#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
NPIPA5	100288332	broad.mit.edu	37	16	15457701	15457701	+	Missense_Mutation	SNP	G	G	A			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr16:15457701G>A	ENST00000360151.4	-	8	867	c.868C>T	c.(868-870)Ctc>Ttc	p.L290F		NM_001277325.1	NP_001264254.1	E9PKD4	NPIA5_HUMAN	nuclear pore complex interacting protein family, member A5	290	Pro-rich.							p.L290F(2)									AGGGGAGTGAGCAGACACTCG	0.562																																						ENST00000360151.4																			2	Substitution - Missense(2)	p.L290F(2)	kidney(2)								c.(868-870)Ctc>Ttc		nuclear pore complex interacting protein family, member A5																																				SO:0001583	missense	100288332							g.chr16:15457701G>A		CCDS59264.1	16p13.11	2013-06-11			ENSG00000183793	ENSG00000183793			41980	protein-coding gene	gene with protein product							Standard	NM_001277325		Approved			E9PKD4	OTTHUMG00000166305	ENST00000360151.4:c.868C>T	16.37:g.15457701G>A	ENSP00000433597:p.Leu290Phe						p.L290F	NM_001277325.1	NP_001264254.1					8	867	-								Q0P618	Missense_Mutation	SNP	ENST00000360151.4	37	c.868C>T	CCDS59264.1	.	.	.	.	.	.	.	.	.	.	.	4.044	0.005714	0.07866	.	.	ENSG00000183793	ENST00000360151	T	0.56275	0.47	.	.	.	.	.	.	.	.	T	0.52338	0.1728	M	0.62723	1.935	0.09310	N	1	.	.	.	.	.	.	T	0.44742	-0.9308	4	0.36615	T	0.2	.	.	.	.	.	.	.	.	F	290	ENSP00000433597:L290F	ENSP00000433597:L290F	L	-	1	0	RP11-82O18.1	15365202	.	.	.	.	.	.	.	.	.	.	.	.	CTC		0.562	NPIPA5-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389069.1			4	76	0	0	0	1	0	4	76				
CCDC51	79714	broad.mit.edu	37	3	48474343	48474343	+	Silent	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr3:48474343C>T	ENST00000395694.2	-	4	796	c.711G>A	c.(709-711)gcG>gcA	p.A237A	PLXNB1_ENST00000448774.2_5'Flank|CCDC51_ENST00000442740.1_Silent_p.A128A|PLXNB1_ENST00000296440.6_5'Flank|CCDC51_ENST00000447018.1_Silent_p.A128A|CCDC51_ENST00000412398.2_Silent_p.A128A|CCDC51_ENST00000395696.1_Silent_p.A237A	NM_001256964.1	NP_001243893.1	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	237						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				endometrium(4)|kidney(4)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GCCCCTTCTGCGCCTCCAGGA	0.597																																						ENST00000395694.2																			0				endometrium(4)|kidney(4)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						c.(709-711)gcG>gcA		coiled-coil domain containing 51							63.0	68.0	66.0					3																	48474343		1915	4123	6038	SO:0001819	synonymous_variant	79714					integral to membrane		g.chr3:48474343C>T	AK022498	CCDS2766.2, CCDS58830.1	3p21.31	2005-12-30			ENSG00000164051	ENSG00000164051			25714	protein-coding gene	gene with protein product						12477932	Standard	NM_001256964		Approved	FLJ12436	uc003ctc.3	Q96ER9	OTTHUMG00000133534	ENST00000395694.2:c.711G>A	3.37:g.48474343C>T						CCDC51_ENST00000412398.2_Silent_p.A128A|CCDC51_ENST00000395696.1_Silent_p.A237A|CCDC51_ENST00000447018.1_Silent_p.A128A|CCDC51_ENST00000442740.1_Silent_p.A128A	p.A237A	NM_001256964.1	NP_001243893.1	Q96ER9	CCD51_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	4	796	-			237					Q9HA01	Silent	SNP	ENST00000395694.2	37	c.711G>A	CCDS2766.2																																																																																				0.597	CCDC51-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344599.2	NM_024661		4	157	0	0	0	1	0	4	157				
HIVEP2	3097	broad.mit.edu	37	6	143092407	143092407	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr6:143092407G>A	ENST00000367604.1	-	4	4108	c.3469C>T	c.(3469-3471)Cag>Tag	p.Q1157*	HIVEP2_ENST00000012134.2_Nonsense_Mutation_p.Q1157*|HIVEP2_ENST00000367603.2_Nonsense_Mutation_p.Q1157*			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TGCATGATCTGTGGCTGGGCC	0.557																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	ENST00000367603.2																			0				NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100						c.(3469-3471)Cag>Tag		human immunodeficiency virus type I enhancer binding protein 2							78.0	84.0	82.0					6																	143092407		2013	4194	6207	SO:0001587	stop_gained	3097				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:143092407G>A	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3469C>T	6.37:g.143092407G>A	ENSP00000356576:p.Gln1157*					HIVEP2_ENST00000012134.2_Nonsense_Mutation_p.Q1157*|HIVEP2_ENST00000367604.1_Nonsense_Mutation_p.Q1157*	p.Q1157*	NM_006734.3	NP_006725.3	P31629	ZEP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)	5	4211	-			1157					Q02646|Q5THT5|Q9NS05	Nonsense_Mutation	SNP	ENST00000367604.1	37	c.3469C>T	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	G	45	11.955706	0.99621	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	.	.	.	5.67	4.8	0.61643	.	0.672954	0.15592	N	0.254351	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-17.7177	14.0279	0.64597	0.0737:0.0:0.9263:0.0	.	.	.	.	X	1157	.	ENSP00000012134:Q1157X	Q	-	1	0	HIVEP2	143134100	1.000000	0.71417	0.925000	0.36789	0.435000	0.31806	4.355000	0.59424	2.687000	0.91594	0.563000	0.77884	CAG		0.557	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			5	137	0	0	0	1	0	5	137				
PANK1	53354	broad.mit.edu	37	10	91359177	91359177	+	Missense_Mutation	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr10:91359177C>T	ENST00000307534.4	-	3	1297	c.1142G>A	c.(1141-1143)gGc>gAc	p.G381D	PANK1_ENST00000371774.2_Missense_Mutation_p.G183D|PANK1_ENST00000342512.3_Missense_Mutation_p.G156D|PANK1_ENST00000322191.6_Missense_Mutation_p.G156D	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	381					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						TTCTGGCTTGCCGTTGAAGCC	0.428																																						ENST00000307534.4																			0				cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						c.(1141-1143)gGc>gAc		pantothenate kinase 1	Bezafibrate(DB01393)						142.0	132.0	136.0					10																	91359177		2203	4300	6503	SO:0001583	missense	53354				coenzyme A biosynthetic process|pantothenate metabolic process	cytosol|nucleus	ATP binding|pantothenate kinase activity	g.chr10:91359177C>T	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.1142G>A	10.37:g.91359177C>T	ENSP00000302108:p.Gly381Asp					PANK1_ENST00000322191.6_Missense_Mutation_p.G156D|PANK1_ENST00000371774.2_Missense_Mutation_p.G183D|PANK1_ENST00000342512.3_Missense_Mutation_p.G156D	p.G381D	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN			3	1297	-			381					A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	ENST00000307534.4	37	c.1142G>A	CCDS31244.1	.	.	.	.	.	.	.	.	.	.	C	33	5.213226	0.95069	.	.	ENSG00000152782	ENST00000342512;ENST00000322191;ENST00000371774;ENST00000307534;ENST00000371775	D;D;D;D	0.99515	-6.06;-6.06;-6.06;-6.06	5.91	5.91	0.95273	.	0.114181	0.64402	D	0.000011	D	0.99396	0.9787	M	0.65975	2.015	0.80722	D	1	B;D;B;B	0.76494	0.159;0.999;0.391;0.093	B;D;B;B	0.70016	0.088;0.967;0.196;0.061	D	0.99888	1.1127	10	0.30854	T	0.27	.	20.3018	0.98617	0.0:1.0:0.0:0.0	.	183;381;156;156	Q8TE04-4;Q8TE04;Q8TE04-3;Q8TE04-2	.;PANK1_HUMAN;.;.	D	156;156;183;381;244	ENSP00000345118:G156D;ENSP00000318526:G156D;ENSP00000360839:G183D;ENSP00000302108:G381D	ENSP00000302108:G381D	G	-	2	0	PANK1	91349157	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.070000	0.71220	2.799000	0.96334	0.650000	0.86243	GGC		0.428	PANK1-201	KNOWN	basic|CCDS	protein_coding	protein_coding				4	175	0	0	0	1	0	4	175				
CUTC	51076	broad.mit.edu	37	10	101503043	101503043	+	Nonsense_Mutation	SNP	T	T	A			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr10:101503043T>A	ENST00000370476.5	+	4	456	c.327T>A	c.(325-327)taT>taA	p.Y109*	CUTC_ENST00000493385.1_3'UTR	NM_015960.2	NP_057044.2	Q9NTM9	CUTC_HUMAN	cutC copper transporter	109					copper ion homeostasis (GO:0055070)|copper ion transport (GO:0006825)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		CCAAGCTTTATGGTGCTGATG	0.428																																						ENST00000370476.5																			0				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						c.(325-327)taT>taA		cutC copper transporter							243.0	224.0	230.0					10																	101503043		2203	4300	6503	SO:0001587	stop_gained	51076				copper ion homeostasis|copper ion transport|protein tetramerization	cytoplasm|nucleus	copper ion binding	g.chr10:101503043T>A	AF132966	CCDS7483.1	10q24.31	2013-07-31	2013-07-31		ENSG00000119929	ENSG00000119929			24271	protein-coding gene	gene with protein product		610101	"""cutC copper transporter homolog (E. coli)"""			16182249	Standard	NM_015960		Approved	CGI-32	uc001kqd.4	Q9NTM9	OTTHUMG00000018889	ENST00000370476.5:c.327T>A	10.37:g.101503043T>A	ENSP00000359507:p.Tyr109*					CUTC_ENST00000493385.1_3'UTR	p.Y109*	NM_015960.2	NP_057044.2	Q9NTM9	CUTC_HUMAN		Epithelial(162;3e-10)|all cancers(201;2.37e-08)	4	456	+		Colorectal(252;0.234)	109					Q5TCZ8|Q9Y321	Nonsense_Mutation	SNP	ENST00000370476.5	37	c.327T>A	CCDS7483.1	.	.	.	.	.	.	.	.	.	.	T	19.40	3.820790	0.71028	.	.	ENSG00000119929	ENST00000370476;ENST00000370472	.	.	.	6.07	4.94	0.65067	.	0.155685	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-10.8994	9.565	0.39394	0.0:0.1504:0.0:0.8496	.	.	.	.	X	109;46	.	ENSP00000359503:Y46X	Y	+	3	2	CUTC	101493033	0.992000	0.36948	1.000000	0.80357	0.991000	0.79684	0.201000	0.17276	1.126000	0.42016	0.477000	0.44152	TAT		0.428	CUTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049811.1	NM_015960		10	147	0	0	0	1	0	10	147				
