#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SHROOM3	57619	genome.wustl.edu	37	4	77357347	77357347	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr4:77357347C>T	ENST00000296043.6	+	1	1095	c.142C>T	c.(142-144)Cac>Tac	p.H48Y		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	48	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TGGCCTGGAGCACGGAGAACC	0.408													ENSG00000138771																																					0													195.0	195.0	195.0					4																	77357347		2203	4300	6503	SO:0001583	missense	0			-	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.142C>T	4.37:g.77357347C>T	ENSP00000296043:p.His48Tyr		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H48Y	ENST00000296043.6	37	c.142	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624887	0.46840	.	.	ENSG00000138771	ENST00000296043	T	0.27402	1.67	5.44	5.44	0.79542	PDZ/DHR/GLGF (4);	0.669254	0.13401	N	0.390609	T	0.47210	0.1433	L	0.46947	1.48	0.26340	N	0.977379	D	0.69078	0.997	D	0.64776	0.929	T	0.30416	-0.9979	10	0.45353	T	0.12	-5.8736	14.0181	0.64536	0.1511:0.8489:0.0:0.0	.	48	Q8TF72	SHRM3_HUMAN	Y	48	ENSP00000296043:H48Y	ENSP00000296043:H48Y	H	+	1	0	SHROOM3	77576371	0.995000	0.38212	0.976000	0.42696	0.821000	0.46438	2.716000	0.47219	2.937000	0.99478	0.650000	0.86243	CAC	-	SHROOM3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.408	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	0	0	1	32	32	55	0.00	1.79	C	NM_020859		77357347	+1	12	29	80	160	tier1	no_errors	ENST00000296043	ensembl	human	known	74_37	missense	12.90	15.34	SNP	0.982	T	12	80
FAT1	2195	genome.wustl.edu	37	4	187630313	187630313	+	Silent	SNP	G	G	T	rs200782651		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr4:187630313G>T	ENST00000441802.2	-	2	878	c.669C>A	c.(667-669)ctC>ctA	p.L223L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	223	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGTCCGCAGCGAGGATTTCCA	0.493										HNSCC(5;0.00058)			ENSG00000083857																									Colon(197;1040 2055 4143 4984 49344)												0													105.0	106.0	106.0					4																	187630313		2153	4273	6426	SO:0001819	synonymous_variant	0			-	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.669C>A	4.37:g.187630313G>T				Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.L223	ENST00000441802.2	37	c.669	CCDS47177.1	4																																																																																			-	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.493	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	0	0	0	11	11	59	0.00	0.00	G	NM_005245		187630313	-1	11	19	30	70	tier1	no_errors	ENST00000441802	ensembl	human	known	74_37	silent	26.83	21.35	SNP	0.045	T	11	30
TNXB	7148	genome.wustl.edu	37	6	32014049	32014049	+	Silent	SNP	G	G	T	rs370330613		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr6:32014049G>T	ENST00000375244.3	-	31	10710	c.10509C>A	c.(10507-10509)acC>acA	p.T3503T	TNXB_ENST00000375247.2_Silent_p.T3501T|TNXB_ENST00000451343.1_5'Flank			P22105	TENX_HUMAN	tenascin XB	3548	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGTCCTCTACGGTGACTGTGC	0.642													ENSG00000168477																																					0													36.0	42.0	40.0					6																	32014049		1321	2584	3905	SO:0001819	synonymous_variant	0			-	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10509C>A	6.37:g.32014049G>T			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.T3501	ENST00000375244.3	37	c.10503		6																																																																																			-	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	0	0	0	121	121	42	0.00	0.00	G	NM_019105		32014049	-1	38	6	44	22	tier1	no_errors	ENST00000375247	ensembl	human	known	74_37	silent	46.34	21.43	SNP	0.000	T	38	44
WDFY4	57705	genome.wustl.edu	37	10	49951578	49951578	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:49951578C>G	ENST00000325239.5	+	11	2471	c.2444C>G	c.(2443-2445)cCa>cGa	p.P815R	WDFY4_ENST00000413659.2_Missense_Mutation_p.P815R	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	815						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AAGCAGTGGCCAGACCTGGAG	0.552													ENSG00000128815																																					0													8.0	9.0	9.0					10																	49951578		691	1590	2281	SO:0001583	missense	0			-	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2444C>G	10.37:g.49951578C>G	ENSP00000320563:p.Pro815Arg		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P815R	ENST00000325239.5	37	c.2444	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683787	0.68157	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.55930	0.49;1.5	5.26	5.26	0.73747	Armadillo-type fold (1);	.	.	.	.	T	0.58308	0.2113	M	0.61703	1.905	0.30961	N	0.723622	D	0.62365	0.991	P	0.48873	0.593	T	0.64214	-0.6460	8	.	.	.	.	14.3521	0.66711	0.0:1.0:0.0:0.0	.	815	Q6ZS81	WDFY4_HUMAN	R	824;815;815;815	ENSP00000320563:P815R;ENSP00000403789:P815R	.	P	+	2	0	WDFY4	49621584	0.996000	0.38824	1.000000	0.80357	0.809000	0.45718	1.677000	0.37576	2.455000	0.83008	0.563000	0.77884	CCA	-	WDFY4	-	superfamily_ARM-type_fold		0.552	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		0	0	0	18	18	88	0.00	0.00	C	XM_033379		49951578	+1	4	23	10	89	tier1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	28.57	20.54	SNP	1.000	G	4	10
CTB-52I2.4	0	genome.wustl.edu	37	19	18142862	18142862	+	RNA	SNP	A	A	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr19:18142862A>C	ENST00000594957.3	+	0	1623																											GGGGAAAGTGACTACCAGAAA	0.413													ENSG00000268032																																					0																																												0			-																													19.37:g.18142862A>C				R	SNP	-	NULL	ENST00000594957.3	37	NULL		19																																																																																			-	CTB-52I2.4	-	-		0.413	CTB-52I2.4-002	KNOWN	basic	processed_transcript	ENSG00000268032	Clone_based_vega_gene	pseudogene	OTTHUMT00000466852.4	0	0	0	86	86	45	0.00	0.00	A			18142862	+1	33	10	111	39	tier1	no_errors	ENST00000594957	ensembl	human	known	74_37	rna	22.92	20.41	SNP	0.062	C	33	111
PCDHA7	56141	genome.wustl.edu	37	5	140214396	140214396	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:140214396C>T	ENST00000525929.1	+	1	428	c.428C>T	c.(427-429)gCg>gTg	p.A143V	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A143V|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	143	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A143V(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTTCATCGCGGAATCCAGG	0.567													ENSG00000204963																									NSCLC(160;258 2013 5070 22440 28951)												2	Substitution - Missense(2)	large_intestine(2)											72.0	68.0	69.0					5																	140214396		2203	4292	6495	SO:0001583	missense	0			-	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.428C>T	5.37:g.140214396C>T	ENSP00000436426:p.Ala143Val		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A143V	ENST00000525929.1	37	c.428	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	6.361	0.434793	0.12045	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.52983	0.64;0.64	4.17	1.88	0.25563	Cadherin (3);Cadherin-like (1);	0.708972	0.10662	U	0.648542	T	0.57286	0.2043	M	0.62209	1.925	0.09310	N	1	P;P	0.48016	0.904;0.869	B;P	0.58820	0.361;0.846	T	0.43163	-0.9408	10	0.27785	T	0.31	.	7.9008	0.29734	0.2103:0.6976:0.0:0.0921	.	143;143	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	143	ENSP00000436426:A143V;ENSP00000367365:A143V	ENSP00000367365:A143V	A	+	2	0	PCDHA7	140194580	0.000000	0.05858	0.001000	0.08648	0.062000	0.15995	-0.060000	0.11712	0.830000	0.34757	0.455000	0.32223	GCG	-	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.567	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	0	0	0	162	162	134	0.00	0.00	C	NM_018910		140214396	+1	19	17	92	72	tier1	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	17.12	19.10	SNP	0.002	T	19	92
ANKRD36BP2	645784	genome.wustl.edu	37	2	89084354	89084354	+	RNA	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:89084354G>A	ENST00000393525.3	+	0	722									ankyrin repeat domain 36B pseudogene 2																		AGCCAAGATAGACAAGAACTT	0.393													ENSG00000230006																																					0																																												0			-			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89084354G>A				R	SNP	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			-	ANKRD36BP2	-	-		0.393	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1	0	0	0	26	26	7	0.00	0.00	G			89084354	+1	30	7	96	38	tier1	no_errors	ENST00000393515	ensembl	human	known	74_37	rna	23.81	15.56	SNP	0.017	A	30	96
DNM3	26052	genome.wustl.edu	37	1	172356396	172356396	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:172356396G>A	ENST00000355305.5	+	19	2357	c.2200G>A	c.(2200-2202)Gca>Aca	p.A734T	DNM3_ENST00000367731.1_Missense_Mutation_p.A724T|DNM3_ENST00000358155.4_Missense_Mutation_p.A728T			Q9UQ16	DYN3_HUMAN	dynamin 3	734	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AATGTATCAAGCACTGAAAGA	0.542													ENSG00000197959																																					0													64.0	68.0	66.0					1																	172356396		2025	4173	6198	SO:0001583	missense	0			-	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.2200G>A	1.37:g.172356396G>A	ENSP00000347457:p.Ala734Thr		A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.A728T	ENST00000355305.5	37	c.2182		1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166978	0.57476	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000355305;ENST00000367731;ENST00000485254	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.43	5.43	0.79202	GTPase effector domain, GED (1);Dynamin GTPase effector (2);	0.119442	0.56097	D	0.000031	T	0.50222	0.1603	M	0.69523	2.12	0.80722	D	1	P;P;P	0.51537	0.946;0.843;0.659	P;P;B	0.50754	0.649;0.596;0.359	T	0.46992	-0.9151	10	0.30078	T	0.28	.	13.1689	0.59587	0.0:0.0:0.8403:0.1596	.	734;724;728	Q9UQ16;Q9UQ16-2;Q9UQ16-3	DYN3_HUMAN;.;.	T	738;728;734;724;97	ENSP00000350876:A728T;ENSP00000347457:A734T;ENSP00000356705:A724T;ENSP00000429165:A97T	ENSP00000347457:A734T	A	+	1	0	DNM3	170623019	1.000000	0.71417	0.936000	0.37596	0.551000	0.35334	6.641000	0.74324	2.717000	0.92951	0.585000	0.79938	GCA	-	DNM3	-	pfam_GED,smart_GED		0.542	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	HGNC	protein_coding	OTTHUMT00000084531.1	0	0	0	44	44	31	0.00	0.00	G	NM_015569		172356396	+1	13	8	38	51	tier1	no_errors	ENST00000358155	ensembl	human	known	74_37	missense	25.49	13.56	SNP	0.996	A	13	38
