#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
AGAP2-AS1	100130776	genome.wustl.edu	37	12	58121452	58121452	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:58121452C>T	ENST00000542466.2	+	2	813	c.677C>T	c.(676-678)tCc>tTc	p.S226F	AGAP2_ENST00000547588.1_Intron|AGAP2_ENST00000257897.3_Intron|RP11-571M6.8_ENST00000548410.2_RNA					AGAP2 antisense RNA 1																		TCCGCTGCCTCCTGGCACTCA	0.682													ENSG00000255737																																					0													36.0	37.0	37.0					12																	58121452		2201	4298	6499	SO:0001583	missense	0			-	BC039697, BC069024		12q14.1	2013-05-30			ENSG00000255737	ENSG00000255737		"""Long non-coding RNAs"""	48633	non-coding RNA	RNA, long non-coding							Standard	NR_027032		Approved				OTTHUMG00000170286	ENST00000542466.2:c.677C>T	12.37:g.58121452C>T	ENSP00000437523:p.Ser226Phe			Missense_Mutation	SNP	NULL	p.S226F	ENST00000542466.2	37	c.677		12	.	.	.	.	.	.	.	.	.	.	C	0.098	-1.156059	0.01686	.	.	ENSG00000255737	ENST00000542466	.	.	.	4.47	-0.896	0.10557	.	.	.	.	.	T	0.28699	0.0711	.	.	.	0.09310	N	0.999993	B	0.26483	0.15	B	0.21546	0.035	T	0.24764	-1.0151	7	0.87932	D	0	.	5.5487	0.17079	0.0:0.3104:0.4326:0.257	.	226	B7Z718	.	F	226	.	ENSP00000437523:S226F	S	+	2	0	RP11-571M6.6	56407719	0.000000	0.05858	0.012000	0.15200	0.157000	0.22087	-0.044000	0.12023	-0.270000	0.09285	-0.150000	0.13652	TCC	-	AGAP2-AS1	-	NULL		0.682	AGAP2-AS1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	AGAP2-AS1	HGNC	protein_coding	OTTHUMT00000408368.1	0	0	0	50	50	25	0.00	0.00	C			58121452	+1	67	20	305	151	tier1	no_errors	ENST00000542466	ensembl	human	putative	74_37	missense	17.96	11.70	SNP	0.004	T	67	305
UNC80	285175	genome.wustl.edu	37	2	210642248	210642248	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr2:210642248G>A	ENST00000439458.1	+	4	645	c.565G>A	c.(565-567)Gtg>Atg	p.V189M	UNC80_ENST00000478701.1_3'UTR|UNC80_ENST00000272845.6_Missense_Mutation_p.V189M	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	189					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V189M(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GGAGCTCTTCGTGTTTCTGTT	0.502													ENSG00000144406																																					2	Substitution - Missense(2)	large_intestine(2)											105.0	109.0	108.0					2																	210642248		2203	4300	6503	SO:0001583	missense	0			-	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.565G>A	2.37:g.210642248G>A	ENSP00000391088:p.Val189Met		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.V189M	ENST00000439458.1	37	c.565	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.075077	0.94000	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	T;T	0.53423	0.62;0.63	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.70710	0.3255	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.71427	-0.4596	10	0.87932	D	0	.	20.3248	0.98698	0.0:0.0:1.0:0.0	.	189;189	Q8N2C7;Q8N2C7-3	UNC80_HUMAN;.	M	189	ENSP00000391088:V189M;ENSP00000272845:V189M	ENSP00000272845:V189M	V	+	1	0	UNC80	210350493	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.609000	0.98334	2.818000	0.97014	0.655000	0.94253	GTG	-	UNC80	-	NULL		0.502	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		0	0	0	46	46	116	0.00	0.00	G	NM_182587		210642248	+1	11	48	21	47	tier1	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	34.38	50.53	SNP	1.000	A	11	21
FZD6	8323	genome.wustl.edu	37	8	104336784	104336784	+	Silent	SNP	A	A	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr8:104336784A>G	ENST00000358755.4	+	4	767	c.450A>G	c.(448-450)acA>acG	p.T150T	FZD6_ENST00000522566.1_Silent_p.T150T|FZD6_ENST00000540287.1_Intron|FZD6_ENST00000523739.1_Silent_p.T118T	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	150					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			AGAAGAAAACAGAACAAGTCC	0.383													ENSG00000164930																																					0													56.0	61.0	59.0					8																	104336784		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.450A>G	8.37:g.104336784A>G			B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.T150	ENST00000358755.4	37	c.450	CCDS6298.1	8																																																																																			-	FZD6	-	NULL		0.383	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	HGNC	protein_coding	OTTHUMT00000380560.1	0	0	0	43	43	51	0.00	0.00	A	NM_003506		104336784	+1	23	12	75	46	tier1	no_errors	ENST00000358755	ensembl	human	known	74_37	silent	23.47	20.69	SNP	0.991	G	23	75
IFNG	3458	genome.wustl.edu	37	12	68551748	68551748	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:68551748A>T	ENST00000229135.3	-	3	442	c.311T>A	c.(310-312)tTt>tAt	p.F104Y	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	104					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	GCTATTGAAAAACTTGACATT	0.353													ENSG00000111537																																					0													157.0	157.0	157.0					12																	68551748		2203	4300	6503	SO:0001583	missense	0			-		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.311T>A	12.37:g.68551748A>T	ENSP00000229135:p.Phe104Tyr		B5BU88|Q53ZV4	Missense_Mutation	SNP	pfam_Interferon_gamma,superfamily_4_helix_cytokine-like_core,pirsf_Interferon_gamma	p.F104Y	ENST00000229135.3	37	c.311	CCDS8980.1	12	.	.	.	.	.	.	.	.	.	.	A	18.29	3.592236	0.66219	.	.	ENSG00000111537	ENST00000229135	T	0.54279	0.58	5.38	4.16	0.48862	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.636531	0.17197	N	0.183271	T	0.70798	0.3265	M	0.84511	2.7	0.09310	N	1	D	0.76494	0.999	D	0.69307	0.963	T	0.62310	-0.6881	9	.	.	.	-8.4815	8.1574	0.31178	0.8216:0.0:0.0:0.1784	.	104	P01579	IFNG_HUMAN	Y	104	ENSP00000229135:F104Y	.	F	-	2	0	IFNG	66838015	0.965000	0.33210	0.654000	0.29608	0.046000	0.14306	2.427000	0.44740	2.171000	0.68590	0.533000	0.62120	TTT	-	IFNG	-	pfam_Interferon_gamma,superfamily_4_helix_cytokine-like_core,pirsf_Interferon_gamma		0.353	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNG	HGNC	protein_coding	OTTHUMT00000402301.1	0	0	0	42	42	43	0.00	0.00	A			68551748	-1	24	39	46	53	tier1	no_errors	ENST00000229135	ensembl	human	known	74_37	missense	34.29	42.39	SNP	0.086	T	24	46
ANTXR2	118429	genome.wustl.edu	37	4	80828146	80828146	+	3'UTR	SNP	A	A	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr4:80828146A>C	ENST00000403729.2	-	0	2429				ANTXR2_ENST00000482406.1_5'UTR	NM_058172.5	NP_477520.2	P58335	ANTR2_HUMAN	anthrax toxin receptor 2						reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						ATGGATAAAGATCTTGCCACA	0.403									Juvenile Hyaline Fibromatosis				ENSG00000163297																																					0																																										SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	-	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000403729.2:c.*437T>G	4.37:g.80828146A>C			Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	R	SNP	-	NULL	ENST00000403729.2	37	NULL	CCDS47085.1	4																																																																																			-	ANTXR2	-	-		0.403	ANTXR2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ANTXR2	HGNC	protein_coding	OTTHUMT00000324666.2	0	0	0	11	11	55	0.00	0.00	A	NM_058172		80828146	-1	11	45	15	45	tier1	no_errors	ENST00000482406	ensembl	human	known	74_37	rna	42.31	50.00	SNP	0.407	C	11	15
FHOD3	80206	genome.wustl.edu	37	18	34297864	34297864	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr18:34297864G>T	ENST00000359247.4	+	15	2027	c.2027G>T	c.(2026-2028)cGg>cTg	p.R676L	FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000257209.4_Missense_Mutation_p.R693L|FHOD3_ENST00000445677.1_Missense_Mutation_p.R655L|FHOD3_ENST00000592128.1_5'Flank|FHOD3_ENST00000590592.1_Missense_Mutation_p.R868L|FHOD3_ENST00000591635.1_Intron	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	676					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACCAACAAACGGTTCATGCTT	0.542													ENSG00000134775																																					0													124.0	105.0	112.0					18																	34297864		2203	4300	6503	SO:0001583	missense	0			-	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2027G>T	18.37:g.34297864G>T	ENSP00000352186:p.Arg676Leu		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.R693L	ENST00000359247.4	37	c.2078		18	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247908	0.59103	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.32753	1.44;1.46;1.44	5.24	5.24	0.73138	.	0.249780	0.40469	N	0.001093	T	0.47764	0.1463	L	0.48642	1.525	0.49915	D	0.999831	B;D;B	0.67145	0.011;0.996;0.03	B;D;B	0.72338	0.011;0.977;0.02	T	0.28267	-1.0049	10	0.36615	T	0.2	.	15.5657	0.76290	0.0:0.0:1.0:0.0	.	655;676;693	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	L	693;676;655	ENSP00000257209:R693L;ENSP00000352186:R676L;ENSP00000411430:R655L	ENSP00000257209:R693L	R	+	2	0	FHOD3	32551862	1.000000	0.71417	0.988000	0.46212	0.964000	0.63967	6.394000	0.73223	2.458000	0.83093	0.455000	0.32223	CGG	-	FHOD3	-	NULL		0.542	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	0	0	0	26	26	115	0.00	0.00	G	XM_371114		34297864	+1	38	43	49	58	tier1	no_errors	ENST00000257209	ensembl	human	known	74_37	missense	43.68	42.57	SNP	1.000	T	38	49
MYH4	4622	genome.wustl.edu	37	17	10367818	10367818	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:10367818T>C	ENST00000255381.2	-	7	729	c.619A>G	c.(619-621)Aaa>Gaa	p.K207E	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	207	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GGTTCCTCTTTTTTCTTCTCT	0.423													ENSG00000264424																																					0													79.0	77.0	78.0					17																	10367818		2203	4300	6503	SO:0001583	missense	0			-		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.619A>G	17.37:g.10367818T>C	ENSP00000255381:p.Lys207Glu			Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K207E	ENST00000255381.2	37	c.619	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	T	18.09	3.546147	0.65198	.	.	ENSG00000141048	ENST00000255381	T	0.71579	-0.58	5.12	5.12	0.69794	Myosin head, motor domain (2);	0.000000	0.39020	U	0.001492	T	0.58438	0.2122	N	0.25060	0.705	0.48452	D	0.999654	B	0.02656	0.0	B	0.14578	0.011	T	0.54529	-0.8280	10	0.37606	T	0.19	.	15.1975	0.73104	0.0:0.0:0.0:1.0	.	207	Q9Y623	MYH4_HUMAN	E	207	ENSP00000255381:K207E	ENSP00000255381:K207E	K	-	1	0	MYH4	10308543	1.000000	0.71417	0.922000	0.36590	0.711000	0.40976	3.490000	0.53245	2.043000	0.60533	0.528000	0.53228	AAA	-	MYH4	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.423	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	0	0	0	28	28	19	0.00	0.00	T	NM_017533		10367818	-1	12	12	37	26	tier1	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	24.49	31.58	SNP	1.000	C	12	37
SLC22A15	55356	genome.wustl.edu	37	1	116574007	116574007	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:116574007G>A	ENST00000369503.4	+	6	879	c.749G>A	c.(748-750)cGt>cAt	p.R250H	SLC22A15_ENST00000369502.1_Intron	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	250					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GAATCACCTCGTTGGTTATAC	0.468													ENSG00000163393																																					0													64.0	63.0	63.0					1																	116574007		1963	4142	6105	SO:0001583	missense	0			-	AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.749G>A	1.37:g.116574007G>A	ENSP00000358515:p.Arg250His		A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R250H	ENST00000369503.4	37	c.749	CCDS44198.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.196417	0.94960	.	.	ENSG00000163393	ENST00000369503	T	0.79653	-1.29	4.81	4.81	0.61882	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.91922	0.7442	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.93947	0.7228	10	0.87932	D	0	.	18.0583	0.89369	0.0:0.0:1.0:0.0	.	250	Q8IZD6	S22AF_HUMAN	H	250	ENSP00000358515:R250H	ENSP00000358515:R250H	R	+	2	0	SLC22A15	116375530	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.973000	0.93428	2.498000	0.84270	0.655000	0.94253	CGT	-	SLC22A15	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.468	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A15	HGNC	protein_coding	OTTHUMT00000033220.2	0	0	0	21	21	41	0.00	0.00	G	NM_018420		116574007	+1	12	36	25	40	tier1	no_errors	ENST00000369503	ensembl	human	known	74_37	missense	32.43	47.37	SNP	1.000	A	12	25
