983C>A	CCDS12669.1	0	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674372	0.47781	.	.	ENSG00000177464	ENST00000323040	T	0.61742	0.08	4.53	4.53	0.55603	4.53	4.53	0.55603	.	0.190762	0.35378	N	0.003255	T	0.32133	0.0819	N	0.08118	0	0.30785	N	0.741534	B	0.34103	0.437	B	0.27500	0.08	T	0.28870	-1.0030	10	0.19147	T	0.46	.	12.6317	0.56661	0.0:0.0:1.0:0.0	.	328	P46093	GPR4_HUMAN	N	328	ENSP00000319744:T328N	ENSP00000319744:T328N	T	-	2	0	0	GPR4	50785982	50785982	0.977000	0.34250	0.425000	0.26659	0.971000	0.66376	6.583000	0.74053	2.356000	0.79943	0.455000	0.32223	ACC	0.775112		TCGA-YY-A8LH-01A-11D-A36O-08	0.652	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1	0	0	1	2	2	2	2	0	0	0	0	119	119	119	118	1	3.730000	-3.414721	1	0.550000	NM_005282		0	13	13	0	552	544	0		1	0		0	0	119	0	0	0.999494	7.432037e-02	0	0	0	18	0	13	552
NANOS2	339345	broad.mit.edu	37	19	46417571	46417571	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:46417571G>A	ENST00000341294.2	-	1	465	c.381C>T	c.(379-381)agC>agT	p.S127S		NM_001029861.2	NP_001025032.1	P60321	NANO2_HUMAN	nanos homolog 2 (Drosophila)	127					germ-line stem cell maintenance (GO:0030718)|mRNA catabolic process (GO:0006402)|multicellular organismal development (GO:0007275)|negative regulation of meiosis (GO:0045835)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	mRNA binding (GO:0003729)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	6		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0668)|Epithelial(262;0.231)		AGTTGCGCCCGCTGCGGCGGT	0.667																																						ENST00000341294.2	1.000000	3.100000e-01	1.000000	4.300000e-01	0.610000	0.672828	0.610000	0.520000																										0				6						c.(379-381)agC>agT		nanos homolog 2 (Drosophila)							28.0	27.0	28.0					19																	46417571		2201	4299	6500	SO:0001819	synonymous_variant	339345	0	0					g.chr19:46417571G>A	BC042883	CCDS33056.1	19q13.32	2003-12-01				ENSG00000188425			23292	protein-coding gene	gene with protein product		608228				12947200, 12690449	Standard	NM_001029861		Approved	NOS2	uc002pdu.3	P60321		ENST00000341294.2:c.381C>T	chr19.hg19:g.46417571G>A		1						p.S127S	NM_001029861.2	NP_001025032.1	3	6	9	2.722969	P60321	NANO2_HUMAN		1	465	-		Ovarian(192;0.0308)|all_neural(266;0.0476)	Q17R30|Q4G0P8	Silent	SNP	ENST00000341294.2	1	1	hg19	c.381C>T	CCDS33056.1	0																																																																																								0.775112		TCGA-YY-A8LH-01A-11D-A36O-08	0.667	NANOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461685.1	1	0	1	2	2	2	2	0	0	0	0	34	34	34	34	1	3.730000	-16.511560	1	0.550000			0	12	11	0	152	150	0		1			0	0	34	0	0	0.999137	0	0	0	0	0	0	12	152
ZNF350	59348	broad.mit.edu	37	19	52469393	52469393	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:52469393C>A	ENST00000243644.4	-	5	540	c.313G>T	c.(313-315)Gaa>Taa	p.E105*	ZNF350_ENST00000600703.1_5'Flank|HCCAT3_ENST00000595010.1_RNA|HCCAT3_ENST00000600253.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	105					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		GCATCATGTTCATGACATGGT	0.363																																						ENST00000243644.4	0.160000	2.000000e-02	0.130000	5.000000e-02	0.080000	0.092338	0.080000	0.080000																										0				26						c.(313-315)Gaa>Taa		zinc finger protein 350							70.0	71.0	71.0					19																	52469393		2203	4299	6502	SO:0001587	stop_gained	59348	0	0					g.chr19:52469393C>A	AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.313G>T	chr19.hg19:g.52469393C>A	ENSP00000243644:p.Glu105*	1					HCCAT3_ENST00000600253.1_RNA|HCCAT3_ENST00000595010.1_RNA|ZNF350_ENST00000600703.1_5'Flank	p.E105*	NM_021632.3	NP_067645.3	2	2	4	2.155460	Q9GZX5	ZN350_HUMAN		5	540	-		all_neural(266;0.0505)	Q96G73|Q9HAQ4	Nonsense_Mutation	SNP	ENST00000243644.4	0	1	hg19	c.313G>T	CCDS12845.1	0	.	.	.	.	.	.	.	.	.	.	C	16.19	3.054148	0.55218	.	.	ENSG00000256683	ENST00000243644	.	.	.	3.25	-3.54	0.04653	3.25	-3.54	0.04653	.	0.733993	0.11162	N	0.592957	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	4.1621	0.10289	0.0:0.3024:0.19:0.5075	.	.	.	.	X	105	.	ENSP00000243644:E105X	E	-	1	0	0	ZNF350	57161205	57161205	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.533000	0.06157	-0.395000	0.07715	-0.142000	0.14014	GAA	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.363	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	0	0	1	2	2	2	2	0	0	0	0	131	131	131	130	1	3.730000	-2.781414	1	0.550000	NM_021632		0	8	7	0	541	536	0		1	0		0	0	131	0	0	0.988890	1.706219e-02	0	0	0	12	0	8	541
RPL36	25873	broad.mit.edu	37	19	5691442	5691442	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:5691442C>T	ENST00000577222.1	+	5	750	c.206C>T	c.(205-207)gCc>gTc	p.A69V	RPL36_ENST00000347512.3_Missense_Mutation_p.A69V|RPL36_ENST00000579649.1_Missense_Mutation_p.A69V|RPL36_ENST00000394580.2_Missense_Mutation_p.A69V|RPL36_ENST00000579446.1_Missense_Mutation_p.A69V			Q9Y3U8	RL36_HUMAN	ribosomal protein L36	69					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|upper_aerodigestive_tract(1)	2						GACAAACGGGCCCTCAAATTT	0.642											OREG0025183	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000577222.1	0.200000	3.000000e-02	0.160000	6.000000e-02	0.100000	0.115033	0.100000	0.110000																										0				2						c.(205-207)gCc>gTc		ribosomal protein L36							44.0	49.0	47.0					19																	5691442		2203	4299	6502	SO:0001583	missense	25873	0	0					g.chr19:5691442C>T		CCDS12147.1	19p13.2	2011-04-06				ENSG00000130255		"""L ribosomal proteins"""	13631	protein-coding gene	gene with protein product							Standard	NM_033643		Approved	DKFZp566B023, L36	uc002mcv.3	Q9Y3U8		ENST00000577222.1:c.206C>T	chr19.hg19:g.5691442C>T	ENSP00000464342:p.Ala69Val	1		OREG0025183	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	628	RPL36_ENST00000579649.1_Missense_Mutation_p.A69V|RPL36_ENST00000394580.2_Missense_Mutation_p.A69V|RPL36_ENST00000579446.1_Missense_Mutation_p.A69V|RPL36_ENST00000347512.3_Missense_Mutation_p.A69V	p.A69V			2	2	4	2.124233	Q9Y3U8	RL36_HUMAN		5	750	+			B2R4Y1|D6W634|Q6FIG1|Q9UQF6	Missense_Mutation	SNP	ENST00000577222.1	0	1	hg19	c.206C>T	CCDS12147.1	0	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311575	0.81358	.	.	ENSG00000130255	ENST00000347512;ENST00000394580	T;T	0.60920	0.15;0.15	4.21	4.21	0.49690	4.21	4.21	0.49690	.	0.000000	0.85682	U	0.000000	T	0.77850	0.4192	H	0.95574	3.69	0.80722	D	1	P	0.48503	0.911	P	0.53360	0.724	D	0.85194	0.1011	10	0.72032	D	0.01	.	14.0553	0.64764	0.0:1.0:0.0:0.0	.	69	Q9Y3U8	RL36_HUMAN	V	69	ENSP00000252543:A69V;ENSP00000378081:A69V	ENSP00000252543:A69V	A	+	2	0	0	RPL36	5642442	5642442	1.000000	0.71417	0.959000	0.39883	0.303000	0.27691	7.568000	0.82369	1.881000	0.54492	0.467000	0.42956	GCC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.642	RPL36-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442561.1	0	0	0	2	2	2	2	0	0	0	0	106	106	106	105	1	3.730000	-3.075512	1	0.550000	NM_015414		0	7	7	0	383	376	0		1	1		0	0	106	0	0	0.979350	1	0	85	0	6342	0	7	383
MUC16	94025	broad.mit.edu	37	19	9058858	9058858	+	Missense_Mutation	SNP	C	C	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:9058858C>G	ENST00000397910.4	-	3	28791	c.28588G>C	c.(28588-28590)Gag>Cag	p.E9530Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9532	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAGAGTTCCTCTGTAGCACTG	0.483																																						ENST00000397910.4	0.320000	9.000000e-02	0.260000	1.400000e-01	0.190000	0.202186	0.190000	0.200000																										0				590						c.(28588-28590)Gag>Cag		mucin 16, cell surface associated							116.0	116.0	116.0					19																	9058858		1961	4150	6111	SO:0001583	missense	94025	0	0					g.chr19:9058858C>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28588G>C	chr19.hg19:g.9058858C>G	ENSP00000381008:p.Glu9530Gln	1						p.E9530Q	NM_024690.2	NP_078966.2	2	2	4	2.124233	Q8WXI7	MUC16_HUMAN		3	28791	-			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	1	1	hg19	c.28588G>C	CCDS54212.1	0	.	.	.	.	.	.	.	.	.	.	c	5.207	0.223796	0.09863	.	.	ENSG00000181143	ENST00000397910	T	0.21734	1.99	2.3	-0.0756	0.13726	2.3	-0.0756	0.13726	.	.	.	.	.	T	0.10465	0.0256	N	0.08118	0	.	.	.	B	0.16603	0.018	B	0.17979	0.02	T	0.16748	-1.0392	8	0.87932	D	0	.	8.0918	0.30805	0.0:0.5336:0.4664:0.0	.	9530	B5ME49	.	Q	9530	ENSP00000381008:E9530Q	ENSP00000381008:E9530Q	E	-	1	0	0	MUC16	8919858	8919858	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.149000	0.10204	0.072000	0.16694	0.305000	0.20034	GAG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1	2	2	2	2	0	0	0	0	95	95	95	95	1	3.730000	-2.928019	1	0.550000	NM_024690		0	12	11	0	348	346	0		1			0	0	95	0	0	0.999108	0	0	0	0	0	0	12	348
PPP2R1A	5518	broad.mit.edu	37	19	52714630	52714630	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr19:52714630C>T	ENST00000322088.6	+	4	446	c.388C>T	c.(388-390)Ccg>Tcg	p.P130S	PPP2R1A_ENST00000444322.2_Missense_Mutation_p.P75S|PPP2R1A_ENST00000473455.2_3'UTR|PPP2R1A_ENST00000462990.1_5'UTR	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	130	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.			P -> A (in Ref. 1; AAA35531). {ECO:0000305}.	apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		GCACTTTGTGCCGCTAGTGAA	0.657			Mis		clear cell ovarian carcinoma																																	ENST00000322088.6	0.150000	1.000000e-02	0.110000	3.000000e-02	0.070000	0.078196	0.070000	0.080000				Dom?	yes			Dom?	yes		19	19q13.41	19q13.41	5518	Mis	"""protein phosphatase 2, regulatory subunit A, alpha"""				E	E			clear cell ovarian carcinoma		0				135						c.(388-390)Ccg>Tcg		protein phosphatase 2, regulatory subunit A, alpha							62.0	66.0	65.0					19																	52714630		2203	4300	6503	SO:0001583	missense	5518	0	0					g.chr19:52714630C>T		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.388C>T	chr19.hg19:g.52714630C>T	ENSP00000324804:p.Pro130Ser	1					PPP2R1A_ENST00000462990.1_5'UTR|PPP2R1A_ENST00000473455.2_3'UTR|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.P75S	p.P130S	NM_014225.5	NP_055040.2	2	2	4	2.155460	P30153	2AAA_HUMAN		4	446	+			Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	0	1	hg19	c.388C>T	CCDS12849.1	0	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624587	0.46840	.	.	ENSG00000105568	ENST00000423369;ENST00000322088;ENST00000444322	T;T	0.35973	1.28;1.28	4.46	4.46	0.54185	4.46	4.46	0.54185	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000011	T	0.43897	0.1268	M	0.85373	2.75	0.58432	D	0.999999	P;P;P	0.37233	0.493;0.588;0.588	B;B;B	0.34301	0.179;0.102;0.102	T	0.56757	-0.7926	10	0.66056	D	0.02	-36.5931	15.0187	0.71609	0.0:1.0:0.0:0.0	.	75;130;130	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	S	120;130;75	ENSP00000324804:P130S;ENSP00000415067:P75S	ENSP00000324804:P130S	P	+	1	0	0	PPP2R1A	57406442	57406442	1.000000	0.71417	0.994000	0.49952	0.038000	0.13279	6.787000	0.75099	2.482000	0.83794	0.655000	0.94253	CCG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.657	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	0	0	1	2	2	14	2	1	1	1	0	110	110	110	80	1	3.730000	-2.559621	1	0.550000	NM_014225		0	5	5	0	420	365	0		1	0		1	0	110	0	0	0.911943	2.656785e-02	0	0	0	414	0	5	420
COL11A1	1301	broad.mit.edu	37	1	103427802	103427802	+	Missense_Mutation	SNP	C	C	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:103427802C>G	ENST00000370096.3	-	40	3356	c.3044G>C	c.(3043-3045)gGt>gCt	p.G1015A	COL11A1_ENST00000353414.4_Missense_Mutation_p.G976A|COL11A1_ENST00000358392.2_Missense_Mutation_p.G1027A|COL11A1_ENST00000512756.1_Missense_Mutation_p.G899A	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1015	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCCTGAGATACCTTGAGGACC	0.383																																						ENST00000370096.3	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999988	0.990000	1.000000																										0				258						c.(3043-3045)gGt>gCt		collagen, type XI, alpha 1							85.0	87.0	87.0					1																	103427802		2203	4300	6503	SO:0001583	missense	1301	0	0					g.chr1:103427802C>G	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3044G>C	chr1.hg19:g.103427802C>G	ENSP00000359114:p.Gly1015Ala	1					COL11A1_ENST00000512756.1_Missense_Mutation_p.G899A|COL11A1_ENST00000358392.2_Missense_Mutation_p.G1027A|COL11A1_ENST00000353414.4_Missense_Mutation_p.G976A	p.G1015A	NM_001854.3	NP_001845.3	0	4	4	1.660921	P12107	COBA1_HUMAN		40	3356	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	1	1	hg19	c.3044G>C	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822094	0.71028	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.99607	-6.27;-6.27;-6.27;-6.27	5.37	5.37	0.77165	5.37	5.37	0.77165	.	0.061018	0.64402	D	0.000003	D	0.99753	0.9901	M	0.92880	3.355	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.87578	0.997;0.998;0.998;0.995;0.994	D	0.97603	1.0124	10	0.59425	D	0.04	.	19.1062	0.93296	0.0:1.0:0.0:0.0	.	899;976;1027;1015;235	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	A	1015;1027;976;235;899	ENSP00000359114:G1015A;ENSP00000351163:G1027A;ENSP00000302551:G976A;ENSP00000426533:G899A	ENSP00000302551:G976A	G	-	2	0	0	COL11A1	103200390	103200390	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.404000	0.79996	2.509000	0.84616	0.557000	0.71058	GGT	0.631148		TCGA-YY-A8LH-01A-11D-A36O-08	0.383	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	1	0	1	2	2	2	2	0	0	0	0	94	94	94	94	1	3.730000	-20.000000	1	0.550000	NM_080630		0	98	98	0	225	221	1		1	0		0	0	94	0	0	1.000000	5.880410e-01	0	0	0	6	0	98	225
PSMB4	5692	broad.mit.edu	37	1	151372581	151372581	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:151372581C>T	ENST00000290541.6	+	2	319	c.265C>T	c.(265-267)Cga>Tga	p.R89*		NM_002796.2	NP_002787.2	P28070	PSB4_HUMAN	proteasome (prosome, macropain) subunit, beta type, 4	89					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	lipopolysaccharide binding (GO:0001530)|threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|lung(9)|ovary(2)|prostate(1)|skin(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCGCATTATGCGAGTCAACAA	0.537																																						ENST00000290541.6	1.000000	0	1.000000	3.000000e-02	0.060000	0.276291	0.060000	0.060000																										0				14						c.(265-267)Cga>Tga		proteasome (prosome, macropain) subunit, beta type, 4							168.0	169.0	168.0					1																	151372581		2203	4300	6503	SO:0001587	stop_gained	5692	0	0					g.chr1:151372581C>T	D26600	CCDS996.1	1q21	2008-02-05			ENSG00000159377	ENSG00000159377		"""Proteasome (prosome, macropain) subunits"""	9541	protein-coding gene	gene with protein product		602177				7918633	Standard	NM_002796		Approved	HN3, PROS26	uc001eyc.1	P28070	OTTHUMG00000012494	ENST00000290541.6:c.265C>T	chr1.hg19:g.151372581C>T	ENSP00000290541:p.Arg89*	1						p.R89*	NM_002796.2	NP_002787.2	3	5	8	2.670671	P28070	PSB4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)	2	319	+	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		B2R9L3|P31148|Q5SZS5|Q6IBI4|Q969L6	Nonsense_Mutation	SNP	ENST00000290541.6	0	1	hg19	c.265C>T	CCDS996.1	0	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459609	0.84317	.	.	ENSG00000159377	ENST00000290541	.	.	.	5.34	2.32	0.28847	5.34	2.32	0.28847	.	0.261003	0.36703	N	0.002445	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-0.0211	13.7733	0.63038	0.6506:0.3494:0.0:0.0	.	.	.	.	X	89	.	ENSP00000290541:R89X	R	+	1	2	2	PSMB4	149639205	149639205	0.998000	0.40836	0.954000	0.39281	0.610000	0.37248	0.845000	0.27668	0.197000	0.20387	-0.314000	0.08810	CGA	0.773869		TCGA-YY-A8LH-01A-11D-A36O-08	0.537	PSMB4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034885.1	0	0	0	2	2	2	2	0	0	0	0	263	263	263	260	1	3.730000	-1.724933	0	0.550000	NM_002796		0	7	7	0	1111	1097	0		1	1		0	0	263	0	0	0.979696	9.915177e-01	0	3	0	1382	0	7	1111
GATAD2B	57459	broad.mit.edu	37	1	153789912	153789912	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:153789912G>A	ENST00000368655.4	-	6	1079	c.836C>T	c.(835-837)cCg>cTg	p.P279L		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	279					ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGGCTTAGGCGGGCCCCGCTG	0.527																																						ENST00000368655.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				38						c.(835-837)cCg>cTg		GATA zinc finger domain containing 2B							115.0	101.0	106.0					1																	153789912		2203	4300	6503	SO:0001583	missense	57459	6	121412	39				g.chr1:153789912G>A	AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.836C>T	chr1.hg19:g.153789912G>A	ENSP00000357644:p.Pro279Leu	1						p.P279L	NM_020699.2	NP_065750.1	3	5	8	2.670671	Q8WXI9	P66B_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)	6	1079	-	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	ENST00000368655.4	1	1	hg19	c.836C>T	CCDS1054.1	1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284508	0.40394	.	.	ENSG00000143614	ENST00000368655	T	0.35605	1.3	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.054498	0.85682	D	0.000000	T	0.19248	0.0462	L	0.38175	1.15	0.80722	D	1	D	0.53619	0.961	B	0.36989	0.238	T	0.02126	-1.1209	10	0.40728	T	0.16	-4.5218	19.3531	0.94398	0.0:0.0:1.0:0.0	.	279	Q8WXI9	P66B_HUMAN	L	279	ENSP00000357644:P279L	ENSP00000357644:P279L	P	-	2	0	0	GATAD2B	152056536	152056536	1.000000	0.71417	0.931000	0.37212	0.149000	0.21700	6.016000	0.70798	2.941000	0.99782	0.655000	0.94253	CCG	0.773869		TCGA-YY-A8LH-01A-11D-A36O-08	0.527	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090305.1	1	0	1	2	2	2	2	0	0	0	0	79	79	79	79	1	3.730000	-6.151129	1	0.550000	NM_020699		0	103	100	0	284	279	1		1	1		0	0	79	0	0	1.000000	6.720691e-01	0	2	0	6	0	103	284
ADAR	103	broad.mit.edu	37	1	154569625	154569625	+	Missense_Mutation	SNP	T	T	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:154569625T>C	ENST00000368474.4	-	5	2252	c.2053A>G	c.(2053-2055)Acc>Gcc	p.T685A	ADAR_ENST00000292205.5_Missense_Mutation_p.T728A|ADAR_ENST00000368471.3_Missense_Mutation_p.T390A	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	685					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ATGGAGTTGGTCGCCTCCCCA	0.522																																						ENST00000368474.4	1.000000	4.000000e-02	1.000000	9.000000e-02	0.160000	0.348384	0.160000	0.120000																										0				51						c.(2053-2055)Acc>Gcc		adenosine deaminase, RNA-specific							67.0	65.0	66.0					1																	154569625		2203	4300	6503	SO:0001583	missense	103	0	0					g.chr1:154569625T>C	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2053A>G	chr1.hg19:g.154569625T>C	ENSP00000357459:p.Thr685Ala	1					ADAR_ENST00000368471.3_Missense_Mutation_p.T390A|ADAR_ENST00000292205.5_Missense_Mutation_p.T728A	p.T685A	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	3	5	8	2.670671	P55265	DSRAD_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.185)	5	2252	-	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	0	1	hg19	c.2053A>G	CCDS1071.1	0	.	.	.	.	.	.	.	.	.	.	T	4.071	0.011032	0.07912	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.14022	2.74;2.75;2.54;2.76	5.43	-3.95	0.04118	5.43	-3.95	0.04118	.	0.826008	0.10923	N	0.619176	T	0.01222	0.0040	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.47837	-0.9086	10	0.06625	T	0.88	-5.3793	9.0032	0.36094	0.1254:0.5779:0.0:0.2967	.	685;685;685	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	A	728;685;390;680	ENSP00000292205:T728A;ENSP00000357459:T685A;ENSP00000357456:T390A;ENSP00000431794:T680A	ENSP00000292205:T728A	T	-	1	0	0	ADAR	152836249	152836249	0.001000	0.12720	0.000000	0.03702	0.428000	0.31595	0.036000	0.13819	-0.609000	0.05724	0.533000	0.62120	ACC	0.773869		TCGA-YY-A8LH-01A-11D-A36O-08	0.522	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	0	0	1	2	2	2	2	0	0	0	0	94	94	94	94	1	3.730000	-6.781585	1	0.550000	NM_001111		0	6	6	0	327	324	0		1	1		0	0	94	0	0	0.964349	8.938192e-01	0	5	0	215	0	6	327
LMNA	4000	broad.mit.edu	37	1	156105808	156105808	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:156105808G>A	ENST00000368300.4	+	6	1265	c.1053G>A	c.(1051-1053)agG>agA	p.R351R	LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000448611.2_Silent_p.R239R|LMNA_ENST00000392353.3_Silent_p.R270R|LMNA_ENST00000368297.1_Silent_p.R270R|LMNA_ENST00000368301.2_Silent_p.R351R|LMNA_ENST00000473598.2_Silent_p.R252R|LMNA_ENST00000361308.4_Silent_p.R351R|LMNA_ENST00000368299.3_Silent_p.R351R|LMNA_ENST00000347559.2_Silent_p.R351R	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	351	Coil 2.|Rod.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TGCGGGCAAGGATGCAGCAGC	0.647									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																													ENST00000368300.4	1.000000	2.000000e-01	1.000000	2.800000e-01	0.410000	0.525588	0.410000	0.340000																										0				10						c.(1051-1053)agG>agA		lamin A/C							58.0	58.0	58.0					1																	156105808		2203	4300	6503	SO:0001819	synonymous_variant	4000	0	0		Werner syndrome;Hutchinson-Gilford Progeria Syndrome	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	g.chr1:156105808G>A	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1053G>A	chr1.hg19:g.156105808G>A		1					LMNA_ENST00000368299.3_Silent_p.R351R|LMNA_ENST00000448611.2_Silent_p.R239R|LMNA_ENST00000392353.3_Silent_p.R270R|LMNA_ENST00000368297.1_Silent_p.R270R|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000368301.2_Silent_p.R351R|LMNA_ENST00000473598.2_Silent_p.R252R|LMNA_ENST00000361308.4_Silent_p.R351R|LMNA_ENST00000347559.2_Silent_p.R351R	p.R351R	NM_170707.3	NP_733821.1	3	5	8	2.670671	P02545	LMNA_HUMAN		6	1265	+	Hepatocellular(266;0.158)		B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	1	0	hg19	c.1053G>A	CCDS1129.1	0																																																																																								0.773869		TCGA-YY-A8LH-01A-11D-A36O-08	0.647	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	1	0	1	2	2	2	2	0	0	0	0	74	74	74	73	1	3.730000	-14.306460	1	0.550000	NM_170707		0	12	12	0	232	225	0		1	1		0	0	74	0	0	0.999026	1	0	98	0	1725	0	12	232
