#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SYNE2	23224	genome.wustl.edu	37	14	64445579	64445579	+	Silent	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr14:64445579C>T	ENST00000344113.4	+	14	1628	c.1416C>T	c.(1414-1416)aaC>aaT	p.N472N	SYNE2_ENST00000554584.1_Silent_p.N472N|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Silent_p.N472N	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	472					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAATCAACAACATTTTGGAGA	0.289													ENSG00000054654																																					0													53.0	49.0	50.0					14																	64445579		1789	4059	5848	SO:0001819	synonymous_variant	0			-	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.1416C>T	14.37:g.64445579C>T			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.N472	ENST00000344113.4	37	c.1416	CCDS41963.1	14																																																																																			-	SYNE2	-	NULL		0.289	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	0	0	0	69	69	41	0.00	0.00	C	NM_182914		64445579	+1	28	30	65	60	tier1	no_errors	ENST00000358025	ensembl	human	known	74_37	silent	30.11	33.33	SNP	0.989	T	28	65
LHX1	3975	genome.wustl.edu	37	17	35300104	35300104	+	Silent	SNP	C	C	T	rs546566090		TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr17:35300104C>T	ENST00000254457.5	+	5	2308	c.897C>T	c.(895-897)ggC>ggT	p.G299G	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	299					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				TCCCGCAAGGCCCCCCGTCCT	0.726													ENSG00000132130																																					0													16.0	17.0	16.0					17																	35300104		2200	4296	6496	SO:0001819	synonymous_variant	0			-	U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.897C>T	17.37:g.35300104C>T			Q3MIW0	Silent	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.G299	ENST00000254457.5	37	c.897	CCDS11316.1	17																																																																																			-	LHX1	-	NULL		0.726	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LHX1	HGNC	protein_coding	OTTHUMT00000256704.3	0	0	0	16	16	24	0.00	0.00	C	NM_005568		35300104	+1	7	6	28	27	tier1	no_errors	ENST00000254457	ensembl	human	known	74_37	silent	20.00	17.65	SNP	1.000	T	7	28
REN	5972	genome.wustl.edu	37	1	204125025	204125025	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr1:204125025C>G	ENST00000272190.8	-	9	1010	c.982G>C	c.(982-984)Ggc>Cgc	p.G328R	REN_ENST00000367195.2_Missense_Mutation_p.G325R	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	328					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	AGTGTAGGGCCCTCGTTACAC	0.577													ENSG00000143839																																					0													52.0	51.0	51.0					1																	204125025		2203	4300	6503	SO:0001583	missense	0			-	BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.982G>C	1.37:g.204125025C>G	ENSP00000272190:p.Gly328Arg		Q6FI38|Q6T5C2	Missense_Mutation	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.G328R	ENST00000272190.8	37	c.982	CCDS30981.1	1	.	.	.	.	.	.	.	.	.	.	C	9.220	1.033225	0.19590	.	.	ENSG00000143839	ENST00000367195;ENST00000545733;ENST00000272190	T;T	0.57107	0.42;0.42	4.24	2.31	0.28768	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.402708	0.26773	N	0.022580	T	0.17916	0.0430	N	0.00661	-1.28	0.09310	N	0.999995	P	0.36171	0.541	B	0.29716	0.106	T	0.19582	-1.0301	10	0.87932	D	0	.	8.9237	0.35628	0.0:0.742:0.0:0.258	.	328	P00797	RENI_HUMAN	R	325;247;328	ENSP00000356163:G325R;ENSP00000272190:G328R	ENSP00000272190:G328R	G	-	1	0	REN	202391648	0.974000	0.33945	0.540000	0.28089	0.020000	0.10135	3.294000	0.51787	0.764000	0.33197	0.467000	0.42956	GGC	-	REN	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom		0.577	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REN	HGNC	protein_coding	OTTHUMT00000087891.1	0	0	0	55	55	28	0.00	0.00	C	NM_000537		204125025	-1	32	42	41	30	tier1	no_errors	ENST00000272190	ensembl	human	known	74_37	missense	43.84	56.76	SNP	0.228	G	32	41
HAVCR1	26762	genome.wustl.edu	37	5	156482487	156482487	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr5:156482487G>T	ENST00000339252.3	-	2	636	c.104C>A	c.(103-105)cCc>cAc	p.P35H	HAVCR1_ENST00000522693.1_Missense_Mutation_p.P35H|HAVCR1_ENST00000544197.1_Missense_Mutation_p.P35H|HAVCR1_ENST00000425854.1_Missense_Mutation_p.P35H|HAVCR1_ENST00000523175.1_Missense_Mutation_p.P35H	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTAGTGGCAGGGTAGTGTGAC	0.473													ENSG00000113249																																					0													64.0	64.0	64.0					5																	156482487		1965	4155	6120	SO:0001583	missense	0			-	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.104C>A	5.37:g.156482487G>T	ENSP00000344844:p.Pro35His		O43656	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.P35H	ENST00000339252.3	37	c.104	CCDS43392.1	5	.	.	.	.	.	.	.	.	.	.	G	14.29	2.489915	0.44249	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.44	4.57	0.56435	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.220169	0.37483	N	0.002070	D	0.84977	0.5592	M	0.92880	3.355	0.38153	D	0.938817	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.89563	0.3808	10	0.87932	D	0	-18.1586	13.1496	0.59482	0.0784:0.0:0.9216:0.0	.	35;35	F1CME6;Q96D42	.;HAVR1_HUMAN	H	35	ENSP00000428524:P35H;ENSP00000427898:P35H;ENSP00000344844:P35H;ENSP00000403333:P35H;ENSP00000440258:P35H;ENSP00000428422:P35H	ENSP00000344844:P35H	P	-	2	0	HAVCR1	156415065	1.000000	0.71417	0.018000	0.16275	0.007000	0.05969	3.345000	0.52182	1.298000	0.44778	0.650000	0.86243	CCC	-	HAVCR1	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.473	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HAVCR1	HGNC	protein_coding	OTTHUMT00000373698.1	0	0	0	35	35	41	0.00	0.00	G			156482487	-1	16	9	65	69	tier1	no_errors	ENST00000425854	ensembl	human	known	74_37	missense	19.75	11.54	SNP	0.958	T	16	65
MEF2B	100271849	genome.wustl.edu	37	19	19260125	19260125	+	Silent	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:19260125C>T	ENST00000602424.2	-	5	894	c.168G>A	c.(166-168)caG>caA	p.Q56Q	MEF2B_ENST00000424583.2_Silent_p.Q56Q|MEF2B_ENST00000410050.1_Silent_p.Q56Q|MEF2B_ENST00000409224.1_Silent_p.Q56Q|MEF2BNB-MEF2B_ENST00000602276.1_5'UTR|MEF2B_ENST00000409447.2_Silent_p.Q56Q|MEF2B_ENST00000162023.5_Silent_p.Q56Q|MEF2BNB-MEF2B_ENST00000514819.3_Silent_p.Q73Q|MEF2BNB-MEF2B_ENST00000444486.3_Silent_p.Q56Q	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	56	MADS-box. {ECO:0000255|PROSITE- ProRule:PRU00251}.				muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			TGCTGGCATACTGGAAGAGGC	0.577													ENSG00000213999																																					0													137.0	88.0	104.0					19																	19260125		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.168G>A	19.37:g.19260125C>T			A0AV80|B4DVH7|B7ZVY1|G5E9M1	Silent	SNP	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.Q56	ENST00000602424.2	37	c.168	CCDS12394.1	19																																																																																			-	MEF2B	-	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox		0.577	MEF2B-202	KNOWN	basic|CCDS	protein_coding	MEF2B	HGNC	protein_coding		0	0	0	60	60	23	0.00	0.00	C	NM_005919		19260125	-1	16	8	91	54	tier1	no_errors	ENST00000162023	ensembl	human	known	74_37	silent	14.95	12.90	SNP	1.000	T	16	91
PKLR	5313	genome.wustl.edu	37	1	155263113	155263113	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr1:155263113C>T	ENST00000342741.4	-	9	1329	c.1291G>A	c.(1291-1293)Gca>Aca	p.A431T	PKLR_ENST00000392414.3_Missense_Mutation_p.A400T	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	431			A -> T (in PKRD). {ECO:0000269|PubMed:9827908}.		ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TGGTACACTGCGGCCTCTGCC	0.602													ENSG00000143627																																					0			GRCh37	CM981573	PKLR	M							63.0	57.0	59.0					1																	155263113		2203	4300	6503	SO:0001583	missense	0			-	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.1291G>A	1.37:g.155263113C>T	ENSP00000339933:p.Ala431Thr		O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.A431T	ENST00000342741.4	37	c.1291	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.894173	0.91889	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99418	-5.87;-5.87	4.54	4.54	0.55810	Pyruvate/Phosphoenolpyruvate kinase (1);Pyruvate kinase, barrel (1);Pyruvate kinase, alpha/beta (1);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	L	0.55834	1.745	0.80722	D	1	D;P	0.54601	0.967;0.91	P;P	0.54815	0.532;0.761	D	0.98635	1.0673	10	0.48119	T	0.1	-14.7614	15.1641	0.72807	0.0:1.0:0.0:0.0	.	431;422	P30613;B1AVT1	KPYR_HUMAN;.	T	456;400;431;345	ENSP00000376214:A400T;ENSP00000339933:A431T	ENSP00000271946:A345T	A	-	1	0	PKLR	153529737	1.000000	0.71417	0.665000	0.29768	0.985000	0.73830	7.551000	0.82182	2.530000	0.85305	0.561000	0.74099	GCA	-	PKLR	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,tigrfam_Pyr_Knase		0.602	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	0	0	0	65	65	24	0.00	0.00	C	NM_000298		155263113	-1	11	21	114	84	tier1	no_errors	ENST00000342741	ensembl	human	known	74_37	missense	8.80	20.00	SNP	0.998	T	11	114