CT47B1	643311	broad.mit.edu	37	X	120008936	120008936	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chrX:120008936G>A	ENST00000371311.3	-	1	843	c.589C>T	c.(589-591)Cag>Tag	p.Q197*		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	197										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GCGGCCTCCTGGACCGACGCA	0.706																																						ENST00000371311.3																			0				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						c.(589-591)Cag>Tag		cancer/testis antigen family 47, member B1							27.0	27.0	27.0					X																	120008936		692	1589	2281	SO:0001587	stop_gained	643311							g.chrX:120008936G>A		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.589C>T	X.37:g.120008936G>A	ENSP00000360360:p.Gln197*						p.Q197*	NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN			1	843	-			197					A6NM97	Nonsense_Mutation	SNP	ENST00000371311.3	37	c.589C>T	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.772063	0.69992	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.76	-0.299	0.12808	.	.	.	.	.	.	.	.	.	.	.	0.49798	A	0.99982	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	3.266	0.06865	0.237:0.3792:0.3838:0.0	.	.	.	.	X	197	.	ENSP00000360360:Q197X	Q	-	1	0	CT47B1	119892964	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	0.113000	0.15499	-0.177000	0.10690	0.171000	0.16805	CAG		0.706	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		5	85	0	0	0	1	0	5	85				
NOS1	4842	broad.mit.edu	37	12	117768561	117768561	+	Missense_Mutation	SNP	G	G	A	rs76839820		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr12:117768561G>A	ENST00000338101.4	-	1	318	c.314C>T	c.(313-315)aCg>aTg	p.T105M	NOS1_ENST00000344089.3_Missense_Mutation_p.T105M|NOS1_ENST00000549189.1_5'Flank|NOS1_ENST00000317775.6_Missense_Mutation_p.T105M			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CTCCAGGTGCGTGGTGAAACC	0.612																																					Esophageal Squamous(162;1748 2599 51982 52956)	ENST00000317775.6																			0				NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						c.(313-315)aCg>aTg		nitric oxide synthase 1 (neuronal)	L-Citrulline(DB00155)						39.0	44.0	42.0					12																	117768561		1971	4127	6098	SO:0001583	missense	4842				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr12:117768561G>A		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.314C>T	12.37:g.117768561G>A	ENSP00000337459:p.Thr105Met					NOS1_ENST00000338101.4_Missense_Mutation_p.T105M|NOS1_ENST00000344089.3_Missense_Mutation_p.T105M	p.T105M	NM_000620.4|NM_001204218.1	NP_000611.1|NP_001191147.1	P29475	NOS1_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.0561)	2	999	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		105			Interaction with NOSIP (By similarity).			Missense_Mutation	SNP	ENST00000338101.4	37	c.314C>T	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621920	0.66787	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000344089;ENST00000338101	T;T;T	0.06528	4.91;3.29;4.89	4.91	4.02	0.46733	PDZ/DHR/GLGF (1);	0.047332	0.85682	N	0.000000	T	0.23926	0.0579	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.01283	-1.1396	10	0.87932	D	0	-12.1159	13.2987	0.60313	0.076:0.0:0.924:0.0	.	105	P29475	NOS1_HUMAN	M	105	ENSP00000320758:T105M;ENSP00000339862:T105M;ENSP00000337459:T105M	ENSP00000320758:T105M	T	-	2	0	NOS1	116252944	1.000000	0.71417	0.892000	0.35008	0.572000	0.35998	9.232000	0.95325	1.301000	0.44836	0.555000	0.69702	ACG		0.612	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1			5	100	0	0	0	1	0	5	100				
POLQ	10721	broad.mit.edu	37	3	121208388	121208388	+	Silent	SNP	A	A	G			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr3:121208388A>G	ENST00000264233.5	-	16	3518	c.3390T>C	c.(3388-3390)aaT>aaC	p.N1130N		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1130					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CAAAATTATCATTAGTTAGTG	0.348								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	ENST00000264233.5																			0				NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120						c.(3388-3390)aaT>aaC	DNA polymerases (catalytic subunits)	polymerase (DNA directed), theta							87.0	87.0	87.0					3																	121208388		2203	4300	6503	SO:0001819	synonymous_variant	10721				DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity	g.chr3:121208388A>G	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3390T>C	3.37:g.121208388A>G							p.N1130N	NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN		GBM - Glioblastoma multiforme(114;0.0915)	16	3518	-			1130					O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	37	c.3390T>C	CCDS33833.1																																																																																				0.348	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420		26	67	0	0	0	1	0	26	67				
KCTD10	83892	broad.mit.edu	37	12	109894046	109894046	+	Silent	SNP	G	G	C			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr12:109894046G>C	ENST00000228495.6	-	6	881	c.600C>G	c.(598-600)gtC>gtG	p.V200V	KCTD10_ENST00000540411.1_Silent_p.V174V|KCTD10_ENST00000538161.1_5'UTR|KCTD10_ENST00000540089.1_Silent_p.V19V|KCTD10_ENST00000424763.2_Silent_p.V19V	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN	potassium channel tetramerization domain containing 10	200					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						TTATGAACAGGACCCTTCCGT	0.438																																						ENST00000228495.6																			0				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						c.(598-600)gtC>gtG		potassium channel tetramerization domain containing 10							158.0	143.0	148.0					12																	109894046		2203	4300	6503	SO:0001819	synonymous_variant	83892				proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:109894046G>C	BC040062	CCDS9128.1	12q24.12	2013-06-20	2013-06-20		ENSG00000110906	ENSG00000110906		"""BTB/POZ domain containing"""	23236	protein-coding gene	gene with protein product		613421	"""potassium channel tetramerisation domain containing 10"""			12477932	Standard	XM_005253946		Approved	MSTP028, BTBD28	uc001toi.1	Q9H3F6	OTTHUMG00000169253	ENST00000228495.6:c.600C>G	12.37:g.109894046G>C						KCTD10_ENST00000538161.1_5'UTR|KCTD10_ENST00000540411.1_Silent_p.V174V|KCTD10_ENST00000424763.2_Silent_p.V19V|KCTD10_ENST00000540089.1_Silent_p.V19V	p.V200V	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN			6	881	-			200					Q53HN2|Q59FV1|Q6PL47|Q96SU0	Silent	SNP	ENST00000228495.6	37	c.600C>G	CCDS9128.1	.	.	.	.	.	.	.	.	.	.	G	9.161	1.018801	0.19355	.	.	ENSG00000110906	ENST00000538161	.	.	.	4.65	3.75	0.43078	.	.	.	.	.	T	0.69052	0.3068	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68693	-0.5341	4	.	.	.	-30.2303	13.7571	0.62943	0.0:0.3124:0.6876:0.0	.	.	.	.	C	166	.	.	S	-	2	0	KCTD10	108378429	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	0.680000	0.25306	1.292000	0.44672	0.561000	0.74099	TCC		0.438	KCTD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403099.1	NM_031954		12	86	0	0	0	1	0	12	86				
BMS1P20	96610	broad.mit.edu	37	22	22664141	22664141	+	RNA	SNP	G	G	A	rs369590722		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr22:22664141G>A	ENST00000426066.1	+	0	664					NR_027293.1				BMS1 pseudogene 20																		AAATTTGAAGGTGCTGTGATT	0.448																																						ENST00000426066.1																			0																																																			0							g.chr22:22664141G>A			22q11.22	2013-09-20			ENSG00000236850	ENSG00000236850			49153	pseudogene	pseudogene							Standard	XR_430414		Approved				OTTHUMG00000151046		22.37:g.22664141G>A								NR_027293.1						0	664	+									RNA	SNP	ENST00000426066.1	37																																																																																						0.448	BMS1P20-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000473090.1			5	83	0	0	0	1	0	5	83				
DCAF8L1	139425	broad.mit.edu	37	X	27997690	27997690	+	Missense_Mutation	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chrX:27997690C>T	ENST00000441525.1	-	1	1876	c.1762G>A	c.(1762-1764)Gag>Aag	p.E588K		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	588								p.E588K(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						CCCTCCTCCTCGGATGTATCT	0.502																																						ENST00000441525.1																			1	Substitution - Missense(1)	p.E588K(1)	kidney(1)	NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						c.(1762-1764)Gag>Aag		DDB1 and CUL4 associated factor 8-like 1							111.0	85.0	94.0					X																	27997690		2202	4300	6502	SO:0001583	missense	139425							g.chrX:27997690C>T		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1762G>A	X.37:g.27997690C>T	ENSP00000405222:p.Glu588Lys						p.E588K	NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN			1	1876	-			588					B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	c.1762G>A	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.971566	0.34754	.	.	ENSG00000226372	ENST00000441525	T	0.65364	-0.15	0.842	0.842	0.18927	.	0.374885	0.22253	N	0.062525	T	0.52158	0.1717	M	0.74881	2.28	0.21933	N	0.999461	D	0.54601	0.967	B	0.39027	0.288	T	0.48636	-0.9018	10	0.24483	T	0.36	.	7.2758	0.26283	0.0:0.9999:0.0:1.0E-4	.	588	A6NGE4	DC8L1_HUMAN	K	588	ENSP00000405222:E588K	ENSP00000405222:E588K	E	-	1	0	DCAF8L1	27907611	0.910000	0.30920	0.066000	0.19879	0.075000	0.17131	0.894000	0.28350	0.691000	0.31592	0.284000	0.19432	GAG		0.502	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690		4	48	0	0	0	1	0	4	48				