POGZ	23126	genome.wustl.edu	37	1	151384810	151384810	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:151384810C>T	ENST00000271715.2	-	11	2055	c.1741G>A	c.(1741-1743)Gat>Aat	p.D581N	POGZ_ENST00000409503.1_Missense_Mutation_p.D572N|POGZ_ENST00000540984.1_5'UTR|POGZ_ENST00000361398.3_Missense_Mutation_p.D528N|POGZ_ENST00000531094.1_Missense_Mutation_p.D519N|POGZ_ENST00000392723.1_Missense_Mutation_p.D528N|POGZ_ENST00000491586.1_Missense_Mutation_p.D528N|POGZ_ENST00000368863.2_Missense_Mutation_p.D486N	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	581					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTATGAGTATCCTTCATATGC	0.398													ENSG00000143442																																					0													96.0	89.0	91.0					1																	151384810		2203	4300	6503	SO:0001583	missense	0			-	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.1741G>A	1.37:g.151384810C>T	ENSP00000271715:p.Asp581Asn		B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_D-bd_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_HTH_CenpB_D-bd_dom,pfscan_Znf_C2H2	p.D581N	ENST00000271715.2	37	c.1741	CCDS997.1	1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.866000	0.71949	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000529669	T;T;T;T;T;T;T;T	0.14766	5.88;5.91;5.88;5.87;5.9;5.9;5.34;2.48	5.1	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000003	T	0.16342	0.0393	N	0.25245	0.725	0.80722	D	1	P;D;P;D;D;P	0.71674	0.473;0.993;0.607;0.998;0.998;0.473	B;D;B;D;D;B	0.75484	0.13;0.971;0.3;0.986;0.986;0.158	T	0.05099	-1.0906	10	0.40728	T	0.16	-17.9801	17.2582	0.87063	0.0:1.0:0.0:0.0	.	519;572;486;528;528;581	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	N	528;581;528;486;572;519;528;30	ENSP00000376484:D528N;ENSP00000271715:D581N;ENSP00000354467:D528N;ENSP00000357856:D486N;ENSP00000386836:D572N;ENSP00000431259:D519N;ENSP00000418408:D528N;ENSP00000432295:D30N	ENSP00000271715:D581N	D	-	1	0	POGZ	149651434	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.055000	0.49916	2.656000	0.90262	0.557000	0.71058	GAT	-	POGZ	-	smart_Znf_C2H2-like		0.398	POGZ-001	KNOWN	basic|CCDS	protein_coding	POGZ	HGNC	protein_coding	OTTHUMT00000034915.2	0	0	0	19	19	70	0.00	0.00	C	NM_207171		151384810	-1	23	30	37	93	tier1	no_errors	ENST00000271715	ensembl	human	known	74_37	missense	38.33	24.39	SNP	1.000	T	23	37
OR10T2	128360	genome.wustl.edu	37	1	158368481	158368481	+	Missense_Mutation	SNP	T	T	C	rs139047952		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:158368481T>C	ENST00000334438.1	-	1	775	c.776A>G	c.(775-777)tAt>tGt	p.Y259C		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					GGGCCGCAGATAGATGATAGA	0.512													ENSG00000186306																																					0								T	CYS/TYR	0,4406		0,0,2203	103.0	90.0	94.0		776	3.4	1.0	1	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR10T2	NM_001004475.1	194	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	259/315	158368481	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.776A>G	1.37:g.158368481T>C	ENSP00000334115:p.Tyr259Cys		Q6IF98	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y259C	ENST00000334438.1	37	c.776	CCDS30895.1	1	.	.	.	.	.	.	.	.	.	.	T	14.61	2.587180	0.46110	0.0	1.16E-4	ENSG00000186306	ENST00000334438	T	0.00295	8.25	4.57	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38164	N	0.001795	T	0.00440	0.0014	M	0.94142	3.5	0.26885	N	0.96746	D	0.89917	1.0	D	0.97110	1.0	T	0.19063	-1.0317	10	0.87932	D	0	.	10.6412	0.45594	0.0:0.0:0.1616:0.8384	.	259	Q8NGX3	O10T2_HUMAN	C	259	ENSP00000334115:Y259C	ENSP00000334115:Y259C	Y	-	2	0	OR10T2	156635105	0.997000	0.39634	0.968000	0.41197	0.834000	0.47266	2.316000	0.43761	0.780000	0.33566	-0.258000	0.10820	TAT	rs139047952	OR10T2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10T2	HGNC	protein_coding	OTTHUMT00000046371.1	0	0	0	19	19	58	0.00	0.00	T	NM_001004475		158368481	-1	22	39	30	45	tier1	no_errors	ENST00000334438	ensembl	human	known	74_37	missense	42.31	45.88	SNP	0.989	C	22	30
TTC29	83894	genome.wustl.edu	37	4	147628647	147628647	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr4:147628647C>T	ENST00000325106.4	-	12	1613	c.1387G>A	c.(1387-1389)Gaa>Aaa	p.E463K	TTC29_ENST00000398886.4_Missense_Mutation_p.E489K|TTC29_ENST00000513335.1_Missense_Mutation_p.E489K	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	463										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					CTACTGAGTTCTTCCAAACGT	0.328													ENSG00000137473																																					0													126.0	121.0	123.0					4																	147628647		1819	4075	5894	SO:0001583	missense	0			-	AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1387G>A	4.37:g.147628647C>T	ENSP00000316740:p.Glu463Lys		A4GU95|Q9BXB6	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.E489K	ENST00000325106.4	37	c.1465	CCDS47141.1	4	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893006	0.33442	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000504425	T;T;T;T	0.28069	1.63;1.63;1.69;1.68	3.56	0.871	0.19107	.	0.280190	0.27130	N	0.020792	T	0.25195	0.0612	L	0.56769	1.78	0.09310	N	1	B;B;B	0.13594	0.001;0.008;0.001	B;B;B	0.12156	0.002;0.007;0.002	T	0.21690	-1.0238	10	0.59425	D	0.04	-7.5989	5.306	0.15803	0.0:0.618:0.0:0.382	.	462;489;463	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	K	489;489;463;462	ENSP00000423505:E489K;ENSP00000381861:E489K;ENSP00000316740:E463K;ENSP00000425778:E462K	ENSP00000316740:E463K	E	-	1	0	TTC29	147848097	0.001000	0.12720	0.095000	0.20976	0.314000	0.28054	0.317000	0.19487	0.153000	0.19213	0.650000	0.86243	GAA	-	TTC29	-	NULL		0.328	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC29	HGNC	protein_coding		0	0	0	31	31	27	0.00	0.00	C	NM_031956		147628647	-1	25	42	67	46	tier1	no_errors	ENST00000398886	ensembl	human	known	74_37	missense	27.17	47.73	SNP	0.128	T	25	67
MYO16	23026	genome.wustl.edu	37	13	109438081	109438081	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr13:109438081G>A	ENST00000357550.2	+	4	581	c.540G>A	c.(538-540)ctG>ctA	p.L180L	MYO16_ENST00000251041.5_Silent_p.L180L|MYO16_ENST00000356711.2_Silent_p.L180L|MYO16_ENST00000467639.1_3'UTR	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGACCTATCTGGATGAAAATG	0.378													ENSG00000041515																																					0													76.0	71.0	73.0					13																	109438081		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.540G>A	13.37:g.109438081G>A				Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L180	ENST00000357550.2	37	c.540	CCDS32008.1	13																																																																																			-	MYO16	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.378	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	0	0	0	13	13	75	0.00	0.00	G	NM_015011		109438081	+1	21	30	26	60	tier1	no_errors	ENST00000356711	ensembl	human	known	74_37	silent	44.68	33.33	SNP	1.000	A	21	26
GTF2H1	2965	genome.wustl.edu	37	11	18369142	18369142	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr11:18369142G>C	ENST00000265963.4	+	8	1005	c.845G>C	c.(844-846)gGc>gCc	p.G282A	GTF2H1_ENST00000530496.2_5'UTR|GTF2H1_ENST00000534641.1_Missense_Mutation_p.G166A|GTF2H1_ENST00000453096.2_Missense_Mutation_p.G282A|GTF2H1_ENST00000524753.4_Missense_Mutation_p.G78A	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	282					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						CAGGGCTATGGCATTTCCTCT	0.363								Nucleotide excision repair (NER)					ENSG00000110768																																					0													39.0	37.0	38.0					11																	18369142		2199	4293	6492	SO:0001583	missense	0			-		CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.845G>C	11.37:g.18369142G>C	ENSP00000265963:p.Gly282Ala		B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Missense_Mutation	SNP	pfam_BSD,pfam_TFIIH_BTF_p62_N,smart_BSD,pfscan_BSD	p.G282A	ENST00000265963.4	37	c.845	CCDS7838.1	11	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362036	0.82353	.	.	ENSG00000110768	ENST00000453096;ENST00000534641;ENST00000265963;ENST00000524753	T;T;T;T	0.34275	1.68;1.64;1.68;1.37	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	M	0.68317	2.08	0.80722	D	1	D	0.65815	0.995	P	0.59761	0.863	T	0.46665	-0.9175	10	0.29301	T	0.29	-8.6112	19.8506	0.96738	0.0:0.0:1.0:0.0	.	282	P32780	TF2H1_HUMAN	A	282;166;282;78	ENSP00000393638:G282A;ENSP00000435375:G166A;ENSP00000265963:G282A;ENSP00000436575:G78A	ENSP00000265963:G282A	G	+	2	0	GTF2H1	18325718	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.882000	0.92420	2.686000	0.91538	0.655000	0.94253	GGC	-	GTF2H1	-	NULL		0.363	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2H1	HGNC	protein_coding	OTTHUMT00000395627.2	0	0	0	26	26	21	0.00	0.00	G	NM_005316		18369142	+1	6	7	24	48	tier1	no_errors	ENST00000265963	ensembl	human	known	74_37	missense	20.00	12.73	SNP	1.000	C	6	24
GPR98	84059	genome.wustl.edu	37	5	90106134	90106134	+	Silent	SNP	T	T	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr5:90106134T>C	ENST00000405460.2	+	74	15153	c.15057T>C	c.(15055-15057)gaT>gaC	p.D5019D	GPR98_ENST00000425867.2_Silent_p.D680D	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5019	Calx-beta 33. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGTCAGAAGATACACAGATGA	0.393													ENSG00000164199																																					0													43.0	41.0	41.0					5																	90106134		1844	4095	5939	SO:0001819	synonymous_variant	0			-	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15057T>C	5.37:g.90106134T>C			O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D5019	ENST00000405460.2	37	c.15057	CCDS47246.1	5																																																																																			-	GPR98	-	pfam_Calx_beta,smart_Calx_beta		0.393	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	0	0	0	39	39	50	0.00	0.00	T	NM_032119		90106134	+1	18	35	46	52	tier1	no_errors	ENST00000405460	ensembl	human	known	74_37	silent	28.12	40.23	SNP	0.010	C	18	46
INPP5F	22876	genome.wustl.edu	37	10	121565903	121565903	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:121565903G>A	ENST00000361976.2	+	12	1517	c.1351G>A	c.(1351-1353)Gaa>Aaa	p.E451K		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	753	5-phosphatase.		D -> G (in OCRL; dbSNP:rs137853850). {ECO:0000269|PubMed:9199559}.|D -> N (in OCRL; dbSNP:rs137853838). {ECO:0000269|PubMed:21031565}.		cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ATGTAAGCAGGAAGGGATTTT	0.383													ENSG00000198825																																					0													120.0	116.0	118.0					10																	121565903		2203	4300	6503	SO:0001583	missense	0			-	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1351G>A	10.37:g.121565903G>A	ENSP00000354519:p.Glu451Lys		A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	pfam_Syja_N,pfam_Inositol_phosphatase,pfscan_Syja_N	p.E451K	ENST00000361976.2	37	c.1351	CCDS7616.1	10	.	.	.	.	.	.	.	.	.	.	G	9.984	1.228905	0.22542	.	.	ENSG00000198825	ENST00000361976	T	0.21543	2.0	5.5	5.5	0.81552	Synaptojanin, N-terminal (1);	0.111092	0.64402	D	0.000012	T	0.08714	0.0216	N	0.02247	-0.625	0.80722	D	1	B	0.30193	0.272	B	0.23419	0.046	T	0.19614	-1.0300	10	0.05833	T	0.94	-28.7048	19.425	0.94737	0.0:0.0:1.0:0.0	.	451	Q9Y2H2	SAC2_HUMAN	K	451	ENSP00000354519:E451K	ENSP00000354519:E451K	E	+	1	0	INPP5F	121555893	1.000000	0.71417	0.998000	0.56505	0.920000	0.55202	7.696000	0.84270	2.584000	0.87258	0.563000	0.77884	GAA	-	INPP5F	-	pfscan_Syja_N		0.383	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5F	HGNC	protein_coding	OTTHUMT00000050679.1	0	0	0	30	30	110	0.00	0.00	G	NM_014937		121565903	+1	10	22	50	110	tier1	no_errors	ENST00000361976	ensembl	human	known	74_37	missense	16.67	16.67	SNP	1.000	A	10	50
