#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
DNA2	1763	broad.mit.edu	37	10	70176584	70176584	+	Missense_Mutation	SNP	C	C	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr10:70176584C>A	ENST00000358410.3	-	20	3046	c.2996G>T	c.(2995-2997)cGt>cTt	p.R999L	DNA2_ENST00000399179.2_Missense_Mutation_p.R761L|DNA2_ENST00000399180.2_Missense_Mutation_p.R1085L	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	999	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						AACATTAAGACGTCGCCAATC	0.368																																						ENST00000358410.3	1.000000	0.120000	0.770000	0.230000	0.390000	0.473100	0.390000	0.310000																										0				20						c.(2995-2997)cGt>cTt		DNA replication helicase/nuclease 2							71.0	69.0	70.0					10																	70176584		1848	4094	5942	SO:0001583	missense	1763	0	0					g.chr10:70176584C>A	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2996G>T	chr10.hg19:g.70176584C>A	ENSP00000351185:p.Arg999Leu	0					DNA2_ENST00000399180.2_Missense_Mutation_p.R1085L|DNA2_ENST00000399179.2_Missense_Mutation_p.R761L	p.R999L	NM_001080449.2	NP_001073918.2	1	2	3	2.008553	P51530	DNA2_HUMAN		20	3046	-			Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	0	1	hg19	c.2996G>T		0	.	.	.	.	.	.	.	.	.	.	C	31	5.101057	0.94245	.	.	ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410	D;D;D	0.95853	-3.83;-3.83;-3.83	5.08	5.08	0.68730	5.08	5.08	0.68730	.	0.115150	0.53938	D	0.000046	D	0.98425	0.9476	H	0.94620	3.56	0.37731	D	0.92528	D;D	0.89917	1.0;0.984	D;P	0.80764	0.994;0.877	D	0.99956	1.1623	10	0.87932	D	0	.	18.4906	0.90846	0.0:1.0:0.0:0.0	.	761;999	F8VR31;P51530	.;DNA2L_HUMAN	L	761;1085;761;999	ENSP00000382133:R1085L;ENSP00000382132:R761L;ENSP00000351185:R999L	ENSP00000351185:R999L	R	-	2	0	0	DNA2	69846590	69846590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.356000	0.79943	0.655000	0.94253	CGT	0.107586		TCGA-Z5-AAPL-01A-12D-A40W-08	0.368	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2	0	0	1		2	2	2	0		0	0	51		51	50	1	2	-5.407937	1	0.100000				4	4		242	236	0		1	0		0	0	51	0		0.885218	1.430237e-03	0	0	0	3	0	4	242
KCNMA1	3778	broad.mit.edu	37	10	78787582	78787582	+	Splice_Site	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr10:78787582G>A	ENST00000286628.8	-	16	1926	c.1927C>T	c.(1927-1929)Cgt>Tgt	p.R643C	KCNMA1_ENST00000354353.5_Splice_Site_p.R643C|KCNMA1_ENST00000286627.5_Splice_Site_p.R643C|KCNMA1_ENST00000372443.1_Splice_Site_p.R643C|KCNMA1_ENST00000406533.3_Splice_Site_p.R643C|KCNMA1_ENST00000372440.1_Splice_Site_p.R643C|KCNMA1_ENST00000404771.3_Splice_Site_p.R643C|KCNMA1_ENST00000404857.1_Splice_Site_p.R643C	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	643					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CAAACTTACCGGCTCTCTCGG	0.483																																						ENST00000286628.8	1.000000	0.290000	0.900000	0.410000	0.580000	0.625223	0.580000	0.520000																										0				68						c.(1927-1929)Cgt>Tgt		potassium large conductance calcium-activated channel, subfamily M, alpha member 1	Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)						140.0	131.0	134.0					10																	78787582		2203	4300	6503	SO:0001630	splice_region_variant	3778	0	0					g.chr10:78787582G>A	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1928+1C>T	chr10.hg19:g.78787582G>A		0					KCNMA1_ENST00000406533.3_Splice_Site_p.R643C|KCNMA1_ENST00000404771.3_Splice_Site_p.R643C|KCNMA1_ENST00000372443.1_Splice_Site_p.R643C|KCNMA1_ENST00000404857.1_Splice_Site_p.R643C|KCNMA1_ENST00000372440.1_Splice_Site_p.R643C|KCNMA1_ENST00000354353.5_Splice_Site_p.R643C|KCNMA1_ENST00000286627.5_Splice_Site_p.R643C	p.R643C	NM_001161352.1	NP_001154824.1	1	2	3	2.008553	Q12791	KCMA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)	16	1926	-	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Splice_Site	SNP	ENST00000286628.8	0	1	hg19	c.1927C>T		0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.42|16.42	3.117764|3.117764	0.56505|0.56505	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372421;ENST00000434208;ENST00000450795|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708	.|D;D;D;D;D;D;D;D;D	.|0.84589	.|-1.86;-1.85;-1.85;-1.86;-1.86;-1.86;-1.79;-1.87;-1.87	5.32|5.32	5.32|5.32	0.75619|0.75619	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.117057	.|0.64402	.|D	.|0.000016	D|D	0.82806|0.82806	0.5117|0.5117	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999997|0.999997	.|B;B;B;B;P;B;B	.|0.52463	.|0.006;0.003;0.001;0.032;0.953;0.002;0.033	.|B;B;B;B;B;B;B	.|0.43838	.|0.001;0.001;0.003;0.005;0.433;0.004;0.011	D|D	0.84716|0.84716	0.0737|0.0737	4|9	.|0.66056	.|D	.|0.02	-5.4467|-5.4467	12.2533|12.2533	0.54610|0.54610	0.0:0.0:0.7865:0.2135|0.0:0.0:0.7865:0.2135	.|.	.|643;643;643;643;643;425;643	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96	.|.;.;.;KCMA1_HUMAN;.;.;.	L|C	631;321;135|643;580;578;617;580;643;643;617;643;643;643;425	.|ENSP00000361517:R643C;ENSP00000361485:R580C;ENSP00000361514:R578C;ENSP00000396608:R617C;ENSP00000361520:R643C;ENSP00000286627:R643C;ENSP00000385552:R643C;ENSP00000346321:R643C;ENSP00000385806:R643C	.|ENSP00000286627:R643C	P|R	-|-	2|1	0|0	0|0	KCNMA1|KCNMA1	78457588|78457588	78457588|78457588	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.020000|6.020000	0.70826|0.70826	2.628000|2.628000	0.89032|0.89032	0.655000|0.655000	0.94253|0.94253	CCG|CGT	0.107586		TCGA-Z5-AAPL-01A-12D-A40W-08	0.483	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	0	0	1		2	2	2	0		0	0	89		89	87	1	2	-2.588164	1	0.100000	NM_002247	Missense_Mutation		11	10		404	395	0		1			0	0	89	0		0.998146	0	0	0	0	0	0	11	404
PAOX	196743	broad.mit.edu	37	10	135193525	135193525	+	Silent	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr10:135193525G>A	ENST00000278060.5	+	2	287	c.204G>A	c.(202-204)gcG>gcA	p.A68A	PAOX_ENST00000368535.2_3'UTR|AL360181.1_ENST00000597657.1_5'Flank|PAOX_ENST00000368539.4_Intron|PAOX_ENST00000357296.3_Silent_p.A68A|PAOX_ENST00000480071.2_Silent_p.A68A	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	206					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		AGGTGGGCGCGCACTGGATCC	0.677																																						ENST00000278060.5	1.000000	0.430000	1.000000	0.610000	0.860000	0.829197	0.860000	1.000000																										0				23						c.(202-204)gcG>gcA		polyamine oxidase (exo-N4-amino)							39.0	48.0	45.0					10																	135193525		2198	4298	6496	SO:0001819	synonymous_variant	196743	0	0					g.chr10:135193525G>A	BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.204G>A	chr10.hg19:g.135193525G>A		0					PAOX_ENST00000368539.4_Intron|PAOX_ENST00000368535.2_3'UTR|PAOX_ENST00000480071.2_Silent_p.A68A|AL360181.1_ENST00000597657.1_5'Flank|PAOX_ENST00000357296.3_Silent_p.A68A	p.A68A	NM_152911.2	NP_690875.1	1	2	3	2.008553	Q6QHF9	PAOX_HUMAN		2	287	+		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Silent	SNP	ENST00000278060.5	1	1	hg19	c.204G>A	CCDS7683.1	1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528603	0.27299	.	.	ENSG00000148832	ENST00000539775	.	.	.	5.07	-10.1	0.00402	5.07	-10.1	0.00402	.	0.000000	0.85682	D	0.000000	T	0.47783	0.1464	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59553	-0.7433	6	0.87932	D	0	-19.4616	2.3134	0.04192	0.173:0.3174:0.3293:0.1803	.	.	.	.	T	37	.	ENSP00000437742:A37T	A	+	1	0	0	PAOX	135043515	135043515	0.001000	0.12720	0.497000	0.27552	0.975000	0.68041	-2.122000	0.01321	-1.784000	0.01272	-0.253000	0.11424	GCA	0.107586		TCGA-Z5-AAPL-01A-12D-A40W-08	0.677	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051146.2	1	0	1		2	2	2	0		0	0	39		39	38	1	2	-2.810109	1	0.100000	NM_152911			10	10		241	239	0		1	0		0	0	39	0		0.996924	2.687242e-02	0	0	0	6	0	10	241
NAP1L4	4676	broad.mit.edu	37	11	2975837	2975837	+	Missense_Mutation	SNP	T	T	C			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr11:2975837T>C	ENST00000380542.4	-	12	1095	c.955A>G	c.(955-957)Att>Gtt	p.I319V	NAP1L4_ENST00000526115.1_Missense_Mutation_p.I319V	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	319					nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		AAGTGTCCAATTTCAAAATCA	0.448																																						ENST00000380542.4	1.000000	0.220000	0.930000	0.350000	0.530000	0.587000	0.530000	0.460000																										0				13						c.(955-957)Att>Gtt		nucleosome assembly protein 1-like 4							64.0	63.0	63.0					11																	2975837		1868	4098	5966	SO:0001583	missense	4676	0	0					g.chr11:2975837T>C	AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.955A>G	chr11.hg19:g.2975837T>C	ENSP00000369915:p.Ile319Val	0					NAP1L4_ENST00000526115.1_Missense_Mutation_p.I319V	p.I319V	NM_005969.3	NP_005960.1	1	2	3	2.011791	Q99733	NP1L4_HUMAN		12	1095	-		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)	B2R6J4|F5HFY4	Missense_Mutation	SNP	ENST00000380542.4	0	1	hg19	c.955A>G	CCDS41599.1	0	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742296	0.49151	.	.	ENSG00000205531	ENST00000399624;ENST00000380542;ENST00000526115	T;T	0.28666	1.6;1.6	4.63	4.63	0.57726	4.63	4.63	0.57726	.	0.055524	0.64402	D	0.000001	T	0.34077	0.0885	M	0.64404	1.975	0.53688	D	0.999972	B;B	0.26744	0.158;0.019	B;B	0.36244	0.22;0.03	T	0.14896	-1.0456	10	0.34782	T	0.22	-17.8508	9.5911	0.39545	0.0:0.0824:0.0:0.9176	.	319;319	F5HFY4;Q99733	.;NP1L4_HUMAN	V	319	ENSP00000369915:I319V;ENSP00000436397:I319V	ENSP00000369915:I319V	I	-	1	0	0	NAP1L4	2932413	2932413	1.000000	0.71417	0.967000	0.41034	0.884000	0.51177	5.617000	0.67716	1.936000	0.56123	0.528000	0.53228	ATT	0.108028		TCGA-Z5-AAPL-01A-12D-A40W-08	0.448	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030273.3	0	0	1		2	2	2	0		0	0	55		55	55	1	2	-7.871812	1	0.100000	NM_005969			7	7		292	290	0		1	1		0	0	55	0		0.980472	9.709519e-01	0	14	0	251	0	7	292
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.190000	0.880000	0.320000	0.520000	0.573928	0.520000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	2	3	2.000035	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.105812		TCGA-Z5-AAPL-01A-12D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1		2	2	2	0		0	0	60		60	59	1	2	-3.509279	1	0.100000	NM_033360			5	5		213	212	0		1	0	1	0	0	60	327		0.937507	3.838478e-02	9.900869e-01	1	6	10	386	5	213
CSRNP2	81566	broad.mit.edu	37	12	51461619	51461619	+	Missense_Mutation	SNP	C	C	T	rs148149139		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr12:51461619C>T	ENST00000228515.1	-	4	842	c.545G>A	c.(544-546)cGg>cAg	p.R182Q		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	182					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						GGCCCGTCGCCGTTTGGTGGG	0.537																																						ENST00000228515.1	1.000000	0.270000	0.780000	0.380000	0.530000	0.577806	0.530000	0.480000																										0				14						c.(544-546)cGg>cAg		cysteine-serine-rich nuclear protein 2		C	GLN/ARG	0,4406		0,0,2203	102.0	90.0	94.0		545	4.9	1.0	12	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	missense	CSRNP2	NM_030809.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	182/544	51461619	1,13005	2203	4300	6503	SO:0001583	missense	81566	2	121412	37				g.chr12:51461619C>T	AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.545G>A	chr12.hg19:g.51461619C>T	ENSP00000228515:p.Arg182Gln	0						p.R182Q	NM_030809.2	NP_110436.1	1	2	3	2.000035	Q9H175	CSRN2_HUMAN		4	842	-				Missense_Mutation	SNP	ENST00000228515.1	1	1	hg19	c.545G>A	CCDS8807.1	0	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535451	0.64972	0.0	1.16E-4	ENSG00000110925	ENST00000228515	T	0.10860	2.83	4.94	4.94	0.65067	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.15478	0.0373	N	0.05608	-0.01	0.58432	D	0.999996	D	0.89917	1.0	D	0.81914	0.995	T	0.38520	-0.9657	10	0.23302	T	0.38	-18.6725	17.4885	0.87696	0.0:1.0:0.0:0.0	.	182	Q9H175	CSRN2_HUMAN	Q	182	ENSP00000228515:R182Q	ENSP00000228515:R182Q	R	-	2	0	0	CSRNP2	49747886	49747886	0.171000	0.23029	1.000000	0.80357	0.995000	0.86356	0.943000	0.29030	2.758000	0.94735	0.561000	0.74099	CGG	0.105812		TCGA-Z5-AAPL-01A-12D-A40W-08	0.537	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404893.1	0	0	1		2	2	2	0		0	0	60		60	60	1	2	-2.978236	1	0.100000				11	11		435	429	0		1	0		0	0	60	0		0.998248	8.576470e-02	0	1	0	17	0	11	435