PRRT3	285368	broad.mit.edu	37	3	9989295	9989295	+	Missense_Mutation	SNP	A	A	G			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr3:9989295A>G	ENST00000412055.1	-	4	1691	c.1562T>C	c.(1561-1563)aTg>aCg	p.M521T	PRRT3-AS1_ENST00000431558.1_RNA	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	521						integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						GTCGGTAAGCATGTAGGCGGA	0.716																																						ENST00000412055.1																			0				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						c.(1561-1563)aTg>aCg		proline-rich transmembrane protein 3							8.0	14.0	12.0					3																	9989295		2089	4175	6264	SO:0001583	missense	285368					integral to membrane		g.chr3:9989295A>G	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.1562T>C	3.37:g.9989295A>G	ENSP00000392511:p.Met521Thr					PRRT3-AS1_ENST00000431558.1_RNA	p.M521T	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN			4	1691	-			521					Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	ENST00000412055.1	37	c.1562T>C	CCDS43049.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.490394	0.64074	.	.	ENSG00000163704	ENST00000412055	T	0.16073	2.37	4.87	4.87	0.63330	.	0.080690	0.50627	D	0.000116	T	0.14657	0.0354	N	0.08118	0	0.80722	D	1	D	0.57899	0.981	P	0.53593	0.73	T	0.16453	-1.0402	9	.	.	.	-25.7365	12.4944	0.55918	1.0:0.0:0.0:0.0	.	521	Q5FWE3	PRRT3_HUMAN	T	521	ENSP00000392511:M521T	.	M	-	2	0	PRRT3	9964295	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	5.850000	0.69473	2.044000	0.60594	0.460000	0.39030	ATG		0.716	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351		5	20	0	0	0	1	0	5	20				
RP11-423O2.5	0	broad.mit.edu	37	1	142803543	142803543	+	lincRNA	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr1:142803543C>T	ENST00000423385.1	-	0	1422																											TGTTGGAATTCCTGATGAATC	0.269																																						ENST00000423385.1																			0																																																			0							g.chr1:142803543C>T																													1.37:g.142803543C>T														0	1422	-									RNA	SNP	ENST00000423385.1	37																																																																																						0.269	RP11-423O2.5-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000193203.1			6	164	0	0	0	1	0	6	164				
OXR1	55074	broad.mit.edu	37	8	107752617	107752617	+	Missense_Mutation	SNP	T	T	G	rs367716578		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr8:107752617T>G	ENST00000442977.2	+	13	2312	c.2213T>G	c.(2212-2214)cTt>cGt	p.L738R	OXR1_ENST00000312046.6_Missense_Mutation_p.L703R|OXR1_ENST00000449762.2_Missense_Mutation_p.L80R|OXR1_ENST00000531443.1_Missense_Mutation_p.L710R|OXR1_ENST00000521592.1_5'UTR|OXR1_ENST00000517566.2_Missense_Mutation_p.L737R|OXR1_ENST00000445937.1_Missense_Mutation_p.L710R|OXR1_ENST00000452423.2_Missense_Mutation_p.L158R|OXR1_ENST00000297447.6_Missense_Mutation_p.L107R	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	738	TLD.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			CCATGGACTCTTGTTTATGGT	0.378																																						ENST00000445937.1																			0				NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31						c.(2128-2130)cTt>cGt		oxidation resistance 1							128.0	118.0	122.0					8																	107752617		2203	4299	6502	SO:0001583	missense	55074				cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion		g.chr8:107752617T>G	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2213T>G	8.37:g.107752617T>G	ENSP00000405424:p.Leu738Arg					OXR1_ENST00000517566.2_Missense_Mutation_p.L737R|OXR1_ENST00000312046.6_Missense_Mutation_p.L703R|OXR1_ENST00000452423.2_Missense_Mutation_p.L158R|OXR1_ENST00000297447.6_Missense_Mutation_p.L107R|OXR1_ENST00000531443.1_Missense_Mutation_p.L710R|OXR1_ENST00000521592.1_5'UTR|OXR1_ENST00000449762.2_Missense_Mutation_p.L80R|OXR1_ENST00000442977.2_Missense_Mutation_p.L738R	p.L710R	NM_018002.3	NP_060472.2	Q8N573	OXR1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)		13	2390	+			738					A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	37	c.2129T>G	CCDS56548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.511467|4.511467	0.85389|0.85389	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000445937;ENST00000531443;ENST00000517566;ENST00000452423;ENST00000442977;ENST00000312046;ENST00000449762;ENST00000297447|ENST00000519415	T;T;T;T;T;T;T;T|T	0.52526|0.54479	0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66|0.57	5.36|5.36	5.36|5.36	0.76844|0.76844	TLDc (2);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.78515|0.78515	0.4295|0.4295	M|M	0.93375|0.93375	3.41|3.41	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;0.999;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;0.998;0.999;0.999|.	D|D	0.84467|0.84467	0.0597|0.0597	10|8	0.72032|0.62326	D|D	0.01|0.03	-14.6952|-14.6952	15.3618|15.3618	0.74483|0.74483	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	703;738;737;80;107;710|.	Q8N573-2;Q8N573;D3HIS6;B7Z8N5;Q8N573-4;Q8N573-5|.	.;OXR1_HUMAN;.;.;.;.|.	R|V	710;710;737;158;738;703;80;107|382	ENSP00000402918:L710R;ENSP00000431966:L710R;ENSP00000429205:L737R;ENSP00000395032:L158R;ENSP00000405424:L738R;ENSP00000311026:L703R;ENSP00000408659:L80R;ENSP00000297447:L107R|ENSP00000430701:L382V	ENSP00000297447:L107R|ENSP00000430701:L382V	L|L	+|+	2|1	0|2	OXR1|OXR1	107821793|107821793	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.040000|8.040000	0.89188|0.89188	2.018000|2.018000	0.59344|0.59344	0.533000|0.533000	0.62120|0.62120	CTT|TTG		0.378	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354		5	98	0	0	0	1	0	5	98				
ZBTB22	9278	broad.mit.edu	37	6	33284252	33284252	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr6:33284252G>A	ENST00000431845.2	-	2	593	c.442C>T	c.(442-444)Cga>Tga	p.R148*	TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000434618.2_5'Flank|ZBTB22_ENST00000418724.1_Nonsense_Mutation_p.R148*|TAPBP_ENST00000489157.1_5'Flank|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000475304.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						CGGCCTTCTCGGAGTAGTTCA	0.592																																						ENST00000431845.2																			0				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						c.(442-444)Cga>Tga		zinc finger and BTB domain containing 22							99.0	97.0	98.0					6																	33284252		2203	4300	6503	SO:0001587	stop_gained	0				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:33284252G>A	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.442C>T	6.37:g.33284252G>A	ENSP00000407545:p.Arg148*					ZBTB22_ENST00000418724.1_Nonsense_Mutation_p.R148*	p.R148*	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN			2	593	-			148					B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Nonsense_Mutation	SNP	ENST00000431845.2	37	c.442C>T	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889567	0.72524	.	.	ENSG00000236104	ENST00000418724;ENST00000431845;ENST00000441117	.	.	.	4.24	4.24	0.50183	.	0.000000	0.31102	N	0.008241	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	9.4211	0.38553	0.0:0.0:0.7879:0.2121	.	.	.	.	X	148	.	ENSP00000404403:R148X	R	-	1	2	ZBTB22	33392230	0.048000	0.20356	0.997000	0.53966	0.996000	0.88848	1.080000	0.30779	2.197000	0.70478	0.551000	0.68910	CGA		0.592	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2			4	190	0	0	0	1	0	4	190				
ITPKB	3707	broad.mit.edu	37	1	226924202	226924202	+	Missense_Mutation	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr1:226924202C>T	ENST00000272117.3	-	1	957	c.958G>A	c.(958-960)Gat>Aat	p.D320N	ITPKB_ENST00000366784.1_Missense_Mutation_p.D320N|ITPKB_ENST00000429204.1_Missense_Mutation_p.D320N			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	320					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				AGGGCAAGATCCTGTGGACGG	0.627																																					Colon(84;110 1851 5306 33547)	ENST00000429204.1																			0				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30						c.(958-960)Gat>Aat		inositol-trisphosphate 3-kinase B							50.0	59.0	56.0					1																	226924202		2203	4300	6503	SO:0001583	missense	3707						ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity	g.chr1:226924202C>T	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.958G>A	1.37:g.226924202C>T	ENSP00000272117:p.Asp320Asn					ITPKB_ENST00000366784.1_Missense_Mutation_p.D320N|ITPKB_ENST00000272117.3_Missense_Mutation_p.D320N	p.D320N	NM_002221.3	NP_002212.3	P27987	IP3KB_HUMAN			2	1285	-		Prostate(94;0.0773)	320					Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	c.958G>A	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.133056	0.56828	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.27256	1.72;1.72;1.68	4.3	2.33	0.28932	.	1.009740	0.07952	N	0.981118	T	0.16685	0.0401	N	0.24115	0.695	0.09310	N	1	P	0.48911	0.917	B	0.41135	0.348	T	0.14117	-1.0484	10	0.25751	T	0.34	-4.3258	6.9337	0.24455	0.0:0.7248:0.1767:0.0985	.	320	P27987	IP3KB_HUMAN	N	320	ENSP00000272117:D320N;ENSP00000411152:D320N;ENSP00000355748:D320N	ENSP00000272117:D320N	D	-	1	0	ITPKB	224990825	0.001000	0.12720	0.001000	0.08648	0.607000	0.37147	1.084000	0.30828	0.513000	0.28278	0.561000	0.74099	GAT		0.627	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221		5	89	0	0	0	1	0	5	89				