CLCNKA	1187	broad.mit.edu	37	1	16353850	16353850	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:16353850G>A	ENST00000331433.4	+	8	720	c.701G>A	c.(700-702)cGg>cAg	p.R234Q	CLCNKA_ENST00000420078.1_Missense_Mutation_p.R234Q|CLCNKA_ENST00000375692.1_Missense_Mutation_p.R234Q|CLCNKA_ENST00000439316.2_Missense_Mutation_p.R191Q|CLCNKA_ENST00000464764.1_3'UTR			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	234					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	TTCTCTGTCCGGGATTACTGG	0.637																																						ENST00000331433.4	1.000000	4.000000e-02	1.000000	7.000000e-02	0.100000	0.284638	0.100000	0.100000																										0				19						c.(700-702)cGg>cAg		chloride channel, voltage-sensitive Ka	Niflumic Acid(DB04552)						95.0	99.0	98.0					1																	16353850		2203	4300	6503	SO:0001583	missense	1187	0	0					g.chr1:16353850G>A		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.701G>A	chr1.hg19:g.16353850G>A	ENSP00000332771:p.Arg234Gln	1					CLCNKA_ENST00000420078.1_Missense_Mutation_p.R234Q|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000375692.1_Missense_Mutation_p.R234Q|CLCNKA_ENST00000439316.2_Missense_Mutation_p.R191Q	p.R234Q			0	6	6	1.806204	P51800	CLCKA_HUMAN		8	720	+		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Missense_Mutation	SNP	ENST00000331433.4	0	1	hg19	c.701G>A	CCDS167.1	0	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397759	0.62177	.	.	ENSG00000186510	ENST00000375692;ENST00000420078;ENST00000439316;ENST00000331433	D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51	3.02	3.02	0.34903	3.02	3.02	0.34903	Chloride channel, core (2);	0.189554	0.45606	D	0.000349	D	0.94212	0.8142	M	0.68728	2.09	0.28863	N	0.895394	B;P;B	0.39480	0.364;0.675;0.364	B;P;B	0.46026	0.342;0.501;0.342	D	0.90856	0.4735	10	0.51188	T	0.08	.	13.4842	0.61355	0.0:0.0:1.0:0.0	.	191;234;234	E7EPH6;Q5T5Q4;P51800	.;.;CLCKA_HUMAN	Q	234;234;191;234	ENSP00000364844:R234Q;ENSP00000410353:R234Q;ENSP00000414445:R191Q;ENSP00000332771:R234Q	ENSP00000332771:R234Q	R	+	2	0	0	CLCNKA	16226437	16226437	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.291000	0.65667	1.674000	0.50907	0.313000	0.20887	CGG	0.661654		TCGA-YY-A8LH-01A-11D-A36O-08	0.637	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1	0	0	1	2	2	2	2	0	0	0	0	215	215	215	212	1	3.730000	-2.080577	0	0.550000			0	12	12	0	593	574	0		1	0		0	0	215	0	0	0.998940	0	0	0	0	1	0	12	593
INSRR	3645	broad.mit.edu	37	1	156824033	156824033	+	Missense_Mutation	SNP	C	C	T	rs558428940		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:156824033C>T	ENST00000368195.3	-	2	544	c.148G>A	c.(148-150)Gtg>Atg	p.V50M	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	50					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCCTCCACCACGCTGCAGTTC	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		20162	0.0		0.0	False		,,,				2504	0.001					ENST00000368195.3	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				42						c.(148-150)Gtg>Atg		insulin receptor-related receptor							49.0	50.0	49.0					1																	156824033		2203	4300	6503	SO:0001583	missense	3645	15	121410	40				g.chr1:156824033C>T	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.148G>A	chr1.hg19:g.156824033C>T	ENSP00000357178:p.Val50Met	1					NTRK1_ENST00000392302.2_Intron	p.V50M	NM_014215.2	NP_055030.1	3	5	8	2.670671	P14616	INSRR_HUMAN		2	544	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	1	1	hg19	c.148G>A	CCDS1160.1	1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450024	0.63290	.	.	ENSG00000027644	ENST00000368195	D	0.82081	-1.57	5.06	4.15	0.48705	5.06	4.15	0.48705	EGF receptor, L domain (1);	0.000000	0.41294	D	0.000916	D	0.87939	0.6304	.	.	.	0.48341	D	0.999632	D	0.89917	1.0	D	0.81914	0.995	D	0.89318	0.3638	9	0.72032	D	0.01	.	11.4951	0.50404	0.0:0.9113:0.0:0.0887	.	50	P14616	INSRR_HUMAN	M	50	ENSP00000357178:V50M	ENSP00000357178:V50M	V	-	1	0	0	INSRR	155090657	155090657	0.646000	0.27295	0.893000	0.35052	0.832000	0.47134	1.287000	0.33284	1.146000	0.42352	-0.252000	0.11476	GTG	0.773869		TCGA-YY-A8LH-01A-11D-A36O-08	0.627	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	1	0	1	2	2	2	2	0	0	0	0	42	42	42	42	1	3.730000	-20.000000	1	0.550000	NM_014215		0	69	69	0	111	109	1		1			0	0	42	0	0	1.000000	0	0	0	0	0	0	69	111
F5	2153	broad.mit.edu	37	1	169519117	169519117	+	Missense_Mutation	SNP	G	G	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:169519117G>C	ENST00000367797.3	-	10	1734	c.1533C>G	c.(1531-1533)atC>atG	p.I511M	F5_ENST00000367796.3_Missense_Mutation_p.I511M|F5_ENST00000546081.1_3'UTR	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	511	F5/8 type A 2.|Plastocyanin-like 3.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TGTCTCTCATGATGTCCACGT	0.433																																						ENST00000367797.3	1.000000	4.000000e-02	1.000000	8.000000e-02	0.140000	0.342269	0.140000	0.110000																										0				128						c.(1531-1533)atC>atG		coagulation factor V (proaccelerin, labile factor)	ART-123(DB05777)|Drotrecogin alfa(DB00055)						210.0	187.0	195.0					1																	169519117		2203	4300	6503	SO:0001583	missense	2153	0	0					g.chr1:169519117G>C	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1533C>G	chr1.hg19:g.169519117G>C	ENSP00000356771:p.Ile511Met	1					F5_ENST00000367796.3_Missense_Mutation_p.I511M|F5_ENST00000546081.1_3'UTR	p.I511M	NM_000130.4	NP_000121	3	6	9	2.666250	P12259	FA5_HUMAN		10	1734	-	all_hematologic(923;0.208)		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	0	1	hg19	c.1533C>G	CCDS1281.1	0	.	.	.	.	.	.	.	.	.	.	G	9.285	1.049094	0.19827	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98602	-5.02;-5.02	5.71	0.262	0.15597	5.71	0.262	0.15597	Cupredoxin (2);	0.596635	0.18720	N	0.133041	D	0.85600	0.5734	N	0.11064	0.09	0.25005	N	0.991444	B	0.26195	0.144	B	0.18263	0.021	T	0.74819	-0.3535	9	0.15066	T	0.55	-0.6017	7.1569	0.25643	0.2659:0.4684:0.2657:0.0	.	511	P12259	FA5_HUMAN	M	511	ENSP00000356771:I511M;ENSP00000356770:I511M	ENSP00000356770:I511M	I	-	3	3	3	F5	167785741	167785741	0.072000	0.21174	0.226000	0.23910	0.924000	0.55760	-0.367000	0.07553	0.060000	0.16281	-0.175000	0.13238	ATC	0.770701		TCGA-YY-A8LH-01A-11D-A36O-08	0.433	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	0	0	1	2	2	2	2	0	0	0	0	102	102	102	100	1	3.730000	-3.240787	1	0.550000	NM_000130		0	8	8	0	479	472	0		1	0		0	0	102	0	0	0.988842	3.654612e-02	0	0	0	16	0	8	479
MRPS14	63931	broad.mit.edu	37	1	174983906	174983906	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:174983906G>A	ENST00000476371.1	-	3	302	c.286C>T	c.(286-288)Cgt>Tgt	p.R96C	MRPS14_ENST00000498253.1_5'UTR	NM_022100.2	NP_071383.1			mitochondrial ribosomal protein S14									p.R96S(1)		large_intestine(2)|lung(5)|pancreas(1)|prostate(2)	10						CCACGCGGACGGGACGTCATA	0.522																																						ENST00000476371.1	1.000000	4.000000e-02	1.000000	8.000000e-02	0.140000	0.341029	0.140000	0.110000																										1	Substitution - Missense(1)	p.R96S(1)	lung(1)	10						c.(286-288)Cgt>Tgt		mitochondrial ribosomal protein S14							155.0	143.0	147.0					1																	174983906		2203	4300	6503	SO:0001583	missense	63931	0	0					g.chr1:174983906G>A	AB051350	CCDS1316.1	1q25.1	2012-09-13			ENSG00000120333	ENSG00000120333		"""Mitochondrial ribosomal proteins / small subunits"""	14049	protein-coding gene	gene with protein product		611978					Standard	NR_037606		Approved	HSMRPS14	uc001gkk.3	O60783	OTTHUMG00000034878	ENST00000476371.1:c.286C>T	chr1.hg19:g.174983906G>A	ENSP00000420714:p.Arg96Cys	1					MRPS14_ENST00000498253.1_5'UTR	p.R96C	NM_022100.2	NP_071383.1	3	6	9	2.666250				3	302	-				Missense_Mutation	SNP	ENST00000476371.1	0	1	hg19	c.286C>T	CCDS1316.1	0	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899841	0.91962	.	.	ENSG00000120333	ENST00000476371	.	.	.	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.91653	0.7362	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94083	0.7346	9	0.87932	D	0	-16.0916	20.6593	0.99626	0.0:0.0:1.0:0.0	.	96	O60783	RT14_HUMAN	C	96	.	ENSP00000420714:R96C	R	-	1	0	0	MRPS14	173250529	173250529	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.365000	0.73090	2.885000	0.99019	0.655000	0.94253	CGT	0.770701		TCGA-YY-A8LH-01A-11D-A36O-08	0.522	MRPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084416.2	0	0	1	2	15	7	2	1	1	1	1	133	133	133	130	1	3.730000	-1.977340	0	0.550000	NM_022100		0	9	8	0	540	526	0		0	0		1	0	133	0	0	0.134414	8.914797e-02	0	4	0	187	0	9	540
CFHR1	3078	broad.mit.edu	37	1	196797211	196797211	+	Missense_Mutation	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:196797211G>T	ENST00000320493.5	+	4	530	c.442G>T	c.(442-444)Gtg>Ttg	p.V148L	CFHR2_ENST00000367421.3_Intron|CFHR1_ENST00000367424.4_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	148	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						CACTTCCTGTGTGAATCCGCC	0.383																																						ENST00000320493.5	1.000000	2.000000e-02	1.000000	6.000000e-02	0.110000	0.325133	0.110000	0.110000																										0				11						c.(442-444)Gtg>Ttg		complement factor H-related 1							55.0	73.0	67.0					1																	196797211		1827	4114	5941	SO:0001583	missense	3078	0	0					g.chr1:196797211G>T	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.442G>T	chr1.hg19:g.196797211G>T	ENSP00000314299:p.Val148Leu	1					CFHR1_ENST00000367424.4_Intron|CFHR2_ENST00000367421.3_Intron	p.V148L	NM_002113.2	NP_002104.2	3	6	9	2.666250	Q03591	FHR1_HUMAN		4	530	+			A8K465|Q3B774|Q9UJ17	Missense_Mutation	SNP	ENST00000320493.5	0	1	hg19	c.442G>T	CCDS1386.1	0	.	.	.	.	.	.	.	.	.	.	.	6.008	0.369878	0.11352	.	.	ENSG00000244414	ENST00000320493	T	0.64260	-0.09	2.89	1.95	0.26073	2.89	1.95	0.26073	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.55561	0.1928	L	0.37466	1.105	0.80722	D	1	B;D	0.54047	0.387;0.964	B;P	0.52554	0.326;0.702	T	0.47995	-0.9073	9	0.28530	T	0.3	.	6.0102	0.19571	0.1541:0.0:0.8459:0.0	.	148;1049	Q03591;A8K5T0	FHR1_HUMAN;.	L	148	ENSP00000314299:V148L	ENSP00000314299:V148L	V	+	1	0	0	CFHR1	195063834	195063834	0.321000	0.24625	0.995000	0.50966	0.022000	0.10575	0.327000	0.19663	0.520000	0.28426	0.398000	0.26397	GTG	0.770701		TCGA-YY-A8LH-01A-11D-A36O-08	0.383	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	0	0	1	2	2	2	2	0	0	0	0	135	135	135	133	1	3.730000	-6.444139	1	0.550000	NM_002113		0	8	8	0	579	571	0		1			0	0	135	0	0	0.988836	0	0	0	0	0	0	8	579
ANGEL2	90806	broad.mit.edu	37	1	213178772	213178772	+	Missense_Mutation	SNP	C	C	A	rs373606563		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:213178772C>A	ENST00000366962.3	-	5	891	c.737G>T	c.(736-738)cGg>cTg	p.R246L	ANGEL2_ENST00000540642.1_Missense_Mutation_p.R120L|ANGEL2_ENST00000535388.1_Missense_Mutation_p.R77L|ANGEL2_ENST00000544555.1_Missense_Mutation_p.R77L|ANGEL2_ENST00000360506.2_Missense_Mutation_p.R77L	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	246								p.R246L(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		CCTTCCTGTCCGCATCTTATA	0.363																																						ENST00000366962.3	1.000000	5.000000e-02	1.000000	9.000000e-02	0.140000	0.342352	0.140000	0.110000																										1	Substitution - Missense(1)	p.R246L(1)	lung(1)	24						c.(736-738)cGg>cTg		angel homolog 2 (Drosophila)							96.0	102.0	100.0					1																	213178772		2195	4299	6494	SO:0001583	missense	90806	0	0					g.chr1:213178772C>A	AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.737G>T	chr1.hg19:g.213178772C>A	ENSP00000355929:p.Arg246Leu	1					ANGEL2_ENST00000535388.1_Missense_Mutation_p.R77L|ANGEL2_ENST00000544555.1_Missense_Mutation_p.R77L|ANGEL2_ENST00000540642.1_Missense_Mutation_p.R120L|ANGEL2_ENST00000360506.2_Missense_Mutation_p.R77L	p.R246L	NM_144567.3	NP_653168.2	3	6	9	2.666250	Q5VTE6	ANGE2_HUMAN		5	891	-			B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	ENST00000366962.3	0	1	hg19	c.737G>T	CCDS1512.1	0	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606850	0.87157	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642;ENST00000535388	D;D;D;D;D	0.95622	-3.76;-3.16;-3.16;-3.76;-3.16	5.45	4.53	0.55603	5.45	4.53	0.55603	Endonuclease/exonuclease/phosphatase (2);	0.060391	0.64402	D	0.000003	D	0.98137	0.9385	M	0.93420	3.415	0.58432	D	0.999999	D;D	0.76494	0.996;0.999	D;D	0.77557	0.959;0.99	D	0.99007	1.0813	10	0.87932	D	0	-10.8417	13.6511	0.62312	0.0:0.9244:0.0:0.0756	.	120;246	F5H476;Q5VTE6	.;ANGE2_HUMAN	L	246;77;77;120;77	ENSP00000355929:R246L;ENSP00000353696:R77L;ENSP00000443193:R77L;ENSP00000446124:R120L;ENSP00000438141:R77L	ENSP00000353696:R77L	R	-	2	0	0	ANGEL2	211245395	211245395	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.604000	0.67626	1.398000	0.46701	0.650000	0.86243	CGG	0.770701		TCGA-YY-A8LH-01A-11D-A36O-08	0.363	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089693.1	0	0	1	2	2	2	2	0	0	0	0	120	120	120	120	1	3.730000	-2.102206	0	0.550000	NM_144567		0	10	9	0	586	580	0		1	0		0	0	120	0	0	0.996730	4.477750e-02	0	0	0	18	0	10	586
RAB3GAP2	25782	broad.mit.edu	37	1	220364491	220364491	+	Missense_Mutation	SNP	G	G	A	rs151225064	byFrequency	TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:220364491G>A	ENST00000358951.2	-	14	1522	c.1406C>T	c.(1405-1407)gCg>gTg	p.A469V		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	469					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)	p.A469V(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CCTTCTTGGCGCATAGATCAC	0.493																																						ENST00000358951.2	1.000000	1.000000e-02	1.000000	4.000000e-02	0.080000	0.301197	0.080000	0.060000																										1	Substitution - Missense(1)	p.A469V(1)	prostate(1)	39						c.(1405-1407)gCg>gTg		RAB3 GTPase activating protein subunit 2 (non-catalytic)		G	VAL/ALA	0,4406		0,0,2203	137.0	134.0	135.0		1406	5.7	0.9	1	dbSNP_134	135	2,8598	2.2+/-6.3	0,2,4298	no	missense	RAB3GAP2	NM_012414.3	64	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	469/1394	220364491	2,13004	2203	4300	6503	SO:0001583	missense	25782	19	121410	47				g.chr1:220364491G>A	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.1406C>T	chr1.hg19:g.220364491G>A	ENSP00000351832:p.Ala469Val	1						p.A469V	NM_012414.3	NP_036546.2	3	6	9	2.666250	Q9H2M9	RBGPR_HUMAN		14	1522	-			A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	0	1	hg19	c.1406C>T	CCDS31028.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.508939	0.96386	0.0	2.33E-4	ENSG00000118873	ENST00000358951	D	0.90444	-2.67	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.94925	0.8359	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94568	0.7768	10	0.56958	D	0.05	.	19.7176	0.96129	0.0:0.0:1.0:0.0	.	469	Q9H2M9	RBGPR_HUMAN	V	469	ENSP00000351832:A469V	ENSP00000351832:A469V	A	-	2	0	0	RAB3GAP2	218431114	218431114	1.000000	0.71417	0.907000	0.35723	0.936000	0.57629	9.090000	0.94144	2.670000	0.90874	0.563000	0.77884	GCG	0.770701		TCGA-YY-A8LH-01A-11D-A36O-08	0.493	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	0	0	1	2	2	2	2	0	0	0	0	125	125	125	124	1	3.730000	-1.721084	0	0.550000	NM_012414		0	6	6	0	611	606	0		1	0		0	0	125	0	0	0.964035	8.721834e-03	0	0	0	12	0	6	611
ARID1A	8289	broad.mit.edu	37	1	27099950	27099950	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:27099950C>T	ENST00000324856.7	+	15	4200	c.3829C>T	c.(3829-3831)Cag>Tag	p.Q1277*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1277*|ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q894*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1277					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.G1274fs*7(2)|p.M1273fs(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGGACCACGACAGCACTATCC	0.602			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	ENST00000324856.7	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000				Rec	yes			Rec	yes		1	1p35.3	1p35.3	8289	Mis, N, F, S, D	AT rich interactive domain 1A (SWI-like)				E	E			clear cell ovarian carcinoma, RCC	ARID1A/MAST2_ENST00000361297(2)	3	Deletion - Frameshift(2)|Complex(1)	p.G1274fs*7(2)|p.M1273fs(1)	liver(3)	411						c.(3829-3831)Cag>Tag		AT rich interactive domain 1A (SWI-like)							73.0	65.0	67.0					1																	27099950		2203	4300	6503	SO:0001587	stop_gained	8289	0	0					g.chr1:27099950C>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3829C>T	chr1.hg19:g.27099950C>T	ENSP00000320485:p.Gln1277*	1					ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q894*|ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1277*	p.Q1277*	NM_006015.4	NP_006006.3	0	5	5	1.780378	O14497	ARI1A_HUMAN		15	4200	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	0	1	hg19	c.3829C>T	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.172493|9.172493	0.99089|0.99089	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152|ENST00000430799	.|.	.|.	.|.	4.72|4.72	4.72|4.72	0.59763|0.59763	4.72|4.72	4.72|4.72	0.59763|0.59763	.|.	0.053822|.	0.85682|.	D|.	0.000000|.	.|T	.|0.73938	.|0.3651	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72997	.|-0.4121	.|4	0.09843|.	T|.	0.71|.	-1.2962|-1.2962	18.2413|18.2413	0.89968|0.89968	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	1277;1277;894|173	.|.	ENSP00000320485:Q1277X|.	Q|T	+|+	1|2	0|0	0|0	ARID1A|ARID1A	26972537|26972537	26972537|26972537	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.231000|7.231000	0.78106|0.78106	2.627000|2.627000	0.88993|0.88993	0.655000|0.655000	0.94253|0.94253	CAG|ACA	0.653045		TCGA-YY-A8LH-01A-11D-A36O-08	0.602	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	1	0	1	2	2	2	2	0	0	0	0	34	34	34	33	1	3.730000	-20.000000	1	0.550000	NM_139135		0	48	47	0	62	62	1		1	1	1	0	0	34	900	0	1.000000	9.999679e-01	1	10	268	16	416	48	62
BSND	7809	broad.mit.edu	37	1	55470697	55470697	+	Silent	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:55470697C>T	ENST00000371265.4	+	2	434	c.180C>T	c.(178-180)atC>atT	p.I60I		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	60					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						GCTTGCAGATCACCTTCGTCC	0.577																																					Ovarian(191;1657 2078 22894 42033 48899)	ENST00000371265.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				17						c.(178-180)atC>atT		barttin CLCNK-type chloride channel accessory beta subunit							114.0	94.0	101.0					1																	55470697		2203	4300	6503	SO:0001819	synonymous_variant	7809	1	121412	33				g.chr1:55470697C>T	AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.180C>T	chr1.hg19:g.55470697C>T		1						p.I60I	NM_057176.2	NP_476517.1	0	5	5	1.780378	Q8WZ55	BSND_HUMAN		2	434	+			Q6NT28	Silent	SNP	ENST00000371265.4	1	1	hg19	c.180C>T	CCDS602.1	1																																																																																								0.653045		TCGA-YY-A8LH-01A-11D-A36O-08	0.577	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022213.4	1	0	1	2	2	2	2	0	0	0	0	53	53	53	53	1	3.730000	-20.000000	1	0.550000	NM_057176		0	61	60	0	85	84	1		1			0	0	53	0	0	1.000000	0	0	0	0	0	0	61	85
TRIM67	440730	broad.mit.edu	37	1	231339749	231339749	+	Silent	SNP	A	A	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr1:231339749A>G	ENST00000366653.5	+	6	1671	c.1671A>G	c.(1669-1671)ggA>ggG	p.G557G	TRIM67_ENST00000444294.3_Silent_p.G555G|TRIM67_ENST00000366652.2_Silent_p.G557G|TRIM67_ENST00000449018.3_Silent_p.G495G			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	557	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GTGCCGGGGGACAGTTCCGGG	0.637																																						ENST00000366653.5	1.000000	8.300000e-01	1.000000	9.800000e-01	0.990000	0.985346	0.990000	1.000000																										0				29						c.(1669-1671)ggA>ggG		tripartite motif containing 67							54.0	69.0	64.0					1																	231339749		2035	4177	6212	SO:0001819	synonymous_variant	440730	0	0					g.chr1:231339749A>G	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1671A>G	chr1.hg19:g.231339749A>G		1					TRIM67_ENST00000449018.3_Silent_p.G495G|TRIM67_ENST00000366652.2_Silent_p.G557G|TRIM67_ENST00000444294.3_Silent_p.G555G	p.G557G			3	6	9	2.666250	Q6ZTA4	TRI67_HUMAN		6	1671	+	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)	Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	ENST00000366653.5	1	1	hg19	c.1671A>G	CCDS44333.1	1																																																																																								0.770701		TCGA-YY-A8LH-01A-11D-A36O-08	0.637	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	1	0	1	2	2	2	2	0	0	0	0	37	37	37	37	1	3.730000	-20.000000	1	0.550000	NM_001004342		0	37	37	0	200	196	1		1			0	0	37	0	0	1.000000	0	0	0	0	0	0	37	200
ZHX3	23051	broad.mit.edu	37	20	39832133	39832133	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr20:39832133G>A	ENST00000309060.3	-	4	1839	c.1424C>T	c.(1423-1425)gCg>gTg	p.A475V	ZHX3_ENST00000544979.2_Missense_Mutation_p.A475V|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000559234.1_Missense_Mutation_p.A475V|ZHX3_ENST00000560361.1_Missense_Mutation_p.A475V|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000540170.1_Missense_Mutation_p.A475V|ZHX3_ENST00000432768.2_Missense_Mutation_p.A475V			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	475	Required for homodimerization and interaction with NFYA.|Required for repressor activity.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A475V(1)		endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				CGACTGGGCCGCATTGACCAC	0.537																																						ENST00000309060.3	1.000000	6.000000e-02	1.000000	1.200000e-01	0.200000	0.381746	0.200000	0.170000																										1	Substitution - Missense(1)	p.A475V(1)	large_intestine(1)	31						c.(1423-1425)gCg>gTg		zinc fingers and homeoboxes 3							72.0	58.0	62.0					20																	39832133		2203	4300	6503	SO:0001583	missense	23051	5	121412	36				g.chr20:39832133G>A	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.1424C>T	chr20.hg19:g.39832133G>A	ENSP00000312222:p.Ala475Val	1					ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.A475V|ZHX3_ENST00000432768.2_Missense_Mutation_p.A475V|ZHX3_ENST00000544979.2_Missense_Mutation_p.A475V|ZHX3_ENST00000559234.1_Missense_Mutation_p.A475V|ZHX3_ENST00000540170.1_Missense_Mutation_p.A475V|ZHX3_ENST00000558993.1_Intron	p.A475V			3	3	6	2.220022	Q9H4I2	ZHX3_HUMAN		4	1839	-		Myeloproliferative disorder(115;0.00425)	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	0	1	hg19	c.1424C>T	CCDS13315.1	0	.	.	.	.	.	.	.	.	.	.	G	12.63	1.997092	0.35226	.	.	ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262;ENST00000432768	T;T;T;T;T	0.34859	1.34;2.8;2.8;2.59;1.34	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.242897	0.40469	N	0.001094	T	0.32645	0.0836	L	0.40543	1.245	0.18873	N	0.999981	P;B;P	0.41673	0.532;0.348;0.759	B;B;B	0.37480	0.251;0.102;0.176	T	0.38394	-0.9663	10	0.72032	D	0.01	-9.9771	16.3863	0.83505	0.0:0.1314:0.8686:0.0	.	475;475;475	A8K8Q0;Q9H4I2;F5H820	.;ZHX3_HUMAN;.	V	475;475;475;475;253;475	ENSP00000312222:A475V;ENSP00000362360:A475V;ENSP00000442290:A475V;ENSP00000443783:A475V;ENSP00000415498:A475V	ENSP00000312222:A475V	A	-	2	0	0	ZHX3	39265547	39265547	0.534000	0.26362	0.181000	0.23098	0.707000	0.40811	2.718000	0.47236	2.815000	0.96918	0.561000	0.74099	GCG	0.725275		TCGA-YY-A8LH-01A-11D-A36O-08	0.537	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	0	0	1	2	2	2	2	0	0	0	0	50	50	50	50	1	3.730000	-2.799494	1	0.550000	NM_015035		0	5	5	0	180	176	0		1	0		0	0	50	0	0	0.934761	1.097081e-02	0	0	0	5	0	5	180