ZNF852	285346	genome.wustl.edu	37	3	44541497	44541497	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr3:44541497G>A	ENST00000436261.1	-	4	932	c.772C>T	c.(772-774)Ctc>Ttc	p.L258F	ZNF852_ENST00000489411.1_5'UTR			Q6ZMS4	ZN852_HUMAN	zinc finger protein 852	258						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|lung(5)	8						TGGTCGAAGAGTTTGGAGCTC	0.443													ENSG00000178917																																					0																																										SO:0001583	missense	0			-	BC014381		3p21.32	2013-01-08			ENSG00000178917	ENSG00000178917		"""Zinc fingers, C2H2-type"", ""-"""	27713	protein-coding gene	gene with protein product							Standard	NM_001287349		Approved		uc011azx.2	Q6ZMS4	OTTHUMG00000156453	ENST00000436261.1:c.772C>T	3.37:g.44541497G>A	ENSP00000389841:p.Leu258Phe		B4DLD7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L258F	ENST00000436261.1	37	c.772		3	.	.	.	.	.	.	.	.	.	.	g	5.465	0.270880	0.10349	.	.	ENSG00000178917	ENST00000436261;ENST00000313378	T	0.15603	2.41	3.44	2.56	0.30785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32793	0.0841	.	.	.	0.09310	N	1	D	0.71674	0.998	D	0.68621	0.959	T	0.05550	-1.0878	8	0.51188	T	0.08	.	6.7591	0.23530	0.1056:0.1786:0.7158:0.0	.	224	Q6ZMS4	ZN852_HUMAN	F	258	ENSP00000389841:L258F	ENSP00000322569:L258F	L	-	1	0	ZNF852	44516501	1.000000	0.71417	0.020000	0.16555	0.002000	0.02628	3.135000	0.50546	0.742000	0.32697	-0.336000	0.08194	CTC	-	ZNF852	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZNF852-001	KNOWN	basic|appris_principal	protein_coding	ZNF852	HGNC	protein_coding	OTTHUMT00000344244.1	0	0	0	55	55	15	0.00	0.00	G	XM_001717402		44541497	-1	22	8	49	39	tier1	no_errors	ENST00000436261	ensembl	human	known	74_37	missense	30.56	17.02	SNP	0.007	A	22	49
CHAF1A	10036	genome.wustl.edu	37	19	4430604	4430604	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:4430604A>G	ENST00000301280.5	+	11	2014	c.1913A>G	c.(1912-1914)cAt>cGt	p.H638R	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	638					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)	p.H638R(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTGTGCCCCATGGGTACCTG	0.493								Chromatin Structure					ENSG00000167670																																					1	Substitution - Missense(1)	large_intestine(1)											153.0	121.0	132.0					19																	4430604		2203	4300	6503	SO:0001583	missense	0			-	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1913A>G	19.37:g.4430604A>G	ENSP00000301280:p.His638Arg		Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A	p.H638R	ENST00000301280.5	37	c.1913	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	A	17.15	3.315217	0.60524	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.25414	1.8	4.25	4.25	0.50352	.	.	.	.	.	T	0.51381	0.1671	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.58312	-0.7658	9	0.87932	D	0	-25.3162	12.6767	0.56897	1.0:0.0:0.0:0.0	.	638	Q13111	CAF1A_HUMAN	R	638	ENSP00000301280:H638R	ENSP00000301280:H638R	H	+	2	0	CHAF1A	4381604	1.000000	0.71417	0.989000	0.46669	0.563000	0.35712	8.189000	0.89712	1.785000	0.52413	0.260000	0.18958	CAT	-	CHAF1A	-	NULL		0.493	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	0	0	0	55	55	98	0.00	0.00	A	NM_005483		4430604	+1	18	37	64	91	tier1	no_errors	ENST00000301280	ensembl	human	known	74_37	missense	21.95	28.91	SNP	1.000	G	18	64
TUBGCP3	10426	genome.wustl.edu	37	13	113153364	113153364	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr13:113153364T>A	ENST00000261965.3	-	20	2629	c.2443A>T	c.(2443-2445)Att>Ttt	p.I815F	TUBGCP3_ENST00000375669.3_Missense_Mutation_p.I815F	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	815					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CATACCTCAATTTCACGCTGT	0.353													ENSG00000126216																																					0													162.0	151.0	155.0					13																	113153364		2202	4300	6502	SO:0001583	missense	0			-	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.2443A>T	13.37:g.113153364T>A	ENSP00000261965:p.Ile815Phe		O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	pfam_TUBGCP	p.I815F	ENST00000261965.3	37	c.2443	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798245	0.31777	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.22539	1.97;1.95	4.44	-5.48	0.02592	.	1.234910	0.05355	N	0.532539	T	0.08670	0.0215	N	0.08118	0	0.09310	N	1	B;B;B	0.16802	0.002;0.019;0.001	B;B;B	0.15870	0.003;0.014;0.003	T	0.30736	-0.9968	10	0.35671	T	0.21	0.0564	4.1043	0.10030	0.105:0.461:0.1959:0.238	.	805;815;815	B4DYP7;Q96CW5-2;Q96CW5	.;.;GCP3_HUMAN	F	815	ENSP00000261965:I815F;ENSP00000364821:I815F	ENSP00000261965:I815F	I	-	1	0	TUBGCP3	112201365	0.000000	0.05858	0.000000	0.03702	0.762000	0.43233	-0.207000	0.09384	-0.894000	0.03925	0.402000	0.26972	ATT	-	TUBGCP3	-	NULL		0.353	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	0	0	0	47	47	56	0.00	0.00	T	NM_006322		113153364	-1	26	36	87	138	tier1	no_errors	ENST00000261965	ensembl	human	known	74_37	missense	23.01	20.69	SNP	0.001	A	26	87
COL18A1	80781	genome.wustl.edu	37	21	46925093	46925093	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr21:46925093C>A	ENST00000359759.4	+	34	4180	c.4159C>A	c.(4159-4161)Cct>Act	p.P1387T	COL18A1_ENST00000355480.5_Missense_Mutation_p.P1152T|COL18A1_ENST00000400337.2_Missense_Mutation_p.P972T|SLC19A1_ENST00000567670.1_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1387	Triple-helical region 9 (COL9).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCCACCTGGACCTCAGGGACC	0.726													ENSG00000182871																																					0													7.0	10.0	9.0					21																	46925093		1722	3965	5687	SO:0001583	missense	0			-		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4159C>A	21.37:g.46925093C>A	ENSP00000352798:p.Pro1387Thr		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.P1387T	ENST00000359759.4	37	c.4159		21	.	.	.	.	.	.	.	.	.	.	C	22.7	4.323817	0.81580	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82	3.95	3.95	0.45737	.	0.060928	0.64402	N	0.000003	D	0.96965	0.9009	M	0.71036	2.16	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.996	D;D;P	0.66979	0.942;0.948;0.907	D	0.97060	0.9770	10	0.52906	T	0.07	.	15.4345	0.75133	0.0:1.0:0.0:0.0	.	1387;1152;972	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	T	972;972;1152;1387;1387;319	ENSP00000383191:P972T;ENSP00000347665:P1152T;ENSP00000352798:P1387T;ENSP00000339118:P319T	ENSP00000339118:P319T	P	+	1	0	COL18A1	45749521	0.936000	0.31750	0.999000	0.59377	0.991000	0.79684	2.609000	0.46317	2.138000	0.66242	0.555000	0.69702	CCT	-	COL18A1	-	NULL		0.726	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	0	0	0	70	70	17	0.00	0.00	C			46925093	+1	15	4	83	23	tier1	no_errors	ENST00000359759	ensembl	human	known	74_37	missense	15.31	14.81	SNP	1.000	A	15	83
XIRP2	129446	genome.wustl.edu	37	2	168104932	168104932	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr2:168104932C>T	ENST00000409195.1	+	9	7119	c.7030C>T	c.(7030-7032)Ctc>Ttc	p.L2344F	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.L2344F|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.L2122F|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2169					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTTTCCAGGCCTCCCTCTTCC	0.468													ENSG00000163092																																					0													132.0	136.0	135.0					2																	168104932		1887	4108	5995	SO:0001583	missense	0			-	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7030C>T	2.37:g.168104932C>T	ENSP00000386840:p.Leu2344Phe		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.L2344F	ENST00000409195.1	37	c.7030	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622440	0.28889	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.03386	3.95;3.95;3.95	5.95	4.17	0.49024	.	0.346810	0.30781	N	0.008882	T	0.03390	0.0098	L	0.40543	1.245	0.37097	D	0.899692	B;B;B	0.29085	0.149;0.232;0.232	B;B;B	0.31442	0.061;0.13;0.13	T	0.44128	-0.9348	10	0.11794	T	0.64	-1.5753	6.5517	0.22438	0.0:0.6937:0.1483:0.1581	.	2169;2169;2122	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	F	2344;2344;2122	ENSP00000386840:L2344F;ENSP00000295237:L2344F;ENSP00000387255:L2122F	ENSP00000295237:L2344F	L	+	1	0	XIRP2	167813178	0.198000	0.23374	0.974000	0.42286	0.799000	0.45148	1.165000	0.31822	0.864000	0.35578	0.655000	0.94253	CTC	-	XIRP2	-	NULL		0.468	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	0	0	0	53	53	53	0.00	0.00	C	NM_152381		168104932	+1	15	12	56	58	tier1	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	21.13	17.14	SNP	0.921	T	15	56
FBXO3	26273	genome.wustl.edu	37	11	33773135	33773135	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr11:33773135C>T	ENST00000265651.3	-	7	761	c.743G>A	c.(742-744)tGg>tAg	p.W248*	FBXO3_ENST00000448981.2_Nonsense_Mutation_p.W248*|FBXO3_ENST00000530401.1_Nonsense_Mutation_p.W243*|FBXO3_ENST00000531080.1_5'UTR|FBXO3_ENST00000532057.1_5'UTR|FBXO3_ENST00000526785.1_Nonsense_Mutation_p.W135*|FBXO3_ENST00000534136.1_Nonsense_Mutation_p.W248*	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	248					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		AGAGGTAAACCAGTCAGTAAA	0.328													ENSG00000110429																																					0													66.0	67.0	67.0					11																	33773135		2202	4297	6499	SO:0001587	stop_gained	0			-	AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.743G>A	11.37:g.33773135C>T	ENSP00000265651:p.Trp248*		B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Nonsense_Mutation	SNP	pfam_ApaG_domain,pfam_F-box_dom,superfamily_ApaG_domain,superfamily_F-box_dom,smart_F-box_dom,smart_SMI1/KNR4_like_dom,pfscan_ApaG_domain,pfscan_F-box_dom	p.W248*	ENST00000265651.3	37	c.743	CCDS7887.1	11	.	.	.	.	.	.	.	.	.	.	C	38	6.687324	0.97764	.	.	ENSG00000110429	ENST00000526785;ENST00000265651;ENST00000530401;ENST00000534136;ENST00000448981	.	.	.	6.17	6.17	0.99709	.	0.102433	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.6268	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	135;248;243;248;248	.	ENSP00000265651:W248X	W	-	2	0	FBXO3	33729711	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.473000	0.81007	2.941000	0.99782	0.655000	0.94253	TGG	-	FBXO3	-	smart_SMI1/KNR4_like_dom		0.328	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO3	HGNC	protein_coding	OTTHUMT00000388665.1	0	0	0	51	51	55	0.00	0.00	C	NM_012175		33773135	-1	11	18	82	81	tier1	no_errors	ENST00000265651	ensembl	human	known	74_37	nonsense	11.83	18.18	SNP	1.000	T	11	82