PTPRB	5787	broad.mit.edu	37	12	70964902	70964902	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr12:70964902G>A	ENST00000261266.5	-	11	2649	c.2620C>T	c.(2620-2622)Cga>Tga	p.R874*	PTPRB_ENST00000334414.6_Nonsense_Mutation_p.R1092*|PTPRB_ENST00000551525.1_Nonsense_Mutation_p.R1091*|PTPRB_ENST00000550358.1_Nonsense_Mutation_p.R1004*|PTPRB_ENST00000451516.2_Nonsense_Mutation_p.R784*|PTPRB_ENST00000550857.1_Nonsense_Mutation_p.R784*|PTPRB_ENST00000538708.1_Nonsense_Mutation_p.R874*	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	874	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GAAGTAAATCGATACTCGGTT	0.453																																						ENST00000261266.5	1.000000	0.220000	1.000000	0.370000	0.600000	0.634053	0.600000	1.000000																										0				107						c.(2620-2622)Cga>Tga		protein tyrosine phosphatase, receptor type, B							90.0	86.0	87.0					12																	70964902		1937	4134	6071	SO:0001587	stop_gained	5787	0	0					g.chr12:70964902G>A	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2620C>T	chr12.hg19:g.70964902G>A	ENSP00000261266:p.Arg874*	0					PTPRB_ENST00000334414.6_Nonsense_Mutation_p.R1092*|PTPRB_ENST00000538708.1_Nonsense_Mutation_p.R874*|PTPRB_ENST00000551525.1_Nonsense_Mutation_p.R1091*|PTPRB_ENST00000451516.2_Nonsense_Mutation_p.R784*|PTPRB_ENST00000550358.1_Nonsense_Mutation_p.R1004*|PTPRB_ENST00000550857.1_Nonsense_Mutation_p.R784*	p.R874*	NM_002837.4	NP_002828.3	1	2	3	2.000035	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)	11	2649	-	Renal(347;0.236)		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Nonsense_Mutation	SNP	ENST00000261266.5	0	1	hg19	c.2620C>T	CCDS44944.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.958065	0.97145	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	.	.	.	5.9	3.02	0.34903	5.9	3.02	0.34903	.	1.012530	0.07887	N	0.970442	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	8.9582	0.35832	0.0691:0.0:0.4405:0.4904	.	.	.	.	X	1092;784;1004;874;784;874;1091;971	.	ENSP00000261266:R874X	R	-	1	2	2	PTPRB	69251169	69251169	0.008000	0.16893	0.049000	0.19019	0.466000	0.32739	0.162000	0.16501	0.358000	0.24211	-0.188000	0.12872	CGA	0.105812		TCGA-Z5-AAPL-01A-12D-A40W-08	0.453	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1	0	0	1		2	2	2	0		0	0	51		51	51	1	2	-6.841176	1	0.100000				5	5		185	181	0		1	0		0	0	51	0		0.934835	1.239321e-01	0	0	0	19	0	5	185
FNDC3A	22862	broad.mit.edu	37	13	49781232	49781232	+	Missense_Mutation	SNP	G	G	A	rs142361918	byFrequency	TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr13:49781232G>A	ENST00000492622.2	+	26	3603	c.3298G>A	c.(3298-3300)Gac>Aac	p.D1100N	FNDC3A_ENST00000398316.3_Missense_Mutation_p.D1044N|FNDC3A_ENST00000541916.1_Missense_Mutation_p.D1100N	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	1100	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		CAAGGGTCCCGACTCTTCCTT	0.438													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19519	0.0		0.0	False		,,,				2504	0.0					ENST00000492622.2	1.000000	0.180000	0.730000	0.280000	0.420000	0.497430	0.420000	0.380000																										0				41						c.(3298-3300)Gac>Aac		fibronectin type III domain containing 3A		G	ASN/ASP,ASN/ASP	10,4396	16.8+/-37.8	0,10,2193	75.0	75.0	75.0		3298,3130	3.5	0.1	13	dbSNP_134	75	0,8600		0,0,4300	yes	missense,missense	FNDC3A	NM_001079673.1,NM_014923.3	23,23	0,10,6493	AA,AG,GG		0.0,0.227,0.0769	benign,benign	1100/1199,1044/1143	49781232	10,12996	2203	4300	6503	SO:0001583	missense	22862	20	121412	44				g.chr13:49781232G>A	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.3298G>A	chr13.hg19:g.49781232G>A	ENSP00000417257:p.Asp1100Asn	0					FNDC3A_ENST00000398316.3_Missense_Mutation_p.D1044N|FNDC3A_ENST00000541916.1_Missense_Mutation_p.D1100N	p.D1100N	NM_001079673.1	NP_001073141.1	1	2	3	2.008041	Q9Y2H6	FND3A_HUMAN	KIRC - Kidney renal clear cell carcinoma(9;0.206)	26	3603	+		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	0	1	hg19	c.3298G>A	CCDS41886.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	1.261	-0.615789	0.03663	0.00227	0.0	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.35605	1.31;1.31;1.3	5.23	3.51	0.40186	5.23	3.51	0.40186	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.380675	0.24422	N	0.038661	T	0.23886	0.0578	L	0.35487	1.065	0.09310	N	0.999999	B;B	0.16166	0.016;0.009	B;B	0.15870	0.014;0.002	T	0.20538	-1.0272	10	0.18276	T	0.48	-4.6725	8.3463	0.32275	0.2376:0.0:0.7624:0.0	.	1044;1100	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	N	1100;1036;1100;1044	ENSP00000417257:D1100N;ENSP00000441831:D1100N;ENSP00000381362:D1044N	ENSP00000338579:D1036N	D	+	1	0	0	FNDC3A	48679233	48679233	1.000000	0.71417	0.066000	0.19879	0.010000	0.07245	4.351000	0.59398	0.596000	0.29794	-0.781000	0.03364	GAC	0.107586		TCGA-Z5-AAPL-01A-12D-A40W-08	0.438	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	0	0	1		2	2	2	0		0	0	95		95	94	1	2	-6.767522	1	0.100000	NM_014923			7	7		366	362	0		1	1		0	0	95	0		0.980089	2.929347e-01	0	9	0	42	0	7	366
ACSBG1	23205	broad.mit.edu	37	15	78474328	78474328	+	Missense_Mutation	SNP	C	C	T			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr15:78474328C>T	ENST00000258873.4	-	8	1259	c.1054G>A	c.(1054-1056)Gaa>Aaa	p.E352K	ACSBG1_ENST00000560817.1_Missense_Mutation_p.E110K|ACSBG1_ENST00000541759.1_Missense_Mutation_p.E110K	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	352					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						GCGTCGGGTTCGGCAAAGCAA	0.617																																						ENST00000258873.4	1.000000	0.290000	1.000000	0.440000	0.650000	0.681715	0.650000	1.000000																										0				37						c.(1054-1056)Gaa>Aaa		acyl-CoA synthetase bubblegum family member 1							95.0	74.0	81.0					15																	78474328		2196	4293	6489	SO:0001583	missense	23205	1	121412	32				g.chr15:78474328C>T	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1054G>A	chr15.hg19:g.78474328C>T	ENSP00000258873:p.Glu352Lys	0					ACSBG1_ENST00000541759.1_Missense_Mutation_p.E110K|ACSBG1_ENST00000560817.1_Missense_Mutation_p.E110K	p.E352K	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	1	2	3	2.009458	Q96GR2	ACBG1_HUMAN		8	1259	-			B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	0	1	hg19	c.1054G>A	CCDS10298.1	0	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263568	0.59431	.	.	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.11712	2.75;2.75	5.14	4.21	0.49690	5.14	4.21	0.49690	AMP-dependent synthetase/ligase (1);	0.343803	0.30338	N	0.009850	T	0.12305	0.0299	L	0.54863	1.705	0.31434	N	0.672767	P;B	0.35192	0.489;0.076	B;B	0.32624	0.149;0.045	T	0.04053	-1.0981	10	0.30854	T	0.27	-20.9457	15.0902	0.72188	0.0:0.8577:0.1423:0.0	.	348;352	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	K	352;110	ENSP00000258873:E352K;ENSP00000439955:E110K	ENSP00000258873:E352K	E	-	1	0	0	ACSBG1	76261383	76261383	0.780000	0.28664	0.125000	0.21846	0.935000	0.57460	1.253000	0.32886	1.283000	0.44513	0.650000	0.86243	GAA	0.107586		TCGA-Z5-AAPL-01A-12D-A40W-08	0.617	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	0	0	1		2	2	2	0		0	0	43		43	42	1	2	-3.393421	1	0.100000	NM_015162			8	8		265	263	0		1	0		0	0	43	0		0.989342	0	0	0	0	1	0	8	265
DNAH9	1770	broad.mit.edu	37	17	11687719	11687719	+	Missense_Mutation	SNP	G	G	T			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr17:11687719G>T	ENST00000262442.4	+	41	7992	c.7924G>T	c.(7924-7926)Gcg>Tcg	p.A2642S	DNAH9_ENST00000454412.2_Missense_Mutation_p.A2642S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2642	AAA 3. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AAACTTCCCGGCGTCCCTGCA	0.542																																						ENST00000262442.4	0.700000	0.280000	0.580000	0.360000	0.460000	0.480862	0.460000	0.460000																										0				290						c.(7924-7926)Gcg>Tcg		dynein, axonemal, heavy chain 9							175.0	168.0	170.0					17																	11687719		2203	4300	6503	SO:0001583	missense	1770	0	0					g.chr17:11687719G>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.7924G>T	chr17.hg19:g.11687719G>T	ENSP00000262442:p.Ala2642Ser	0					DNAH9_ENST00000454412.2_Missense_Mutation_p.A2642S	p.A2642S	NM_001372.3	NP_001363.2	0	1	1	1.993482	Q9NYC9	DYH9_HUMAN		41	7992	+		Breast(5;0.0122)|all_epithelial(5;0.131)	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	1	1	hg19	c.7924G>T	CCDS11160.1	0	.	.	.	.	.	.	.	.	.	.	G	0.947	-0.707583	0.03230	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.36699	1.24;1.24	5.56	0.768	0.18487	5.56	0.768	0.18487	.	0.509864	0.20467	N	0.091774	T	0.12817	0.0311	N	0.04820	-0.15	0.09310	N	0.999996	B	0.06786	0.001	B	0.12156	0.007	T	0.25467	-1.0131	10	0.10902	T	0.67	.	4.329	0.11053	0.1421:0.1233:0.6074:0.1272	.	2642	Q9NYC9	DYH9_HUMAN	S	2642;2642;1224	ENSP00000262442:A2642S;ENSP00000414874:A2642S	ENSP00000262442:A2642S	A	+	1	0	0	DNAH9	11628444	11628444	0.149000	0.22717	0.002000	0.10522	0.000000	0.00434	2.179000	0.42528	0.694000	0.31654	-0.152000	0.13540	GCG	0.092742		TCGA-Z5-AAPL-01A-12D-A40W-08	0.542	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	0	0	1		2	2	2	0		0	0	139		139	139	1	2	-3.042933	1	0.100000	NM_001372			18	17		754	742	0		1			0	0	139	0		0.999979	0	0	0	0	0	0	18	754
KRT26	353288	broad.mit.edu	37	17	38926606	38926606	+	Missense_Mutation	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr17:38926606G>A	ENST00000335552.4	-	3	628	c.580C>T	c.(580-582)Cgc>Tgc	p.R194C		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				AACACTCTGCGAAGACCACTG	0.488																																						ENST00000335552.4	0.930000	0.330000	0.760000	0.440000	0.580000	0.607845	0.580000	0.570000																										0				16						c.(580-582)Cgc>Tgc		keratin 26							145.0	137.0	140.0					17																	38926606		2203	4300	6503	SO:0001583	missense	353288	1	121412	35				g.chr17:38926606G>A	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.580C>T	chr17.hg19:g.38926606G>A	ENSP00000334798:p.Arg194Cys	0						p.R194C	NM_181539.4	NP_853517.2	0	1	1	1.993482				3	628	-		Breast(137;0.00526)		Missense_Mutation	SNP	ENST00000335552.4	1	1	hg19	c.580C>T	CCDS11374.1	0	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664425	0.47572	.	.	ENSG00000186393	ENST00000335552	D	0.92545	-3.06	5.42	5.42	0.78866	5.42	5.42	0.78866	Filament (1);	0.193938	0.37136	N	0.002236	D	0.96078	0.8722	M	0.82193	2.58	0.35379	D	0.789788	D	0.89917	1.0	D	0.85130	0.997	D	0.99215	1.0877	10	0.87932	D	0	.	15.037	0.71754	0.0:0.0:0.8576:0.1424	.	194	Q7Z3Y9	K1C26_HUMAN	C	194	ENSP00000334798:R194C	ENSP00000334798:R194C	R	-	1	0	0	KRT26	36180132	36180132	0.004000	0.15560	0.133000	0.22050	0.393000	0.30537	1.481000	0.35476	2.705000	0.92388	0.655000	0.94253	CGC	0.092742		TCGA-Z5-AAPL-01A-12D-A40W-08	0.488	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	0	0	1		2	2	2	0		0	0	92		92	89	1	2	-2.951480	1	0.100000	NM_181539			13	12		431	422	0		1			0	0	92	0		0.999474	0	0	0	0	0	0	13	431