DIDO1	11083	broad.mit.edu	37	20	61538515	61538515	+	Missense_Mutation	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr20:61538515G>T	ENST00000266070.4	-	5	1683	c.1358C>A	c.(1357-1359)cCg>cAg	p.P453Q	DIDO1_ENST00000370366.1_Missense_Mutation_p.P453Q|DIDO1_ENST00000395340.1_Missense_Mutation_p.P453Q|DIDO1_ENST00000370371.4_Missense_Mutation_p.P453Q|DIDO1_ENST00000395343.1_Missense_Mutation_p.P453Q|DIDO1_ENST00000395335.2_Missense_Mutation_p.P453Q|DIDO1_ENST00000266071.5_Missense_Mutation_p.P453Q|DIDO1_ENST00000354665.4_Missense_Mutation_p.P453Q|DIDO1_ENST00000370368.1_Missense_Mutation_p.P453Q	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	453					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P453L(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					ACCGCATTTCGGAAGACTGGG	0.527																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	ENST00000266070.4	1.000000	1.000000e-02	1.000000	3.000000e-02	0.070000	0.287662	0.070000	0.070000																										1	Substitution - Missense(1)	p.P453L(1)	ovary(1)	99						c.(1357-1359)cCg>cAg		death inducer-obliterator 1							219.0	190.0	200.0					20																	61538515		2203	4300	6503	SO:0001583	missense	11083	0	0					g.chr20:61538515G>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1358C>A	chr20.hg19:g.61538515G>T	ENSP00000266070:p.Pro453Gln	1					DIDO1_ENST00000395340.1_Missense_Mutation_p.P453Q|DIDO1_ENST00000395335.2_Missense_Mutation_p.P453Q|DIDO1_ENST00000370371.4_Missense_Mutation_p.P453Q|DIDO1_ENST00000354665.4_Missense_Mutation_p.P453Q|DIDO1_ENST00000370366.1_Missense_Mutation_p.P453Q|DIDO1_ENST00000266071.5_Missense_Mutation_p.P453Q|DIDO1_ENST00000395343.1_Missense_Mutation_p.P453Q|DIDO1_ENST00000370368.1_Missense_Mutation_p.P453Q	p.P453Q	NM_033081.2	NP_149072.2	3	3	6	2.220022	Q9BTC0	DIDO1_HUMAN		5	1683	-	Breast(26;5.68e-08)		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	0	1	hg19	c.1358C>A	CCDS33506.1	0	.	.	.	.	.	.	.	.	.	.	G	1.689	-0.504488	0.04261	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	T;T;T;T;T;T;T;T;T	0.18338	3.06;3.06;2.72;2.72;2.22;2.22;2.22;2.23;2.23	4.91	1.78	0.24846	4.91	1.78	0.24846	.	0.173706	0.27622	N	0.018547	T	0.11793	0.0287	L	0.41236	1.265	0.09310	N	1	B;B;B;B	0.33494	0.239;0.414;0.203;0.128	B;B;B;B	0.28991	0.097;0.097;0.034;0.026	T	0.17258	-1.0375	10	0.36615	T	0.2	-8.571	8.456	0.32899	0.0737:0.0:0.6357:0.2906	.	453;453;453;453	Q9BTC0-2;Q9BTC0-3;Q9BTC0-1;Q9BTC0	.;.;.;DIDO1_HUMAN	Q	453	ENSP00000266070:P453Q;ENSP00000378752:P453Q;ENSP00000378749:P453Q;ENSP00000378744:P453Q;ENSP00000359397:P453Q;ENSP00000359394:P453Q;ENSP00000346692:P453Q;ENSP00000359391:P453Q;ENSP00000266071:P453Q	ENSP00000266070:P453Q	P	-	2	0	0	DIDO1	61008960	61008960	0.105000	0.21958	0.097000	0.21041	0.010000	0.07245	0.494000	0.22467	0.557000	0.29117	0.561000	0.74099	CCG	0.725275		TCGA-YY-A8LH-01A-11D-A36O-08	0.527	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	0	0	1	2	2	2	2	0	0	0	0	240	240	240	236	1	3.730000	-1.887496	0	0.550000	NM_080796		0	9	8	0	846	836	0		1	0		0	0	240	0	0	0.993916	3.417694e-01	0	0	0	105	0	9	846
CCT8L2	150160	broad.mit.edu	37	22	17072527	17072527	+	Missense_Mutation	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr22:17072527G>T	ENST00000359963.3	-	1	1173	c.914C>A	c.(913-915)aCa>aAa	p.T305K		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	305					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GTCCGCCAGTGTGAGGGTCTC	0.517																																						ENST00000359963.3	0.160000	3.000000e-02	0.130000	5.000000e-02	0.080000	0.094718	0.080000	0.090000																										0				67						c.(913-915)aCa>aAa		chaperonin containing TCP1, subunit 8 (theta)-like 2							194.0	172.0	179.0					22																	17072527		2203	4300	6503	SO:0001583	missense	150160	0	0					g.chr22:17072527G>T	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.914C>A	chr22.hg19:g.17072527G>T	ENSP00000353048:p.Thr305Lys	1						p.T305K	NM_014406.4	NP_055221.1	0	3	3	1.756595	Q96SF2	TCPQM_HUMAN		1	1173	-	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	0	1	hg19	c.914C>A	CCDS13738.1	0	.	.	.	.	.	.	.	.	.	.	g	6.540	0.467967	0.12402	.	.	ENSG00000198445	ENST00000359963	T	0.74526	-0.85	1.98	-1.43	0.08884	1.98	-1.43	0.08884	.	1.219940	0.06186	U	0.680487	T	0.64327	0.2588	L	0.44542	1.39	0.09310	N	1	B	0.15141	0.012	B	0.14578	0.011	T	0.53954	-0.8365	10	0.87932	D	0	-0.7241	5.2737	0.15638	0.5034:0.0:0.4966:0.0	.	305	Q96SF2	TCPQM_HUMAN	K	305	ENSP00000353048:T305K	ENSP00000353048:T305K	T	-	2	0	0	CCT8L2	15452527	15452527	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.513000	0.06305	-0.295000	0.08960	-1.325000	0.01285	ACA	0.647059		TCGA-YY-A8LH-01A-11D-A36O-08	0.517	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1	0	0	1	2	2	2	2	0	0	0	0	200	200	200	204	1	3.730000	-3.002451	1	0.550000			0	9	9	0	478	441	0		1			0	0	200	0	0	0.991874	0	0	0	0	0	0	9	478
DGCR2	9993	broad.mit.edu	37	22	19035956	19035956	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr22:19035956G>A	ENST00000263196.7	-	7	1250	c.1003C>T	c.(1003-1005)Cca>Tca	p.P335S	DGCR2_ENST00000545799.1_3'UTR|DGCR11_ENST00000609958.1_RNA|DGCR2_ENST00000537045.1_Missense_Mutation_p.P294S	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	335					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					GTCTCACCTGGGTCCAGACAC	0.587																																						ENST00000263196.7	1.000000	7.000000e-02	1.000000	1.000000e-01	0.150000	0.334407	0.150000	0.130000																										0				18						c.(1003-1005)Cca>Tca		DiGeorge syndrome critical region gene 2							153.0	154.0	154.0					22																	19035956		2203	4300	6503	SO:0001583	missense	9993	0	0					g.chr22:19035956G>A	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1003C>T	chr22.hg19:g.19035956G>A	ENSP00000263196:p.Pro335Ser	1					DGCR11_ENST00000609958.1_RNA|DGCR2_ENST00000545799.1_3'UTR|DGCR2_ENST00000537045.1_Missense_Mutation_p.P294S	p.P335S	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	0	3	3	1.489688	P98153	IDD_HUMAN		7	1250	-	Colorectal(54;0.0993)		A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	ENST00000263196.7	1	1	hg19	c.1003C>T	CCDS33598.1	0	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711467	0.68730	.	.	ENSG00000070413	ENST00000537045;ENST00000263196	T;D	0.97114	0.87;-4.25	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.100398	0.64402	D	0.000001	D	0.95338	0.8487	L	0.46157	1.445	0.80722	D	1	P;P	0.41232	0.743;0.485	B;B	0.38755	0.281;0.146	D	0.94464	0.7679	10	0.34782	T	0.22	.	19.6734	0.95921	0.0:0.0:1.0:0.0	.	291;335	B7Z3T5;P98153	.;IDD_HUMAN	S	294;335	ENSP00000440062:P294S;ENSP00000263196:P335S	ENSP00000263196:P335S	P	-	1	0	0	DGCR2	17415956	17415956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.485000	0.73625	2.735000	0.93741	0.655000	0.94253	CCA	0.618240		TCGA-YY-A8LH-01A-11D-A36O-08	0.587	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	0	0	1	2	2	2	2	0	0	0	0	212	212	212	210	1	3.730000	-3.002296	1	0.550000	NM_005137		0	14	13	0	421	415	0		1	1		0	0	212	0	0	0.999734	6.531106e-01	0	5	0	62	0	14	421
GNB1L	54584	broad.mit.edu	37	22	19794255	19794255	+	Missense_Mutation	SNP	T	T	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr22:19794255T>A	ENST00000329517.6	-	6	679	c.443A>T	c.(442-444)aAg>aTg	p.K148M	GNB1L_ENST00000403325.1_Missense_Mutation_p.K148M|GNB1L_ENST00000460402.1_5'UTR|GNB1L_ENST00000405009.1_Missense_Mutation_p.K148M	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	148					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					CACTGACGTCTTGGAGGGCAT	0.572																																						ENST00000329517.6	1.000000	1.200000e-01	1.000000	2.100000e-01	0.350000	0.478250	0.350000	0.290000																										0				12						c.(442-444)aAg>aTg		guanine nucleotide binding protein (G protein), beta polypeptide 1-like							54.0	44.0	47.0					22																	19794255		2203	4300	6503	SO:0001583	missense	54584	0	0					g.chr22:19794255T>A	AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.443A>T	chr22.hg19:g.19794255T>A	ENSP00000331313:p.Lys148Met	1					GNB1L_ENST00000405009.1_Missense_Mutation_p.K148M|GNB1L_ENST00000403325.1_Missense_Mutation_p.K148M|GNB1L_ENST00000460402.1_5'UTR	p.K148M	NM_053004.2	NP_443730.1	0	3	3	1.489688	Q9BYB4	GNB1L_HUMAN		6	679	-	Colorectal(54;0.0993)		Q9H2S2|Q9H4M4	Missense_Mutation	SNP	ENST00000329517.6	1	1	hg19	c.443A>T	CCDS13768.1	0	.	.	.	.	.	.	.	.	.	.	T	25.5	4.640031	0.87760	.	.	ENSG00000185838	ENST00000329517;ENST00000403325;ENST00000405009	T;T;T	0.40756	1.02;1.02;5.0	5.21	4.16	0.48862	5.21	4.16	0.48862	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.128959	0.50627	U	0.000116	T	0.52273	0.1724	M	0.77103	2.36	0.49299	D	0.999779	D	0.56746	0.977	P	0.49887	0.625	T	0.57774	-0.7753	10	0.87932	D	0	-3.2795	11.353	0.49598	0.1361:0.0:0.0:0.8639	.	148	Q9BYB4	GNB1L_HUMAN	M	148	ENSP00000331313:K148M;ENSP00000385154:K148M;ENSP00000384626:K148M	ENSP00000331313:K148M	K	-	2	0	0	GNB1L	18174255	18174255	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.204000	0.65180	0.798000	0.33994	-0.333000	0.08304	AAG	0.618240		TCGA-YY-A8LH-01A-11D-A36O-08	0.572	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075202.1	0	0	1	2	2	2	2	0	0	0	0	30	30	30	30	1	3.730000	-9.538021	1	0.550000			0	5	5	0	70	68	1		1	0		0	0	30	0	0	0.935284	7.843762e-01	0	1	0	41	0	5	70
SGSM3	27352	broad.mit.edu	37	22	40797636	40797636	+	Missense_Mutation	SNP	C	C	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr22:40797636C>G	ENST00000248929.9	+	3	236	c.47C>G	c.(46-48)aCt>aGt	p.T16S	SGSM3_ENST00000454798.2_Intron	NM_015705.4	NP_056520.2			small G protein signaling modulator 3											cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)	19						TCAGCCCTGACTCCGAGCATA	0.567																																						ENST00000248929.9	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999999	0.990000	1.000000																										0				19						c.(46-48)aCt>aGt		small G protein signaling modulator 3							142.0	136.0	138.0					22																	40797636		2203	4300	6503	SO:0001583	missense	27352	0	0					g.chr22:40797636C>G	AL022238	CCDS14002.1	22q13.1-q13.2	2013-07-09	2007-08-14	2007-08-14	ENSG00000100359	ENSG00000100359		"""Small G protein signaling modulators"""	25228	protein-coding gene	gene with protein product	"""RUN and SH3 containing 3"""	610440	"""RUN and TBC1 domain containing 3"""	RUTBC3		11214971, 17509819	Standard	XM_005261572		Approved	DJ1042K10.2, RUSC3, RabGAP-5, RABGAP5	uc003ayu.1	Q96HU1	OTTHUMG00000151141	ENST00000248929.9:c.47C>G	chr22.hg19:g.40797636C>G	ENSP00000248929:p.Thr16Ser	1					SGSM3_ENST00000454798.2_Intron	p.T16S	NM_015705.4	NP_056520.2	0	3	3	1.503948				3	236	+				Missense_Mutation	SNP	ENST00000248929.9	1	1	hg19	c.47C>G	CCDS14002.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814574	0.90790	.	.	ENSG00000100359	ENST00000248929	T	0.13901	2.55	5.45	5.45	0.79879	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.31482	0.0798	M	0.71581	2.175	0.80722	D	1	P;P;P	0.48230	0.887;0.907;0.907	P;B;B	0.52217	0.693;0.437;0.437	T	0.01045	-1.1470	10	0.54805	T	0.06	.	19.6801	0.95958	0.0:1.0:0.0:0.0	.	16;16;16	Q96HU1-2;B9A6J5;Q96HU1	.;.;SGSM3_HUMAN	S	16	ENSP00000248929:T16S	ENSP00000248929:T16S	T	+	2	0	0	SGSM3	39127582	39127582	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.973000	0.76116	2.749000	0.94314	0.655000	0.94253	ACT	0.620013		TCGA-YY-A8LH-01A-11D-A36O-08	0.567	SGSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321504.2	1	0	1	2	2	2	2	0	0	0	0	164	164	164	164	1	3.730000	-20.000000	1	0.550000	NM_015705		0	109	106	0	227	224	1		1	1		0	0	164	0	0	1.000000	1	0	37	0	34	0	109	227
TTN	7273	broad.mit.edu	37	2	179433869	179433869	+	Missense_Mutation	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr2:179433869G>T	ENST00000591111.1	-	276	72291	c.72067C>A	c.(72067-72069)Cag>Aag	p.Q24023K	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.Q16599K|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q16791K|TTN_ENST00000342992.6_Missense_Mutation_p.Q23096K|TTN_ENST00000359218.5_Missense_Mutation_p.Q16724K|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q25664K|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24023	Fibronectin type-III 74. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTGGAGCTGATCGATTTTC	0.388																																						ENST00000591111.1	0.140000	2.000000e-02	0.110000	5.000000e-02	0.070000	0.082724	0.070000	0.080000																										0				1448						c.(72067-72069)Cag>Aag		titin							191.0	193.0	192.0					2																	179433869		1930	4117	6047	SO:0001583	missense	7273	0	0					g.chr2:179433869G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.72067C>A	chr2.hg19:g.179433869G>T	ENSP00000465570:p.Gln24023Lys	1					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q23096K|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.Q16599K|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q25664K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q16791K|TTN_ENST00000359218.5_Missense_Mutation_p.Q16724K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.Q24023K			2	2	4	2.110673	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	72291	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.72067C>A		0	.	.	.	.	.	.	.	.	.	.	G	2.557	-0.302746	0.05495	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.93	3.1	0.35709	5.93	3.1	0.35709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.26048	0.0635	N	0.02266	-0.62	0.33359	D	0.572126	B;B;B;B	0.14012	0.009;0.009;0.009;0.002	B;B;B;B	0.14023	0.005;0.005;0.005;0.01	T	0.16808	-1.0390	9	0.87932	D	0	.	14.5358	0.67960	0.0589:0.212:0.7291:0.0	.	16599;16724;16791;24023	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	23096;16599;16791;16724;16597	ENSP00000343764:Q23096K;ENSP00000434586:Q16599K;ENSP00000340554:Q16791K;ENSP00000352154:Q16724K	ENSP00000340554:Q16791K	Q	-	1	0	0	TTN	179142115	179142115	1.000000	0.71417	0.163000	0.22734	0.218000	0.24690	4.194000	0.58393	0.087000	0.17167	-0.810000	0.03169	CAG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	249	249	249	248	1	3.730000	-2.277787	0	0.550000	NM_133378		0	12	11	0	887	884	0		1			0	0	249	0	0	0.999088	0	0	0	0	0	0	12	887
TTN	7273	broad.mit.edu	37	2	179434141	179434141	+	Missense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr2:179434141C>A	ENST00000591111.1	-	276	72019	c.71795G>T	c.(71794-71796)cGa>cTa	p.R23932L	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R16508L|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16700L|TTN_ENST00000342992.6_Missense_Mutation_p.R23005L|TTN_ENST00000359218.5_Missense_Mutation_p.R16633L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25573L|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23932	Ig-like 120.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTATCATATCGGTTGACATT	0.423																																						ENST00000591111.1	0.180000	1.000000e-02	0.130000	4.000000e-02	0.080000	0.095034	0.080000	0.080000																										0				1448						c.(71794-71796)cGa>cTa		titin							94.0	87.0	90.0					2																	179434141		1906	4114	6020	SO:0001583	missense	7273	0	0					g.chr2:179434141C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.71795G>T	chr2.hg19:g.179434141C>A	ENSP00000465570:p.Arg23932Leu	1					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R23005L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R16508L|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25573L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16700L|TTN_ENST00000359218.5_Missense_Mutation_p.R16633L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.R23932L			2	2	4	2.110673	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	72019	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.71795G>T		0	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679673	0.47886	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.71	5.71	0.89125	5.71	5.71	0.89125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65913	0.2737	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.67114	-0.5752	9	0.87932	D	0	.	19.8644	0.96799	0.0:1.0:0.0:0.0	.	16508;16633;16700;23932	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	23005;16508;16700;16633;16506	ENSP00000343764:R23005L;ENSP00000434586:R16508L;ENSP00000340554:R16700L;ENSP00000352154:R16633L	ENSP00000340554:R16700L	R	-	2	0	0	TTN	179142387	179142387	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.691000	0.91804	0.655000	0.94253	CGA	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1	2	2	2	2	0	0	0	0	106	106	106	105	1	3.730000	-2.924756	1	0.550000	NM_133378		0	5	5	0	347	340	0		1			0	0	106	0	0	0.934621	0	0	0	0	0	0	5	347
TTN	7273	broad.mit.edu	37	2	179440550	179440550	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr2:179440550C>T	ENST00000591111.1	-	276	65610	c.65386G>A	c.(65386-65388)Ggc>Agc	p.G21796S	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G14372S|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G14564S|TTN_ENST00000342992.6_Missense_Mutation_p.G20869S|TTN_ENST00000359218.5_Missense_Mutation_p.G14497S|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G23437S|TTN-AS1_ENST00000592689.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21796				PGPVLN -> ARPSPQ (in Ref. 13; CAA45939). {ECO:0000305}.	adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G14372C(1)|p.G20867C(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGACTGGGCCTGGCGTGTCC	0.493																																						ENST00000591111.1	0.400000	1.900000e-01	0.350000	2.300000e-01	0.290000	0.298419	0.290000	0.280000																										2	Substitution - Missense(2)	p.G14372C(1)|p.G20867C(1)	ovary(2)	1448						c.(65386-65388)Ggc>Agc		titin							94.0	101.0	98.0					2																	179440550		2103	4242	6345	SO:0001583	missense	7273	0	0					g.chr2:179440550C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65386G>A	chr2.hg19:g.179440550C>T	ENSP00000465570:p.Gly21796Ser	1					RP11-171I2.2_ENST00000603521.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G20869S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G14372S|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G23437S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G14564S|TTN_ENST00000359218.5_Missense_Mutation_p.G14497S|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.G21796S			2	2	4	2.110673	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	65610	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.65386G>A		0	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138080	0.56936	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.67	5.67	0.87782	5.67	5.67	0.87782	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70298	0.3208	M	0.72479	2.2	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.72124	-0.4385	9	0.87932	D	0	.	19.7429	0.96238	0.0:1.0:0.0:0.0	.	14372;14497;14564;21796	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	20869;14372;14564;14497;14370	ENSP00000343764:G20869S;ENSP00000434586:G14372S;ENSP00000340554:G14564S;ENSP00000352154:G14497S	ENSP00000340554:G14564S	G	-	1	0	0	TTN	179148796	179148796	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.685000	0.91497	0.655000	0.94253	GGC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1	2	2	2	2	0	0	0	0	179	179	179	177	1	3.730000	-5.622918	1	0.550000	NM_133378		0	31	32	0	571	566	0		1			0	0	179	0	0	1.000000	0	0	0	0	0	0	31	571
VAX2	25806	broad.mit.edu	37	2	71148347	71148347	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr2:71148347C>T	ENST00000234392.2	+	2	399	c.367C>T	c.(367-369)Cgc>Tgc	p.R123C		NM_012476.2	NP_036608.1	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	123					axonogenesis (GO:0007409)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic eye morphogenesis (GO:0048048)|forebrain development (GO:0030900)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R123S(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	7						GGAGTTCCAGCGCTGCCAGTA	0.637																																						ENST00000234392.2	0.740000	3.500000e-01	0.640000	4.300000e-01	0.530000	0.545981	0.530000	0.520000																										1	Substitution - Missense(1)	p.R123S(1)	lung(1)	7						c.(367-369)Cgc>Tgc		ventral anterior homeobox 2							43.0	42.0	42.0					2																	71148347		2203	4300	6503	SO:0001583	missense	25806	0	0					g.chr2:71148347C>T	Y17791	CCDS1911.1	2p13.3	2011-06-20			ENSG00000116035	ENSG00000116035		"""Homeoboxes / ANTP class : NKL subclass"""	12661	protein-coding gene	gene with protein product		604295				10485894	Standard	NM_012476		Approved	DRES93	uc002shh.3	Q9UIW0	OTTHUMG00000129714	ENST00000234392.2:c.367C>T	chr2.hg19:g.71148347C>T	ENSP00000234392:p.Arg123Cys	1						p.R123C	NM_012476.2	NP_036608.1	2	2	4	2.110673	Q9UIW0	VAX2_HUMAN		2	399	+			Q53Y33	Missense_Mutation	SNP	ENST00000234392.2	1	1	hg19	c.367C>T	CCDS1911.1	0	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967070	0.74131	.	.	ENSG00000116035	ENST00000234392	D	0.96365	-3.99	5.43	4.47	0.54385	5.43	4.47	0.54385	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.059173	0.64402	D	0.000005	D	0.96632	0.8901	L	0.52905	1.665	0.80722	D	1	D	0.76494	0.999	P	0.61722	0.893	D	0.96374	0.9276	10	0.72032	D	0.01	-14.5215	12.2143	0.54398	0.2453:0.7547:0.0:0.0	.	123	Q9UIW0	VAX2_HUMAN	C	123	ENSP00000234392:R123C	ENSP00000234392:R123C	R	+	1	0	0	VAX2	71001855	71001855	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.230000	0.42999	2.547000	0.85894	0.655000	0.94253	CGC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.637	VAX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251923.1	1	0	0	2	2	2	2	0	0	0	0	69	69	69	66	1	3.730000	-10.026350	1	0.550000			0	25	24	0	241	241	0		1	0		0	0	69	0	0	1.000000	2.518388e-01	0	0	0	10	0	25	241