OR8K3	219473	broad.mit.edu	37	11	56085932	56085932	+	Missense_Mutation	SNP	G	G	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr11:56085932G>T	ENST00000312711.1	+	1	150	c.150G>T	c.(148-150)aaG>aaT	p.K50N		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TCCTCACCAAGTTGGACTCCA	0.433																																						ENST00000312711.1																			0				central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						c.(148-150)aaG>aaT		olfactory receptor, family 8, subfamily K, member 3							215.0	202.0	206.0					11																	56085932		2201	4296	6497	SO:0001583	missense	219473				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56085932G>T	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.150G>T	11.37:g.56085932G>T	ENSP00000323555:p.Lys50Asn						p.K50N	NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN			1	150	+	Esophageal squamous(21;0.00448)		50					Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	c.150G>T	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	G	1.754	-0.488616	0.04352	.	.	ENSG00000181689	ENST00000312711	T	0.03004	4.08	4.56	1.61	0.23674	GPCR, rhodopsin-like superfamily (1);	0.390052	0.24766	N	0.035763	T	0.02727	0.0082	L	0.33137	0.985	0.09310	N	1	B	0.12630	0.006	B	0.15870	0.014	T	0.45702	-0.9243	10	0.22706	T	0.39	.	4.8843	0.13696	0.1826:0.0:0.648:0.1693	.	50	Q8NH51	OR8K3_HUMAN	N	50	ENSP00000323555:K50N	ENSP00000323555:K50N	K	+	3	2	OR8K3	55842508	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	-1.033000	0.03571	0.249000	0.21456	-0.154000	0.13518	AAG		0.433	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202		36	140	1	0	1.08052e-11	1	1.13197e-11	36	140				
PRB4	5545	broad.mit.edu	37	12	11461642	11461642	+	Missense_Mutation	SNP	G	G	A			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr12:11461642G>A	ENST00000535904.1	-	3	308	c.275C>T	c.(274-276)cCc>cTc	p.P92L	PRB4_ENST00000279575.1_Missense_Mutation_p.P92L|PRB4_ENST00000445719.2_Missense_Mutation_p.P92L			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	113	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.			Missing (in Ref. 7; CAA30542). {ECO:0000305}.		extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						ATGAGGTGGGGGACCTTGGGA	0.612										HNSCC(22;0.051)																												ENST00000279575.1																			0				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						c.(274-276)cCc>cTc		proline-rich protein BstNI subfamily 4							313.0	336.0	328.0					12																	11461642		2203	4300	6503	SO:0001583	missense	5545					extracellular region		g.chr12:11461642G>A		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.275C>T	12.37:g.11461642G>A	ENSP00000442834:p.Pro92Leu	HNSCC(22;0.051)				PRB4_ENST00000535904.1_Missense_Mutation_p.P92L|PRB4_ENST00000445719.2_Missense_Mutation_p.P92L	p.P92L	NM_001261399.1|NM_002723.4	NP_001248328.1|NP_002714.2	P10163	PRB4_HUMAN			3	308	-			92	Missing (in Ref. 7; CAA30542).		9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	c.275C>T	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	5.562	0.288588	0.10513	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.05996	3.36;3.36;3.36	0.805	0.805	0.18703	.	.	.	.	.	T	0.18882	0.0453	M	0.76574	2.34	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.05903	-1.0857	9	0.66056	D	0.02	.	4.9008	0.13773	0.0:0.0:1.0:0.0	.	92	E9PAL0	.	L	92	ENSP00000279575:P92L;ENSP00000442834:P92L;ENSP00000412740:P92L	ENSP00000279575:P92L	P	-	2	0	PRB4	11352909	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	-0.289000	0.08365	0.698000	0.31739	0.205000	0.17691	CCC		0.612	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723		7	662	0	0	0	1	0	7	662				
SLC5A12	159963	broad.mit.edu	37	11	26702711	26702711	+	Missense_Mutation	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr11:26702711C>T	ENST00000396005.3	-	12	1675	c.1366G>A	c.(1366-1368)Gcc>Acc	p.A456T		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	456					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						TAAATGAAGGCCCCAATGGCC	0.468																																						ENST00000396005.3																			0				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						c.(1366-1368)Gcc>Acc		solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12							68.0	66.0	67.0					11																	26702711		1901	4117	6018	SO:0001583	missense	159963				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity	g.chr11:26702711C>T	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1366G>A	11.37:g.26702711C>T	ENSP00000379326:p.Ala456Thr						p.A456T	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN			12	1675	-			456					Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	c.1366G>A	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919264	0.73098	.	.	ENSG00000148942	ENST00000396005	D	0.86030	-2.06	5.52	3.59	0.41128	.	0.685367	0.11593	U	0.548539	D	0.82356	0.5019	L	0.45137	1.4	0.80722	D	1	P	0.42161	0.772	B	0.40825	0.341	T	0.78848	-0.2042	10	0.72032	D	0.01	.	14.0823	0.64932	0.2476:0.7524:0.0:0.0	.	456	Q1EHB4	SC5AC_HUMAN	T	456	ENSP00000379326:A456T	ENSP00000379326:A456T	A	-	1	0	SLC5A12	26659287	0.164000	0.22935	0.975000	0.42487	0.947000	0.59692	2.443000	0.44881	0.639000	0.30564	0.655000	0.94253	GCC		0.468	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498		11	20	0	0	0	1	0	11	20				
MTF1	4520	broad.mit.edu	37	1	38300818	38300818	+	Missense_Mutation	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr1:38300818C>T	ENST00000373036.4	-	6	1063	c.923G>A	c.(922-924)aGt>aAt	p.S308N		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	308					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TTTCATGTGACTTTTGAGACT	0.403																																						ENST00000373036.4																			0				endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31						c.(922-924)aGt>aAt		metal-regulatory transcription factor 1							341.0	289.0	307.0					1																	38300818		2203	4300	6503	SO:0001583	missense	4520					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding	g.chr1:38300818C>T	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.923G>A	1.37:g.38300818C>T	ENSP00000362127:p.Ser308Asn						p.S308N	NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN			6	1063	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	308					B2RAK6|Q96CB1	Missense_Mutation	SNP	ENST00000373036.4	37	c.923G>A	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016813	0.75161	.	.	ENSG00000188786	ENST00000373036;ENST00000543396	T	0.35973	1.28	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	M	0.68952	2.095	0.58432	D	0.999992	B	0.23735	0.09	B	0.21708	0.036	T	0.29458	-1.0011	10	0.41790	T	0.15	.	18.7043	0.91631	0.0:1.0:0.0:0.0	.	308	Q14872	MTF1_HUMAN	N	308;176	ENSP00000362127:S308N	ENSP00000362127:S308N	S	-	2	0	MTF1	38073405	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.665000	0.83852	2.408000	0.81797	0.650000	0.86243	AGT		0.403	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955		37	74	0	0	0	1	0	37	74				
LRRIQ3	127255	broad.mit.edu	37	1	74649343	74649343	+	Missense_Mutation	SNP	T	T	C			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr1:74649343T>C	ENST00000395089.1	-	1	25	c.26A>G	c.(25-27)gAg>gGg	p.E9G	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.E9G|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.E9G|LRRIQ3_ENST00000370909.2_Missense_Mutation_p.E9G			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	9										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						ACTGGTTAGCTCTTCTGTGAC	0.313																																						ENST00000354431.4																			0				NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						c.(25-27)gAg>gGg		leucine-rich repeats and IQ motif containing 3							54.0	57.0	56.0					1																	74649343		2200	4295	6495	SO:0001583	missense	127255							g.chr1:74649343T>C	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.26A>G	1.37:g.74649343T>C	ENSP00000378524:p.Glu9Gly					LRRIQ3_ENST00000395089.1_Missense_Mutation_p.E9G|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.E9G|LRRIQ3_ENST00000370909.2_Missense_Mutation_p.E9G	p.E9G	NM_001105659.1	NP_001099129.1	A6PVS8	LRIQ3_HUMAN			2	217	-			9					A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	c.26A>G	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.236251	0.58886	.	.	ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000370909;ENST00000388972;ENST00000370911	T;T;T;T	0.35973	2.76;2.76;1.28;2.31	5.36	2.94	0.34122	.	0.000000	0.44902	D	0.000403	T	0.09730	0.0239	N	0.24115	0.695	0.09310	N	0.999993	P	0.37015	0.578	B	0.36845	0.234	T	0.08806	-1.0704	10	0.87932	D	0	.	3.8212	0.08836	0.1878:0.0979:0.0:0.7143	.	9	A6PVS8	LRIQ3_HUMAN	G	9	ENSP00000378524:E9G;ENSP00000346414:E9G;ENSP00000359946:E9G;ENSP00000359948:E9G	ENSP00000346414:E9G	E	-	2	0	LRRIQ3	74421931	0.950000	0.32346	0.946000	0.38457	0.873000	0.50193	4.529000	0.60588	2.147000	0.66899	0.533000	0.62120	GAG		0.313	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258		8	20	0	0	0	1	0	8	20				