TP53	7157	broad.mit.edu	37	17	7577566	7577566	+	Missense_Mutation	SNP	T	T	C			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr17:7577566T>C	ENST00000269305.4	-	7	904	c.715A>G	c.(715-717)Aac>Gac	p.N239D	TP53_ENST00000455263.2_Missense_Mutation_p.N239D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.N239D|TP53_ENST00000445888.2_Missense_Mutation_p.N239D|TP53_ENST00000420246.2_Missense_Mutation_p.N239D|TP53_ENST00000359597.4_Missense_Mutation_p.N239D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239D(33)|p.N239fs*25(12)|p.0?(8)|p.N239Y(6)|p.N239fs*1(5)|p.?(5)|p.M237_N239delMCN(4)|p.N239_C242delNSSC(3)|p.N239fs*8(2)|p.N239_S240delNS(2)|p.N239fs*26(1)|p.N146D(1)|p.N146fs*1(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238fs*21(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGAACTGTTACACATGTAG	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.470000	1.000000	0.640000	0.850000	0.834432	0.850000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		95	Substitution - Missense(40)|Insertion - Frameshift(18)|Deletion - In frame(14)|Whole gene deletion(8)|Deletion - Frameshift(7)|Unknown(5)|Substitution - Nonsense(1)|Complex - frameshift(1)|Insertion - In frame(1)	p.N239D(33)|p.N239fs*25(12)|p.0?(8)|p.N239Y(6)|p.N239fs*1(5)|p.?(5)|p.M237_N239delMCN(4)|p.N239_C242delNSSC(3)|p.N239fs*8(2)|p.N239_S240delNS(2)|p.N239fs*26(1)|p.N146D(1)|p.N146fs*1(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238fs*21(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242del(1)	ovary(14)|oesophagus(11)|haematopoietic_and_lymphoid_tissue(10)|biliary_tract(7)|central_nervous_system(7)|large_intestine(7)|lung(7)|breast(6)|upper_aerodigestive_tract(5)|endometrium(5)|bone(5)|urinary_tract(4)|stomach(3)|prostate(2)|liver(1)|pancreas(1)	24185						c.(715-717)Aac>Gac	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						133.0	104.0	114.0					17																	7577566		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577566T>C	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.715A>G	chr17.hg19:g.7577566T>C	ENSP00000269305:p.Asn239Asp	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.N239D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.N239D|TP53_ENST00000420246.2_Missense_Mutation_p.N239D|TP53_ENST00000359597.4_Missense_Mutation_p.N239D|TP53_ENST00000413465.2_Missense_Mutation_p.N239D	p.N239D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.993482	P04637	P53_HUMAN		7	904	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.715A>G	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.564934	0.86439	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99748	-6.62;-6.62;-6.62;-6.62;-6.62;-6.62;-6.62;-6.62	4.09	4.09	0.47781	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99648	0.9870	M	0.87381	2.88	0.58432	D	0.99999	D;D;D;D;D;D	0.89917	0.999;0.972;0.999;0.999;0.999;1.0	D;P;D;D;D;D	0.91635	0.993;0.803;0.998;0.993;0.996;0.999	D	0.97636	1.0145	10	0.87932	D	0	-35.9081	11.6823	0.51466	0.0:0.0:0.0:1.0	.	239;239;146;239;239;239	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	239;239;239;239;239;239;228;146;107;146	ENSP00000410739:N239D;ENSP00000352610:N239D;ENSP00000269305:N239D;ENSP00000398846:N239D;ENSP00000391127:N239D;ENSP00000391478:N239D;ENSP00000425104:N107D;ENSP00000423862:N146D	ENSP00000269305:N239D	N	-	1	0	0	TP53	7518291	7518291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.074000	0.62210	0.379000	0.24179	AAC	0.092742		TCGA-Z5-AAPL-01A-12D-A40W-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	0	0	1		2	2	2	0		0	0	62		62	60	1	2	-4.308988	1	0.100000	NM_000546			12	11		267	263	1		1	1	1	0	0	62	936		0.999075	9.052728e-01	9.999997e-01	11	15	83	762	12	267
PTRF	284119	broad.mit.edu	37	17	40557306	40557306	+	Missense_Mutation	SNP	C	C	G			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr17:40557306C>G	ENST00000357037.5	-	2	991	c.572G>C	c.(571-573)cGg>cCg	p.R191P		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CTCCTCGGGCCGCTCGCCCTC	0.642																																						ENST00000357037.5	0.500000	0.160000	0.410000	0.220000	0.300000	0.322435	0.300000	0.300000																										0				17						c.(571-573)cGg>cCg		polymerase I and transcript release factor							81.0	87.0	85.0					17																	40557306		2203	4299	6502	SO:0001583	missense	284119	0	0					g.chr17:40557306C>G	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.572G>C	chr17.hg19:g.40557306C>G	ENSP00000349541:p.Arg191Pro	0						p.R191P	NM_012232.5	NP_036364.2	0	1	1	1.993482				2	991	-		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		Missense_Mutation	SNP	ENST00000357037.5	0	1	hg19	c.572G>C	CCDS11425.1	0	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309923	0.23821	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.59083	0.29	5.35	3.16	0.36331	5.35	3.16	0.36331	.	0.763946	0.12471	N	0.465970	T	0.37376	0.1001	N	0.14661	0.345	0.29558	N	0.850856	P;P	0.46952	0.887;0.755	B;B	0.43360	0.417;0.417	T	0.17992	-1.0351	10	0.32370	T	0.25	-26.2144	4.1299	0.10144	0.0:0.5917:0.0:0.4083	.	173;191	B4DNU9;Q6NZI2	.;PTRF_HUMAN	P	191;146	ENSP00000349541:R191P	ENSP00000349541:R191P	R	-	2	0	0	PTRF	37810832	37810832	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	2.269000	0.43346	1.260000	0.44134	0.446000	0.29264	CGG	0.092742		TCGA-Z5-AAPL-01A-12D-A40W-08	0.642	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	0	0	1		2	2	2	0		0	0	146		146	143	1	2	-2.543191	1	0.100000	NM_012232			12	12		776	753	0		1	0		0	0	146	0		0.998943	3.523221e-01	0	1	0	75	0	12	776
LRRC30	339291	broad.mit.edu	37	18	7231720	7231720	+	Missense_Mutation	SNP	C	C	T	rs374067933		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr18:7231720C>T	ENST00000383467.2	+	1	598	c.584C>T	c.(583-585)tCg>tTg	p.S195L		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	195										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CACGTGGGCTCGAATCGCCTG	0.537																																						ENST00000383467.2	0.850000	0.230000	0.670000	0.340000	0.480000	0.511772	0.480000	0.460000																										0				31						c.(583-585)tCg>tTg		leucine rich repeat containing 30							88.0	92.0	91.0					18																	7231720		2105	4242	6347	SO:0001583	missense	339291	0	0					g.chr18:7231720C>T		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.584C>T	chr18.hg19:g.7231720C>T	ENSP00000372959:p.Ser195Leu	0						p.S195L	NM_001105581.1	NP_001099051.1	0	0	0	1.962870	A6NM36	LRC30_HUMAN		1	598	+				Missense_Mutation	SNP	ENST00000383467.2	0	1	hg19	c.584C>T	CCDS42409.1	0	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809700	0.50421	.	.	ENSG00000206422	ENST00000383467	T	0.25912	1.77	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.097810	0.64402	D	0.000001	T	0.31702	0.0805	M	0.86740	2.835	0.40424	D	0.979872	D	0.59357	0.985	B	0.38106	0.265	T	0.43877	-0.9364	10	0.10902	T	0.67	.	16.3636	0.83296	0.0:0.8683:0.1317:0.0	.	195	A6NM36	LRC30_HUMAN	L	195	ENSP00000372959:S195L	ENSP00000372959:S195L	S	+	2	0	0	LRRC30	7221720	7221720	1.000000	0.71417	0.996000	0.52242	0.932000	0.56968	3.118000	0.50414	2.827000	0.97445	0.650000	0.86243	TCG	0.076923		TCGA-Z5-AAPL-01A-12D-A40W-08	0.537	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1	0	0	1		2	2	2	0		0	0	72		72	70	1	2	-3.077805	1	0.100000	XM_292678			8	8		320	316	0		1			0	0	72	0		0.989055	0	0	0	0	0	0	8	320
DTNA	1837	broad.mit.edu	37	18	32374135	32374135	+	Missense_Mutation	SNP	C	C	T			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr18:32374135C>T	ENST00000399113.3	+	3	283	c.283C>T	c.(283-285)Cgg>Tgg	p.R95W	DTNA_ENST00000598142.1_Missense_Mutation_p.R95W|DTNA_ENST00000348997.5_Missense_Mutation_p.R95W|DTNA_ENST00000598774.1_Missense_Mutation_p.R95W|DTNA_ENST00000596745.1_Missense_Mutation_p.R95W|DTNA_ENST00000315456.6_Missense_Mutation_p.R95W|DTNA_ENST00000269190.7_Missense_Mutation_p.R95W|DTNA_ENST00000283365.9_Missense_Mutation_p.R95W|DTNA_ENST00000269191.6_Missense_Mutation_p.R95W|DTNA_ENST00000595022.1_Missense_Mutation_p.R95W|DTNA_ENST00000399097.3_5'UTR|DTNA_ENST00000554864.3_Missense_Mutation_p.R95W|DTNA_ENST00000597599.1_Missense_Mutation_p.R95W|DTNA_ENST00000598334.1_Missense_Mutation_p.R95W|DTNA_ENST00000399121.5_Missense_Mutation_p.R95W|DTNA_ENST00000444659.1_Missense_Mutation_p.R95W			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	95	Interaction with MAGEE1. {ECO:0000250}.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						GCTCAACAAACGGATGCCAAC	0.498																																						ENST00000399113.3	0.990000	0.340000	0.810000	0.460000	0.620000	0.641320	0.620000	1.000000																										0				29						c.(283-285)Cgg>Tgg		dystrobrevin, alpha							253.0	197.0	216.0					18																	32374135		2203	4300	6503	SO:0001583	missense	1837	0	0					g.chr18:32374135C>T	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.283C>T	chr18.hg19:g.32374135C>T	ENSP00000382064:p.Arg95Trp	0					DTNA_ENST00000596745.1_Missense_Mutation_p.R95W|DTNA_ENST00000598774.1_Missense_Mutation_p.R95W|DTNA_ENST00000269191.6_Missense_Mutation_p.R95W|DTNA_ENST00000348997.5_Missense_Mutation_p.R95W|DTNA_ENST00000595022.1_Missense_Mutation_p.R95W|DTNA_ENST00000269190.7_Missense_Mutation_p.R95W|DTNA_ENST00000399097.3_5'UTR|DTNA_ENST00000554864.3_Missense_Mutation_p.R95W|DTNA_ENST00000598142.1_Missense_Mutation_p.R95W|DTNA_ENST00000399121.5_Missense_Mutation_p.R95W|DTNA_ENST00000283365.9_Missense_Mutation_p.R95W|DTNA_ENST00000444659.1_Missense_Mutation_p.R95W|DTNA_ENST00000597599.1_Missense_Mutation_p.R95W|DTNA_ENST00000315456.6_Missense_Mutation_p.R95W|DTNA_ENST00000598334.1_Missense_Mutation_p.R95W	p.R95W			0	0	0	1.962870	Q9Y4J8	DTNA_HUMAN		3	283	+			A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	1	1	hg19	c.283C>T	CCDS59311.1	0	.	.	.	.	.	.	.	.	.	.	C	22.1	4.247247	0.80024	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000315456;ENST00000556176;ENST00000399114;ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113	T;T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.43	2.35	0.29111	5.43	2.35	0.29111	EF-hand domain, type 1 (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.82898	0.5137	M	0.89214	3.015	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.995;0.999;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.996;0.933;0.965;0.998;0.999;0.953;0.999;0.999;0.998;0.999;0.988;0.998	D	0.85817	0.1383	10	0.87932	D	0	-20.1745	13.365	0.60678	0.4429:0.5571:0.0:0.0	.	95;95;95;95;95;95;95;106;95;95;95;95	B4DGS6;Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-4;E9PEH8;Q59GK7;Q9BS59;Q9Y4J8-2;Q9Y4J8-5;Q9Y4J8-7	.;DTNA_HUMAN;.;.;.;.;.;.;.;.;.;.	W	95	ENSP00000283365:R95W;ENSP00000322519:R95W;ENSP00000269190:R95W;ENSP00000336682:R95W;ENSP00000382072:R95W;ENSP00000405819:R95W;ENSP00000269191:R95W;ENSP00000382064:R95W	ENSP00000269190:R95W	R	+	1	2	2	DTNA	30628133	30628133	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.601000	0.46249	0.699000	0.31761	0.563000	0.77884	CGG	0.076923		TCGA-Z5-AAPL-01A-12D-A40W-08	0.498	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	0	0	1		2	2	2	0		0	0	71		71	71	1	2	-3.194878	1	0.100000	NM_001390			12	12		367	360	0		1	0		0	0	71	0		0.999047	1.155573e-02	0	0	0	5	0	12	367
