#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
VMO1	284013	genome.wustl.edu	37	17	4688713	4688713	+	Missense_Mutation	SNP	C	C	T	rs377200420		TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr17:4688713C>T	ENST00000328739.5	-	3	632	c.553G>A	c.(553-555)Ggc>Agc	p.G185S	VMO1_ENST00000441199.2_3'UTR|VMO1_ENST00000416307.2_3'UTR|VMO1_ENST00000354194.4_3'UTR	NM_182566.2	NP_872372.1	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 homolog (chicken)	185						extracellular vesicular exosome (GO:0070062)		p.G185C(1)		kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|pancreas(1)	11						TCGCCGAGGCCTCTAGGTCCC	0.672													ENSG00000182853																																					1	Substitution - Missense(1)	large_intestine(1)						C	,,,SER/GLY	1,4405	2.1+/-5.4	0,1,2202	54.0	52.0	52.0		,,,553	4.8	0.1	17		52	0,8600		0,0,4300	no	utr-3,utr-3,utr-3,missense	VMO1	NM_001144939.1,NM_001144940.1,NM_001144941.1,NM_182566.2	,,,56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,probably-damaging	,,,185/203	4688713	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF521892	CCDS11055.1, CCDS45585.1, CCDS45586.1, CCDS45587.1	17p13.2	2013-03-07	2005-11-14						30387	protein-coding gene	gene with protein product						22025569	Standard	NM_182566		Approved		uc002fyx.3	Q7Z5L0		ENST00000328739.5:c.553G>A	17.37:g.4688713C>T	ENSP00000328397:p.Gly185Ser		C9JQ15|E9PAU9|E9PGP4|Q3SXP1|Q8IUY1	Missense_Mutation	SNP	pfam_VOMI,superfamily_VOMI	p.G185S	ENST00000328739.5	37	c.553	CCDS11055.1	17	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180998	0.38511	2.27E-4	0.0	ENSG00000182853	ENST00000328739	T	0.51325	0.71	4.77	4.77	0.60923	.	0.254416	0.40385	N	0.001101	T	0.68879	0.3049	M	0.78801	2.425	0.25211	N	0.989978	D	0.89917	1.0	D	0.83275	0.996	T	0.63028	-0.6728	10	0.56958	D	0.05	-29.602	15.333	0.74229	0.0:1.0:0.0:0.0	.	185	Q7Z5L0	VMO1_HUMAN	S	185	ENSP00000328397:G185S	ENSP00000328397:G185S	G	-	1	0	VMO1	4635453	0.083000	0.21467	0.122000	0.21767	0.021000	0.10359	2.271000	0.43364	2.491000	0.84063	0.561000	0.74099	GGC	-	VMO1	-	pfam_VOMI,superfamily_VOMI		0.672	VMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VMO1	HGNC	protein_coding	OTTHUMT00000439587.1	0	0	0	132	132	76	0.00	0.00	C	NM_182566		4688713	-1	15	8	51	18	tier1	no_errors	ENST00000328739	ensembl	human	known	74_37	missense	22.73	30.77	SNP	0.044	T	15	51
ZNF804B	219578	genome.wustl.edu	37	7	88965547	88965547	+	Missense_Mutation	SNP	G	G	T	rs139960501	byFrequency	TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr7:88965547G>T	ENST00000333190.4	+	4	3860	c.3251G>T	c.(3250-3252)gGt>gTt	p.G1084V		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1084							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAATATACTGGTGTGACTGAT	0.353										HNSCC(36;0.09)			ENSG00000182348																																					0													54.0	53.0	54.0					7																	88965547		2202	4299	6501	SO:0001583	missense	0			-	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3251G>T	7.37:g.88965547G>T	ENSP00000329638:p.Gly1084Val		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.G1084V	ENST00000333190.4	37	c.3251	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	6.088	0.384517	0.11524	.	.	ENSG00000182348	ENST00000333190	T	0.05081	3.5	5.04	3.19	0.36642	.	0.471757	0.21800	N	0.068930	T	0.03477	0.0100	N	0.20986	0.625	0.50313	D	0.999868	B	0.29988	0.264	B	0.20577	0.03	T	0.50734	-0.8793	10	0.19147	T	0.46	-0.8535	5.3016	0.15781	0.0789:0.1242:0.6152:0.1817	.	1084	A4D1E1	Z804B_HUMAN	V	1084	ENSP00000329638:G1084V	ENSP00000329638:G1084V	G	+	2	0	ZNF804B	88803483	0.958000	0.32768	0.256000	0.24389	0.780000	0.44128	0.233000	0.17911	0.803000	0.34113	0.655000	0.94253	GGT	-	ZNF804B	-	NULL		0.353	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	0	0	0	9	9	30	0.00	0.00	G	NM_181646		88965547	+1	14	25	31	72	tier1	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	31.11	25.51	SNP	0.865	T	14	31
MOGAT3	346606	genome.wustl.edu	37	7	100841961	100841961	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr7:100841961C>T	ENST00000223114.4	-	4	605	c.439G>A	c.(439-441)Gtg>Atg	p.V147M	MOGAT3_ENST00000440203.2_Missense_Mutation_p.V147M|MOGAT3_ENST00000379423.3_Missense_Mutation_p.V147M	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	147					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					CCAGCCAGCACGGCTAACCAG	0.587													ENSG00000106384																																					0													50.0	53.0	52.0					7																	100841961		2203	4300	6503	SO:0001583	missense	0			-	AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.439G>A	7.37:g.100841961C>T	ENSP00000223114:p.Val147Met		Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	pfam_DAGAT	p.V147M	ENST00000223114.4	37	c.439	CCDS5714.1	7	.	.	.	.	.	.	.	.	.	.	.	12.49	1.953512	0.34471	.	.	ENSG00000106384	ENST00000223114;ENST00000440203;ENST00000379423	D;T;T	0.93426	-3.22;2.38;2.38	5.2	-6.09	0.02145	.	1.437400	0.04089	N	0.310942	D	0.84009	0.5378	N	0.16833	0.445	0.09310	N	1	P;B	0.34864	0.473;0.282	B;B	0.22386	0.025;0.039	T	0.76979	-0.2758	10	0.44086	T	0.13	0.8381	10.3006	0.43650	0.0:0.1868:0.1114:0.7018	.	147;147	Q86VF5-2;Q86VF5	.;MOGT3_HUMAN	M	147	ENSP00000223114:V147M;ENSP00000403756:V147M;ENSP00000368734:V147M	ENSP00000223114:V147M	V	-	1	0	MOGAT3	100628681	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.238000	0.08977	-1.924000	0.01064	0.561000	0.74099	GTG	-	MOGAT3	-	pfam_DAGAT		0.587	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT3	HGNC	protein_coding	OTTHUMT00000059649.3	0	0	0	162	162	33	0.00	0.00	C	NM_178176		100841961	-1	15	10	63	29	tier1	no_errors	ENST00000440203	ensembl	human	known	74_37	missense	19.23	25.64	SNP	0.000	T	15	63
MPEG1	219972	genome.wustl.edu	37	11	58979797	58979797	+	Missense_Mutation	SNP	C	C	T	rs370491206		TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr11:58979797C>T	ENST00000361050.3	-	1	627	c.542G>A	c.(541-543)cGt>cAt	p.R181H	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	181	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				GTTCTCTAGACGGTCAGAGAT	0.522													ENSG00000197629																																					0								C	HIS/ARG	3,3923		0,3,1960	131.0	120.0	124.0		542	-1.4	0.1	11		124	0,8280		0,0,4140	no	missense	MPEG1	NM_001039396.1	29	0,3,6100	TT,TC,CC		0.0,0.0764,0.0246	probably-damaging	181/717	58979797	3,12203	1963	4140	6103	SO:0001583	missense	0			-	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.542G>A	11.37:g.58979797C>T	ENSP00000354335:p.Arg181His		Q2M1T6|Q8TEF8	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R181H	ENST00000361050.3	37	c.542	CCDS41650.1	11	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.594018	0.00857	7.64E-4	0.0	ENSG00000197629	ENST00000361050	D	0.84070	-1.8	5.2	-1.44	0.08856	Membrane attack complex component/perforin (MACPF) domain (3);	0.485207	0.22233	N	0.062790	T	0.68174	0.2972	L	0.45137	1.4	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.50617	-0.8807	10	0.11182	T	0.66	-0.8451	5.387	0.16224	0.1354:0.3776:0.0:0.487	.	181	Q2M385	MPEG1_HUMAN	H	181	ENSP00000354335:R181H	ENSP00000354335:R181H	R	-	2	0	MPEG1	58736373	0.941000	0.31946	0.077000	0.20336	0.245000	0.25701	0.774000	0.26675	-0.600000	0.05790	-0.794000	0.03295	CGT	-	MPEG1	-	pfam_MACPF,smart_MACPF		0.522	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	HGNC	protein_coding	OTTHUMT00000370027.1	0	0	0	34	34	104	0.00	0.00	C	NM_001039396		58979797	-1	5	19	21	64	tier1	no_errors	ENST00000361050	ensembl	human	known	74_37	missense	19.23	22.89	SNP	0.068	T	5	21
SULF1	23213	genome.wustl.edu	37	8	70476322	70476322	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr8:70476322C>T	ENST00000260128.4	+	5	829	c.112C>T	c.(112-114)Cga>Tga	p.R38*	SULF1_ENST00000402687.4_Nonsense_Mutation_p.R38*|SULF1_ENST00000458141.2_Nonsense_Mutation_p.R38*|SULF1_ENST00000419716.3_Nonsense_Mutation_p.R38*	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	38					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ACAGCAGGAACGAAAAAACAT	0.493													ENSG00000137573																																					0													179.0	164.0	169.0					8																	70476322		2203	4300	6503	SO:0001587	stop_gained	0			-	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.112C>T	8.37:g.70476322C>T	ENSP00000260128:p.Arg38*		Q86YV8|Q8NCA2|Q9UPS5	Nonsense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.R38*	ENST00000260128.4	37	c.112	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	C	38	6.729123	0.97796	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000529134;ENST00000402687;ENST00000419716;ENST00000534179;ENST00000528783;ENST00000525999	.	.	.	6.06	3.13	0.36017	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8513	0.70297	0.4965:0.5035:0.0:0.0	.	.	.	.	X	38	.	ENSP00000260128:R38X	R	+	1	2	SULF1	70638876	0.997000	0.39634	0.997000	0.53966	0.996000	0.88848	0.780000	0.26760	0.843000	0.35070	0.650000	0.86243	CGA	-	SULF1	-	pirsf_Extracellular_sulfatase		0.493	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	0	0	0	71	71	126	0.00	0.00	C	NM_015170		70476322	+1	41	51	63	74	tier1	no_errors	ENST00000260128	ensembl	human	known	74_37	nonsense	39.42	40.80	SNP	1.000	T	41	63