NPVF	64111	genome.wustl.edu	37	7	25267967	25267967	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr7:25267967A>C	ENST00000222674.2	-	1	138	c.92T>G	c.(91-93)gTg>gGg	p.V31G		NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor	31					negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						ATTGGAGATCACTAATTCATC	0.269													ENSG00000105954																																					0													65.0	71.0	69.0					7																	25267967		2200	4294	6494	SO:0001583	missense	0			-	AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.92T>G	7.37:g.25267967A>C	ENSP00000222674:p.Val31Gly		A4D164|Q7LE27|Q96PI9	Missense_Mutation	SNP	NULL	p.V31G	ENST00000222674.2	37	c.92	CCDS5395.1	7	.	.	.	.	.	.	.	.	.	.	A	4.916	0.170122	0.09339	.	.	ENSG00000105954	ENST00000222674	T	0.27402	1.67	5.37	-1.62	0.08372	.	0.875003	0.10029	N	0.725020	T	0.16342	0.0393	N	0.19112	0.55	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.26744	-1.0094	10	0.28530	T	0.3	4.2326	6.0141	0.19592	0.4303:0.4191:0.1507:0.0	.	31	Q9HCQ7	RFRP_HUMAN	G	31	ENSP00000222674:V31G	ENSP00000222674:V31G	V	-	2	0	NPVF	25234492	0.000000	0.05858	0.001000	0.08648	0.315000	0.28087	0.383000	0.20651	-0.546000	0.06216	0.528000	0.53228	GTG	-	NPVF	-	NULL		0.269	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPVF	HGNC	protein_coding	OTTHUMT00000250315.1	0	0	0	26	26	13	0.00	0.00	A	NM_022150		25267967	-1	50	14	135	90	tier1	no_errors	ENST00000222674	ensembl	human	known	74_37	missense	26.88	13.46	SNP	0.023	C	50	135
NELFB	25920	genome.wustl.edu	37	9	140150876	140150876	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr9:140150876C>T	ENST00000343053.4	+	3	699	c.362C>T	c.(361-363)cCc>cTc	p.P121L		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	121					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AAGCACCTGCCCAAGGTAGGG	0.597													ENSG00000188986																																					0													134.0	108.0	117.0					9																	140150876		2203	4300	6503	SO:0001583	missense	0			-	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.362C>T	9.37:g.140150876C>T	ENSP00000339495:p.Pro121Leu		A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	pfam_COBRA1	p.P121L	ENST00000343053.4	37	c.362	CCDS7040.1	9	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983649	0.93044	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.93	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.77691	0.4168	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79759	-0.1668	9	0.72032	D	0.01	-34.2851	11.925	0.52814	0.0:0.9145:0.0:0.0855	.	121	Q8WX92	NELFB_HUMAN	L	121	.	ENSP00000339495:P121L	P	+	2	0	COBRA1	139270697	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.501000	0.81600	1.076000	0.40961	0.561000	0.74099	CCC	-	NELFB	-	pfam_COBRA1		0.597	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELFB	HGNC	protein_coding	OTTHUMT00000254710.1	0	0	0	23	23	79	0.00	0.00	C	NM_015456		140150876	+1	6	17	25	43	tier1	no_errors	ENST00000343053	ensembl	human	known	74_37	missense	19.35	28.33	SNP	1.000	T	6	25
TP53BP1	7158	genome.wustl.edu	37	15	43749174	43749174	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr15:43749174A>T	ENST00000263801.3	-	12	1869	c.1617T>A	c.(1615-1617)gaT>gaA	p.D539E	TP53BP1_ENST00000450115.2_Missense_Mutation_p.D544E|TP53BP1_ENST00000382039.3_Missense_Mutation_p.D544E|TP53BP1_ENST00000382044.4_Missense_Mutation_p.D544E|TP53BP1_ENST00000605155.1_5'Flank	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	539					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TGTTTTCTCCATCTTCATCAA	0.403								Other conserved DNA damage response genes					ENSG00000067369																																					0													142.0	123.0	129.0					15																	43749174		2201	4298	6499	SO:0001583	missense	0			-	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.1617T>A	15.37:g.43749174A>T	ENSP00000263801:p.Asp539Glu		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.D544E	ENST00000263801.3	37	c.1632	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	A	14.05	2.418697	0.42918	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02	5.04	0.0937	0.14477	.	0.063969	0.64402	D	0.000014	T	0.21387	0.0515	M	0.73598	2.24	0.37885	D	0.930535	P;P;P;P	0.49961	0.858;0.886;0.93;0.93	P;B;P;P	0.45881	0.472;0.301;0.496;0.496	T	0.34254	-0.9836	10	0.12766	T	0.61	-6.4613	5.8147	0.18486	0.4165:0.0:0.4428:0.1407	.	544;539;544;544	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	E	539;544;544;544;544	ENSP00000263801:D539E;ENSP00000371475:D544E;ENSP00000371470:D544E;ENSP00000393497:D544E;ENSP00000388028:D544E	ENSP00000263801:D539E	D	-	3	2	TP53BP1	41536466	0.902000	0.30710	0.998000	0.56505	0.968000	0.65278	0.179000	0.16840	0.043000	0.15746	0.460000	0.39030	GAT	-	TP53BP1	-	NULL		0.403	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	0	0	0	34	34	48	0.00	0.00	A			43749174	-1	10	16	91	110	tier1	no_errors	ENST00000382044	ensembl	human	known	74_37	missense	9.90	12.70	SNP	0.971	T	10	91
LHX8	431707	genome.wustl.edu	37	1	75608895	75608895	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:75608895G>A	ENST00000294638.5	+	6	1146	c.482G>A	c.(481-483)tGc>tAc	p.C161Y	LHX8_ENST00000356261.3_Missense_Mutation_p.C151Y	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	161	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CACTTGGCATGCTTTGCCTGC	0.488													ENSG00000162624																																					0													120.0	112.0	115.0					1																	75608895		2203	4299	6502	SO:0001583	missense	0			-	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.482G>A	1.37:g.75608895G>A	ENSP00000294638:p.Cys161Tyr		E9PGE3	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.C161Y	ENST00000294638.5	37	c.482	CCDS30756.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366347	0.82463	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.95412	-3.7;-3.7	5.3	5.3	0.74995	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	H	0.99783	4.775	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.98920	1.0783	10	0.87932	D	0	.	19.3413	0.94342	0.0:0.0:1.0:0.0	.	161	Q68G74	LHX8_HUMAN	Y	161;151	ENSP00000294638:C161Y;ENSP00000348597:C151Y	ENSP00000294638:C161Y	C	+	2	0	LHX8	75381483	1.000000	0.71417	0.996000	0.52242	0.916000	0.54674	9.476000	0.97823	2.660000	0.90430	0.650000	0.86243	TGC	-	LHX8	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.488	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LHX8	HGNC	protein_coding	OTTHUMT00000026700.1	0	0	0	17	17	21	0.00	0.00	G	NM_001001933		75608895	+1	9	7	55	61	tier1	no_errors	ENST00000294638	ensembl	human	known	74_37	missense	14.06	10.00	SNP	1.000	A	9	55
MRPS5	64969	genome.wustl.edu	37	2	95753147	95753147	+	Silent	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:95753147T>A	ENST00000272418.2	-	12	1456	c.1248A>T	c.(1246-1248)ggA>ggT	p.G416G		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	416					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						AGCGCTTCATTCCCTGTGCAG	0.572													ENSG00000144029																																					0													103.0	97.0	99.0					2																	95753147		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.1248A>T	2.37:g.95753147T>A			Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Silent	SNP	pfam_Ribosomal_S5_C,pfam_Ribosomal_S5_N,superfamily_Ribosomal_S5_D2-typ_fold,pfscan_Ribosomal_S5_N	p.G416	ENST00000272418.2	37	c.1248	CCDS2010.1	2																																																																																			-	MRPS5	-	NULL		0.572	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS5	HGNC	protein_coding	OTTHUMT00000252772.1	0	0	0	42	42	52	0.00	0.00	T	NM_031902		95753147	-1	14	23	43	102	tier1	no_errors	ENST00000272418	ensembl	human	known	74_37	silent	24.56	18.40	SNP	0.009	A	14	43
FAM110B	90362	genome.wustl.edu	37	8	59058842	59058842	+	Missense_Mutation	SNP	C	C	T	rs140524173	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:59058842C>T	ENST00000361488.3	+	5	933	c.53C>T	c.(52-54)gCg>gTg	p.A18V	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	18						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GTCAGCCCCGCGGGCACCTTC	0.667													ENSG00000169122																																					0								C	VAL/ALA	0,4406		0,0,2203	32.0	32.0	32.0		53	5.0	1.0	8	dbSNP_134	32	4,8596	3.0+/-9.4	0,4,4296	yes	missense	FAM110B	NM_147189.2	64	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign	18/371	59058842	4,13002	2203	4300	6503	SO:0001583	missense	0			-	U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.53C>T	8.37:g.59058842C>T	ENSP00000355204:p.Ala18Val		Q5BM08|Q9Y4K2	Missense_Mutation	SNP	NULL	p.A18V	ENST00000361488.3	37	c.53	CCDS6170.1	8	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195907	0.58126	0.0	4.65E-4	ENSG00000169122	ENST00000361488	T	0.57752	0.38	5.0	5.0	0.66597	.	0.059016	0.64402	D	0.000003	T	0.45296	0.1335	L	0.44542	1.39	0.58432	D	0.999997	P	0.40970	0.734	B	0.35510	0.204	T	0.42616	-0.9441	9	.	.	.	0.428	18.2903	0.90127	0.0:1.0:0.0:0.0	.	18	Q8TC76	F110B_HUMAN	V	18	ENSP00000355204:A18V	.	A	+	2	0	FAM110B	59221396	0.998000	0.40836	1.000000	0.80357	0.931000	0.56810	3.761000	0.55242	2.312000	0.78011	0.313000	0.20887	GCG	rs140524173	FAM110B	-	NULL		0.667	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM110B	HGNC	protein_coding	OTTHUMT00000378095.2	0	0	0	161	161	36	0.00	0.00	C	NM_147189		59058842	+1	19	4	67	25	tier1	no_errors	ENST00000361488	ensembl	human	known	74_37	missense	22.09	13.79	SNP	0.999	T	19	67