EMR1	2015	broad.mit.edu	37	19	6896543	6896543	+	Nonsense_Mutation	SNP	C	C	T	rs202045997		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr19:6896543C>T	ENST00000312053.4	+	3	266	c.229C>T	c.(229-231)Cga>Tga	p.R77*	EMR1_ENST00000381407.5_Nonsense_Mutation_p.R77*|EMR1_ENST00000250572.8_Nonsense_Mutation_p.R77*|EMR1_ENST00000381404.4_Nonsense_Mutation_p.R77*|AC020895.1_ENST00000580648.1_RNA|EMR1_ENST00000450315.3_Nonsense_Mutation_p.R77*|EMR1_ENST00000601198.1_3'UTR	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	77	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					TCCAGGAGTGCGATGCAAAGG	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		19179	0.001		0.0	False		,,,				2504	0.0					ENST00000312053.4	1.000000	0.230000	1.000000	0.380000	0.620000	0.660959	0.620000	1.000000																										0				62						c.(229-231)Cga>Tga		egf-like module containing, mucin-like, hormone receptor-like 1							126.0	92.0	104.0					19																	6896543		2203	4300	6503	SO:0001587	stop_gained	2015	3	121410	35				g.chr19:6896543C>T	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.229C>T	chr19.hg19:g.6896543C>T	ENSP00000311545:p.Arg77*	0					AC020895.1_ENST00000580648.1_RNA|EMR1_ENST00000601198.1_3'UTR|EMR1_ENST00000381407.5_Nonsense_Mutation_p.R77*|EMR1_ENST00000450315.3_Nonsense_Mutation_p.R77*|EMR1_ENST00000250572.8_Nonsense_Mutation_p.R77*|EMR1_ENST00000381404.4_Nonsense_Mutation_p.R77*	p.R77*	NM_001974.4	NP_001965.3	1	2	3	2.018897	Q14246	EMR1_HUMAN		3	266	+	all_hematologic(4;0.166)		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Nonsense_Mutation	SNP	ENST00000312053.4	0	1	hg19	c.229C>T	CCDS12175.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	13.99	2.401597	0.42613	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	.	.	.	3.91	-4.95	0.03048	3.91	-4.95	0.03048	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	5.419	0.16390	0.5275:0.1535:0.319:0.0	.	.	.	.	X	77	.	ENSP00000250572:R77X	R	+	1	2	2	EMR1	6847543	6847543	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.033000	0.03571	-1.227000	0.02571	-1.146000	0.01853	CGA	0.109792		TCGA-Z5-AAPL-01A-12D-A40W-08	0.488	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1	0	0	0		2	2	2	0		0	0	47		47	46	1	2	-6.731108	1	0.100000				5	4		185	184	0		1	0		0	0	47	0		0.936632	0	0	0	0	1	0	5	185
MCOLN1	57192	broad.mit.edu	37	19	7594053	7594053	+	Missense_Mutation	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr19:7594053G>A	ENST00000264079.6	+	10	1326	c.1201G>A	c.(1201-1203)Gtg>Atg	p.V401M		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	401					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTGGGTGGGCGTGATCCGCTA	0.572																																						ENST00000264079.6	1.000000	0.200000	1.000000	0.320000	0.510000	0.578691	0.510000	0.430000																										0				18						c.(1201-1203)Gtg>Atg		mucolipin 1							108.0	98.0	101.0					19																	7594053		2203	4300	6503	SO:0001583	missense	57192	0	0					g.chr19:7594053G>A	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.1201G>A	chr19.hg19:g.7594053G>A	ENSP00000264079:p.Val401Met	0						p.V401M	NM_020533.2	NP_065394.1	1	2	3	2.018897	Q9GZU1	MCLN1_HUMAN		10	1326	+			D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Missense_Mutation	SNP	ENST00000264079.6	0	1	hg19	c.1201G>A	CCDS12180.1	0	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668544	0.88348	.	.	ENSG00000090674	ENST00000264079;ENST00000394321	T	0.71934	-0.61	5.27	5.27	0.74061	5.27	5.27	0.74061	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	T	0.81460	0.4827	M	0.69248	2.105	0.80722	D	1	D;D	0.69078	0.969;0.997	P;D	0.64237	0.713;0.923	T	0.82374	-0.0489	10	0.52906	T	0.07	.	16.364	0.83307	0.0:0.0:1.0:0.0	.	366;401	Q9GZU1-2;Q9GZU1	.;MCLN1_HUMAN	M	401;366	ENSP00000264079:V401M	ENSP00000264079:V401M	V	+	1	0	0	MCOLN1	7500053	7500053	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.473000	0.97714	2.459000	0.83118	0.561000	0.74099	GTG	0.109792		TCGA-Z5-AAPL-01A-12D-A40W-08	0.572	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458974.2	0	0	1		2	2	2	0		0	0	64		64	63	1	2	-3.021927	1	0.100000	NM_020533			6	6		268	263	1		1	1		0	0	64	0		0.963408	1.982095e-01	0	9	0	23	0	6	268
ERICH3	127254	broad.mit.edu	37	1	75065538	75065538	+	Missense_Mutation	SNP	T	T	C			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr1:75065538T>C	ENST00000326665.5	-	11	1785	c.1567A>G	c.(1567-1569)Atg>Gtg	p.M523V	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Missense_Mutation_p.M326V	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		523	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						ATTCCATTCATTTGAACATCA	0.388																																						ENST00000326665.5	1.000000	0.370000	0.920000	0.480000	0.630000	0.669864	0.630000	0.590000																										0				184						c.(1567-1569)Atg>Gtg									223.0	226.0	225.0					1																	75065538		2203	4300	6503	SO:0001583	missense	0	0	0					g.chr1:75065538T>C																												ENST00000326665.5:c.1567A>G	chr1.hg19:g.75065538T>C	ENSP00000322609:p.Met523Val	0					C1orf173_ENST00000420661.2_Missense_Mutation_p.M326V|RP4-612J11.1_ENST00000416017.1_RNA	p.M523V	NM_001002912.4	NP_001002912.4	1	2	3	2.010900	Q5RHP9	ERIC3_HUMAN		11	1785	-			Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	1	1	hg19	c.1567A>G	CCDS30755.1	0	.	.	.	.	.	.	.	.	.	.	T	0.834	-0.744144	0.03088	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.16897	2.71;2.31	6.05	2.54	0.30619	6.05	2.54	0.30619	.	.	.	.	.	T	0.04634	0.0126	L	0.43152	1.355	0.25581	N	0.986794	B;B	0.28350	0.018;0.208	B;B	0.22152	0.011;0.038	T	0.37407	-0.9707	9	0.27082	T	0.32	-8.5564	8.5652	0.33536	0.0:0.2774:0.0:0.7226	.	326;523	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	V	523;326	ENSP00000322609:M523V;ENSP00000398581:M326V	ENSP00000322609:M523V	M	-	1	0	0	C1orf173	74838126	74838126	1.000000	0.71417	0.973000	0.42090	0.002000	0.02628	1.395000	0.34520	0.531000	0.28639	-0.924000	0.02725	ATG	0.108028		TCGA-Z5-AAPL-01A-12D-A40W-08	0.388	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1	0	0	1		2	2	2	0		0	0	118		118	118	1	2	-15.734380	1	0.100000				18	18		593	589	0		1			0	0	118	0		0.999981	0	0	0	0	0	0	18	593
FAM20B	9917	broad.mit.edu	37	1	179033482	179033482	+	Silent	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr1:179033482G>A	ENST00000263733.4	+	6	1125	c.789G>A	c.(787-789)acG>acA	p.T263T		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	263						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						TGAAGAAAACGTCCCCTTATG	0.502																																						ENST00000263733.4	1.000000	0.240000	0.730000	0.350000	0.480000	0.542722	0.480000	0.440000																										0				14						c.(787-789)acG>acA		family with sequence similarity 20, member B							232.0	188.0	203.0					1																	179033482		2203	4300	6503	SO:0001819	synonymous_variant	9917	1	121412	33				g.chr1:179033482G>A	AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.789G>A	chr1.hg19:g.179033482G>A		0						p.T263T	NM_014864.3	NP_055679.1	1	2	3	2.005483	O75063	XYLK_HUMAN		6	1125	+			Q5W0C3|Q5W0C4	Silent	SNP	ENST00000263733.4	0	1	hg19	c.789G>A	CCDS1328.1	0																																																																																								0.106700		TCGA-Z5-AAPL-01A-12D-A40W-08	0.502	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	0	0	1		2	2	2	0		0	0	99		99	99	1	2	-3.111983	1	0.100000	NM_014864			11	11		481	475	0		1	0		0	0	99	0		0.998252	7.977548e-02	0	0	0	19	0	11	481
DIDO1	11083	broad.mit.edu	37	20	61513415	61513415	+	Missense_Mutation	SNP	G	G	A	rs558826220	byFrequency	TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr20:61513415G>A	ENST00000266070.4	-	16	4218	c.3893C>T	c.(3892-3894)aCg>aTg	p.T1298M	DIDO1_ENST00000395343.1_Missense_Mutation_p.T1298M	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1298					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GGAAGCTGCCGTGGAGGCTGC	0.587													G|||	3	0.000599042	0.0	0.0	5008	,	,		15342	0.0		0.0	False		,,,				2504	0.0031				Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	ENST00000266070.4	1.000000	0.840000	1.000000	0.990000	0.990000	0.988215	0.990000	1.000000																										0				99						c.(3892-3894)aCg>aTg		death inducer-obliterator 1							68.0	75.0	73.0					20																	61513415		2203	4297	6500	SO:0001583	missense	11083	8	121390	42				g.chr20:61513415G>A	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3893C>T	chr20.hg19:g.61513415G>A	ENSP00000266070:p.Thr1298Met	0					DIDO1_ENST00000395343.1_Missense_Mutation_p.T1298M	p.T1298M	NM_033081.2	NP_149072.2	1	2	3	2.029556	Q9BTC0	DIDO1_HUMAN		16	4218	-	Breast(26;5.68e-08)		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	1	1	hg19	c.3893C>T	CCDS33506.1	1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816445	0.50527	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.08984	3.03;3.03	5.1	-5.01	0.02991	5.1	-5.01	0.02991	.	1.157060	0.06652	N	0.762887	T	0.05547	0.0146	L	0.44542	1.39	0.09310	N	1	D	0.55385	0.971	B	0.32805	0.153	T	0.39623	-0.9605	10	0.48119	T	0.1	-4.5123	8.9622	0.35854	0.3154:0.4322:0.2523:0.0	.	1298	Q9BTC0	DIDO1_HUMAN	M	1298	ENSP00000266070:T1298M;ENSP00000378752:T1298M	ENSP00000266070:T1298M	T	-	2	0	0	DIDO1	60983860	60983860	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.961000	0.03845	-0.878000	0.04007	-0.253000	0.11424	ACG	0.111988		TCGA-Z5-AAPL-01A-12D-A40W-08	0.587	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	1	0	1		2	2	2	0		0	0	127		127	115	1	2	-3.017764	1	0.100000	NM_080796			35	31		571	497	0		1	0		0	0	127	0		1.000000	1.983426e-02	0	0	0	4	0	35	571
KRTAP11-1	337880	broad.mit.edu	37	21	32253584	32253584	+	Missense_Mutation	SNP	C	C	T	rs368602449		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr21:32253584C>T	ENST00000332378.4	-	1	290	c.260G>A	c.(259-261)cGa>cAa	p.R87Q		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	87						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R87P(3)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						GGTAGTTTGTCGAGAGCAAGT	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		19865	0.0		0.001	False		,,,				2504	0.0					ENST00000332378.4	1.000000	0.180000	1.000000	0.310000	0.500000	0.568734	0.500000	0.410000																										3	Substitution - Missense(3)	p.R87P(3)	lung(3)	18						c.(259-261)cGa>cAa		keratin associated protein 11-1		C	GLN/ARG	0,4406		0,0,2203	88.0	83.0	85.0		260	3.4	0.1	21		85	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRTAP11-1	NM_175858.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	87/164	32253584	1,13005	2203	4300	6503	SO:0001583	missense	337880	14	121412	42				g.chr21:32253584C>T	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.260G>A	chr21.hg19:g.32253584C>T	ENSP00000330720:p.Arg87Gln	0						p.R87Q	NM_175858.2	NP_787054.1	1	2	3	2.013952	Q8IUC1	KR111_HUMAN		1	290	-			A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	0	1	hg19	c.260G>A	CCDS13608.1	0	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220423	0.58560	0.0	1.16E-4	ENSG00000182591	ENST00000332378	T	0.03272	3.99	5.4	3.44	0.39384	5.4	3.44	0.39384	.	0.155844	0.40222	N	0.001147	T	0.12561	0.0305	M	0.83118	2.625	0.09310	N	1	D	0.63880	0.993	P	0.55260	0.772	T	0.21280	-1.0250	10	0.15952	T	0.53	-4.064	14.4357	0.67279	0.0:0.7222:0.2778:0.0	.	87	Q8IUC1	KR111_HUMAN	Q	87	ENSP00000330720:R87Q	ENSP00000330720:R87Q	R	-	2	0	0	KRTAP11-1	31175455	31175455	0.328000	0.24687	0.105000	0.21289	0.909000	0.53808	1.165000	0.31822	1.398000	0.46701	0.650000	0.86243	CGA	0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.562	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1	0	0	1		2	2	2	0		0	0	35		35	35	1	2	-2.905518	1	0.100000				5	6		228	227	0		1			0	0	35	0		0.938210	0	0	0	0	0	0	5	228