MYCT1	80177	genome.wustl.edu	37	6	153019226	153019226	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr6:153019226C>G	ENST00000367245.5	+	1	197	c.189C>G	c.(187-189)aaC>aaG	p.N63K	MYCT1_ENST00000529453.1_Missense_Mutation_p.N63K	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	63						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		GGCCAGAAAACTTTTGGGGTA	0.313													ENSG00000120279																																					0													37.0	38.0	38.0					6																	153019226		2203	4295	6498	SO:0001583	missense	0			-	AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.189C>G	6.37:g.153019226C>G	ENSP00000356214:p.Asn63Lys		Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	NULL	p.N63K	ENST00000367245.5	37	c.189	CCDS5239.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.25|11.25	1.584553|1.584553	0.28268|0.28268	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000367245;ENST00000529453|ENST00000532295	T|.	0.28895|.	1.59|.	5.59|5.59	3.49|3.49	0.39957|0.39957	.|.	0.271361|.	0.37393|.	N|.	0.002109|.	T|T	0.19765|0.19765	0.0475|0.0475	L|L	0.40543|0.40543	1.245|1.245	0.27947|0.27947	N|N	0.937313|0.937313	B;B|.	0.18310|.	0.027;0.027|.	B;B|.	0.19391|.	0.025;0.025|.	T|T	0.11991|0.11991	-1.0565|-1.0565	10|5	0.30078|.	T|.	0.28|.	-16.6028|-16.6028	7.3267|7.3267	0.26560|0.26560	0.0:0.6293:0.1439:0.2268|0.0:0.6293:0.1439:0.2268	.|.	15;63|.	D6Q1S4;Q8N699|.	.;MYCT1_HUMAN|.	K|S	63|44	ENSP00000356214:N63K|.	ENSP00000356214:N63K|.	N|T	+|+	3|2	2|0	MYCT1|MYCT1	153060919|153060919	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.212000|0.212000	0.17497|0.17497	1.369000|1.369000	0.46134|0.46134	0.650000|0.650000	0.86243|0.86243	AAC|ACT	-	MYCT1	-	NULL		0.313	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYCT1	HGNC	protein_coding	OTTHUMT00000042750.2	0	0	0	56	56	39	0.00	0.00	C	NM_025107		153019226	+1	24	23	31	25	tier1	no_errors	ENST00000367245	ensembl	human	known	74_37	missense	43.64	47.92	SNP	1.000	G	24	31
TLR1	7096	genome.wustl.edu	37	4	38802484	38802484	+	5'UTR	SNP	G	G	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr4:38802484G>C	ENST00000502213.2	-	0	156				TLR1_ENST00000308979.2_5'UTR			Q15399	TLR1_HUMAN	toll-like receptor 1						cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TTACCCTTTTGTAGGGGTGCC	0.438													ENSG00000174125																									GBM(5;216 373 40795 46382)												0																																										SO:0001623	5_prime_UTR_variant	0			-	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.-74C>G	4.37:g.38802484G>C			D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	R	SNP	-	NULL	ENST00000502213.2	37	NULL	CCDS33973.1	4																																																																																			-	TLR1	-	-		0.438	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	HGNC	protein_coding	OTTHUMT00000360510.3	0	0	0	63	63	103	0.00	0.00	G			38802484	-1	36	33	76	79	tier1	no_errors	ENST00000505744	ensembl	human	known	74_37	rna	32.14	29.46	SNP	0.000	C	36	76
YARS	8565	genome.wustl.edu	37	1	33282793	33282793	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr1:33282793A>C	ENST00000373477.4	-	1	961	c.53T>G	c.(52-54)cTg>cGg	p.L18R	S100PBP_ENST00000373476.1_5'Flank|S100PBP_ENST00000373475.5_5'Flank|S100PBP_ENST00000398243.3_5'Flank	NM_003680.3	NP_003671.1	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase	18					apoptotic process (GO:0006915)|gene expression (GO:0010467)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)|tyrosyl-tRNA aminoacylation (GO:0006437)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|interleukin-8 receptor binding (GO:0005153)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)|tRNA binding (GO:0000049)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	CCTGACCTGCAGGTTCCGGGT	0.627													ENSG00000134684																																					0													109.0	107.0	108.0					1																	33282793		2203	4300	6503	SO:0001583	missense	0			-	U89436	CCDS368.1	1p35.1	2014-09-17			ENSG00000134684	ENSG00000134684	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	12840	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 1, cytoplasmic"""	603623				8552597, 9162081	Standard	NM_003680		Approved	YTS, YRS, tyrRS	uc001bvy.1	P54577	OTTHUMG00000003933	ENST00000373477.4:c.53T>G	1.37:g.33282793A>C	ENSP00000362576:p.Leu18Arg		B3KWK4|D3DPQ4|O43276|Q53EN1	Missense_Mutation	SNP	pfam_aa-tR-synth_Ic,pfam_tR-bd_dom,superfamily_-bd_OB-fold,prints_Tyr-tR-ligase,pfscan_tR-bd_dom,tigrfam_Tyr-tR-ligase	p.L18R	ENST00000373477.4	37	c.53	CCDS368.1	1	.	.	.	.	.	.	.	.	.	.	A	31	5.104000	0.94245	.	.	ENSG00000134684	ENST00000373477	T	0.74842	-0.88	5.23	5.23	0.72850	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.89494	0.6731	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92188	0.5757	10	0.72032	D	0.01	-8.5665	15.4172	0.74980	1.0:0.0:0.0:0.0	.	18	P54577	SYYC_HUMAN	R	18	ENSP00000362576:L18R	ENSP00000362576:L18R	L	-	2	0	YARS	33055380	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.826000	0.86716	2.110000	0.64415	0.459000	0.35465	CTG	-	YARS	-	tigrfam_Tyr-tR-ligase		0.627	YARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS	HGNC	protein_coding	OTTHUMT00000011225.1	0	0	0	265	265	150	0.00	0.00	A	NM_003680		33282793	-1	29	9	112	54	tier1	no_errors	ENST00000373477	ensembl	human	known	74_37	missense	20.57	14.29	SNP	1.000	C	29	112
ENDOU	8909	genome.wustl.edu	37	12	48111281	48111281	+	Intron	SNP	T	T	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr12:48111281T>C	ENST00000422538.3	-	4	505				ENDOU_ENST00000542202.1_Intron|ENDOU_ENST00000545824.2_Intron|RP1-197B17.3_ENST00000547799.1_lincRNA|ENDOU_ENST00000229003.3_Intron	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific						female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						GCAGCTTAGCTAAGGGAGCAG	0.493											OREG0021752	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000257433																																					0													113.0	105.0	107.0					12																	48111281		2203	4300	6503	SO:0001627	intron_variant	0			-	M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.382+19A>G	12.37:g.48111281T>C		952	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	R	SNP	-	NULL	ENST00000422538.3	37	NULL	CCDS53785.1	12																																																																																			-	RP1-197B17.3	-	-		0.493	ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000257433	Clone_based_vega_gene	protein_coding	OTTHUMT00000405352.1	0	0	0	35	35	143	0.00	0.00	T	NM_006025.2		48111281	+1	6	19	33	70	tier1	no_errors	ENST00000547799	ensembl	human	known	74_37	rna	15.38	21.11	SNP	0.002	C	6	33
ARAP2	116984	genome.wustl.edu	37	4	36149219	36149219	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr4:36149219C>A	ENST00000303965.4	-	18	3639	c.3150G>T	c.(3148-3150)atG>atT	p.M1050I		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1050	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GAACTTCTTGCATTTGAAGGC	0.403													ENSG00000047365																																					0													89.0	88.0	88.0					4																	36149219		2203	4300	6503	SO:0001583	missense	0			-	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3150G>T	4.37:g.36149219C>A	ENSP00000302895:p.Met1050Ile		Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.M1050I	ENST00000303965.4	37	c.3150	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	C	10.90	1.480015	0.26598	.	.	ENSG00000047365	ENST00000303965	T	0.71579	-0.58	5.46	1.54	0.23209	Pleckstrin homology domain (1);	0.647892	0.17321	N	0.178518	T	0.52058	0.1711	L	0.36672	1.1	0.23940	N	0.996407	B	0.21071	0.051	B	0.16722	0.016	T	0.38542	-0.9656	10	0.39692	T	0.17	.	1.2559	0.01991	0.2552:0.4088:0.1242:0.2118	.	1050	Q8WZ64	ARAP2_HUMAN	I	1050	ENSP00000302895:M1050I	ENSP00000302895:M1050I	M	-	3	0	ARAP2	35825614	0.710000	0.27896	0.993000	0.49108	0.946000	0.59487	-0.302000	0.08221	0.272000	0.22027	-0.781000	0.03364	ATG	-	ARAP2	-	smart_Pleckstrin_homology		0.403	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	HGNC	protein_coding	OTTHUMT00000215074.2	0	0	0	27	27	20	0.00	0.00	C	NM_015230		36149219	-1	24	28	46	57	tier1	no_errors	ENST00000303965	ensembl	human	known	74_37	missense	34.29	32.94	SNP	0.931	A	24	46
OR13C4	138804	genome.wustl.edu	37	9	107288554	107288554	+	Silent	SNP	T	T	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr9:107288554T>G	ENST00000277216.3	-	1	936	c.937A>C	c.(937-939)Agg>Cgg	p.R313R		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						ATAGCTTTCCTGCTCAGCAAA	0.353													ENSG00000148136																																					0													65.0	73.0	70.0					9																	107288554		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.937A>C	9.37:g.107288554T>G			Q6IF51|Q96R41	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R313	ENST00000277216.3	37	c.937	CCDS35088.1	9																																																																																			-	OR13C4	-	NULL		0.353	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C4	HGNC	protein_coding	OTTHUMT00000053478.1	0	0	0	47	47	25	0.00	0.00	T			107288554	-1	22	31	70	45	tier1	no_errors	ENST00000277216	ensembl	human	known	74_37	silent	23.91	40.26	SNP	0.000	G	22	70