DYM	54808	genome.wustl.edu	37	18	46860165	46860165	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr18:46860165A>C	ENST00000269445.6	-	7	1010	c.553T>G	c.(553-555)Tgc>Ggc	p.C185G	DYM_ENST00000578396.1_Missense_Mutation_p.C30G|DYM_ENST00000442713.2_Intron	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	185					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						AAGAGTTGGCAGGAAAGGAAA	0.353													ENSG00000141627																																					0													120.0	115.0	116.0					18																	46860165		2203	4300	6503	SO:0001583	missense	0			-	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.553T>G	18.37:g.46860165A>C	ENSP00000269445:p.Cys185Gly		A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	pfam_Dymeclin,superfamily_ARM-type_fold	p.C185G	ENST00000269445.6	37	c.553	CCDS11937.1	18	.	.	.	.	.	.	.	.	.	.	A	13.50	2.257253	0.39896	.	.	ENSG00000141627	ENST00000269445	T	0.81330	-1.48	5.19	5.19	0.71726	.	0.149974	0.64402	D	0.000003	T	0.78773	0.4336	L	0.34521	1.04	0.46458	D	0.99905	P;P	0.39157	0.631;0.662	P;B	0.45577	0.486;0.171	T	0.81422	-0.0940	10	0.72032	D	0.01	-13.8336	15.8199	0.78631	1.0:0.0:0.0:0.0	.	7;185	Q9NXS9;Q7RTS9	.;DYM_HUMAN	G	185	ENSP00000269445:C185G	ENSP00000269445:C185G	C	-	1	0	DYM	45114163	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.353000	0.90077	2.278000	0.76064	0.524000	0.50904	TGC	-	DYM	-	pfam_Dymeclin		0.353	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYM	HGNC	protein_coding	OTTHUMT00000255912.3	0	0	0	31	31	52	0.00	0.00	A	NM_017653		46860165	-1	21	33	34	66	tier1	no_errors	ENST00000269445	ensembl	human	known	74_37	missense	38.18	33.00	SNP	1.000	C	21	34
LAPTM5	7805	genome.wustl.edu	37	1	31210526	31210526	+	Silent	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr1:31210526C>T	ENST00000294507.3	-	6	605	c.531G>A	c.(529-531)gaG>gaA	p.E177E	MIR4420_ENST00000583944.1_RNA	NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	177					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)				large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		GAGGCATATCCTCCTGGCTGG	0.483													ENSG00000162511																																					0													173.0	149.0	157.0					1																	31210526		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.531G>A	1.37:g.31210526C>T			Q13240|Q14698|Q3KP54	Silent	SNP	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5	p.E177	ENST00000294507.3	37	c.531	CCDS337.1	1																																																																																			-	LAPTM5	-	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5		0.483	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAPTM5	HGNC	protein_coding	OTTHUMT00000010463.1	0	0	0	45	45	47	0.00	0.00	C	NM_006762		31210526	-1	14	10	52	76	tier1	no_errors	ENST00000294507	ensembl	human	known	74_37	silent	21.21	11.63	SNP	0.283	T	14	52
SCAMP5	192683	genome.wustl.edu	37	15	75305127	75305127	+	Silent	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr15:75305127C>T	ENST00000361900.6	+	4	324	c.117C>T	c.(115-117)cgC>cgT	p.R39R	SCAMP5_ENST00000565923.1_3'UTR|SCAMP5_ENST00000562212.1_Silent_p.R39R|SCAMP5_ENST00000545456.1_Missense_Mutation_p.P21S|SCAMP5_ENST00000425597.3_Silent_p.R39R	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	39					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)				large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						TGACCAAGCGCCTCTACTACC	0.592													ENSG00000198794																																					0													85.0	86.0	86.0					15																	75305127		2060	4199	6259	SO:0001819	synonymous_variant	0			-	AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.117C>T	15.37:g.75305127C>T			B3KPJ7|B7Z762|D3DW71|Q8N3M4	Missense_Mutation	SNP	pfam_SCAMP	p.P21S	ENST00000361900.6	37	c.61	CCDS45306.1	15	.	.	.	.	.	.	.	.	.	.	C	14.44	2.537540	0.45176	.	.	ENSG00000198794	ENST00000545456	T	0.60171	0.21	4.75	0.616	0.17613	.	.	.	.	.	T	0.42810	0.1219	.	.	.	0.52099	D	0.999943	B	0.02656	0.0	B	0.01281	0.0	T	0.33059	-0.9883	8	0.87932	D	0	-21.7726	4.922	0.13874	0.0:0.3685:0.2988:0.3326	.	21	Q8TAC9-3	.	S	21	ENSP00000439685:P21S	ENSP00000439685:P21S	P	+	1	0	SCAMP5	73092180	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.723000	0.25939	0.227000	0.20999	-0.199000	0.12753	CCT	-	SCAMP5	-	NULL		0.592	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP5	HGNC	protein_coding	OTTHUMT00000420015.2	0	0	0	33	33	43	0.00	0.00	C	NM_138967		75305127	+1	18	15	62	87	tier1	no_errors	ENST00000545456	ensembl	human	known	74_37	missense	22.50	14.71	SNP	0.998	T	18	62
SLC17A6	57084	genome.wustl.edu	37	11	22391670	22391670	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr11:22391670T>C	ENST00000263160.3	+	8	1414	c.977T>C	c.(976-978)tTt>tCt	p.F326S		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	326					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						AGCTGGACTTTTTATTTATTG	0.318													ENSG00000091664																																					0													71.0	72.0	71.0					11																	22391670		2202	4297	6499	SO:0001583	missense	0			-	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.977T>C	11.37:g.22391670T>C	ENSP00000263160:p.Phe326Ser		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F326S	ENST00000263160.3	37	c.977	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	T	26.3	4.726737	0.89298	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.60040	0.22	5.42	5.42	0.78866	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.76579	0.4007	M	0.82433	2.59	0.80722	D	1	D	0.57257	0.979	D	0.63957	0.92	T	0.80850	-0.1198	10	0.87932	D	0	.	15.7332	0.77822	0.0:0.0:0.0:1.0	.	326	Q9P2U8	VGLU2_HUMAN	S	326;214	ENSP00000263160:F326S	ENSP00000263160:F326S	F	+	2	0	SLC17A6	22348246	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.997000	0.88414	2.182000	0.69389	0.482000	0.46254	TTT	-	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.318	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	0	0	0	77	77	35	0.00	0.00	T	NM_020346		22391670	+1	23	13	95	72	tier1	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	19.49	15.29	SNP	1.000	C	23	95
PCDHA6	56142	genome.wustl.edu	37	5	140209098	140209098	+	Silent	SNP	C	C	T	rs146722468	byFrequency	TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr5:140209098C>T	ENST00000529310.1	+	1	1536	c.1422C>T	c.(1420-1422)atC>atT	p.I474I	PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Silent_p.I474I	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	474	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGCCACATCTTCACGGTGT	0.647													ENSG00000081842	.|||	3	0.000599042	0.0023	0.0	5008	,	,		19262	0.0		0.0	False		,,,				2504	0.0																0								C	,,,,,,,,	28,4374		0,28,2173	41.0	49.0	47.0		,,,,,1422,,1422,1422	1.8	1.0	5	dbSNP_134	47	0,8580		0,0,4290	no	intron,intron,intron,intron,intron,coding-synonymous,intron,coding-synonymous,coding-synonymous	PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_031411.1,NM_031848.1,NM_031849.1	,,,,,,,,	0,28,6463	TT,TC,CC		0.0,0.6361,0.2157	,,,,,,,,	,,,,,474/951,,474/804,474/687	140209098	28,12954	2201	4290	6491	SO:0001819	synonymous_variant	0			-	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1422C>T	5.37:g.140209098C>T			O75283|Q9NRT8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I474	ENST00000529310.1	37	c.1422	CCDS47281.1	5																																																																																			rs146722468	PCDHA6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.647	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	0	0	0	284	284	28	0.00	0.00	C	NM_018909		140209098	+1	66	3	261	13	tier1	no_errors	ENST00000529310	ensembl	human	known	74_37	silent	20.18	18.75	SNP	0.998	T	66	261
ADAM21	8747	genome.wustl.edu	37	14	70924558	70924558	+	Nonsense_Mutation	SNP	C	C	G	rs61979126	byFrequency	TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr14:70924558C>G	ENST00000603540.1	+	2	600	c.342C>G	c.(340-342)taC>taG	p.Y114*	ADAM21_ENST00000267499.3_Nonsense_Mutation_p.Y114*|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	114					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		ATCATGGTTACGTGGAGGCAG	0.473													ENSG00000139985																																					0													95.0	127.0	116.0					14																	70924558		2200	4300	6500	SO:0001587	stop_gained	0			-	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.342C>G	14.37:g.70924558C>G	ENSP00000474385:p.Tyr114*		O43507|Q2VPC6|Q32MR0	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Y114*	ENST00000603540.1	37	c.342	CCDS9804.1	14	.	.	.	.	.	.	.	.	.	.	C	1.716	-0.497903	0.04291	.	.	ENSG00000139985	ENST00000267499	.	.	.	3.55	-3.91	0.04168	.	0.189654	0.25352	U	0.031296	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2141	0.37337	0.0:0.5491:0.1196:0.3312	.	.	.	.	X	114	.	ENSP00000267499:Y114X	Y	+	3	2	ADAM21	69994311	0.002000	0.14202	0.472000	0.27241	0.250000	0.25880	-0.593000	0.05740	-0.622000	0.05626	-0.259000	0.10710	TAC	-	ADAM21	-	pfam_Peptidase_M12B_N		0.473	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3	0	0	0	36	36	71	0.00	0.00	C			70924558	+1	9	26	60	119	tier1	no_errors	ENST00000267499	ensembl	human	known	74_37	nonsense	13.04	17.93	SNP	0.288	G	9	60