AGAP2	116986	genome.wustl.edu	37	12	58121737	58121737	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:58121737C>T	ENST00000547588.1	-	15	2748	c.2749G>A	c.(2749-2751)Gag>Aag	p.E917K	AGAP2_ENST00000257897.3_Missense_Mutation_p.E561K|RP11-571M6.8_ENST00000548410.2_RNA|AGAP2-AS1_ENST00000542466.2_3'UTR	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	917					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						TTGCTGCTCTCACAGCATTGC	0.592													ENSG00000135439																																					0													232.0	215.0	221.0					12																	58121737		2203	4300	6503	SO:0001583	missense	0			-	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2749G>A	12.37:g.58121737C>T	ENSP00000449241:p.Glu917Lys		A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.E917K	ENST00000547588.1	37	c.2749	CCDS44932.1	12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425230	0.83667	.	.	ENSG00000135439	ENST00000257897;ENST00000547588	T;T	0.16743	2.32;2.32	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.26412	0.0645	M	0.64080	1.96	0.80722	D	1	P;B;B	0.45957	0.869;0.199;0.126	P;B;B	0.44696	0.458;0.144;0.068	T	0.03413	-1.1039	10	0.66056	D	0.02	.	17.4429	0.87570	0.0:1.0:0.0:0.0	.	561;917;917	Q99490-2;F8VVT9;Q99490	.;.;AGAP2_HUMAN	K	561;917	ENSP00000257897:E561K;ENSP00000449241:E917K	ENSP00000257897:E561K	E	-	1	0	AGAP2	56408004	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.878000	0.63093	2.480000	0.83734	0.655000	0.94253	GAG	-	AGAP2	-	NULL		0.592	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	HGNC	protein_coding	OTTHUMT00000408367.1	0	0	0	39	39	104	0.00	0.00	C	NM_014770		58121737	-1	46	100	194	496	tier1	no_errors	ENST00000547588	ensembl	human	known	74_37	missense	19.17	16.75	SNP	1.000	T	46	194
HSD17B1	3292	genome.wustl.edu	37	17	40705302	40705302	+	Silent	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:40705302C>T	ENST00000585807.1	+	2	3978	c.258C>T	c.(256-258)gaC>gaT	p.D86D	RP11-400F19.8_ENST00000585572.1_RNA|RP11-400F19.6_ENST00000590513.1_RNA|HSD17B1_ENST00000225929.5_Silent_p.D86D	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	86					bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	GCCGCGTGGACGTGCTGGGTG	0.642													ENSG00000108786																																					0													28.0	32.0	31.0					17																	40705302		2203	4299	6502	SO:0001819	synonymous_variant	0			-		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.258C>T	17.37:g.40705302C>T			B3KXS1|Q2M2L8	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pirsf_17beta_DH,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR	p.D86	ENST00000585807.1	37	c.258	CCDS11428.1	17																																																																																			-	HSD17B1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pirsf_17beta_DH,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR		0.642	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD17B1	HGNC	protein_coding	OTTHUMT00000450392.1	1	1	0	112	112	34	0.88	0.00	C	NM_000413		40705302	+1	40	6	51	14	tier1	no_errors	ENST00000585807	ensembl	human	known	74_37	silent	43.96	30.00	SNP	0.997	T	40	51
EARS2	124454	genome.wustl.edu	37	16	23540873	23540873	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:23540873C>A	ENST00000563459.1	-	7	1308	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H	EARS2_ENST00000564987.1_5'UTR|EARS2_ENST00000564501.1_Missense_Mutation_p.Q434H|EARS2_ENST00000563232.1_Missense_Mutation_p.Q434H|EARS2_ENST00000449606.1_Missense_Mutation_p.Q434H			Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2, mitochondrial	434					gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|tRNA aminoacylation for mitochondrial protein translation (GO:0070127)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|glutamate-tRNA(Gln) ligase activity (GO:0050561)|tRNA binding (GO:0000049)			central_nervous_system(1)|endometrium(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(48;0.0353)		TGGCGTCCAGCTGTGCTCGAC	0.597													ENSG00000103356																																					0													48.0	50.0	49.0					16																	23540873		2093	4238	6331	SO:0001583	missense	0			-	AB075850	CCDS42132.1	16p12.2	2014-05-06	2012-10-26		ENSG00000103356	ENSG00000103356	6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"""	29419	protein-coding gene	gene with protein product	"""glutamate tRNA ligase 2, mitochondrial"""	612799	"""glutamyl-tRNA synthetase 2, mitochondrial (putative)"""			15779907, 19805282, 22492562	Standard	NM_001083614		Approved	KIAA1970, MSE1	uc002dlt.4	Q5JPH6	OTTHUMG00000177018	ENST00000563459.1:c.1302G>T	16.37:g.23540873C>A	ENSP00000456467:p.Gln434His		B3KTT2|D3DWF1|Q86YH3|Q8TF31	Missense_Mutation	SNP	pfam_Glu/Gln-tR-synth_Ib_cat-dom,superfamily_aa-tR-synth_I_codon-bd,prints_Glu/Gln-tR-synth,tigrfam_Glu-tR-ligase_bac/mito	p.Q434H	ENST00000563459.1	37	c.1302	CCDS42132.1	16	.	.	.	.	.	.	.	.	.	.	C	9.663	1.144631	0.21288	.	.	ENSG00000103356	ENST00000449606;ENST00000341597	T	0.44881	0.91	5.61	2.55	0.30701	Aminoacyl-tRNA synthetase, class I, anticodon-binding (1);	0.053464	0.85682	D	0.000000	T	0.40094	0.1103	M	0.72894	2.215	0.45490	D	0.998456	B;B	0.24533	0.105;0.004	B;B	0.22880	0.042;0.009	T	0.19516	-1.0303	10	0.37606	T	0.19	-3.1148	10.298	0.43635	0.0:0.7834:0.0:0.2166	.	434;434	Q86YH3;Q5JPH6	.;SYEM_HUMAN	H	434	ENSP00000395196:Q434H	ENSP00000343488:Q434H	Q	-	3	2	EARS2	23448374	0.996000	0.38824	0.357000	0.25798	0.017000	0.09413	0.401000	0.20948	0.303000	0.22785	0.563000	0.77884	CAG	-	EARS2	-	superfamily_aa-tR-synth_I_codon-bd,tigrfam_Glu-tR-ligase_bac/mito		0.597	EARS2-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	EARS2	HGNC	protein_coding	OTTHUMT00000434844.1	0	0	0	29	29	44	0.00	0.00	C	NM_133451		23540873	-1	11	9	42	53	tier1	no_errors	ENST00000449606	ensembl	human	known	74_37	missense	20.75	14.52	SNP	1.000	A	11	42
ATP11B	23200	genome.wustl.edu	37	3	182583358	182583358	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:182583358G>A	ENST00000323116.5	+	13	1575	c.1315G>A	c.(1315-1317)Gaa>Aaa	p.E439K		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	439					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			ACTTGTACCCGAAGGACCAAC	0.373													ENSG00000058063																																					0													125.0	125.0	125.0					3																	182583358		2203	4300	6503	SO:0001583	missense	0			-	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.1315G>A	3.37:g.182583358G>A	ENSP00000321195:p.Glu439Lys		Q96FN1|Q9UKK7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E439K	ENST00000323116.5	37	c.1315	CCDS33896.1	3	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352910	0.82132	.	.	ENSG00000058063	ENST00000323116	T	0.69685	-0.42	5.82	5.82	0.92795	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.803616	0.11588	N	0.549050	T	0.78052	0.4223	L	0.37466	1.105	0.80722	D	1	D;P	0.89917	1.0;0.694	D;B	0.75484	0.986;0.227	T	0.74780	-0.3549	10	0.48119	T	0.1	.	20.0915	0.97822	0.0:0.0:1.0:0.0	.	13;439	B3KSJ2;Q9Y2G3	.;AT11B_HUMAN	K	439	ENSP00000321195:E439K	ENSP00000321195:E439K	E	+	1	0	ATP11B	184066052	1.000000	0.71417	0.985000	0.45067	0.832000	0.47134	9.209000	0.95087	2.736000	0.93811	0.650000	0.86243	GAA	-	ATP11B	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.373	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	HGNC	protein_coding	OTTHUMT00000350598.1	0	0	0	20	20	40	0.00	0.00	G	NM_014616		182583358	+1	15	22	77	66	tier1	no_errors	ENST00000323116	ensembl	human	known	74_37	missense	16.30	24.72	SNP	1.000	A	15	77
DMXL1	1657	genome.wustl.edu	37	5	118539113	118539113	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr5:118539113G>A	ENST00000311085.8	+	33	7925	c.7845G>A	c.(7843-7845)aaG>aaA	p.K2615K	DMXL1_ENST00000539542.1_Silent_p.K2615K	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2615										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TATTCACAAAGAAACGGTGTC	0.323													ENSG00000172869																																					0													75.0	78.0	77.0					5																	118539113		2202	4300	6502	SO:0001819	synonymous_variant	0			-	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.7845G>A	5.37:g.118539113G>A				Silent	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K2615	ENST00000311085.8	37	c.7845	CCDS4125.1	5																																																																																			-	DMXL1	-	NULL		0.323	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	0	0	0	29	29	50	0.00	0.00	G	NM_005509		118539113	+1	27	14	121	78	tier1	no_errors	ENST00000539542	ensembl	human	known	74_37	silent	18.24	15.22	SNP	1.000	A	27	121
MYO5C	55930	genome.wustl.edu	37	15	52497276	52497276	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr15:52497276G>A	ENST00000261839.7	-	38	4767	c.4606C>T	c.(4606-4608)Cgc>Tgc	p.R1536C	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1536	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		CTAGAGGAGCGCTTCCGGAAG	0.602													ENSG00000128833																																					0													68.0	75.0	73.0					15																	52497276		2004	4147	6151	SO:0001583	missense	0			-	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4606C>T	15.37:g.52497276G>A	ENSP00000261839:p.Arg1536Cys		Q6P1W8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1536C	ENST00000261839.7	37	c.4606	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943843	0.92593	.	.	ENSG00000128833	ENST00000261839	D	0.90504	-2.68	4.66	4.66	0.58398	Dilute (1);	0.000000	0.85682	D	0.000000	D	0.95503	0.8539	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.96041	0.9024	10	0.87932	D	0	.	18.0881	0.89464	0.0:0.0:1.0:0.0	.	1536	Q9NQX4	MYO5C_HUMAN	C	1536	ENSP00000261839:R1536C	ENSP00000261839:R1536C	R	-	1	0	MYO5C	50284568	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.601000	0.98297	2.583000	0.87209	0.462000	0.41574	CGC	-	MYO5C	-	pfscan_Dilute		0.602	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1	0	0	0	17	17	25	0.00	0.00	G	NM_018728		52497276	-1	16	15	23	24	tier1	no_errors	ENST00000261839	ensembl	human	known	74_37	missense	41.03	38.46	SNP	1.000	A	16	23
C14orf37	145407	genome.wustl.edu	37	14	58604835	58604835	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr14:58604835C>G	ENST00000267485.7	-	2	1436	c.1242G>C	c.(1240-1242)ttG>ttC	p.L414F	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	414						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						TACTTTGGAGCAAGTTCACAA	0.443													ENSG00000139971																																					0													90.0	87.0	88.0					14																	58604835		2203	4300	6503	SO:0001583	missense	0			-		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1242G>C	14.37:g.58604835C>G	ENSP00000267485:p.Leu414Phe		A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	NULL	p.L414F	ENST00000267485.7	37	c.1242	CCDS32089.1	14	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454245	0.63290	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.21734	1.99	5.75	2.39	0.29439	.	1.012730	0.07919	N	0.975556	T	0.39384	0.1076	M	0.64997	1.995	0.09310	N	1	D;D;D;D	0.63046	0.977;0.992;0.977;0.977	P;P;P;P	0.62813	0.803;0.907;0.803;0.803	T	0.13791	-1.0496	10	0.59425	D	0.04	0.3821	8.0285	0.30451	0.0:0.579:0.327:0.094	.	452;414;414;414	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	F	414;452	ENSP00000267485:L414F	ENSP00000267485:L414F	L	-	3	2	C14orf37	57674588	0.000000	0.05858	0.016000	0.15963	0.430000	0.31655	-0.539000	0.06113	0.722000	0.32252	0.655000	0.94253	TTG	-	C14orf37	-	NULL		0.443	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	HGNC	protein_coding	OTTHUMT00000412059.1	0	0	1	44	44	119	0.00	0.83	C	NM_001001872		58604835	-1	12	13	49	74	tier1	no_errors	ENST00000267485	ensembl	human	known	74_37	missense	19.67	14.77	SNP	0.002	G	12	49
CADM4	199731	genome.wustl.edu	37	19	44130154	44130154	+	Splice_Site	SNP	C	C	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr19:44130154C>G	ENST00000222374.2	-	6	713		c.e6-1		CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4						cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				GTGGGGGAGTCTGTTAGGCAA	0.617													ENSG00000105767																																					0													51.0	50.0	50.0					19																	44130154		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.665-1G>C	19.37:g.44130154C>G			B2R7L5|Q9Y4A4	Splice_Site	SNP	-	e6-1	ENST00000222374.2	37	c.665-1	CCDS12627.1	19	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038872	0.55003	.	.	ENSG00000105767	ENST00000222374	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6608	0.85240	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CADM4	48821994	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	5.014000	0.64029	2.538000	0.85594	0.491000	0.48974	.	-	CADM4	-	-		0.617	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM4	HGNC	protein_coding	OTTHUMT00000463352.1	0	0	1	43	43	99	0.00	1.00	C	NM_145296	Intron	44130154	-1	12	14	42	51	tier1	no_errors	ENST00000222374	ensembl	human	known	74_37	splice_site	22.22	21.54	SNP	1.000	G	12	42