SEMA4C	54910	broad.mit.edu	37	2	97527586	97527586	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr2:97527586C>T	ENST00000305476.5	-	13	1621	c.1489G>A	c.(1489-1491)Gtg>Atg	p.V497M		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	497	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						CAGTCGGCCACGGGCAGCTGC	0.682																																						ENST00000305476.5	0.590000	1.400000e-01	0.460000	2.200000e-01	0.320000	0.348430	0.320000	0.320000																										0				17						c.(1489-1491)Gtg>Atg		sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C							20.0	19.0	19.0					2																	97527586		2201	4298	6499	SO:0001583	missense	54910	1	121222	19				g.chr2:97527586C>T	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.1489G>A	chr2.hg19:g.97527586C>T	ENSP00000306844:p.Val497Met	1						p.V497M	NM_017789.4	NP_060259.4	2	2	4	2.110673	Q9C0C4	SEM4C_HUMAN		13	1621	-			Q32MJ3|Q7Z5X0	Missense_Mutation	SNP	ENST00000305476.5	1	1	hg19	c.1489G>A	CCDS2029.1	0	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906697	0.33628	.	.	ENSG00000168758	ENST00000305476	T	0.36340	1.26	4.93	1.01	0.19927	4.93	1.01	0.19927	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.261632	0.33075	N	0.005317	T	0.22085	0.0532	L	0.28649	0.875	0.20489	N	0.999892	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.14868	-1.0457	10	0.52906	T	0.07	.	5.9613	0.19301	0.2318:0.4117:0.3565:0.0	.	497;207	Q9C0C4;Q6P5A5	SEM4C_HUMAN;.	M	497	ENSP00000306844:V497M	ENSP00000306844:V497M	V	-	1	0	0	SEMA4C	96891313	96891313	1.000000	0.71417	0.960000	0.40013	0.749000	0.42624	0.770000	0.26618	0.274000	0.22072	-0.232000	0.12228	GTG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.682	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	1	0	1	2	2	2	2	0	0	0	0	36	36	36	36	1	3.730000	-11.131590	1	0.550000	NM_017789		0	7	7	0	120	118	0		1	1		0	0	36	0	0	0.980486	9.181122e-01	0	8	0	71	0	7	120
DNER	92737	broad.mit.edu	37	2	230377562	230377562	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr2:230377562C>T	ENST00000341772.4	-	6	1218	c.1084G>A	c.(1084-1086)Gcg>Acg	p.A362T		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	362	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		ATACAGCTCGCGTTGTTTTGG	0.438																																						ENST00000341772.4	0.570000	2.800000e-01	0.490000	3.400000e-01	0.410000	0.423984	0.410000	0.400000																										0				63						c.(1084-1086)Gcg>Acg		delta/notch-like EGF repeat containing							226.0	187.0	200.0					2																	230377562		2203	4300	6503	SO:0001583	missense	92737	7	121412	39				g.chr2:230377562C>T	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.1084G>A	chr2.hg19:g.230377562C>T	ENSP00000345229:p.Ala362Thr	1						p.A362T	NM_139072.3	NP_620711.3	2	2	4	2.110673	Q8NFT8	DNER_HUMAN		6	1218	-		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	1	1	hg19	c.1084G>A	CCDS33390.1	0	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281809	0.59758	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.94232	-3.38	5.76	5.76	0.90799	5.76	5.76	0.90799	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.221819	0.45867	D	0.000328	D	0.95082	0.8407	M	0.77486	2.375	0.27064	N	0.963488	D	0.57899	0.981	P	0.50049	0.629	D	0.91199	0.4990	10	0.72032	D	0.01	.	18.7207	0.91692	0.0:1.0:0.0:0.0	.	362	Q8NFT8	DNER_HUMAN	T	362;90	ENSP00000345229:A362T	ENSP00000345229:A362T	A	-	1	0	0	DNER	230085806	230085806	0.921000	0.31238	0.021000	0.16686	0.046000	0.14306	5.864000	0.69575	2.724000	0.93272	0.591000	0.81541	GCG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.438	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	1	0	1	2	2	2	2	0	0	0	0	93	93	93	93	1	3.730000	-8.468063	1	0.550000	NM_139072		0	31	31	0	392	391	0		1	0		0	0	93	0	0	1.000000	1.656908e-02	0	0	0	3	0	31	392
SLC6A1	6529	broad.mit.edu	37	3	11058924	11058924	+	Silent	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:11058924C>T	ENST00000287766.4	+	3	448	c.27C>T	c.(25-27)gcC>gcT	p.A9A	SLC6A1_ENST00000536032.1_5'UTR|SLC6A1-AS1_ENST00000414969.2_RNA|SLC6A1_ENST00000462473.1_3'UTR	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	9					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	GCAAGGTGGCCGACGGGCAGA	0.632																																						ENST00000287766.4	0.430000	9.000000e-02	0.310000	1.400000e-01	0.210000	0.238991	0.210000	0.210000																										0				26						c.(25-27)gcC>gcT		solute carrier family 6 (neurotransmitter transporter), member 1	Clobazam(DB00349)|Tiagabine(DB00906)						46.0	43.0	44.0					3																	11058924		2203	4300	6503	SO:0001819	synonymous_variant	6529	0	0					g.chr3:11058924C>T		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.27C>T	chr3.hg19:g.11058924C>T		1					SLC6A1_ENST00000536032.1_5'UTR|SLC6A1-AS1_ENST00000414969.2_RNA|SLC6A1_ENST00000462473.1_3'UTR	p.A9A	NM_003042.3	NP_003033.3	1	2	3	1.724728	P30531	SC6A1_HUMAN		3	448	+		Ovarian(110;0.0392)	Q8N4K8	Silent	SNP	ENST00000287766.4	1	1	hg19	c.27C>T	CCDS2603.1	0																																																																																								0.645530		TCGA-YY-A8LH-01A-11D-A36O-08	0.632	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	0	0	1	2	2	2	2	0	0	0	0	56	56	56	56	1	3.730000	-3.269789	1	0.550000	NM_003042		0	7	7	0	150	148	0		1			0	0	56	0	0	0.980480	0	0	0	0	0	0	7	150
FBXO40	51725	broad.mit.edu	37	3	121340995	121340995	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:121340995G>A	ENST00000338040.4	+	3	1133	c.719G>A	c.(718-720)aGc>aAc	p.S240N		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	240					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		AGCTGTGAGAGCAAGAACAAG	0.458																																						ENST00000338040.4	1.000000	4.000000e-02	0.280000	9.000000e-02	0.150000	0.247795	0.150000	0.140000																										0				46						c.(718-720)aGc>aAc		F-box protein 40							68.0	74.0	72.0					3																	121340995		2203	4300	6503	SO:0001583	missense	51725	0	0					g.chr3:121340995G>A	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.719G>A	chr3.hg19:g.121340995G>A	ENSP00000337510:p.Ser240Asn	1						p.S240N	NM_016298.3	NP_057382.2	1	2	3	1.690063	Q9UH90	FBX40_HUMAN		3	1133	+			B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	0	1	hg19	c.719G>A	CCDS33835.1	0	.	.	.	.	.	.	.	.	.	.	G	0.205	-1.041439	0.02013	.	.	ENSG00000163833	ENST00000338040	T	0.43688	0.94	5.64	2.3	0.28687	5.64	2.3	0.28687	.	1.305700	0.04337	N	0.353342	T	0.22475	0.0542	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.19647	-1.0299	10	0.17832	T	0.49	-0.1509	4.5317	0.12008	0.3425:0.1562:0.5013:0.0	.	240	Q9UH90	FBX40_HUMAN	N	240	ENSP00000337510:S240N	ENSP00000337510:S240N	S	+	2	0	0	FBXO40	122823685	122823685	0.057000	0.20700	0.014000	0.15608	0.512000	0.34134	0.903000	0.28475	0.121000	0.18284	0.591000	0.81541	AGC	0.636877		TCGA-YY-A8LH-01A-11D-A36O-08	0.458	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	0	0	1	2	2	2	2	0	0	0	0	39	39	39	38	1	3.730000	-6.571600	1	0.550000	NM_016298		0	4	4	0	134	132	0		1			0	0	39	0	0	0.888040	0	0	0	0	0	0	4	134
OSBPL11	114885	broad.mit.edu	37	3	125279224	125279224	+	Splice_Site	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:125279224C>A	ENST00000296220.5	-	8	1443	c.1154G>T	c.(1153-1155)aGa>aTa	p.R385I		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	385					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						ATTACTTACTCTTGTTAAATC	0.383																																						ENST00000296220.5	1.000000	2.500000e-01	0.440000	3.000000e-01	0.360000	0.388478	0.360000	0.360000																										0				27						c.(1153-1155)aGa>aTa		oxysterol binding protein-like 11							159.0	138.0	145.0					3																	125279224		2203	4300	6503	SO:0001630	splice_region_variant	114885	0	0					g.chr3:125279224C>A	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.1155+1G>T	chr3.hg19:g.125279224C>A		1						p.R385I	NM_022776.4	NP_073613.2	1	2	3	1.720110	Q9BXB4	OSB11_HUMAN		8	1443	-			A8K9I7	Splice_Site	SNP	ENST00000296220.5	1	0	hg19	c.1154G>T	CCDS3033.1	0	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977820	0.74360	.	.	ENSG00000144909	ENST00000296220	T	0.34072	1.38	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.68796	0.3040	M	0.91196	3.185	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.76451	-0.2954	10	0.87932	D	0	-26.5516	18.9367	0.92589	0.0:1.0:0.0:0.0	.	385	Q9BXB4	OSB11_HUMAN	I	385	ENSP00000296220:R385I	ENSP00000296220:R385I	R	-	2	0	0	OSBPL11	126761914	126761914	1.000000	0.71417	0.922000	0.36590	0.516000	0.34256	7.555000	0.82223	2.776000	0.95493	0.655000	0.94253	AGA	0.643987		TCGA-YY-A8LH-01A-11D-A36O-08	0.383	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	1	0	1	2	2	2	2	0	0	0	0	135	135	135	134	1	3.730000	-2.879461	1	0.550000	NM_022776	Missense_Mutation	0	32	32	0	375	367	0		1	0		0	0	135	0	0	1.000000	7.970774e-02	0	0	0	6	0	32	375
ABCC5	10057	broad.mit.edu	37	3	183663704	183663704	+	Silent	SNP	C	C	A	rs375899840		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:183663704C>A	ENST00000334444.6	-	24	3678	c.3438G>T	c.(3436-3438)acG>acT	p.T1146T	ABCC5_ENST00000265586.6_Silent_p.T1103T	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1146	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	CCAGTCTGACCGTAAACTGGA	0.448																																						ENST00000334444.6	1.000000	0	0.070000	2.000000e-02	0.040000	0.075009	0.040000	0.050000																										0				62						c.(3436-3438)acG>acT		ATP-binding cassette, sub-family C (CFTR/MRP), member 5	Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)						238.0	227.0	230.0					3																	183663704		1934	4149	6083	SO:0001819	synonymous_variant	10057	0	0					g.chr3:183663704C>A	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3438G>T	chr3.hg19:g.183663704C>A		1					ABCC5_ENST00000265586.6_Silent_p.T1103T	p.T1146T	NM_005688.2	NP_005679.2	1	2	3	1.720110	O15440	MRP5_HUMAN	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)	24	3678	-	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	0	1	hg19	c.3438G>T	CCDS43176.1	0																																																																																								0.643987		TCGA-YY-A8LH-01A-11D-A36O-08	0.448	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	0	0	1	2	2	2	2	0	0	0	0	278	278	278	275	1	3.730000	-1.730994	0	0.550000	NM_005688		0	8	8	0	837	829	0		1	0		0	0	278	0	0	0.988967	5.348054e-02	0	0	0	34	0	8	837
LRRFIP2	9209	broad.mit.edu	37	3	37154441	37154441	+	Missense_Mutation	SNP	T	T	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:37154441T>C	ENST00000336686.4	-	8	483	c.403A>G	c.(403-405)Aag>Gag	p.K135E	LRRFIP2_ENST00000396428.2_Missense_Mutation_p.K104E|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.K135E|LRRFIP2_ENST00000421276.2_Intron|LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000354379.4_Intron			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	135	DVL3-binding.|Ser-rich.				Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GACCTCTTCTTCATTCCATGA	0.328																																						ENST00000336686.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999998	0.990000	1.000000																										1	Whole gene deletion(1)	p.0?(1)	ovary(1)	22						c.(403-405)Aag>Gag		leucine rich repeat (in FLII) interacting protein 2							123.0	126.0	125.0					3																	37154441		2203	4300	6503	SO:0001583	missense	9209	0	0					g.chr3:37154441T>C	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.403A>G	chr3.hg19:g.37154441T>C	ENSP00000338727:p.Lys135Glu	1					LRRFIP2_ENST00000421276.2_Intron|LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000396428.2_Missense_Mutation_p.K104E|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.K135E|LRRFIP2_ENST00000354379.4_Intron	p.K135E			1	2	3	1.724728	Q9Y608	LRRF2_HUMAN		8	483	-			A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	ENST00000336686.4	1	1	hg19	c.403A>G	CCDS2664.1	1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.886492	0.51908	.	.	ENSG00000093167	ENST00000421307;ENST00000336686;ENST00000396428	T;T;T	0.46063	0.88;0.88;1.21	5.31	5.31	0.75309	5.31	5.31	0.75309	.	0.394787	0.25872	N	0.027745	T	0.30355	0.0762	N	0.14661	0.345	0.32566	N	0.530498	P;P	0.45348	0.762;0.856	B;B	0.42738	0.303;0.396	T	0.40794	-0.9544	10	0.40728	T	0.16	-25.7202	14.3757	0.66874	0.0:0.0:0.0:1.0	.	104;135	A8MXR0;Q9Y608	.;LRRF2_HUMAN	E	135;135;104	ENSP00000392217:K135E;ENSP00000338727:K135E;ENSP00000379705:K104E	ENSP00000338727:K135E	K	-	1	0	0	LRRFIP2	37129445	37129445	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	5.517000	0.67061	2.145000	0.66743	0.482000	0.46254	AAG	0.645530		TCGA-YY-A8LH-01A-11D-A36O-08	0.328	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253335.3	1	0	1	2	2	2	2	0	0	0	0	219	219	219	218	1	3.730000	-20.000000	1	0.550000	NM_006309		0	202	199	0	535	528	1		1			0	0	219	0	0	1.000000	0	0	0	0	0	0	202	535
ZNF502	91392	broad.mit.edu	37	3	44763222	44763222	+	Silent	SNP	C	C	A	rs561539227		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:44763222C>A	ENST00000296091.4	+	4	1169	c.913C>A	c.(913-915)Cga>Aga	p.R305R	ZNF502_ENST00000436624.2_Silent_p.R305R|ZNF502_ENST00000449836.1_Silent_p.R305R	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		CTCTTCTTTTCGAAAACACTC	0.408																																						ENST00000296091.4	0.120000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.073238	0.050000	0.060000																										0				19						c.(913-915)Cga>Aga		zinc finger protein 502							164.0	170.0	168.0					3																	44763222		2203	4300	6503	SO:0001819	synonymous_variant	91392	0	0					g.chr3:44763222C>A	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.913C>A	chr3.hg19:g.44763222C>A		1					ZNF502_ENST00000449836.1_Silent_p.R305R|ZNF502_ENST00000436624.2_Silent_p.R305R	p.R305R	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	1	2	3	1.724728	Q8TBZ5	ZN502_HUMAN		4	1169	+				Silent	SNP	ENST00000296091.4	0	1	hg19	c.913C>A	CCDS2719.1	0	.	.	.	.	.	.	.	.	.	.	C	4.294	0.053853	0.08291	.	.	ENSG00000196653	ENST00000427783	.	.	.	4.27	-0.248	0.13015	4.27	-0.248	0.13015	.	.	.	.	.	T	0.39545	0.1082	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.40478	-0.9561	5	0.87932	D	0	-0.978	6.8198	0.23851	0.4135:0.3026:0.2839:0.0	.	.	.	.	L	304	.	ENSP00000397812:F304L	F	+	3	2	2	ZNF502	44738226	44738226	0.547000	0.26465	0.305000	0.25099	0.935000	0.57460	2.045000	0.41250	0.132000	0.18615	0.655000	0.94253	TTC	0.645530		TCGA-YY-A8LH-01A-11D-A36O-08	0.408	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	0	0	1	2	2	2	2	0	0	0	0	246	246	246	245	1	3.730000	-2.319485	0	0.550000	NM_033210		0	9	11	0	714	707	0		1	0		0	0	246	0	0	0.994066	1.226507e-03	0	0	0	4	0	9	714
CXCR6	10663	broad.mit.edu	37	3	45988477	45988477	+	Silent	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:45988477C>A	ENST00000458629.1	+	1	1967	c.504C>A	c.(502-504)atC>atA	p.I168I	CXCR6_ENST00000438735.1_Silent_p.I168I|FYCO1_ENST00000535325.1_Intron|FYCO1_ENST00000296137.2_Intron|CXCR6_ENST00000457814.1_Silent_p.I168I|FYCO1_ENST00000438446.1_Intron|CXCR6_ENST00000304552.4_Silent_p.I168I			O00574	CXCR6_HUMAN	chemokine (C-X-C motif) receptor 6	168					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|viral genome replication (GO:0019079)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(3)|lung(1)|prostate(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CCCAAATTATCTATGGCAATG	0.502																																					Esophageal Squamous(63;1005 1117 15521 45762 47089)	ENST00000458629.1	0.210000	4.000000e-02	0.150000	6.000000e-02	0.100000	0.120831	0.100000	0.100000																										0				8						c.(502-504)atC>atA		chemokine (C-X-C motif) receptor 6							114.0	108.0	110.0					3																	45988477		2203	4300	6503	SO:0001819	synonymous_variant	10663	0	0					g.chr3:45988477C>A	AF007545	CCDS2735.1	3p21	2012-08-08			ENSG00000172215	ENSG00000172215		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	16647	protein-coding gene	gene with protein product		605163				9166430, 9230441	Standard	XM_005264809		Approved	TYMSTR, STRL33, BONZO, CD186	uc003cpc.1	O00574	OTTHUMG00000133448	ENST00000458629.1:c.504C>A	chr3.hg19:g.45988477C>A		1					CXCR6_ENST00000457814.1_Silent_p.I168I|FYCO1_ENST00000296137.2_Intron|FYCO1_ENST00000535325.1_Intron|CXCR6_ENST00000438735.1_Silent_p.I168I|FYCO1_ENST00000438446.1_Intron|CXCR6_ENST00000304552.4_Silent_p.I168I	p.I168I			1	2	3	1.724728	O00574	CXCR6_HUMAN		1	1967	+			O00575|Q9HCA5	Silent	SNP	ENST00000458629.1	0	1	hg19	c.504C>A	CCDS2735.1	0																																																																																								0.645530		TCGA-YY-A8LH-01A-11D-A36O-08	0.502	CXCR6-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344395.1	0	0	1	2	2	2	2	0	0	0	0	132	132	132	129	1	3.730000	-3.126642	1	0.550000			0	8	8	0	360	355	0		1	0		0	0	132	0	0	0.988955	6.521172e-04	0	0	0	2	0	8	360
EHHADH	1962	broad.mit.edu	37	3	184910478	184910478	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr3:184910478G>A	ENST00000231887.3	-	7	1783	c.1708C>T	c.(1708-1710)Cga>Tga	p.R570*	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Nonsense_Mutation_p.R474*	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	570	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			TGGCCAAATCGTCCTAATTCA	0.473																																						ENST00000231887.3	1.000000	4.000000e-02	0.160000	7.000000e-02	0.110000	0.146087	0.110000	0.120000																										0				24						c.(1708-1710)Cga>Tga		enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase							91.0	81.0	84.0					3																	184910478		2203	4300	6503	SO:0001587	stop_gained	1962	2	121412	31				g.chr3:184910478G>A	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1708C>T	chr3.hg19:g.184910478G>A	ENSP00000231887:p.Arg570*	1					EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Nonsense_Mutation_p.R474*	p.R570*	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	1	2	3	1.720110	Q08426	ECHP_HUMAN	Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)	7	1783	-	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Nonsense_Mutation	SNP	ENST00000231887.3	0	1	hg19	c.1708C>T	CCDS33901.1	0	.	.	.	.	.	.	.	.	.	.	G	39	7.633440	0.98403	.	.	ENSG00000113790	ENST00000231887;ENST00000456310	.	.	.	5.91	-0.0269	0.13928	5.91	-0.0269	0.13928	.	0.058373	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.3739	17.2992	0.87177	0.0:0.0:0.3145:0.6855	.	.	.	.	X	570;474	.	ENSP00000231887:R570X	R	-	1	2	2	EHHADH	186393172	186393172	1.000000	0.71417	0.893000	0.35052	0.999000	0.98932	1.576000	0.36504	0.050000	0.15949	0.655000	0.94253	CGA	0.643987		TCGA-YY-A8LH-01A-11D-A36O-08	0.473	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1	0	0	1	2	2	2	2	0	0	0	0	133	133	133	132	1	3.730000	-3.747530	1	0.550000			0	9	9	0	369	359	0		1	0		0	0	133	0	0	0.993616	7.132423e-03	0	0	0	5	0	9	369
ZFYVE28	57732	broad.mit.edu	37	4	2355738	2355738	+	Silent	SNP	G	G	A	rs542809889	byFrequency	TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr4:2355738G>A	ENST00000290974.2	-	2	441	c.102C>T	c.(100-102)gcC>gcT	p.A34A	ZFYVE28_ENST00000515169.1_5'UTR|ZFYVE28_ENST00000509171.1_Intron|ZFYVE28_ENST00000503000.1_Silent_p.A34A|ZFYVE28_ENST00000511071.1_Silent_p.A34A|ZFYVE28_ENST00000515312.1_5'UTR	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	34					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						CCAGCTCCGCGGCCACCTGGT	0.677													g|||	7	0.00139776	0.0	0.0	5008	,	,		16128	0.001		0.0	False		,,,				2504	0.0061					ENST00000290974.2	1.000000	4.400000e-01	1.000000	6.500000e-01	0.930000	0.860893	0.930000	1.000000																										0				31						c.(100-102)gcC>gcT		zinc finger, FYVE domain containing 28							18.0	17.0	18.0					4																	2355738		2201	4300	6501	SO:0001819	synonymous_variant	57732	36	121166	38				g.chr4:2355738G>A	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.102C>T	chr4.hg19:g.2355738G>A		1					ZFYVE28_ENST00000509171.1_Intron|ZFYVE28_ENST00000515312.1_5'UTR|ZFYVE28_ENST00000503000.1_Silent_p.A34A|ZFYVE28_ENST00000515169.1_5'UTR|ZFYVE28_ENST00000511071.1_Silent_p.A34A	p.A34A	NM_020972.2	NP_066023.2	2	2	4	2.111114	Q9HCC9	LST2_HUMAN		2	441	-			B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	ENST00000290974.2	0	1	hg19	c.102C>T	CCDS33942.1	1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.677	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	1	0	1	2	2	2	2	0	0	0	0	14	14	14	14	1	3.730000	-14.381540	1	0.550000	XM_035371		0	7	7	0	37	36	1		1	1		0	0	14	0	0	0.982226	6.893196e-01	0	5	0	9	0	7	37
FAM193A	8603	broad.mit.edu	37	4	2691390	2691390	+	Missense_Mutation	SNP	A	A	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr4:2691390A>T	ENST00000324666.5	+	12	1967	c.1616A>T	c.(1615-1617)aAg>aTg	p.K539M	FAM193A_ENST00000545951.1_Missense_Mutation_p.K539M|FAM193A_ENST00000382839.3_Missense_Mutation_p.K539M|FAM193A_ENST00000502458.1_Missense_Mutation_p.K561M|FAM193A_ENST00000505311.1_Missense_Mutation_p.K539M	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	539										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						ATGAATGATAAGAACTGGAAT	0.353																																						ENST00000324666.5	0.220000	4.000000e-02	0.180000	8.000000e-02	0.120000	0.132008	0.120000	0.120000																										0				40						c.(1615-1617)aAg>aTg		family with sequence similarity 193, member A							68.0	73.0	72.0					4																	2691390		2203	4300	6503	SO:0001583	missense	8603	0	0					g.chr4:2691390A>T	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1616A>T	chr4.hg19:g.2691390A>T	ENSP00000324587:p.Lys539Met	1					FAM193A_ENST00000545951.1_Missense_Mutation_p.K539M|FAM193A_ENST00000382839.3_Missense_Mutation_p.K539M|FAM193A_ENST00000505311.1_Missense_Mutation_p.K539M|FAM193A_ENST00000502458.1_Missense_Mutation_p.K561M	p.K539M	NM_001256666.1	NP_001243595.1	2	2	4	2.111114	P78312	F193A_HUMAN		12	1967	+			B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	0	1	hg19	c.1616A>T	CCDS58875.1	0	.	.	.	.	.	.	.	.	.	.	A	20.3	3.973078	0.74246	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.38	5.38	0.77491	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.47728	0.1461	L	0.59436	1.845	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.997;0.998;0.997;0.998	T	0.47724	-0.9095	10	0.72032	D	0.01	-39.2116	14.6205	0.68582	1.0:0.0:0.0:0.0	.	539;561;539;561;539	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	M	539;539;539;561;393	ENSP00000372290:K539M;ENSP00000324587:K539M;ENSP00000443617:K539M;ENSP00000427505:K561M;ENSP00000427260:K393M	ENSP00000324587:K539M	K	+	2	0	0	FAM193A	2661188	2661188	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.217000	0.72218	2.048000	0.60808	0.456000	0.33151	AAG	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.353	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	3.730000	-8.269270	1	0.550000	NM_003704		0	8	8	0	374	371	0		1	0		0	0	88	0	0	0.989201	4.424851e-02	0	0	0	14	0	8	374