OR56A3	390083	genome.wustl.edu	37	11	5969021	5969021	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr11:5969021G>A	ENST00000329564.6	+	1	452	c.445G>A	c.(445-447)Gcc>Acc	p.A149T	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGTCAAGGCTGCCATGTTTAT	0.438													ENSG00000184478																																					0													147.0	146.0	147.0					11																	5969021		2198	4296	6494	SO:0001583	missense	0			-		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.445G>A	11.37:g.5969021G>A	ENSP00000331572:p.Ala149Thr		A6NN77|Q6IFF7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A149T	ENST00000329564.6	37	c.445	CCDS41614.1	11	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.329991	0.00227	.	.	ENSG00000184478	ENST00000329564	T	0.37752	1.18	5.13	0.0787	0.14413	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31257	U	0.007979	T	0.22475	0.0542	N	0.25426	0.745	0.09310	N	1	B	0.13145	0.007	B	0.20767	0.031	T	0.17440	-1.0369	10	0.59425	D	0.04	-5.1715	7.6668	0.28437	0.2149:0.0:0.6697:0.1154	.	149	Q8NH54	O56A3_HUMAN	T	149	ENSP00000331572:A149T	ENSP00000331572:A149T	A	+	1	0	OR56A3	5925597	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.141000	0.10327	-0.128000	0.11641	-0.850000	0.03035	GCC	-	OR56A3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.438	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR56A3	HGNC	protein_coding	OTTHUMT00000383753.1	0	0	0	39	39	89	0.00	0.00	G	NM_001003443		5969021	+1	11	19	43	105	tier1	no_errors	ENST00000329564	ensembl	human	known	74_37	missense	20.37	15.32	SNP	0.000	A	11	43
COL28A1	340267	genome.wustl.edu	37	7	7571327	7571327	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr7:7571327C>G	ENST00000399429.3	-	3	473	c.333G>C	c.(331-333)tgG>tgC	p.W111C		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	111	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		GCAGGTCCTTCCAGGAAGAAA	0.428													ENSG00000215018																																					0													66.0	63.0	64.0					7																	7571327		1879	4116	5995	SO:0001583	missense	0			-	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.333G>C	7.37:g.7571327C>G	ENSP00000382356:p.Trp111Cys		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.W111C	ENST00000399429.3	37	c.333	CCDS43553.1	7	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125710	0.56721	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	T	0.54071	0.59	4.2	4.2	0.49525	von Willebrand factor, type A (3);	0.184547	0.38663	U	0.001619	T	0.70701	0.3254	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75068	-0.3448	10	0.72032	D	0.01	-3.1347	16.6996	0.85345	0.0:1.0:0.0:0.0	.	111	Q2UY09	COSA1_HUMAN	C	111	ENSP00000382356:W111C	ENSP00000382347:W111C	W	-	3	0	COL28A1	7537852	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.080000	0.64437	2.358000	0.79984	0.655000	0.94253	TGG	-	COL28A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.428	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	0	0	0	23	23	53	0.00	0.00	C	NM_001037763		7571327	-1	11	25	43	118	tier1	no_errors	ENST00000399429	ensembl	human	known	74_37	missense	20.37	17.36	SNP	1.000	G	11	43
CCDC146	57639	genome.wustl.edu	37	7	76912006	76912006	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr7:76912006G>A	ENST00000285871.4	+	15	2179	c.2052G>A	c.(2050-2052)atG>atA	p.M684I	CCDC146_ENST00000415740.2_3'UTR|CCDC146_ENST00000431197.1_Missense_Mutation_p.M398I	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	684										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				TCCTGAAAATGAAGATTGCTG	0.378													ENSG00000135205																																					0													65.0	63.0	64.0					7																	76912006		2203	4300	6503	SO:0001583	missense	0			-	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.2052G>A	7.37:g.76912006G>A	ENSP00000285871:p.Met684Ile		A8K8X6|Q9P223	Missense_Mutation	SNP	NULL	p.M684I	ENST00000285871.4	37	c.2052	CCDS34671.1	7	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751278	0.31046	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.39229	1.09;1.09	5.24	2.34	0.29019	.	0.347798	0.30101	N	0.010408	T	0.21841	0.0526	N	0.11818	0.18	0.28364	N	0.920321	B;B	0.10296	0.001;0.003	B;B	0.13407	0.001;0.009	T	0.12915	-1.0529	10	0.30854	T	0.27	-1.9993	7.902	0.29740	0.1355:0.2557:0.6088:0.0	.	398;684	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	I	684;398	ENSP00000285871:M684I;ENSP00000413885:M398I	ENSP00000285871:M684I	M	+	3	0	AC007000.1	76749942	1.000000	0.71417	0.999000	0.59377	0.926000	0.56050	0.926000	0.28804	0.674000	0.31244	0.655000	0.94253	ATG	-	CCDC146	-	NULL		0.378	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	0	0	0	54	54	34	0.00	0.00	G	NM_020879		76912006	+1	13	18	85	70	tier1	no_errors	ENST00000285871	ensembl	human	known	74_37	missense	13.27	20.22	SNP	1.000	A	13	85
ZNF467	168544	genome.wustl.edu	37	7	149461979	149461979	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr7:149461979T>C	ENST00000302017.3	-	5	2025	c.1612A>G	c.(1612-1614)Aca>Gca	p.T538A	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGGGAGCCTGTGTGGATCGCC	0.692													ENSG00000181444																																					0													38.0	45.0	43.0					7																	149461979		2190	4294	6484	SO:0001583	missense	0			-	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1612A>G	7.37:g.149461979T>C	ENSP00000304769:p.Thr538Ala			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T538A	ENST00000302017.3	37	c.1612	CCDS5899.1	7	.	.	.	.	.	.	.	.	.	.	T	18.74	3.688601	0.68271	.	.	ENSG00000181444	ENST00000302017	T	0.26518	1.73	3.82	3.82	0.43975	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.525079	0.14054	U	0.344514	T	0.36166	0.0957	L	0.56124	1.755	0.36801	D	0.885332	D	0.55605	0.972	P	0.51615	0.675	T	0.46541	-0.9184	10	0.87932	D	0	-5.034	12.4249	0.55540	0.0:0.0:0.0:1.0	.	538	Q7Z7K2	ZN467_HUMAN	A	538	ENSP00000304769:T538A	ENSP00000304769:T538A	T	-	1	0	ZNF467	149092912	0.992000	0.36948	0.981000	0.43875	0.980000	0.70556	1.113000	0.31184	1.619000	0.50296	0.379000	0.24179	ACA	-	ZNF467	-	pfscan_Znf_C2H2		0.692	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	HGNC	protein_coding	OTTHUMT00000349833.1	0	0	0	132	132	28	0.00	0.00	T	NM_207336		149461979	-1	30	3	178	21	tier1	no_errors	ENST00000302017	ensembl	human	known	74_37	missense	14.42	12.50	SNP	1.000	C	30	178
KPNB1	3837	genome.wustl.edu	37	17	45735974	45735974	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr17:45735974C>T	ENST00000290158.4	+	5	991	c.584C>T	c.(583-585)aCg>aTg	p.T195M	KPNB1_ENST00000535458.2_Missense_Mutation_p.T50M|KPNB1_ENST00000537679.1_Missense_Mutation_p.T50M|KPNB1_ENST00000540627.1_Missense_Mutation_p.T50M|KPNB1_ENST00000577918.1_3'UTR	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	195					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|ovary(1)|pancreas(1)|skin(1)	4						CTAGCTGCTACGAATGCACTC	0.403													ENSG00000108424																																					0													100.0	93.0	96.0					17																	45735974		2203	4300	6503	SO:0001583	missense	0			-	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.584C>T	17.37:g.45735974C>T	ENSP00000290158:p.Thr195Met		B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,pfam_Armadillo,superfamily_ARM-type_fold,smart_Importin-beta_N,smart_Armadillo,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.T195M	ENST00000290158.4	37	c.584	CCDS11513.1	17	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336154	0.60963	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82861	0.5129	M	0.76433	2.335	0.44380	D	0.997286	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.98	T	0.81420	-0.0941	9	0.49607	T	0.09	-2.7436	20.5407	0.99260	0.0:1.0:0.0:0.0	.	50;195	F5H4R7;Q14974	.;IMB1_HUMAN	M	50;195;50;50	ENSP00000438253:T50M;ENSP00000290158:T195M;ENSP00000438964:T50M;ENSP00000445006:T50M	ENSP00000290158:T195M	T	+	2	0	KPNB1	43090973	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	7.815000	0.86186	2.865000	0.98341	0.655000	0.94253	ACG	-	KPNB1	-	superfamily_ARM-type_fold		0.403	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNB1	HGNC	protein_coding	OTTHUMT00000089755.2	0	0	0	35	35	58	0.00	0.00	C	NM_002265		45735974	+1	11	11	31	55	tier1	no_errors	ENST00000290158	ensembl	human	known	74_37	missense	26.19	16.67	SNP	1.000	T	11	31
HERC2P3	283755	genome.wustl.edu	37	15	20588706	20588706	+	RNA	SNP	T	T	C	rs568112887		TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr15:20588706T>C	ENST00000428453.1	-	0	4044							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CTGGACATTCTTTCCTGAAAA	0.299													ENSG00000180229																																					0													111.0	81.0	91.0					15																	20588706		2181	4240	6421			0			-	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20588706T>C				R	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			-	HERC2P3	-	-		0.299	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	0	0	0	76	76	15	0.00	0.00	T	NG_008269		20588706	-1	22	6	78	29	tier1	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	21.78	17.14	SNP	0.002	C	22	78