SSPO	23145	genome.wustl.edu	37	7	149493130	149493130	+	RNA	SNP	G	G	A	rs566756129		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr7:149493130G>A	ENST00000378016.2	+	0	6534							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GAGACAAACCGCACGAAGCGG	0.627													ENSG00000197558	G|||	1	0.000199681	0.0008	0.0	5008	,	,		20086	0.0		0.0	False		,,,				2504	0.0																0																																												0			-	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149493130G>A			Q76B61	R	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	SSPO	-	-		0.627	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		0	0	0	30	30	69	0.00	0.00	G			149493130	+1	16	22	36	41	tier1	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	30.77	34.92	SNP	0.004	A	16	36
FKBP10	60681	genome.wustl.edu	37	17	39973444	39973444	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:39973444G>T	ENST00000321562.4	+	2	484	c.380G>T	c.(379-381)aGc>aTc	p.S127I	FKBP10_ENST00000544340.1_5'Flank	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	127	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		GGCTATGGGAGCATCGGCCTG	0.642													ENSG00000141756																																					0													66.0	65.0	66.0					17																	39973444		2203	4300	6503	SO:0001583	missense	0			-	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.380G>T	17.37:g.39973444G>T	ENSP00000317232:p.Ser127Ile		Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.S127I	ENST00000321562.4	37	c.380	CCDS11409.1	17	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072909	0.76415	.	.	ENSG00000141756	ENST00000269598;ENST00000429461;ENST00000321562;ENST00000414352	D;D	0.86366	-2.11;-2.11	5.35	5.35	0.76521	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.000000	0.85682	D	0.000000	D	0.90380	0.6989	M	0.64404	1.975	0.80722	D	1	P	0.49090	0.919	P	0.55749	0.783	D	0.91118	0.4927	10	0.72032	D	0.01	-10.7618	14.3574	0.66748	0.0732:0.0:0.9268:0.0	.	127	Q96AY3	FKB10_HUMAN	I	127;67;127;127	ENSP00000408232:S67I;ENSP00000317232:S127I	ENSP00000269598:S127I	S	+	2	0	FKBP10	37226970	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.550000	0.67268	2.526000	0.85167	0.561000	0.74099	AGC	-	FKBP10	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom		0.642	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	HGNC	protein_coding	OTTHUMT00000257410.2	0	0	0	16	16	21	0.00	0.00	G	NM_021939		39973444	+1	7	5	8	13	tier1	no_errors	ENST00000321562	ensembl	human	known	74_37	missense	46.67	27.78	SNP	1.000	T	7	8
CILP	8483	genome.wustl.edu	37	15	65499236	65499236	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr15:65499236C>A	ENST00000261883.4	-	4	474	c.308G>T	c.(307-309)gGc>gTc	p.G103V		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	103					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GCCAGTGCTGCCCGCAGGTGT	0.622													ENSG00000138615																																					0													36.0	34.0	35.0					15																	65499236		2201	4299	6500	SO:0001583	missense	0			-	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.308G>T	15.37:g.65499236C>A	ENSP00000261883:p.Gly103Val		B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.G103V	ENST00000261883.4	37	c.308	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703091	0.48412	.	.	ENSG00000138615	ENST00000261883	T	0.16743	2.32	5.58	1.19	0.21007	.	0.334287	0.35903	N	0.002905	T	0.13030	0.0316	L	0.39898	1.24	0.20307	N	0.999916	P	0.42871	0.792	P	0.44860	0.462	T	0.13229	-1.0517	10	0.18710	T	0.47	0.2513	5.1895	0.15203	0.1295:0.5084:0.2805:0.0817	.	103	O75339	CILP1_HUMAN	V	103	ENSP00000261883:G103V	ENSP00000261883:G103V	G	-	2	0	CILP	63286289	0.010000	0.17322	0.719000	0.30619	0.721000	0.41392	1.543000	0.36147	0.663000	0.31027	0.561000	0.74099	GGC	-	CILP	-	NULL		0.622	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	0	0	0	20	20	37	0.00	0.00	C	NM_003613		65499236	-1	7	10	15	18	tier1	no_errors	ENST00000261883	ensembl	human	known	74_37	missense	31.82	35.71	SNP	0.001	A	7	15
TTN	7273	genome.wustl.edu	37	2	179429737	179429737	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr2:179429737G>A	ENST00000591111.1	-	276	76423	c.76199C>T	c.(76198-76200)aCg>aTg	p.T25400M	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T27041M|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T24473M|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T18101M|TTN_ENST00000460472.2_Missense_Mutation_p.T17976M|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T18168M			Q8WZ42	TITIN_HUMAN	titin	25400	Fibronectin type-III 84. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGGTACTCCGTGCCTGTTTT	0.393													ENSG00000155657																																					0													136.0	134.0	134.0					2																	179429737		1884	4097	5981	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76199C>T	2.37:g.179429737G>A	ENSP00000465570:p.Thr25400Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T24473M	ENST00000591111.1	37	c.73418		2	.	.	.	.	.	.	.	.	.	.	G	7.656	0.683867	0.14907	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	5.88	-0.83	0.10792	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67021	0.2849	M	0.65677	2.01	0.09310	N	1	P;P;P;P	0.40083	0.702;0.702;0.702;0.702	B;B;B;B	0.41813	0.231;0.231;0.367;0.367	T	0.68029	-0.5517	9	0.87932	D	0	.	21.8457	0.99962	0.0:0.5919:0.4081:0.0	.	17976;18101;18168;25400	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	24473;17976;18168;18101;17974	ENSP00000343764:T24473M;ENSP00000434586:T17976M;ENSP00000340554:T18168M;ENSP00000352154:T18101M	ENSP00000340554:T18168M	T	-	2	0	TTN	179137983	0.577000	0.26708	0.264000	0.24511	0.990000	0.78478	0.901000	0.28445	-0.135000	0.11495	0.555000	0.69702	ACG	-	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	29	29	78	0.00	0.00	G	NM_133378		179429737	-1	19	37	39	92	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	32.76	28.46	SNP	0.209	A	19	39
LGR5	8549	genome.wustl.edu	37	12	71955560	71955560	+	Splice_Site	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:71955560G>C	ENST00000266674.5	+	8	1096		c.e8-1		LGR5_ENST00000540815.2_Intron|LGR5_ENST00000536515.1_Splice_Site			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5						G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TCTCTTTCTAGAGGATTTCAT	0.368													ENSG00000139292																																					0													52.0	47.0	49.0					12																	71955560		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.786-1G>C	12.37:g.71955560G>C			D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Splice_Site	SNP	-	e8-1	ENST00000266674.5	37	c.786-1	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874737	0.91664	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LGR5	70241827	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.623000	0.98386	2.937000	0.99478	0.650000	0.86243	.	-	LGR5	-	-		0.368	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	0	0	0	33	33	29	0.00	0.00	G	NM_003667	Intron	71955560	+1	384	321	117	101	tier1	no_errors	ENST00000266674	ensembl	human	known	74_37	splice_site	76.49	75.89	SNP	1.000	C	384	117
ATRX	546	genome.wustl.edu	37	X	76890194	76890194	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chrX:76890194C>T	ENST00000373344.5	-	17	4914	c.4700G>A	c.(4699-4701)gGt>gAt	p.G1567D	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Splice_Site_p.G1529D	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1567					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAACTGAACACCTAAAAATAA	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											115.0	115.0	115.0					X																	76890194		2203	4296	6499	SO:0001630	splice_region_variant	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4700-1G>A	X.37:g.76890194C>T			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G1567D	ENST00000373344.5	37	c.4700	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	19.64	3.866043	0.71949	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.94457	-3.43;-3.43	5.77	5.77	0.91146	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.85682	U	0.000000	D	0.98592	0.9529	H	0.98314	4.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99694	1.1002	10	0.87932	D	0	.	18.913	0.92493	0.0:1.0:0.0:0.0	.	1529;1567	P46100-4;P46100	.;ATRX_HUMAN	D	1567;1529	ENSP00000362441:G1567D;ENSP00000378967:G1529D	ENSP00000362441:G1567D	G	-	2	0	ATRX	76776850	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.463000	0.80869	2.414000	0.81942	0.600000	0.82982	GGT	-	ATRX	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	15	15	47	0.00	0.00	C	NM_000489	Missense_Mutation	76890194	-1	34	43	14	22	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	70.83	66.15	SNP	1.000	T	34	14
UBTF	7343	genome.wustl.edu	37	17	42290278	42290278	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:42290278G>A	ENST00000302904.4	-	7	1061	c.569C>T	c.(568-570)gCc>gTc	p.A190V	UBTF_ENST00000343638.5_Missense_Mutation_p.A190V|UBTF_ENST00000533177.1_Missense_Mutation_p.A190V|UBTF_ENST00000537550.1_5'Flank|UBTF_ENST00000527034.1_Missense_Mutation_p.A190V|UBTF_ENST00000529383.1_Missense_Mutation_p.A190V|UBTF_ENST00000436088.1_Missense_Mutation_p.A190V|UBTF_ENST00000393606.3_Missense_Mutation_p.A190V|UBTF_ENST00000526094.1_Missense_Mutation_p.A190V|CTB-175E5.7_ENST00000586560.1_RNA			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	190					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CGATTTCTTGGCATTCTGGAT	0.587													ENSG00000108312																																					0													161.0	155.0	157.0					17																	42290278		2203	4300	6503	SO:0001583	missense	0			-	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.569C>T	17.37:g.42290278G>A	ENSP00000302640:p.Ala190Val		A8K6R8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_ARM-type_fold,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A190V	ENST00000302904.4	37	c.569	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	g	15.09	2.730484	0.48939	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383	D;D;D;D;D;D;D;D	0.98329	-4.84;-4.11;-4.87;-4.84;-4.11;-4.84;-4.84;-4.11	5.0	5.0	0.66597	High mobility group, HMG1/HMG2 (1);	0.265763	0.38720	N	0.001587	D	0.93933	0.8058	N	0.03608	-0.345	0.31864	N	0.62057	P;P;B	0.41643	0.629;0.758;0.021	B;B;B	0.41646	0.199;0.362;0.015	D	0.93192	0.6584	10	0.30854	T	0.27	-23.7501	17.5755	0.87947	0.0:0.0:1.0:0.0	.	190;190;190	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	V	190	ENSP00000345297:A190V;ENSP00000302640:A190V;ENSP00000431539:A190V;ENSP00000437180:A190V;ENSP00000390669:A190V;ENSP00000377231:A190V;ENSP00000432925:A190V;ENSP00000435708:A190V	ENSP00000302640:A190V	A	-	2	0	UBTF	39645804	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.618000	0.67722	2.757000	0.94681	0.655000	0.94253	GCC	-	UBTF	-	superfamily_ARM-type_fold		0.587	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	HGNC	protein_coding	OTTHUMT00000395205.1	0	0	0	59	59	208	0.00	0.00	G	NM_014233		42290278	-1	26	34	35	58	tier1	no_errors	ENST00000302904	ensembl	human	known	74_37	missense	42.62	36.96	SNP	1.000	A	26	35
MPZL1	9019	genome.wustl.edu	37	1	167691169	167691169	+	5'Flank	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:167691169G>C	ENST00000359523.2	+	0	0				MPZL1_ENST00000392121.3_5'Flank|MPZL1_ENST00000474859.1_5'Flank	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1						cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					AAGGGTGCGGGCAGGCCAATG	0.716													ENSG00000197965																																					0																																										SO:0001631	upstream_gene_variant	0			-	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571		1.37:g.167691169G>C	Exception_encountered		B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	R	SNP	-	NULL	ENST00000359523.2	37	NULL	CCDS1264.1	1																																																																																			-	MPZL1	-	-		0.716	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPZL1	HGNC	protein_coding	OTTHUMT00000083655.2	0	0	0	33	33	45	0.00	0.00	G	NM_024569		167691169	+1	10	9	13	16	tier1	no_errors	ENST00000487858	ensembl	human	putative	74_37	rna	43.48	36.00	SNP	0.000	C	10	13