VWA3B	200403	broad.mit.edu	37	2	98736133	98736133	+	Missense_Mutation	SNP	G	G	A	rs200875707		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr2:98736133G>A	ENST00000477737.1	+	4	653	c.449G>A	c.(448-450)gGc>gAc	p.G150D	VWA3B_ENST00000451075.2_Intron|VWA3B_ENST00000435344.1_Missense_Mutation_p.G150D	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	150										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GATTTTGGCGGCATTCTGGAG	0.522																																						ENST00000477737.1	0.310000	0.070000	0.240000	0.110000	0.160000	0.178256	0.160000	0.150000																										0				70						c.(448-450)gGc>gAc		von Willebrand factor A domain containing 3B							192.0	187.0	189.0					2																	98736133		1991	4149	6140	SO:0001583	missense	200403	0	0					g.chr2:98736133G>A	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.449G>A	chr2.hg19:g.98736133G>A	ENSP00000417955:p.Gly150Asp	0					VWA3B_ENST00000451075.2_Intron|VWA3B_ENST00000435344.1_Missense_Mutation_p.G150D	p.G150D	NM_144992.4	NP_659429.4	0	1	1	1.999628	Q502W6	VWA3B_HUMAN		4	653	+			B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	0	1	hg19	c.449G>A	CCDS42718.1	0	.	.	.	.	.	.	.	.	.	.	G	1.464	-0.561569	0.03939	.	.	ENSG00000168658	ENST00000435344;ENST00000477737	T;T	0.35973	1.28;1.28	6.02	-3.25	0.05079	6.02	-3.25	0.05079	.	1.332560	0.04551	N	0.389819	T	0.19967	0.0480	N	0.17474	0.49	0.09310	N	1	B;B	0.13145	0.007;0.001	B;B	0.13407	0.009;0.002	T	0.17501	-1.0367	10	0.32370	T	0.25	.	4.4567	0.11647	0.553:0.1139:0.2439:0.0893	.	150;150	Q502W6;Q502W6-8	VWA3B_HUMAN;.	D	150	ENSP00000401959:G150D;ENSP00000417955:G150D	ENSP00000411168:G150D	G	+	2	0	0	VWA3B	98102565	98102565	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	0.140000	0.16056	-0.462000	0.06984	-0.150000	0.13652	GGC	0.094112		TCGA-Z5-AAPL-01A-12D-A40W-08	0.522	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	0	0	1		2	2	2	0		0	0	158		158	157	1	2	-1.904572	0	0.100000	NM_144992			7	7		873	855	0		1			0	0	158	0		0.979139	0	0	0	0	0	0	7	873
TTLL4	9654	broad.mit.edu	37	2	219614735	219614735	+	Silent	SNP	C	C	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr2:219614735C>A	ENST00000392102.1	+	15	3079	c.2739C>A	c.(2737-2739)ctC>ctA	p.L913L	TTLL4_ENST00000258398.4_Silent_p.L913L|TTLL4_ENST00000457313.1_Silent_p.L748L|TTLL4_ENST00000442769.1_Silent_p.L849L	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	913	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TCTGAAGCCTCCACTCCAGCT	0.468																																					GBM(172;1818 2053 15407 20943 49753)	ENST00000392102.1	0.680000	0.310000	0.590000	0.390000	0.480000	0.492939	0.480000	0.480000																										0				39						c.(2737-2739)ctC>ctA		tubulin tyrosine ligase-like family, member 4							218.0	204.0	209.0					2																	219614735		2203	4300	6503	SO:0001819	synonymous_variant	9654	0	0					g.chr2:219614735C>A		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2739C>A	chr2.hg19:g.219614735C>A		0					TTLL4_ENST00000457313.1_Silent_p.L748L|TTLL4_ENST00000442769.1_Silent_p.L849L|TTLL4_ENST00000258398.4_Silent_p.L913L	p.L913L	NM_014640.4	NP_055455.3	0	1	1	1.999628	Q14679	TTLL4_HUMAN		15	3079	+		Renal(207;0.0915)	A8K6V5|Q8WW29	Silent	SNP	ENST00000392102.1	1	1	hg19	c.2739C>A	CCDS2422.1	0	.	.	.	.	.	.	.	.	.	.	C	7.239	0.600803	0.13939	.	.	ENSG00000135912	ENST00000436668	.	.	.	4.87	1.8	0.24995	4.87	1.8	0.24995	.	.	.	.	.	T	0.54431	0.1858	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46359	-0.9197	4	.	.	.	.	6.8562	0.24042	0.0:0.6245:0.1469:0.2285	.	.	.	.	T	58	.	.	P	+	1	0	0	TTLL4	219322979	219322979	0.989000	0.36119	0.998000	0.56505	0.827000	0.46813	0.307000	0.19296	0.624000	0.30286	0.650000	0.86243	CCA	0.094112		TCGA-Z5-AAPL-01A-12D-A40W-08	0.468	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	0	0	1		2	2	2	0		0	0	270		270	268	1	2	-2.296168	0	0.100000	NM_014640			24	24		972	958	0		1	1		0	0	270	0		1.000000	2.559310e-01	0	5	0	34	0	24	972
PBRM1	55193	broad.mit.edu	37	3	52637535	52637535	+	Splice_Site	SNP	A	A	G			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr3:52637535A>G	ENST00000296302.7	-	17	2781		c.e17+1		PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AAAGAAACCAACCTCTTTTTT	0.318			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	ENST00000296302.7	1.000000	0.390000	1.000000	0.630000	0.960000	0.859649	0.960000	1.000000				Rec	yes			Rec	yes		3	3p21	3p21	55193	Mis, N, F, S, D, O	polybromo 1				E	E			clear cell renal carcinoma, breast		0				335						c.e17+1		polybromo 1							61.0	59.0	60.0					3																	52637535		2202	4299	6501	SO:0001630	splice_region_variant	55193	0	0					g.chr3:52637535A>G	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2779+1T>C	chr3.hg19:g.52637535A>G		0					PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site				0	0	0	1.979503	Q86U86	PB1_HUMAN		17	2781	-			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	0	1	hg19			1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.302447	0.81136	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.43	5.43	0.79202	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3425	0.66636	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	PBRM1	52612575	52612575	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.877000	0.92386	2.174000	0.68829	0.445000	0.29226	.	0.085366		TCGA-Z5-AAPL-01A-12D-A40W-08	0.318	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	0	0	1		2	2	2	0		0	0	25		25	25	1	2	-8.962530	1	0.100000	NM_018165	Intron		5	5		93	91	0		1		1	0	0	25	262		0.935809	0	9.985971e-01	0	7	0	280	5	93
RAPGEF2	9693	broad.mit.edu	37	4	160266337	160266337	+	Missense_Mutation	SNP	A	A	T			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr4:160266337A>T	ENST00000264431.4	+	18	3294	c.2875A>T	c.(2875-2877)Agt>Tgt	p.S959C		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	959					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GGTACGTCGTAGTTCCTTTCT	0.448																																						ENST00000264431.4	1.000000	0.610000	1.000000	0.760000	0.940000	0.899503	0.940000	1.000000																										0				70						c.(2875-2877)Agt>Tgt		Rap guanine nucleotide exchange factor (GEF) 2							178.0	178.0	178.0					4																	160266337		1939	4147	6086	SO:0001583	missense	9693	0	0					g.chr4:160266337A>T	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2875A>T	chr4.hg19:g.160266337A>T	ENSP00000264431:p.Ser959Cys	0						p.S959C	NM_014247.2	NP_055062.1	1	2	3	2.003601	Q9Y4G8	RPGF2_HUMAN		18	3294	+	all_hematologic(180;0.24)		D3DP27	Missense_Mutation	SNP	ENST00000264431.4	1	1	hg19	c.2875A>T	CCDS43277.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.5|26.5	4.747227|4.747227	0.89663|0.89663	.|.	.|.	ENSG00000109756|ENSG00000109756	ENST00000264431|ENST00000502485	T|.	0.43688|.	0.94|.	6.07|6.07	6.07|6.07	0.98685|0.98685	6.07|6.07	6.07|6.07	0.98685|0.98685	Ras guanine nucleotide exchange factor, domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.77896|.	0.4199|.	M|M	0.79693|0.79693	2.465|2.465	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.68765|.	0.96|.	T|.	0.78640|.	-0.2125|.	10|.	0.87932|.	D|.	0|.	.|.	16.6288|16.6288	0.85011|0.85011	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	959|.	Q9Y4G8|.	RPGF2_HUMAN|.	C|L	959|64	ENSP00000264431:S959C|.	ENSP00000264431:S959C|.	S|X	+|+	1|2	0|0	0|0	RAPGEF2|RAPGEF2	160485787|160485787	160485787|160485787	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.339000|9.339000	0.96797|0.96797	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	AGT|TAG	0.106256		TCGA-Z5-AAPL-01A-12D-A40W-08	0.448	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	1	0	1		2	2	2	0		0	0	119		119	117	1	2	-5.056357	1	0.100000	NM_014247			25	25		528	522	0		1	1		0	0	119	0		1.000000	1.724307e-01	0	2	0	14	0	25	528
C4orf50	389197	broad.mit.edu	37	4	5969140	5969140	+	Splice_Site	SNP	C	C	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr4:5969140C>A	ENST00000324058.5	-	5	547		c.e5+1		C4orf50_ENST00000531445.1_Splice_Site			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50											breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						ATCACACTGACCTCTTAAAGC	0.537																																						ENST00000324058.5	1.000000	0.140000	0.590000	0.220000	0.350000	0.426579	0.350000	0.300000																										0				15						c.e5+1		chromosome 4 open reading frame 50							144.0	125.0	132.0					4																	5969140		2203	4300	6503	SO:0001630	splice_region_variant	389197	9	121412	40				g.chr4:5969140C>A	BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971	ENST00000324058.5:c.457+1G>T	chr4.hg19:g.5969140C>A		0					C4orf50_ENST00000531445.1_Splice_Site				1	2	3	2.003601	Q6ZRC1	CD050_HUMAN		5	547	-				Splice_Site	SNP	ENST00000324058.5	0	1	hg19			0	.	.	.	.	.	.	.	.	.	.	C	11.01	1.514360	0.27123	.	.	ENSG00000181215	ENST00000531445;ENST00000324058	.	.	.	2.99	2.99	0.34606	2.99	2.99	0.34606	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7214	0.40306	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	C4orf50	6020041	6020041	0.997000	0.39634	1.000000	0.80357	0.411000	0.31082	1.288000	0.33296	1.992000	0.58205	0.655000	0.94253	.	0.106256		TCGA-Z5-AAPL-01A-12D-A40W-08	0.537	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	74		74	73	1	2	-6.003041	1	0.100000	NM_207405	Intron		6	6		381	376	0		1			0	0	74	0		0.963835	0	0	0	0	0	0	6	381
FAT1	2195	broad.mit.edu	37	4	187521297	187521297	+	Missense_Mutation	SNP	C	C	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr4:187521297C>A	ENST00000441802.2	-	22	12067	c.11858G>T	c.(11857-11859)gGt>gTt	p.G3953V	FAT1_ENST00000512347.1_5'Flank	NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3953	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GATGTGGCCACCAAAAAACAC	0.488										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	ENST00000441802.2	1.000000	0.420000	0.940000	0.560000	0.730000	0.748371	0.730000	1.000000																										0				228						c.(11857-11859)gGt>gTt		FAT atypical cadherin 1							99.0	100.0	99.0					4																	187521297		1971	4147	6118	SO:0001583	missense	2195	0	0					g.chr4:187521297C>A	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11858G>T	chr4.hg19:g.187521297C>A	ENSP00000406229:p.Gly3953Val	0	HNSCC(5;0.00058)				FAT1_ENST00000512347.1_5'Flank	p.G3953V	NM_005245.3	NP_005236.2	0	1	1	1.982565	Q14517	FAT1_HUMAN		22	12067	-				Missense_Mutation	SNP	ENST00000441802.2	1	1	hg19	c.11858G>T	CCDS47177.1	0	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043601	0.93685	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	D	0.96716	-4.1	4.94	4.94	0.65067	4.94	4.94	0.65067	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.98626	0.9540	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98858	1.0761	10	0.52906	T	0.07	.	18.7161	0.91677	0.0:1.0:0.0:0.0	.	3953	Q14517	FAT1_HUMAN	V	3953;3955	ENSP00000406229:G3953V	ENSP00000260147:G3955V	G	-	2	0	0	FAT1	187758291	187758291	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.490000	0.81461	2.726000	0.93360	0.655000	0.94253	GGT	0.087684		TCGA-Z5-AAPL-01A-12D-A40W-08	0.488	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	0	0	1		2	2	2	0		0	0	66		66	66	1	2	-3.745974	1	0.100000	NM_005245			14	14		362	359	1		1	1		0	0	66	0		0.999753	4.899405e-01	0	8	0	34	0	14	362