POLD1	5424	genome.wustl.edu	37	19	50912435	50912435	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:50912435C>T	ENST00000440232.2	+	16	2002	c.1949C>T	c.(1948-1950)tCa>tTa	p.S650L	POLD1_ENST00000595904.1_Missense_Mutation_p.S676L|POLD1_ENST00000599857.1_Missense_Mutation_p.S650L	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	650					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GTGAAGACCTCAGTGCGGAAG	0.622								DNA polymerases (catalytic subunits)					ENSG00000062822																																					0													64.0	61.0	62.0					19																	50912435		2203	4300	6503	SO:0001583	missense	0			-		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.1949C>T	19.37:g.50912435C>T	ENSP00000406046:p.Ser650Leu		Q8NER3|Q96H98	Missense_Mutation	SNP	pfam_D-dir_D_pol_B_multi_dom,pfam_D-dir_D_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_D-dir_D_pol_B,prints_D-dir_D_pol_B,tigrfam_D-dir_D_pol_B_pol2	p.S650L	ENST00000440232.2	37	c.1949	CCDS12795.1	19	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783595	0.49891	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.17691	2.26	4.55	2.37	0.29283	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.067754	0.64402	D	0.000011	T	0.39279	0.1072	H	0.97077	3.935	0.21256	N	0.999749	P;P	0.50819	0.662;0.939	P;P	0.49012	0.598;0.583	T	0.45041	-0.9288	10	0.66056	D	0.02	-2.4173	7.9094	0.29782	0.0:0.6072:0.3064:0.0864	.	676;650	E7EVW0;P28340	.;DPOD1_HUMAN	L	650;651	ENSP00000406046:S650L	ENSP00000366129:S651L	S	+	2	0	POLD1	55604247	0.813000	0.29090	0.009000	0.14445	0.674000	0.39518	3.326000	0.52037	0.469000	0.27268	0.561000	0.74099	TCA	-	POLD1	-	pfam_D-dir_D_pol_B_multi_dom,smart_D-dir_D_pol_B,tigrfam_D-dir_D_pol_B_pol2		0.622	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	HGNC	protein_coding	OTTHUMT00000464732.1	0	0	0	30	30	52	0.00	0.00	C			50912435	+1	20	29	49	77	tier1	no_errors	ENST00000440232	ensembl	human	known	74_37	missense	28.99	27.36	SNP	0.089	T	20	49
SLC9A3	6550	genome.wustl.edu	37	5	482667	482667	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr5:482667A>T	ENST00000264938.3	-	7	1361	c.1352T>A	c.(1351-1353)tTc>tAc	p.F451Y	SLC9A3_ENST00000514375.1_Missense_Mutation_p.F451Y|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	451					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CCTCACCTGGAAGATGACGGT	0.627													ENSG00000066230																																					0													87.0	77.0	81.0					5																	482667		2203	4300	6503	SO:0001583	missense	0			-		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.1352T>A	5.37:g.482667A>T	ENSP00000264938:p.Phe451Tyr		B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	pfam_Cation/H_exchanger,superfamily_Reg_factor_effector_dom,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F451Y	ENST00000264938.3	37	c.1352	CCDS3855.1	5	.	.	.	.	.	.	.	.	.	.	A	17.03	3.283365	0.59867	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.16196	2.42;2.36	4.13	4.13	0.48395	Cation/H+ exchanger (1);	0.336489	0.32518	N	0.005996	T	0.32763	0.0840	M	0.85041	2.73	0.43160	D	0.994949	P;D	0.53619	0.737;0.961	P;P	0.48770	0.524;0.589	T	0.41288	-0.9517	10	0.72032	D	0.01	.	12.8099	0.57634	1.0:0.0:0.0:0.0	.	451;451	E9PF67;P48764	.;SL9A3_HUMAN	Y	451	ENSP00000264938:F451Y;ENSP00000422983:F451Y	ENSP00000264938:F451Y	F	-	2	0	SLC9A3	535667	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	7.187000	0.77730	1.497000	0.48584	0.459000	0.35465	TTC	-	SLC9A3	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.627	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3	HGNC	protein_coding	OTTHUMT00000206677.2	0	0	0	124	124	71	0.00	0.00	A	NM_004174		482667	-1	17	10	163	73	tier1	no_errors	ENST00000264938	ensembl	human	known	74_37	missense	9.39	12.05	SNP	0.992	T	17	163
IGFALS	3483	genome.wustl.edu	37	16	1840734	1840734	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr16:1840734A>G	ENST00000215539.3	-	2	1795	c.1685T>C	c.(1684-1686)gTc>gCc	p.V562A	IGFALS_ENST00000415638.3_Missense_Mutation_p.V600A			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	562	LRRCT.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						GATGGCCTGGACGAAGCGGGG	0.682													ENSG00000099769																																					0													22.0	21.0	21.0					16																	1840734		2184	4293	6477	SO:0001583	missense	0			-	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.1685T>C	16.37:g.1840734A>G	ENSP00000215539:p.Val562Ala		B4DZY8|E9PGU3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.V600A	ENST00000215539.3	37	c.1799	CCDS10446.1	16	.	.	.	.	.	.	.	.	.	.	A	18.05	3.537350	0.65085	.	.	ENSG00000099769	ENST00000215539;ENST00000415638	T;T	0.23950	1.88;1.88	4.45	4.45	0.53987	Cysteine-rich flanking region, C-terminal (1);	0.068616	0.56097	D	0.000022	T	0.30008	0.0751	M	0.78223	2.4	0.80722	D	1	P;P	0.52316	0.952;0.952	P;B	0.44518	0.452;0.444	T	0.28618	-1.0038	10	0.07813	T	0.8	.	12.5601	0.56275	1.0:0.0:0.0:0.0	.	600;562	E9PGU3;P35858	.;ALS_HUMAN	A	562;600	ENSP00000215539:V562A;ENSP00000416683:V600A	ENSP00000215539:V562A	V	-	2	0	IGFALS	1780735	1.000000	0.71417	0.017000	0.16124	0.041000	0.13682	7.289000	0.78701	1.643000	0.50594	0.459000	0.35465	GTC	-	IGFALS	-	smart_Cys-rich_flank_reg_C		0.682	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFALS	HGNC	protein_coding	OTTHUMT00000250509.2	0	0	0	242	242	36	0.00	0.00	A			1840734	-1	108	18	241	44	tier1	no_errors	ENST00000415638	ensembl	human	known	74_37	missense	30.95	28.57	SNP	0.810	G	108	241
ERGIC1	57222	genome.wustl.edu	37	5	172362219	172362219	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr5:172362219G>A	ENST00000393784.3	+	9	810	c.671G>A	c.(670-672)cGc>cAc	p.R224H		NM_001031711.2	NP_001026881.1	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1	224					ER to Golgi vesicle-mediated transport (GO:0006888)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)	9	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CACACGGGCCGCATCATCCCT	0.567													ENSG00000113719																																					0													91.0	85.0	87.0					5																	172362219		2203	4300	6503	SO:0001583	missense	0			-	AF267855	CCDS34292.1	5q35.1	2009-11-06			ENSG00000113719	ENSG00000113719			29205	protein-coding gene	gene with protein product						10574461, 15308636	Standard	NM_001031711		Approved	ERGIC32, ERGIC-32, KIAA1181, NET24	uc003mbw.4	Q969X5	OTTHUMG00000130520	ENST00000393784.3:c.671G>A	5.37:g.172362219G>A	ENSP00000377374:p.Arg224His		Q9H0L0|Q9H2J2|Q9ULN9	Missense_Mutation	SNP	pfam_Erv_C	p.R224H	ENST00000393784.3	37	c.671	CCDS34292.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.678263	0.96764	.	.	ENSG00000113719	ENST00000393784	.	.	.	5.88	5.88	0.94601	Domain of unknown function DUF1692 (1);	0.000000	0.85682	D	0.000000	T	0.66509	0.2796	L	0.39085	1.19	0.80722	D	1	D;D	0.76494	0.971;0.999	P;D	0.66847	0.541;0.947	T	0.57046	-0.7878	9	0.15499	T	0.54	-38.5207	19.8311	0.96636	0.0:0.0:1.0:0.0	.	169;224	B4E0N6;Q969X5	.;ERGI1_HUMAN	H	224	.	ENSP00000377374:R224H	R	+	2	0	ERGIC1	172294825	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.141000	0.94612	2.790000	0.95986	0.591000	0.81541	CGC	-	ERGIC1	-	pfam_Erv_C		0.567	ERGIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERGIC1	HGNC	protein_coding	OTTHUMT00000252938.3	0	0	0	78	78	30	0.00	0.00	G	NM_020462		172362219	+1	30	10	161	64	tier1	no_errors	ENST00000393784	ensembl	human	known	74_37	missense	15.62	13.51	SNP	1.000	A	30	161
RARB	5915	genome.wustl.edu	37	3	25502747	25502747	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr3:25502747C>G	ENST00000404969.1	+	2	242	c.242C>G	c.(241-243)cCc>cGc	p.P81R	RARB_ENST00000458646.1_5'UTR|RARB_ENST00000330688.4_Missense_Mutation_p.P74R|RARB_ENST00000437042.2_5'UTR|RARB_ENST00000462272.1_3'UTR			P10826	RARB_HUMAN	retinoic acid receptor, beta	81	Modulating.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CCACTTCCTCCCCCTCGAGTG	0.512													ENSG00000077092																																					0													102.0	105.0	104.0					3																	25502747		2203	4300	6503	SO:0001583	missense	0			-	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.242C>G	3.37:g.25502747C>G	ENSP00000385865:p.Pro81Arg		P12891|Q00989|Q15298|Q9UN48	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.P81R	ENST00000404969.1	37	c.242		3	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716535	0.89205	.	.	ENSG00000077092	ENST00000383772;ENST00000404969;ENST00000538226;ENST00000330688	D;D;D	0.92858	-2.91;-3.12;-3.08	5.71	5.71	0.89125	.	0.189798	0.46758	D	0.000278	D	0.94827	0.8329	L	0.53671	1.685	0.80722	D	1	P;D	0.56746	0.95;0.977	P;P	0.62649	0.873;0.905	D	0.94550	0.7753	10	0.59425	D	0.04	.	19.9109	0.97025	0.0:1.0:0.0:0.0	.	81;74	P10826;F1D8S6	RARB_HUMAN;.	R	81;81;81;74	ENSP00000373282:P81R;ENSP00000385865:P81R;ENSP00000332296:P74R	ENSP00000332296:P74R	P	+	2	0	RARB	25477751	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.818000	0.86416	2.723000	0.93209	0.644000	0.83932	CCC	-	RARB	-	NULL		0.512	RARB-201	KNOWN	basic	protein_coding	RARB	HGNC	protein_coding		0	0	0	44	44	48	0.00	0.00	C	NM_000965, NM_016152		25502747	+1	15	23	75	135	tier1	no_errors	ENST00000404969	ensembl	human	known	74_37	missense	16.67	14.56	SNP	1.000	G	15	75
POM121L12	285877	genome.wustl.edu	37	7	53103958	53103958	+	Silent	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr7:53103958C>T	ENST00000408890.4	+	1	610	c.594C>T	c.(592-594)ttC>ttT	p.F198F		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	198								p.F198F(2)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CGTTGTGGTTCGAGGTCTCAG	0.667													ENSG00000221900																																					2	Substitution - coding silent(2)	prostate(1)|kidney(1)											49.0	58.0	55.0					7																	53103958		1981	4145	6126	SO:0001819	synonymous_variant	0			-		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.594C>T	7.37:g.53103958C>T			Q8NDI9	Silent	SNP	NULL	p.F198	ENST00000408890.4	37	c.594	CCDS43584.1	7																																																																																			-	POM121L12	-	NULL		0.667	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L12	HGNC	protein_coding	OTTHUMT00000342656.1	0	0	0	80	80	46	0.00	0.00	C	NM_182595		53103958	+1	31	16	199	40	tier1	no_errors	ENST00000408890	ensembl	human	known	74_37	silent	13.42	28.57	SNP	0.001	T	31	199