CRISPLD1	83690	genome.wustl.edu	37	8	75929118	75929118	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:75929118C>G	ENST00000262207.4	+	8	1339	c.871C>G	c.(871-873)Caa>Gaa	p.Q291E	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.Q103E|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.Q105E	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	291	LCCL 1. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CTTTGTAGCCCAAATTGTTTC	0.234													ENSG00000121005																																					0													23.0	24.0	23.0					8																	75929118		2131	4239	6370	SO:0001583	missense	0			-	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.871C>G	8.37:g.75929118C>G	ENSP00000262207:p.Gln291Glu		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.Q291E	ENST00000262207.4	37	c.871	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930786	0.52866	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.89270	-2.49;-2.49;-2.49	4.97	4.97	0.65823	LCCL (4);	0.000000	0.85682	D	0.000000	D	0.95118	0.8418	M	0.87328	2.875	0.80722	D	1	D;D	0.64830	0.969;0.994	D;D	0.72338	0.93;0.977	D	0.94901	0.8056	10	0.51188	T	0.08	.	18.7915	0.91975	0.0:1.0:0.0:0.0	.	105;291	B7Z929;Q9H336	.;CRLD1_HUMAN	E	291;103;105	ENSP00000262207:Q291E;ENSP00000430105:Q103E;ENSP00000429746:Q105E	ENSP00000262207:Q291E	Q	+	1	0	CRISPLD1	76091673	1.000000	0.71417	1.000000	0.80357	0.230000	0.25150	4.335000	0.59298	2.752000	0.94435	0.650000	0.86243	CAA	-	CRISPLD1	-	superfamily_LCCL,smart_LCCL,pfscan_LCCL		0.234	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	0	0	0	16	16	25	0.00	0.00	C	NM_031461		75929118	+1	17	13	79	62	tier1	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	17.71	17.11	SNP	1.000	G	17	79
PPIP5K2	23262	genome.wustl.edu	37	5	102486984	102486984	+	Silent	SNP	C	C	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:102486984C>A	ENST00000358359.3	+	9	1443	c.934C>A	c.(934-936)Cgg>Agg	p.R312R	PPIP5K2_ENST00000321521.9_Silent_p.R312R|PPIP5K2_ENST00000414217.1_Silent_p.R312R|PPIP5K2_ENST00000513500.1_3'UTR	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	312					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TGATTTGTTACGGGCCAATGG	0.318													ENSG00000145725																																					0													95.0	98.0	97.0					5																	102486984		2202	4300	6502	SO:0001819	synonymous_variant	0			-	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.934C>A	5.37:g.102486984C>A			A1NI53|A6NGS8|Q8TB50	Silent	SNP	pfam_His_Pase_superF_clade-2	p.R312	ENST00000358359.3	37	c.934		5																																																																																			-	PPIP5K2	-	NULL		0.318	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	HGNC	protein_coding	OTTHUMT00000370487.1	0	0	0	125	125	34	0.00	0.00	C	NM_015216		102486984	+1	70	22	280	90	tier1	no_errors	ENST00000358359	ensembl	human	known	74_37	silent	20.00	19.64	SNP	1.000	A	70	280
LRP1B	53353	genome.wustl.edu	37	2	141641542	141641542	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:141641542T>C	ENST00000389484.3	-	25	4984	c.4013A>G	c.(4012-4014)gAa>gGa	p.E1338G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1338					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTCAGGCCTTCTGGAGTAGC	0.473										TSP Lung(27;0.18)			ENSG00000168702																									Colon(99;50 2074 2507 20106)												0													136.0	130.0	132.0					2																	141641542		2203	4300	6503	SO:0001583	missense	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4013A>G	2.37:g.141641542T>C	ENSP00000374135:p.Glu1338Gly		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.E1338G	ENST00000389484.3	37	c.4013	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.254309	0.80135	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.96459	-2.79;-4.02	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97999	0.9341	M	0.83692	2.655	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.80764	0.964;0.994	D	0.97940	1.0325	10	0.35671	T	0.21	.	16.1381	0.81502	0.0:0.0:0.0:1.0	.	521;1338	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	G	1338;1276;483	ENSP00000374135:E1338G;ENSP00000413239:E483G	ENSP00000374135:E1338G	E	-	2	0	LRP1B	141358012	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	7.926000	0.87569	2.258000	0.74832	0.533000	0.62120	GAA	-	LRP1B	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.473	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0	0	18	18	10	0.00	0.00	T	NM_018557		141641542	-1	11	12	42	80	tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	20.75	12.90	SNP	1.000	C	11	42
TTN	7273	genome.wustl.edu	37	2	179569022	179569022	+	Silent	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:179569022G>T	ENST00000591111.1	-	104	29348	c.29124C>A	c.(29122-29124)ggC>ggA	p.G9708G	TTN_ENST00000589042.1_Silent_p.G10025G|TTN_ENST00000342992.6_Silent_p.G8781G|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13786	Ig-like 78.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAGGATTCTGCCATTTCTGA	0.423													ENSG00000155657																																					0													198.0	186.0	190.0					2																	179569022		1889	4117	6006	SO:0001819	synonymous_variant	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29124C>A	2.37:g.179569022G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G8781	ENST00000591111.1	37	c.26343		2																																																																																			-	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	16	16	33	0.00	0.00	G	NM_133378		179569022	-1	8	9	55	57	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	12.70	13.64	SNP	1.000	T	8	55
TAB1	10454	genome.wustl.edu	37	22	39811644	39811644	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr22:39811644C>T	ENST00000216160.6	+	3	372	c.310C>T	c.(310-312)Cgt>Tgt	p.R104C	TAB1_ENST00000331454.3_Missense_Mutation_p.R104C	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	104	PP2C-like.				activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						CGATGTGCGGCGTGTGCTGCT	0.647													ENSG00000100324																																					0													38.0	34.0	36.0					22																	39811644		2203	4299	6502	SO:0001583	missense	0			-	U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.310C>T	22.37:g.39811644C>T	ENSP00000216160:p.Arg104Cys		Q2PP09|Q8IZW2	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.R104C	ENST00000216160.6	37	c.310	CCDS13993.1	22	.	.	.	.	.	.	.	.	.	.	C	11.53	1.665435	0.29604	.	.	ENSG00000100324	ENST00000216160;ENST00000331454	T;T	0.10192	2.9;2.9	5.23	4.17	0.49024	Protein phosphatase 2C-like (4);	0.129212	0.50627	D	0.000109	T	0.24353	0.0590	L	0.46157	1.445	0.58432	D	0.999992	D;D;D	0.89917	0.998;0.998;1.0	P;P;D	0.81914	0.675;0.734;0.995	T	0.00346	-1.1800	10	0.62326	D	0.03	-24.9071	12.2775	0.54744	0.2998:0.7002:0.0:0.0	.	104;104;248	Q15750-2;Q15750;Q59FT7	.;TAB1_HUMAN;.	C	104	ENSP00000216160:R104C;ENSP00000333049:R104C	ENSP00000216160:R104C	R	+	1	0	TAB1	38141590	0.955000	0.32602	0.981000	0.43875	0.939000	0.58152	1.472000	0.35376	2.450000	0.82876	0.655000	0.94253	CGT	-	TAB1	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom		0.647	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB1	HGNC	protein_coding	OTTHUMT00000321313.1	0	0	0	133	133	21	0.00	0.00	C	NM_153497		39811644	+1	8	7	27	20	tier1	no_errors	ENST00000216160	ensembl	human	known	74_37	missense	22.86	25.93	SNP	0.849	T	8	27
WNT10B	7480	genome.wustl.edu	37	12	49360194	49360194	+	Missense_Mutation	SNP	A	A	T	rs146010731	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr12:49360194A>T	ENST00000301061.4	-	5	1202	c.854T>A	c.(853-855)aTt>aAt	p.I285N	WNT10B_ENST00000407467.1_3'UTR|WNT10B_ENST00000403957.1_3'UTR	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	285			I -> T. {ECO:0000269|PubMed:16477437}.		bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						GTGGGTATCAATGAAGATGGC	0.622													ENSG00000169884																																					0													39.0	48.0	45.0					12																	49360194		2203	4300	6503	SO:0001583	missense	0			-	X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.854T>A	12.37:g.49360194A>T	ENSP00000301061:p.Ile285Asn		B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt10	p.I285N	ENST00000301061.4	37	c.854	CCDS8775.1	12	.	.	.	.	.	.	.	.	.	.	A	19.17	3.774820	0.70107	.	.	ENSG00000169884	ENST00000301061	T	0.78003	-1.14	4.43	4.43	0.53597	.	0.072919	0.53938	D	0.000055	D	0.86619	0.5976	M	0.86805	2.84	0.80722	D	1	D	0.63880	0.993	D	0.65323	0.934	D	0.87741	0.2585	10	0.87932	D	0	.	7.902	0.29740	0.9054:0.0:0.0946:0.0	.	285	O00744	WN10B_HUMAN	N	285	ENSP00000301061:I285N	ENSP00000301061:I285N	I	-	2	0	WNT10B	47646461	1.000000	0.71417	0.966000	0.40874	0.974000	0.67602	7.119000	0.77145	2.010000	0.58986	0.459000	0.35465	ATT	-	WNT10B	-	pfam_Wnt,smart_Wnt		0.622	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT10B	HGNC	protein_coding	OTTHUMT00000319864.1	1	1	0	349	349	76	0.29	0.00	A	NM_003394		49360194	-1	24	11	153	40	tier1	no_errors	ENST00000301061	ensembl	human	known	74_37	missense	13.56	21.57	SNP	0.991	T	24	153