TMPRSS3	64699	genome.wustl.edu	37	21	43815480	43815480	+	Missense_Mutation	SNP	C	C	T	rs369418733		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr21:43815480C>T	ENST00000291532.3	-	2	1002	c.47G>A	c.(46-48)cGa>cAa	p.R16Q	TMPRSS3_ENST00000398397.3_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.R100Q|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.R16Q	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	16					cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						AAAAAGCGATCGGAATGAGAA	0.517													ENSG00000160183																																					0								C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	102.0	107.0		47,47	4.5	1.0	21		107	0,8600		0,0,4300	no	missense,missense	TMPRSS3	NM_024022.2,NM_032405.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	16/455,16/345	43815480	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.47G>A	21.37:g.43815480C>T	ENSP00000291532:p.Arg16Gln		D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_SRCR,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_LDrepeatLR_classA_rpt,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R100Q	ENST00000291532.3	37	c.299	CCDS13686.1	21	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916630	0.73098	2.27E-4	0.0	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	D;D;D;D;D	0.88354	-2.33;-2.33;-2.33;-2.37;-2.33	5.39	4.5	0.54988	.	0.132141	0.36628	N	0.002499	T	0.80276	0.4593	N	0.19112	0.55	0.28577	N	0.910325	D;P;P	0.57899	0.981;0.948;0.913	B;B;B	0.43916	0.436;0.237;0.12	T	0.74551	-0.3628	9	.	.	.	.	9.3585	0.38182	0.0:0.904:0.0:0.096	.	16;16;16	P57727-3;P57727-5;P57727	.;.;TMPS3_HUMAN	Q	16;16;16;100;16	ENSP00000291532:R16Q;ENSP00000411013:R16Q;ENSP00000381442:R16Q;ENSP00000369762:R100Q;ENSP00000381434:R16Q	.	R	-	2	0	TMPRSS3	42688549	0.993000	0.37304	0.956000	0.39512	0.959000	0.62525	1.712000	0.37940	2.691000	0.91804	0.655000	0.94253	CGA	-	TMPRSS3	-	NULL		0.517	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS3	HGNC	protein_coding	OTTHUMT00000195347.1	0	0	0	32	32	90	0.00	0.00	C			43815480	-1	14	25	47	64	tier1	no_errors	ENST00000380399	ensembl	human	known	74_37	missense	22.95	28.09	SNP	0.958	T	14	47
PHTF1	10745	genome.wustl.edu	37	1	114281367	114281367	+	Missense_Mutation	SNP	C	C	T	rs376636226		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:114281367C>T	ENST00000369604.1	-	4	640	c.157G>A	c.(157-159)Gtt>Att	p.V53I	PHTF1_ENST00000369600.1_Missense_Mutation_p.V53I|PHTF1_ENST00000369598.1_Missense_Mutation_p.V53I|PHTF1_ENST00000393357.2_Missense_Mutation_p.V53I|PHTF1_ENST00000357783.2_Missense_Mutation_p.V53I|PHTF1_ENST00000447664.2_Missense_Mutation_p.V53I|PHTF1_ENST00000369596.2_Missense_Mutation_p.V53I			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	53					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTAAGTCAACGTCAATCAAG	0.294													ENSG00000116793																																					0								C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	149.0	156.0	153.0		157	4.8	1.0	1		153	0,8600		0,0,4300	no	missense	PHTF1	NM_006608.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	53/763	114281367	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.157G>A	1.37:g.114281367C>T	ENSP00000358617:p.Val53Ile		Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	pfam_TF_homeodomain_male	p.V53I	ENST00000369604.1	37	c.157	CCDS861.1	1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.080172	0.55753	2.27E-4	0.0	ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783;ENST00000447664;ENST00000446739	.	.	.	5.68	4.77	0.60923	Transcription factor homeodomain, male germ-cell (1);	0.000000	0.85682	D	0.000000	T	0.65698	0.2716	M	0.85542	2.76	0.80722	D	1	D;D;D;D	0.63880	0.964;0.964;0.993;0.982	P;B;P;P	0.51945	0.477;0.437;0.62;0.685	T	0.71272	-0.4642	9	0.46703	T	0.11	-19.2185	12.9872	0.58598	0.0:0.9254:0.0:0.0746	.	53;53;53;53	F5H7M5;Q9UMS5;B4DGS8;Q9UMS5-2	.;PHTF1_HUMAN;.;.	I	53	.	ENSP00000350428:V53I	V	-	1	0	PHTF1	114082890	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	7.645000	0.83430	1.413000	0.46997	-0.145000	0.13849	GTT	-	PHTF1	-	pfam_TF_homeodomain_male		0.294	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	HGNC	protein_coding	OTTHUMT00000032666.1	0	0	0	61	61	67	0.00	0.00	C	NM_006608		114281367	-1	53	43	84	73	tier1	no_errors	ENST00000369604	ensembl	human	known	74_37	missense	38.69	37.07	SNP	1.000	T	53	84
AC018755.1	0	genome.wustl.edu	37	19	52097498	52097498	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr19:52097498T>G	ENST00000301439.3	-	1	132	c.77A>C	c.(76-78)aAt>aCt	p.N26T	AC018755.16_ENST00000598755.1_RNA																							CCTTTTCACATTCCCAATCTC	0.537													ENSG00000167765																																					0																																										SO:0001583	missense	0			-																												ENST00000301439.3:c.77A>C	19.37:g.52097498T>G	ENSP00000301439:p.Asn26Thr			Missense_Mutation	SNP	NULL	p.N26T	ENST00000301439.3	37	c.77		19	.	.	.	.	.	.	.	.	.	.	T	2.919	-0.223557	0.06061	.	.	ENSG00000167765	ENST00000301439	.	.	.	2.1	-0.317	0.12736	.	.	.	.	.	T	0.29061	0.0722	.	.	.	0.09310	N	1	B	0.27823	0.19	B	0.30716	0.119	T	0.34800	-0.9814	7	0.87932	D	0	.	2.656	0.05012	0.2805:0.5488:0.0:0.1707	.	26	Q96NP5	.	T	26	.	ENSP00000301439:N26T	N	-	2	0	AC018755.11	56789310	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.656000	0.05342	0.037000	0.15575	-0.558000	0.04189	AAT	-	AC018755.1	-	NULL		0.537	AC018755.1-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ENSG00000167765	Clone_based_ensembl_gene	protein_coding		0	0	0	53	53	131	0.00	0.00	T			52097498	-1	16	26	16	42	tier1	no_errors	ENST00000301439	ensembl	human	known	74_37	missense	50.00	38.24	SNP	0.002	G	16	16
CFAP43	80217	genome.wustl.edu	37	10	105944776	105944776	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:105944776C>T	ENST00000278064.2	-	16	2257	c.1932G>A	c.(1930-1932)tgG>tgA	p.W644*	WDR96_ENST00000428666.1_Nonsense_Mutation_p.W714*|WDR96_ENST00000357060.3_Nonsense_Mutation_p.W713*																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTACGTACTTCCACTTTAGGT	0.403													ENSG00000197748																																					0													200.0	172.0	182.0					10																	105944776		2203	4300	6503	SO:0001587	stop_gained	0			-																												ENST00000278064.2:c.1932G>A	10.37:g.105944776C>T	ENSP00000278064:p.Trp644*			Nonsense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu	p.W713*	ENST00000278064.2	37	c.2139		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.536514|8.536514	0.98854|0.98854	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000434629|ENST00000357060;ENST00000428666;ENST00000278064	.|.	.|.	.|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	.|0.260238	.|0.32703	.|N	.|0.005760	T|.	0.69967|.	0.3170|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71457|.	-0.4587|.	3|.	.|0.33141	.|T	.|0.24	.|.	16.1676|16.1676	0.81782|0.81782	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	74|713;714;644	.|.	.|ENSP00000278064:W644X	G|W	-|-	2|3	0|0	WDR96|WDR96	105934766|105934766	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.638000|0.638000	0.38207|0.38207	4.369000|4.369000	0.59511|0.59511	2.403000|2.403000	0.81681|0.81681	0.655000|0.655000	0.94253|0.94253	GGA|TGG	-	WDR96	-	superfamily_WD40_repeat_dom		0.403	WDR96-003	KNOWN	basic	protein_coding	WDR96	HGNC	protein_coding	OTTHUMT00000050200.1	0	0	0	34	34	83	0.00	0.00	C			105944776	-1	7	17	15	75	tier1	no_errors	ENST00000357060	ensembl	human	known	74_37	nonsense	31.82	18.48	SNP	1.000	T	7	15
EMX2	2018	genome.wustl.edu	37	10	119307608	119307608	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:119307608G>T	ENST00000553456.3	+	3	1448	c.624G>T	c.(622-624)aaG>aaT	p.K208N	EMX2_ENST00000546446.1_3'UTR|EMX2_ENST00000442245.4_Missense_Mutation_p.V147F	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	208					anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		GAAGAACAAAGTTCAAAAGGC	0.488													ENSG00000170370																																					0													56.0	51.0	53.0					10																	119307608		2203	4300	6503	SO:0001583	missense	0			-	AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.624G>T	10.37:g.119307608G>T	ENSP00000450962:p.Lys208Asn		G3V305|Q96NN8|Q9BQF4	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_HTH_motif	p.K208N	ENST00000553456.3	37	c.624	CCDS7601.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.545742|4.545742	0.86022|0.86022	.|.	.|.	ENSG00000170370|ENSG00000258614	ENST00000369201|ENST00000553456	.|.	.|.	.|.	5.31|5.31	2.38|2.38	0.29361|0.29361	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64327|0.64327	0.2588|0.2588	M|M	0.93898|0.93898	3.47|3.47	0.28467|0.28467	N|N	0.915583|0.915583	D|P	0.89917|0.39250	1.0|0.665	D|B	0.97110|0.41088	1.0|0.347	T|T	0.63051|0.63051	-0.6723|-0.6723	9|7	0.87932|.	D|.	0|.	-18.7931|-18.7931	9.8207|9.8207	0.40880|0.40880	0.2285:0.0:0.7715:0.0|0.2285:0.0:0.7715:0.0	.|.	208|147	Q04743|G3V305	EMX2_HUMAN|.	N|F	208|147	.|.	ENSP00000358202:K208N|.	K|V	+|+	3|1	2|0	EMX2|AC005871.1	119297598|119297598	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.399000|2.399000	0.44495|0.44495	0.597000|0.597000	0.29811|0.29811	0.549000|0.549000	0.68633|0.68633	AAG|GTT	-	EMX2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_HTH_motif		0.488	EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMX2	HGNC	protein_coding	OTTHUMT00000050569.4	0	0	0	34	34	135	0.00	0.00	G	NM_004098		119307608	+1	11	11	30	55	tier1	no_errors	ENST00000553456	ensembl	human	known	74_37	missense	26.83	16.67	SNP	1.000	T	11	30
NR2C1	7181	genome.wustl.edu	37	12	95434360	95434360	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:95434360G>C	ENST00000333003.5	-	10	1475	c.1145C>G	c.(1144-1146)tCt>tGt	p.S382C	NR2C1_ENST00000393101.3_Missense_Mutation_p.S382C|NR2C1_ENST00000545833.1_5'UTR|NR2C1_ENST00000330677.7_Missense_Mutation_p.S382C	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	382					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S382F(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						AGGCATAGGAGAAGGCATGGT	0.398													ENSG00000120798																																					1	Substitution - Missense(1)	large_intestine(1)											131.0	113.0	119.0					12																	95434360		2203	4300	6503	SO:0001583	missense	0			-	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1145C>G	12.37:g.95434360G>C	ENSP00000333275:p.Ser382Cys		A8K5K4|Q15625|Q15626	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.S382C	ENST00000333003.5	37	c.1145	CCDS9051.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.31|16.31	3.086795|3.086795	0.55861|0.55861	.|.	.|.	ENSG00000120798|ENSG00000120798	ENST00000551647|ENST00000333003;ENST00000393101;ENST00000330677	.|D;D;D	.|0.96967	.|-4.19;-4.19;-4.19	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	.|0.171825	.|0.53938	.|D	.|0.000049	D|D	0.98160|0.98160	0.9392|0.9392	M|M	0.79475|0.79475	2.455|2.455	0.47511|0.47511	D|D	0.999441|0.999441	.|D;D;D;D	.|0.76494	.|0.999;0.999;0.999;0.999	.|D;P;D;D	.|0.79784	.|0.993;0.89;0.926;0.933	D|D	0.98214|0.98214	1.0474|1.0474	5|10	.|0.66056	.|D	.|0.02	.|.	20.6208|20.6208	0.99490|0.99490	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|382;382;382;382	.|B6ZGT7;P13056-3;P13056-2;P13056	.|.;.;.;NR2C1_HUMAN	L|C	5|382	.|ENSP00000333275:S382C;ENSP00000376813:S382C;ENSP00000328843:S382C	.|ENSP00000328843:S382C	F|S	-|-	3|2	2|0	NR2C1|NR2C1	93958491|93958491	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	4.782000|4.782000	0.62396|0.62396	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	TTC|TCT	-	NR2C1	-	superfamily_Nucl_hormone_rcpt_ligand-bd		0.398	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	HGNC	protein_coding	OTTHUMT00000407565.2	0	0	0	59	59	76	0.00	0.00	G	NM_003297		95434360	-1	55	56	112	121	tier1	no_errors	ENST00000333003	ensembl	human	known	74_37	missense	32.93	31.64	SNP	1.000	C	55	112