ZNF99	7652	genome.wustl.edu	37	19	22942170	22942170	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:22942170A>T	ENST00000596209.1	-	4	631	c.541T>A	c.(541-543)Tca>Aca	p.S181T	ZNF99_ENST00000397104.3_Intron	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ATGAAAAATGATTTGCTACAT	0.274													ENSG00000213973																																					0													32.0	26.0	28.0					19																	22942170		692	1574	2266	SO:0001583	missense	0			-	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.541T>A	19.37:g.22942170A>T	ENSP00000472969:p.Ser181Thr		M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S181T	ENST00000596209.1	37	c.541	CCDS59369.1	19																																																																																			-	ZNF99	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.274	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	0	0	0	72	72	4	0.00	0.00	A	XM_065124		22942170	-1	22	7	45	15	tier1	no_errors	ENST00000596209	ensembl	human	novel	74_37	missense	32.84	31.82	SNP	0.002	T	22	45
PSG9	5678	genome.wustl.edu	37	19	43752792	43752792	+	Intron	SNP	T	T	C			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:43752792T>C	ENST00000418820.2	-	4	1063				CEACAMP10_ENST00000489959.1_RNA			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				CAGCTGGAGATGAAGCTGATT	0.463													ENSG00000241104																																					0																																										SO:0001627	intron_variant	0			-	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000418820.2:c.964+9561A>G	19.37:g.43752792T>C			B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	R	SNP	-	NULL	ENST00000418820.2	37	NULL		19																																																																																			-	CEACAMP10	-	-		0.463	PSG9-011	PUTATIVE	basic	protein_coding	CEACAMP10	HGNC	protein_coding	OTTHUMT00000463916.1	0	0	0	34	34	8	0.00	0.00	T	NM_002784		43752792	-1	16	4	31	14	tier1	no_errors	ENST00000489959	ensembl	human	known	74_37	rna	34.04	22.22	SNP	0.003	C	16	31
PCSK9	255738	genome.wustl.edu	37	1	55523034	55523034	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr1:55523034G>T	ENST00000302118.5	+	7	1317	c.1027G>T	c.(1027-1029)Gac>Tac	p.D343Y	PCSK9_ENST00000543384.1_Missense_Mutation_p.D143Y|PCSK9_ENST00000490692.1_Intron	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	343	Peptidase S8.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						CAATGCCCAAGACCAGCCGGT	0.617													ENSG00000169174																									Pancreas(137;1454 1827 5886 22361 42375)												0													64.0	59.0	60.0					1																	55523034		2203	4300	6503	SO:0001583	missense	0			-	AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.1027G>T	1.37:g.55523034G>T	ENSP00000303208:p.Asp343Tyr		A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_Inhibitor_I9,superfamily_Peptidase_S8/S53_dom,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.D343Y	ENST00000302118.5	37	c.1027	CCDS603.1	1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.235057	0.79800	.	.	ENSG00000169174	ENST00000302118;ENST00000543384	T;T	0.79033	-1.23;-1.23	4.13	4.13	0.48395	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.120443	0.52532	D	0.000064	D	0.88621	0.6486	M	0.83953	2.67	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	D	0.90907	0.4773	10	0.87932	D	0	-23.6123	16.5961	0.84796	0.0:0.0:1.0:0.0	.	343	Q8NBP7	PCSK9_HUMAN	Y	343;143	ENSP00000303208:D343Y;ENSP00000441859:D143Y	ENSP00000303208:D343Y	D	+	1	0	PCSK9	55295622	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.173000	0.89680	2.106000	0.64143	0.462000	0.41574	GAC	-	PCSK9	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom		0.617	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK9	HGNC	protein_coding	OTTHUMT00000022280.1	0	0	0	55	55	53	0.00	0.00	G	NM_174936		55523034	+1	21	21	69	106	tier1	no_errors	ENST00000302118	ensembl	human	known	74_37	missense	23.33	16.54	SNP	1.000	T	21	69
GGCX	2677	genome.wustl.edu	37	2	85780578	85780578	+	Missense_Mutation	SNP	C	C	T	rs369862766		TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr2:85780578C>T	ENST00000233838.4	-	8	1012	c.932G>A	c.(931-933)tGc>tAc	p.C311Y	GGCX_ENST00000473665.1_5'UTR|GGCX_ENST00000430215.3_Missense_Mutation_p.C254Y	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	311					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	CTCAGGGGAGCAGAAGAGAGG	0.567													ENSG00000115486																																					0													68.0	77.0	74.0					2																	85780578		2203	4300	6503	SO:0001583	missense	0			-		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.932G>A	2.37:g.85780578C>T	ENSP00000233838:p.Cys311Tyr		B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	pfam_VKG_COase,superfamily_RmlC_Cupin,smart_HTTM	p.C311Y	ENST00000233838.4	37	c.932	CCDS1978.1	2	.	.	.	.	.	.	.	.	.	.	C	10.45	1.354027	0.24512	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	D;D	0.92048	-2.96;-2.96	5.64	5.64	0.86602	HTTM (1);	0.090482	0.85682	D	0.000000	D	0.94627	0.8268	L	0.49640	1.575	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.971	P;D;P	0.71184	0.899;0.972;0.893	D	0.94776	0.7949	10	0.66056	D	0.02	-25.0909	17.1941	0.86887	0.0:1.0:0.0:0.0	.	254;150;311	E9PEE1;B4DQW4;P38435	.;.;VKGC_HUMAN	Y	311;254	ENSP00000233838:C311Y;ENSP00000408045:C254Y	ENSP00000233838:C311Y	C	-	2	0	GGCX	85634089	1.000000	0.71417	1.000000	0.80357	0.143000	0.21401	5.311000	0.65786	2.657000	0.90304	0.655000	0.94253	TGC	-	GGCX	-	pfam_VKG_COase,smart_HTTM		0.567	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	HGNC	protein_coding	OTTHUMT00000252490.3	0	0	0	12	12	27	0.00	0.00	C	NM_000821		85780578	-1	6	12	12	42	tier1	no_errors	ENST00000233838	ensembl	human	known	74_37	missense	33.33	22.22	SNP	1.000	T	6	12
CHD9	80205	genome.wustl.edu	37	16	53191180	53191180	+	Silent	SNP	A	A	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr16:53191180A>G	ENST00000398510.3	+	1	1266	c.1179A>G	c.(1177-1179)caA>caG	p.Q393Q	CHD9_ENST00000564845.1_Silent_p.Q393Q|CHD9_ENST00000447540.1_Silent_p.Q393Q|CHD9_ENST00000566029.1_Silent_p.Q393Q			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	393					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TACTTCATCAAGTGGAATCTC	0.428													ENSG00000177200																																					0													31.0	29.0	29.0					16																	53191180		1881	4101	5982	SO:0001819	synonymous_variant	0			-	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.1179A>G	16.37:g.53191180A>G			B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Q393	ENST00000398510.3	37	c.1179		16																																																																																			-	CHD9	-	NULL		0.428	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	0	0	0	45	45	39	0.00	0.00	A	NM_025134		53191180	+1	34	27	28	44	tier1	no_errors	ENST00000398510	ensembl	human	known	74_37	silent	54.84	38.03	SNP	1.000	G	34	28
DGCR2	9993	genome.wustl.edu	37	22	19055725	19055725	+	Silent	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr22:19055725C>T	ENST00000263196.7	-	3	463	c.216G>A	c.(214-216)gaG>gaA	p.E72E	DGCR2_ENST00000537045.1_Silent_p.E31E|DGCR2_ENST00000545799.1_Silent_p.E72E|DGCR2_ENST00000473832.1_5'Flank	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	72					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					GAGGACGCACCTCCCCGGTCA	0.642													ENSG00000070413																																					0													47.0	39.0	42.0					22																	19055725		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.216G>A	22.37:g.19055725C>T			A6NIB5|A8K6K5|B5TY34|B7Z935	Silent	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_C-type_lectin_fold,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_C-type_lectin,smart_VWF_C,pfscan_LDrepeatLR_classA_rpt,pfscan_C-type_lectin	p.E72	ENST00000263196.7	37	c.216	CCDS33598.1	22																																																																																			-	DGCR2	-	superfamily_LDrepeatLR_classA_rpt		0.642	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DGCR2	HGNC	protein_coding	OTTHUMT00000316504.1	0	0	0	51	51	55	0.00	0.00	C	NM_005137		19055725	-1	46	11	77	47	tier1	no_errors	ENST00000263196	ensembl	human	known	74_37	silent	37.40	18.97	SNP	0.047	T	46	77