RBBP7	5931	genome.wustl.edu	37	X	16875809	16875809	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chrX:16875809C>A	ENST00000380087.2	-	5	865	c.505G>T	c.(505-507)Gat>Tat	p.D169Y	RBBP7_ENST00000380084.4_Missense_Mutation_p.D213Y|RBBP7_ENST00000404022.1_Missense_Mutation_p.D160Y			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	169					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					AATCTGAGATCAGGATTACAT	0.383													ENSG00000102054																																					0													161.0	137.0	145.0					X																	16875809		2203	4300	6503	SO:0001583	missense	0			-	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.505G>T	X.37:g.16875809C>A	ENSP00000369427:p.Asp169Tyr		Q5JP00	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Histone-bd_RBBP4_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D169Y	ENST00000380087.2	37	c.505	CCDS14179.1	X	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609181	0.87258	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000416035	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.01	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66066	0.2752	N	0.17379	0.485	0.80722	D	1	D;B;D;D	0.67145	0.977;0.035;0.996;0.992	P;B;D;D	0.65874	0.882;0.087;0.939;0.925	T	0.72279	-0.4340	10	0.87932	D	0	-0.0322	17.1671	0.86819	0.0:1.0:0.0:0.0	.	155;160;169;213	B0R0W4;E9PC52;Q16576;Q5JP00	.;.;RBBP7_HUMAN;.	Y	169;213;160;89	ENSP00000369427:D169Y;ENSP00000369424:D213Y;ENSP00000386068:D160Y;ENSP00000392714:D89Y	ENSP00000369424:D213Y	D	-	1	0	RBBP7	16785730	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.772000	0.85439	2.351000	0.79841	0.513000	0.50165	GAT	-	RBBP7	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.383	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP7	HGNC	protein_coding	OTTHUMT00000055920.2	0	0	0	62	62	68	0.00	0.00	C	NM_002893		16875809	-1	60	45	40	28	tier1	no_errors	ENST00000380087	ensembl	human	known	74_37	missense	60.00	61.64	SNP	1.000	A	60	40
MESDC2	23184	genome.wustl.edu	37	15	81281996	81281996	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr15:81281996G>A	ENST00000261758.4	-	1	223	c.137C>T	c.(136-138)cCa>cTa	p.P46L	RP11-775C24.3_ENST00000563737.1_lincRNA	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	46	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						CCGGGGAGGTGGGGTAGACTC	0.642													ENSG00000117899																																					0													62.0	59.0	60.0					15																	81281996		2203	4300	6503	SO:0001583	missense	0			-	D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.137C>T	15.37:g.81281996G>A	ENSP00000261758:p.Pro46Leu		B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	pfam_Mesoderm_development_cand-2	p.P46L	ENST00000261758.4	37	c.137	CCDS32308.1	15	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503156	0.85176	.	.	ENSG00000117899	ENST00000422879;ENST00000261758	.	.	.	4.36	2.24	0.28232	.	0.559222	0.18006	N	0.154754	T	0.25717	0.0626	L	0.27053	0.805	0.09310	N	1	B	0.24317	0.101	B	0.18561	0.022	T	0.12578	-1.0542	9	0.41790	T	0.15	-15.1623	6.5993	0.22691	0.0:0.2012:0.5912:0.2076	.	46	Q14696	MESD_HUMAN	L	46	.	ENSP00000261758:P46L	P	-	2	0	MESDC2	79069051	0.000000	0.05858	0.004000	0.12327	0.703000	0.40648	0.012000	0.13287	1.130000	0.42092	0.591000	0.81541	CCA	-	MESDC2	-	NULL		0.642	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESDC2	HGNC	protein_coding	OTTHUMT00000417673.2	0	0	0	160	160	87	0.00	0.00	G	NM_015154		81281996	-1	28	7	58	29	tier1	no_errors	ENST00000261758	ensembl	human	known	74_37	missense	32.56	19.44	SNP	0.002	A	28	58
USH2A	7399	genome.wustl.edu	37	1	216246286	216246286	+	Silent	SNP	C	C	T	rs149776188	byFrequency	TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr1:216246286C>T	ENST00000307340.3	-	29	6188	c.5802G>A	c.(5800-5802)tcG>tcA	p.S1934S	RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA|USH2A_ENST00000366943.2_Silent_p.S1934S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1934	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCCTTCATGCGAGGCTATCA	0.403										HNSCC(13;0.011)			ENSG00000042781	C|||	6	0.00119808	0.0045	0.0	5008	,	,		20872	0.0		0.0	False		,,,				2504	0.0																0								C		6,4400	12.9+/-30.5	0,6,2197	137.0	120.0	126.0		5802	-12.0	0.0	1	dbSNP_134	126	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	USH2A	NM_206933.2		0,7,6496	TT,TC,CC		0.0116,0.1362,0.0538		1934/5203	216246286	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5802G>A	1.37:g.216246286C>T			Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.S1934	ENST00000307340.3	37	c.5802	CCDS31025.1	1																																																																																			rs149776188	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	22	22	19	0.00	0.00	C	NM_007123		216246286	-1	12	11	74	60	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	silent	13.95	15.49	SNP	0.007	T	12	74
OR13C4	138804	genome.wustl.edu	37	9	107288553	107288553	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr9:107288553C>G	ENST00000277216.3	-	1	937	c.938G>C	c.(937-939)aGg>aCg	p.R313T		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						AATAGCTTTCCTGCTCAGCAA	0.353													ENSG00000148136																																					0													66.0	73.0	71.0					9																	107288553		2203	4300	6503	SO:0001583	missense	0			-		CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.938G>C	9.37:g.107288553C>G	ENSP00000277216:p.Arg313Thr		Q6IF51|Q96R41	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R313T	ENST00000277216.3	37	c.938	CCDS35088.1	9	.	.	.	.	.	.	.	.	.	.	C	8.343	0.829203	0.16749	.	.	ENSG00000148136	ENST00000277216;ENST00000545903	T	0.39592	1.07	4.02	-2.4	0.06583	.	2.271960	0.02875	U	0.132173	T	0.42063	0.1186	M	0.61703	1.905	0.09310	N	1	B	0.17852	0.024	B	0.16722	0.016	T	0.47341	-0.9125	10	0.72032	D	0.01	.	8.6898	0.34260	0.0:0.3648:0.0:0.6352	.	313	Q8NGS5	O13C4_HUMAN	T	313;342	ENSP00000277216:R313T	ENSP00000277216:R313T	R	-	2	0	OR13C4	106328374	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.186000	0.01251	-0.393000	0.07739	-0.214000	0.12660	AGG	-	OR13C4	-	NULL		0.353	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C4	HGNC	protein_coding	OTTHUMT00000053478.1	0	0	0	49	49	25	0.00	0.00	C			107288553	-1	22	31	70	46	tier1	no_errors	ENST00000277216	ensembl	human	known	74_37	missense	23.91	40.26	SNP	0.000	G	22	70
ZNF804B	219578	genome.wustl.edu	37	7	88965546	88965546	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr7:88965546G>C	ENST00000333190.4	+	4	3859	c.3250G>C	c.(3250-3252)Ggt>Cgt	p.G1084R		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1084							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TAAATATACTGGTGTGACTGA	0.348										HNSCC(36;0.09)			ENSG00000182348																																					0													54.0	53.0	53.0					7																	88965546		2202	4299	6501	SO:0001583	missense	0			-	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3250G>C	7.37:g.88965546G>C	ENSP00000329638:p.Gly1084Arg		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.G1084R	ENST00000333190.4	37	c.3250	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	11.89	1.773395	0.31411	.	.	ENSG00000182348	ENST00000333190	T	0.05717	3.4	5.04	2.21	0.28008	.	0.471757	0.21800	N	0.068930	T	0.06554	0.0168	L	0.32530	0.975	0.30509	N	0.769631	D	0.54397	0.966	P	0.48030	0.564	T	0.15636	-1.0430	10	0.54805	T	0.06	-0.8535	5.1019	0.14764	0.228:0.0:0.6258:0.1461	.	1084	A4D1E1	Z804B_HUMAN	R	1084	ENSP00000329638:G1084R	ENSP00000329638:G1084R	G	+	1	0	ZNF804B	88803482	0.955000	0.32602	0.306000	0.25113	0.807000	0.45602	0.711000	0.25764	0.384000	0.24942	0.655000	0.94253	GGT	-	ZNF804B	-	NULL		0.348	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	0	0	0	9	9	30	0.00	0.00	G	NM_181646		88965546	+1	14	25	30	73	tier1	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	31.82	25.51	SNP	0.912	C	14	30
UNKL	64718	genome.wustl.edu	37	16	1444179	1444179	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr16:1444179G>C	ENST00000389221.4	-	7	880	c.881C>G	c.(880-882)aCc>aGc	p.T294S	UNKL_ENST00000397462.1_Missense_Mutation_p.T484S|UNKL_ENST00000508903.2_Missense_Mutation_p.T297S	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	294					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GCAGTACCCGGTTTGGCGCAT	0.522													ENSG00000059145																																					0																																										SO:0001583	missense	0			-	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.881C>G	16.37:g.1444179G>C	ENSP00000373873:p.Thr294Ser		B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.T484S	ENST00000389221.4	37	c.1451	CCDS53981.1	16	.	.	.	.	.	.	.	.	.	.	G	6.901	0.535828	0.13188	.	.	ENSG00000059145	ENST00000389221;ENST00000508903;ENST00000397462	T;T;T	0.53206	0.63;0.63;0.63	4.94	4.94	0.65067	Zinc finger, CCCH-type (3);	0.108036	0.64402	N	0.000007	T	0.51550	0.1681	L	0.28504	0.86	0.21105	N	0.999786	D	0.64830	0.994	P	0.62298	0.9	T	0.44236	-0.9341	10	0.15952	T	0.53	.	15.6618	0.77193	0.0:0.0:1.0:0.0	.	294	Q9H9P5	UNKL_HUMAN	S	294;297;484	ENSP00000373873:T294S;ENSP00000422852:T297S;ENSP00000380604:T484S	ENSP00000373873:T294S	T	-	2	0	UNKL	1384180	0.994000	0.37717	0.772000	0.31596	0.089000	0.18198	4.354000	0.59417	2.295000	0.77249	0.591000	0.81541	ACC	-	UNKL	-	pfam_Znf_CCCH,smart_Znf_CCCH		0.522	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding		0	0	0	150	150	201	0.00	0.00	G	NM_001037125		1444179	-1	25	16	115	94	tier1	no_errors	ENST00000397462	ensembl	human	known	74_37	missense	17.86	14.55	SNP	0.978	C	25	115
TMEM139	135932	genome.wustl.edu	37	7	142983670	142983670	+	Silent	SNP	G	G	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr7:142983670G>C	ENST00000359333.3	+	3	912	c.399G>C	c.(397-399)ggG>ggC	p.G133G	TMEM139_ENST00000409102.1_Silent_p.G133G|TMEM139_ENST00000471161.1_3'UTR|AC073342.12_ENST00000427392.1_RNA|TMEM139_ENST00000410004.1_Silent_p.G133G|CASP2_ENST00000310447.5_5'Flank|CASP2_ENST00000392925.2_5'Flank|TMEM139_ENST00000409541.1_Silent_p.G133G|AC073342.12_ENST00000446192.1_RNA|TMEM139_ENST00000409244.1_Silent_p.G133G	NM_001242775.2|NM_001282876.1|NM_001282877.1	NP_001229704.1|NP_001269805.1|NP_001269806.1	Q8IV31	TM139_HUMAN	transmembrane protein 139	133						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(1)|prostate(1)	7	Melanoma(164;0.059)					ATCCAGAGGGGTCCAGGAGAG	0.602													ENSG00000178826																																					0													74.0	77.0	76.0					7																	142983670		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK075067	CCDS5878.1	7q34	2006-03-17			ENSG00000178826	ENSG00000178826			22058	protein-coding gene	gene with protein product							Standard	NM_153345		Approved	FLJ90586	uc003wck.4	Q8IV31	OTTHUMG00000152652	ENST00000359333.3:c.399G>C	7.37:g.142983670G>C			B2RCL5|D3DXD4|Q6ZME2|Q8NC22|Q96AU8	Silent	SNP	NULL	p.G133	ENST00000359333.3	37	c.399	CCDS5878.1	7																																																																																			-	TMEM139	-	NULL		0.602	TMEM139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM139	HGNC	protein_coding	OTTHUMT00000327145.1	0	0	0	115	115	149	0.00	0.00	G	NM_153345		142983670	+1	15	10	82	88	tier1	no_errors	ENST00000359333	ensembl	human	known	74_37	silent	15.46	10.10	SNP	0.000	C	15	82