CD58	965	genome.wustl.edu	37	1	117087035	117087035	+	Missense_Mutation	SNP	C	C	T	rs369159196		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:117087035C>T	ENST00000369489.5	-	2	328	c.262G>A	c.(262-264)Ggt>Agt	p.G88S	CD58_ENST00000457047.2_Missense_Mutation_p.G88S|CD58_ENST00000369487.3_Missense_Mutation_p.G88S	NM_001779.2	NP_001770.1	P19256	LFA3_HUMAN	CD58 molecule	88	Ig-like.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interferon-gamma (GO:0071346)|cellular response to tumor necrosis factor (GO:0071356)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|positive regulation of interleukin-8 secretion (GO:2000484)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		GTGAGGCTACCTGACACAGTG	0.338													ENSG00000116815																																					0													97.0	99.0	98.0					1																	117087035		2202	4300	6502	SO:0001583	missense	0			-	BC005930	CCDS888.1, CCDS44199.1	1p13	2008-02-05	2006-03-28		ENSG00000116815	ENSG00000116815		"""CD molecules"""	1688	protein-coding gene	gene with protein product		153420	"""CD58 antigen, (lymphocyte function-associated antigen 3)"""	LFA3		9510189	Standard	NM_001144822		Approved		uc001egm.3	P19256	OTTHUMG00000022749	ENST00000369489.5:c.262G>A	1.37:g.117087035C>T	ENSP00000358501:p.Gly88Ser		A8K7G5|Q5U053|Q6IB65|Q96KI9	Missense_Mutation	SNP	NULL	p.G88S	ENST00000369489.5	37	c.262	CCDS888.1	1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069261	0.55539	.	.	ENSG00000116815	ENST00000369489;ENST00000457047;ENST00000526981;ENST00000369487	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	3.71	3.71	0.42584	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.094859	0.39475	N	0.001346	T	0.23886	0.0578	L	0.58810	1.83	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.03545	-1.1026	10	0.22706	T	0.39	-21.9633	11.1519	0.48464	0.0:1.0:0.0:0.0	.	88;88;88	P19256-3;B1AMW1;P19256	.;.;LFA3_HUMAN	S	88;88;60;88	ENSP00000358501:G88S;ENSP00000409080:G88S;ENSP00000433648:G60S;ENSP00000358499:G88S	ENSP00000358499:G88S	G	-	1	0	CD58	116888558	0.012000	0.17670	0.031000	0.17742	0.004000	0.04260	1.412000	0.34714	2.063000	0.61619	0.561000	0.74099	GGT	-	CD58	-	NULL		0.338	CD58-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD58	HGNC	protein_coding	OTTHUMT00000059036.1	0	0	0	31	31	42	0.00	0.00	C	NM_001779		117087035	-1	23	17	50	70	tier1	no_errors	ENST00000369489	ensembl	human	known	74_37	missense	31.51	19.54	SNP	0.056	T	23	50
TMEM40	55287	genome.wustl.edu	37	3	12778114	12778114	+	Silent	SNP	G	G	A	rs199796616	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:12778114G>A	ENST00000314124.7	-	10	938	c.582C>T	c.(580-582)ttC>ttT	p.F194F	TMEM40_ENST00000264728.8_Silent_p.F194F|TMEM40_ENST00000435218.2_Silent_p.F164F|TMEM40_ENST00000431022.2_Silent_p.F210F|TMEM40_ENST00000476331.1_5'UTR|TMEM40_ENST00000435575.1_Silent_p.F118F	NM_001284406.1|NM_018306.2	NP_001271335.1|NP_060776.2	Q8WWA1	TMM40_HUMAN	transmembrane protein 40	194						integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(5)|urinary_tract(1)	10						CCAGGGAGGCGAAGGTGAGCA	0.597													ENSG00000088726	G|||	2	0.000399361	0.0008	0.0	5008	,	,		15525	0.0		0.001	False		,,,				2504	0.0																0													85.0	50.0	62.0					3																	12778114		2194	4288	6482	SO:0001819	synonymous_variant	0			GMAF=0.0005	BC020658	CCDS2613.1, CCDS68347.1, CCDS68348.1	3p25.2	2005-01-10			ENSG00000088726	ENSG00000088726			25620	protein-coding gene	gene with protein product						12477932	Standard	NM_018306		Approved	FLJ11036	uc003bxg.1	Q8WWA1	OTTHUMG00000129801	ENST00000314124.7:c.582C>T	3.37:g.12778114G>A			C9JID5|Q8NAL4|Q9NUZ4	Silent	SNP	NULL	p.F210	ENST00000314124.7	37	c.630	CCDS2613.1	3																																																																																			rs199796616	TMEM40	-	NULL		0.597	TMEM40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM40	HGNC	protein_coding	OTTHUMT00000252029.2	0	0	0	55	55	50	0.00	0.00	G	NM_018306		12778114	-1	27	33	55	40	tier1	no_errors	ENST00000431022	ensembl	human	known	74_37	silent	32.93	45.21	SNP	0.899	A	27	55
TTLL5	23093	genome.wustl.edu	37	14	76330059	76330059	+	Missense_Mutation	SNP	G	G	A	rs542956518		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr14:76330059G>A	ENST00000298832.9	+	29	3581	c.3376G>A	c.(3376-3378)Gtg>Atg	p.V1126M	TTLL5_ENST00000554510.1_Missense_Mutation_p.V635M|TTLL5_ENST00000557636.1_Missense_Mutation_p.V1141M|TTLL5_ENST00000556893.1_Missense_Mutation_p.V677M	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	1126					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		AGAAAACAACGTGTACAGCCA	0.502													ENSG00000119685																																					0													104.0	101.0	102.0					14																	76330059		2203	4300	6503	SO:0001583	missense	0			-	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.3376G>A	14.37:g.76330059G>A	ENSP00000298832:p.Val1126Met		B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.V1126M	ENST00000298832.9	37	c.3376	CCDS32124.1	14	.	.	.	.	.	.	.	.	.	.	G	12.62	1.993627	0.35131	.	.	ENSG00000119685	ENST00000286653;ENST00000557636;ENST00000298832;ENST00000393826;ENST00000556893;ENST00000554510	T;T;T;T	0.25085	3.92;4.0;1.82;1.83	5.78	3.97	0.46021	.	0.633514	0.16692	N	0.203500	T	0.18467	0.0443	N	0.14661	0.345	0.21933	N	0.999466	P;P;P;P	0.52170	0.951;0.945;0.951;0.71	P;B;P;B	0.47251	0.542;0.36;0.542;0.181	T	0.05022	-1.0911	10	0.66056	D	0.02	.	7.3064	0.26451	0.1404:0.0:0.7241:0.1355	.	1141;200;677;1126	G3V2J9;F8W7N3;Q6EMB2-2;Q6EMB2	.;.;.;TTLL5_HUMAN	M	200;1141;1126;677;677;635	ENSP00000450713:V1141M;ENSP00000298832:V1126M;ENSP00000452524:V677M;ENSP00000451946:V635M	ENSP00000286653:V200M	V	+	1	0	TTLL5	75399812	0.961000	0.32948	0.983000	0.44433	0.398000	0.30690	3.112000	0.50368	0.924000	0.37069	-0.119000	0.15052	GTG	-	TTLL5	-	NULL		0.502	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	0	0	0	33	33	78	0.00	0.00	G	NM_015072		76330059	+1	20	13	32	50	tier1	no_errors	ENST00000298832	ensembl	human	known	74_37	missense	38.46	20.63	SNP	0.839	A	20	32
PTCH1	5727	genome.wustl.edu	37	9	98239127	98239127	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr9:98239127G>C	ENST00000331920.6	-	11	1815	c.1516C>G	c.(1516-1518)Ctc>Gtc	p.L506V	PTCH1_ENST00000429896.2_Missense_Mutation_p.L355V|PTCH1_ENST00000421141.1_Missense_Mutation_p.L355V|PTCH1_ENST00000430669.2_Missense_Mutation_p.L440V|PTCH1_ENST00000437951.1_Missense_Mutation_p.L440V|PTCH1_ENST00000375274.2_Missense_Mutation_p.L505V|PTCH1_ENST00000418258.1_Missense_Mutation_p.L355V	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	506	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.		FL -> LR (in BCNS).		brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCAAGAGCGAGAAATGGCAAA	0.438													ENSG00000185920																																					0													140.0	108.0	119.0					9																	98239127		2203	4300	6503	SO:0001583	missense	0			-	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1516C>G	9.37:g.98239127G>C	ENSP00000332353:p.Leu506Val		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.L506V	ENST00000331920.6	37	c.1516	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199427	0.58126	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271	D;D;D;D;D;D;D;D	0.97772	-4.53;-4.53;-4.53;-4.53;-4.53;-4.53;-4.53;-4.53	5.54	4.64	0.57946	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.98573	0.9523	M	0.78801	2.425	0.58432	D	0.999991	D;D;P;D	0.89917	1.0;0.966;0.938;0.972	D;P;P;P	0.87578	0.998;0.747;0.801;0.836	D	0.99609	1.0980	10	0.62326	D	0.03	-22.7339	16.6136	0.84901	0.0:0.13:0.87:0.0	.	355;440;505;506	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	V	506;440;355;355;440;355;505;171	ENSP00000332353:L506V;ENSP00000389744:L440V;ENSP00000399981:L355V;ENSP00000396135:L355V;ENSP00000410287:L440V;ENSP00000414823:L355V;ENSP00000364423:L505V;ENSP00000364420:L171V	ENSP00000332353:L506V	L	-	1	0	PTCH1	97278948	1.000000	0.71417	0.934000	0.37439	0.531000	0.34715	4.271000	0.58902	1.562000	0.49601	0.655000	0.94253	CTC	-	PTCH1	-	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched		0.438	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2	0	0	0	21	21	99	0.00	0.00	G	NM_000264		98239127	-1	27	34	50	94	tier1	no_errors	ENST00000331920	ensembl	human	known	74_37	missense	35.06	26.15	SNP	1.000	C	27	50
DYNC1LI2	1783	genome.wustl.edu	37	16	66785214	66785214	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:66785214C>A	ENST00000258198.2	-	2	349	c.143G>T	c.(142-144)aGg>aTg	p.R48M	DYNC1LI2_ENST00000440564.2_Missense_Mutation_p.R48M|DYNC1LI2_ENST00000443351.2_Missense_Mutation_p.R48M|RP11-61A14.4_ENST00000501143.1_lincRNA|DYNC1LI2_ENST00000379482.2_Missense_Mutation_p.R48M	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	48					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		CAGCTTGGACCTGGCGCGGGT	0.726													ENSG00000135720																																					0													37.0	39.0	38.0					16																	66785214		2200	4300	6500	SO:0001583	missense	0			-	AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.143G>T	16.37:g.66785214C>A	ENSP00000258198:p.Arg48Met		A8K6V1|B4DZP4|Q8TAT3	Missense_Mutation	SNP	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	p.R48M	ENST00000258198.2	37	c.143	CCDS10818.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.411794	0.96072	.	.	ENSG00000135720	ENST00000258198;ENST00000379482;ENST00000443351;ENST00000440564	T;T;T;T	0.30981	2.13;2.13;1.51;2.13	4.82	4.82	0.62117	.	0.088348	0.85682	D	0.000000	T	0.53690	0.1812	M	0.70275	2.135	0.50813	D	0.999896	D;B;P;D	0.61080	0.989;0.372;0.642;0.961	D;B;P;P	0.63113	0.911;0.309;0.478;0.907	T	0.57900	-0.7731	10	0.66056	D	0.02	-7.1182	17.7036	0.88302	0.0:1.0:0.0:0.0	.	48;48;48;48	B4E2E0;B4DHD8;B4DZP4;O43237	.;.;.;DC1L2_HUMAN	M	48	ENSP00000258198:R48M;ENSP00000368795:R48M;ENSP00000394289:R48M;ENSP00000408566:R48M	ENSP00000258198:R48M	R	-	2	0	DYNC1LI2	65342715	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.432000	0.80349	2.505000	0.84491	0.557000	0.71058	AGG	-	DYNC1LI2	-	pfam_Dynein_light_int_chain		0.726	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1LI2	HGNC	protein_coding	OTTHUMT00000268846.1	0	0	0	107	107	70	0.00	0.00	C	NM_006141		66785214	-1	23	11	100	32	tier1	no_errors	ENST00000258198	ensembl	human	known	74_37	missense	18.70	25.58	SNP	1.000	A	23	100
NEUROG1	4762	genome.wustl.edu	37	5	134871035	134871035	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr5:134871035G>C	ENST00000314744.4	-	1	604	c.346C>G	c.(346-348)Cgc>Ggc	p.R116G		NM_006161.2	NP_006152.2	Q92886	NGN1_HUMAN	neurogenin 1	116	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell fate commitment (GO:0045165)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perikaryon (GO:0043204)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			endometrium(1)|liver(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGCACGCTGCGCAGTGCGTCC	0.657													ENSG00000181965																																					0													38.0	41.0	40.0					5																	134871035		2203	4300	6503	SO:0001583	missense	0			-	U63842	CCDS4187.1	5q23-q31	2013-05-21			ENSG00000181965	ENSG00000181965		"""Basic helix-loop-helix proteins"""	7764	protein-coding gene	gene with protein product	"""neurogenic differentiation 3"""	601726		NEUROD3		9119405	Standard	NM_006161		Approved	AKA, Math4C, ngn1, bHLHa6	uc003lax.3	Q92886	OTTHUMG00000129138	ENST00000314744.4:c.346C>G	5.37:g.134871035G>C	ENSP00000317580:p.Arg116Gly		Q5U0Q9|Q96HE1	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R116G	ENST00000314744.4	37	c.346	CCDS4187.1	5	.	.	.	.	.	.	.	.	.	.	g	17.08	3.297503	0.60086	.	.	ENSG00000181965	ENST00000314744	D	0.98701	-5.08	4.98	4.98	0.66077	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99349	1.0914	10	0.87932	D	0	-7.746	12.0798	0.53665	0.0:0.0:0.6986:0.3014	.	116	Q92886	NGN1_HUMAN	G	116	ENSP00000317580:R116G	ENSP00000317580:R116G	R	-	1	0	NEUROG1	134898934	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.546000	0.53656	2.284000	0.76573	0.651000	0.88453	CGC	-	NEUROG1	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom		0.657	NEUROG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROG1	HGNC	protein_coding	OTTHUMT00000251192.1	0	0	0	70	70	40	0.00	0.00	G	NM_006161		134871035	-1	28	14	29	11	tier1	no_errors	ENST00000314744	ensembl	human	known	74_37	missense	49.12	56.00	SNP	1.000	C	28	29