VANGL1	81839	genome.wustl.edu	37	1	116206547	116206547	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:116206547C>T	ENST00000355485.2	+	4	741	c.470C>T	c.(469-471)gCa>gTa	p.A157V	VANGL1_ENST00000369510.4_Missense_Mutation_p.A155V|VANGL1_ENST00000310260.3_Missense_Mutation_p.A157V|VANGL1_ENST00000369509.1_Missense_Mutation_p.A157V	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	157					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		ATCTCCATGGCATTCAAACTC	0.512													ENSG00000173218																																					0													116.0	118.0	117.0					1																	116206547		2203	4300	6503	SO:0001583	missense	0			-	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.470C>T	1.37:g.116206547C>T	ENSP00000347672:p.Ala157Val		Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.A157V	ENST00000355485.2	37	c.470	CCDS883.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602908	0.87157	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.34	5.34	0.76211	.	0.055167	0.64402	D	0.000001	D	0.82747	0.5104	M	0.74467	2.265	0.80722	D	1	P;P	0.44380	0.801;0.834	B;B	0.44133	0.314;0.442	D	0.85338	0.1094	10	0.62326	D	0.03	0.0369	19.4118	0.94677	0.0:1.0:0.0:0.0	.	155;157	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	V	157;155;157;157	ENSP00000347672:A157V;ENSP00000358523:A155V;ENSP00000310800:A157V;ENSP00000358522:A157V	ENSP00000310800:A157V	A	+	2	0	VANGL1	116008070	1.000000	0.71417	0.080000	0.20451	0.812000	0.45895	7.487000	0.81328	2.662000	0.90505	0.650000	0.86243	GCA	-	VANGL1	-	pfam_Strabismus,pirsf_Strabismus		0.512	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VANGL1	HGNC	protein_coding	OTTHUMT00000033096.1	0	0	0	94	94	65	0.00	0.00	C			116206547	+1	21	26	95	122	tier1	no_errors	ENST00000310260	ensembl	human	known	74_37	missense	18.10	17.57	SNP	0.987	T	21	95
MOSPD2	158747	genome.wustl.edu	37	X	14933790	14933790	+	Splice_Site	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chrX:14933790G>A	ENST00000380492.3	+	12	1178	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M	MOSPD2_ENST00000495110.1_3'UTR|MOSPD2_ENST00000482354.1_Splice_Site_p.V364M	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	364	MSP. {ECO:0000255|PROSITE- ProRule:PRU00132}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					TTATAAATAGGTGAGAACAAC	0.373													ENSG00000130150																																					0													98.0	103.0	101.0					X																	14933790		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.1090-1G>A	X.37:g.14933790G>A			Q8N3H2|Q8NA83	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_MSP_dom,superfamily_CRAL-TRIO_dom,superfamily_PapD-like,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_MSP_dom	p.V364M	ENST00000380492.3	37	c.1090	CCDS14162.1	X	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848078	0.91277	.	.	ENSG00000130150	ENST00000380492	T	0.80393	-1.37	5.83	5.83	0.93111	PapD-like (2);	0.000000	0.85682	D	0.000000	D	0.91610	0.7349	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92314	0.5860	9	.	.	.	.	18.6997	0.91615	0.0:0.0:1.0:0.0	.	364	Q8NHP6	MSPD2_HUMAN	M	364	ENSP00000369860:V364M	.	V	+	1	0	MOSPD2	14843711	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.325000	0.96381	2.460000	0.83146	0.600000	0.82982	GTG	-	MOSPD2	-	pfam_MSP_dom,superfamily_PapD-like,pfscan_MSP_dom		0.373	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	HGNC	protein_coding	OTTHUMT00000055837.1	0	0	0	19	19	16	0.00	0.00	G	NM_152581	Missense_Mutation	14933790	+1	33	16	37	34	tier1	no_errors	ENST00000380492	ensembl	human	known	74_37	missense	47.14	32.00	SNP	1.000	A	33	37
KANSL1L	151050	genome.wustl.edu	37	2	210892036	210892036	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:210892036T>C	ENST00000281772.9	-	12	2698	c.2435A>G	c.(2434-2436)aAt>aGt	p.N812S	KANSL1L_ENST00000418791.1_Missense_Mutation_p.N770S|RP11-260M2.1_ENST00000608095.1_RNA	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	812						histone acetyltransferase complex (GO:0000123)											TTTGCCTAAATTATATTCATC	0.323													ENSG00000144445																																					0													83.0	82.0	82.0					2																	210892036		2203	4298	6501	SO:0001583	missense	0			-	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2435A>G	2.37:g.210892036T>C	ENSP00000281772:p.Asn812Ser		B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	NULL	p.N812S	ENST00000281772.9	37	c.2435	CCDS33370.1	2	.	.	.	.	.	.	.	.	.	.	T	2.663	-0.279282	0.05642	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	T;T	0.39997	1.05;1.05	5.97	2.1	0.27182	.	0.486350	0.18781	N	0.131328	T	0.32823	0.0842	L	0.40543	1.245	0.09310	N	1	B;B	0.23249	0.082;0.082	B;B	0.24394	0.053;0.053	T	0.17806	-1.0357	10	0.25751	T	0.34	.	12.0291	0.53388	0.0:0.0:0.4232:0.5768	.	770;812	A0AUZ9-2;A0AUZ9	.;CB067_HUMAN	S	812;770	ENSP00000281772:N812S;ENSP00000405724:N770S	ENSP00000281772:N812S	N	-	2	0	C2orf67	210600281	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	0.101000	0.15251	0.111000	0.17947	0.528000	0.53228	AAT	-	KANSL1L	-	NULL		0.323	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANSL1L	HGNC	protein_coding	OTTHUMT00000336633.3	0	0	0	48	48	82	0.00	0.00	T	NM_152519		210892036	-1	13	26	85	108	tier1	no_errors	ENST00000281772	ensembl	human	known	74_37	missense	13.27	19.40	SNP	0.002	C	13	85
RB1	5925	genome.wustl.edu	37	13	49050980	49050980	+	Splice_Site	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr13:49050980G>A	ENST00000267163.4	+	25	2801		c.e25+1		RB1_ENST00000484879.1_Splice_Site	NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAGATGGAAGGTAGGAACCAG	0.458		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(11)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)											116.0	112.0	113.0					13																	49050980		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2663+1G>A	13.37:g.49050980G>A			A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	-	e25+1	ENST00000267163.4	37	c.2663+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435521	0.83885	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7343	0.96195	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47948981	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.724000	0.91462	2.751000	0.94390	0.591000	0.81541	.	-	RB1	-	-		0.458	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	32	32	19	0.00	0.00	G		Intron	49050980	+1	21	26	87	78	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	splice_site	19.44	25.00	SNP	1.000	A	21	87
ANKRD36BP2	645784	genome.wustl.edu	37	2	89084352	89084352	+	RNA	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:89084352T>A	ENST00000393525.3	+	0	720									ankyrin repeat domain 36B pseudogene 2																		TCAGCCAAGATAGACAAGAAC	0.393													ENSG00000230006																																					0																																												0			-			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89084352T>A				R	SNP	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			-	ANKRD36BP2	-	-		0.393	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1	0	0	0	26	26	7	0.00	0.00	T			89084352	+1	30	7	101	38	tier1	no_errors	ENST00000393515	ensembl	human	known	74_37	rna	22.90	15.56	SNP	0.014	A	30	101
CTSK	1513	genome.wustl.edu	37	1	150772185	150772185	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:150772185C>T	ENST00000271651.3	-	6	729	c.619G>A	c.(619-621)Gaa>Aaa	p.E207K		NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K	207					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAACTCTCTTCCTGGAAGAAA	0.458													ENSG00000143387																																					0													117.0	111.0	113.0					1																	150772185		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.619-1G>A	1.37:g.150772185C>T			Q6FHS6	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,pfam_Peptidase_C1B,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.E207K	ENST00000271651.3	37	c.619	CCDS969.1	1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926480	0.73327	.	.	ENSG00000143387	ENST00000271651	D	0.97480	-4.4	5.78	5.78	0.91487	Peptidase C1A, papain C-terminal (2);	0.139981	0.64402	D	0.000007	D	0.90861	0.7129	N	0.12746	0.255	0.54753	D	0.999987	B	0.15719	0.014	B	0.19391	0.025	D	0.86910	0.2060	10	0.72032	D	0.01	.	17.5056	0.87745	0.0:1.0:0.0:0.0	.	207	P43235	CATK_HUMAN	K	207	ENSP00000271651:E207K	ENSP00000271651:E207K	E	-	1	0	CTSK	149038809	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	6.079000	0.71291	2.744000	0.94065	0.563000	0.77884	GAA	-	CTSK	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C		0.458	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSK	HGNC	protein_coding	OTTHUMT00000084732.1	0	0	0	34	34	43	0.00	0.00	C	NM_000396	Missense_Mutation	150772185	-1	14	16	56	70	tier1	no_errors	ENST00000271651	ensembl	human	known	74_37	missense	20.00	18.60	SNP	1.000	T	14	56
RASA3	22821	genome.wustl.edu	37	13	114773080	114773080	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr13:114773080G>C	ENST00000334062.7	-	18	1792	c.1671C>G	c.(1669-1671)ttC>ttG	p.F557L	RASA3_ENST00000389544.4_Missense_Mutation_p.F525L	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	557					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCAGATCCAAGAACTAAAGTT	0.542													ENSG00000185989																																					0													89.0	78.0	81.0					13																	114773080		2202	4299	6501	SO:0001583	missense	0			-		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1671C>G	13.37:g.114773080G>C	ENSP00000335029:p.Phe557Leu		A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_dom,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_C2_dom,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.F557L	ENST00000334062.7	37	c.1671	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589520	0.28357	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.22743	1.94;1.94	4.58	1.84	0.25277	Rho GTPase activation protein (1);Ras GTPase-activating protein (2);	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	M	0.71206	2.165	0.80722	D	1	B	0.29835	0.258	B	0.35312	0.2	T	0.02721	-1.1119	9	.	.	.	.	9.4201	0.38546	0.2474:0.0:0.7525:0.0	.	557	Q14644	RASA3_HUMAN	L	557;525	ENSP00000335029:F557L;ENSP00000374195:F525L	.	F	-	3	2	RASA3	113791182	1.000000	0.71417	0.352000	0.25734	0.142000	0.21351	0.829000	0.27449	0.113000	0.18004	-0.258000	0.10820	TTC	-	RASA3	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP		0.542	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	0	0	0	82	82	119	0.00	0.00	G	NM_007368		114773080	-1	9	15	29	56	tier1	no_errors	ENST00000334062	ensembl	human	known	74_37	missense	23.68	21.13	SNP	0.997	C	9	29