UGDH	7358	broad.mit.edu	37	4	39512385	39512385	+	Missense_Mutation	SNP	T	T	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr4:39512385T>C	ENST00000316423.6	-	4	703	c.361A>G	c.(361-363)Aat>Gat	p.N121D	UGDH_ENST00000506179.1_Missense_Mutation_p.N121D|UGDH_ENST00000501493.2_Intron|UGDH_ENST00000515398.1_5'Flank|UGDH_ENST00000507089.1_Missense_Mutation_p.N24D	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	O60701	UGDH_HUMAN	UDP-glucose 6-dehydrogenase	121					cellular glucuronidation (GO:0052695)|gastrulation with mouth forming second (GO:0001702)|glycosaminoglycan biosynthetic process (GO:0006024)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|UDP-glucose 6-dehydrogenase activity (GO:0003979)			breast(1)|central_nervous_system(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(2)	27						TTGTACCCATTTGAGTTTTGC	0.433																																						ENST00000316423.6	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				27						c.(361-363)Aat>Gat		UDP-glucose 6-dehydrogenase							169.0	157.0	161.0					4																	39512385		2203	4300	6503	SO:0001583	missense	7358	4	121410	42				g.chr4:39512385T>C	AF061016	CCDS3455.1, CCDS54757.1, CCDS54758.1	4p14	2011-11-16	2010-04-28		ENSG00000109814	ENSG00000109814	1.1.1.22		12525	protein-coding gene	gene with protein product		603370	"""UDP-glucose dehydrogenase"""			9737970, 10575217	Standard	NM_003359		Approved		uc003guk.2	O60701	OTTHUMG00000099371	ENST00000316423.6:c.361A>G	chr4.hg19:g.39512385T>C	ENSP00000319501:p.Asn121Asp	1					UGDH_ENST00000507089.1_Missense_Mutation_p.N24D|UGDH_ENST00000506179.1_Missense_Mutation_p.N121D|UGDH_ENST00000501493.2_Intron|UGDH_ENST00000515398.1_5'Flank	p.N121D	NM_001184701.1|NM_003359.3	NP_001171630.1|NP_003350.1	2	2	4	2.111114	O60701	UGDH_HUMAN		4	703	-			B3KUU2|B4DN25|O60589	Missense_Mutation	SNP	ENST00000316423.6	1	1	hg19	c.361A>G	CCDS3455.1	1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563464	0.45694	.	.	ENSG00000109814	ENST00000316423;ENST00000506179;ENST00000507089;ENST00000515021;ENST00000514106;ENST00000509391	T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.95	-0.408	0.12381	5.95	-0.408	0.12381	UDP-glucose/GDP-mannose dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.233858	0.49916	D	0.000133	T	0.53238	0.1784	N	0.17922	0.545	0.37435	D	0.914199	B	0.02656	0.0	B	0.06405	0.002	T	0.41998	-0.9477	10	0.12430	T	0.62	0.1388	11.693	0.51527	0.0828:0.0:0.1465:0.7707	.	121	O60701	UGDH_HUMAN	D	121;121;24;134;121;121	ENSP00000319501:N121D;ENSP00000421757:N121D;ENSP00000426560:N24D;ENSP00000421954:N134D;ENSP00000425834:N121D;ENSP00000422603:N121D	ENSP00000319501:N121D	N	-	1	0	0	UGDH	39188780	39188780	0.994000	0.37717	0.980000	0.43619	0.998000	0.95712	1.356000	0.34079	0.011000	0.14865	0.528000	0.53228	AAT	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.433	UGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216818.3	1	0	1	2	2	2	2	0	0	0	0	162	162	162	162	1	3.730000	-20.000000	1	0.550000	NM_003359		0	207	205	0	466	463	1		1	1		0	0	162	0	0	1.000000	1	0	22	0	57	0	207	466
HERC5	51191	broad.mit.edu	37	4	89414249	89414249	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr4:89414249G>A	ENST00000264350.3	+	17	2373	c.2220G>A	c.(2218-2220)ccG>ccA	p.P740P	HERC5_ENST00000508159.1_Silent_p.P378P|AC083829.1_ENST00000408152.2_RNA	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	740	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TGATCCAGCCGGAATATGGGA	0.443																																					Esophageal Squamous(39;887 1012 34045 50514)	ENST00000264350.3	0.600000	2.900000e-01	0.520000	3.500000e-01	0.430000	0.443684	0.430000	0.440000																										0				53						c.(2218-2220)ccG>ccA		HECT and RLD domain containing E3 ubiquitin protein ligase 5							189.0	166.0	174.0					4																	89414249		2203	4300	6503	SO:0001819	synonymous_variant	51191	3	121412	37				g.chr4:89414249G>A	AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.2220G>A	chr4.hg19:g.89414249G>A		1					AC083829.1_ENST00000408152.2_RNA|HERC5_ENST00000508159.1_Silent_p.P378P	p.P740P	NM_016323.3	NP_057407.2	2	2	4	2.111114	Q9UII4	HERC5_HUMAN		17	2373	+		Hepatocellular(203;0.114)	B2RTQ1|Q69G20	Silent	SNP	ENST00000264350.3	1	1	hg19	c.2220G>A	CCDS3630.1	0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.443	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	0	0	1	2	16	4	2	1	1	1	1	83	83	83	82	1	3.730000	-2.665581	1	0.550000	NM_016323		0	28	28	0	338	333	0		1	0		1	0	83	0	0	0.975938	5.338351e-01	0	1	0	48	0	28	338
PCDH10	57575	broad.mit.edu	37	4	134073128	134073128	+	Silent	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr4:134073128C>T	ENST00000264360.5	+	1	2659	c.1833C>T	c.(1831-1833)ggC>ggT	p.G611G	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	611	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CGGACGACGGCGAGAACGCCC	0.692																																						ENST00000264360.5	0.280000	4.000000e-02	0.210000	8.000000e-02	0.130000	0.152737	0.130000	0.120000																										0				136						c.(1831-1833)ggC>ggT		protocadherin 10							27.0	31.0	29.0					4																	134073128		2132	4234	6366	SO:0001819	synonymous_variant	57575	0	0					g.chr4:134073128C>T	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1833C>T	chr4.hg19:g.134073128C>T		1					RP11-9G1.3_ENST00000505289.1_lincRNA	p.G611G	NM_032961.1	NP_116586.1	2	2	4	2.111114	Q9P2E7	PCD10_HUMAN		1	2659	+			Q4W5F6|Q96SF0	Silent	SNP	ENST00000264360.5	0	1	hg19	c.1833C>T	CCDS34063.1	0																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.692	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	0	0	1	2	2	2	2	0	0	0	0	74	74	74	72	1	3.730000	-6.531740	1	0.550000	NM_032961		0	5	5	0	214	212	0		1			0	0	74	0	0	0.936747	0	0	0	0	0	0	5	214
CTNND2	1501	broad.mit.edu	37	5	11364949	11364949	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:11364949G>A	ENST00000304623.8	-	8	1420	c.1231C>T	c.(1231-1233)Cgg>Tgg	p.R411W	CTNND2_ENST00000503622.1_Missense_Mutation_p.R74W|CTNND2_ENST00000359640.2_Missense_Mutation_p.R411W|CTNND2_ENST00000511377.1_Missense_Mutation_p.R320W|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	411					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGCAGGGCCCGCAACTCTGGG	0.577																																						ENST00000304623.8	1.000000	8.000000e-01	1.000000	9.600000e-01	0.990000	0.979939	0.990000	1.000000																										0				136						c.(1231-1233)Cgg>Tgg		catenin (cadherin-associated protein), delta 2							49.0	54.0	52.0					5																	11364949		2203	4300	6503	SO:0001583	missense	1501	0	0					g.chr5:11364949G>A	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1231C>T	chr5.hg19:g.11364949G>A	ENSP00000307134:p.Arg411Trp	0					CTNND2_ENST00000503622.1_Missense_Mutation_p.R74W|CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000511377.1_Missense_Mutation_p.R320W|CTNND2_ENST00000359640.2_Missense_Mutation_p.R411W|CTNND2_ENST00000495388.2_5'UTR	p.R411W	NM_001332.2	NP_001323.1	2	2	4	1.978537	Q9UQB3	CTND2_HUMAN		8	1420	-			B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	1	1	hg19	c.1231C>T	CCDS3881.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504805	0.85176	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000503622;ENST00000502551	D;D;D;T	0.83419	-1.6;-1.72;-1.6;-1.41	5.47	4.52	0.55395	5.47	4.52	0.55395	.	0.000000	0.64402	D	0.000019	D	0.88097	0.6345	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.99;0.998	D	0.88375	0.2997	10	0.87932	D	0	-20.37	10.9741	0.47456	0.0:0.0:0.5842:0.4157	.	74;411	B4DRK2;Q9UQB3	.;CTND2_HUMAN	W	411;411;320;74;151	ENSP00000307134:R411W;ENSP00000352661:R411W;ENSP00000426510:R320W;ENSP00000426887:R74W	ENSP00000307134:R411W	R	-	1	2	2	CTNND2	11417949	11417949	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.008000	0.49544	2.581000	0.87130	0.655000	0.94253	CGG	0.692202		TCGA-YY-A8LH-01A-11D-A36O-08	0.577	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	1	0	1	2	2	2	2	0	0	0	0	28	28	28	28	1	3.730000	-3.771706	1	0.550000	NM_001332		0	29	28	0	109	105	1		1			0	0	28	0	0	1.000000	0	0	0	0	0	0	29	109
FBN2	2201	broad.mit.edu	37	5	127624885	127624885	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:127624885C>T	ENST00000508053.1	-	58	7545	c.6571G>A	c.(6571-6573)Gac>Aac	p.D2191N	FBN2_ENST00000262464.4_Missense_Mutation_p.D2191N			P35556	FBN2_HUMAN	fibrillin 2	2191	EGF-like 36; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AAAGATCCGTCGGTGTTGATA	0.413																																						ENST00000508053.1	0.350000	1.400000e-01	0.300000	1.800000e-01	0.230000	0.244462	0.230000	0.240000																										0				197						c.(6571-6573)Gac>Aac		fibrillin 2							161.0	150.0	154.0					5																	127624885		2203	4300	6503	SO:0001583	missense	2201	0	0					g.chr5:127624885C>T	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6571G>A	chr5.hg19:g.127624885C>T	ENSP00000424571:p.Asp2191Asn	0					FBN2_ENST00000262464.4_Missense_Mutation_p.D2191N	p.D2191N			2	2	4	2.090344	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	58	7545	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	1	1	hg19	c.6571G>A	CCDS34222.1	0	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715887	0.89112	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92299	-3.01;-3.01	5.76	4.88	0.63580	5.76	4.88	0.63580	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.090325	0.48286	D	0.000191	D	0.87087	0.6090	L	0.46885	1.475	0.51233	D	0.999917	P	0.51933	0.949	B	0.35470	0.203	D	0.86989	0.2109	10	0.34782	T	0.22	.	15.7202	0.77705	0.0:0.9314:0.0:0.0686	.	2191	P35556	FBN2_HUMAN	N	2191	ENSP00000262464:D2191N;ENSP00000424571:D2191N	ENSP00000262464:D2191N	D	-	1	0	0	FBN2	127652784	127652784	1.000000	0.71417	0.702000	0.30337	0.730000	0.41778	5.939000	0.70179	2.882000	0.98803	0.655000	0.94253	GAC	0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.413	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	1	0	1	2	2	2	2	0	0	0	0	137	137	137	134	1	3.730000	-3.292531	1	0.550000	NM_001999		0	22	22	0	504	497	0		1			0	0	137	0	0	0.999999	0	0	0	0	0	0	22	504
TRPC7	57113	broad.mit.edu	37	5	135692940	135692940	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:135692940G>A	ENST00000513104.1	-	2	418	c.136C>T	c.(136-138)Cgc>Tgc	p.R46C	TRPC7_ENST00000426057.2_Missense_Mutation_p.R46C|TRPC7_ENST00000355180.3_Missense_Mutation_p.R46C	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	46					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCCAGGAAGCGCTCCTCCTCG	0.612																																						ENST00000513104.1	0.290000	1.100000e-01	0.240000	1.400000e-01	0.180000	0.195600	0.180000	0.200000																										0				46						c.(136-138)Cgc>Tgc		transient receptor potential cation channel, subfamily C, member 7							90.0	101.0	97.0					5																	135692940		2131	4259	6390	SO:0001583	missense	57113	0	0					g.chr5:135692940G>A	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.136C>T	chr5.hg19:g.135692940G>A	ENSP00000426070:p.Arg46Cys	0					TRPC7_ENST00000355180.3_Missense_Mutation_p.R46C|TRPC7_ENST00000426057.2_Missense_Mutation_p.R46C	p.R46C	NM_020389.2	NP_065122.1	2	2	4	2.090344	Q9HCX4	TRPC7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	2	418	-			A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	1	1	hg19	c.136C>T	CCDS47267.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.2|27.2	4.814083|4.814083	0.90790|0.90790	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753|ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	.|T;T;T	.|0.79247	.|-1.09;-1.25;-1.21	5.2|5.2	5.2|5.2	0.72013|0.72013	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85327|0.85327	0.5671|0.5671	L|L	0.55990|0.55990	1.75|1.75	0.58432|0.58432	D|D	0.999993|0.999993	.|P;D;D;D	.|0.89917	.|0.916;1.0;0.999;0.999	.|B;D;P;P	.|0.65010	.|0.232;0.931;0.899;0.899	D|D	0.86290|0.86290	0.1673|0.1673	5|10	.|0.72032	.|D	.|0.01	-15.4883|-15.4883	18.9316|18.9316	0.92568|0.92568	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|46;46;46;46	.|Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.|.;.;.;TRPC7_HUMAN	V|C	45|46	.|ENSP00000347312:R46C;ENSP00000441628:R46C;ENSP00000426070:R46C	.|ENSP00000265193:R46C	A|R	-|-	2|1	0|0	0|0	TRPC7|TRPC7	135720839|135720839	135720839|135720839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	7.761000|7.761000	0.85260|0.85260	2.691000|2.691000	0.91804|0.91804	0.655000|0.655000	0.94253|0.94253	GCG|CGC	0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.612	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	0	0	1	2	2	2	2	0	0	0	0	184	184	184	184	1	3.730000	-3.276538	1	0.550000	NM_020389		0	22	22	0	636	629	0		1			0	0	184	0	0	0.999999	0	0	0	0	0	0	22	636
PCDHA9	9752	broad.mit.edu	37	5	140229544	140229544	+	Silent	SNP	C	C	G	rs527334652	byFrequency	TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:140229544C>G	ENST00000532602.1	+	1	2497	c.1464C>G	c.(1462-1464)gcC>gcG	p.A488A	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.A488A|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	488	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAGAACGCCCTGGTGTCCT	0.667													.|||	2	0.000399361	0.0015	0.0	5008	,	,		17639	0.0		0.0	False		,,,				2504	0.0				Melanoma(55;1800 1972 14909)	ENST00000532602.1	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999996	0.990000	1.000000																										0				59						c.(1462-1464)gcC>gcG		protocadherin alpha 9																																				SO:0001819	synonymous_variant	9752	8	120800	41				g.chr5:140229544C>G	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1464C>G	chr5.hg19:g.140229544C>G		0					PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.A488A|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron	p.A488A	NM_031857.1	NP_114063.1	2	2	4	2.090344	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2497	+			O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	1	1	hg19	c.1464C>G	CCDS54920.1	1																																																																																								0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.667	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	1	0	0	2	2	2	2	0	0	0	0	175	175	175	178	1	3.730000	-4.882734	1	0.550000	NM_031857		0	129	109	0	409	397	1		1			0	0	175	0	0	1.000000	0	0	0	0	0	0	129	409
TCERG1	10915	broad.mit.edu	37	5	145851118	145851118	+	Missense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:145851118C>A	ENST00000296702.5	+	9	1618	c.1580C>A	c.(1579-1581)gCt>gAt	p.A527D	TCERG1_ENST00000394421.2_Missense_Mutation_p.A506D	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	527					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTGCTACTGCTCCTATTCCT	0.423																																						ENST00000296702.5	0.130000	0	0.090000	2.000000e-02	0.050000	0.061583	0.050000	0.040000																										0				46						c.(1579-1581)gCt>gAt		transcription elongation regulator 1							124.0	124.0	124.0					5																	145851118		2203	4300	6503	SO:0001583	missense	10915	0	0					g.chr5:145851118C>A	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.1580C>A	chr5.hg19:g.145851118C>A	ENSP00000296702:p.Ala527Asp	0					TCERG1_ENST00000394421.2_Missense_Mutation_p.A506D	p.A527D	NM_006706.3	NP_006697.2	2	2	4	2.090344	O14776	TCRG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	9	1618	+		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	0	1	hg19	c.1580C>A	CCDS4282.1	0	.	.	.	.	.	.	.	.	.	.	C	16.34	3.095411	0.56075	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.44482	0.92;0.92	5.63	5.63	0.86233	5.63	5.63	0.86233	.	0.094736	0.64402	D	0.000001	T	0.30978	0.0782	N	0.08118	0	0.31301	N	0.688266	P;P;B	0.42649	0.786;0.762;0.041	B;B;B	0.43082	0.407;0.242;0.003	T	0.15263	-1.0443	10	0.30078	T	0.28	-8.6494	19.6756	0.95930	0.0:1.0:0.0:0.0	.	506;506;527	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	D	527;506	ENSP00000296702:A527D;ENSP00000377943:A506D	ENSP00000296702:A527D	A	+	2	0	0	TCERG1	145831311	145831311	1.000000	0.71417	0.998000	0.56505	0.751000	0.42716	4.739000	0.62080	2.664000	0.90586	0.313000	0.20887	GCT	0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.423	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	0	0	0	2	2	2	2	0	0	0	0	105	105	105	105	1	3.730000	-4.486774	1	0.550000	NM_001040006		0	5	4	0	526	514	0		1	0		0	0	105	0	0	0.933653	3.286819e-02	0	0	0	24	0	5	526
GABRG2	2566	broad.mit.edu	37	5	161580182	161580182	+	Silent	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:161580182C>T	ENST00000361925.4	+	9	1432	c.1212C>T	c.(1210-1212)taC>taT	p.Y404Y	GABRG2_ENST00000356592.3_Silent_p.Y412Y|GABRG2_ENST00000414552.2_Silent_p.Y452Y|GABRG2_ENST00000393933.4_Silent_p.Y309Y			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	404					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGAAGAGTACGGCTATGAGT	0.488																																						ENST00000361925.4	0.230000	3.000000e-02	0.170000	6.000000e-02	0.110000	0.120489	0.110000	0.120000																										0				62						c.(1210-1212)taC>taT		gamma-aminobutyric acid (GABA) A receptor, gamma 2	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)						185.0	170.0	175.0					5																	161580182		2203	4300	6503	SO:0001819	synonymous_variant	2566	17	121410	44				g.chr5:161580182C>T		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1212C>T	chr5.hg19:g.161580182C>T		0					GABRG2_ENST00000393933.4_Silent_p.Y309Y|GABRG2_ENST00000414552.2_Silent_p.Y452Y|GABRG2_ENST00000356592.3_Silent_p.Y412Y	p.Y404Y			2	2	4	2.090344	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	9	1432	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	0	1	hg19	c.1212C>T	CCDS4358.1	0																																																																																								0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.488	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1	0	0	1	2	2	2	2	0	0	0	0	88	88	88	88	1	3.730000	-2.841467	1	0.550000			0	6	6	0	318	314	0		1			0	0	88	0	0	0.963989	0	0	0	0	0	0	6	318
MRPS27	23107	broad.mit.edu	37	5	71533926	71533926	+	Missense_Mutation	SNP	A	A	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:71533926A>G	ENST00000261413.5	-	5	350	c.311T>C	c.(310-312)cTg>cCg	p.L104P	MRPS27_ENST00000513900.1_Missense_Mutation_p.L118P|MRPS27_ENST00000522562.1_5'UTR|MRPS27_ENST00000457646.4_Missense_Mutation_p.L48P|MRPS27_ENST00000515404.1_Missense_Mutation_p.L48P	NM_015084.2	NP_055899.2	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27	104						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		CCAGTTTCTCAGGTACCAGCA	0.413																																						ENST00000261413.5	0.110000	0	0.090000	2.000000e-02	0.040000	0.056180	0.040000	0.040000																										0				6						c.(310-312)cTg>cCg		mitochondrial ribosomal protein S27							103.0	92.0	96.0					5																	71533926		2203	4300	6503	SO:0001583	missense	23107	0	0					g.chr5:71533926A>G	D87453	CCDS4013.1, CCDS68890.1, CCDS75257.1	5q13.2	2012-09-13			ENSG00000113048	ENSG00000113048		"""Mitochondrial ribosomal proteins / small subunits"""	14512	protein-coding gene	gene with protein product		611989					Standard	NM_015084		Approved	KIAA0264	uc003kbz.4	Q92552	OTTHUMG00000100951	ENST00000261413.5:c.311T>C	chr5.hg19:g.71533926A>G	ENSP00000261413:p.Leu104Pro	0					MRPS27_ENST00000522562.1_5'UTR|MRPS27_ENST00000513900.1_Missense_Mutation_p.L118P|MRPS27_ENST00000457646.4_Missense_Mutation_p.L48P|MRPS27_ENST00000515404.1_Missense_Mutation_p.L48P	p.L104P	NM_015084.2	NP_055899.2	2	2	4	2.090344	Q92552	RT27_HUMAN		5	350	-		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)	B4DRT2|Q6P1S1	Missense_Mutation	SNP	ENST00000261413.5	0	1	hg19	c.311T>C	CCDS4013.1	0	.	.	.	.	.	.	.	.	.	.	A	24.3	4.518352	0.85495	.	.	ENSG00000113048	ENST00000261413;ENST00000457646;ENST00000513900;ENST00000508863;ENST00000515404	T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27	5.22	5.22	0.72569	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000001	T	0.75657	0.3879	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.998	T	0.79317	-0.1853	10	0.87932	D	0	-18.2091	15.0979	0.72250	1.0:0.0:0.0:0.0	.	118;48;104	B4DRT2;D6RJC7;Q92552	.;.;RT27_HUMAN	P	104;48;118;48;48	ENSP00000261413:L104P;ENSP00000428120:L48P;ENSP00000426941:L118P;ENSP00000426176:L48P;ENSP00000427237:L48P	ENSP00000261413:L104P	L	-	2	0	0	MRPS27	71569682	71569682	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.771000	0.91751	1.970000	0.57323	0.374000	0.22700	CTG	0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.413	MRPS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218560.2	0	0	0	2	2	2	2	0	0	0	0	157	157	157	157	1	3.730000	-2.999378	1	0.550000	NM_015084		0	6	6	0	664	654	0		1	1		0	0	157	0	0	0.963426	6.069618e-02	0	2	0	35	0	6	664
NKX2-5	1482	broad.mit.edu	37	5	172660081	172660081	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr5:172660081G>A	ENST00000329198.4	-	2	739	c.466C>T	c.(466-468)Cgc>Tgc	p.R156C	NKX2-5_ENST00000521848.1_3'UTR|NKX2-5_ENST00000424406.2_3'UTR	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	156					adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGCTTGAAGCGCCGCTCCAGC	0.677																																					Esophageal Squamous(72;810 1219 2387 13420 44943)	ENST00000329198.4	1.000000	3.300000e-01	0.920000	4.800000e-01	0.680000	0.694449	0.680000	1.000000																										0				12						c.(466-468)Cgc>Tgc		NK2 homeobox 5							16.0	14.0	15.0					5																	172660081		2203	4296	6499	SO:0001583	missense	1482	0	0					g.chr5:172660081G>A	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.466C>T	chr5.hg19:g.172660081G>A	ENSP00000327758:p.Arg156Cys	0					NKX2-5_ENST00000424406.2_3'UTR|NKX2-5_ENST00000521848.1_3'UTR	p.R156C	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	2	2	4	2.090344	P52952	NKX25_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	2	739	-	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	0	1	hg19	c.466C>T	CCDS4387.1	0	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038907	0.75617	.	.	ENSG00000183072	ENST00000329198	D	0.96136	-3.92	4.12	3.16	0.36331	4.12	3.16	0.36331	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.52532	D	0.000063	D	0.96589	0.8887	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96214	0.9155	10	0.87932	D	0	.	11.6702	0.51396	0.0:0.0:0.7125:0.2875	.	156	P52952	NKX25_HUMAN	C	156	ENSP00000327758:R156C	ENSP00000327758:R156C	R	-	1	0	0	NKX2-5	172592687	172592687	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.303000	0.51858	2.307000	0.77673	0.462000	0.41574	CGC	0.708644		TCGA-YY-A8LH-01A-11D-A36O-08	0.677	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2	0	0	1	2	2	2	2	0	0	0	0	24	24	24	24	1	3.730000	-14.680890	1	0.550000			0	8	7	0	61	61	1		1			0	0	24	0	0	0.990252	0	0	0	0	0	0	8	61