MEGF10	84466	broad.mit.edu	37	5	126732303	126732303	+	Silent	SNP	C	C	T			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr5:126732303C>T	ENST00000274473.6	+	7	759	c.492C>T	c.(490-492)acC>acT	p.T164T	MEGF10_ENST00000418761.2_Silent_p.T164T|MEGF10_ENST00000508365.1_Silent_p.T164T|MEGF10_ENST00000503335.2_Silent_p.T164T	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	164	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ACCCCATCACCGGGGCTTGCC	0.622																																						ENST00000274473.6	1.000000	0.100000	0.490000	0.170000	0.280000	0.366232	0.280000	0.240000																										0				68						c.(490-492)acC>acT		multiple EGF-like-domains 10							54.0	61.0	59.0					5																	126732303		2202	4299	6501	SO:0001819	synonymous_variant	84466	0	0					g.chr5:126732303C>T	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.492C>T	chr5.hg19:g.126732303C>T		0					MEGF10_ENST00000418761.2_Silent_p.T164T|MEGF10_ENST00000503335.2_Silent_p.T164T|MEGF10_ENST00000508365.1_Silent_p.T164T	p.T164T	NM_032446.2	NP_115822.1	1	2	3	2.003182	Q96KG7	MEG10_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	7	759	+		Prostate(80;0.165)	Q68DE5|Q8WUL3	Silent	SNP	ENST00000274473.6	0	1	hg19	c.492C>T	CCDS4142.1	0																																																																																								0.106256		TCGA-Z5-AAPL-01A-12D-A40W-08	0.622	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	0	0	1		2	2	2	0		0	0	87		87	85	1	2	-2.953216	1	0.100000	NM_032446			5	5		406	395	0		1			0	0	87	0		0.932924	0	0	0	0	0	0	5	406
PCDHGB6	56100	broad.mit.edu	37	5	140788191	140788191	+	Missense_Mutation	SNP	A	A	G			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr5:140788191A>G	ENST00000520790.1	+	1	422	c.422A>G	c.(421-423)gAa>gGa	p.E141G	PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	141	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATACATTTAGAAATTTTCGAA	0.363																																						ENST00000520790.1	1.000000	0.240000	0.840000	0.360000	0.530000	0.586072	0.530000	0.480000																										0				48						c.(421-423)gAa>gGa		protocadherin gamma subfamily B, 6							96.0	96.0	96.0					5																	140788191		1834	4106	5940	SO:0001583	missense	56100	0	0					g.chr5:140788191A>G	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.422A>G	chr5.hg19:g.140788191A>G	ENSP00000428603:p.Glu141Gly	0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron	p.E141G	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	1	2	3	2.003182	Q9Y5F9	PCDGI_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	422	+			Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	0	1	hg19	c.422A>G	CCDS54929.1	0	.	.	.	.	.	.	.	.	.	.	a	17.47	3.397159	0.62177	.	.	ENSG00000253305	ENST00000520790	T	0.54866	0.55	5.16	5.16	0.70880	5.16	5.16	0.70880	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.70544	0.3236	M	0.91406	3.205	0.23773	N	0.996885	P;P	0.45768	0.866;0.837	P;P	0.48770	0.589;0.559	T	0.69105	-0.5233	9	0.87932	D	0	.	14.9944	0.71418	1.0:0.0:0.0:0.0	.	141;141	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	G	141	ENSP00000428603:E141G	ENSP00000428603:E141G	E	+	2	0	0	PCDHGB6	140768375	140768375	0.990000	0.36364	0.666000	0.29783	0.959000	0.62525	3.486000	0.53215	1.943000	0.56356	0.383000	0.25322	GAA	0.106256		TCGA-Z5-AAPL-01A-12D-A40W-08	0.363	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	0	0	1		2	2	2	0		0	0	69		69	69	1	2	-9.175200	1	0.100000	NM_018926			8	8		320	317	0		1	0		0	0	69	0		0.989192	8.239495e-04	0	0	0	2	0	8	320
SH3TC2	79628	broad.mit.edu	37	5	148407193	148407193	+	Missense_Mutation	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr5:148407193G>A	ENST00000515425.1	-	11	2203	c.2102C>T	c.(2101-2103)gCc>gTc	p.A701V	SH3TC2_ENST00000394358.2_Missense_Mutation_p.A586V|SH3TC2_ENST00000512049.1_Missense_Mutation_p.A694V|SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000538184.1_Missense_Mutation_p.A248V	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	701					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATCCCTTGGGCACTCTGGAT	0.522																																						ENST00000515425.1	1.000000	0.190000	0.640000	0.290000	0.410000	0.480060	0.410000	0.380000																										0				39						c.(2101-2103)gCc>gTc		SH3 domain and tetratricopeptide repeats 2							112.0	118.0	116.0					5																	148407193		2203	4300	6503	SO:0001583	missense	79628	0	0					g.chr5:148407193G>A	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.2102C>T	chr5.hg19:g.148407193G>A	ENSP00000423660:p.Ala701Val	0					SH3TC2_ENST00000394358.2_Missense_Mutation_p.A586V|SH3TC2_ENST00000512049.1_Missense_Mutation_p.A694V|SH3TC2_ENST00000538184.1_Missense_Mutation_p.A248V|SH3TC2_ENST00000513340.1_5'Flank	p.A701V	NM_024577.3	NP_078853.2	1	2	3	2.003182	Q8TF17	S3TC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	11	2203	-			B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	0	1	hg19	c.2102C>T	CCDS4293.1	0	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.400817	0.01165	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049;ENST00000394358	T;T;T;T	0.80738	-1.41;-0.99;-0.99;-0.62	6.16	0.91	0.19337	6.16	0.91	0.19337	.	0.676499	0.15440	N	0.262254	T	0.60907	0.2305	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.10296	0.003;0.001;0.0;0.001	B;B;B;B	0.08055	0.003;0.001;0.001;0.001	T	0.43988	-0.9357	10	0.33141	T	0.24	0.0658	2.7471	0.05270	0.3708:0.1077:0.4114:0.1101	.	586;694;701;701	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	V	248;701;694;586	ENSP00000441427:A248V;ENSP00000423660:A701V;ENSP00000421860:A694V;ENSP00000377886:A586V	ENSP00000377886:A586V	A	-	2	0	0	SH3TC2	148387386	148387386	0.000000	0.05858	0.018000	0.16275	0.056000	0.15407	-0.600000	0.05693	-0.109000	0.12044	0.650000	0.86243	GCC	0.106256		TCGA-Z5-AAPL-01A-12D-A40W-08	0.522	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	0	0	1		2	2	2	0		0	0	82		82	81	1	2	-3.118319	1	0.100000	NM_024577			9	9		466	456	0		1	0		0	0	82	0		0.993669	0	0	0	0	1	0	9	466
MAP3K7	6885	broad.mit.edu	37	6	91281458	91281458	+	Missense_Mutation	SNP	T	T	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr6:91281458T>A	ENST00000369329.3	-	2	350	c.189A>T	c.(187-189)aaA>aaT	p.K63N	MAP3K7_ENST00000369332.3_Missense_Mutation_p.K63N|MAP3K7_ENST00000369327.3_Missense_Mutation_p.K63N|MAP3K7_ENST00000369325.3_Missense_Mutation_p.K63N	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	63	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		TTTCTATTTGTTTAATAGCAA	0.343																																						ENST00000369329.3	1.000000	0.160000	0.730000	0.270000	0.430000	0.496058	0.430000	0.360000																										0				28						c.(187-189)aaA>aaT		mitogen-activated protein kinase kinase kinase 7							153.0	139.0	144.0					6																	91281458		2203	4299	6502	SO:0001583	missense	6885	0	0					g.chr6:91281458T>A	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.189A>T	chr6.hg19:g.91281458T>A	ENSP00000358335:p.Lys63Asn	0					MAP3K7_ENST00000369332.3_Missense_Mutation_p.K63N|MAP3K7_ENST00000369327.3_Missense_Mutation_p.K63N|MAP3K7_ENST00000369325.3_Missense_Mutation_p.K63N	p.K63N	NM_145331.2	NP_663304.1	1	2	3	2.000725	O43318	M3K7_HUMAN		2	350	-		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	0	1	hg19	c.189A>T	CCDS5028.1	0	.	.	.	.	.	.	.	.	.	.	T	20.8	4.049793	0.75846	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000450832	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.57	0.54	0.17163	5.57	0.54	0.17163	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.083754	0.85682	D	0.000000	D	0.83718	0.5315	H	0.96833	3.89	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.84563	0.0651	10	0.87932	D	0	.	9.6418	0.39844	0.0:0.3498:0.0:0.6502	.	63;63;63;63	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	N	63	ENSP00000358338:K63N;ENSP00000358335:K63N;ENSP00000358331:K63N;ENSP00000358333:K63N	ENSP00000358331:K63N	K	-	3	2	2	MAP3K7	91338179	91338179	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	0.788000	0.26872	-0.119000	0.11830	0.455000	0.32223	AAA	0.105812		TCGA-Z5-AAPL-01A-12D-A40W-08	0.343	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	0	0	1		2	2	2	0		0	0	42		42	42	1	2	-6.396762	1	0.100000	NM_145331			5	5		260	254	0		1	1		0	0	42	0		0.934301	1.822282e-01	0	2	0	32	0	5	260
IYD	389434	broad.mit.edu	37	6	150719206	150719206	+	Missense_Mutation	SNP	A	A	G			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr6:150719206A>G	ENST00000344419.3	+	5	843	c.703A>G	c.(703-705)Act>Gct	p.T235A	IYD_ENST00000229447.5_Missense_Mutation_p.D272G|IYD_ENST00000392256.2_3'UTR	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	235					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		AGGTCTGGTGACTGTCACTAC	0.547																																						ENST00000344419.3	1.000000	0.210000	0.680000	0.310000	0.440000	0.504319	0.440000	0.400000																										0				15						c.(703-705)Act>Gct		iodotyrosine deiodinase							97.0	93.0	94.0					6																	150719206		2203	4300	6503	SO:0001583	missense	389434	0	0					g.chr6:150719206A>G	AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.703A>G	chr6.hg19:g.150719206A>G	ENSP00000343763:p.Thr235Ala	0					IYD_ENST00000392256.2_3'UTR|IYD_ENST00000229447.5_Missense_Mutation_p.D272G	p.T235A	NM_203395.2	NP_981932.1	1	2	3	2.000725	Q6PHW0	IYD1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.215)	5	843	+		Ovarian(120;0.028)	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Missense_Mutation	SNP	ENST00000344419.3	1	1	hg19	c.703A>G	CCDS5227.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.13|19.13	3.767314|3.767314	0.69878|0.69878	.|.	.|.	ENSG00000009765|ENSG00000009765	ENST00000229447|ENST00000344419	D|T	0.89270|0.76578	-2.49|-1.03	6.06|6.06	6.06|6.06	0.98353|0.98353	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Nitroreductase-like (3);	1.386530|.	0.04568|.	N|.	0.392699|.	T|T	0.74199|0.74199	0.3685|0.3685	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	P|B;B	0.39282|0.32543	0.666|0.375;0.105	B|B;B	0.33339|0.40329	0.162|0.28;0.326	T|T	0.75539|0.75539	-0.3282|-0.3282	10|9	0.12430|0.45353	T|T	0.62|0.12	-7.4588|-7.4588	16.6127|16.6127	0.84892|0.84892	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	272|153;235	C9JFW2|Q2VPV9;Q6PHW0	.|.;IYD1_HUMAN	G|A	272|235	ENSP00000229447:D272G|ENSP00000343763:T235A	ENSP00000229447:D272G|ENSP00000343763:T235A	D|T	+|+	2|1	0|0	0|0	IYD|IYD	150760899|150760899	150760899|150760899	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.980000|0.980000	0.70556|0.70556	9.158000|9.158000	0.94723|0.94723	2.322000|2.322000	0.78497|0.78497	0.528000|0.528000	0.53228|0.53228	GAC|ACT	0.105812		TCGA-Z5-AAPL-01A-12D-A40W-08	0.547	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043754.3	0	0	1		2	2	2	0		0	0	109		109	107	1	2	-8.238377	1	0.100000	NM_203395			9	9		431	424	0		1			0	0	109	0		0.993890	0	0	0	0	0	0	9	431