ATRX	546	genome.wustl.edu	37	X	76890128	76890128	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chrX:76890128C>T	ENST00000373344.5	-	17	4980	c.4766G>A	c.(4765-4767)gGa>gAa	p.G1589E	ATRX_ENST00000395603.3_Missense_Mutation_p.G1551E|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1589	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.G1589V(1)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAGAATGCATCCTGAACCTGG	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	2	Substitution - Missense(1)|Unknown(1)	central_nervous_system(1)|bone(1)											179.0	175.0	176.0					X																	76890128		2203	4296	6499	SO:0001583	missense	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4766G>A	X.37:g.76890128C>T	ENSP00000362441:p.Gly1589Glu		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G1589E	ENST00000373344.5	37	c.4766	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014706	0.75161	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	T;T	0.26373	1.74;1.74	5.77	5.77	0.91146	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	H	0.98646	4.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83198	-0.0080	10	0.87932	D	0	-9.7166	18.913	0.92493	0.0:1.0:0.0:0.0	.	1551;1589	P46100-4;P46100	.;ATRX_HUMAN	E	1589;1551	ENSP00000362441:G1589E;ENSP00000378967:G1551E	ENSP00000362441:G1589E	G	-	2	0	ATRX	76776784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.463000	0.80869	2.414000	0.81942	0.600000	0.82982	GGA	-	ATRX	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	119	119	113	0.00	0.00	C	NM_000489		76890128	-1	41	42	51	34	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	44.57	55.26	SNP	1.000	T	41	51
CCDC168	643677	genome.wustl.edu	37	13	103383736	103383736	+	Silent	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr13:103383736C>T	ENST00000322527.2	-	1	5423	c.5424G>A	c.(5422-5424)agG>agA	p.R1808R		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1808																	GTAAAGATTTCCTTGCCATCT	0.313													ENSG00000175820																																					0													106.0	86.0	92.0					13																	103383736		692	1590	2282	SO:0001819	synonymous_variant	0			-		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.5424G>A	13.37:g.103383736C>T			Q8N800	Silent	SNP	NULL	p.R1808	ENST00000322527.2	37	c.5424		13																																																																																			-	CCDC168	-	NULL		0.313	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		0	0	0	25	25	16	0.00	0.00	C	NM_001146197		103383736	-1	33	34	36	24	tier1	no_errors	ENST00000322527	ensembl	human	known	74_37	silent	47.14	58.62	SNP	0.000	T	33	36
PRIMPOL	201973	genome.wustl.edu	37	4	185599415	185599415	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr4:185599415C>G	ENST00000314970.6	+	8	1307	c.874C>G	c.(874-876)Cta>Gta	p.L292V	PRIMPOL_ENST00000515774.1_Missense_Mutation_p.L163V|PRIMPOL_ENST00000512834.1_Missense_Mutation_p.L292V|PRIMPOL_ENST00000503752.1_Missense_Mutation_p.L292V	NM_152683.2	NP_689896	Q96LW4	PRIPO_HUMAN	primase and polymerase (DNA-directed)	292					mitochondrial DNA replication (GO:0006264)|replication fork processing (GO:0031297)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA primase activity (GO:0003896)|DNA-directed DNA polymerase activity (GO:0003887)|manganese ion binding (GO:0030145)										AAACTTTCGGCTATATAAATC	0.289													ENSG00000164306																																					0													32.0	34.0	33.0					4																	185599415		2198	4289	6487	SO:0001583	missense	0			-	AK057729	CCDS3837.1, CCDS75211.1, CCDS75212.1	4q35.1	2013-09-27	2013-09-27	2013-09-27	ENSG00000164306	ENSG00000164306			26575	protein-coding gene	gene with protein product		615421	"""coiled-coil domain containing 111"""	CCDC111		12477932	Standard	XM_005262814		Approved	FLJ33167	uc003iwk.2	Q96LW4	OTTHUMG00000160495	ENST00000314970.6:c.874C>G	4.37:g.185599415C>G	ENSP00000313816:p.Leu292Val		D3DP55|D6RDM1|Q5HYJ9	Missense_Mutation	SNP	pfam_D_primase_UL52/UL70_Herpvir,pfam_D_primase_S	p.L292V	ENST00000314970.6	37	c.874	CCDS3837.1	4	.	.	.	.	.	.	.	.	.	.	C	15.69	2.907394	0.52333	.	.	ENSG00000164306	ENST00000314970;ENST00000515774;ENST00000503752;ENST00000512834	T;T;T;T	0.56611	0.75;0.45;0.75;0.75	5.95	4.24	0.50183	.	0.143204	0.47852	D	0.000205	T	0.66528	0.2798	M	0.77313	2.365	0.22787	N	0.99874	D;D	0.64830	0.994;0.994	D;D	0.71656	0.952;0.974	T	0.59456	-0.7451	10	0.59425	D	0.04	0.1488	4.3578	0.11187	0.1588:0.5461:0.0:0.295	.	292;292	Q96LW4;D6RDM1	CC111_HUMAN;.	V	292;163;292;292	ENSP00000313816:L292V;ENSP00000421913:L163V;ENSP00000420860:L292V;ENSP00000425316:L292V	ENSP00000313816:L292V	L	+	1	2	CCDC111	185836409	0.969000	0.33509	0.050000	0.19076	0.961000	0.63080	1.593000	0.36686	0.867000	0.35654	0.655000	0.94253	CTA	-	PRIMPOL	-	pfam_D_primase_S		0.289	PRIMPOL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRIMPOL	HGNC	protein_coding	OTTHUMT00000360827.1	1	1	0	107	107	67	0.91	0.00	C	NM_152683		185599415	+1	49	28	86	62	tier1	no_errors	ENST00000314970	ensembl	human	known	74_37	missense	36.30	30.77	SNP	0.302	G	49	86
NPAP1	23742	genome.wustl.edu	37	15	24921704	24921704	+	Silent	SNP	G	G	A	rs146878373		TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr15:24921704G>A	ENST00000329468.2	+	1	1164	c.690G>A	c.(688-690)gcG>gcA	p.A230A		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	230					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CGTCTCCAGCGAGCTCCTGCT	0.612													ENSG00000185823																																					0								G		0,4406		0,0,2203	30.0	33.0	32.0		690	1.7	0.0	15	dbSNP_134	32	1,8599		0,1,4299	no	coding-synonymous	C15orf2	NM_018958.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		230/1157	24921704	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.690G>A	15.37:g.24921704G>A				Silent	SNP	NULL	p.A230	ENST00000329468.2	37	c.690	CCDS10015.1	15																																																																																			rs146878373	NPAP1	-	NULL		0.612	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	0	0	0	95	95	74	0.00	0.00	G	NM_018958		24921704	+1	9	10	67	31	tier1	no_errors	ENST00000329468	ensembl	human	known	74_37	silent	11.84	24.39	SNP	0.001	A	9	67
RSL24D1	51187	genome.wustl.edu	37	15	55483213	55483213	+	Silent	SNP	A	A	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr15:55483213A>G	ENST00000260443.4	-	3	404	c.228T>C	c.(226-228)aaT>aaC	p.N76N	RSL24D1_ENST00000565854.1_5'Flank	NM_016304.2	NP_057388.1	Q9UHA3	RLP24_HUMAN	ribosomal L24 domain containing 1	76					ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)				central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	7						TGATAGGTTCATTTCTACGTT	0.313													ENSG00000137876																																					0													80.0	77.0	78.0					15																	55483213		2192	4287	6479	SO:0001819	synonymous_variant	0			-	AF201949	CCDS10152.1	15q21	2009-02-27	2009-02-27	2009-02-27	ENSG00000137876	ENSG00000137876			18479	protein-coding gene	gene with protein product		613262	"""chromosome 15 open reading frame 15"""	C15orf15		12808088, 11707418	Standard	NM_016304		Approved	HRP-L30-iso, L30, RPL24L, RPL24	uc002acn.3	Q9UHA3	OTTHUMG00000131957	ENST00000260443.4:c.228T>C	15.37:g.55483213A>G			B2RD72|Q561V8|Q8N6S8|Q96B04|Q96C76|Q96HJ1	Silent	SNP	pfam_Ribosomal_L24e_rel,smart_TRASH_dom	p.N76	ENST00000260443.4	37	c.228	CCDS10152.1	15																																																																																			-	RSL24D1	-	NULL		0.313	RSL24D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSL24D1	HGNC	protein_coding	OTTHUMT00000254916.1	0	0	0	52	52	26	0.00	0.00	A	NM_016304		55483213	-1	13	16	38	30	tier1	no_errors	ENST00000260443	ensembl	human	known	74_37	silent	25.49	34.78	SNP	1.000	G	13	38
ALS2	57679	genome.wustl.edu	37	2	202589136	202589136	+	Missense_Mutation	SNP	G	G	A	rs149670991		TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr2:202589136G>A	ENST00000264276.6	-	21	3766	c.3394C>T	c.(3394-3396)Cgt>Tgt	p.R1132C	ALS2_ENST00000457679.2_Missense_Mutation_p.R444C	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1132					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TGACCATGACGCATATTATCT	0.413													ENSG00000003393	G|||	1	0.000199681	0.0008	0.0	5008	,	,		18074	0.0		0.0	False		,,,				2504	0.0																0													186.0	164.0	171.0					2																	202589136		1901	4131	6032	SO:0001583	missense	0			GMAF=0.0005	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.3394C>T	2.37:g.202589136G>A	ENSP00000264276:p.Arg1132Cys		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_RCC1/BLIP-II,superfamily_DH-domain,smart_MORN,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain,prints_Reg_chr_condens	p.R1132C	ENST00000264276.6	37	c.3394	CCDS42800.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	27.0	4.792192	0.90453	.	.	ENSG00000003393	ENST00000264276;ENST00000457679	T;T	0.50001	0.76;0.76	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.69611	0.3130	M	0.78344	2.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71609	-0.4541	10	0.66056	D	0.02	.	15.0971	0.72244	0.0:0.0:0.8584:0.1416	.	1132;1132	Q6IQ41;Q96Q42	.;ALS2_HUMAN	C	1132;444	ENSP00000264276:R1132C;ENSP00000394823:R444C	ENSP00000264276:R1132C	R	-	1	0	ALS2	202297381	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.305000	0.72805	2.805000	0.96524	0.655000	0.94253	CGT	rs149670991	ALS2	-	pfam_MORN,smart_MORN		0.413	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3	0	0	0	94	94	125	0.00	0.00	G	NM_020919		202589136	-1	32	28	51	41	tier1	no_errors	ENST00000264276	ensembl	human	known	74_37	missense	38.55	40.00	SNP	1.000	A	32	51