GRIK2	2898	broad.mit.edu	37	6	102266347	102266348	+	Missense_Mutation	DNP	AC	AC	TT			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr6:102266347_102266348AC>TT	ENST00000421544.1	+	9	1796_1797	c.1306_1307AC>TT	c.(1306-1308)ACc>TTc	p.T436F	GRIK2_ENST00000369137.3_Missense_Mutation_p.T436F|GRIK2_ENST00000369134.4_Missense_Mutation_p.T387F|GRIK2_ENST00000369138.1_Missense_Mutation_p.T436F|GRIK2_ENST00000318991.6_Missense_Mutation_p.T436F|GRIK2_ENST00000413795.1_Missense_Mutation_p.T436F	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	436					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTTGATTGTTACCACCATTTTG	0.381																																						ENST00000421544.1	1.000000	7.000000e-02|8.000000e-02	0.300000	1.200000e-01|1.300000e-01	0.190000	0.244449|0.246070	0.190000	0.180000																										0				83						c.(1306-1308)Acc>Tcc|c.(1306-1308)aCc>aTc		glutamate receptor, ionotropic, kainate 2	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)																																			SO:0001583	missense	2898	0	0					g.chr6:102266347A>T|g.chr6:102266348C>T		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	Exception_encountered	chr6.hg19:g.102266347_102266348delinsTT	ENSP00000397026:p.Thr436Phe	1					GRIK2_ENST00000369138.1_Missense_Mutation_p.T436S|GRIK2_ENST00000413795.1_Missense_Mutation_p.T436S|GRIK2_ENST00000318991.6_Missense_Mutation_p.T436S|GRIK2_ENST00000369137.3_Missense_Mutation_p.T436S|GRIK2_ENST00000369134.4_Missense_Mutation_p.T387S|GRIK2_ENST00000369138.1_Missense_Mutation_p.T436I|GRIK2_ENST00000413795.1_Missense_Mutation_p.T436I|GRIK2_ENST00000318991.6_Missense_Mutation_p.T436I|GRIK2_ENST00000369137.3_Missense_Mutation_p.T436I|GRIK2_ENST00000369134.4_Missense_Mutation_p.T387I	p.T436S|p.T436I	NM_021956.4	NP_068775.1	0	2	2	1.454667	Q13002	GRIK2_HUMAN		9	1796|1797	+		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	1	1	hg19	c.1306A>T|c.1307C>T	CCDS5048.1	0																									5.81	5.81	0.92471																																												0			102373040|102373041														0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.381	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1	1|0	0	1	2	2	2	2	0	0	0	0	38	38|39	38|39	38|39	1	3.730000	-4.280973|-4.229092	1	0.550000			0	6	6	0	114|113	112|111	0		1			0	0	38|39	0	0	0.964399|0.964395	0	0	0	0	0	0	6	113
PHIP	55023	broad.mit.edu	37	6	79711802	79711802	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr6:79711802G>A	ENST00000275034.4	-	17	1860	c.1693C>T	c.(1693-1695)Ctt>Ttt	p.L565F		NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	565					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TCACGAATAAGTGGCCGATAA	0.358																																						ENST00000275034.4	1.000000	1.800000e-01	0.410000	2.400000e-01	0.310000	0.354078	0.310000	0.300000																										0				68						c.(1693-1695)Ctt>Ttt		pleckstrin homology domain interacting protein							113.0	104.0	107.0					6																	79711802		2203	4300	6503	SO:0001583	missense	55023	0	0					g.chr6:79711802G>A	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.1693C>T	chr6.hg19:g.79711802G>A	ENSP00000275034:p.Leu565Phe	1						p.L565F	NM_017934.5	NP_060404	0	2	2	1.454667	Q8WWQ0	PHIP_HUMAN		17	1860	-		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	1	1	hg19	c.1693C>T	CCDS4987.1	0	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950918	0.73787	.	.	ENSG00000146247	ENST00000275034	T	0.61392	0.11	5.63	4.75	0.60458	5.63	4.75	0.60458	.	0.088632	0.45867	D	0.000337	T	0.77890	0.4198	M	0.92604	3.325	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.82327	-0.0512	9	.	.	.	-16.7819	14.5837	0.68310	0.074:0.0:0.926:0.0	.	565;565	A7J992;Q8WWQ0	.;PHIP_HUMAN	F	565	ENSP00000275034:L565F	.	L	-	1	0	0	PHIP	79768521	79768521	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	6.205000	0.72148	2.799000	0.96334	0.650000	0.86243	CTT	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.358	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2	1	0	1	2	2	2	2	0	0	0	0	55	55	55	55	1	3.730000	-19.995470	1	0.550000			0	16	16	0	173	173	0		1	0		0	0	55	0	0	0.999946	8.344241e-03	0	0	0	2	0	16	173
LPA	4018	broad.mit.edu	37	6	161020546	161020546	+	Missense_Mutation	SNP	T	T	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr6:161020546T>G	ENST00000316300.5	-	20	3317	c.3273A>C	c.(3271-3273)gaA>gaC	p.E1091D	LPA_ENST00000447678.1_Missense_Mutation_p.E1091D			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3599	Kringle 10. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TTGGGTAGTTTTCTGGGGTCC	0.483																																						ENST00000316300.5	1.000000	0	0.040000	0	0.010000	0.070741	0.010000	0.020000																										0				107						c.(3271-3273)gaA>gaC		lipoprotein, Lp(a)	Aminocaproic Acid(DB00513)						307.0	333.0	324.0					6																	161020546		2201	4300	6501	SO:0001583	missense	4018	0	0					g.chr6:161020546T>G	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3273A>C	chr6.hg19:g.161020546T>G	ENSP00000321334:p.Glu1091Asp	1					LPA_ENST00000447678.1_Missense_Mutation_p.E1091D	p.E1091D			0	2	2	1.454667	P08519	APOA_HUMAN		20	3317	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	0	1	hg19	c.3273A>C	CCDS43523.1	0	.	.	.	.	.	.	.	.	.	.	t	8.354	0.831520	0.16820	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.68025	-0.3;-0.3	2.48	-2.05	0.07321	2.48	-2.05	0.07321	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.31009	0.0783	L	0.41824	1.3	0.09310	N	1	B	0.15141	0.012	B	0.31751	0.135	T	0.39683	-0.9602	9	0.30078	T	0.28	.	2.9399	0.05826	0.0:0.3134:0.2443:0.4423	.	3599	P08519	APOA_HUMAN	D	1091	ENSP00000321334:E1091D;ENSP00000395608:E1091D	ENSP00000321334:E1091D	E	-	3	2	2	LPA	160940536	160940536	0.000000	0.05858	0.013000	0.15412	0.003000	0.03518	-0.976000	0.03786	-0.618000	0.05656	-0.782000	0.03352	GAA	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.483	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	0	0	0	2	2	2	2	0	0	0	0	638	638	638	626	1	3.730000	-7.885989	1	0.550000	NM_005577		0	8	7	0	1211	1188	0		1			0	0	638	0	0	0.988449	0	0	0	0	0	0	8	1211
NDUFA4	4697	broad.mit.edu	37	7	10979646	10979646	+	Silent	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			C	A	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:10979646C>A	ENST00000339600.5	-	1	237	c.39G>T	c.(37-39)ccG>ccT	p.P13P	RP5-855F16.1_ENST00000604183.1_lincRNA|NDUFA4_ENST00000492822.1_5'UTR	NM_002489.3	NP_002480.1	O00483	NDUA4_HUMAN	NDUFA4, mitochondrial complex associated	13					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrial respiratory chain complex IV (GO:0005751)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|protein complex binding (GO:0032403)			large_intestine(2)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		AACTTACGCTCGGATGCTTCT	0.567																																						ENST00000339600.5	1.000000	1.000000e-02	0.160000	5.000000e-02	0.100000	0.162449	0.100000	0.130000																										0				3						c.(37-39)ccG>ccT		NDUFA4, mitochondrial complex associated							213.0	187.0	196.0					7																	10979646		2203	4300	6503	SO:0001819	synonymous_variant	4697	0	0					g.chr7:10979646C>A	U94586	CCDS5357.1	7p21.3	2014-07-30	2014-07-30		ENSG00000189043	ENSG00000189043			7687	protein-coding gene	gene with protein product	"""complex I 9kDa subunit"", ""NADH-ubiquinone oxidoreductase MLRQ subunit"""	603833	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (9kD, MLRQ)"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa"""			9352085	Standard	NM_002489		Approved	MLRQ, CI-9k	uc003srx.2	O00483	OTTHUMG00000023880	ENST00000339600.5:c.39G>T	chr7.hg19:g.10979646C>A		1					RP5-855F16.1_ENST00000604183.1_lincRNA|NDUFA4_ENST00000492822.1_5'UTR	p.P13P	NM_002489.3	NP_002480.1	2	5	7	3.090611	O00483	NDUA4_HUMAN		1	237	-			A4D109|Q6FHN5	Silent	SNP	ENST00000339600.5	0	1	hg19	c.39G>T	CCDS5357.1	0																																																																																								0.801325		TCGA-YY-A8LH-01A-11D-A36O-08	0.567	NDUFA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207507.3	0	0	1	2	2	2	2	0	0	0	0	156	156	156	153	1	3.730000	-2.028848	0	0.550000	NM_002489		0	11	11	0	915	903	0		1	0		0	0	156	0	0	0.998195	9.999990e-01	0	1	0	2601	0	11	915
GNB2	2783	broad.mit.edu	37	7	100276124	100276124	+	Missense_Mutation	SNP	A	A	T	rs147810006		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:100276124A>T	ENST00000303210.4	+	9	1285	c.803A>T	c.(802-804)aAc>aTc	p.N268I	GNB2_ENST00000424361.1_Missense_Mutation_p.N224I|GNB2_ENST00000419828.1_Missense_Mutation_p.N168I|GNB2_ENST00000436220.1_Missense_Mutation_p.N224I|GNB2_ENST00000393924.1_Missense_Mutation_p.N268I|GNB2_ENST00000427895.1_Missense_Mutation_p.N168I|GNB2_ENST00000393926.1_Missense_Mutation_p.N268I	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2	268					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				TCCCATGACAACATCATCTGT	0.607																																						ENST00000303210.4	1.000000	9.700000e-01	1.000000	9.900000e-01	0.990000	0.998207	0.990000	1.000000																										0				7						c.(802-804)aAc>aTc		guanine nucleotide binding protein (G protein), beta polypeptide 2		A	ILE/ASN	0,4406		0,0,2203	60.0	60.0	60.0		803	4.4	1.0	7	dbSNP_134	60	2,8598		0,2,4298	no	missense	GNB2	NM_005273.3	149	0,2,6501	TT,TA,AA		0.0233,0.0,0.0154	possibly-damaging	268/341	100276124	2,13004	2203	4300	6503	SO:0001583	missense	2783	2	121412	38				g.chr7:100276124A>T	M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.803A>T	chr7.hg19:g.100276124A>T	ENSP00000305260:p.Asn268Ile	0					GNB2_ENST00000393926.1_Missense_Mutation_p.N268I|GNB2_ENST00000427895.1_Missense_Mutation_p.N168I|GNB2_ENST00000436220.1_Missense_Mutation_p.N224I|GNB2_ENST00000393924.1_Missense_Mutation_p.N268I|GNB2_ENST00000424361.1_Missense_Mutation_p.N224I|GNB2_ENST00000419828.1_Missense_Mutation_p.N168I	p.N268I	NM_005273.3	NP_005264.2	2	2	4	2.097417	P62879	GBB2_HUMAN		9	1285	+	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)	B3KPU1|P11016|P54312	Missense_Mutation	SNP	ENST00000303210.4	1	1	hg19	c.803A>T	CCDS5703.1	1	.	.	.	.	.	.	.	.	.	.	.	21.3	4.125242	0.77436	0.0	2.33E-4	ENSG00000172354	ENST00000303210;ENST00000436220;ENST00000424361;ENST00000419828;ENST00000427895;ENST00000393926;ENST00000393924	T;D;D;D;D;T;T	0.82619	5.0;-1.63;-1.63;-1.63;-1.63;5.0;5.0	5.67	4.45	0.53987	5.67	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85952	0.5817	M	0.75264	2.295	0.58432	D	0.999996	B	0.32409	0.37	P	0.44732	0.459	D	0.86865	0.2032	10	0.72032	D	0.01	-11.881	10.667	0.45736	0.8397:0.1603:0.0:0.0	.	268	P62879	GBB2_HUMAN	I	268;224;224;168;168;268;268	ENSP00000305260:N268I;ENSP00000401873:N224I;ENSP00000389391:N224I;ENSP00000390543:N168I;ENSP00000400286:N168I;ENSP00000377503:N268I;ENSP00000377501:N268I	ENSP00000305260:N268I	N	+	2	0	0	GNB2	100114060	100114060	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.846000	0.39289	2.174000	0.68829	0.454000	0.30748	AAC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.607	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268391.2	1	0	1	2	2	2	2	0	0	0	0	48	48	48	47	1	3.730000	-20.000000	1	0.550000	NM_005273		0	43	41	0	144	143	1		1	1		0	0	48	0	0	1.000000	1	0	291	0	857	0	43	144
HDAC9	9734	broad.mit.edu	37	7	18767353	18767353	+	Missense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:18767353C>A	ENST00000432645.2	+	12	1873	c.1873C>A	c.(1873-1875)Cgc>Agc	p.R625S	HDAC9_ENST00000401921.1_Missense_Mutation_p.R584S|HDAC9_ENST00000441542.2_Missense_Mutation_p.R628S|HDAC9_ENST00000406451.4_Missense_Mutation_p.R625S	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	625					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AGCAATGGACCGCCCCCTCCA	0.527																																						ENST00000432645.2	1.000000	1.100000e-01	0.530000	2.000000e-01	0.330000	0.389371	0.330000	0.270000																										0				82						c.(1873-1875)Cgc>Agc		histone deacetylase 9	Valproic Acid(DB00313)						41.0	46.0	44.0					7																	18767353		1988	4143	6131	SO:0001583	missense	9734	0	0					g.chr7:18767353C>A	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1873C>A	chr7.hg19:g.18767353C>A	ENSP00000410337:p.Arg625Ser	1					HDAC9_ENST00000441542.2_Missense_Mutation_p.R628S|HDAC9_ENST00000401921.1_Missense_Mutation_p.R584S|HDAC9_ENST00000406451.4_Missense_Mutation_p.R625S	p.R625S	NM_058176.2	NP_478056.1	2	5	7	3.090611	Q9UKV0	HDAC9_HUMAN		12	1873	+	all_lung(11;0.187)		A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	0	1	hg19	c.1873C>A	CCDS47555.1	0	.	.	.	.	.	.	.	.	.	.	C	5.499	0.276989	0.10403	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.57107	0.43;0.42;0.42;0.43	4.87	1.44	0.22558	4.87	1.44	0.22558	.	0.387462	0.22358	N	0.061105	T	0.35537	0.0935	L	0.36672	1.1	0.80722	D	1	B;B;B;B;B;B;B	0.19817	0.001;0.01;0.034;0.01;0.02;0.01;0.039	B;B;B;B;B;B;B	0.17979	0.003;0.01;0.018;0.018;0.008;0.018;0.02	T	0.10337	-1.0634	10	0.09338	T	0.73	-24.6513	9.38	0.38306	0.0:0.7311:0.0:0.2689	.	625;537;584;628;625;625;603	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	S	625;584;625;628;537	ENSP00000384657:R625S;ENSP00000383912:R584S;ENSP00000410337:R625S;ENSP00000408617:R628S	ENSP00000339165:R537S	R	+	1	0	0	HDAC9	18733878	18733878	1.000000	0.71417	0.829000	0.32907	0.991000	0.79684	1.096000	0.30976	0.150000	0.19136	0.557000	0.71058	CGC	0.801325		TCGA-YY-A8LH-01A-11D-A36O-08	0.527	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1	0	0	1	2	2	2	2	0	0	0	0	23	23	23	22	1	3.730000	-3.346692	1	0.550000			0	5	5	0	135	135	0		1	0		0	0	23	0	0	0.938689	0	0	0	0	1	0	5	135
FAM188B	84182	broad.mit.edu	37	7	30825421	30825421	+	Missense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:30825421C>A	ENST00000265299.6	+	4	553	c.476C>A	c.(475-477)cCg>cAg	p.P159Q	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	159										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AAAAGGCCCCCGCACAAAAGT	0.448																																						ENST00000265299.6	1.000000	2.000000e-02	0.180000	6.000000e-02	0.110000	0.175118	0.110000	0.130000																										0				29						c.(475-477)cCg>cAg		family with sequence similarity 188, member B							99.0	104.0	102.0					7																	30825421		1846	4097	5943	SO:0001583	missense	84182	0	0					g.chr7:30825421C>A	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.476C>A	chr7.hg19:g.30825421C>A	ENSP00000265299:p.Pro159Gln	1					INMT-FAM188B_ENST00000458257.1_3'UTR	p.P159Q	NM_032222.2	NP_115598.2	2	5	7	3.090611	Q4G0A6	F188B_HUMAN		4	553	+			Q71AZ7|Q9H6D2	Missense_Mutation	SNP	ENST00000265299.6	0	1	hg19	c.476C>A	CCDS43565.1	0	.	.	.	.	.	.	.	.	.	.	C	2.790	-0.251521	0.05867	.	.	ENSG00000106125	ENST00000265299	T	0.23552	1.9	5.19	2.32	0.28847	5.19	2.32	0.28847	.	0.790451	0.11983	N	0.510580	T	0.16642	0.0400	L	0.41236	1.265	0.09310	N	1	P	0.34955	0.477	B	0.24701	0.055	T	0.19943	-1.0290	10	0.87932	D	0	-7.9428	4.8572	0.13564	0.1701:0.6496:0.0:0.1803	.	159	Q4G0A6	F188B_HUMAN	Q	159	ENSP00000265299:P159Q	ENSP00000265299:P159Q	P	+	2	0	0	FAM188B	30791946	30791946	0.001000	0.12720	0.104000	0.21259	0.172000	0.22775	1.070000	0.30653	0.762000	0.33152	0.650000	0.86243	CCG	0.801325		TCGA-YY-A8LH-01A-11D-A36O-08	0.448	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1	0	0	1	2	2	2	2	0	0	0	0	100	100	100	99	1	3.730000	-2.063888	0	0.550000	NM_032222		0	9	9	0	683	675	0		1	0		0	0	100	0	0	0.993943	6.828432e-02	0	0	0	29	0	9	683
GLI3	2737	broad.mit.edu	37	7	42116379	42116379	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:42116379C>T	ENST00000395925.3	-	4	529	c.445G>A	c.(445-447)Gat>Aat	p.D149N	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	149					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GGAGATGGATCGTAATGGTAA	0.433									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																													ENST00000395925.3	1.000000	7.000000e-02	0.290000	1.200000e-01	0.190000	0.251803	0.190000	0.200000																										0				112						c.(445-447)Gat>Aat		GLI family zinc finger 3							167.0	142.0	150.0					7																	42116379		2203	4300	6503	SO:0001583	missense	2737	0	0		Pallister-Hall syndrome;Greig Cephalopolysyndactyly	Familial Cancer Database	;	g.chr7:42116379C>T		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.445G>A	chr7.hg19:g.42116379C>T	ENSP00000379258:p.Asp149Asn	1					GLI3_ENST00000479210.1_5'UTR	p.D149N	NM_000168.5	NP_000159.3	2	5	7	3.090611	P10071	GLI3_HUMAN		4	529	-			A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	0	1	hg19	c.445G>A	CCDS5465.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.070585	0.93950	.	.	ENSG00000106571	ENST00000395925;ENST00000448703	T;T	0.69561	-0.41;-0.41	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.099090	0.64402	D	0.000003	T	0.72510	0.3469	L	0.34521	1.04	0.80722	D	1	D	0.67145	0.996	P	0.57960	0.83	T	0.74411	-0.3674	10	0.72032	D	0.01	.	20.0781	0.97751	0.0:1.0:0.0:0.0	.	149	P10071	GLI3_HUMAN	N	149	ENSP00000379258:D149N;ENSP00000406135:D149N	ENSP00000379258:D149N	D	-	1	0	0	GLI3	42082904	42082904	1.000000	0.71417	0.966000	0.40874	0.990000	0.78478	7.252000	0.78309	2.817000	0.96982	0.563000	0.77884	GAT	0.801325		TCGA-YY-A8LH-01A-11D-A36O-08	0.433	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	0	0	1	2	2	2	2	0	0	0	0	47	47	47	46	1	3.730000	-2.849615	1	0.550000	NM_000168		0	8	8	0	360	358	0		1			0	0	47	0	0	0.989319	0	0	0	0	0	0	8	360
ABCA13	154664	broad.mit.edu	37	7	48317894	48317894	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:48317894C>T	ENST00000435803.1	+	18	7127	c.7103C>T	c.(7102-7104)gCc>gTc	p.A2368V		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2368					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTATTTAATGCCCTTCTCAGG	0.308																																						ENST00000435803.1	1.000000	8.900000e-01	1.000000	9.900000e-01	0.990000	0.993708	0.990000	1.000000																										0				270						c.(7102-7104)gCc>gTc		ATP-binding cassette, sub-family A (ABC1), member 13							40.0	40.0	40.0					7																	48317894		1803	4069	5872	SO:0001583	missense	154664	0	0					g.chr7:48317894C>T	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7103C>T	chr7.hg19:g.48317894C>T	ENSP00000411096:p.Ala2368Val	1						p.A2368V	NM_152701.3	NP_689914.2	2	5	7	3.105492	Q86UQ4	ABCAD_HUMAN		18	7127	+			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	1	1	hg19	c.7103C>T	CCDS47584.1	1	.	.	.	.	.	.	.	.	.	.	C	4.546	0.101394	0.08731	.	.	ENSG00000179869	ENST00000435803	T	0.55760	0.5	4.75	1.32	0.21799	4.75	1.32	0.21799	.	1.533400	0.04221	N	0.333578	T	0.38480	0.1042	L	0.28274	0.84	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.34675	-0.9819	10	0.72032	D	0.01	.	2.659	0.05020	0.2212:0.501:0.0:0.2778	.	2368	Q86UQ4	ABCAD_HUMAN	V	2368	ENSP00000411096:A2368V	ENSP00000411096:A2368V	A	+	2	0	0	ABCA13	48288440	48288440	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.498000	0.06420	0.517000	0.28361	0.561000	0.74099	GCC	0.802523		TCGA-YY-A8LH-01A-11D-A36O-08	0.308	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	1	0	1	2	2	2	2	0	0	0	0	23	23	23	23	1	3.730000	-20.000000	1	0.550000	NM_152701		0	28	28	0	154	150	1		1			0	0	23	0	0	1.000000	0	0	0	0	0	0	28	154
KCTD7	154881	broad.mit.edu	37	7	66103879	66103879	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:66103879G>A	ENST00000275532.3	+	4	714	c.530G>A	c.(529-531)cGt>cAt	p.R177H	KCTD7_ENST00000443322.1_Missense_Mutation_p.R177H	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	177					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.R177H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GCCCGGCTGCGTGCGGTCCAG	0.577																																						ENST00000275532.3	0.250000	3.000000e-02	0.180000	7.000000e-02	0.110000	0.131341	0.110000	0.120000																										1	Substitution - Missense(1)	p.R177H(1)	ovary(1)	16						c.(529-531)cGt>cAt		potassium channel tetramerization domain containing 7							62.0	63.0	63.0					7																	66103879		2203	4300	6503	SO:0001583	missense	154881	0	0					g.chr7:66103879G>A	AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.530G>A	chr7.hg19:g.66103879G>A	ENSP00000275532:p.Arg177His	0					KCTD7_ENST00000443322.1_Missense_Mutation_p.R177H	p.R177H	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	2	2	4	2.097417	Q96MP8	KCTD7_HUMAN		4	714	+			A4D2M4|Q8IVR0	Missense_Mutation	SNP	ENST00000275532.3	0	1	hg19	c.530G>A	CCDS5534.1	0	.	.	.	.	.	.	.	.	.	.	g	34	5.320885	0.95682	.	.	ENSG00000243335	ENST00000275532;ENST00000443322	T;T	0.79033	-1.23;-1.23	5.36	5.36	0.76844	5.36	5.36	0.76844	.	.	.	.	.	T	0.79411	0.4441	L	0.43152	1.355	0.80722	D	1	D	0.67145	0.996	P	0.51170	0.661	T	0.80476	-0.1366	9	0.52906	T	0.07	.	18.4294	0.90620	0.0:0.0:1.0:0.0	.	177	Q96MP8	KCTD7_HUMAN	H	177	ENSP00000275532:R177H;ENSP00000411624:R177H	ENSP00000275532:R177H	R	+	2	0	0	KCTD7	65741314	65741314	1.000000	0.71417	0.993000	0.49108	0.978000	0.69477	9.097000	0.94193	2.675000	0.91044	0.655000	0.94253	CGT	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.577	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	0	0	1	2	2	2	2	0	0	0	0	82	82	82	81	1	3.730000	-3.977127	1	0.550000	NM_153033		0	5	5	0	250	248	0		1	0		0	0	82	0	0	0.936200	5.908465e-03	0	0	0	5	0	5	250
SAMD9L	219285	broad.mit.edu	37	7	92764937	92764937	+	Silent	SNP	T	T	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:92764937T>C	ENST00000318238.4	-	5	1564	c.348A>G	c.(346-348)tcA>tcG	p.S116S	SAMD9L_ENST00000411955.1_Silent_p.S116S|SAMD9L_ENST00000437805.1_Silent_p.S116S	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	116					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CAATATTAGATGACATTGAAT	0.323																																						ENST00000318238.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				88						c.(346-348)tcA>tcG		sterile alpha motif domain containing 9-like							107.0	118.0	114.0					7																	92764937		2203	4300	6503	SO:0001819	synonymous_variant	219285	0	0					g.chr7:92764937T>C	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.348A>G	chr7.hg19:g.92764937T>C		0					SAMD9L_ENST00000437805.1_Silent_p.S116S|SAMD9L_ENST00000411955.1_Silent_p.S116S	p.S116S	NM_152703.2	NP_689916.2	2	2	4	2.097417	Q8IVG5	SAM9L_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)	5	1564	-	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Silent	SNP	ENST00000318238.4	1	1	hg19	c.348A>G	CCDS34681.1	1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.323	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	1	0	1	2	2	2	2	0	0	0	0	98	98	98	98	1	3.730000	-20.000000	1	0.550000	NM_152703		0	131	130	0	286	283	1		1	1		0	0	98	0	0	1.000000	9.605059e-01	0	6	0	8	0	131	286