FBLN2	2199	genome.wustl.edu	37	3	13612954	13612954	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:13612954C>T	ENST00000295760.7	+	2	1168	c.1099C>T	c.(1099-1101)Ctc>Ttc	p.L367F	FBLN2_ENST00000535798.1_Missense_Mutation_p.L393F|FBLN2_ENST00000492059.1_Missense_Mutation_p.L367F|FBLN2_ENST00000404922.3_Missense_Mutation_p.L367F	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	367	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CAAGGCTGCTCTCGTCCCAAC	0.657													ENSG00000163520																																					0													36.0	47.0	43.0					3																	13612954		2144	4236	6380	SO:0001583	missense	0			-	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1099C>T	3.37:g.13612954C>T	ENSP00000295760:p.Leu367Phe		B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.L367F	ENST00000295760.7	37	c.1099	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	C	2.956	-0.215625	0.06101	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.79845	-1.31;-1.28;-1.22;-1.28	4.82	-2.08	0.07254	.	1.746520	0.02894	N	0.134492	T	0.65647	0.2711	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.51655	-0.8678	10	0.31617	T	0.26	.	8.0595	0.30625	0.4261:0.2017:0.3722:0.0	.	367;367;393	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	F	393;367;367;367	ENSP00000445705:L393F;ENSP00000384169:L367F;ENSP00000295760:L367F;ENSP00000420042:L367F	ENSP00000295760:L367F	L	+	1	0	FBLN2	13587955	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.415000	0.02469	-0.291000	0.09012	-0.155000	0.13514	CTC	-	FBLN2	-	NULL		0.657	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	0	0	0	53	53	75	0.00	0.00	C	NM_001004019		13612954	+1	15	27	25	31	tier1	no_errors	ENST00000404922	ensembl	human	known	74_37	missense	37.50	46.55	SNP	0.000	T	15	25
BEND3P1	644459	genome.wustl.edu	37	10	52419299	52419299	+	RNA	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:52419299C>T	ENST00000449695.1	+	0	2033																											GCTACAACTCCTCCAGCCTGC	0.622													ENSG00000231345																																					0																																												0			-																													10.37:g.52419299C>T				R	SNP	-	NULL	ENST00000449695.1	37	NULL		10																																																																																			-	RP11-564C4.6	-	-		0.622	RP11-564C4.6-002	KNOWN	basic	processed_transcript	ENSG00000231345	Clone_based_vega_gene	pseudogene	OTTHUMT00000048079.1	0	0	0	18	18	19	0.00	0.00	C			52419299	+1	7	6	7	6	tier1	no_errors	ENST00000449695	ensembl	human	known	74_37	rna	50.00	50.00	SNP	0.814	T	7	7
KIAA1161	57462	genome.wustl.edu	37	9	34371506	34371506	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr9:34371506G>A	ENST00000297625.7	-	2	1559	c.1334C>T	c.(1333-1335)cCg>cTg	p.P445L		NM_020702.3	NP_065753.2	Q6NSJ0	K1161_HUMAN	KIAA1161	479					carbohydrate metabolic process (GO:0005975)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|skeletal muscle fiber development (GO:0048741)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		GTCCGGCAGCGGCCGGTAGGT	0.672													ENSG00000164976																																					0													11.0	15.0	14.0					9																	34371506		2078	4185	6263	SO:0001583	missense	0			-	AB032987		9p11.2	2009-11-06			ENSG00000164976	ENSG00000164976			19918	protein-coding gene	gene with protein product						10574461	Standard	XM_006716808		Approved	NET37	uc003zue.4	Q6NSJ0	OTTHUMG00000019816	ENST00000297625.7:c.1334C>T	9.37:g.34371506G>A	ENSP00000297625:p.Pro445Leu		Q5T587|Q5T588|Q9ULQ9	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	p.P445L	ENST00000297625.7	37	c.1334		9	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536143	0.64972	.	.	ENSG00000164976	ENST00000297625	D	0.91011	-2.77	5.27	4.36	0.52297	Glycoside hydrolase, superfamily (1);	0.109422	0.64402	D	0.000005	D	0.93959	0.8066	M	0.77616	2.38	0.58432	D	0.999992	D	0.76494	0.999	P	0.59948	0.866	D	0.93806	0.7105	10	0.51188	T	0.08	-17.2791	14.0966	0.65027	0.0:0.0:0.8488:0.1512	.	479	Q6NSJ0	K1161_HUMAN	L	445	ENSP00000297625:P445L	ENSP00000297625:P445L	P	-	2	0	KIAA1161	34361506	1.000000	0.71417	0.945000	0.38365	0.989000	0.77384	4.409000	0.59768	1.193000	0.43086	0.462000	0.41574	CCG	-	KIAA1161	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF		0.672	KIAA1161-001	KNOWN	basic|appris_principal	protein_coding	KIAA1161	HGNC	protein_coding	OTTHUMT00000052158.1	0	0	0	28	28	6	0.00	0.00	G	XM_351807		34371506	-1	10	9	6	5	tier1	no_errors	ENST00000297625	ensembl	human	known	74_37	missense	62.50	64.29	SNP	0.994	A	10	6
PRAMEF2	65122	genome.wustl.edu	37	1	12919081	12919081	+	Missense_Mutation	SNP	C	C	A	rs45443899	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:12919081C>A	ENST00000240189.2	+	2	304	c.217C>A	c.(217-219)Ctt>Att	p.L73I		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	73					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GATGAAGACGCTTCATCTGGA	0.557													ENSG00000120952																																					0													154.0	164.0	161.0					1																	12919081		2201	4296	6497	SO:0001583	missense	0			-		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.217C>A	1.37:g.12919081C>A	ENSP00000240189:p.Leu73Ile			Missense_Mutation	SNP	NULL	p.L73I	ENST00000240189.2	37	c.217	CCDS149.1	1	.	.	.	.	.	.	.	.	.	.	C	9.162	1.019047	0.19355	.	.	ENSG00000120952	ENST00000240189	T	0.16324	2.35	0.842	0.842	0.18927	.	0.886493	0.09599	N	0.780473	T	0.19327	0.0464	L	0.49126	1.545	0.09310	N	1	P	0.48503	0.911	P	0.47430	0.547	T	0.18272	-1.0342	10	0.56958	D	0.05	.	5.0452	0.14480	0.0:1.0:0.0:0.0	.	73	O60811	PRAM2_HUMAN	I	73	ENSP00000240189:L73I	ENSP00000240189:L73I	L	+	1	0	PRAMEF2	12841668	0.000000	0.05858	0.055000	0.19348	0.048000	0.14542	0.446000	0.21694	0.759000	0.33084	0.194000	0.17425	CTT	-	PRAMEF2	-	NULL		0.557	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	HGNC	protein_coding	OTTHUMT00000005517.1	0	0	0	54	54	11	0.00	0.00	C	NM_023014		12919081	+1	30	4	64	7	tier1	no_errors	ENST00000240189	ensembl	human	known	74_37	missense	31.91	33.33	SNP	0.084	A	30	64
STAG3L1	54441	genome.wustl.edu	37	7	74988500	74988500	+	RNA	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr7:74988500C>T	ENST00000402225.5	+	0	53							P0CL83	ST3L1_HUMAN	stromal antigen 3-like 1 (pseudogene)							nucleus (GO:0005634)											CGCCCTCCGTCGTGGTCTGGC	0.612													ENSG00000205583																																					0																																												0			-			7q11.23	2013-06-26	2013-06-26		ENSG00000205583	ENSG00000205583			33852	pseudogene	pseudogene			"""stromal antigen 3-like 1"""				Standard	NR_040583		Approved	DKFZP434A0131, STAG3L1P	uc022agf.1	P0CL83	OTTHUMG00000155940		7.37:g.74988500C>T			A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	R	SNP	-	NULL	ENST00000402225.5	37	NULL		7																																																																																			-	STAG3L1	-	-		0.612	STAG3L1-012	KNOWN	basic	processed_transcript	STAG3L1	HGNC	pseudogene	OTTHUMT00000437242.1	0	0	0	35	35	8	0.00	0.00	C	NM_001002840		74988500	+1	9	3	18	1	tier1	no_errors	ENST00000402225	ensembl	human	known	74_37	rna	33.33	75.00	SNP	0.000	T	9	18
UBR2	23304	genome.wustl.edu	37	6	42583771	42583771	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr6:42583771G>A	ENST00000372899.1	+	10	1383	c.1125G>A	c.(1123-1125)atG>atA	p.M375I	UBR2_ENST00000372901.1_Missense_Mutation_p.M375I|UBR2_ENST00000372903.2_Missense_Mutation_p.M375I|UBR2_ENST00000372883.3_5'Flank	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	375					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AGTTGTTCATGAGCAGTCTGC	0.338													ENSG00000024048																																					0													211.0	203.0	206.0					6																	42583771		2203	4300	6503	SO:0001583	missense	0			-	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1125G>A	6.37:g.42583771G>A	ENSP00000361990:p.Met375Ile		O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.M375I	ENST00000372899.1	37	c.1125	CCDS4870.1	6	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120963	0.56613	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.71103	-0.54;0.55;0.55	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.33792	1.035	0.80722	D	1	D;B;B	0.63046	0.992;0.02;0.328	D;B;B	0.71656	0.974;0.034;0.111	T	0.62234	-0.6897	10	0.13108	T	0.6	7.4134	19.6467	0.95778	0.0:0.0:1.0:0.0	.	375;375;375	Q8IWV8-4;Q8IWV8;Q8IWV8-2	.;UBR2_HUMAN;.	I	375	ENSP00000361994:M375I;ENSP00000361990:M375I;ENSP00000361992:M375I	ENSP00000361990:M375I	M	+	3	0	UBR2	42691749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.020000	0.93667	2.716000	0.92895	0.655000	0.94253	ATG	-	UBR2	-	NULL		0.338	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	0	0	0	43	43	32	0.00	0.00	G	NM_015255		42583771	+1	9	8	102	75	tier1	no_errors	ENST00000372899	ensembl	human	known	74_37	missense	8.11	9.64	SNP	1.000	A	9	102
UBR2	23304	genome.wustl.edu	37	6	42583801	42583801	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr6:42583801G>A	ENST00000372899.1	+	10	1413	c.1155G>A	c.(1153-1155)aaG>aaA	p.K385K	UBR2_ENST00000372901.1_Silent_p.K385K|UBR2_ENST00000372903.2_Silent_p.K385K|UBR2_ENST00000372883.3_5'Flank	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	385					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGAAATACAAGAAACTATTTG	0.343													ENSG00000024048																																					0													194.0	187.0	189.0					6																	42583801		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1155G>A	6.37:g.42583801G>A			O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Silent	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.K385	ENST00000372899.1	37	c.1155	CCDS4870.1	6																																																																																			-	UBR2	-	NULL		0.343	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	0	0	0	44	44	29	0.00	0.00	G	NM_015255		42583801	+1	11	6	91	71	tier1	no_errors	ENST00000372899	ensembl	human	known	74_37	silent	10.78	7.79	SNP	1.000	A	11	91
UBR2	23304	genome.wustl.edu	37	6	42583818	42583818	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr6:42583818G>A	ENST00000372899.1	+	10	1430	c.1172G>A	c.(1171-1173)cGa>cAa	p.R391Q	UBR2_ENST00000372901.1_Missense_Mutation_p.R391Q|UBR2_ENST00000372903.2_Missense_Mutation_p.R391Q|UBR2_ENST00000372883.3_5'Flank	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	391					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R391P(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TTTGCTGTTCGATTTGCAAAA	0.313													ENSG00000024048																																					1	Substitution - Missense(1)	endometrium(1)											166.0	160.0	162.0					6																	42583818		2203	4300	6503	SO:0001583	missense	0			-	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1172G>A	6.37:g.42583818G>A	ENSP00000361990:p.Arg391Gln		O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R391Q	ENST00000372899.1	37	c.1172	CCDS4870.1	6	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454776	0.43634	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.71222	-0.55;0.45;0.45	5.45	5.45	0.79879	.	0.062532	0.64402	D	0.000002	T	0.40322	0.1112	N	0.20401	0.57	0.80722	D	1	B;B;B	0.19583	0.037;0.002;0.02	B;B;B	0.14023	0.01;0.001;0.006	T	0.46498	-0.9187	10	0.07990	T	0.79	-12.8367	19.6467	0.95778	0.0:0.0:1.0:0.0	.	391;391;391	Q8IWV8-4;Q8IWV8;Q8IWV8-2	.;UBR2_HUMAN;.	Q	391	ENSP00000361994:R391Q;ENSP00000361990:R391Q;ENSP00000361992:R391Q	ENSP00000361990:R391Q	R	+	2	0	UBR2	42691796	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.755000	0.68750	2.716000	0.92895	0.655000	0.94253	CGA	-	UBR2	-	NULL		0.313	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	0	0	0	40	40	30	0.00	0.00	G	NM_015255		42583818	+1	12	4	80	69	tier1	no_errors	ENST00000372899	ensembl	human	known	74_37	missense	13.04	5.48	SNP	1.000	A	12	80