CPZ	8532	genome.wustl.edu	37	4	8621215	8621215	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr4:8621215G>C	ENST00000360986.4	+	11	2004	c.1830G>C	c.(1828-1830)ttG>ttC	p.L610F	CPZ_ENST00000429646.2_Missense_Mutation_p.L218F|CPZ_ENST00000382480.2_Missense_Mutation_p.L473F|CPZ_ENST00000315782.6_Missense_Mutation_p.L599F	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	610					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCAGCTCTTTGGGGGAGGCCA	0.657													ENSG00000109625																																					0													36.0	39.0	38.0					4																	8621215		2203	4300	6503	SO:0001583	missense	0			-	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1830G>C	4.37:g.8621215G>C	ENSP00000354255:p.Leu610Phe		O00520|Q96MX2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Frizzled_dom,superfamily_Frizzled_dom,superfamily_CarboxyPept-like_regulatory,smart_Frizzled_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Frizzled_dom	p.L610F	ENST00000360986.4	37	c.1830	CCDS33953.1	4	.	.	.	.	.	.	.	.	.	.	G	6.385	0.439176	0.12104	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782;ENST00000429646	T;T;T;T	0.58210	0.68;2.06;0.35;1.94	4.66	0.155	0.14906	.	12.913800	0.00166	N	0.000003	T	0.28764	0.0713	N	0.08118	0	0.09310	N	1	B;B	0.18013	0.024;0.025	B;B	0.18561	0.022;0.01	T	0.13818	-1.0495	10	0.10377	T	0.69	0.0381	3.2528	0.06820	0.126:0.3622:0.3876:0.1242	.	599;610	Q66K79-2;Q66K79	.;CBPZ_HUMAN	F	610;473;599;218	ENSP00000354255:L610F;ENSP00000371920:L473F;ENSP00000315074:L599F;ENSP00000403981:L218F	ENSP00000315074:L599F	L	+	3	2	CPZ	8672115	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-1.740000	0.01839	0.064000	0.16427	0.456000	0.33151	TTG	-	CPZ	-	NULL		0.657	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	HGNC	protein_coding	OTTHUMT00000207001.4	0	0	0	43	43	37	0.00	0.00	G	NM_003652		8621215	+1	7	7	36	21	tier1	no_errors	ENST00000360986	ensembl	human	known	74_37	missense	16.28	25.00	SNP	0.000	C	7	36
AMER3	205147	genome.wustl.edu	37	2	131520382	131520382	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr2:131520382C>T	ENST00000423981.1	+	2	847	c.737C>T	c.(736-738)tCg>tTg	p.S246L	AMER3_ENST00000321420.4_Missense_Mutation_p.S246L	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	246					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										AGCTTCGACTCGCTCACGGGT	0.642													ENSG00000178171																																					0													63.0	72.0	69.0					2																	131520382		2203	4300	6503	SO:0001583	missense	0			-	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.737C>T	2.37:g.131520382C>T	ENSP00000392700:p.Ser246Leu		B7ZLH6	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.S246L	ENST00000423981.1	37	c.737	CCDS2164.1	2	.	.	.	.	.	.	.	.	.	.	C	18.07	3.542408	0.65198	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.43294	0.95;0.95	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000001	T	0.66458	0.2791	M	0.77103	2.36	0.48236	D	0.999618	D	0.89917	1.0	D	0.91635	0.999	T	0.70421	-0.4876	10	0.87932	D	0	.	16.6282	0.84992	0.0:1.0:0.0:0.0	.	246	Q8N944	F123C_HUMAN	L	246	ENSP00000314914:S246L;ENSP00000392700:S246L	ENSP00000314914:S246L	S	+	2	0	FAM123C	131236852	1.000000	0.71417	0.952000	0.39060	0.084000	0.17831	6.971000	0.76105	2.597000	0.87782	0.561000	0.74099	TCG	-	AMER3	-	pfam_Uncharacterised_FAM123		0.642	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER3	HGNC	protein_coding	OTTHUMT00000254531.3	0	0	0	94	94	75	0.00	0.00	C	NM_152698		131520382	+1	12	9	14	12	tier1	no_errors	ENST00000321420	ensembl	human	known	74_37	missense	46.15	42.86	SNP	0.999	T	12	14
CNOT4	4850	genome.wustl.edu	37	7	135047671	135047671	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr7:135047671T>A	ENST00000451834.1	-	12	2382	c.2099A>T	c.(2098-2100)gAt>gTt	p.D700V	CNOT4_ENST00000473470.1_5'Flank|CNOT4_ENST00000541284.1_Missense_Mutation_p.D703V|CNOT4_ENST00000361528.4_Missense_Mutation_p.D629V|CNOT4_ENST00000423368.2_Missense_Mutation_p.D632V			O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	0					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						CTGTAGTAAATCTGTGGGGGT	0.527													ENSG00000080802																									Ovarian(51;766 1130 5502 35047 50875)												0													204.0	213.0	210.0					7																	135047671		1855	4095	5950	SO:0001583	missense	0			-	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000451834.1:c.2099A>T	7.37:g.135047671T>A	ENSP00000388491:p.Asp700Val		B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,pfscan_Znf_RING,pfscan_RRM_dom	p.D703V	ENST00000451834.1	37	c.2108	CCDS55167.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.87|18.87	3.715352|3.715352	0.68844|0.68844	.|.	.|.	ENSG00000080802|ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000361528|ENST00000262563	T;T;T;T|.	0.54279|.	0.63;0.62;0.58;0.58|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	.|0.248154	.|0.47852	.|N	.|0.000208	T|T	0.54255|0.54255	0.1847|0.1847	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	P;D;D;D|.	0.55385|.	0.952;0.971;0.971;0.971|.	P;P;P;P|.	0.55455|.	0.521;0.776;0.624;0.624|.	T|T	0.49835|0.49835	-0.8897|-0.8897	9|7	0.87932|0.02654	D|T	0|1	-2.7989|-2.7989	16.3594|16.3594	0.83251|0.83251	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	700;703;632;629|.	E7ET38;F8VQP3;O95628-4;O95628-8|.	.;.;.;.|.	V|F	703;700;632;629|690	ENSP00000445508:D703V;ENSP00000388491:D700V;ENSP00000406777:D632V;ENSP00000354673:D629V|.	ENSP00000354673:D629V|ENSP00000262563:I690F	D|I	-|-	2|1	0|0	CNOT4|CNOT4	134698211|134698211	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.856000|7.856000	0.86956|0.86956	2.266000|2.266000	0.75297|0.75297	0.455000|0.455000	0.32223|0.32223	GAT|ATT	-	CNOT4	-	NULL		0.527	CNOT4-003	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CNOT4	HGNC	protein_coding	OTTHUMT00000340670.1	0	0	0	50	50	75	0.00	0.00	T	NM_013316		135047671	-1	7	7	49	42	tier1	no_errors	ENST00000541284	ensembl	human	known	74_37	missense	12.28	14.00	SNP	1.000	A	7	49
TP53	7157	genome.wustl.edu	37	17	7578464	7578464	+	Missense_Mutation	SNP	G	G	C	rs563378859		TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr17:7578464G>C	ENST00000269305.4	-	5	655	c.466C>G	c.(466-468)Cgc>Ggc	p.R156G	TP53_ENST00000445888.2_Missense_Mutation_p.R156G|TP53_ENST00000359597.4_Missense_Mutation_p.R156G|TP53_ENST00000420246.2_Missense_Mutation_p.R156G|TP53_ENST00000455263.2_Missense_Mutation_p.R156G|TP53_ENST00000413465.2_Missense_Mutation_p.R156G|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	156	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R156fs*14(9)|p.0?(8)|p.?(5)|p.P152fs*14(4)|p.R156S(3)|p.R156G(3)|p.G154fs*14(2)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.R156fs*25(2)|p.R156C(2)|p.T155_R156delTR(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156del(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R156_V157del(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.G154_R156delGTR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCGCGGACGCGGGTGCCGGGC	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	58	Deletion - Frameshift(24)|Deletion - In frame(11)|Whole gene deletion(8)|Substitution - Missense(8)|Unknown(5)|Insertion - Frameshift(2)	skin(7)|ovary(7)|upper_aerodigestive_tract(5)|lung(5)|stomach(4)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|bone(4)|large_intestine(3)|oesophagus(3)|urinary_tract(2)|liver(2)|pancreas(2)|soft_tissue(1)|genital_tract(1)											50.0	52.0	51.0					17																	7578464		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.466C>G	17.37:g.7578464G>C	ENSP00000269305:p.Arg156Gly		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R156G	ENST00000269305.4	37	c.466	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873152	0.33069	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99766	-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69	5.47	1.13	0.20643	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.599272	0.17934	N	0.157074	D	0.99447	0.9804	M	0.73598	2.24	0.09310	N	1	D;P;P;P;P;P;D	0.65815	0.995;0.792;0.615;0.928;0.719;0.914;0.977	D;P;B;P;P;P;P	0.64595	0.927;0.624;0.338;0.682;0.661;0.813;0.759	D	0.98395	1.0565	10	0.72032	D	0.01	-1.0137	1.5494	0.02571	0.2515:0.1413:0.4617:0.1454	.	117;156;156;63;156;156;156	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	G	156;156;156;156;156;156;145;63;24;63;24;156	ENSP00000410739:R156G;ENSP00000352610:R156G;ENSP00000269305:R156G;ENSP00000398846:R156G;ENSP00000391127:R156G;ENSP00000391478:R156G;ENSP00000425104:R24G;ENSP00000423862:R63G;ENSP00000424104:R156G	ENSP00000269305:R156G	R	-	1	0	TP53	7519189	0.068000	0.21057	0.000000	0.03702	0.074000	0.17049	-0.035000	0.12205	0.068000	0.16574	0.563000	0.77884	CGC	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	42	42	137	0.00	0.00	G	NM_000546		7578464	-1	9	23	10	21	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	47.37	52.27	SNP	0.010	C	9	10