COL1A2	1278	broad.mit.edu	37	7	94039063	94039063	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:94039063G>A	ENST00000297268.6	+	19	1436	c.965G>A	c.(964-966)gGc>gAc	p.G322D		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	322					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGGGCTCCCGGCCTCCCTGGA	0.577										HNSCC(75;0.22)																												ENST00000297268.6	0.610000	2.800000e-01	0.530000	3.500000e-01	0.430000	0.444880	0.430000	0.440000																									COL1A2/PLAG1(3)	0				115						c.(964-966)gGc>gAc		collagen, type I, alpha 2	Collagenase(DB00048)						98.0	101.0	100.0					7																	94039063		2203	4300	6503	SO:0001583	missense	1278	0	0					g.chr7:94039063G>A	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.965G>A	chr7.hg19:g.94039063G>A	ENSP00000297268:p.Gly322Asp	0	HNSCC(75;0.22)					p.G322D	NM_000089.3	NP_000080.2	2	2	4	2.097417	P08123	CO1A2_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)	19	1436	+	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	1	1	hg19	c.965G>A	CCDS34682.1	0	.	.	.	.	.	.	.	.	.	.	G	22.8	4.335985	0.81801	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99619	-6.28	5.58	5.58	0.84498	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.99796	0.9913	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97235	0.9887	10	0.87932	D	0	.	19.966	0.97266	0.0:0.0:1.0:0.0	.	322	P08123	CO1A2_HUMAN	D	322;323	ENSP00000297268:G322D	ENSP00000297268:G322D	G	+	2	0	0	COL1A2	93876999	93876999	1.000000	0.71417	0.985000	0.45067	0.772000	0.43724	9.439000	0.97543	2.802000	0.96397	0.655000	0.94253	GGC	0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.577	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	1	0	1	2	2	2	2	0	0	0	0	74	74	74	74	1	3.730000	-8.187247	1	0.550000	NM_000089		0	25	26	0	302	301	0		1	0		0	0	74	0	0	1.000000	9.999997e-01	0	0	0	311	0	25	302
SSPO	23145	broad.mit.edu	37	7	149503953	149503953	+	RNA	SNP	G	G	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr7:149503953G>T	ENST00000378016.2	+	0	8777							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCCCGGCTGCACCTGCCCC	0.657																																						ENST00000378016.2	1.000000	7.900000e-01	1.000000	9.800000e-01	0.990000	0.981714	0.990000	1.000000																										0												SCO-spondin							22.0	30.0	27.0					7																	149503953		1923	4114	6037			23145	0	0					g.chr7:149503953G>T	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149503953G>T		0									2	2	4	2.097417	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)	0	8777	+	Melanoma(164;0.165)|Ovarian(565;0.177)		Q76B61	RNA	SNP	ENST00000378016.2	0	1	hg19			1																																																																																								0.709677		TCGA-YY-A8LH-01A-11D-A36O-08	0.657	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript		0	0	1	2	2	2	2	0	0	0	0	21	21	21	20	1	3.730000	-20.000000	1	0.550000			0	20	18	0	74	74	0		1			0	0	21	0	0	0.999997	0	0	0	0	0	0	20	74
USP17L2	377630	broad.mit.edu	37	8	11995011	11995011	+	Nonsense_Mutation	SNP	A	A	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr8:11995011A>T	ENST00000333796.3	-	1	1575	c.1259T>A	c.(1258-1260)tTg>tAg	p.L420*	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	420	Mediates interaction with SUDS3.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						GCGCTCGTCCAACTCGGGTGC	0.567																																						ENST00000333796.3	1.000000	2.000000e-01	1.000000	2.600000e-01	0.330000	0.483988	0.330000	0.310000																										0				29						c.(1258-1260)tTg>tAg		ubiquitin specific peptidase 17-like family member 2							59.0	64.0	62.0					8																	11995011		1603	3597	5200	SO:0001587	stop_gained	377630	0	0					g.chr8:11995011A>T	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1259T>A	chr8.hg19:g.11995011A>T	ENSP00000333329:p.Leu420*	1					FAM66D_ENST00000434078.2_RNA	p.L420*	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	3	3	6	2.162354	Q6R6M4	U17L2_HUMAN		1	1575	-				Nonsense_Mutation	SNP	ENST00000333796.3	0	1	hg19	c.1259T>A	CCDS43713.1	0	.	.	.	.	.	.	.	.	.	.	A	19.49	3.836544	0.71373	.	.	ENSG00000223443	ENST00000333796	.	.	.	0.36	-0.721	0.11189	0.36	-0.721	0.11189	.	0.944627	0.08527	U	0.932543	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	.	.	.	.	.	.	.	X	420	.	ENSP00000333329:L420X	L	-	2	0	0	USP17L2	12032420	12032420	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.011000	0.12721	-0.718000	0.04949	-0.731000	0.03576	TTG	0.717691		TCGA-YY-A8LH-01A-11D-A36O-08	0.567	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	1	0	1	2	2	2	2	0	0	0	0	121	121	121	121	1	3.730000	-19.999990	1	0.550000	NM_201402		0	23	23	0	409	385	0		1			0	0	121	0	0	0.999999	0	0	0	0	0	0	23	409
CYP11B1	1584	broad.mit.edu	37	8	143957228	143957228	+	Missense_Mutation	SNP	G	G	A	rs372115638		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr8:143957228G>A	ENST00000292427.4	-	6	1053	c.1021C>T	c.(1021-1023)Cgc>Tgc	p.R341C	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R412C|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R341C	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	341					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CTCTCCTGGCGCAGGGCCTGC	0.642									Familial Hyperaldosteronism type I																													ENST00000292427.4	1.000000	3.300000e-01	1.000000	3.900000e-01	0.470000	0.588020	0.470000	0.460000																										0				67	GRCh37	HM972176	CYP11B1	M		c.(1021-1023)Cgc>Tgc		cytochrome P450, family 11, subfamily B, polypeptide 1	Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	78.0	80.0	79.0		1021,1021	2.2	1.0	8		79	1,8599		0,1,4299	no	missense,missense	CYP11B1	NM_000497.3,NM_001026213.1	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	341/504,341/438	143957228	1,13005	2203	4300	6503	SO:0001583	missense	1584	12	121408	43	Familial Hyperaldosteronism type I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	g.chr8:143957228G>A	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1021C>T	chr8.hg19:g.143957228G>A	ENSP00000292427:p.Arg341Cys	1					CYP11B1_ENST00000377675.3_Missense_Mutation_p.R412C|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R341C	p.R341C	NM_000497.3	NP_000488.3	3	3	6	2.162354	P15538	C11B1_HUMAN		6	1053	-	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	1	1	hg19	c.1021C>T	CCDS6392.1	0	.	.	.	.	.	.	.	.	.	.	.	17.71	3.456204	0.63401	0.0	1.16E-4	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.73152	-0.72;2.31;-0.72	4.42	2.16	0.27623	4.42	2.16	0.27623	.	0.126247	0.31963	N	0.006789	D	0.85652	0.5746	M	0.93854	3.465	0.58432	D	0.999996	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.997;0.997;0.976;0.999	D	0.86599	0.1865	10	0.66056	D	0.02	.	9.7347	0.40382	0.0:0.0:0.4473:0.5527	.	412;341;341;341;57	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	C	341;341;412	ENSP00000292427:R341C;ENSP00000428043:R341C;ENSP00000366903:R412C	ENSP00000292427:R341C	R	-	1	0	0	CYP11B1	143954230	143954230	0.011000	0.17503	0.991000	0.47740	0.808000	0.45660	0.560000	0.23500	0.949000	0.37715	0.555000	0.69702	CGC	0.717691		TCGA-YY-A8LH-01A-11D-A36O-08	0.642	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2	1	0	1	2	2	2	2	0	0	0	0	178	178	178	176	1	3.730000	-10.672130	1	0.550000			0	44	43	0	524	516	0		1			0	0	178	0	0	1.000000	0	0	0	0	0	0	44	524
BMP1	649	broad.mit.edu	37	8	22054897	22054897	+	Missense_Mutation	SNP	G	G	A	rs200401797		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr8:22054897G>A	ENST00000306385.5	+	15	2741	c.2071G>A	c.(2071-2073)Gtg>Atg	p.V691M	BMP1_ENST00000397816.3_Missense_Mutation_p.V691M|BMP1_ENST00000354870.5_3'UTR|BMP1_ENST00000306349.8_Missense_Mutation_p.V691M	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	691	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CGACAACACCGTGTCCAAAAA	0.567																																						ENST00000306385.5	1.000000	1.100000e-01	1.000000	1.500000e-01	0.200000	0.385379	0.200000	0.170000																										0				30						c.(2071-2073)Gtg>Atg		bone morphogenetic protein 1		G	MET/VAL,MET/VAL	0,4406		0,0,2203	236.0	214.0	222.0		2071,2071	5.3	1.0	8		222	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	BMP1	NM_001199.3,NM_006129.4	21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	691/731,691/987	22054897	1,13005	2203	4300	6503	SO:0001583	missense	649	4	121412	42				g.chr8:22054897G>A		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.2071G>A	chr8.hg19:g.22054897G>A	ENSP00000305714:p.Val691Met	1					BMP1_ENST00000397816.3_Missense_Mutation_p.V691M|BMP1_ENST00000354870.5_3'UTR|BMP1_ENST00000306349.8_Missense_Mutation_p.V691M	p.V691M	NM_006129.4	NP_006120.1	3	3	6	2.162354	P13497	BMP1_HUMAN		15	2741	+			A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	1	1	hg19	c.2071G>A	CCDS6026.1	0	.	.	.	.	.	.	.	.	.	.	G	28.2	4.895680	0.91962	0.0	1.16E-4	ENSG00000168487	ENST00000306385;ENST00000397816;ENST00000306349	T;T;T	0.30981	1.51;1.51;1.51	5.29	5.29	0.74685	5.29	5.29	0.74685	CUB (5);	0.000000	0.34853	U	0.003625	T	0.58836	0.2150	M	0.79343	2.45	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.993	T	0.63346	-0.6658	10	0.72032	D	0.01	.	17.6986	0.88289	0.0:0.0:1.0:0.0	.	691;764;691;691	P13497;Q59F71;P13497-2;P13497-6	BMP1_HUMAN;.;.;.	M	691	ENSP00000305714:V691M;ENSP00000380917:V691M;ENSP00000306121:V691M	ENSP00000306121:V691M	V	+	1	0	0	BMP1	22110842	22110842	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.869000	0.99810	2.451000	0.82905	0.563000	0.77884	GTG	0.717691		TCGA-YY-A8LH-01A-11D-A36O-08	0.567	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	0	0	1	2	2	2	2	0	0	0	0	213	213	213	210	1	3.730000	-3.047490	1	0.550000	NM_006132		0	22	22	0	676	660	0		1	0		0	0	213	0	0	0.999998	7.014472e-01	0	1	0	74	0	22	676
OPRK1	4986	broad.mit.edu	37	8	54142191	54142191	+	Missense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr8:54142191C>T	ENST00000265572.3	-	4	1106	c.809G>A	c.(808-810)cGt>cAt	p.R270H	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000524278.1_Missense_Mutation_p.R181H|OPRK1_ENST00000520287.1_Missense_Mutation_p.R270H	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	270					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	GGTGATCCTACGCAGGTTGCG	0.572																																						ENST00000265572.3	1.000000	1.000000e-01	1.000000	1.600000e-01	0.260000	0.427731	0.260000	0.210000																										0				43						c.(808-810)cGt>cAt		opioid receptor, kappa 1	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)						78.0	83.0	81.0					8																	54142191		2203	4300	6503	SO:0001583	missense	4986	2	121412	35				g.chr8:54142191C>T		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.809G>A	chr8.hg19:g.54142191C>T	ENSP00000265572:p.Arg270His	1					RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000520287.1_Missense_Mutation_p.R270H|OPRK1_ENST00000524278.1_Missense_Mutation_p.R181H	p.R270H	NM_000912.3	NP_000903.2	3	3	6	2.162354	P41145	OPRK_HUMAN		4	1106	-		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	0	1	hg19	c.809G>A	CCDS6152.1	0	.	.	.	.	.	.	.	.	.	.	C	16.06	3.017222	0.54576	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.73681	-0.77;-0.77;-0.77	5.8	4.91	0.64330	5.8	4.91	0.64330	GPCR, rhodopsin-like superfamily (1);	0.047781	0.85682	D	0.000000	D	0.87176	0.6112	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89336	0.3650	10	0.87932	D	0	.	16.2563	0.82519	0.1338:0.8662:0.0:0.0	.	270	P41145	OPRK_HUMAN	H	270;181;270;256	ENSP00000265572:R270H;ENSP00000430923:R181H;ENSP00000429706:R270H	ENSP00000265572:R270H	R	-	2	0	0	OPRK1	54304744	54304744	1.000000	0.71417	0.055000	0.19348	0.004000	0.04260	7.818000	0.86416	1.433000	0.47394	-0.188000	0.12872	CGT	0.717691		TCGA-YY-A8LH-01A-11D-A36O-08	0.572	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1	0	0	1	2	2	2	2	0	0	0	0	52	52	52	51	1	3.730000	-9.099499	1	0.550000			0	7	6	0	179	175	0		1			0	0	52	0	0	0.979295	0	0	0	0	0	0	7	179
PLEC	5339	broad.mit.edu	37	8	144994985	144994985	+	Nonsense_Mutation	SNP	G	G	A	rs137853161		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr8:144994985G>A	ENST00000322810.4	-	32	9584	c.9415C>T	c.(9415-9417)Cga>Tga	p.R3139*	PLEC_ENST00000354589.3_Nonsense_Mutation_p.R3002*|PLEC_ENST00000354958.2_Nonsense_Mutation_p.R2980*|PLEC_ENST00000436759.2_Nonsense_Mutation_p.R3029*|PLEC_ENST00000345136.3_Nonsense_Mutation_p.R3002*|PLEC_ENST00000357649.2_Nonsense_Mutation_p.R3006*|PLEC_ENST00000398774.2_Nonsense_Mutation_p.R2970*|PLEC_ENST00000527096.1_Nonsense_Mutation_p.R3025*|PLEC_ENST00000356346.3_Nonsense_Mutation_p.R2988*	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3139	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCACCTCGCTGCAGCTGC	0.687																																						ENST00000322810.4	1.000000	2.000000e-01	1.000000	2.700000e-01	0.380000	0.515406	0.380000	0.330000																										0				137	GRCh37	CM050309	PLEC	M	rs137853161	c.(9415-9417)Cga>Tga		plectin							20.0	24.0	22.0					8																	144994985		2052	4156	6208	SO:0001587	stop_gained	5339	0	0					g.chr8:144994985G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9415C>T	chr8.hg19:g.144994985G>A	ENSP00000323856:p.Arg3139*	1					PLEC_ENST00000436759.2_Nonsense_Mutation_p.R3029*|PLEC_ENST00000354589.3_Nonsense_Mutation_p.R3002*|PLEC_ENST00000527096.1_Nonsense_Mutation_p.R3025*|PLEC_ENST00000357649.2_Nonsense_Mutation_p.R3006*|PLEC_ENST00000354958.2_Nonsense_Mutation_p.R2980*|PLEC_ENST00000345136.3_Nonsense_Mutation_p.R3002*|PLEC_ENST00000356346.3_Nonsense_Mutation_p.R2988*|PLEC_ENST00000398774.2_Nonsense_Mutation_p.R2970*	p.R3139*	NM_201380.2	NP_958782.1	3	3	6	2.162354	Q15149	PLEC_HUMAN		32	9584	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Nonsense_Mutation	SNP	ENST00000322810.4	0	1	hg19	c.9415C>T	CCDS43772.1	0	.	.	.	.	.	.	.	.	.	.	G	49	15.377758	0.99832	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	.	.	.	4.6	3.71	0.42584	4.6	3.71	0.42584	.	0.750881	0.11464	U	0.561429	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	13.7863	0.63112	0.0:0.1557:0.8443:0.0	.	.	.	.	X	3002;3006;3002;2970;3139;2980;2988;3029;3025	.	ENSP00000323856:R3139X	R	-	1	2	2	PLEC	145066973	145066973	0.864000	0.29904	0.748000	0.31131	0.005000	0.04900	2.894000	0.48640	1.042000	0.40150	0.448000	0.29417	CGA	0.717691		TCGA-YY-A8LH-01A-11D-A36O-08	0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	1	0	1	2	2	2	2	0	0	0	0	50	50	50	47	1	3.730000	-16.106850	1	0.550000	NM_000445		0	13	14	0	209	206	0		1	1		0	0	50	0	0	0.999555	9.998292e-01	0	20	0	233	0	13	209
OR2K2	26248	broad.mit.edu	37	9	114090184	114090184	+	Missense_Mutation	SNP	G	G	A	rs137871340	byFrequency	TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr9:114090184G>A	ENST00000374428.1	-	1	616	c.617C>T	c.(616-618)aCg>aTg	p.T206M	OR2K2_ENST00000302681.1_Missense_Mutation_p.T177M			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						AATTTCACACGTGAAGTGATC	0.517													G|||	4	0.000798722	0.0	0.0	5008	,	,		21515	0.004		0.0	False		,,,				2504	0.0					ENST00000374428.1	1.000000	9.000000e-02	1.000000	1.400000e-01	0.200000	0.344041	0.200000	0.190000																										0				20						c.(616-618)aCg>aTg		olfactory receptor, family 2, subfamily K, member 2							81.0	75.0	77.0					9																	114090184		2203	4300	6503	SO:0001583	missense	26248	35	121410	46				g.chr9:114090184G>A	X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.617C>T	chr9.hg19:g.114090184G>A	ENSP00000363550:p.Thr206Met	1					OR2K2_ENST00000302681.1_Missense_Mutation_p.T177M	p.T206M			1	2	3	1.623441	Q8NGT1	OR2K2_HUMAN		1	616	-			Q2TA61|Q5VYK4|Q6IFI5	Missense_Mutation	SNP	ENST00000374428.1	1	1	hg19	c.617C>T		0	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	7.211	0.595400	0.13875	.	.	ENSG00000171133	ENST00000302681;ENST00000374428	T;T	0.00084	8.75;8.75	4.92	1.0	0.19881	4.92	1.0	0.19881	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41712	U	0.000834	T	0.00144	0.0004	L	0.31926	0.97	0.18873	N	0.999982	D	0.89917	1.0	D	0.70716	0.97	T	0.52975	-0.8503	10	0.62326	D	0.03	.	3.5372	0.07798	0.2438:0.0:0.4545:0.3016	.	206	Q8NGT1	OR2K2_HUMAN	M	177;206	ENSP00000305055:T177M;ENSP00000363550:T206M	ENSP00000305055:T177M	T	-	2	0	0	OR2K2	113130005	113130005	0.000000	0.05858	0.023000	0.16930	0.086000	0.17979	0.148000	0.16224	0.096000	0.17463	-0.194000	0.12790	ACG	0.626943		TCGA-YY-A8LH-01A-11D-A36O-08	0.517	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	84	84	84	84	1	3.730000	-3.277497	1	0.550000	NM_205859		0	9	9	0	207	202	0		1			0	0	84	0	0	0.993885	0	0	0	0	0	0	9	207
C9orf72	203228	broad.mit.edu	37	9	27567059	27567059	+	Missense_Mutation	SNP	A	A	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr9:27567059A>T	ENST00000380003.3	-	2	123	c.60T>A	c.(58-60)agT>agA	p.S20R	C9orf72_ENST00000488117.1_5'UTR|C9orf72_ENST00000379997.3_Missense_Mutation_p.S20R	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	20					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		GTGATTTGCCACTTAAAGCAA	0.458																																						ENST00000380003.3	1.000000	2.000000e-02	1.000000	4.000000e-02	0.080000	0.249547	0.080000	0.080000																										0				23						c.(58-60)agT>agA		chromosome 9 open reading frame 72							81.0	76.0	78.0					9																	27567059		2203	4300	6503	SO:0001583	missense	203228	0	0					g.chr9:27567059A>T	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.60T>A	chr9.hg19:g.27567059A>T	ENSP00000369339:p.Ser20Arg	1					C9orf72_ENST00000488117.1_5'UTR|C9orf72_ENST00000379997.3_Missense_Mutation_p.S20R	p.S20R	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	1	2	3	1.623441	Q96LT7	CI072_HUMAN		2	123	-		all_neural(11;7.57e-10)	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	0	1	hg19	c.60T>A	CCDS6522.1	0	.	.	.	.	.	.	.	.	.	.	A	13.46	2.242614	0.39598	.	.	ENSG00000147894	ENST00000380003;ENST00000379997;ENST00000379995	T;T;T	0.44083	0.93;0.93;0.93	5.99	5.99	0.97316	5.99	5.99	0.97316	.	0.225686	0.53938	D	0.000046	T	0.22859	0.0552	N	0.08118	0	0.33621	D	0.604779	B;B	0.16603	0.018;0.011	B;B	0.18871	0.023;0.003	T	0.32587	-0.9901	9	.	.	.	.	11.5134	0.50507	0.931:0.0:0.069:0.0	.	20;20	Q96LT7-2;Q96LT7	.;CI072_HUMAN	R	20	ENSP00000369339:S20R;ENSP00000369333:S20R;ENSP00000369331:S20R	.	S	-	3	2	2	C9orf72	27557059	27557059	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.511000	0.35801	2.291000	0.77112	0.533000	0.62120	AGT	0.626943		TCGA-YY-A8LH-01A-11D-A36O-08	0.458	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	0	0	0	2	2	2	2	0	0	0	0	97	97	97	97	1	3.730000	-5.987158	1	0.550000	NM_018325		0	5	0	0	300	297	0		0	0		0	0	97	0	0	0.933018	1.409316e-02	0	0	0	9	0	5	300
ASS1	445	broad.mit.edu	37	9	133355188	133355188	+	Splice_Site	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chr9:133355188G>A	ENST00000372394.1	+	11	1254		c.e11+1		ASS1_ENST00000372393.3_Splice_Site|ASS1_ENST00000493984.2_Splice_Site|ASS1_ENST00000352480.5_Splice_Site			P00966	ASSY_HUMAN	argininosuccinate synthase 1						acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	ACGAAGTCGCGTGAGTGTCTG	0.617																																						ENST00000372394.1	1.000000	2.200000e-01	0.550000	2.900000e-01	0.390000	0.458941	0.390000	0.370000																										0				17						c.e11+1		argininosuccinate synthase 1	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)						71.0	62.0	65.0					9																	133355188		2203	4300	6503	SO:0001630	splice_region_variant	445	0	0					g.chr9:133355188G>A	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.773+1G>A	chr9.hg19:g.133355188G>A		1					ASS1_ENST00000493984.2_Splice_Site|ASS1_ENST00000372393.3_Splice_Site|ASS1_ENST00000352480.5_Splice_Site				1	2	3	1.664950	P00966	ASSY_HUMAN		11	1254	+			Q6LDL2|Q86UZ0|Q96GT4	Splice_Site	SNP	ENST00000372394.1	1	1	hg19		CCDS6933.1	0	.	.	.	.	.	.	.	.	.	.	G	7.670	0.686809	0.14973	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393	.	.	.	4.91	4.91	0.64330	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0774	0.86590	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	ASS1	132345009	132345009	1.000000	0.71417	0.999000	0.59377	0.096000	0.18686	8.569000	0.90744	2.270000	0.75569	0.467000	0.42956	.	0.635258		TCGA-YY-A8LH-01A-11D-A36O-08	0.617	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	1	0	1	2	9	2	2	0	0	0	1	89	89	89	88	1	3.730000	-19.980240	1	0.550000	NM_000050	Intron	0	16	15	0	179	177	0		1	1		0	0	89	0	0	0.946225	4.325148e-01	0	3	0	14	0	16	179
ACSL4	2182	broad.mit.edu	37	X	108906514	108906514	+	Missense_Mutation	SNP	T	T	C	rs148996116		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:108906514T>C	ENST00000469796.2	-	13	2027	c.1631A>G	c.(1630-1632)gAt>gGt	p.D544G	ACSL4_ENST00000348502.6_Missense_Mutation_p.D503G|ACSL4_ENST00000340800.2_Missense_Mutation_p.D544G			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	544					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TCCATTTTCATCCACAGAATA	0.378																																					Pancreas(188;358 2127 38547 41466 45492)	ENST00000469796.2	0.080000	2.000000e-02	0.070000	3.000000e-02	0.040000	0.051789	0.040000	0.050000																										0				22						c.(1630-1632)gAt>gGt		acyl-CoA synthetase long-chain family member 4	Icosapent(DB00159)|Rosiglitazone(DB00412)	T	GLY/ASP,GLY/ASP	1,3834		0,1,1631,571	233.0	235.0	234.0		1508,1631	5.5	1.0	X	dbSNP_134	234	0,6728		0,0,2428,1872	no	missense,missense	ACSL4	NM_004458.2,NM_022977.2	94,94	0,1,4059,2443	CC,CT,TT,T		0.0,0.0261,0.0095	probably-damaging,probably-damaging	503/671,544/712	108906514	1,10562	2203	4300	6503	SO:0001583	missense	2182	7	121410	46				g.chrX:108906514T>C	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1631A>G	chrX.hg19:g.108906514T>C	ENSP00000419171:p.Asp544Gly						ACSL4_ENST00000348502.6_Missense_Mutation_p.D503G|ACSL4_ENST00000340800.2_Missense_Mutation_p.D544G	p.D544G			0	1	1		O60488	ACSL4_HUMAN		13	2027	-			D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	0	1	hg19	c.1631A>G	CCDS14548.1	0	.	.	.	.	.	.	.	.	.	.	T	25.1	4.608081	0.87258	2.61E-4	0.0	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.13420	2.59;2.59;2.59	5.52	5.52	0.82312	5.52	5.52	0.82312	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.49253	0.1546	H	0.94345	3.525	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.64525	-0.6387	10	0.87932	D	0	-21.9098	14.6742	0.68967	0.0:0.0:0.0:1.0	.	544	O60488	ACSL4_HUMAN	G	503;544;544	ENSP00000262835:D503G;ENSP00000419171:D544G;ENSP00000339787:D544G	ENSP00000339787:D544G	D	-	2	0	0	ACSL4	108793170	108793170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.035000	0.88872	1.846000	0.53633	0.486000	0.48141	GAT	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.378	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	0	0	1	2	2	2	2	0	0	0	0	351	351	351	349	1	3.730000	-3.142737	1	0.550000	NM_004458		0	18	18	0	1304	1295	0		1	0		0	0	351	0	0	0.999980	1.005664e-01	0	0	0	37	0	18	1304