ABCG1	9619	genome.wustl.edu	37	21	43711222	43711222	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr21:43711222T>A	ENST00000361802.2	+	12	1595	c.1450T>A	c.(1450-1452)Ttt>Att	p.F484I	ABCG1_ENST00000347800.2_Missense_Mutation_p.F469I|ABCG1_ENST00000340588.4_Missense_Mutation_p.F592I|ABCG1_ENST00000398457.2_Missense_Mutation_p.F474I|ABCG1_ENST00000398437.1_Missense_Mutation_p.F630I|ABCG1_ENST00000398449.3_Missense_Mutation_p.F472I|ABCG1_ENST00000343687.3_Missense_Mutation_p.F483I|ABCG1_ENST00000462050.1_3'UTR	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	484	ABC transmembrane type-2.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	GATGGGAGTCTTTCTTCGGGA	0.532													ENSG00000160179																																					0													112.0	87.0	96.0					21																	43711222		2203	4300	6503	SO:0001583	missense	0			-	U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.1450T>A	21.37:g.43711222T>A	ENSP00000354995:p.Phe484Ile		Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Pigment_permease	p.F630I	ENST00000361802.2	37	c.1888	CCDS13682.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.031533|4.031533	0.75504|0.75504	.|.	.|.	ENSG00000160179|ENSG00000160179	ENST00000398457;ENST00000347800;ENST00000398449;ENST00000361802;ENST00000343687;ENST00000398437;ENST00000340588|ENST00000489035;ENST00000469119;ENST00000482161	T;T;T;T;T;T;T|.	0.72835|.	-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69|.	3.97|3.97	3.97|3.97	0.46021|0.46021	ABC-2 type transporter (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71324|0.71324	0.3326|0.3326	M|M	0.70787|0.70787	2.145|2.145	0.80722|0.80722	D|D	1|1	P;D;D;B;P;D|.	0.76494|.	0.587;0.964;0.999;0.357;0.847;0.989|.	B;P;D;B;P;D|.	0.75020|.	0.241;0.835;0.98;0.237;0.73;0.985|.	T|T	0.72154|0.72154	-0.4376|-0.4376	9|5	.|.	.|.	.|.	-17.0863|-17.0863	13.1771|13.1771	0.59633|0.59633	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	495;483;484;472;469;474|.	B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3|.	.;.;ABCG1_HUMAN;.;.;.|.	I|H	474;469;472;484;483;630;592|219;207;207	ENSP00000381475:F474I;ENSP00000291524:F469I;ENSP00000381467:F472I;ENSP00000354995:F484I;ENSP00000339744:F483I;ENSP00000381464:F630I;ENSP00000343820:F592I|.	.|.	F|L	+|+	1|2	0|0	ABCG1|ABCG1	42584291|42584291	1.000000|1.000000	0.71417|0.71417	0.191000|0.191000	0.23289|0.23289	0.893000|0.893000	0.52053|0.52053	7.654000|7.654000	0.83653|0.83653	1.582000|1.582000	0.49881|0.49881	0.383000|0.383000	0.25322|0.25322	TTT|CTT	-	ABCG1	-	pfam_ABC_2_trans,tigrfam_Pigment_permease		0.532	ABCG1-006	KNOWN	basic|CCDS	protein_coding	ABCG1	HGNC	protein_coding	OTTHUMT00000195318.2	0	0	0	74	74	97	0.00	0.00	T	NM_207174		43711222	+1	13	17	58	84	tier1	no_errors	ENST00000398437	ensembl	human	known	74_37	missense	18.31	16.83	SNP	0.997	A	13	58
ABCC1	4363	genome.wustl.edu	37	16	16205244	16205244	+	Missense_Mutation	SNP	G	G	A	rs371105838		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr16:16205244G>A	ENST00000399410.3	+	22	3059	c.2884G>A	c.(2884-2886)Gtg>Atg	p.V962M	ABCC1_ENST00000346370.5_Missense_Mutation_p.V906M|ABCC1_ENST00000349029.5_Missense_Mutation_p.V847M|ABCC1_ENST00000345148.5_Missense_Mutation_p.V962M|ABCC1_ENST00000399408.2_Missense_Mutation_p.V972M|ABCC1_ENST00000351154.5_Missense_Mutation_p.V903M	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	962					arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CAAGCTTTCCGTGTACTGGGA	0.557													ENSG00000103222																																					0								G	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4243		0,1,2121	179.0	189.0	186.0		2884,2707,2716,2539,2884	4.7	1.0	16		186	0,8470		0,0,4235	no	missense,missense,missense,missense,missense	ABCC1	NM_004996.3,NM_019862.2,NM_019898.2,NM_019899.2,NM_019900.2	21,21,21,21,21	0,1,6356	AA,AG,GG		0.0,0.0236,0.0079	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	962/1532,903/1473,906/1476,847/1417,962/1467	16205244	1,12713	2122	4235	6357	SO:0001583	missense	0			-	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.2884G>A	16.37:g.16205244G>A	ENSP00000382342:p.Val962Met		A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.V972M	ENST00000399410.3	37	c.2914	CCDS42122.1	16	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494921	0.64186	2.36E-4	0.0	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.91894	-2.92;-2.93;-2.64;-2.75;-2.88;-2.84	5.66	4.68	0.58851	ABC transporter, transmembrane domain, type 1 (1);	0.187299	0.46758	D	0.000265	D	0.95211	0.8447	M	0.72353	2.195	0.47737	D	0.999507	P;P;D;D;D;D	0.71674	0.758;0.531;0.996;0.994;0.993;0.998	B;B;D;P;P;D	0.70487	0.358;0.092;0.922;0.869;0.872;0.969	D	0.94777	0.7950	10	0.44086	T	0.13	-28.972	15.5785	0.76414	0.0:0.138:0.862:0.0	.	847;962;906;903;962;972	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	M	962;972;906;903;962;847;646	ENSP00000382342:V962M;ENSP00000382340:V972M;ENSP00000263019:V906M;ENSP00000263017:V903M;ENSP00000263014:V962M;ENSP00000263016:V847M	ENSP00000263014:V962M	V	+	1	0	ABCC1	16112745	1.000000	0.71417	0.964000	0.40570	0.741000	0.42261	5.708000	0.68377	1.358000	0.45922	0.650000	0.86243	GTG	-	ABCC1	-	superfamily_ABC1_TM_dom,tigrfam_Multidrug-R_assoc		0.557	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	HGNC	protein_coding	OTTHUMT00000109701.1	0	0	0	48	48	76	0.00	0.00	G	NM_004996		16205244	+1	6	22	48	85	tier1	no_errors	ENST00000399408	ensembl	human	known	74_37	missense	11.11	20.56	SNP	0.997	A	6	48
FREM2	341640	genome.wustl.edu	37	13	39265091	39265091	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr13:39265091A>C	ENST00000280481.7	+	1	3826	c.3610A>C	c.(3610-3612)Atg>Ctg	p.M1204L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1204					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GATGGAAGGCATGAGTCTGGT	0.413													ENSG00000150893																																					0													272.0	257.0	262.0					13																	39265091		2203	4300	6503	SO:0001583	missense	0			-	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3610A>C	13.37:g.39265091A>C	ENSP00000280481:p.Met1204Leu		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.M1204L	ENST00000280481.7	37	c.3610	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126807	0.56721	.	.	ENSG00000150893	ENST00000280481	T	0.50277	0.75	6.08	4.91	0.64330	.	0.075314	0.85682	D	0.000000	T	0.58250	0.2109	M	0.89214	3.015	0.58432	D	0.999999	P	0.42483	0.781	P	0.44732	0.459	T	0.60347	-0.7281	10	0.27082	T	0.32	.	12.0888	0.53713	0.9334:0.0:0.0666:0.0	.	1204	Q5SZK8	FREM2_HUMAN	L	1204	ENSP00000280481:M1204L	ENSP00000280481:M1204L	M	+	1	0	FREM2	38163091	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.526000	0.81920	1.131000	0.42111	0.533000	0.62120	ATG	-	FREM2	-	superfamily_Cadherin-like		0.413	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	0	0	0	19	19	34	0.00	0.00	A	NM_207361		39265091	+1	18	15	33	61	tier1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	35.29	19.74	SNP	1.000	C	18	33
RAD21L1	642636	genome.wustl.edu	37	20	1212265	1212265	+	Splice_Site	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr20:1212265T>A	ENST00000409241.1	+	4	461		c.e4+2		RAD21L1_ENST00000402452.1_Splice_Site|RAD21L1_ENST00000381882.2_Splice_Site|RAD21L1_ENST00000477283.1_Splice_Site	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)						attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						AAATATGAAGTAAAATATTTT	0.279													ENSG00000244588																																					0													31.0	24.0	26.0					20																	1212265		692	1580	2272	SO:0001630	splice_region_variant	0			-	AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.368+2T>A	20.37:g.1212265T>A			B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Splice_Site	SNP	-	e3+2	ENST00000409241.1	37	c.368+2	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	T	15.48	2.847281	0.51164	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9845	0.58583	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RAD21L1	1160265	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	5.821000	0.69257	2.126000	0.65437	0.533000	0.62120	.	-	RAD21L1	-	-		0.279	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	HGNC	protein_coding	OTTHUMT00000334022.1	0	0	0	8	8	10	0.00	0.00	T		Intron	1212265	+1	6	5	30	29	tier1	no_errors	ENST00000409241	ensembl	human	known	74_37	splice_site	16.67	14.71	SNP	1.000	A	6	30
LOXHD1	125336	genome.wustl.edu	37	18	44173692	44173692	+	Silent	SNP	G	G	A	rs377086603		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr18:44173692G>A	ENST00000398722.4	-	3	467	c.468C>T	c.(466-468)acC>acT	p.T156T	LOXHD1_ENST00000536736.1_Silent_p.T434T|LOXHD1_ENST00000441551.2_Silent_p.T434T			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	156	PLAT 2. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TCTTTAGGTCGGTTGTCCAGA	0.463													ENSG00000167210																																					0													87.0	75.0	78.0					18																	44173692		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.468C>T	18.37:g.44173692G>A			B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.T434	ENST00000398722.4	37	c.1302		18	.	.	.	.	.	.	.	.	.	.	g	7.408	0.634235	0.14322	.	.	ENSG00000167210	ENST00000441551	.	.	.	5.95	-4.8	0.03190	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9579	0.09398	0.3605:0.1164:0.4104:0.1126	.	.	.	.	X	415	.	.	R	-	1	2	LOXHD1	42427690	0.365000	0.25006	0.553000	0.28255	0.748000	0.42578	-0.152000	0.10159	-1.160000	0.02804	-0.404000	0.06349	CGA	-	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.463	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		0	0	0	15	15	35	0.00	0.00	G	NM_144612		44173692	-1	16	24	74	83	tier1	no_errors	ENST00000536736	ensembl	human	known	74_37	silent	17.58	22.43	SNP	0.452	A	16	74