RARS	5917	genome.wustl.edu	37	5	167929104	167929104	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr5:167929104G>C	ENST00000231572.3	+	9	1105	c.1051G>C	c.(1051-1053)Gat>Cat	p.D351H	RARS_ENST00000538719.1_Missense_Mutation_p.D145H	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	351					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		GGAATTTGAAGATAGAGGTAG	0.318													ENSG00000113643																																					0													89.0	97.0	95.0					5																	167929104		2203	4296	6499	SO:0001583	missense	0			-	BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1051G>C	5.37:g.167929104G>C	ENSP00000231572:p.Asp351His		B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	pfam_Arg-tR-synth_Ia_core,pfam_DALR_anticod-bd,pfam_Arg-tR-synth_N,superfamily_tRsynth_1a_anticodon-bd,superfamily_Arg-tR-synth_N,smart_DALR_anticod-bd,prints_Arg-tR-synth_Ia_core,tigrfam_Arg-tR-ligase_Ia	p.D351H	ENST00000231572.3	37	c.1051	CCDS4367.1	5	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069120	0.55539	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	T;T	0.66280	-0.15;-0.2	5.14	4.22	0.49857	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.345825	0.36665	N	0.002480	T	0.66636	0.2809	M	0.64404	1.975	0.47905	D	0.999548	P	0.36110	0.537	P	0.45506	0.483	T	0.67150	-0.5743	10	0.46703	T	0.11	-3.3726	12.9631	0.58470	0.0838:0.0:0.9162:0.0	.	351	P54136	SYRC_HUMAN	H	351;145	ENSP00000231572:D351H;ENSP00000439108:D145H	ENSP00000231572:D351H	D	+	1	0	RARS	167861682	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	5.843000	0.69424	1.195000	0.43115	-0.345000	0.07892	GAT	-	RARS	-	pfam_Arg-tR-synth_Ia_core,tigrfam_Arg-tR-ligase_Ia		0.318	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS	HGNC	protein_coding	OTTHUMT00000252794.2	0	0	0	66	66	32	0.00	0.00	G	NM_002887		167929104	+1	11	11	63	67	tier1	no_errors	ENST00000231572	ensembl	human	known	74_37	missense	14.67	14.10	SNP	1.000	C	11	63
CHST8	64377	genome.wustl.edu	37	19	34263881	34263881	+	Silent	SNP	G	G	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:34263881G>A	ENST00000262622.4	+	4	1946	c.1188G>A	c.(1186-1188)tcG>tcA	p.S396S	CHST8_ENST00000434302.1_Silent_p.S396S|CHST8_ENST00000438847.3_Silent_p.S396S	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	396					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					CCCAACTCTCGGCCCTGCAAA	0.617													ENSG00000124302																																					0													50.0	54.0	53.0					19																	34263881		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.1188G>A	19.37:g.34263881G>A			Q9H3N2	Silent	SNP	pfam_Sulfotransferase	p.S396	ENST00000262622.4	37	c.1188	CCDS12433.1	19																																																																																			-	CHST8	-	pfam_Sulfotransferase		0.617	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHST8	HGNC	protein_coding	OTTHUMT00000451453.1	0	0	0	44	44	60	0.00	0.00	G	NM_022467		34263881	+1	30	45	41	87	tier1	no_errors	ENST00000262622	ensembl	human	known	74_37	silent	42.25	34.09	SNP	0.000	A	30	41
RSBN1	54665	genome.wustl.edu	37	1	114308661	114308661	+	Frame_Shift_Del	DEL	T	T	-			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr1:114308661delT	ENST00000261441.5	-	7	2413	c.2350delA	c.(2350-2352)agtfs	p.S784fs	RSBN1_ENST00000369581.2_5'Flank	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	784						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCAGTCTACTTTCCACTTTT	0.363													ENSG00000081019																																					0													96.0	93.0	94.0					1																	114308661		2203	4300	6503	SO:0001589	frameshift_variant	0				AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.2350delA	1.37:g.114308661delT	ENSP00000261441:p.Ser784fs		A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Frame_Shift_Del	DEL	NULL	p.S784fs	ENST00000261441.5	37	c.2350	CCDS862.1	1																																																																																				RSBN1	-	NULL		0.363	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1	HGNC	protein_coding	OTTHUMT00000033022.2	0	0	0	81	81	59	0.00	0.00	T	NM_018364		114308661	-1	22	23	79	79	tier1	no_errors	ENST00000261441	ensembl	human	known	74_37	frame_shift_del	21.78	22.55	DEL	1.000	-	22	79
PRKCG	5582	genome.wustl.edu	37	19	54409605	54409605	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:54409605C>A	ENST00000263431.3	+	17	2081	c.1799C>A	c.(1798-1800)tCa>tAa	p.S600*	PRKCG_ENST00000540413.1_Nonsense_Mutation_p.S600*|CACNG7_ENST00000391767.1_5'Flank|PRKCG_ENST00000542049.1_Nonsense_Mutation_p.S451*	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CGCCTGGGCTCAGGGCCTGAT	0.582													ENSG00000126583																																					0													46.0	34.0	38.0					19																	54409605		2167	4229	6396	SO:0001587	stop_gained	0			-	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1799C>A	19.37:g.54409605C>A	ENSP00000263431:p.Ser600*		B7Z8Q0	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.S600*	ENST00000263431.3	37	c.1799	CCDS12867.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.550089	0.96501	.	.	ENSG00000126583	ENST00000540413;ENST00000263431;ENST00000542049	.	.	.	3.89	3.89	0.44902	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	7.561	0.27851	0.0:0.884:0.0:0.116	.	.	.	.	X	600;600;451	.	ENSP00000263431:S600X	S	+	2	0	PRKCG	59101417	0.973000	0.33851	0.917000	0.36280	0.951000	0.60555	1.958000	0.40402	2.187000	0.69744	0.555000	0.69702	TCA	-	PRKCG	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_dom		0.582	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	HGNC	protein_coding	OTTHUMT00000139233.3	0	0	0	52	52	72	0.00	0.00	C	NM_002739		54409605	+1	12	7	97	106	tier1	no_errors	ENST00000540413	ensembl	human	known	74_37	nonsense	11.01	6.19	SNP	0.810	A	12	97
DOCK9	23348	genome.wustl.edu	37	13	99461377	99461377	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr13:99461377C>T	ENST00000376460.1	-	49	5453	c.5373G>A	c.(5371-5373)gcG>gcA	p.A1791A	DOCK9_ENST00000339416.2_Intron	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1792	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AAGAACTTACCGCTGCCTTaa	0.333													ENSG00000088387																																					0													54.0	49.0	51.0					13																	99461377		956	2079	3035	SO:0001630	splice_region_variant	0			-	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.5373+1G>A	13.37:g.99461377C>T			B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A1791	ENST00000376460.1	37	c.5373	CCDS45062.1	13																																																																																			-	DOCK9	-	NULL		0.333	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	0	0	0	39	39	27	0.00	0.00	C	NM_015296	Silent	99461377	-1	7	7	60	80	tier1	no_errors	ENST00000376460	ensembl	human	known	74_37	silent	10.45	8.05	SNP	1.000	T	7	60
HAPLN3	145864	genome.wustl.edu	37	15	89436251	89436251	+	Intron	SNP	A	A	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr15:89436251A>T	ENST00000359595.3	-	1	168				HAPLN3_ENST00000562889.1_Missense_Mutation_p.S31R	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	CTGTCTGGGCACTcagacctg	0.557													ENSG00000140511																																					0																																										SO:0001627	intron_variant	0			-	AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.46+2438T>A	15.37:g.89436251A>T			A8K7P0	Missense_Mutation	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.S31R	ENST00000359595.3	37	c.93	CCDS10346.1	15																																																																																			-	HAPLN3	-	NULL		0.557	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN3	HGNC	protein_coding	OTTHUMT00000309070.1	0	0	0	52	52	114	0.00	0.00	A	NM_178232		89436251	-1	5	9	49	115	tier1	no_errors	ENST00000562889	ensembl	human	novel	74_37	missense	9.26	7.20	SNP	0.000	T	5	49
RASGEF1C	255426	genome.wustl.edu	37	5	179564684	179564684	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr5:179564684C>A	ENST00000393371.2	-	2	502	c.206G>T	c.(205-207)aGc>aTc	p.S69I	RASGEF1C_ENST00000519883.1_5'Flank|RASGEF1C_ENST00000522500.1_5'Flank|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.S69I			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	69	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGGCGAGAGCTCAGCAGGAA	0.642													ENSG00000146090																																					0													46.0	41.0	43.0					5																	179564684		2202	4300	6502	SO:0001583	missense	0			-	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.206G>T	5.37:g.179564684C>A	ENSP00000377037:p.Ser69Ile		D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S69I	ENST00000393371.2	37	c.206	CCDS4452.1	5	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377846	0.82682	.	.	ENSG00000146090	ENST00000361132;ENST00000393371	T;T	0.51071	0.72;0.72	4.05	4.05	0.47172	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.72137	0.3423	M	0.88105	2.93	0.80722	D	1	D	0.58970	0.984	D	0.71184	0.972	T	0.78999	-0.1982	10	0.62326	D	0.03	.	15.1598	0.72775	0.0:1.0:0.0:0.0	.	69	Q8N431	RGF1C_HUMAN	I	69	ENSP00000354963:S69I;ENSP00000377037:S69I	ENSP00000354963:S69I	S	-	2	0	RASGEF1C	179497290	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.282000	0.65615	1.996000	0.58369	0.511000	0.50034	AGC	-	RASGEF1C	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,pfscan_Ras-like_Gua-exchang_fac_N		0.642	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	HGNC	protein_coding	OTTHUMT00000253506.2	0	0	1	26	26	44	0.00	2.22	C	NM_175062		179564684	-1	8	17	32	65	tier1	no_errors	ENST00000361132	ensembl	human	known	74_37	missense	20.00	20.73	SNP	1.000	A	8	32
PARG	8505	genome.wustl.edu	37	10	51041063	51041064	+	5'UTR	INS	-	-	T	rs550663040		TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr10:51041063_51041064insT	ENST00000492350.1	-	0	256_257				PARG_ENST00000402038.3_Intron			Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)			endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		TCAATTTCTCATTTTTTTTTTC	0.366													ENSG00000227345																																					0																																										SO:0001623	5_prime_UTR_variant	0				AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000492350.1:c.-216->A	10.37:g.51041073_51041073dupT			A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	R	INS	-	NULL	ENST00000492350.1	37	NULL		10																																																																																				PARG	-	-		0.366	PARG-003	KNOWN	basic	processed_transcript	PARG	HGNC	protein_coding	OTTHUMT00000048013.1	0	0	1	20	20	33	0.00	2.94	-	NM_003631		51041064	-1	3	9	22	64	tier1	no_errors	ENST00000492350	ensembl	human	known	74_37	rna	12.00	12.33	INS	0.000:0.000	T	3	22