HBP1	26959	broad.mit.edu	37	7	106826825	106826825	+	Missense_Mutation	SNP	C	C	G			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr7:106826825C>G	ENST00000222574.4	+	5	746	c.560C>G	c.(559-561)tCt>tGt	p.S187C	HBP1_ENST00000485846.1_Missense_Mutation_p.S187C|HBP1_ENST00000468410.1_Missense_Mutation_p.S187C	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	187					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						GAGTCAGAATCTGGCATTTTC	0.353																																						ENST00000222574.4	1.000000	0.180000	0.580000	0.260000	0.370000	0.445952	0.370000	0.340000																										0				10						c.(559-561)tCt>tGt		HMG-box transcription factor 1							176.0	164.0	168.0					7																	106826825		2203	4300	6503	SO:0001583	missense	26959	0	0					g.chr7:106826825C>G	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.560C>G	chr7.hg19:g.106826825C>G	ENSP00000222574:p.Ser187Cys	0					HBP1_ENST00000468410.1_Missense_Mutation_p.S187C|HBP1_ENST00000485846.1_Missense_Mutation_p.S187C	p.S187C	NM_012257.3	NP_036389.2	1	2	3	2.006178	O60381	HBP1_HUMAN		5	746	+			B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	ENST00000222574.4	0	1	hg19	c.560C>G	CCDS5741.1	0	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552901	0.86127	.	.	ENSG00000105856	ENST00000468410;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.99292	-5.7;-5.7;-5.7	5.87	5.87	0.94306	5.87	5.87	0.94306	.	0.045544	0.85682	D	0.000000	D	0.99020	0.9665	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.83275	0.97;0.996;0.991	D	0.99933	1.1335	10	0.87932	D	0	-17.6824	20.206	0.98277	0.0:1.0:0.0:0.0	.	197;187;187	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	C	187;187;187;179	ENSP00000420500:S187C;ENSP00000222574:S187C;ENSP00000418738:S187C	ENSP00000222574:S187C	S	+	2	0	0	HBP1	106614061	106614061	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.785000	0.95823	0.655000	0.94253	TCT	0.107143		TCGA-Z5-AAPL-01A-12D-A40W-08	0.353	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	0	0	1		2	2	2	0		0	0	91		91	91	1	2	-2.934237	1	0.100000	NM_012257			10	10		585	575	0		1	1		0	0	91	0		0.996644	3.265751e-01	0	2	0	62	0	10	585
PRSS55	203074	broad.mit.edu	37	8	10389055	10389055	+	Splice_Site	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr8:10389055G>A	ENST00000328655.3	+	3	638	c.598G>A	c.(598-600)Gct>Act	p.A200T	PRSS55_ENST00000522210.1_Splice_Site_p.A200T|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	200	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						GACCAATGCTGGTATGTGACT	0.597																																						ENST00000328655.3	1.000000	0.130000	0.850000	0.230000	0.400000	0.483996	0.400000	0.320000																										0				31						c.(598-600)Gct>Act		protease, serine, 55							41.0	39.0	39.0					8																	10389055		2203	4299	6502	SO:0001630	splice_region_variant	203074	0	0					g.chr8:10389055G>A	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.598+1G>A	chr8.hg19:g.10389055G>A		0					PRSS55_ENST00000522210.1_Splice_Site_p.A200T|PRSS51_ENST00000523024.1_RNA	p.A200T	NM_198464.3	NP_940866.2	1	2	3	2.012571	Q6UWB4	PRS55_HUMAN		3	638	+			E5RJX5	Splice_Site	SNP	ENST00000328655.3	0	1	hg19	c.598G>A	CCDS5976.1	0	.	.	.	.	.	.	.	.	.	.	G	9.359	1.067468	0.20067	.	.	ENSG00000184647	ENST00000328655;ENST00000522210	D;D	0.92752	-3.1;-3.1	4.98	3.07	0.35406	4.98	3.07	0.35406	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.277430	0.02191	N	0.061344	D	0.84088	0.5395	N	0.11789	0.175	0.30422	N	0.77797	B	0.20671	0.047	B	0.19148	0.024	T	0.74070	-0.3783	10	0.19590	T	0.45	.	5.7986	0.18401	0.2921:0.0:0.7079:0.0	.	200	Q6UWB4	PRS55_HUMAN	T	200	ENSP00000333003:A200T;ENSP00000430459:A200T	ENSP00000333003:A200T	A	+	1	0	0	PRSS55	10426465	10426465	0.954000	0.32549	0.319000	0.25293	0.107000	0.19398	1.531000	0.36018	0.657000	0.30906	0.655000	0.94253	GCT	0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.597	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	0	0	1		2	2	2	0		0	0	48		48	48	1	2	-3.968658	1	0.100000	NM_198464	Missense_Mutation		4	4		240	237	0		1			0	0	48	0		0.888188	0	0	0	0	0	0	4	240
RIMS2	9699	broad.mit.edu	37	8	104898176	104898176	+	Missense_Mutation	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr8:104898176G>A	ENST00000436393.2	+	2	924	c.683G>A	c.(682-684)cGt>cAt	p.R228H	RIMS2_ENST00000406091.3_Missense_Mutation_p.R450H|RIMS2_ENST00000507740.1_Missense_Mutation_p.R258H|RIMS2_ENST00000262231.10_Missense_Mutation_p.R258H			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	481					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACTTGAGGCGTACTGACTCA	0.463										HNSCC(12;0.0054)																												ENST00000436393.2	1.000000	0.190000	0.910000	0.300000	0.480000	0.548108	0.480000	0.410000																										0				144						c.(682-684)cGt>cAt		regulating synaptic membrane exocytosis 2							107.0	97.0	100.0					8																	104898176		1941	4150	6091	SO:0001583	missense	9699	0	0					g.chr8:104898176G>A	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.683G>A	chr8.hg19:g.104898176G>A	ENSP00000390665:p.Arg228His	0	HNSCC(12;0.0054)				RIMS2_ENST00000507740.1_Missense_Mutation_p.R258H|RIMS2_ENST00000406091.3_Missense_Mutation_p.R450H|RIMS2_ENST00000262231.10_Missense_Mutation_p.R258H	p.R228H			1	2	3	2.012571	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)	2	924	+			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	0	1	hg19	c.683G>A		0	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986352	0.74589	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.19250	2.16;2.65;2.22;2.27;2.3;2.23;2.62	5.65	5.65	0.86999	5.65	5.65	0.86999	.	.	.	.	.	T	0.42154	0.1190	L	0.43152	1.355	0.80722	D	1	P;D;D;D;D	0.89917	0.474;0.999;0.999;1.0;1.0	B;D;D;D;D	0.87578	0.087;0.992;0.983;0.995;0.998	T	0.10405	-1.0631	9	0.54805	T	0.06	.	19.7233	0.96151	0.0:0.0:1.0:0.0	.	481;228;258;258;450	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	H	450;481;450;481;258;258;258;258;228	ENSP00000427018:R450H;ENSP00000384892:R450H;ENSP00000425205:R258H;ENSP00000262231:R258H;ENSP00000423559:R258H;ENSP00000386228:R258H;ENSP00000390665:R228H	ENSP00000262231:R258H	R	+	2	0	0	RIMS2	104967352	104967352	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.553000	0.73918	2.653000	0.90120	0.563000	0.77884	CGT	0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	0	0	1		2	2	2	0		0	0	37		37	37	1	2	-3.126101	1	0.100000	NM_001100117			6	6		283	278	0		1			0	0	37	0		0.963485	0	0	0	0	0	0	6	283
KCNQ3	3786	broad.mit.edu	37	8	133141614	133141614	+	Silent	SNP	C	C	T	rs568466967		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr8:133141614C>T	ENST00000388996.4	-	15	2934	c.2514G>A	c.(2512-2514)acG>acA	p.T838T	KCNQ3_ENST00000519445.1_Silent_p.T826T|KCNQ3_ENST00000521134.1_Silent_p.T718T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	838					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TGTCTGTGTCCGTCTCACCCT	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		18584	0.0		0.001	False		,,,				2504	0.0					ENST00000388996.4	1.000000	0.350000	1.000000	0.530000	0.810000	0.783944	0.810000	1.000000																										0				70						c.(2512-2514)acG>acA		potassium voltage-gated channel, KQT-like subfamily, member 3	Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)						84.0	71.0	75.0					8																	133141614		2203	4300	6503	SO:0001819	synonymous_variant	3786	3	121412	38				g.chr8:133141614C>T	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2514G>A	chr8.hg19:g.133141614C>T		0					KCNQ3_ENST00000521134.1_Silent_p.T718T|KCNQ3_ENST00000519445.1_Silent_p.T826T	p.T838T	NM_004519.3	NP_004510.1	1	2	3	2.012571	O43525	KCNQ3_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000311)	15	2934	-	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		A2VCT8|B4DJY4|E7EQ89	Silent	SNP	ENST00000388996.4	0	1	hg19	c.2514G>A	CCDS34943.1	0																																																																																								0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.592	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	0	0	1		2	2	2	0		0	0	31		31	30	1	2	-3.339554	1	0.100000	NM_004519			7	7		188	186	0		1	0		0	0	31	0		0.980476	0	0	0	0	1	0	7	188
PCM1	5108	broad.mit.edu	37	8	17829972	17829972	+	Missense_Mutation	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr8:17829972G>A	ENST00000519253.1	+	23	3970	c.3719G>A	c.(3718-3720)cGc>cAc	p.R1240H	PCM1_ENST00000327578.8_5'Flank|PCM1_ENST00000524226.1_Missense_Mutation_p.R1241H|PCM1_ENST00000325083.8_Missense_Mutation_p.R1240H			Q15154	PCM1_HUMAN	pericentriolar material 1	1240					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AGTAGTAACCGCAAAAATCAA	0.383			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																	ENST00000519253.1	1.000000	0.120000	0.690000	0.210000	0.340000	0.435849	0.340000	0.290000				Dom	yes			Dom	yes		8	8p22-p21.3	8p22-p21.3	5108	T	pericentriolar material 1  (PTC4)				"""E, L"""	E, L	RET, JAK2		papillary thyroid, CML, MPD	PCM1/JAK2(30)	0				48						c.(3718-3720)cGc>cAc		pericentriolar material 1							91.0	86.0	87.0					8																	17829972		1848	4087	5935	SO:0001583	missense	5108	5	120784	38				g.chr8:17829972G>A		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.3719G>A	chr8.hg19:g.17829972G>A	ENSP00000431099:p.Arg1240His	0					PCM1_ENST00000325083.8_Missense_Mutation_p.R1240H|PCM1_ENST00000327578.8_5'Flank|PCM1_ENST00000524226.1_Missense_Mutation_p.R1241H	p.R1240H			1	2	3	2.012571	Q15154	PCM1_HUMAN		23	3970	+			Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	0	1	hg19	c.3719G>A		0	.	.	.	.	.	.	.	.	.	.	G	1.036	-0.680456	0.03353	.	.	ENSG00000078674	ENST00000325083;ENST00000519253;ENST00000524226	T;T;T	0.50277	0.75;0.75;0.75	4.97	3.19	0.36642	4.97	3.19	0.36642	.	0.364612	0.32416	N	0.006134	T	0.15435	0.0372	N	0.00926	-1.1	0.80722	D	1	B;B;B;B	0.13145	0.0;0.007;0.0;0.007	B;B;B;B	0.06405	0.001;0.002;0.001;0.002	T	0.03034	-1.1080	10	0.27082	T	0.32	-1.6817	4.7527	0.13068	0.3013:0.1584:0.5402:0.0	.	102;1240;1241;1240	B4DJ00;E7ETA6;E7EV56;Q15154	.;.;.;PCM1_HUMAN	H	1240;1240;1241	ENSP00000327077:R1240H;ENSP00000431099:R1240H;ENSP00000430521:R1241H	ENSP00000327077:R1240H	R	+	2	0	0	PCM1	17874252	17874252	0.837000	0.29446	1.000000	0.80357	0.087000	0.18053	0.636000	0.24644	0.776000	0.33473	-0.424000	0.05967	CGC	0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.383	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	0	0	1		23	8	2	1		1	1	46		46	46	1	2	-2.351312	0	0.100000	NM_006197			5	5		341	341	0		0	0		1	0	46	0		0.000351	7.366289e-04	0	0	0	82	0	5	341
ERLIN2	11160	broad.mit.edu	37	8	37611540	37611540	+	Silent	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr8:37611540G>A	ENST00000276461.5	+	12	994	c.927G>A	c.(925-927)gcG>gcA	p.A309A	ERLIN2_ENST00000519638.1_Silent_p.A309A	NM_007175.6	NP_009106.1	O94905	ERLN2_HUMAN	ER lipid raft associated 2	309	Interaction with ERLIN1.				cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|lung(5)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGGACTCTGCGGGCAGTGTGA	0.458																																						ENST00000276461.5	1.000000	0.280000	1.000000	0.420000	0.630000	0.665130	0.630000	1.000000																										0				7						c.(925-927)gcG>gcA		ER lipid raft associated 2							109.0	97.0	101.0					8																	37611540		2203	4300	6503	SO:0001819	synonymous_variant	11160	3	121412	38				g.chr8:37611540G>A	AY358108	CCDS6095.1, CCDS34879.1	8p11.2	2012-11-23	2007-01-26	2007-01-26	ENSG00000147475	ENSG00000147475			1356	protein-coding gene	gene with protein product		611605	"""chromosome 8 open reading frame 2"", ""SPFH domain family, member 2"""	C8orf2, SPFH2, Erlin-2		10449903, 15897872, 16835267	Standard	NM_007175		Approved	NET32, SPG18	uc003xke.4	O94905	OTTHUMG00000164005	ENST00000276461.5:c.927G>A	chr8.hg19:g.37611540G>A		0					ERLIN2_ENST00000519638.1_Silent_p.A309A	p.A309A	NM_007175.6	NP_009106.1	1	2	3	2.012571	O94905	ERLN2_HUMAN	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)	12	994	+		Lung NSC(58;0.174)	A0JLQ1|A8K5S9|B4DM38|D3DSW0|Q6NW21|Q86VS6|Q86W49	Silent	SNP	ENST00000276461.5	0	1	hg19	c.927G>A	CCDS6095.1	0																																																																																								0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.458	ERLIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376712.2	0	0	1		2	2	2	0		0	0	71		71	70	1	2	-2.547914	1	0.100000	NM_007175			8	8		278	273	1		1	1		0	0	71	0		0.988865	2.422494e-01	0	6	0	24	0	8	278