PKNOX2	63876	genome.wustl.edu	37	11	125221274	125221274	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr11:125221274C>A	ENST00000298282.9	+	4	344	c.73C>A	c.(73-75)Cag>Aag	p.Q25K	PKNOX2_ENST00000542175.1_Silent_p.T7T|PKNOX2_ENST00000530517.1_Intron	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	25					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CCCACCCTACCAGGACAGCCC	0.652													ENSG00000165495																																					0													27.0	31.0	30.0					11																	125221274		2086	4202	6288	SO:0001583	missense	0			-	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.73C>A	11.37:g.125221274C>A	ENSP00000298282:p.Gln25Lys		B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.Q25K	ENST00000298282.9	37	c.73	CCDS41730.1	11	.	.	.	.	.	.	.	.	.	.	c	16.11	3.031156	0.54790	.	.	ENSG00000165495	ENST00000298282;ENST00000527238;ENST00000531212;ENST00000535518	T	0.29142	1.58	5.61	5.61	0.85477	.	0.067689	0.64402	D	0.000012	T	0.20373	0.0490	L	0.38175	1.15	0.80722	D	1	P	0.38535	0.635	B	0.27887	0.084	T	0.08207	-1.0733	10	0.05959	T	0.93	-8.6851	18.4197	0.90586	0.0:1.0:0.0:0.0	.	25	Q96KN3	PKNX2_HUMAN	K	25;25;25;13	ENSP00000298282:Q25K	ENSP00000298282:Q25K	Q	+	1	0	PKNOX2	124726484	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.937000	0.75898	2.622000	0.88805	0.651000	0.88453	CAG	-	PKNOX2	-	NULL		0.652	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX2	HGNC	protein_coding	OTTHUMT00000386866.3	0	0	0	31	31	29	0.00	0.00	C			125221274	+1	5	4	13	14	tier1	no_errors	ENST00000298282	ensembl	human	known	74_37	missense	27.78	22.22	SNP	1.000	A	5	13
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	rs28934578	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	63	63	73	0.00	0.00	C	NM_000546		7578406	-1	7	17	19	34	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	26.92	33.33	SNP	1.000	T	7	19
CDHR1	92211	genome.wustl.edu	37	10	85978986	85978986	+	IGR	SNP	T	T	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:85978986T>A	ENST00000372117.3	+	0	5428				CDHR1_ENST00000332904.3_Missense_Mutation_p.V731E	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1						cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CTGAGTAATGTGAATCTGTAC	0.413													ENSG00000148600																																					0																																										SO:0001628	intergenic_variant	0			-	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634		10.37:g.85978986T>A			Q69YZ8|Q8IXY5	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V731E	ENST00000372117.3	37	c.2192	CCDS7372.1	10	.	.	.	.	.	.	.	.	.	.	T	8.407	0.843195	0.16963	.	.	ENSG00000148600	ENST00000332904	T	0.57907	0.37	2.61	-1.7	0.08159	.	.	.	.	.	T	0.35711	0.0941	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.20955	0.032	T	0.25882	-1.0119	8	0.41790	T	0.15	.	6.0946	0.20013	0.0:0.4829:0.0:0.5171	.	731	Q96JP9-2	.	E	731	ENSP00000331063:V731E	ENSP00000331063:V731E	V	+	2	0	CDHR1	85968966	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-1.434000	0.02425	-0.354000	0.08212	0.533000	0.62120	GTG	-	CDHR1	-	NULL		0.413	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	HGNC	protein_coding	OTTHUMT00000049111.1	0	0	0	67	67	63	0.00	0.00	T	NM_033100		85978986	+1	22	33	75	113	tier1	no_errors	ENST00000332904	ensembl	human	known	74_37	missense	22.68	22.60	SNP	0.001	A	22	75
ARHGEF11	9826	genome.wustl.edu	37	1	156909248	156909248	+	Intron	SNP	G	G	A	rs368977976|rs112685506	byFrequency	TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:156909248G>A	ENST00000361409.2	-	36	4719				ARHGEF11_ENST00000315174.8_Intron|ARHGEF11_ENST00000368194.3_Intron|ARHGEF11_ENST00000487682.1_5'UTR	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGGTACCCAGGGGGAGTATAG	0.517													ENSG00000132694																																					0																																										SO:0001627	intron_variant	0			-	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3976+91C>T	1.37:g.156909248G>A			D3DVD0|Q5VY40|Q6PFW2	R	SNP	-	NULL	ENST00000361409.2	37	NULL	CCDS1162.1	1																																																																																			-	ARHGEF11	-	-		0.517	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	0	0	0	28	28	94	0.00	0.00	G	NM_198236		156909248	-1	11	38	29	136	tier1	no_errors	ENST00000487682	ensembl	human	known	74_37	rna	27.50	21.84	SNP	0.000	A	11	29
TICAM1	148022	genome.wustl.edu	37	19	4816340	4816340	+	Missense_Mutation	SNP	C	C	T	rs376421303		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr19:4816340C>T	ENST00000248244.5	-	2	2279	c.2050G>A	c.(2050-2052)Gca>Aca	p.A684T		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	684	Sufficient to induce apoptosis.				apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		ACCATCTGTGCGTGGTGGATA	0.632													ENSG00000127666																																					0								C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	82.0	76.0	78.0		2050	4.7	0.6	19		78	0,8600		0,0,4300	no	missense	TICAM1	NM_182919.2	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	684/713	4816340	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.2050G>A	19.37:g.4816340C>T	ENSP00000248244:p.Ala684Thr		B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	superfamily_TIR_dom,pirsf_TICAM1	p.A684T	ENST00000248244.5	37	c.2050	CCDS12136.1	19	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771422	0.69992	2.27E-4	0.0	ENSG00000127666	ENST00000248244	T	0.54479	0.57	4.68	4.68	0.58851	.	0.000000	0.34906	U	0.003584	T	0.62270	0.2414	L	0.32530	0.975	0.31593	N	0.6537	D	0.89917	1.0	D	0.97110	1.0	T	0.68228	-0.5464	10	0.87932	D	0	-22.2173	14.6713	0.68945	0.0:1.0:0.0:0.0	.	684	Q8IUC6	TCAM1_HUMAN	T	684	ENSP00000248244:A684T	ENSP00000248244:A684T	A	-	1	0	TICAM1	4767340	0.989000	0.36119	0.629000	0.29254	0.403000	0.30841	4.195000	0.58400	2.293000	0.77203	0.561000	0.74099	GCA	-	TICAM1	-	pirsf_TICAM1		0.632	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TICAM1	HGNC	protein_coding	OTTHUMT00000450435.1	0	0	0	64	64	93	0.00	0.00	C	NM_014261		4816340	-1	10	21	58	54	tier1	no_errors	ENST00000248244	ensembl	human	known	74_37	missense	14.71	28.00	SNP	0.704	T	10	58
EHBP1	23301	genome.wustl.edu	37	2	63220800	63220800	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:63220800C>G	ENST00000263991.5	+	19	3564	c.3082C>G	c.(3082-3084)Cca>Gca	p.P1028A	EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000405015.3_Missense_Mutation_p.P957A|EHBP1_ENST00000354487.3_Missense_Mutation_p.P993A|EHBP1_ENST00000405289.1_Missense_Mutation_p.P993A|EHBP1_ENST00000431489.1_Missense_Mutation_p.P957A	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	1028						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TGAGAATAGACCAGGTAGAAC	0.264													ENSG00000115504																																					0													51.0	50.0	50.0					2																	63220800		2203	4298	6501	SO:0001583	missense	0			-	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.3082C>G	2.37:g.63220800C>G	ENSP00000263991:p.Pro1028Ala		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.P1028A	ENST00000263991.5	37	c.3082	CCDS1872.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.52|15.52	2.857258|2.857258	0.51376|0.51376	.|.	.|.	ENSG00000115504|ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289|ENST00000422032	T;T;T;T;T|.	0.75050|.	-0.81;-0.81;-0.88;-0.9;-0.9|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70474|0.70474	0.3228|0.3228	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.997;0.997|.	T|T	0.64437|0.64437	-0.6408|-0.6408	10|5	0.07990|.	T|.	0.79|.	.|.	20.3172|20.3172	0.98658|0.98658	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	993;957;1028|.	Q8NDI1-2;Q8NDI1-3;Q8NDI1|.	.;.;EHBP1_HUMAN|.	A|S	957;957;1028;993;993|187	ENSP00000384143:P957A;ENSP00000403783:P957A;ENSP00000263991:P1028A;ENSP00000346482:P993A;ENSP00000385524:P993A|.	ENSP00000263991:P1028A|.	P|T	+|+	1|2	0|0	EHBP1|EHBP1	63074304|63074304	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.709000|7.709000	0.84645|0.84645	2.801000|2.801000	0.96364|0.96364	0.650000|0.650000	0.86243|0.86243	CCA|ACC	-	EHBP1	-	NULL		0.264	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	0	0	0	14	14	15	0.00	0.00	C	NM_015252		63220800	+1	14	21	35	84	tier1	no_errors	ENST00000263991	ensembl	human	known	74_37	missense	28.57	20.00	SNP	1.000	G	14	35
RASSF6	166824	genome.wustl.edu	37	4	74481640	74481640	+	Intron	SNP	A	A	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr4:74481640A>G	ENST00000342081.3	-	2	193				RASSF6_ENST00000307439.5_Intron|RASSF6_ENST00000512591.1_Intron|RASSF6_ENST00000395777.2_Intron|RASSF6_ENST00000335049.5_Missense_Mutation_p.S26P	NM_201431.2	NP_958834.1	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family member 6						apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)					breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|pancreas(2)|skin(2)	17	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			AGGCCAGAGGACAGGAAGTGA	0.438													ENSG00000169435																																					0																																										SO:0001627	intron_variant	0			-	AY217664	CCDS3558.1, CCDS3559.1, CCDS58904.1, CCDS58905.1	4q21.1	2008-02-22	2008-02-22		ENSG00000169435	ENSG00000169435			20796	protein-coding gene	gene with protein product		612620					Standard	NM_177532		Approved		uc003hhd.2	Q6ZTQ3	OTTHUMG00000130007	ENST00000342081.3:c.63-4094T>C	4.37:g.74481640A>G			Q68DT2|Q6PDA6|Q86WG9|Q86WH0	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH_dom	p.S26P	ENST00000342081.3	37	c.76	CCDS3558.1	4	.	.	.	.	.	.	.	.	.	.	A	8.796	0.931852	0.18131	.	.	ENSG00000169435	ENST00000335049	T	0.23754	1.89	2.24	0.985	0.19779	.	.	.	.	.	T	0.22936	0.0554	.	.	.	0.09310	N	1	P	0.38148	0.62	B	0.42062	0.374	T	0.18903	-1.0322	8	0.72032	D	0.01	.	5.1895	0.15203	0.6937:0.3063:0.0:0.0	.	26	Q6ZTQ3-3	.	P	26	ENSP00000335582:S26P	ENSP00000335582:S26P	S	-	1	0	RASSF6	74700504	0.000000	0.05858	0.001000	0.08648	0.360000	0.29518	0.233000	0.17911	0.289000	0.22422	-0.666000	0.03841	TCC	-	RASSF6	-	NULL		0.438	RASSF6-002	KNOWN	basic|CCDS	protein_coding	RASSF6	HGNC	protein_coding	OTTHUMT00000252279.1	0	0	0	36	36	29	0.00	0.00	A	NM_177532		74481640	-1	29	18	78	130	tier1	no_errors	ENST00000335049	ensembl	human	known	74_37	missense	27.10	12.00	SNP	0.001	G	29	78