GUCY2D	3000	genome.wustl.edu	37	17	7918813	7918813	+	Silent	SNP	G	G	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr17:7918813G>T	ENST00000254854.4	+	15	3087	c.2937G>T	c.(2935-2937)ctG>ctT	p.L979L		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	979	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				GCATAGGCCTGCACTCGGGTA	0.617													ENSG00000132518																																					0													30.0	25.0	27.0					17																	7918813		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.2937G>T	17.37:g.7918813G>T			Q6LEA7	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Haem_no_assoc-bd,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L979	ENST00000254854.4	37	c.2937	CCDS11127.1	17																																																																																			-	GUCY2D	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.617	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2D	HGNC	protein_coding	OTTHUMT00000226973.2	0	0	0	97	97	83	0.00	0.00	G			7918813	+1	7	11	33	20	tier1	no_errors	ENST00000254854	ensembl	human	known	74_37	silent	17.50	35.48	SNP	1.000	T	7	33
ZNF658	26149	genome.wustl.edu	37	9	40772812	40772812	+	Silent	SNP	T	T	C	rs551555151		TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr9:40772812T>C	ENST00000602553.1	-	5	2757	c.2463A>G	c.(2461-2463)acA>acG	p.T821T	ZNF658_ENST00000377626.3_Silent_p.T821T|ZNF658_ENST00000441795.1_Intron			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	821					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GTTTCTCCCCTGTGTGAATTC	0.418													ENSG00000196409	T|||	1	0.000199681	0.0	0.0	5008	,	,		19907	0.001		0.0	False		,,,				2504	0.0																0													67.0	66.0	67.0					9																	40772812		2201	4295	6496	SO:0001819	synonymous_variant	0			-	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.2463A>G	9.37:g.40772812T>C			Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T821	ENST00000602553.1	37	c.2463	CCDS35023.1	9																																																																																			-	ZNF658	-	pfscan_Znf_C2H2		0.418	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	HGNC	protein_coding	OTTHUMT00000467800.1	1	1	0	109	109	24	0.91	0.00	T	NM_033160		40772812	-1	104	20	144	32	tier1	no_errors	ENST00000377626	ensembl	human	known	74_37	silent	41.94	37.74	SNP	0.999	C	104	144
VAC14	55697	genome.wustl.edu	37	16	70820149	70820149	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr16:70820149C>T	ENST00000261776.5	-	2	484	c.224G>A	c.(223-225)gGc>gAc	p.G75D		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	75					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GGCGGCCAGGCCGATGAGGCC	0.617													ENSG00000103043																																					0													81.0	83.0	82.0					16																	70820149		2198	4300	6498	SO:0001583	missense	0			-	AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.224G>A	16.37:g.70820149C>T	ENSP00000261776:p.Gly75Asp		B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_VAC14_Fig4p-bd,pfam_HEAT,superfamily_ARM-type_fold	p.G75D	ENST00000261776.5	37	c.224	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.440208	0.96168	.	.	ENSG00000103043	ENST00000261776	T	0.66995	-0.24	5.65	5.65	0.86999	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85622	0.5739	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87691	0.2554	10	0.87932	D	0	-30.9136	19.7404	0.96228	0.0:1.0:0.0:0.0	.	75	Q08AM6	VAC14_HUMAN	D	75	ENSP00000261776:G75D	ENSP00000261776:G75D	G	-	2	0	VAC14	69377650	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.734000	0.84928	2.661000	0.90470	0.650000	0.86243	GGC	-	VAC14	-	superfamily_ARM-type_fold		0.617	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	0	0	0	74	74	75	0.00	0.00	C	NM_018052		70820149	-1	12	8	58	28	tier1	no_errors	ENST00000261776	ensembl	human	known	74_37	missense	17.14	22.22	SNP	1.000	T	12	58
C2orf78	388960	genome.wustl.edu	37	2	74043560	74043560	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr2:74043560G>A	ENST00000409561.1	+	3	2331	c.2210G>A	c.(2209-2211)cGg>cAg	p.R737Q		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	737										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						GTTTCTCGGCGGCCAAACCCT	0.542													ENSG00000187833																																					0													196.0	202.0	200.0					2																	74043560		2091	4214	6305	SO:0001583	missense	0			-	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.2210G>A	2.37:g.74043560G>A	ENSP00000387124:p.Arg737Gln			Missense_Mutation	SNP	NULL	p.R737Q	ENST00000409561.1	37	c.2210	CCDS46338.1	2	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387456	0.61956	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.46451	0.87	5.23	0.824	0.18818	.	0.547369	0.16577	N	0.208374	T	0.49966	0.1588	L	0.60455	1.87	0.09310	N	1	D	0.76494	0.999	P	0.61477	0.889	T	0.31447	-0.9943	10	0.51188	T	0.08	-8.9192	6.3866	0.21563	0.4601:0.0:0.5399:0.0	.	737	A6NCI8	CB078_HUMAN	Q	737;707	ENSP00000387124:R737Q	ENSP00000340692:R707Q	R	+	2	0	C2orf78	73897068	0.926000	0.31397	0.026000	0.17262	0.003000	0.03518	0.856000	0.27818	0.313000	0.23062	0.563000	0.77884	CGG	-	C2orf78	-	NULL		0.542	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf78	HGNC	protein_coding	OTTHUMT00000328083.1	0	0	0	34	34	86	0.00	0.00	G	NM_001080474		74043560	+1	28	49	21	33	tier1	no_errors	ENST00000409561	ensembl	human	novel	74_37	missense	57.14	59.76	SNP	0.022	A	28	21
SLIT2	9353	genome.wustl.edu	37	4	20597435	20597435	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr4:20597435T>C	ENST00000504154.1	+	31	3550	c.3298T>C	c.(3298-3300)Tgc>Cgc	p.C1100R	SLIT2_ENST00000503837.1_Missense_Mutation_p.C1096R|SLIT2_ENST00000503823.1_Missense_Mutation_p.C1092R|SLIT2_ENST00000273739.5_Missense_Mutation_p.C1113R	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1100	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CGGCTATACGTGCATATGCCC	0.448													ENSG00000145147																																					0													126.0	117.0	120.0					4																	20597435		2203	4300	6503	SO:0001583	missense	0			-	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3298T>C	4.37:g.20597435T>C	ENSP00000422591:p.Cys1100Arg		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.C1100R	ENST00000504154.1	37	c.3298	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517037	0.85495	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.99992	-12.4;-12.4;-12.4;-12.4	6.17	6.17	0.99709	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99994	0.9999	H	0.99712	4.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	D	0.99995	1.5312	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1092;1100	O94813-3;O94813	.;SLIT2_HUMAN	R	1092;1100;1113;1096;1096	ENSP00000427548:C1092R;ENSP00000422591:C1100R;ENSP00000273739:C1113R;ENSP00000422261:C1096R	ENSP00000273739:C1113R	C	+	1	0	SLIT2	20206533	1.000000	0.71417	0.955000	0.39395	0.829000	0.46940	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	TGC	-	SLIT2	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.448	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	0	0	0	70	70	70	0.00	0.00	T			20597435	+1	38	13	81	68	tier1	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	31.93	16.05	SNP	1.000	C	38	81
CEL	1056	genome.wustl.edu	37	9	135946410	135946410	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr9:135946410C>G	ENST00000372080.4	+	11	1546	c.1530C>G	c.(1528-1530)caC>caG	p.H510Q	CEL_ENST00000351304.7_Missense_Mutation_p.H441Q	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	507					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TGCCCACACACTGGGAACCCT	0.617													ENSG00000170835																																					0													42.0	52.0	49.0					9																	135946410		2058	4199	6257	SO:0001583	missense	0			-	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1530C>G	9.37:g.135946410C>G	ENSP00000361151:p.His510Gln		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.H510Q	ENST00000372080.4	37	c.1530	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	C	7.447	0.641861	0.14451	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.66099	-0.19;0.36	5.04	-3.8	0.04307	Carboxylesterase, type B (1);	1.363530	0.04669	N	0.410338	T	0.34019	0.0883	N	0.05554	-0.025	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10660	-1.0620	10	0.25751	T	0.34	.	2.2627	0.04071	0.3019:0.2649:0.3098:0.1234	.	507	P19835	CEL_HUMAN	Q	510;441;509	ENSP00000361151:H510Q;ENSP00000342217:H441Q	ENSP00000304021:H509Q	H	+	3	2	CEL	134936231	0.000000	0.05858	0.078000	0.20375	0.322000	0.28314	-0.718000	0.04980	-0.104000	0.12154	-0.712000	0.03635	CAC	-	CEL	-	pfam_CarbesteraseB		0.617	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	0	0	0	191	191	126	0.00	0.00	C			135946410	+1	29	10	100	64	tier1	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	22.48	13.51	SNP	0.007	G	29	100
NLGN4X	57502	genome.wustl.edu	37	X	6069226	6069226	+	Silent	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chrX:6069226C>T	ENST00000381095.3	-	2	909	c.282G>A	c.(280-282)ccG>ccA	p.P94P	NLGN4X_ENST00000381093.2_Silent_p.P94P|NLGN4X_ENST00000538097.1_Silent_p.P94P|NLGN4X_ENST00000381092.1_Silent_p.P94P|NLGN4X_ENST00000275857.6_Silent_p.P94P|NLGN4X_ENST00000469740.1_5'UTR	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	94					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TCCAGGAGGACGGGGGTTCTG	0.577													ENSG00000146938																																					0													69.0	63.0	65.0					X																	6069226		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.282G>A	X.37:g.6069226C>T			Q6UX10|Q9ULG0	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.P94	ENST00000381095.3	37	c.282	CCDS14126.1	X																																																																																			-	NLGN4X	-	pfam_CarbesteraseB		0.577	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	0	0	0	74	74	13	0.00	0.00	C	NM_020742		6069226	-1	29	6	23	5	tier1	no_errors	ENST00000381093	ensembl	human	known	74_37	silent	54.72	54.55	SNP	0.000	T	29	23