ARHGAP36	158763	broad.mit.edu	37	X	130215846	130215846	+	Missense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:130215846C>A	ENST00000276211.5	+	2	552	c.207C>A	c.(205-207)caC>caA	p.H69Q	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.H57Q|ARHGAP36_ENST00000370921.1_5'Flank	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	69					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CTGCTTACCACGAACTCGTGG	0.577																																						ENST00000276211.5	0.250000	1.300000e-01	0.220000	1.500000e-01	0.180000	0.191416	0.180000	0.180000																										0				71						c.(205-207)caC>caA		Rho GTPase activating protein 36							112.0	98.0	103.0					X																	130215846		2203	4300	6503	SO:0001583	missense	158763	0	0					g.chrX:130215846C>A		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.207C>A	chrX.hg19:g.130215846C>A	ENSP00000276211:p.His69Gln						ARHGAP36_ENST00000370921.1_5'Flank|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.H57Q	p.H69Q	NM_144967.3	NP_659404.2	0	1	1		Q6ZRI8	RHG36_HUMAN		2	552	+			B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	1	1	hg19	c.207C>A	CCDS14628.1	0	.	.	.	.	.	.	.	.	.	.	C	10.74	1.436770	0.25900	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.09255	3.0;3.0;3.01	4.36	-2.17	0.07059	4.36	-2.17	0.07059	.	0.475884	0.18258	N	0.146730	T	0.04363	0.0120	N	0.19112	0.55	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.003;0.003;0.001	T	0.44050	-0.9353	10	0.22706	T	0.39	.	1.0036	0.01482	0.4372:0.2288:0.1417:0.1922	.	38;57;69	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	Q	69;57;21;38	ENSP00000276211:H69Q;ENSP00000359960:H57Q;ENSP00000408515:H38Q	ENSP00000276211:H69Q	H	+	3	2	2	ARHGAP36	130043527	130043527	0.778000	0.28640	0.937000	0.37676	0.976000	0.68499	-0.888000	0.04148	-0.670000	0.05282	-0.268000	0.10319	CAC	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.577	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	1	0	1	2	2	2	2	0	0	0	0	205	205	205	203	1	3.730000	-6.349091	1	0.550000	NM_144967		0	40	40	0	736	723	0		1	0		0	0	205	0	0	1.000000	0	0	0	0	1	0	40	736
GPC4	2239	broad.mit.edu	37	X	132445300	132445300	+	Missense_Mutation	SNP	C	C	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:132445300C>A	ENST00000370828.3	-	4	1387	c.863G>T	c.(862-864)tGg>tTg	p.W288L	GPC4_ENST00000535467.1_Missense_Mutation_p.W218L	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	288					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					GAAATTGTTCCATTCAAAATC	0.443																																						ENST00000370828.3	0.300000	1.700000e-01	0.270000	2.000000e-01	0.230000	0.240308	0.230000	0.240000																										0				28						c.(862-864)tGg>tTg		glypican 4							154.0	140.0	145.0					X																	132445300		2203	4300	6503	SO:0001583	missense	2239	0	0					g.chrX:132445300C>A	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.863G>T	chrX.hg19:g.132445300C>A	ENSP00000359864:p.Trp288Leu						GPC4_ENST00000535467.1_Missense_Mutation_p.W218L	p.W288L	NM_001448.2	NP_001439.2	0	1	1		O75487	GPC4_HUMAN		4	1387	-	Acute lymphoblastic leukemia(192;0.000127)		B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	ENST00000370828.3	1	1	hg19	c.863G>T	CCDS14637.1	0	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763050	0.89932	.	.	ENSG00000076716	ENST00000370828;ENST00000536418;ENST00000535467	T;T	0.80566	-1.39;-1.39	5.61	5.61	0.85477	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.91432	0.7296	M	0.90082	3.085	0.80722	D	1	D	0.63880	0.993	D	0.69142	0.962	D	0.93066	0.6478	10	0.87932	D	0	-19.8545	17.5641	0.87914	0.0:1.0:0.0:0.0	.	288	O75487	GPC4_HUMAN	L	288;282;218	ENSP00000359864:W288L;ENSP00000444959:W218L	ENSP00000359864:W288L	W	-	2	0	0	GPC4	132272966	132272966	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.754000	0.85163	2.363000	0.80096	0.600000	0.82982	TGG	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.443	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	1	0	1	2	2	2	2	0	0	0	0	181	181	181	177	1	3.730000	-2.966611	1	0.550000	NM_001448		0	51	51	0	733	724	0		1	0		0	0	181	0	0	1.000000	9.464658e-01	0	0	0	71	0	51	733
FGF13	2258	broad.mit.edu	37	X	137793125	137793125	+	Missense_Mutation	SNP	C	C	G			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:137793125C>G	ENST00000315930.6	-	1	702	c.41G>C	c.(40-42)aGg>aCg	p.R14T	FGF13_ENST00000541469.1_Intron|FGF13_ENST00000370603.3_Intron|FGF13_ENST00000305414.4_Intron|FGF13_ENST00000441825.2_Intron|FGF13-AS1_ENST00000446383.1_RNA|FGF13-AS1_ENST00000438238.1_RNA	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	14	Mediates targeting to the nucleus. {ECO:0000250}.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					GCGGGCTTGCCTCTTCTGACG	0.597																																						ENST00000315930.6	0.170000	5.000000e-02	0.140000	7.000000e-02	0.100000	0.109271	0.100000	0.100000																										0				24						c.(40-42)aGg>aCg		fibroblast growth factor 13							84.0	80.0	82.0					X																	137793125		2203	4300	6503	SO:0001583	missense	2258	0	0					g.chrX:137793125C>G	BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.41G>C	chrX.hg19:g.137793125C>G	ENSP00000322390:p.Arg14Thr						FGF13-AS1_ENST00000438238.1_RNA|FGF13_ENST00000305414.4_Intron|FGF13_ENST00000541469.1_Intron|FGF13-AS1_ENST00000446383.1_RNA|FGF13_ENST00000441825.2_Intron|FGF13_ENST00000370603.3_Intron	p.R14T	NM_004114.3	NP_004105.1	0	1	1		Q92913	FGF13_HUMAN		1	702	-	Acute lymphoblastic leukemia(192;0.000127)		B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	ENST00000315930.6	1	1	hg19	c.41G>C	CCDS14665.1	0	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473036	0.84640	.	.	ENSG00000129682	ENST00000315930	D	0.84944	-1.92	4.29	4.29	0.51040	4.29	4.29	0.51040	.	.	.	.	.	D	0.86464	0.5939	L	0.60455	1.87	0.80722	D	1	P	0.46277	0.875	P	0.48524	0.58	D	0.88447	0.3046	9	0.72032	D	0.01	.	15.3424	0.74309	0.0:1.0:0.0:0.0	.	14	Q92913	FGF13_HUMAN	T	14	ENSP00000322390:R14T	ENSP00000322390:R14T	R	-	2	0	0	FGF13	137620791	137620791	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.318000	0.79029	1.889000	0.54706	0.529000	0.55759	AGG	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.597	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058534.2	0	0	1	2	2	2	2	0	0	0	0	127	127	127	126	1	3.730000	-11.792490	1	0.550000	NM_004114		0	13	12	0	450	440	0		1			0	0	127	0	0	0.999468	0	0	0	0	0	0	13	450
PASD1	139135	broad.mit.edu	37	X	150817142	150817142	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:150817142G>A	ENST00000370357.4	+	9	930	c.685G>A	c.(685-687)Gct>Act	p.A229T		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	229	Poly-Ala.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CGTTGAACCCgctgctgctgc	0.438																																						ENST00000370357.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				48						c.(685-687)Gct>Act		PAS domain containing 1							79.0	77.0	78.0					X																	150817142		2203	4299	6502	SO:0001583	missense	139135	1	120992	41				g.chrX:150817142G>A	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.685G>A	chrX.hg19:g.150817142G>A	ENSP00000359382:p.Ala229Thr							p.A229T	NM_173493.2	NP_775764.2	0	1	1		Q8IV76	PASD1_HUMAN		9	930	+	Acute lymphoblastic leukemia(192;6.56e-05)		Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	1	0	hg19	c.685G>A	CCDS35431.1	1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567649	0.28003	.	.	ENSG00000166049	ENST00000370357	T	0.70869	-0.52	4.14	-1.2	0.09554	4.14	-1.2	0.09554	.	.	.	.	.	T	0.34135	0.0887	N	0.14661	0.345	0.09310	N	1	P	0.37997	0.614	B	0.24006	0.05	T	0.39542	-0.9609	9	0.02654	T	1	.	0.9417	0.01357	0.3078:0.1545:0.3775:0.1602	.	229	Q8IV76	PASD1_HUMAN	T	229	ENSP00000359382:A229T	ENSP00000359382:A229T	A	+	1	0	0	PASD1	150567798	150567798	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-0.428000	0.06991	-0.573000	0.05998	0.422000	0.28245	GCT	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.438	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	1	0	1	2	2	2	2	0	0	0	0	183	183	183	90	1	3.730000	-20.000000	1	0.550000	NM_173493		0	308	157	0	327	170	1		1			0	0	183	0	0	1.000000	0	0	0	0	0	0	308	327
MECP2	4204	broad.mit.edu	37	X	153296299	153296299	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:153296299G>A	ENST00000303391.6	-	4	1229	c.980C>T	c.(979-981)aCc>aTc	p.T327I	MECP2_ENST00000453960.2_Missense_Mutation_p.T339I|MECP2_ENST00000460227.1_5'Flank	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	327					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)	p.T327N(1)		breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTCACCGAGGGTGGACACCAG	0.617																																						ENST00000303391.6	0.170000	5.000000e-02	0.140000	7.000000e-02	0.100000	0.110218	0.100000	0.100000																										1	Substitution - Missense(1)	p.T327N(1)	lung(1)	23						c.(979-981)aCc>aTc		methyl CpG binding protein 2							75.0	67.0	70.0					X																	153296299		2203	4300	6503	SO:0001583	missense	4204	0	0					g.chrX:153296299G>A	AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.980C>T	chrX.hg19:g.153296299G>A	ENSP00000301948:p.Thr327Ile						MECP2_ENST00000453960.2_Missense_Mutation_p.T339I|MECP2_ENST00000460227.1_5'Flank	p.T327I	NM_004992.3	NP_004983.1	0	1	1		P51608	MECP2_HUMAN		4	1229	-	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	ENST00000303391.6	1	1	hg19	c.980C>T	CCDS14741.1	0	.	.	.	.	.	.	.	.	.	.	G	14.65	2.599919	0.46318	.	.	ENSG00000169057	ENST00000303391;ENST00000545451;ENST00000453960	D;D	0.91295	-2.82;-2.81	5.06	5.06	0.68205	5.06	5.06	0.68205	.	0.554194	0.19741	N	0.107108	T	0.81531	0.4842	N	0.14661	0.345	0.80722	D	1	B;B	0.26400	0.144;0.148	B;B	0.27170	0.077;0.035	T	0.76683	-0.2869	10	0.19147	T	0.46	-5.948	11.8253	0.52263	0.0:0.0:0.8245:0.1755	.	339;327	P51608-2;P51608	.;MECP2_HUMAN	I	327;327;339	ENSP00000301948:T327I;ENSP00000395535:T339I	ENSP00000301948:T327I	T	-	2	0	0	MECP2	152949493	152949493	0.912000	0.30974	0.128000	0.21923	0.887000	0.51463	5.301000	0.65727	2.344000	0.79699	0.600000	0.82982	ACC	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.617	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061144.1	0	0	1	2	2	2	2	0	0	0	0	118	118	118	116	1	3.730000	-11.963040	1	0.550000	NM_004992		0	13	12	0	446	442	0		1	1		0	0	118	0	0	0.999505	8.692156e-01	0	5	0	122	0	13	446
MAGEB6	158809	broad.mit.edu	37	X	26213024	26213024	+	Missense_Mutation	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:26213024G>A	ENST00000379034.1	+	2	1210	c.1061G>A	c.(1060-1062)tGc>tAc	p.C354Y		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	354	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GATCCTCCATGCTATGAGTTC	0.498																																						ENST00000379034.1	0.340000	1.500000e-01	0.290000	1.900000e-01	0.230000	0.248030	0.230000	0.240000																										0				33						c.(1060-1062)tGc>tAc		melanoma antigen family B, 6							66.0	64.0	64.0					X																	26213024		2202	4292	6494	SO:0001583	missense	158809	0	0					g.chrX:26213024G>A	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.1061G>A	chrX.hg19:g.26213024G>A	ENSP00000368320:p.Cys354Tyr							p.C354Y	NM_173523.2	NP_775794.2	0	1	1		Q8N7X4	MAGB6_HUMAN		2	1210	+			Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	0	1	hg19	c.1061G>A	CCDS14217.1	0	.	.	.	.	.	.	.	.	.	.	G	5.430	0.264533	0.10294	.	.	ENSG00000176746	ENST00000379034	T	0.04706	3.57	3.29	-2.14	0.07123	3.29	-2.14	0.07123	.	0.617794	0.14414	U	0.321058	T	0.04770	0.0129	M	0.66439	2.03	0.09310	N	1	B	0.10296	0.003	B	0.17979	0.02	T	0.49881	-0.8892	10	0.08381	T	0.77	.	5.8566	0.18722	0.2283:0.511:0.2607:0.0	.	354	Q8N7X4	MAGB6_HUMAN	Y	354	ENSP00000368320:C354Y	ENSP00000368320:C354Y	C	+	2	0	0	MAGEB6	26122945	26122945	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.416000	0.02467	-0.702000	0.05056	-0.957000	0.02645	TGC	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.498	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	0	0	1	2	2	2	2	0	0	0	0	138	138	138	202	1	3.730000	-7.329741	1	0.550000	NM_173523		0	26	20	0	367	319	0		1			0	0	138	0	0	1.000000	0	0	0	0	0	0	26	367
BCOR	54880	broad.mit.edu	37	X	39922163	39922163	+	Missense_Mutation	SNP	C	C	T	rs370685925		TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:39922163C>T	ENST00000378444.4	-	9	4237	c.4009G>A	c.(4009-4011)Gaa>Aaa	p.E1337K	BCOR_ENST00000397354.3_Missense_Mutation_p.E1303K|BCOR_ENST00000342274.4_Missense_Mutation_p.E1303K|BCOR_ENST00000378463.1_Missense_Mutation_p.E180K|BCOR_ENST00000378455.4_Missense_Mutation_p.E1285K	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1337					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TCCTCTTCTTCGTCTGCACAC	0.532			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																															ENST00000378444.4	0.390000	1.100000e-01	0.310000	1.600000e-01	0.220000	0.242687	0.220000	0.220000				Rec	yes			Rec	yes		X	Xp11.4	Xp11.4	54880	F, N, S, T	BCL6 corepressor	yes	yes	oculo-facio-cardio-dental genetic			RARA		retinoblastoma, AML, APL(translocation)		0				126						c.(4009-4011)Gaa>Aaa		BCL6 corepressor		C	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	0,3833		0,0,0,1631,571	141.0	112.0	121.0		3907,3853,4009,3907	5.7	0.3	X		121	1,6727		0,0,1,2428,1871	no	missense,missense,missense,missense	BCOR	NM_001123383.1,NM_001123384.1,NM_001123385.1,NM_017745.5	56,56,56,56	0,0,1,4059,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1303/1722,1285/1704,1337/1756,1303/1722	39922163	1,10560	2202	4300	6502	SO:0001583	missense	54880	6	121388	28				g.chrX:39922163C>T	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4009G>A	chrX.hg19:g.39922163C>T	ENSP00000367705:p.Glu1337Lys						BCOR_ENST00000378463.1_Missense_Mutation_p.E180K|BCOR_ENST00000342274.4_Missense_Mutation_p.E1303K|BCOR_ENST00000397354.3_Missense_Mutation_p.E1303K|BCOR_ENST00000378455.4_Missense_Mutation_p.E1285K	p.E1337K	NM_001123385.1	NP_001116857.1	0	1	1		Q6W2J9	BCOR_HUMAN		9	4237	-			D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	ENST00000378444.4	1	1	hg19	c.4009G>A	CCDS48093.1	0	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518746	0.85495	0.0	1.49E-4	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	T;T;T;T;T;T;T	0.70516	-0.42;0.97;1.0;0.98;0.93;0.98;-0.49	5.67	5.67	0.87782	5.67	5.67	0.87782	.	.	.	.	.	T	0.75845	0.3905	N	0.19112	0.55	0.53005	D	0.999965	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.78314	0.951;0.991;0.896	T	0.78889	-0.2026	9	0.56958	D	0.05	-10.0684	18.7655	0.91871	0.0:1.0:0.0:0.0	.	1285;1337;1303	Q6W2J9-4;Q6W2J9;Q6W2J9-2	.;BCOR_HUMAN;.	K	207;180;1285;1303;1337;1303;10	ENSP00000408006:E207K;ENSP00000367724:E180K;ENSP00000367716:E1285K;ENSP00000380512:E1303K;ENSP00000367705:E1337K;ENSP00000345923:E1303K;ENSP00000387552:E10K	ENSP00000345923:E1303K	E	-	1	0	0	BCOR	39807107	39807107	1.000000	0.71417	0.350000	0.25708	0.966000	0.64601	3.518000	0.53451	2.376000	0.81061	0.600000	0.82982	GAA	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.532	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	1	0	1	2	2	2	2	0	0	0	0	43	43	43	42	1	3.730000	-4.988409	1	0.550000	NM_017745		0	9	8	0	138	137	1		1	1		0	0	43	0	0	0.994332	9.788593e-01	0	29	0	77	0	9	138
ZXDB	158586	broad.mit.edu	37	X	57620752	57620752	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:57620752G>A	ENST00000374888.1	+	1	2484	c.2271G>A	c.(2269-2271)gcG>gcA	p.A757A		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	757					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.A757A(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CAACCAAAGCGGAGTGGAACG	0.488																																						ENST00000374888.1	1.000000	7.100000e-01	0.950000	7.800000e-01	0.860000	0.870873	0.860000	1.000000																										1	Substitution - coding silent(1)	p.A757A(1)	lung(1)	27						c.(2269-2271)gcG>gcA		zinc finger, X-linked, duplicated B							163.0	124.0	138.0					X																	57620752		2203	4300	6503	SO:0001819	synonymous_variant	158586	0	0					g.chrX:57620752G>A	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.2271G>A	chrX.hg19:g.57620752G>A								p.A757A	NM_007157.3	NP_009088.1	0	1	1		P98169	ZXDB_HUMAN		1	2484	+			A8K151|Q9UBB3	Silent	SNP	ENST00000374888.1	1	1	hg19	c.2271G>A	CCDS35313.1	1																																																																																								0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.488	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	0	0	1	2	12	2	2	1	1	1	1	122	122	122	119	1	3.730000	-4.614652	1	0.550000	NM_007157		0	89	87	0	283	279	1		1	0		1	0	122	0	0	1.000000	7.787196e-01	0	0	0	11	0	89	283
MAGEE2	139599	broad.mit.edu	37	X	75004797	75004797	+	Silent	SNP	G	G	A			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:75004797G>A	ENST00000373359.2	-	1	282	c.90C>T	c.(88-90)aaC>aaT	p.N30N		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	30								p.N30N(2)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ACCCGGAGGCGTTAGTAGCTT	0.577																																						ENST00000373359.2	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999994	0.990000	1.000000																										2	Substitution - coding silent(2)	p.N30N(2)	large_intestine(1)|endometrium(1)	34						c.(88-90)aaC>aaT		melanoma antigen family E, 2							41.0	33.0	36.0					X																	75004797		2203	4299	6502	SO:0001819	synonymous_variant	139599	4	118024	40				g.chrX:75004797G>A	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.90C>T	chrX.hg19:g.75004797G>A								p.N30N	NM_138703.4	NP_619648.1	0	1	1		Q8TD90	MAGE2_HUMAN		1	282	-			Q5JSI5	Silent	SNP	ENST00000373359.2	1	1	hg19	c.90C>T	CCDS14431.1	1																																																																																								0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.577	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	1	0	1	2	2	2	2	0	0	0	0	56	56	56	55	1	3.730000	-20.000000	1	0.550000	NM_138703		0	89	87	0	145	143	1		1			0	0	56	0	0	1.000000	0	0	0	0	0	0	89	145
RPS6KA6	27330	broad.mit.edu	37	X	83362013	83362013	+	Missense_Mutation	SNP	G	G	C			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:83362013G>C	ENST00000262752.2	-	14	1154	c.1147C>G	c.(1147-1149)Cag>Gag	p.Q383E	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.Q383E|RPS6KA6_ENST00000495332.1_5'Flank	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	383	AGC-kinase C-terminal.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TTGAAGAGCTGATGAGCATTT	0.343																																						ENST00000262752.2	0.340000	1.500000e-01	0.290000	1.900000e-01	0.230000	0.247140	0.230000	0.240000																										0				46						c.(1147-1149)Cag>Gag		ribosomal protein S6 kinase, 90kDa, polypeptide 6							72.0	66.0	68.0					X																	83362013		2203	4300	6503	SO:0001583	missense	27330	0	0					g.chrX:83362013G>C	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1147C>G	chrX.hg19:g.83362013G>C	ENSP00000262752:p.Gln383Glu						RPS6KA6_ENST00000495332.1_5'Flank|RPS6KA6_ENST00000543399.1_Missense_Mutation_p.Q383E	p.Q383E	NM_014496.4	NP_055311.1	0	1	1		Q9UK32	KS6A6_HUMAN		14	1154	-			B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	1	1	hg19	c.1147C>G	CCDS14451.1	0	.	.	.	.	.	.	.	.	.	.	G	10.19	1.280893	0.23392	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.50548	0.74;0.74	4.93	4.93	0.64822	4.93	4.93	0.64822	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);	0.115806	0.64402	D	0.000014	T	0.26738	0.0654	N	0.04148	-0.265	0.80722	D	1	B;B	0.12013	0.001;0.005	B;B	0.18263	0.021;0.015	T	0.12243	-1.0555	10	0.09843	T	0.71	.	17.563	0.87912	0.0:0.0:1.0:0.0	.	383;383	B7ZL90;Q9UK32	.;KS6A6_HUMAN	E	383	ENSP00000262752:Q383E;ENSP00000440830:Q383E	ENSP00000262752:Q383E	Q	-	1	0	0	RPS6KA6	83248669	83248669	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.577000	0.82486	2.162000	0.67917	0.600000	0.82982	CAG	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.343	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	1	0	1	2	2	2	2	0	0	0	0	78	78	78	76	1	3.730000	-20.000000	1	0.550000	NM_014496		0	24	24	0	341	339	0		1	0		0	0	78	0	0	1.000000	0	0	0	0	1	0	24	341
VBP1	7411	broad.mit.edu	37	X	154464621	154464621	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YY-A8LH-01A-11D-A36O-08	TCGA-YY-A8LH-10A-01D-A367-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	527590f9-cf74-408c-a748-c698f1be8d37	81f01f7f-56f1-4882-914f-76940d0d117d	g.chrX:154464621C>T	ENST00000286428.5	+	5	613	c.496C>T	c.(496-498)Cga>Tga	p.R166*	VBP1_ENST00000459836.1_3'UTR|VBP1_ENST00000535916.1_Nonsense_Mutation_p.R161*	NM_003372.5	NP_003363.1	P61758	PFD3_HUMAN	von Hippel-Lindau binding protein 1	166					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)		p.R166G(1)		NS(1)|endometrium(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGACTTTCTTCGAGATCAATT	0.353																																						ENST00000286428.5	0.080000	1.000000e-02	0.060000	2.000000e-02	0.040000	0.048611	0.040000	0.040000																										1	Substitution - Missense(1)	p.R166G(1)	NS(1)	12						c.(496-498)Cga>Tga		von Hippel-Lindau binding protein 1							104.0	97.0	100.0					X																	154464621		2203	4300	6503	SO:0001587	stop_gained	7411	0	0					g.chrX:154464621C>T	U56833	CCDS14765.1	Xq28	2008-07-07			ENSG00000155959	ENSG00000155959			12662	protein-coding gene	gene with protein product	"""prefoldin 3"""	300133				8674032, 9339366	Standard	NM_003372		Approved	PFD3, PFDN3	uc004fnc.3	P61758	OTTHUMG00000022666	ENST00000286428.5:c.496C>T	chrX.hg19:g.154464621C>T	ENSP00000286428:p.Arg166*						VBP1_ENST00000459836.1_3'UTR|VBP1_ENST00000535916.1_Nonsense_Mutation_p.R161*	p.R166*	NM_003372.5	NP_003363.1	0	1	1		P61758	PFD3_HUMAN		5	613	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		B2R8L5|O55228|Q15765|Q5JT81|Q86X96	Nonsense_Mutation	SNP	ENST00000286428.5	0	1	hg19	c.496C>T	CCDS14765.1	0	.	.	.	.	.	.	.	.	.	.	C	37	6.295580	0.97449	.	.	ENSG00000155959	ENST00000535916;ENST00000286428	.	.	.	4.86	4.86	0.63082	4.86	4.86	0.63082	.	0.109676	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.9083	10.1751	0.42933	0.1991:0.8008:0.0:0.0	.	.	.	.	X	161;166	.	ENSP00000286428:R166X	R	+	1	2	2	VBP1	154117815	154117815	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.440000	0.52886	2.324000	0.78689	0.594000	0.82650	CGA	0.550000		TCGA-YY-A8LH-01A-11D-A36O-08	0.353	VBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058806.1	0	0	1	2	2	2	2	0	0	0	0	168	168	168	166	1	3.730000	-2.598769	1	0.550000			0	9	9	0	739	726	0		1	0		0	0	168	0	0	0.993692	4.759532e-01	0	0	0	123	0	9	739