RRAS2	22800	broad.mit.edu	37	11	14316390	14316390	+	Missense_Mutation	SNP	T	T	A	rs113954997		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr11:14316390T>A	ENST00000256196.4	-	3	528	c.215A>T	c.(214-216)cAa>cTa	p.Q72L	RRAS2_ENST00000414023.2_5'UTR|RRAS2_ENST00000526063.1_5'UTR|RRAS2_ENST00000532814.1_5'UTR|RRAS2_ENST00000529237.1_5'UTR|RRAS2_ENST00000534746.1_5'UTR|RRAS2_ENST00000537760.1_Missense_Mutation_p.Q37L|RRAS2_ENST00000545643.1_Missense_Mutation_p.Q78L			P62070	RRAS2_HUMAN	related RAS viral (r-ras) oncogene homolog 2	72			Q -> L (in an ovarian cancer sample; somatic mutation). {ECO:0000269|PubMed:8052619}.		osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.Q72L(2)		breast(3)|endometrium(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	12				Epithelial(150;0.203)		AAACTCTTCTTGTCCTGCTGT	0.393																																						ENST00000545643.1																			2	Substitution - Missense(2)	p.Q72L(2)	lung(1)|endometrium(1)	breast(3)|endometrium(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	12						c.(232-234)cAa>cTa		related RAS viral (r-ras) oncogene homolog 2							116.0	118.0	117.0					11																	14316390		2200	4294	6494	SO:0001583	missense	22800					endoplasmic reticulum|plasma membrane	GTP binding|GTPase activity|protein binding	g.chr11:14316390T>A	M31468	CCDS7814.1, CCDS44544.1, CCDS53603.1	11p15.2	2014-05-09			ENSG00000133818	ENSG00000133818			17271	protein-coding gene	gene with protein product		600098				2108320, 8052619	Standard	NM_012250		Approved	TC21	uc001mlf.4	P62070	OTTHUMG00000165756	ENST00000256196.4:c.215A>T	11.37:g.14316390T>A	ENSP00000256196:p.Gln72Leu					RRAS2_ENST00000529237.1_5'UTR|RRAS2_ENST00000537760.1_Missense_Mutation_p.Q37L|RRAS2_ENST00000532814.1_5'UTR|RRAS2_ENST00000534746.1_5'UTR|RRAS2_ENST00000414023.2_5'UTR|RRAS2_ENST00000256196.4_Missense_Mutation_p.Q72L|RRAS2_ENST00000526063.1_5'UTR	p.Q78L	NM_012250.5	NP_036382.2	P62070	RRAS2_HUMAN		Epithelial(150;0.203)	3	546	-			72					B2R9Z3|B7Z5Z2|B7Z6C4|B7Z7H6|P17082	Missense_Mutation	SNP	ENST00000256196.4	37	c.233A>T	CCDS7814.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.861739	0.91433	.	.	ENSG00000133818	ENST00000537760;ENST00000545643;ENST00000256196;ENST00000531807	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.57	5.57	0.84162	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93789	0.8014	H	0.97365	3.99	0.80722	D	1	D;P	0.67145	0.996;0.946	D;P	0.63033	0.91;0.473	D	0.95850	0.8874	10	0.87932	D	0	.	15.3905	0.74739	0.0:0.0:0.0:1.0	.	78;72	B7Z5Z2;P62070	.;RRAS2_HUMAN	L	37;78;72;53	ENSP00000437547:Q37L;ENSP00000441722:Q78L;ENSP00000256196:Q72L;ENSP00000435453:Q53L	ENSP00000256196:Q72L	Q	-	2	0	RRAS2	14272966	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.702000	0.84576	2.127000	0.65507	0.402000	0.26972	CAA		0.393	RRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386035.1	NM_012250		11	114	0	0	0	1	0	11	114				
KIAA1045	23349	broad.mit.edu	37	9	34978067	34978067	+	Missense_Mutation	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr9:34978067C>T	ENST00000242315.3	+	8	1244	c.1162C>T	c.(1162-1164)Cgc>Tgc	p.R388C	KIAA1045_ENST00000544237.1_Missense_Mutation_p.R388C|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	388							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCTGGCTGCTCGCCCCAACAG	0.542																																						ENST00000242315.3																			0				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						c.(1162-1164)Cgc>Tgc		KIAA1045							128.0	131.0	130.0					9																	34978067		2059	4182	6241	SO:0001583	missense	23349						calcium ion binding	g.chr9:34978067C>T	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.1162C>T	9.37:g.34978067C>T	ENSP00000242315:p.Arg388Cys					KIAA1045_ENST00000476115.2_3'UTR|KIAA1045_ENST00000544237.1_Missense_Mutation_p.R388C	p.R388C	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00575)		8	1244	+			388					B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	ENST00000242315.3	37	c.1162C>T	CCDS43796.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723933	0.89298	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71041	-0.4707	9	0.87932	D	0	.	16.0591	0.80826	0.0:1.0:0.0:0.0	.	388	Q9UPV7	K1045_HUMAN	C	388	.	ENSP00000242315:R388C	R	+	1	0	KIAA1045	34968067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.426000	0.59882	2.550000	0.86006	0.643000	0.83706	CGC		0.542	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592		33	124	0	0	0	1	0	33	124				
MTF1	4520	broad.mit.edu	37	1	38300817	38300817	+	Missense_Mutation	SNP	A	A	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr1:38300817A>T	ENST00000373036.4	-	6	1064	c.924T>A	c.(922-924)agT>agA	p.S308R		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	308					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTTTCATGTGACTTTTGAGAC	0.403																																						ENST00000373036.4																			0				endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31						c.(922-924)agT>agA		metal-regulatory transcription factor 1							344.0	292.0	310.0					1																	38300817		2203	4300	6503	SO:0001583	missense	4520					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding	g.chr1:38300817A>T	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.924T>A	1.37:g.38300817A>T	ENSP00000362127:p.Ser308Arg						p.S308R	NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN			6	1064	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	308					B2RAK6|Q96CB1	Missense_Mutation	SNP	ENST00000373036.4	37	c.924T>A	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.733119	0.48939	.	.	ENSG00000188786	ENST00000373036;ENST00000543396	T	0.35789	1.29	5.18	1.66	0.24008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.31949	0.0813	M	0.68952	2.095	0.43211	D	0.995079	B	0.29805	0.257	B	0.27500	0.08	T	0.07252	-1.0782	10	0.36615	T	0.2	.	8.4384	0.32801	0.6968:0.0:0.3032:0.0	.	308	Q14872	MTF1_HUMAN	R	308;176	ENSP00000362127:S308R	ENSP00000362127:S308R	S	-	3	2	MTF1	38073404	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.100000	0.31025	0.316000	0.23135	0.528000	0.53228	AGT		0.403	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955		36	73	0	0	0	1	0	36	73				
BARHL2	343472	broad.mit.edu	37	1	91182528	91182528	+	Silent	SNP	C	C	A	rs141603891	byFrequency	TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr1:91182528C>A	ENST00000370445.4	-	1	266	c.225G>T	c.(223-225)ccG>ccT	p.P75P		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	75					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		CTACCAGATGCGGCTCCGGGG	0.632													C|||	2	0.000399361	0.0	0.0	5008	,	,		10893	0.001		0.0	False		,,,				2504	0.001				GBM(199;3561 4100 22440)	ENST00000370445.4																			0				cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						c.(223-225)ccG>ccT		BarH-like homeobox 2		C		1,4405	2.1+/-5.4	0,1,2202	33.0	39.0	37.0		225	3.9	1.0	1	dbSNP_134	37	0,8600		0,0,4300	no	coding-synonymous	BARHL2	NM_020063.1		0,1,6502	AA,AC,CC		0.0,0.0227,0.0077		75/388	91182528	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	343472					nucleus	sequence-specific DNA binding	g.chr1:91182528C>A	AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.225G>T	1.37:g.91182528C>A							p.P75P	NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)	1	266	-		all_lung(203;0.0263)|Lung SC(238;0.128)	75					A0AVP2|Q7Z4N7	Silent	SNP	ENST00000370445.4	37	c.225G>T	CCDS730.1																																																																																				0.632	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027728.2			27	77	1	0	1.66031e-10	1	1.69892e-10	27	77				
LCE1F	353137	broad.mit.edu	37	1	152748983	152748983	+	Missense_Mutation	SNP	G	G	A	rs553837591		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr1:152748983G>A	ENST00000334371.2	+	1	136	c.136G>A	c.(136-138)Gtc>Atc	p.V46I		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	46					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTGCAGCGTCAGCTCCGG	0.672													.|||	1	0.000199681	0.0	0.0	5008	,	,		14707	0.0		0.0	False		,,,				2504	0.001					ENST00000334371.2																			0				kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						c.(136-138)Gtc>Atc		late cornified envelope 1F							49.0	51.0	50.0					1																	152748983		2203	4300	6503	SO:0001583	missense	353137				keratinization			g.chr1:152748983G>A		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.136G>A	1.37:g.152748983G>A	ENSP00000334187:p.Val46Ile						p.V46I	NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		1	136	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		46						Missense_Mutation	SNP	ENST00000334371.2	37	c.136G>A	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	G	8.718	0.913642	0.17907	.	.	ENSG00000240386	ENST00000334371	T	0.03635	3.86	3.53	-0.519	0.11939	.	0.270105	0.19747	N	0.106982	T	0.00580	0.0019	N	0.08118	0	0.09310	N	1	B	0.31054	0.306	B	0.19666	0.026	T	0.48281	-0.9049	10	0.87932	D	0	.	5.5437	0.17051	0.0:0.2858:0.3433:0.3709	.	46	Q5T754	LCE1F_HUMAN	I	46	ENSP00000334187:V46I	ENSP00000334187:V46I	V	+	1	0	LCE1F	151015607	0.000000	0.05858	0.045000	0.18777	0.973000	0.67179	-1.297000	0.02759	-0.067000	0.12976	0.557000	0.71058	GTC		0.672	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354		6	123	0	0	0	1	0	6	123				