S100A7	6278	genome.wustl.edu	37	1	153430303	153430303	+	Silent	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:153430303G>A	ENST00000368723.3	-	3	395	c.285C>T	c.(283-285)ccC>ccT	p.P95P	S100A7_ENST00000368722.1_Silent_p.P95P	NM_002963.3	NP_002954.2	P31151	S10A7_HUMAN	S100 calcium binding protein A7	95					angiogenesis (GO:0001525)|defense response to Gram-negative bacterium (GO:0050829)|epidermis development (GO:0008544)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of T cell chemotaxis (GO:0010820)|response to lipopolysaccharide (GO:0032496)|response to reactive oxygen species (GO:0000302)|sequestering of metal ion (GO:0051238)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(5)|skin(2)	10	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCCGGAACAGGGCGCTGCTC	0.517													ENSG00000143556																																					0													65.0	64.0	64.0					1																	153430303		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC034687	CCDS1039.1	1q21	2013-01-10	2006-09-11		ENSG00000143556	ENSG00000143556		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10497	protein-coding gene	gene with protein product		600353	"""S100 calcium-binding protein A7 (psoriasin 1)"", ""S100 calcium binding protein A7 (psoriasin 1)"""	PSOR1		1940442	Standard	NM_002963		Approved	S100A7c	uc001fbv.1	P31151	OTTHUMG00000013123	ENST00000368723.3:c.285C>T	1.37:g.153430303G>A			Q5SY67|Q6FGE3|Q9H1E2	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.P95	ENST00000368723.3	37	c.285	CCDS1039.1	1																																																																																			-	S100A7	-	NULL		0.517	S100A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A7	HGNC	protein_coding	OTTHUMT00000036789.1	0	0	0	43	43	9	0.00	0.00	G	NM_002963		153430303	-1	6	9	49	20	tier1	no_errors	ENST00000368722	ensembl	human	known	74_37	silent	10.71	31.03	SNP	0.000	A	6	49
ZC3H3	23144	genome.wustl.edu	37	8	144621417	144621417	+	Silent	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:144621417C>T	ENST00000262577.5	-	2	151	c.120G>A	c.(118-120)caG>caA	p.Q40Q	RP11-661A12.5_ENST00000530600.1_RNA|7SK_ENST00000517300.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	40					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			AAGTGGGTGGCTGCCACCCAG	0.602													ENSG00000014164																																					0													40.0	39.0	39.0					8																	144621417		2202	4292	6494	SO:0001819	synonymous_variant	0			-	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.120G>A	8.37:g.144621417C>T			Q14163|Q8N4E2|Q9BUS4	Silent	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.Q40	ENST00000262577.5	37	c.120	CCDS6402.1	8																																																																																			-	ZC3H3	-	NULL		0.602	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	HGNC	protein_coding	OTTHUMT00000382011.2	0	0	0	80	80	75	0.00	0.00	C	NM_015117		144621417	-1	18	10	45	67	tier1	no_errors	ENST00000262577	ensembl	human	known	74_37	silent	28.57	12.99	SNP	0.994	T	18	45
KIF1B	23095	genome.wustl.edu	37	1	10423402	10423402	+	Splice_Site	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:10423402G>A	ENST00000377086.1	+	41	4568	c.4366G>A	c.(4366-4368)Ggt>Agt	p.G1456S	KIF1B_ENST00000263934.6_Splice_Site_p.G1410S|KIF1B_ENST00000377081.1_Splice_Site_p.G1456S			O60333	KIF1B_HUMAN	kinesin family member 1B	1456					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGGTAGTCCAGGTAAGCTCTT	0.403													ENSG00000054523																																					0													180.0	174.0	176.0					1																	10423402		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4366+1G>A	1.37:g.10423402G>A			A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G1410S	ENST00000377086.1	37	c.4228		1	.	.	.	.	.	.	.	.	.	.	G	36	5.728432	0.96856	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.74209	-0.75;-0.82;-0.82	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.85826	0.5787	M	0.64404	1.975	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.994;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.977;0.965;0.938;0.999;0.952;0.994	D	0.84920	0.0853	10	0.59425	D	0.04	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	1442;1416;1456;1430;1456;1410	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	S	1456;1410;1456;1456	ENSP00000263934:G1410S;ENSP00000366290:G1456S;ENSP00000366284:G1456S	ENSP00000263934:G1410S	G	+	1	0	KIF1B	10345989	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.386000	0.97228	2.882000	0.98803	0.655000	0.94253	GGT	-	KIF1B	-	NULL		0.403	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	0	0	0	61	61	63	0.00	0.00	G		Missense_Mutation	10423402	+1	17	27	82	114	tier1	no_errors	ENST00000263934	ensembl	human	known	74_37	missense	17.17	19.15	SNP	1.000	A	17	82
REG1P	5969	genome.wustl.edu	37	2	79364441	79364441	+	RNA	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr2:79364441T>C	ENST00000444841.1	-	0	193									regenerating islet-derived 1 pseudogene																		GATCTGGGCCTTGGGCAACTC	0.507													ENSG00000204787																																					0																																												0			-			2p12	2008-06-04	2008-06-04	2008-06-04	ENSG00000204787	ENSG00000204787			9953	pseudogene	pseudogene			"""rat regenerating islet-derived-like, human homolog (pancreatic stone protein-like, pancreatic thread protein-like)"", ""regenerating islet-derived-like, pancreatic stone protein-like, pancreatic thread protein-like (rat)"""	REGL		8333731	Standard	NR_002714		Approved	RS	uc002soc.1		OTTHUMG00000152978		2.37:g.79364441T>C				R	SNP	-	NULL	ENST00000444841.1	37	NULL		2																																																																																			-	REG1P	-	-		0.507	REG1P-002	KNOWN	basic	processed_transcript	REG1P	HGNC	pseudogene	OTTHUMT00000328851.1	0	0	0	35	35	31	0.00	0.00	T	NR_002714		79364441	-1	18	22	57	69	tier1	no_errors	ENST00000377435	ensembl	human	known	74_37	rna	24.00	24.18	SNP	0.000	C	18	57
CCDC127	133957	genome.wustl.edu	37	5	216901	216901	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:216901C>T	ENST00000296824.3	-	2	196	c.64G>A	c.(64-66)Gat>Aat	p.D22N	SDHA_ENST00000264932.6_5'Flank|SDHA_ENST00000504309.1_5'Flank|CTD-2083E4.4_ENST00000565521.1_RNA|SDHA_ENST00000510361.1_5'Flank	NM_145265.2	NP_660308.1	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127	22										breast(1)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12			all cancers(22;0.0236)|Lung(60;0.113)			CTGCTTCCATCACCACCATCC	0.423													ENSG00000164366																																					0													27.0	24.0	25.0					5																	216901		2200	4274	6474	SO:0001583	missense	0			-	AK098567	CCDS3852.1	5p15.33	2008-02-05			ENSG00000164366	ENSG00000164366			30520	protein-coding gene	gene with protein product						12477932	Standard	NM_145265		Approved	FLJ25701	uc003jam.1	Q96BQ5	OTTHUMG00000161586	ENST00000296824.3:c.64G>A	5.37:g.216901C>T	ENSP00000296824:p.Asp22Asn			Missense_Mutation	SNP	NULL	p.D22N	ENST00000296824.3	37	c.64	CCDS3852.1	5	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928533	0.73327	.	.	ENSG00000164366	ENST00000296824;ENST00000441693	T;T	0.47869	0.83;0.83	5.48	5.48	0.80851	.	0.092974	0.64402	D	0.000001	T	0.61311	0.2337	L	0.44542	1.39	0.58432	D	0.999997	D	0.76494	0.999	D	0.68943	0.961	T	0.60120	-0.7325	10	0.52906	T	0.07	-41.1068	17.2004	0.86904	0.0:1.0:0.0:0.0	.	22	Q96BQ5	CC127_HUMAN	N	22	ENSP00000296824:D22N;ENSP00000411206:D22N	ENSP00000296824:D22N	D	-	1	0	CCDC127	269901	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.110000	0.57831	2.736000	0.93811	0.650000	0.86243	GAT	-	CCDC127	-	NULL		0.423	CCDC127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC127	HGNC	protein_coding	OTTHUMT00000365459.2	0	0	0	107	107	72	0.00	0.00	C	NM_145265		216901	-1	18	16	82	55	tier1	no_errors	ENST00000296824	ensembl	human	known	74_37	missense	18.00	22.54	SNP	1.000	T	18	82
PCDH15	65217	genome.wustl.edu	37	10	55568823	55568823	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr10:55568823T>C	ENST00000395445.1	-	36	5381	c.4987A>G	c.(4987-4989)Aga>Gga	p.R1663G	PCDH15_ENST00000395446.1_Missense_Mutation_p.R859G|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395440.1_Missense_Mutation_p.R597G|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395442.1_Missense_Mutation_p.R528G|PCDH15_ENST00000409834.1_3'UTR	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GGCCTTCTTCTTGCAAGCACA	0.468										HNSCC(58;0.16)			ENSG00000150275																																					0													100.0	76.0	84.0					10																	55568823		1568	3582	5150	SO:0001583	missense	0			-	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.4987A>G	10.37:g.55568823T>C	ENSP00000378832:p.Arg1663Gly		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R1663G	ENST00000395445.1	37	c.4987		10	.	.	.	.	.	.	.	.	.	.	T	10.65	1.409924	0.25465	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;D;D;D	0.97161	2.1;-4.27;-4.27;-4.27	5.55	2.99	0.34606	.	.	.	.	.	D	0.92427	0.7596	N	0.14661	0.345	0.58432	D	0.999992	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	D	0.88369	0.2993	9	0.72032	D	0.01	.	13.2557	0.60076	0.0:0.0:0.2616:0.7384	.	1661;1663	C6ZEF5;A2A3E2	.;.	G	1663;859;528;597	ENSP00000378832:R1663G;ENSP00000378833:R859G;ENSP00000378829:R528G;ENSP00000378827:R597G	ENSP00000378827:R597G	R	-	1	2	PCDH15	55238829	0.625000	0.27111	0.816000	0.32577	0.226000	0.24999	1.122000	0.31295	0.905000	0.36596	0.533000	0.62120	AGA	-	PCDH15	-	NULL		0.468	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000291335.1	0	0	0	10	10	43	0.00	0.00	T	NM_033056		55568823	-1	5	40	23	99	tier1	no_errors	ENST00000395445	ensembl	human	novel	74_37	missense	17.24	28.78	SNP	0.701	C	5	23