PCDHB3	56132	genome.wustl.edu	37	5	140481682	140481682	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr5:140481682C>G	ENST00000231130.2	+	1	1449	c.1449C>G	c.(1447-1449)aaC>aaG	p.N483K	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	483	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGGCACCAACGCCCAGGTAA	0.632													ENSG00000113205																																					0													91.0	94.0	93.0					5																	140481682		2203	4298	6501	SO:0001583	missense	0			-	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1449C>G	5.37:g.140481682C>G	ENSP00000231130:p.Asn483Lys		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N483K	ENST00000231130.2	37	c.1449	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	C	10.85	1.466621	0.26335	.	.	ENSG00000113205	ENST00000231130	T	0.59906	0.23	4.24	2.35	0.29111	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.78559	0.4302	H	0.94462	3.54	0.37791	D	0.927353	D	0.89917	1.0	D	0.97110	1.0	T	0.80171	-0.1493	9	0.87932	D	0	.	6.4998	0.22162	0.0:0.5867:0.0:0.4133	.	483	Q9Y5E6	PCDB3_HUMAN	K	483	ENSP00000231130:N483K	ENSP00000231130:N483K	N	+	3	2	PCDHB3	140461866	0.013000	0.17824	0.992000	0.48379	0.103000	0.19146	-1.034000	0.03567	0.873000	0.35799	0.650000	0.86243	AAC	-	PCDHB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.632	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	0	0	0	356	356	5	0.00	0.00	C	NM_018937		140481682	+1	42	2	145	4	tier1	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	22.46	33.33	SNP	1.000	G	42	145
PRKRIR	5612	genome.wustl.edu	37	11	76062812	76062812	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr11:76062812T>C	ENST00000260045.3	-	5	1487	c.1382A>G	c.(1381-1383)aAc>aGc	p.N461S	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	461					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						AGCTATATAGTTATTCCATCT	0.343													ENSG00000137492																																					0													40.0	43.0	42.0					11																	76062812		2193	4287	6480	SO:0001583	missense	0			-	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1382A>G	11.37:g.76062812T>C	ENSP00000260045:p.Asn461Ser		A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	pfam_Znf_C2CH,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_Znf_C2CH,pfscan_Znf_C2CH	p.N461S	ENST00000260045.3	37	c.1382	CCDS8243.1	11	.	.	.	.	.	.	.	.	.	.	T	5.789	0.329888	0.10956	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	.	.	.	4.99	3.85	0.44370	Ribonuclease H-like (1);	0.358236	0.36409	N	0.002602	T	0.26412	0.0645	L	0.28274	0.84	0.32648	N	0.519784	B	0.06786	0.001	B	0.04013	0.001	T	0.21759	-1.0236	9	0.08837	T	0.75	.	5.0764	0.14634	0.0:0.1489:0.1615:0.6896	.	461	O43422	P52K_HUMAN	S	286;461	.	ENSP00000260045:N461S	N	-	2	0	PRKRIR	75740460	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.921000	0.28718	2.043000	0.60533	0.524000	0.50904	AAC	-	PRKRIR	-	superfamily_RNaseH-like_dom		0.343	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRIR	HGNC	protein_coding	OTTHUMT00000383188.1	0	0	0	44	44	9	0.00	0.00	T	NM_004705		76062812	-1	34	4	26	9	tier1	no_errors	ENST00000260045	ensembl	human	known	74_37	missense	56.67	30.77	SNP	0.933	C	34	26
SLC12A3	6559	genome.wustl.edu	37	16	56921864	56921864	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr16:56921864A>G	ENST00000563236.1	+	18	2231	c.2206A>G	c.(2206-2208)Aac>Gac	p.N736D	SLC12A3_ENST00000262502.5_Missense_Mutation_p.N735D|SLC12A3_ENST00000566786.1_Missense_Mutation_p.N735D|SLC12A3_ENST00000438926.2_Missense_Mutation_p.N736D			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	736					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	AATGAAGCCCAACATTCTGGT	0.607													ENSG00000070915																																					0													61.0	58.0	59.0					16																	56921864		2198	4300	6498	SO:0001583	missense	0			-		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2206A>G	16.37:g.56921864A>G	ENSP00000456149:p.Asn736Asp		A8MSJ2|C9JNN9	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.N736D	ENST00000563236.1	37	c.2206	CCDS58464.1	16	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563382	0.86335	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	4.67	4.67	0.58626	.	0.144445	0.64402	D	0.000013	D	0.85234	0.5650	H	0.94771	3.58	0.80722	D	1	D;P;D	0.56521	0.976;0.947;0.968	D;P;P	0.64410	0.925;0.721;0.856	D	0.89529	0.3784	9	0.87932	D	0	.	14.1	0.65049	1.0:0.0:0.0:0.0	.	735;736;736	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	D	735;736	.	ENSP00000262502:N736D	N	+	1	0	SLC12A3	55479365	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.316000	0.79007	1.878000	0.54408	0.460000	0.39030	AAC	-	SLC12A3	-	tigrfam_Na/K/Cl_cotransptS		0.607	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	HGNC	protein_coding	OTTHUMT00000432337.1	0	0	0	139	139	141	0.00	0.00	A			56921864	+1	13	5	85	81	tier1	no_errors	ENST00000438926	ensembl	human	known	74_37	missense	13.27	5.81	SNP	1.000	G	13	85
HCCS	3052	genome.wustl.edu	37	X	11136723	11136723	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chrX:11136723G>T	ENST00000321143.4	+	5	706	c.504G>T	c.(502-504)tgG>tgT	p.W168C	HCCS_ENST00000380762.4_Missense_Mutation_p.W168C|Y_RNA_ENST00000384422.1_RNA|ARHGAP6_ENST00000534860.1_Intron|HCCS_ENST00000380763.3_Missense_Mutation_p.W168C	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	168					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)	7						TTTTGAAGTGGGAAGCCCTTC	0.353													ENSG00000004961																									Ovarian(86;1338 1347 1462 10340 37882)												0													131.0	121.0	125.0					X																	11136723		2203	4300	6503	SO:0001583	missense	0			-		CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.504G>T	X.37:g.11136723G>T	ENSP00000326579:p.Trp168Cys		B3KUS1|Q502X8	Missense_Mutation	SNP	pfam_Cyt_C/C1_haem_lyase	p.W168C	ENST00000321143.4	37	c.504	CCDS14139.1	X	.	.	.	.	.	.	.	.	.	.	g	19.49	3.837172	0.71373	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.89050	-2.46;-2.46;-2.46	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.96445	0.8840	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.97760	1.0220	10	0.87932	D	0	-14.9853	15.9238	0.79597	0.0:0.0:1.0:0.0	.	168	P53701	CCHL_HUMAN	C	168	ENSP00000326579:W168C;ENSP00000370140:W168C;ENSP00000370139:W168C	ENSP00000326579:W168C	W	+	3	0	HCCS	11046644	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.236000	0.95360	2.360000	0.80028	0.597000	0.82753	TGG	-	HCCS	-	pfam_Cyt_C/C1_haem_lyase		0.353	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCCS	HGNC	protein_coding	OTTHUMT00000055742.1	0	0	0	92	92	60	0.00	0.00	G			11136723	+1	19	4	84	72	tier1	no_errors	ENST00000321143	ensembl	human	known	74_37	missense	18.45	5.26	SNP	1.000	T	19	84
RGL4	266747	genome.wustl.edu	37	22	24036039	24036039	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr22:24036039C>T	ENST00000290691.5	+	4	1960	c.790C>T	c.(790-792)Cgt>Tgt	p.R264C	AP000347.2_ENST00000417194.1_RNA|RGL4_ENST00000401461.1_Missense_Mutation_p.R128C|KB-1572G7.2_ENST00000421064.1_RNA|GUSBP11_ENST00000455485.1_RNA	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	264	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						ACCCACAGTTCGTGCCACCAT	0.607													ENSG00000159496																																					0													179.0	116.0	137.0					22																	24036039		2203	4300	6503	SO:0001583	missense	0			-		CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.790C>T	22.37:g.24036039C>T	ENSP00000290691:p.Arg264Cys		Q495L8	Missense_Mutation	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	p.R264C	ENST00000290691.5	37	c.790	CCDS13811.1	22	.	.	.	.	.	.	.	.	.	.	c	7.910	0.736264	0.15574	.	.	ENSG00000159496	ENST00000401461;ENST00000290691;ENST00000382833;ENST00000423392	T;T;T	0.31769	1.48;1.48;1.48	2.95	-1.76	0.08006	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.567956	0.15676	N	0.250138	T	0.16981	0.0408	N	0.24115	0.695	0.32027	N	0.600062	B;B;B;B	0.18461	0.02;0.02;0.028;0.015	B;B;B;B	0.14578	0.007;0.01;0.01;0.011	T	0.09314	-1.0680	10	0.48119	T	0.1	.	7.539	0.27727	0.0:0.5612:0.0:0.4388	.	128;128;264;264	E7EW79;Q495L8;E9PH87;Q8IZJ4	.;.;.;RGDSR_HUMAN	C	128;264;264;264	ENSP00000383951:R128C;ENSP00000290691:R264C;ENSP00000402142:R264C	ENSP00000290691:R264C	R	+	1	0	RGL4	22366039	0.999000	0.42202	0.000000	0.03702	0.002000	0.02628	0.568000	0.23623	-0.241000	0.09681	-1.142000	0.01873	CGT	-	RGL4	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.607	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGL4	HGNC	protein_coding	OTTHUMT00000319711.1	0	0	0	53	53	152	0.00	0.00	C	NM_153615		24036039	+1	4	7	45	67	tier1	no_errors	ENST00000290691	ensembl	human	known	74_37	missense	8.16	9.46	SNP	0.917	T	4	45