AGAP10	728127	broad.mit.edu	37	10	47207813	47207813	+	Splice_Site	SNP	T	T	C	rs202014361	byFrequency	TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr10:47207813T>C	ENST00000452145.2	-	4	506	c.395A>G	c.(394-396)cAt>cGt	p.H132R	AGAP10_ENST00000355232.3_Splice_Site_p.H157R|AGAP10_ENST00000413193.2_Splice_Site_p.H228R|RP11-144G6.12_ENST00000605970.1_RNA			Q5T2P9	AGA10_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 10	132					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.H228R(20)		endometrium(5)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	12						TTTACTTACATGGTTTGTACA	0.294																																						ENST00000355232.3																			20	Substitution - Missense(20)	p.H228R(20)	endometrium(10)|prostate(4)|kidney(4)|urinary_tract(2)	endometrium(5)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	12						c.e5+1		ArfGAP with GTPase domain, ankyrin repeat and PH domain 10																																				SO:0001630	splice_region_variant	728127							g.chr10:47207813T>C	BC075841		10q11.22	2013-01-11	2008-09-22	2008-09-22	ENSG00000204172	ENSG00000204172		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23462	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 7"""	CTGLF7			Standard	XM_006709937		Approved	bA144G6.2		Q5T2P9	OTTHUMG00000018115	ENST00000452145.2:c.396+1A>G	10.37:g.47207813T>C						AGAP10_ENST00000413193.2_Splice_Site_p.H228_splice|AGAP10_ENST00000452145.2_Splice_Site_p.H132_splice|RP11-144G6.12_ENST00000605970.1_RNA	p.H157_splice							5	3482	-									Splice_Site	SNP	ENST00000452145.2	37	c.471_splice		.	.	.	.	.	.	.	.	.	.	t	0.012	-1.675265	0.00751	.	.	ENSG00000204172	ENST00000452145;ENST00000413193;ENST00000355232	D;T;D	0.87966	-2.32;2.68;-2.32	1.4	1.4	0.22301	.	0.264128	0.34555	N	0.003879	T	0.72486	0.3466	.	.	.	0.20764	N	0.999856	B	0.22003	0.063	B	0.19666	0.026	T	0.55471	-0.8136	9	0.16896	T	0.51	.	6.9024	0.24291	0.0:0.0:0.0:1.0	.	132	Q5T2P9	AGA10_HUMAN	R	132;228;157	ENSP00000392206:H132R;ENSP00000407436:H228R;ENSP00000347372:H157R	ENSP00000347372:H157R	H	-	2	0	AGAP10	46627819	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	3.704000	0.54815	0.898000	0.36418	0.163000	0.16589	CAT		0.294	AGAP10-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000047845.2	XM_001714786.2	Missense_Mutation	5	14	0	0	0	1	0	5	14				
RRN3P2	653390	broad.mit.edu	37	16	29110458	29110458	+	RNA	SNP	T	T	C	rs561841139		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr16:29110458T>C	ENST00000564580.1	+	0	1131							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2									p.W375R(25)									GAATTTTGAGTGGATAGTGAT	0.328																																						ENST00000564580.1																			25	Substitution - Missense(25)	p.W375R(25)	endometrium(19)|kidney(4)|prostate(2)																																																0							g.chr16:29110458T>C			16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29110458T>C														0	1131	+									RNA	SNP	ENST00000564580.1	37			.	.	.	.	.	.	.	.	.	.	N	5.632	0.301362	0.10678	.	.	ENSG00000103472	ENST00000427965	.	.	.	1.93	1.93	0.25924	.	0.000000	0.64402	N	0.000001	T	0.11239	0.0274	.	.	.	.	.	.	.	.	.	.	.	.	T	0.29701	-1.0003	5	0.02654	T	1	.	2.7527	0.05285	0.2724:0.5536:0.0:0.174	.	.	.	.	R	375	.	ENSP00000398611:W375R	W	+	1	0	AC009093.1	29017959	1.000000	0.71417	0.564000	0.28396	0.423000	0.31445	3.439000	0.52878	0.163000	0.19507	-1.160000	0.01791	TGG		0.328	RRN3P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000433243.1	NR_003369		5	26	0	0	0	1	0	5	26				
CTC1	80169	broad.mit.edu	37	17	8141481	8141481	+	Missense_Mutation	SNP	T	T	C			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr17:8141481T>C	ENST00000315684.8	-	4	522	c.515A>G	c.(514-516)aAt>aGt	p.N172S	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	172					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						CCCTGAGGAATTCCACCTGGC	0.557																																						ENST00000315684.8																			0				NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						c.(514-516)aAt>aGt		CTS telomere maintenance complex component 1							70.0	77.0	75.0					17																	8141481		1957	4159	6116	SO:0001583	missense	80169				positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding	g.chr17:8141481T>C	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.515A>G	17.37:g.8141481T>C	ENSP00000313759:p.Asn172Ser					CTC1_ENST00000581671.1_5'UTR	p.N172S	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN			4	522	-			172					B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	37	c.515A>G	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.525262	0.27299	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.82893	-1.66;-1.66	5.51	1.74	0.24563	.	0.610508	0.17394	N	0.175836	T	0.65954	0.2741	N	0.13043	0.29	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.52682	-0.8543	10	0.32370	T	0.25	-1.3407	7.0049	0.24830	0.0:0.3265:0.0:0.6735	.	172	Q2NKJ3	CTC1_HUMAN	S	172	ENSP00000313759:N172S;ENSP00000396018:N172S	ENSP00000313759:N172S	N	-	2	0	CTC1	8082206	0.000000	0.05858	0.445000	0.26908	0.193000	0.23685	0.313000	0.19415	0.421000	0.25980	0.459000	0.35465	AAT		0.557	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099		22	75	0	0	0	1	0	22	75				
DFNB31	25861	broad.mit.edu	37	9	117168901	117168901	+	Missense_Mutation	SNP	G	G	C			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr9:117168901G>C	ENST00000362057.3	-	9	2138	c.1970C>G	c.(1969-1971)gCc>gGc	p.A657G	DFNB31_ENST00000374059.3_Missense_Mutation_p.A306G|DFNB31_ENST00000265134.6_Missense_Mutation_p.A274G	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	657	Pro-rich.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTGGGGTTGGCAGGGGAGAC	0.682																																						ENST00000362057.3																			0				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						c.(1969-1971)gCc>gGc		deafness, autosomal recessive 31							52.0	59.0	57.0					9																	117168901		2203	4299	6502	SO:0001583	missense	25861				inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium		g.chr9:117168901G>C	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1970C>G	9.37:g.117168901G>C	ENSP00000354623:p.Ala657Gly					DFNB31_ENST00000374059.3_Missense_Mutation_p.A306G|DFNB31_ENST00000265134.6_Missense_Mutation_p.A274G	p.A657G	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219.3	Q9P202	WHRN_HUMAN			9	2138	-			657			Pro-rich.		A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	c.1970C>G	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299398	0.23650	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.09163	3.93;3.91;3.01	4.93	2.11	0.27256	.	0.317372	0.29093	N	0.013167	T	0.10508	0.0257	M	0.67953	2.075	0.19575	N	0.999962	B;B;B	0.32526	0.203;0.258;0.374	B;B;B	0.26969	0.05;0.075;0.068	T	0.18745	-1.0327	10	0.36615	T	0.2	-18.2912	7.2966	0.26397	0.1459:0.0:0.7164:0.1377	.	657;657;306	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	G	274;306;657	ENSP00000265134:A274G;ENSP00000363172:A306G;ENSP00000354623:A657G	ENSP00000265134:A274G	A	-	2	0	DFNB31	116208722	1.000000	0.71417	0.960000	0.40013	0.307000	0.27823	5.199000	0.65152	0.157000	0.19338	-0.325000	0.08501	GCC		0.682	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404		6	151	0	0	0	1	0	6	151				
PCDHA1	56147	broad.mit.edu	37	5	140167326	140167326	+	Missense_Mutation	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr5:140167326C>T	ENST00000504120.2	+	1	1451	c.1451C>T	c.(1450-1452)gCg>gTg	p.A484V	PCDHA1_ENST00000394633.3_Missense_Mutation_p.A484V|PCDHA1_ENST00000378133.3_Missense_Mutation_p.A484V	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	484	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCGGACGCGCAGGAGAAC	0.662																																						ENST00000504120.2																			0				breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70						c.(1450-1452)gCg>gTg									66.0	71.0	69.0					5																	140167326		2203	4299	6502	SO:0001583	missense	0							g.chr5:140167326C>T	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1451C>T	5.37:g.140167326C>T	ENSP00000420840:p.Ala484Val					PCDHA1_ENST00000394633.3_Missense_Mutation_p.A484V|PCDHA1_ENST00000378133.3_Missense_Mutation_p.A484V	p.A484V	NM_018900.2	NP_061723.1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1451	+								O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	c.1451C>T	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	c	6.504	0.461164	0.12342	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.01871	4.59;4.59;4.59	3.69	3.69	0.42338	Cadherin (4);Cadherin-like (1);	0.000000	0.41097	U	0.000943	T	0.01870	0.0059	N	0.16862	0.45	0.22996	N	0.998455	B;B;B	0.29188	0.236;0.084;0.198	B;B;B	0.25614	0.053;0.007;0.062	T	0.48681	-0.9014	10	0.45353	T	0.12	.	12.3471	0.55126	0.0:0.7694:0.2306:0.0	.	484;484;484	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	V	484	ENSP00000420840:A484V;ENSP00000378129:A484V;ENSP00000367373:A484V	ENSP00000367373:A484V	A	+	2	0	PCDHA1	140147510	0.000000	0.05858	1.000000	0.80357	0.308000	0.27856	-0.123000	0.10611	1.805000	0.52779	0.549000	0.68633	GCG		0.662	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		6	172	0	0	0	1	0	6	172				