UNKL	64718	genome.wustl.edu	37	16	1444442	1444442	+	Intron	SNP	C	C	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr16:1444442C>A	ENST00000389221.4	-	7	852				UNKL_ENST00000508903.2_Intron|UNKL_ENST00000397462.1_Nonsense_Mutation_p.G462*	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GGGGCCATTCCCGCAGCATCT	0.582													ENSG00000059145																																					0																																										SO:0001627	intron_variant	0			-	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.853-235G>T	16.37:g.1444442C>A			B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.G462*	ENST00000389221.4	37	c.1384	CCDS53981.1	16	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915013	0.33815	.	.	ENSG00000059145	ENST00000397462	.	.	.	1.76	0.737	0.18314	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	5.2209	0.15368	0.3417:0.6583:0.0:0.0	.	.	.	.	X	462	.	ENSP00000380604:G462X	G	-	1	0	UNKL	1384443	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.490000	0.22403	0.287000	0.22375	-0.399000	0.06403	GGA	-	UNKL	-	NULL		0.582	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding		0	0	0	65	65	86	0.00	0.00	C	NM_001037125		1444442	-1	8	21	23	59	tier1	no_errors	ENST00000397462	ensembl	human	known	74_37	nonsense	25.81	26.25	SNP	0.001	A	8	23
CACNA1S	779	genome.wustl.edu	37	1	201044742	201044742	+	Splice_Site	SNP	A	A	G			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr1:201044742A>G	ENST00000362061.3	-	13	2055	c.1829T>C	c.(1828-1830)gTa>gCa	p.V610A	CACNA1S_ENST00000367338.3_Splice_Site_p.V610A	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	610					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCTGTCAGTACCTGTATGGA	0.542													ENSG00000081248																																					0													159.0	140.0	146.0					1																	201044742		2203	4300	6503	SO:0001630	splice_region_variant	0			-	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.1828-1T>C	1.37:g.201044742A>G			A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.V610A	ENST00000362061.3	37	c.1829	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	A	18.50	3.637258	0.67130	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97665	-4.48;-4.48	4.45	4.45	0.53987	Ion transport (1);	0.052902	0.64402	D	0.000001	D	0.96935	0.8999	M	0.67517	2.055	0.40525	D	0.980876	P	0.34977	0.478	P	0.45377	0.478	D	0.98115	1.0422	10	0.87932	D	0	.	14.0254	0.64582	1.0:0.0:0.0:0.0	.	610	Q13698	CAC1S_HUMAN	A	610	ENSP00000355192:V610A;ENSP00000356307:V610A	ENSP00000355192:V610A	V	-	2	0	CACNA1S	199311365	1.000000	0.71417	0.999000	0.59377	0.307000	0.27823	9.238000	0.95380	1.781000	0.52344	0.523000	0.50628	GTA	-	CAC1S	-	pfam_Ion_trans_dom,prints_VDCCAlpha1		0.542	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAC1S	HGNC	protein_coding	OTTHUMT00000087049.1	0	0	0	28	28	55	0.00	0.00	A	NM_000069	Missense_Mutation	201044742	-1	9	8	66	112	tier1	no_errors	ENST00000362061	ensembl	human	known	74_37	missense	12.00	6.67	SNP	1.000	G	9	66
C9orf78	51759	genome.wustl.edu	37	9	132597501	132597501	+	5'UTR	SNP	G	G	C	rs199979480		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr9:132597501G>C	ENST00000372447.3	-	0	53				USP20_ENST00000358355.1_5'Flank|C9orf78_ENST00000461762.1_5'Flank|USP20_ENST00000372429.3_5'Flank|USP20_ENST00000315480.4_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				CGACCGGCATGGTGACAACGG	0.701													ENSG00000136819																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.-1C>G	9.37:g.132597501G>C			B3KPX8|Q8WVU6|Q9NT39	R	SNP	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																			-	C9orf78	-	-		0.701	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1	0	0	0	83	83	13	0.00	0.00	G	NM_016520		132597501	-1	13	0	23	5	tier1	no_errors	ENST00000461349	ensembl	human	known	74_37	rna	35.14	0.00	SNP	0.001	C	13	23
MATN4	8785	genome.wustl.edu	37	20	43926658	43926658	+	Silent	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr20:43926658G>A	ENST00000372754.1	-	8	1610	c.1602C>T	c.(1600-1602)cgC>cgT	p.R534R	MATN4_ENST00000360607.6_Silent_p.R452R|MATN4_ENST00000342716.4_Silent_p.R493R|MATN4_ENST00000353917.5_Silent_p.R411R|MATN4_ENST00000537548.1_Silent_p.R493R|MATN4_ENST00000372751.4_Silent_p.R344R|MATN4_ENST00000372756.1_Silent_p.R493R			O95460	MATN4_HUMAN	matrilin 4	534	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				AGGCGATCTCGCGCAGCTCCG	0.672													ENSG00000124159																																					0																																										SO:0001819	synonymous_variant	0			-	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.1602C>T	20.37:g.43926658G>A			A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Silent	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_VWF_A	p.R534	ENST00000372754.1	37	c.1602		20																																																																																			-	MATN4	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.672	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	MATN4	HGNC	protein_coding	OTTHUMT00000080335.1	0	0	0	68	68	10	0.00	0.00	G			43926658	-1	11	0	34	6	tier1	no_errors	ENST00000372754	ensembl	human	known	74_37	silent	23.91	0.00	SNP	0.003	A	11	34
PPP1R16A	84988	genome.wustl.edu	37	8	145725733	145725733	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr8:145725733G>A	ENST00000292539.4	+	6	1581	c.664G>A	c.(664-666)Ggg>Agg	p.G222R	PPP1R16A_ENST00000435887.1_Missense_Mutation_p.G222R|CTD-2517M22.14_ENST00000532766.1_RNA|CTD-2517M14.5_ENST00000569326.1_RNA|GPT_ENST00000528431.1_5'Flank			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	222						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GCTGCAGGCCGGGGCAGACCT	0.736													ENSG00000160972																																					0													4.0	7.0	6.0					8																	145725733		1850	3712	5562	SO:0001583	missense	0			-		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.664G>A	8.37:g.145725733G>A	ENSP00000292539:p.Gly222Arg		D3DWM5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.G222R	ENST00000292539.4	37	c.664	CCDS6429.1	8	.	.	.	.	.	.	.	.	.	.	g	18.07	3.542532	0.65198	.	.	ENSG00000160972	ENST00000292539;ENST00000435887	T;T	0.62364	0.03;0.03	5.44	4.55	0.56014	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.75989	0.3925	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	T	0.78725	-0.2092	10	0.72032	D	0.01	.	13.1958	0.59738	0.0:0.0:0.8391:0.1609	.	222	Q96I34	PP16A_HUMAN	R	222	ENSP00000292539:G222R;ENSP00000391126:G222R	ENSP00000292539:G222R	G	+	1	0	PPP1R16A	145696541	1.000000	0.71417	0.768000	0.31515	0.040000	0.13550	2.698000	0.47068	1.269000	0.44280	0.556000	0.70494	GGG	-	PPP1R16A	-	superfamily_Ankyrin_rpt-contain_dom,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt-contain_dom		0.736	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16A	HGNC	protein_coding	OTTHUMT00000382459.1	0	0	0	25	25	3	0.00	0.00	G	NM_032902		145725733	+1	7	2	13	0	tier1	no_errors	ENST00000292539	ensembl	human	known	74_37	missense	33.33	100.00	SNP	0.998	A	7	13
ZNF407	55628	genome.wustl.edu	37	18	72776361	72776361	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr18:72776361G>T	ENST00000299687.5	+	8	6684	c.6684G>T	c.(6682-6684)gaG>gaT	p.E2228D		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACACCCAGGAGGGCTCCTCGG	0.657													ENSG00000215421																																					0													5.0	7.0	6.0					18																	72776361		2002	4126	6128	SO:0001583	missense	0			-	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6684G>T	18.37:g.72776361G>T	ENSP00000299687:p.Glu2228Asp		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.E2228D	ENST00000299687.5	37	c.6684	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	7.862	0.726288	0.15439	.	.	ENSG00000215421	ENST00000299687	T	0.08370	3.1	4.78	-8.53	0.00916	.	.	.	.	.	T	0.02230	0.0069	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56583	-0.7955	9	0.05351	T	0.99	.	5.0388	0.14449	0.0753:0.3381:0.1058:0.4807	.	2228	Q9C0G0	ZN407_HUMAN	D	2228	ENSP00000299687:E2228D	ENSP00000299687:E2228D	E	+	3	2	ZNF407	70905349	0.019000	0.18553	0.209000	0.23619	0.785000	0.44390	-1.636000	0.02016	0.963000	0.38082	0.462000	0.41574	GAG	-	ZNF407	-	NULL		0.657	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	0	0	0	187	187	41	0.00	0.00	G	NM_017757		72776361	+1	10	2	72	21	tier1	no_errors	ENST00000299687	ensembl	human	known	74_37	missense	12.20	8.70	SNP	0.956	T	10	72
AC026700.1	0	genome.wustl.edu	37	5	84823865	84823870	+	RNA	DEL	TGTGTG	TGTGTG	-	rs3101111|rs201146846|rs145369997		TCGA-3B-A9I3-01A-11D-A38Z-09	TCGA-3B-A9I3-10A-01D-A38Z-09	TGTGTG	TGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6e1ec5e-069a-468e-86f6-24657fdeff5a	1fdd19d3-2a91-411e-b3aa-e425aa45b4ce	g.chr5:84823865_84823870delTGTGTG	ENST00000401134.1	-	0	82_87																											TATAtgtatatgtgtgtgtgtgtgtg	0.345													ENSG00000215953																																					0																																												0																																5.37:g.84823871_84823876delTGTGTG				R	DEL	-	NULL	ENST00000401134.1	37	NULL		5																																																																																				AC026700.1	-	-		0.345	AC026700.1-201	NOVEL	basic	miRNA	ENSG00000215953	Clone_based_ensembl_gene	miRNA		0	0	0	16	16	16	0.00	0.00	TGTGTG			84823870	-1	2	2	36	36	tier1	no_errors	ENST00000401134	ensembl	human	novel	74_37	rna	5.26	5.26	DEL	0.004:0.002:0.002:0.001:0.001:0.001	-	2	36