ACHE	43	genome.wustl.edu	37	7	100491025	100491025	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr7:100491025G>A	ENST00000412389.1	-	1	984	c.829C>T	c.(829-831)Cgc>Tgc	p.R277C	ACHE_ENST00000428317.1_Missense_Mutation_p.R277C|ACHE_ENST00000411582.1_Missense_Mutation_p.R277C|ACHE_ENST00000302913.4_Missense_Mutation_p.R277C|ACHE_ENST00000419336.2_Missense_Mutation_p.R277C|ACHE_ENST00000241069.5_Missense_Mutation_p.R277C|ACHE_ENST00000497647.1_5'Flank			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	277					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	GTGGCCCTGCGACGGGCCTCT	0.706													ENSG00000087085																																					0													28.0	29.0	29.0					7																	100491025		2201	4299	6500	SO:0001583	missense	0			-		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.829C>T	7.37:g.100491025G>A	ENSP00000394976:p.Arg277Cys		A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Cholinesterase	p.R277C	ENST00000412389.1	37	c.829	CCDS5709.1	7	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039189	0.55003	.	.	ENSG00000087085	ENST00000419336;ENST00000241069;ENST00000428317;ENST00000302913;ENST00000412389;ENST00000426415;ENST00000430554;ENST00000411582;ENST00000422451	T;T;T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	4.95	4.03	0.46877	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.84506	0.5487	M	0.93462	3.42	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.75020	0.985;0.982;0.972;0.985	D	0.87729	0.2578	10	0.62326	D	0.03	.	12.4637	0.55747	0.0:0.0:0.8325:0.1675	.	277;277;277;277	B7WPI6;P22303-3;P22303-2;P22303	.;.;.;ACES_HUMAN	C	277	ENSP00000403474:R277C;ENSP00000241069:R277C;ENSP00000414858:R277C;ENSP00000303211:R277C;ENSP00000394976:R277C;ENSP00000397143:R277C;ENSP00000399725:R277C;ENSP00000404865:R277C	ENSP00000241069:R277C	R	-	1	0	ACHE	100328961	0.061000	0.20836	0.997000	0.53966	0.826000	0.46750	0.795000	0.26972	2.281000	0.76405	0.484000	0.47621	CGC	-	ACHE	-	pfam_CarbesteraseB		0.706	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACHE	HGNC	protein_coding	OTTHUMT00000347201.1	0	0	0	51	51	12	0.00	0.00	G	NM_015831		100491025	-1	5	0	27	6	tier1	no_errors	ENST00000302913	ensembl	human	known	74_37	missense	15.62	0.00	SNP	0.986	A	5	27
DNMT3A	1788	genome.wustl.edu	37	2	25536821	25536822	+	Frame_Shift_Ins	INS	-	-	A			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr2:25536821_25536822insA	ENST00000264709.3	-	2	369_370	c.32_33insT	c.(31-33)gacfs	p.D11fs	DNMT3A_ENST00000321117.5_Frame_Shift_Ins_p.D11fs|DNMT3A_ENST00000406659.3_Frame_Shift_Ins_p.D11fs	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	11					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTGCTGGTGTCCCCGGGGCC	0.713			"""Mis, F, N, S"""		AML								ENSG00000119772																												Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0																																										SO:0001589	frameshift_variant	0					CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.32_33insT	2.37:g.25536821_25536822insA	ENSP00000264709:p.Asp11fs		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Frame_Shift_Ins	INS	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.T12fs	ENST00000264709.3	37	c.33_32	CCDS33157.1	2																																																																																				DNMT3A	-	NULL		0.713	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	HGNC	protein_coding	OTTHUMT00000211587.1	0	0	0	177	177	7	0.00	0.00	-	NM_022552		25536822	-1	13	0	64	3	tier1	no_errors	ENST00000264709	ensembl	human	known	74_37	frame_shift_ins	16.88	0.00	INS	1.000:1.000	A	13	64
DNMT3A	1788	genome.wustl.edu	37	2	25536823	25536824	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	CC	CC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr2:25536823_25536824delCC	ENST00000264709.3	-	2	367_368	c.30_31delGG	c.(28-33)ggggacfs	p.D11fs	DNMT3A_ENST00000321117.5_Frame_Shift_Del_p.D11fs|DNMT3A_ENST00000406659.3_Frame_Shift_Del_p.D11fs	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	11					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCTGGTGTCCCCGGGGCCGC	0.718			"""Mis, F, N, S"""		AML								ENSG00000119772																												Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0																																										SO:0001589	frameshift_variant	0					CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.30_31delGG	2.37:g.25536825_25536826delCC	ENSP00000264709:p.Asp11fs		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Frame_Shift_Del	DEL	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.D11fs	ENST00000264709.3	37	c.31_30	CCDS33157.1	2																																																																																				DNMT3A	-	NULL		0.718	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	HGNC	protein_coding	OTTHUMT00000211587.1	0	0	0	172	172	7	0.00	0.00	CC	NM_022552		25536824	-1	26	0	63	3	tier1	no_errors	ENST00000264709	ensembl	human	known	74_37	frame_shift_del	29.21	0.00	DEL	1.000:1.000	-	26	63
FBLN1	2192	genome.wustl.edu	37	22	45921483	45921483	+	Silent	SNP	C	C	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr22:45921483C>T	ENST00000327858.6	+	3	341	c.246C>T	c.(244-246)atC>atT	p.I82I	FBLN1_ENST00000442170.2_Silent_p.I82I|FBLN1_ENST00000262722.7_Silent_p.I82I|FBLN1_ENST00000402984.3_Silent_p.I120I|FBLN1_ENST00000348697.2_Silent_p.I82I|FBLN1_ENST00000340923.5_Silent_p.I82I	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	82	Anaphylatoxin-like 2. {ECO:0000255|PROSITE-ProRule:PRU00022}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CCACGGGCATCAGCCTGGCCA	0.652													ENSG00000077942																																					0													49.0	33.0	38.0					22																	45921483		2014	3828	5842	SO:0001819	synonymous_variant	0			-		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.246C>T	22.37:g.45921483C>T			B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,smart_Anaphylatoxin/fibulin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_Fibulin-1,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.I82	ENST00000327858.6	37	c.246	CCDS14067.1	22																																																																																			-	FBLN1	-	smart_Anaphylatoxin/fibulin,pirsf_Fibulin-1,pfscan_Anaphylatoxin/fibulin		0.652	FBLN1-001	KNOWN	basic|CCDS	protein_coding	FBLN1	HGNC	protein_coding	OTTHUMT00000322287.1	0	0	0	67	67	5	0.00	0.00	C	NM_006486		45921483	+1	4	0	23	2	tier1	no_errors	ENST00000327858	ensembl	human	known	74_37	silent	14.81	0.00	SNP	1.000	T	4	23
DNM1P46	196968	genome.wustl.edu	37	15	100340186	100340186	+	RNA	SNP	C	C	A	rs200975818	byFrequency	TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr15:100340186C>A	ENST00000341853.1	-	0	740					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										CTCGTTCCCACGCGAGTCTCG	0.627													ENSG00000182397																																					0													16.0	17.0	17.0					15																	100340186		1378	3412	4790			0			-	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340186C>A			Q3ZCN3	R	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			rs200975818	DNM1P46	-	-		0.627	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	0	0	0	46	46	0	0.00	0.00	C	NR_003260		100340186	-1	5	0	50	0	tier1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	9.09	0.00	SNP	0.981	A	5	50
SVIL	6840	genome.wustl.edu	37	10	29821886	29821886	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr10:29821886delA	ENST00000355867.4	-	8	2162	c.1410delT	c.(1408-1410)gatfs	p.D470fs	SVIL_ENST00000375398.2_Frame_Shift_Del_p.D470fs|SVIL_ENST00000375400.3_Intron	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	470					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TTCTAGAGGGATCTTCTGGGC	0.498													ENSG00000197321																																					0													104.0	96.0	99.0					10																	29821886		2203	4300	6503	SO:0001589	frameshift_variant	0				AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1410delT	10.37:g.29821886delA	ENSP00000348128:p.Asp470fs		D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Frame_Shift_Del	DEL	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.S472fs	ENST00000355867.4	37	c.1410	CCDS7164.1	10																																																																																				SVIL	-	NULL		0.498	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	0	0	0	32	32	110	0.00	0.00	A			29821886	-1	6	2	41	52	tier1	no_errors	ENST00000355867	ensembl	human	known	74_37	frame_shift_del	12.77	3.70	DEL	0.000	-	6	41
PRKG1	5592	genome.wustl.edu	37	10	52751154	52751154	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3B-A9HX-01A-11D-A38Z-09	TCGA-3B-A9HX-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1fe4e8f7-b729-4f00-9d09-a95a23e97fe3	385e008c-dae7-4b29-9287-16863463e7c6	g.chr10:52751154G>T	ENST00000401604.2	+	1	210	c.16G>T	c.(16-18)Gaa>Taa	p.E6*	PRKG1_ENST00000373985.1_5'UTR			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	6	Required for dimerization.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CGAGCTAGAGGAAGACTTTGC	0.597													ENSG00000185532																																					0													21.0	24.0	23.0					10																	52751154		1846	4078	5924	SO:0001587	stop_gained	0			-		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.16G>T	10.37:g.52751154G>T	ENSP00000384200:p.Glu6*		A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Nonsense_Mutation	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_dom	p.E6*	ENST00000401604.2	37	c.16	CCDS44399.1	10	.	.	.	.	.	.	.	.	.	.	G	40	7.924220	0.98563	.	.	ENSG00000185532	ENST00000401604	.	.	.	4.76	2.83	0.33086	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	8.0573	0.30612	0.0914:0.1612:0.7474:0.0	.	.	.	.	X	6	.	ENSP00000384200:E6X	E	+	1	0	PRKG1	52421160	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	9.078000	0.94023	0.492000	0.27815	0.462000	0.41574	GAA	-	PRKG1	-	pirsf_cGMP-dependent_protein_kinase		0.597	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		0	0	0	316	316	99	0.00	0.00	G			52751154	+1	38	3	128	37	tier1	no_errors	ENST00000401604	ensembl	human	known	74_37	nonsense	22.89	7.50	SNP	1.000	T	38	128