RGPD8	727851	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	G	C	rs370761877		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr2:113127775G>C	ENST00000302558.3	-	23	5469	c.5278C>G	c.(5278-5280)Cct>Gct	p.P1760A	RGPD8_ENST00000409750.1_Missense_Mutation_p.P1620A	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1760				P -> A (in Ref. 3; CAI56757). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)	p.P1760A(12)		endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						GAACGGGAAGGATTTTCTTCC	0.308																																						ENST00000302558.3																			12	Substitution - Missense(12)	p.P1760A(12)	prostate(6)|urinary_tract(2)|endometrium(2)|kidney(2)	endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						c.(5278-5280)Cct>Gct		RANBP2-like and GRIP domain containing 8							235.0	168.0	189.0					2																	113127775		686	1558	2244	SO:0001583	missense	727851							g.chr2:113127775G>C	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.5278C>G	2.37:g.113127775G>C	ENSP00000306637:p.Pro1760Ala					RGPD8_ENST00000409750.1_Missense_Mutation_p.P1620A	p.P1760A	NM_001164463.1	NP_001157935.1					23	5469	-								Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	c.5278C>G	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.892319	0.00522	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.36520	1.25;1.25	0.719	0.719	0.18208	.	.	.	.	.	T	0.11239	0.0274	N	0.02011	-0.69	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.18650	-1.0330	9	0.10902	T	0.67	-6.3628	6.3935	0.21599	0.0:0.6881:0.3119:0.0	.	1760	O14715	RGPD8_HUMAN	A	1760;1620	ENSP00000306637:P1760A;ENSP00000386511:P1620A	ENSP00000306637:P1760A	P	-	1	0	RGPD8	112844246	0.746000	0.28272	0.842000	0.33263	0.015000	0.08874	0.243000	0.18106	-0.105000	0.12132	-1.123000	0.02005	CCT		0.308	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279		4	66	0	0	0	1	0	4	66				
PAN3	255967	broad.mit.edu	37	13	28794430	28794430	+	Silent	SNP	C	C	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr13:28794430C>T	ENST00000380958.3	+	6	1067	c.915C>T	c.(913-915)aaC>aaT	p.N305N	PAN3_ENST00000399613.1_Silent_p.N105N	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GGCTGAGTAACGTGTCCCAGT	0.423																																						ENST00000399613.1																			0				endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						c.(313-315)aaC>aaT		PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)							200.0	192.0	195.0					13																	28794430		2203	4300	6503	SO:0001819	synonymous_variant	255967				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity	g.chr13:28794430C>T	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.915C>T	13.37:g.28794430C>T						PAN3_ENST00000380958.3_Silent_p.N305N	p.N105N			Q58A45	PAN3_HUMAN	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)	5	378	+	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	305			Interaction with polyadenylate-binding protein.			Silent	SNP	ENST00000380958.3	37	c.315C>T	CCDS9329.2																																																																																				0.423	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854		49	176	0	0	0	1	0	49	176				
GPC3	2719	broad.mit.edu	37	X	132887602	132887602	+	Missense_Mutation	SNP	G	G	C			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chrX:132887602G>C	ENST00000370818.3	-	3	1384	c.939C>G	c.(937-939)atC>atG	p.I313M	GPC3_ENST00000543339.1_Missense_Mutation_p.I259M|GPC3_ENST00000394299.2_Missense_Mutation_p.I313M	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	313					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CCATGTCATAGATTCTGTACA	0.443			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																													ENST00000370818.3			yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	"""T, D, Mis, N, F, S"""	glypican 3			O		Wilms tumour			0				breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36						c.(937-939)atC>atG		glypican 3							560.0	360.0	427.0					X																	132887602		2203	4300	6503	SO:0001583	missense	2719	Simpson-Golabi-Behmel syndrome	Familial Cancer Database	SGBS		extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity	g.chrX:132887602G>C	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.939C>G	X.37:g.132887602G>C	ENSP00000359854:p.Ile313Met					GPC3_ENST00000394299.2_Missense_Mutation_p.I313M|GPC3_ENST00000543339.1_Missense_Mutation_p.I259M	p.I313M	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN			3	1384	-	Acute lymphoblastic leukemia(192;0.000127)		313					C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	c.939C>G	CCDS14638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.265|5.265	0.234298|0.234298	0.09969|0.09969	.|.	.|.	ENSG00000147257|ENSG00000147257	ENST00000370818;ENST00000394299;ENST00000543339|ENST00000406757	T;T;T|.	0.49720|.	0.77;0.77;0.77|.	5.7|5.7	2.77|2.77	0.32553|0.32553	.|.	0.240320|.	0.43747|.	D|.	0.000531|.	T|T	0.24890|0.24890	0.0604|0.0604	N|N	0.24115|0.24115	0.695|0.695	0.27223|0.27223	N|N	0.959615|0.959615	B;B;B;B|.	0.23128|.	0.08;0.065;0.002;0.08|.	B;B;B;B|.	0.29663|.	0.105;0.064;0.01;0.105|.	T|T	0.17501|0.17501	-1.0367|-1.0367	10|5	0.40728|.	T|.	0.16|.	.|.	7.0642|7.0642	0.25143|0.25143	0.1562:0.0:0.7052:0.1386|0.1562:0.0:0.7052:0.1386	.|.	297;259;313;313|.	B4DTD8;G3V1R0;C9JLE3;P51654|.	.;.;.;GPC3_HUMAN|.	M|C	313;313;259|43	ENSP00000359854:I313M;ENSP00000377836:I313M;ENSP00000444222:I259M|.	ENSP00000359854:I313M|.	I|S	-|-	3|2	3|0	GPC3|GPC3	132715268|132715268	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	0.683000|0.683000	0.25349|0.25349	1.172000|1.172000	0.42781|0.42781	0.594000|0.594000	0.82650|0.82650	ATC|TCT		0.443	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484		4	97	0	0	0	1	0	4	97				
AQP7	364	broad.mit.edu	37	9	33385585	33385585	+	Missense_Mutation	SNP	C	C	A	rs373454335		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr9:33385585C>A	ENST00000541274.1	-	5	859	c.410G>T	c.(409-411)gGg>gTg	p.G137V	AQP7_ENST00000539936.1_3'UTR|AQP7_ENST00000537089.1_3'UTR|AQP7_ENST00000377425.4_Intron			O14520	AQP7_HUMAN	aquaporin 7	0					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CACCCCCCACCCCTCAACACA	0.602																																						ENST00000541274.1																			0				NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17						c.(409-411)gGg>gTg		aquaporin 7																																				SO:0001583	missense	364				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity	g.chr9:33385585C>A	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000541274.1:c.410G>T	9.37:g.33385585C>A	ENSP00000438860:p.Gly137Val					AQP7_ENST00000377425.4_Intron|AQP7_ENST00000539936.1_3'UTR|AQP7_ENST00000537089.1_3'UTR	p.G137V			O14520	AQP7_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)	5	859	-			0					Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000541274.1	37	c.410G>T		.	.	.	.	.	.	.	.	.	.	c	6.340	0.430890	0.12045	.	.	ENSG00000165269	ENST00000541274	T	0.58940	0.3	4.16	-1.14	0.09741	.	.	.	.	.	T	0.40145	0.1105	.	.	.	0.09310	N	1	B	0.34372	0.451	B	0.31686	0.134	T	0.32929	-0.9888	8	0.87932	D	0	.	3.9387	0.09316	0.0:0.3773:0.1846:0.4381	.	137	B7Z7F6	.	V	137	ENSP00000438860:G137V	ENSP00000438860:G137V	G	-	2	0	AQP7	33375585	0.004000	0.15560	0.024000	0.17045	0.041000	0.13682	0.014000	0.13333	-0.108000	0.12066	-0.270000	0.10280	GGG		0.602	AQP7-204	KNOWN	basic	protein_coding	protein_coding		NM_001170		4	82	1	0	0.00024832	1	0.00024832	4	82				
BAI3	577	broad.mit.edu	37	6	69653743	69653743	+	Missense_Mutation	SNP	G	G	T			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr6:69653743G>T	ENST00000370598.1	+	6	1873	c.1052G>T	c.(1051-1053)tGg>tTg	p.W351L		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	351	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGGGAGGAATGGTCACCATGG	0.403																																						ENST00000370598.1																			0				NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210						c.(1051-1053)tGg>tTg		brain-specific angiogenesis inhibitor 3							232.0	188.0	203.0					6																	69653743		2203	4300	6503	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69653743G>T	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1052G>T	6.37:g.69653743G>T	ENSP00000359630:p.Trp351Leu						p.W351L	NM_001704.2	NP_001695.1	O60242	BAI3_HUMAN			6	1873	+		all_lung(197;0.212)	351			TSP type-1 2.		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.1052G>T	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113095	0.94339	.	.	ENSG00000135298	ENST00000370598	T	0.63417	-0.04	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.73241	0.3562	H	0.98646	4.29	0.80722	D	1	P	0.36199	0.543	B	0.34991	0.193	T	0.83037	-0.0159	10	0.87932	D	0	.	18.8322	0.92144	0.0:0.0:1.0:0.0	.	351	O60242	BAI3_HUMAN	L	351	ENSP00000359630:W351L	ENSP00000359630:W351L	W	+	2	0	BAI3	69710464	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.673000	0.90976	0.650000	0.86243	TGG		0.403	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			37	94	1	0	1.67305e-13	1	1.79547e-13	37	94				