LRRCC1	85444	broad.mit.edu	37	8	86027758	86027758	+	Missense_Mutation	SNP	A	A	T			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr8:86027758A>T	ENST00000360375.3	+	6	1018	c.869A>T	c.(868-870)gAt>gTt	p.D290V	LRRCC1_ENST00000414626.2_Missense_Mutation_p.D270V	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	290					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						CATGAAAACGATTTGCAGAAT	0.343																																						ENST00000360375.3	1.000000	0.250000	1.000000	0.430000	0.690000	0.705856	0.690000	1.000000																										0				43						c.(868-870)gAt>gTt		leucine rich repeat and coiled-coil centrosomal protein 1							65.0	61.0	62.0					8																	86027758		1850	4095	5945	SO:0001583	missense	85444	0	0					g.chr8:86027758A>T	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.869A>T	chr8.hg19:g.86027758A>T	ENSP00000353538:p.Asp290Val	0					LRRCC1_ENST00000414626.2_Missense_Mutation_p.D270V	p.D290V	NM_033402.4	NP_208325.3	1	2	3	2.012571	Q9C099	LRCC1_HUMAN		6	1018	+			B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	0	1	hg19	c.869A>T	CCDS43750.1	0	.	.	.	.	.	.	.	.	.	.	A	5.311	0.242664	0.10077	.	.	ENSG00000133739	ENST00000426019;ENST00000360375;ENST00000414626	T;T	0.34275	1.37;1.4	5.57	3.14	0.36123	5.57	3.14	0.36123	.	1.203710	0.06173	N	0.678078	T	0.36580	0.0972	L	0.54323	1.7	0.09310	N	1	P;P;B	0.41188	0.741;0.573;0.011	B;B;B	0.41988	0.372;0.203;0.013	T	0.23868	-1.0176	10	0.49607	T	0.09	-5.7178	4.583	0.12267	0.7396:0.0:0.0908:0.1695	.	270;197;290	Q9C099-2;E9PE41;Q9C099	.;.;LRCC1_HUMAN	V	197;290;270	ENSP00000353538:D290V;ENSP00000394695:D270V	ENSP00000353538:D290V	D	+	2	0	0	LRRCC1	86215010	86215010	0.902000	0.30710	0.049000	0.19019	0.001000	0.01503	2.486000	0.45259	0.373000	0.24621	0.482000	0.46254	GAT	0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.343	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	0	0	1		2	2	2	0		0	0	53		53	53	1	2	-3.720536	1	0.100000	NM_033402			5	5		163	163	0		1	0		0	0	53	0		0.938488	7.039769e-02	0	1	0	11	0	5	163
PARP10	84875	broad.mit.edu	37	8	145059362	145059362	+	Missense_Mutation	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr8:145059362G>A	ENST00000313028.7	-	5	902	c.808C>T	c.(808-810)Cct>Tct	p.P270S	PARP10_ENST00000524918.1_Missense_Mutation_p.P270S|PARP10_ENST00000533665.1_5'UTR|PARP10_ENST00000525773.1_Missense_Mutation_p.P282S	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	270					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTAGCCCTAGGCCCCTGGGTG	0.652																																						ENST00000313028.7	1.000000	0.200000	0.860000	0.310000	0.470000	0.539043	0.470000	0.410000																										0				27						c.(808-810)Cct>Tct		poly (ADP-ribose) polymerase family, member 10							68.0	68.0	68.0					8																	145059362		2203	4300	6503	SO:0001583	missense	84875	0	0					g.chr8:145059362G>A	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.808C>T	chr8.hg19:g.145059362G>A	ENSP00000325618:p.Pro270Ser	0					PARP10_ENST00000524918.1_Missense_Mutation_p.P270S|PARP10_ENST00000533665.1_5'UTR|PARP10_ENST00000525773.1_Missense_Mutation_p.P282S	p.P270S	NM_032789.3	NP_116178.2	1	2	3	2.012571	Q53GL7	PAR10_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)	5	902	-	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	0	1	hg19	c.808C>T	CCDS34960.1	0	.	.	.	.	.	.	.	.	.	.	G	2.898	-0.228166	0.06022	.	.	ENSG00000178685	ENST00000524918;ENST00000313028;ENST00000525773;ENST00000313059	T;T;T;T	0.30182	3.01;3.02;3.0;1.54	3.23	-2.24	0.06909	3.23	-2.24	0.06909	.	0.851711	0.09771	N	0.758047	T	0.12689	0.0308	N	0.08118	0	0.09310	N	1	B;B;B	0.15141	0.006;0.012;0.006	B;B;B	0.11329	0.006;0.006;0.006	T	0.36601	-0.9741	10	0.13470	T	0.59	.	7.6289	0.28228	0.6322:0.0:0.3678:0.0	.	282;270;270	E9PNI7;E9PK67;Q53GL7	.;.;PAR10_HUMAN	S	270;270;282;185	ENSP00000431620:P270S;ENSP00000325618:P270S;ENSP00000434776:P282S;ENSP00000314320:P185S	ENSP00000325618:P270S	P	-	1	0	0	PARP10	145131350	145131350	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.671000	0.01954	-0.729000	0.04875	-0.266000	0.10368	CCT	0.108470		TCGA-Z5-AAPL-01A-12D-A40W-08	0.652	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383866.1	0	0	1		2	2	2	0		0	0	49		49	49	1	2	-7.204113	1	0.100000	NM_032789			7	7		333	322	0		1	1		0	0	49	0		0.978492	7.817497e-01	0	4	0	133	0	7	333
VPS13A	23230	broad.mit.edu	37	9	79996923	79996923	+	Nonsense_Mutation	SNP	C	C	T	rs199807227		TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chr9:79996923C>T	ENST00000360280.3	+	68	9369	c.9109C>T	c.(9109-9111)Cga>Tga	p.R3037*	VPS13A_ENST00000376636.3_Nonsense_Mutation_p.R2998*|VPS13A_ENST00000376634.4_Nonsense_Mutation_p.R3037*|VPS13A_ENST00000357409.5_Nonsense_Mutation_p.R3037*	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	3037					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GGAGAGTCTGCGACCTCCTCG	0.343																																						ENST00000360280.3	0.770000	0.170000	0.590000	0.270000	0.410000	0.436401	0.410000	0.370000																										0				104	GRCh37	CM011922	VPS13A	M		c.(9109-9111)Cga>Tga		vacuolar protein sorting 13 homolog A (S. cerevisiae)		C	stop/ARG,stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	51.0	51.0	51.0		8992,9109,9109,9109	5.3	1.0	9		51	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained,stop-gained,stop-gained,stop-gained	VPS13A	NM_001018037.1,NM_001018038.2,NM_015186.3,NM_033305.2	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	2998/3136,3037/3070,3037/3096,3037/3175	79996923	1,13005	2203	4300	6503	SO:0001587	stop_gained	23230	2	121412	29				g.chr9:79996923C>T	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.9109C>T	chr9.hg19:g.79996923C>T	ENSP00000353422:p.Arg3037*	0					VPS13A_ENST00000376634.4_Nonsense_Mutation_p.R3037*|VPS13A_ENST00000357409.5_Nonsense_Mutation_p.R3037*|VPS13A_ENST00000376636.3_Nonsense_Mutation_p.R2998*	p.R3037*	NM_033305.2	NP_150648.2	0	0	0	1.970466	Q96RL7	VP13A_HUMAN		68	9369	+			Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Nonsense_Mutation	SNP	ENST00000360280.3	0	1	hg19	c.9109C>T	CCDS6655.1	0	.	.	.	.	.	.	.	.	.	.	C	51	17.370726	0.99885	0.0	1.16E-4	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	.	.	.	5.33	5.33	0.75918	5.33	5.33	0.75918	.	0.201597	0.44483	D	0.000456	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5934	0.88004	0.0:1.0:0.0:0.0	.	.	.	.	X	3037;2998;3037;3037	.	.	R	+	1	2	2	VPS13A	79186743	79186743	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.663000	0.61532	2.494000	0.84150	0.585000	0.79938	CGA	0.080695		TCGA-Z5-AAPL-01A-12D-A40W-08	0.343	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	0	0	1		2	2	2	0		0	0	77		77	77	1	2	-2.680136	1	0.100000	NM_015186			6	6		294	291	0		1	0		0	0	77	0		0.964292	4.996645e-02	0	0	0	15	0	6	294
SPIN2B	474343	broad.mit.edu	37	X	57146293	57146293	+	Missense_Mutation	SNP	T	T	G			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chrX:57146293T>G	ENST00000333933.3	-	2	1080	c.770A>C	c.(769-771)aAg>aCg	p.K257T	RP3-323P24.3_ENST00000439622.1_RNA|SPIN2B_ENST00000460948.1_Intron|SPIN2B_ENST00000275988.5_Missense_Mutation_p.K257T|SPIN2B_ENST00000374912.5_Missense_Mutation_p.K257T|SPIN2B_ENST00000374910.3_Missense_Mutation_p.K156T	NM_001006681.1	NP_001006682.1	Q9BPZ2	SPI2B_HUMAN	spindlin family, member 2B	257					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|skin(1)	5						CAGTTAGGACTTTTTCACCAA	0.368																																						ENST00000333933.3	0.820000	0.220000	0.640000	0.320000	0.460000	0.492367	0.460000	0.440000																										0				5						c.(769-771)aAg>aCg		spindlin family, member 2B							34.0	31.0	32.0					X																	57146293		2201	4295	6496	SO:0001583	missense	474343	0	0					g.chrX:57146293T>G	AF356353	CCDS35311.1, CCDS65274.1	Xp11.1	2014-02-12	2006-12-05		ENSG00000186787	ENSG00000186787			33147	protein-coding gene	gene with protein product		300517				12145692	Standard	XM_005262010		Approved	SPIN-2	uc004dva.3	Q9BPZ2	OTTHUMG00000021680	ENST00000333933.3:c.770A>C	chrX.hg19:g.57146293T>G	ENSP00000335008:p.Lys257Thr						SPIN2B_ENST00000460948.1_Intron|SPIN2B_ENST00000374912.5_Missense_Mutation_p.K257T|SPIN2B_ENST00000374910.3_Missense_Mutation_p.K156T|SPIN2B_ENST00000275988.5_Missense_Mutation_p.K257T|RP3-323P24.3_ENST00000439622.1_RNA	p.K257T	NM_001006681.1	NP_001006682.1	0	1	1		Q9BPZ2	SPI2B_HUMAN		2	1080	-			Q7Z2M0	Missense_Mutation	SNP	ENST00000333933.3	0	1	hg19	c.770A>C	CCDS35311.1	0	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.168787	0.00315	.	.	ENSG00000186787	ENST00000275988;ENST00000374912;ENST00000374910;ENST00000333933	T;T;T;T	0.47528	0.89;0.89;0.84;0.89	2.42	1.17	0.20885	2.42	1.17	0.20885	.	0.157221	0.41500	D	0.000871	T	0.12305	0.0299	N	0.00926	-1.1	0.27097	N	0.962701	B	0.02656	0.0	B	0.01281	0.0	T	0.22243	-1.0222	10	0.07813	T	0.8	-1.1526	2.8319	0.05503	0.2596:0.0:0.2624:0.478	.	257	Q9BPZ2	SPI2B_HUMAN	T	257;257;156;257	ENSP00000275988:K257T;ENSP00000364047:K257T;ENSP00000364045:K156T;ENSP00000335008:K257T	ENSP00000275988:K257T	K	-	2	0	0	SPIN2B	57163018	57163018	1.000000	0.71417	0.920000	0.36463	0.473000	0.32948	4.655000	0.61476	0.241000	0.21283	0.143000	0.16000	AAG	0.100000		TCGA-Z5-AAPL-01A-12D-A40W-08	0.368	SPIN2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056912.1	0	0	0		2	2	2	0		0	0	101		101	151	1	2	-3.206887	1	0.100000	NM_001006681			8	3		346	212	0		1	1		0	0	101	0		0.939656	4.077002e-03	0	2	0	2	0	8	346
GPC3	2719	broad.mit.edu	37	X	132730547	132730547	+	Silent	SNP	G	G	A			TCGA-Z5-AAPL-01A-12D-A40W-08	TCGA-Z5-AAPL-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ae17a1a1-399d-49a2-87da-1d577ce08d01	315533eb-4d79-48c5-956f-a9f82b36d5b8	g.chrX:132730547G>A	ENST00000370818.3	-	7	1939	c.1494C>T	c.(1492-1494)tgC>tgT	p.C498C	GPC3_ENST00000543339.1_Silent_p.C444C|GPC3_ENST00000394299.2_Silent_p.C521C	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	498					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CATCATCACCGCAGTCTCCAC	0.463			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																													ENST00000370818.3	0.360000	0.080000	0.280000	0.130000	0.190000	0.210200	0.190000	0.180000			yes	Rec/X		Simpson-Golabi-Behmel syndrome	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	Xq26.1	2719	T, D, Mis, N, F, S	glypican 3				O	O		Wilms tumour			0				36						c.(1492-1494)tgC>tgT		glypican 3							243.0	206.0	218.0					X																	132730547		2203	4300	6503	SO:0001819	synonymous_variant	2719	6	121410	41	Simpson-Golabi-Behmel syndrome	Familial Cancer Database	SGBS	g.chrX:132730547G>A	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.1494C>T	chrX.hg19:g.132730547G>A							GPC3_ENST00000394299.2_Silent_p.C521C|GPC3_ENST00000543339.1_Silent_p.C444C	p.C498C	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	0	1	1		P51654	GPC3_HUMAN		7	1939	-	Acute lymphoblastic leukemia(192;0.000127)		C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	0	1	hg19	c.1494C>T	CCDS14638.1	0	.	.	.	.	.	.	.	.	.	.	G	2.995	-0.207259	0.06180	.	.	ENSG00000147257	ENST00000406757	.	.	.	4.73	-9.46	0.00597	4.73	-9.46	0.00597	.	.	.	.	.	T	0.72803	0.3506	.	.	.	0.48040	D	0.999576	.	.	.	.	.	.	T	0.82566	-0.0393	4	.	.	.	.	22.4363	0.99971	0.2327:0.0:0.7673:0.0	.	.	.	.	V	228	.	.	A	-	2	0	0	GPC3	132558213	132558213	0.000000	0.05858	0.008000	0.14137	0.665000	0.39181	-3.320000	0.00513	-3.839000	0.00100	-1.679000	0.00737	GCG	0.100000		TCGA-Z5-AAPL-01A-12D-A40W-08	0.463	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	0	0	1		2	2	2	0		0	0	129		129	128	1	2	-2.126687	0	0.100000	NM_004484			7	7		743	733	0		1	0		0	0	129	0		0.979603	8.714832e-02	0	0	0	45	0	7	743