CBFA2T3	863	genome.wustl.edu	37	16	88952543	88952543	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:88952543delA	ENST00000268679.4	-	6	1115	c.719delT	c.(718-720)ctgfs	p.L240fs	CBFA2T3_ENST00000436887.2_Frame_Shift_Del_p.L215fs|CBFA2T3_ENST00000360302.2_Frame_Shift_Del_p.L154fs|CBFA2T3_ENST00000327483.5_Frame_Shift_Del_p.L154fs|RP11-830F9.5_ENST00000565053.1_RNA|RP11-830F9.5_ENST00000569249.1_RNA|CBFA2T3_ENST00000448839.1_Frame_Shift_Del_p.L164fs|RP11-830F9.5_ENST00000562405.1_RNA|RP11-830F9.5_ENST00000562574.1_RNA	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	240	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CAGCAAGGGCAGGTTTGCCTG	0.687			T	RUNX1	AML								ENSG00000129993																												Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0													30.0	30.0	30.0					16																	88952543		2181	4283	6464	SO:0001589	frameshift_variant	0				AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.719delT	16.37:g.88952543delA	ENSP00000268679:p.Leu240fs		D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Frame_Shift_Del	DEL	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG16	p.L240fs	ENST00000268679.4	37	c.719	CCDS10972.1	16																																																																																				CBFA2T3	-	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1		0.687	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CBFA2T3	HGNC	protein_coding	OTTHUMT00000269545.2	0	0	0	86	86	35	0.00	0.00	A	NM_005187		88952543	-1	2	0	17	7	tier1	no_errors	ENST00000268679	ensembl	human	known	74_37	frame_shift_del	10.53	0.00	DEL	1.000	-	2	17
CREBBP	1387	genome.wustl.edu	37	16	3779184	3779184	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:3779184G>A	ENST00000262367.5	-	31	6673	c.5864C>T	c.(5863-5865)gCg>gTg	p.A1955V	CREBBP_ENST00000382070.3_Missense_Mutation_p.A1917V	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1955					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CGCTTCCACCGCTGCAGGAGG	0.711			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome						ENSG00000005339																												Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													3.0	4.0	4.0					16																	3779184		1794	3661	5455	SO:0001583	missense	0			-	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5864C>T	16.37:g.3779184G>A	ENSP00000262367:p.Ala1955Val		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.A1955V	ENST00000262367.5	37	c.5864	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	g	11.53	1.666462	0.29604	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.84516	-1.86;-1.79	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000009	D	0.84392	0.5462	L	0.49126	1.545	0.80722	D	1	D;D	0.56746	0.977;0.977	P;P	0.46940	0.532;0.532	T	0.82202	-0.0574	10	0.21540	T	0.41	-12.7463	18.6472	0.91415	0.0:0.0:1.0:0.0	.	1985;1955	Q4LE28;Q92793	.;CBP_HUMAN	V	1955;1985;1917;490	ENSP00000262367:A1955V;ENSP00000371502:A1917V	ENSP00000262367:A1955V	A	-	2	0	CREBBP	3719185	1.000000	0.71417	0.104000	0.21259	0.611000	0.37282	7.258000	0.78371	2.419000	0.82065	0.655000	0.94253	GCG	-	CREBBP	-	NULL		0.711	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	0	0	0	29	29	6	0.00	0.00	G	NM_004380		3779184	-1	3	0	9	6	tier1	no_errors	ENST00000262367	ensembl	human	known	74_37	missense	25.00	0.00	SNP	0.998	A	3	9
DSCR3	10311	genome.wustl.edu	37	21	38639762	38639763	+	5'UTR	INS	-	-	C	rs35672675|rs397760805		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr21:38639762_38639763insC	ENST00000309117.6	-	0	70_71				DSCR3_ENST00000288304.5_5'UTR|DSCR3_ENST00000476950.1_5'Flank|DSCR3_ENST00000399001.1_5'Flank|DSCR3_ENST00000398998.1_5'UTR|DSCR3_ENST00000539844.1_5'Flank|DSCR3_ENST00000399000.3_5'UTR|AP001412.1_ENST00000608405.1_RNA	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3							nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						GAGGGGCGAATGCCCACGCCTT	0.693													ENSG00000157538																																					0																																										SO:0001623	5_prime_UTR_variant	0				D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.-168->G	21.37:g.38639762_38639763insC			B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	R	INS	-	NULL	ENST00000309117.6	37	NULL	CCDS33553.1	21																																																																																				DSCR3	-	-		0.693	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR3	HGNC	protein_coding	OTTHUMT00000194807.1	0	0	0	17	17	5	0.00	0.00	-			38639763	-1	3	0	6	3	tier1	no_errors	ENST00000399000	ensembl	human	known	74_37	rna	33.33	0.00	INS	0.001:0.001	C	3	6
ATP13A4	84239	genome.wustl.edu	37	3	193272443	193272450	+	Intron	DEL	GTGTGTGT	GTGTGTGT	-	rs71879254|rs62287169|rs66654564|rs61326289|rs113367741|rs58073069|rs544456636	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	GTGTGTGT	GTGTGTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:193272443_193272450delGTGTGTGT	ENST00000342695.4	-	1	383				ATP13A4_ENST00000295548.3_Intron|ATP13A4_ENST00000392443.3_Intron|ATP13A4-AS1_ENST00000431512.1_RNA|ATP13A4-AS1_ENST00000426459.1_RNA	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		tgatgcgtgcgtgtgtgtgtgtgtgtgt	0.433													ENSG00000225473																																					0																																										SO:0001627	intron_variant	0				AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.60+78ACACACAC>-	3.37:g.193272451_193272458delGTGTGTGT			B7WPC7|Q6UY23|Q8N1Q9|Q9H043	R	DEL	-	NULL	ENST00000342695.4	37	NULL	CCDS3304.2	3																																																																																				ATP13A4-AS1	-	-		0.433	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4-AS1	HGNC	protein_coding	OTTHUMT00000157244.4	0	0	0	0	0	0	0.00	0.00	GTGTGTGT	NM_032279		193272450	+1	0	0	0	0	tier1	no_errors	ENST00000426459	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.004:0.003:0.002:0.001:0.019:0.004:0.002:0.000	-	0	0
TBC1D3P3	653017	genome.wustl.edu	37	17	20450947	20450947	+	lincRNA	SNP	T	T	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:20450947T>A	ENST00000591705.1	+	0	2264																											TGGTGCCGGCTGCTCCCTGGG	0.607													ENSG00000267075																																					0																																												0			-																													17.37:g.20450947T>A				R	SNP	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			-	RP11-434D2.3	-	-		0.607	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	Clone_based_vega_gene	lincRNA	OTTHUMT00000441761.2	0	0	0	41	41	0	0.00	0.00	T			20450947	+1	10	0	39	0	tier1	no_errors	ENST00000591705	ensembl	human	known	74_37	rna	20.41	0.00	SNP	0.025	A	10	39
POTEM	641455	genome.wustl.edu	37	14	20010310	20010310	+	Intron	SNP	A	A	G	rs199892710		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr14:20010310A>G	ENST00000551509.1	-	5	969				RP11-244H18.1_ENST00000547584.1_lincRNA|RNU6-1268P_ENST00000391214.1_RNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						TTACCAATTTAACATCTTGCC	0.333													ENSG00000258276																																					0																																										SO:0001627	intron_variant	0			-		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-70T>C	14.37:g.20010310A>G				R	SNP	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			rs199892710	RP11-244H18.1	-	-		0.333	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	Clone_based_vega_gene	protein_coding	OTTHUMT00000409490.3	0	0	0	9	9	3	0.00	0.00	A	NM_001145442		20010310	+1	7	1	15	6	tier1	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	31.82	14.29	SNP	0.005	G	7	15
TBC1D30	23329	genome.wustl.edu	37	12	65175020	65175020	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:65175020G>A	ENST00000229088.6	+	1	432	c.432G>A	c.(430-432)caG>caA	p.Q144Q	TBC1D30_ENST00000456757.2_3'UTR|RP11-629N8.3_ENST00000434563.3_RNA			Q9Y2I9	TBC30_HUMAN	TBC1 domain family, member 30	144					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)	ciliary basal body (GO:0036064)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			NS(3)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	5						AGGAGCTGCAGGAGCGACCGA	0.731													ENSG00000111490																																					0																																										SO:0001819	synonymous_variant	0			-	AB023201	CCDS53813.1	12q14.3	2013-07-10			ENSG00000111490	ENSG00000111490			29164	protein-coding gene	gene with protein product		615077				12618308, 17646400	Standard	NM_015279		Approved	KIAA0984	uc010sst.2	Q9Y2I9	OTTHUMG00000168824	ENST00000229088.6:c.432G>A	12.37:g.65175020G>A			B3KP01|B9A6M9|E7EMW4|F5GYJ9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q144	ENST00000229088.6	37	c.432		12																																																																																			-	TBC1D30	-	NULL		0.731	TBC1D30-201	KNOWN	basic	protein_coding	TBC1D30	HGNC	protein_coding		0	0	0	11	11	2	0.00	0.00	G	XM_037557		65175020	+1	5	0	3	1	tier1	no_errors	ENST00000229088	ensembl	human	known	74_37	silent	62.50	0.00	SNP	1.000	A	5	3
PPP2R1B	5519	genome.wustl.edu	37	11	111631590	111631590	+	Missense_Mutation	SNP	G	G	T	rs186368063		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr11:111631590G>T	ENST00000527614.1	-	4	557	c.492C>A	c.(490-492)agC>agA	p.S164R	PPP2R1B_ENST00000426998.2_Missense_Mutation_p.S100R|PPP2R1B_ENST00000393055.2_Intron|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.S164R|PPP2R1B_ENST00000427203.2_Intron|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.S164R	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	164					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GATAGCAAACGCTGAACAAAC	0.433													ENSG00000137713																																					0													91.0	82.0	85.0					11																	111631590		2201	4297	6498	SO:0001583	missense	0			-	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.492C>A	11.37:g.111631590G>T	ENSP00000437193:p.Ser164Arg		A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.S164R	ENST00000527614.1	37	c.492	CCDS8349.1	11	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355337	0.61293	.	.	ENSG00000137713	ENST00000311129;ENST00000426998;ENST00000527614;ENST00000341980	T;T;T;T	0.06528	3.29;3.29;3.29;3.29	5.96	0.338	0.15974	Armadillo-like helical (1);Armadillo-type fold (1);	0.037215	0.85682	D	0.000000	T	0.18800	0.0451	M	0.90977	3.165	0.80722	D	1	B;D;P;D	0.61697	0.296;0.99;0.464;0.983	B;P;P;P	0.52066	0.225;0.491;0.497;0.689	T	0.08166	-1.0735	10	0.62326	D	0.03	-11.6753	9.4798	0.38893	0.4711:0.0:0.5289:0.0	.	164;100;164;164	F8W8G1;B4DWW5;P30154;P30154-2	.;.;2AAB_HUMAN;.	R	164;100;164;164	ENSP00000311344:S164R;ENSP00000410671:S100R;ENSP00000437193:S164R;ENSP00000343317:S164R	ENSP00000311344:S164R	S	-	3	2	PPP2R1B	111136800	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	1.774000	0.38573	0.141000	0.18875	-0.126000	0.14955	AGC	-	PPP2R1B	-	superfamily_ARM-type_fold		0.433	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PPP2R1B	HGNC	protein_coding	OTTHUMT00000391298.1	0	0	0	34	34	83	0.00	0.00	G	NM_002716		111631590	-1	4	2	29	53	tier1	no_errors	ENST00000311129	ensembl	human	known	74_37	missense	12.12	3.64	SNP	0.988	T	4	29
MAP9	79884	genome.wustl.edu	37	4	156289996	156289996	+	Intron	DEL	A	A	-			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr4:156289996delA	ENST00000311277.4	-	5	745				MAP9_ENST00000515654.1_Intron|AC097467.2_ENST00000598890.1_RNA|MAP9_ENST00000379248.2_Intron|AC097467.2_ENST00000596165.1_RNA|AC097467.2_ENST00000600928.1_RNA|AC097467.2_ENST00000597831.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9						cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		GTGTGTGTATAAAAAAATGAC	0.418													ENSG00000250910																																					0													36.0	36.0	36.0					4																	156289996		2203	4300	6503	SO:0001627	intron_variant	0				AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.482-32T>-	4.37:g.156289996delA			Q4W5I7|Q68DU1|Q9H781|Q9H7B6	R	DEL	-	NULL	ENST00000311277.4	37	NULL	CCDS35493.1	4																																																																																				AC097467.2	-	-		0.418	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000250910	Clone_based_vega_gene	protein_coding	OTTHUMT00000257771.3	0	0	0	31	31	88	0.00	0.00	A	NM_001039580		156289996	+1	4	2	18	66	tier1	no_errors	ENST00000597831	ensembl	human	known	74_37	rna	18.18	2.94	DEL	0.000	-	4	18