ZNF66	7617	genome.wustl.edu	37	19	20988369	20988370	+	Intron	INS	-	-	T	rs556849654|rs34028361	byFrequency	TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:20988369_20988370insT	ENST00000344519.8	+	4	249				ZNF66_ENST00000425625.1_Intron|AC010329.1_ENST00000582722.1_RNA			Q6ZN08	ZNF66_HUMAN	zinc finger protein 66						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										AAGTAACAGACTTTTTTTTTTT	0.371													ENSG00000266156																																					0																																										SO:0001627	intron_variant	0				M88375		19p12	2013-03-06	2013-03-06	2013-03-06	ENSG00000160229	ENSG00000160229			13135	other	unknown			"""zinc finger protein 66, pseudogene"""	ZNF66P		1505991	Standard	NG_023377		Approved	FLJ16537	uc002npe.3	Q6ZN08	OTTHUMG00000167735	ENST00000344519.8:c.227-263->T	19.37:g.20988380_20988380dupT			I3L4P5|Q15939	R	INS	-	NULL	ENST00000344519.8	37	NULL		19																																																																																				AC010329.1	-	-		0.371	ZNF66-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000266156	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000395955.2	0	0	0	13	13	8	0.00	0.00	-	NG_023377		20988370	+1	2	0	16	6	tier1	no_errors	ENST00000582722	ensembl	human	novel	74_37	rna	11.11	0.00	INS	0.000:0.001	T	2	16
OBSCN	84033	genome.wustl.edu	37	1	228451874	228451874	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr1:228451874C>T	ENST00000422127.1	+	16	4687	c.4643C>T	c.(4642-4644)gCg>gTg	p.A1548V	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A1548V|OBSCN_ENST00000570156.2_Missense_Mutation_p.A1732V|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000359599.6_Missense_Mutation_p.A204V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1548	Ig-like 16.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGGCTGAGGCGGGGACCAGT	0.637													ENSG00000154358																																					0													54.0	57.0	56.0					1																	228451874		2104	4224	6328	SO:0001583	missense	0			-	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4643C>T	1.37:g.228451874C>T	ENSP00000409493:p.Ala1548Val		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.A1548V	ENST00000422127.1	37	c.4643	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	1.830	-0.470123	0.04445	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.04406	3.63;3.63;3.63	4.82	-0.476	0.12100	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.570998	0.16208	N	0.224592	T	0.03695	0.0105	N	0.21194	0.64	0.09310	N	0.999999	B;B	0.18013	0.025;0.016	B;B	0.18263	0.021;0.009	T	0.40156	-0.9578	10	0.34782	T	0.22	.	11.5258	0.50580	0.0:0.5213:0.0:0.4787	.	1548;1548	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	V	1548;1548;204	ENSP00000284548:A1548V;ENSP00000409493:A1548V;ENSP00000352613:A204V	ENSP00000284548:A1548V	A	+	2	0	OBSCN	226518497	0.000000	0.05858	0.024000	0.17045	0.006000	0.05464	-1.692000	0.01918	-0.001000	0.14495	-1.452000	0.01034	GCG	-	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		0	0	0	137	137	5	0.00	0.00	C	NM_052843		228451874	+1	29	1	104	0	tier1	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	21.80	100.00	SNP	0.000	T	29	104
AGGF1	55109	genome.wustl.edu	37	5	76332520	76332520	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr5:76332520A>G	ENST00000312916.7	+	4	1038	c.656A>G	c.(655-657)cAc>cGc	p.H219R		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	219					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		TATTTTGACCACAGCACTGGT	0.423													ENSG00000164252																																					0													55.0	55.0	55.0					5																	76332520		2203	4300	6503	SO:0001583	missense	0			-	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.656A>G	5.37:g.76332520A>G	ENSP00000316109:p.His219Arg		O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	pfam_FHA_dom,pfam_G_patch_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_G_patch_dom,pfscan_FHA_dom,pfscan_G_patch_dom	p.H219R	ENST00000312916.7	37	c.656	CCDS4035.1	5	.	.	.	.	.	.	.	.	.	.	A	24.8	4.566395	0.86439	.	.	ENSG00000164252	ENST00000312916	D	0.85702	-2.02	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.86838	0.6029	L	0.39147	1.195	0.80722	D	1	D	0.57257	0.979	P	0.58873	0.847	D	0.85965	0.1473	9	.	.	.	-1.138	14.6704	0.68939	1.0:0.0:0.0:0.0	.	219	Q8N302	AGGF1_HUMAN	R	219	ENSP00000316109:H219R	.	H	+	2	0	AGGF1	76368276	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.587000	0.74071	1.868000	0.54150	0.477000	0.44152	CAC	-	AGGF1	-	NULL		0.423	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGGF1	HGNC	protein_coding	OTTHUMT00000219971.2	0	0	0	50	50	0	0.00	0.00	A	NM_018046		76332520	+1	17	0	35	0	tier1	no_errors	ENST00000312916	ensembl	human	known	74_37	missense	32.69	0.00	SNP	1.000	G	17	35
BX088651.1	0	genome.wustl.edu	37	9	44403192	44403192	+	5'Flank	SNP	C	C	G			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr9:44403192C>G	ENST00000540551.1	-	0	0				RP11-475I24.3_ENST00000435586.1_lincRNA																							ATTTGTGTCACTTGCCCATTT	0.388													ENSG00000237357																																					0																																										SO:0001631	upstream_gene_variant	0			-																													9.37:g.44403192C>G	Exception_encountered			R	SNP	-	NULL	ENST00000540551.1	37	NULL		9																																																																																			-	RP11-475I24.3	-	-		0.388	BX088651.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000237357	Clone_based_vega_gene	protein_coding		0	0	0	40	40	0	0.00	0.00	C			44403192	+1	8	0	53	0	tier1	no_errors	ENST00000425309	ensembl	human	known	74_37	rna	13.11	0.00	SNP	0.242	G	8	53
ANAPC2	29882	genome.wustl.edu	37	9	140070016	140070016	+	Intron	SNP	G	G	C			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr9:140070016G>C	ENST00000323927.2	-	12	2025				ANAPC2_ENST00000487917.1_Intron	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GGGCTCCCGGGCCACCCTGCC	0.721													ENSG00000176248																																					0																																										SO:0001627	intron_variant	0			-	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.2021-92C>G	9.37:g.140070016G>C			Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	R	SNP	-	NULL	ENST00000323927.2	37	NULL	CCDS7033.1	9																																																																																			-	APC2	-	-		0.721	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000055315.1	0	0	0	55	55	1	0.00	0.00	G	NM_013366		140070016	-1	12	0	71	2	tier1	no_errors	ENST00000483432	ensembl	human	known	74_37	rna	14.29	0.00	SNP	0.000	C	12	71
JPH1	56704	genome.wustl.edu	37	8	75227796	75227796	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr8:75227796C>T	ENST00000342232.4	-	2	479	c.439G>A	c.(439-441)Gtg>Atg	p.V147M		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	147					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CCGTAGGGCACGCTCTGGCGC	0.687													ENSG00000104369																																					0																																										SO:0001583	missense	0			-	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.439G>A	8.37:g.75227796C>T	ENSP00000344488:p.Val147Met		B2RTZ0	Missense_Mutation	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.V147M	ENST00000342232.4	37	c.439	CCDS6217.1	8	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973072	0.74246	.	.	ENSG00000104369	ENST00000342232	T	0.61274	0.12	4.41	3.51	0.40186	.	0.064431	0.64402	D	0.000008	T	0.55970	0.1954	L	0.56124	1.755	0.80722	D	1	P	0.39094	0.659	B	0.41894	0.369	T	0.58109	-0.7694	10	0.46703	T	0.11	.	13.5767	0.61879	0.1568:0.8432:0.0:0.0	.	147	Q9HDC5	JPH1_HUMAN	M	147	ENSP00000344488:V147M	ENSP00000344488:V147M	V	-	1	0	JPH1	75390351	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.546000	0.82137	1.027000	0.39758	0.563000	0.77884	GTG	-	JPH1	-	smart_MORN,pirsf_Junctophilin		0.687	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH1	HGNC	protein_coding	OTTHUMT00000379102.1	0	0	0	20	20	3	0.00	0.00	C			75227796	-1	3	0	12	4	tier1	no_errors	ENST00000342232	ensembl	human	known	74_37	missense	20.00	0.00	SNP	1.000	T	3	12
SPPL2B	56928	genome.wustl.edu	37	19	2341094	2341101	+	RNA	DEL	CTCCCTGG	CTCCCTGG	-	rs77642174|rs76166147|rs386805838|rs547300749	byFrequency	TCGA-3B-A9HI-01A-11D-A387-09	TCGA-3B-A9HI-10A-01D-A38A-09	CTCCCTGG	CTCCCTGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7768147-81e0-42bd-aa71-2a835e66dbe4	e6bb0106-9ac8-4f88-b90b-01e3b3269f2f	g.chr19:2341094_2341101delCTCCCTGG	ENST00000452401.2	+	0	1033							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCCCTGCCCTCCCTGGAGGCCGCCCC	0.702													ENSG00000005206		1248	0.249201	0.0469	0.3718	5008	,	,		14617	0.25		0.4294	False		,,,				2504	0.2495																0																																												0					CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2341094_2341101delCTCCCTGG			D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	R	DEL	-	NULL	ENST00000452401.2	37	NULL		19																																																																																				SPPL2B	-	-		0.702	SPPL2B-202	KNOWN	basic	processed_transcript	SPPL2B	HGNC	processed_transcript		0	0	0	0	0	0	0.00	0.00	CTCCCTGG	NM_020172		2341101	+1	0	0	1	1	tier1	no_errors	ENST00000592738	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.010:0.001:0.000:0.000:0.001:0.000	-	0	1