ZSCAN10	84891	broad.mit.edu	37	16	3140420	3140420	+	Missense_Mutation	SNP	G	G	A			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr16:3140420G>A	ENST00000252463.2	-	5	937	c.850C>T	c.(850-852)Ccc>Tcc	p.P284S	ZSCAN10_ENST00000575108.1_5'UTR|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.P202S	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	284					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						TTGGGCTCGGGGACGCCCTCA	0.662																																						ENST00000252463.2																			0				breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						c.(850-852)Ccc>Tcc		zinc finger and SCAN domain containing 10							68.0	71.0	70.0					16																	3140420		2181	4273	6454	SO:0001583	missense	84891				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:3140420G>A	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.850C>T	16.37:g.3140420G>A	ENSP00000252463:p.Pro284Ser					ZSCAN10_ENST00000575108.1_5'UTR|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.P202S	p.P284S	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN			5	937	-			284					B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	ENST00000252463.2	37	c.850C>T	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	G	9.003	0.980565	0.18812	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T	0.05786	3.39	4.42	-4.89	0.03103	.	1.415250	0.04617	N	0.401312	T	0.02970	0.0088	N	0.08118	0	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.44528	-0.9322	10	0.23302	T	0.38	-1.2691	5.5691	0.17187	0.3555:0.4048:0.2397:0.0	.	217;284	Q1WWM2;Q96SZ4	.;ZSC10_HUMAN	S	217;284	ENSP00000252463:P284S	ENSP00000252463:P284S	P	-	1	0	ZSCAN10	3080421	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-1.407000	0.02488	-1.091000	0.03065	0.462000	0.41574	CCC		0.662	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805		6	237	0	0	0	1	0	6	237				
SDHAP1	255812	broad.mit.edu	37	3	195711343	195711344	+	RNA	INS	-	-	T	rs200252504	byFrequency	TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr3:195711343_195711344insT	ENST00000427841.1	-	0	585					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		AAAGACTTCTCTGTGAGCTTTG	0.381													|||unknown(ALL_OTHER_Ns)	3992	0.797125	0.888	0.8112	5008	,	,		14038	0.8571		0.6809	False		,,,				2504	0.7219				Ovarian(67;1158 1227 12109 20189 43170)	ENST00000427841.1																			0																																																			0							g.chr3:195711343_195711344insT	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195711344_195711344dupT								NR_003264.2						0	585	-									RNA	INS	ENST00000427841.1	37																																																																																						0.381	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1			3	6						3	6	---	---	---	---
ZMIZ1	57178	broad.mit.edu	37	10	81072446	81072446	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr10:81072446delC	ENST00000334512.5	+	25	3716	c.3144delC	c.(3142-3144)gacfs	p.D1048fs	ZMIZ1_ENST00000446377.2_Frame_Shift_Del_p.D114fs	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	1048					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CTTATCTGGACCCCCCCGACC	0.557																																						ENST00000334512.5																			0				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30						c.(3142-3144)gafs		zinc finger, MIZ-type containing 1							193.0	181.0	185.0					10																	81072446		2203	4300	6503	SO:0001589	frameshift_variant	57178				transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding	g.chr10:81072446delC	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.3144delC	10.37:g.81072446delC	ENSP00000334474:p.Asp1048fs					ZMIZ1_ENST00000446377.2_Frame_Shift_Del_p.D114fs	p.D1048fs	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)		25	3716	+	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		1048					Q5JSH9|Q7Z7E6	Frame_Shift_Del	DEL	ENST00000334512.5	37	c.3144delC	CCDS7357.1																																																																																				0.557	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2	NM_020338		7	389						7	389	---	---	---	---
LOC101927708	101927708	broad.mit.edu	37	11	3552650	3552651	+	RNA	INS	-	-	G	rs34642454		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr11:3552650_3552651insG	ENST00000527970.1	-	0	285				RP13-726E6.1_ENST00000534291.1_lincRNA																							CAGCACCCCATGGGGGGGCCCT	0.5																																						ENST00000527970.1																			0																																																			0							g.chr11:3552650_3552651insG																													11.37:g.3552657_3552657dupG														0	285	-									RNA	INS	ENST00000527970.1	37																																																																																						0.500	RP13-726E6.2-002	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000392273.1			5	9						5	9	---	---	---	---
OR5M10	390167	broad.mit.edu	37	11	56344440	56344440	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr11:56344440delC	ENST00000526812.2	-	1	823	c.758delG	c.(757-759)ggafs	p.G253fs		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						GAAGAGGGTTCCATAAAACAA	0.438																																						ENST00000526812.2																			0				central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						c.(757-759)gafs		olfactory receptor, family 5, subfamily M, member 10							102.0	99.0	100.0					11																	56344440		1802	4048	5850	SO:0001589	frameshift_variant	390167				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56344440delC	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.758delG	11.37:g.56344440delC	ENSP00000436004:p.Gly253fs						p.G253fs	NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN			1	823	-			253					B9EIL9	Frame_Shift_Del	DEL	ENST00000526812.2	37	c.758delG	CCDS53630.1																																																																																				0.438	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741		48	184						48	184	---	---	---	---
HERC2P9	440248	broad.mit.edu	37	15	28913367	28913367	+	RNA	DEL	T	T	-			TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chr15:28913367delT	ENST00000528584.1	+	0	1224					NR_036443.1				hect domain and RLD 2 pseudogene 9																		TGAGTTCTCCTTTTTTTTTTT	0.308																																						ENST00000528584.1																			0																																																			0							g.chr15:28913367delT	BC047911		15q13.1	2011-05-24			ENSG00000206149	ENSG00000206149			30495	pseudogene	pseudogene							Standard	NR_036443		Approved	FLJ59185	uc010azc.3		OTTHUMG00000167114		15.37:g.28913367delT								NR_036443.1						0	1224	+									RNA	DEL	ENST00000528584.1	37																																																																																						0.308	HERC2P9-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000393268.1	NR_036443		3	4						3	4	---	---	---	---
KDM6A	7403	broad.mit.edu	37	X	44923045	44923048	+	Frame_Shift_Del	DEL	CTAT	CTAT	-	rs398122969		TCGA-EJ-A65G-01A-21D-A29Q-08	TCGA-EJ-A65G-10A-01D-A29Q-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bdb0244b-1099-46e0-857e-35d6ae983c53	23c04493-58ff-4af4-a2df-9dbdd52d4e48	g.chrX:44923045_44923048delCTAT	ENST00000377967.4	+	16	1947_1950	c.1906_1909delCTAT	c.(1906-1911)ctatctfs	p.LS636fs	KDM6A_ENST00000543216.1_Frame_Shift_Del_p.LS557fs|KDM6A_ENST00000382899.4_Frame_Shift_Del_p.LS643fs|KDM6A_ENST00000536777.1_Frame_Shift_Del_p.LS591fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	636	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.0(2)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						GAAAAACCAACTATCTAACTCCAC	0.446			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	ENST00000377967.4				Rec	yes		X	Xp11.2	7403	"""D, N, F, S"""	"""lysine (K)-specific demethylase 6A, UTX"""			"""E, L"""			"""renal, oesophageal SCC, MM"""		8	Whole gene deletion(6)|No detectable mRNA/protein(2)	p.0?(6)|p.0(2)	haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|breast(2)|pancreas(2)	NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						c.(1906-1911)ctfs		lysine (K)-specific demethylase 6A																																				SO:0001589	frameshift_variant	7403				histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chrX:44923045_44923048delCTAT	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.1906_1909delCTAT	X.37:g.44923045_44923048delCTAT	ENSP00000367203:p.Leu636fs					KDM6A_ENST00000382899.4_Frame_Shift_Del_p.LS643fs|KDM6A_ENST00000536777.1_Frame_Shift_Del_p.LS591fs|KDM6A_ENST00000543216.1_Frame_Shift_Del_p.LS557fs	p.LS636fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN			16	1947_1950	+			636					Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	37	c.1906_1909delCTAT	CCDS14265.1																																																																																				0.446	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140		6	4						6	4	---	---	---	---
