#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
KLC3	147700	genome.wustl.edu	37	19	45849840	45849840	+	Missense_Mutation	SNP	G	G	T	rs368201163		TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr19:45849840G>T	ENST00000391946.2	+	3	399	c.297G>T	c.(295-297)gaG>gaT	p.E99D	KLC3_ENST00000585434.1_Missense_Mutation_p.E99D|KLC3_ENST00000470402.1_Missense_Mutation_p.E113D	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	99					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GTGCACTGGAGGCAGAGAAGC	0.716													ENSG00000104892																																					0													6.0	9.0	8.0					19																	45849840		1884	3874	5758	SO:0001583	missense	0			-	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.297G>T	19.37:g.45849840G>T	ENSP00000375810:p.Glu99Asp		A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.E113D	ENST00000391946.2	37	c.339	CCDS12660.2	19	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925470	0.73213	.	.	ENSG00000104892	ENST00000391946;ENST00000470402	T;T	0.48522	0.81;0.81	3.77	3.77	0.43336	Rabaptin, GTPase-Rab5 binding (1);	0.000000	0.64402	D	0.000002	T	0.52709	0.1751	N	0.25485	0.75	0.58432	D	0.999998	D;D;D	0.67145	0.99;0.996;0.992	D;D;D	0.77004	0.98;0.986;0.989	T	0.49399	-0.8944	10	0.32370	T	0.25	-12.4471	13.4628	0.61237	0.0:0.0:1.0:0.0	.	99;113;99	Q6P597-2;Q6P597-3;Q6P597	.;.;KLC3_HUMAN	D	99;113	ENSP00000375810:E99D;ENSP00000436019:E113D	ENSP00000375810:E99D	E	+	3	2	KLC3	50541680	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	2.126000	0.42026	2.113000	0.64589	0.455000	0.32223	GAG	-	KLC3	-	pfam_Rabaptin_Rab5-bd_dom		0.716	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLC3	HGNC	protein_coding	OTTHUMT00000289776.1	0	0	0	26	26	9	0.00	0.00	G	NM_145275		45849840	+1	16	6	4	11	tier1	no_errors	ENST00000470402	ensembl	human	known	74_37	missense	80.00	35.29	SNP	1.000	T	16	4
DMD	1756	genome.wustl.edu	37	X	32407760	32407760	+	Missense_Mutation	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chrX:32407760C>T	ENST00000357033.4	-	32	4582	c.4376G>A	c.(4375-4377)cGa>cAa	p.R1459Q	DMD_ENST00000378677.2_Missense_Mutation_p.R1455Q	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1459	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTGGAATAATCGAAACTTCAT	0.348													ENSG00000198947																																					0													104.0	92.0	96.0					X																	32407760		2202	4300	6502	SO:0001583	missense	0			-	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4376G>A	X.37:g.32407760C>T	ENSP00000354923:p.Arg1459Gln		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.R1459Q	ENST00000357033.4	37	c.4376	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140583	0.56936	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.15256	2.44;2.44	5.67	4.81	0.61882	.	0.000000	0.31519	U	0.007510	T	0.14917	0.0360	L	0.35723	1.085	0.80722	D	1	D;P;P;P;P	0.55800	0.973;0.73;0.954;0.954;0.954	B;B;B;B;B	0.43950	0.437;0.181;0.253;0.253;0.253	T	0.04650	-1.0936	10	0.10636	T	0.68	.	13.938	0.64036	0.0:0.9251:0.0:0.0749	.	1451;1459;1455;118;115	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	Q	1451;118;115;1455;1459;1459;1336	ENSP00000367948:R1455Q;ENSP00000354923:R1459Q	ENSP00000354923:R1459Q	R	-	2	0	DMD	32317681	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	5.850000	0.69473	1.157000	0.42530	0.594000	0.82650	CGA	-	DMD	-	pirsf_Dystrophin/utrophin		0.348	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	0	0	0	35	35	63	0.00	0.00	C	NM_004006		32407760	-1	11	29	0	21	tier1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	100.00	58.00	SNP	1.000	T	11	0
ERC2	26059	genome.wustl.edu	37	3	55542496	55542496	+	3'UTR	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:55542496T>C	ENST00000288221.6	-	0	5977				ERC2_ENST00000486496.1_5'UTR	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TGCCCACTGGTAGTTTCCAGG	0.363													ENSG00000187672																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.*2848A>G	3.37:g.55542496T>C			Q2T9F6|Q86TK4	R	SNP	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																			-	ERC2	-	-		0.363	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	0	0	0	34	34	116	0.00	0.00	T	NM_015576		55542496	-1	5	14	27	81	tier1	no_errors	ENST00000486496	ensembl	human	known	74_37	rna	15.62	14.74	SNP	1.000	C	5	27
CENPE	1062	genome.wustl.edu	37	4	104070553	104070553	+	Missense_Mutation	SNP	G	G	C	rs75617708		TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr4:104070553G>C	ENST00000265148.3	-	27	3498	c.3409C>G	c.(3409-3411)Caa>Gaa	p.Q1137E	CENPE_ENST00000380026.3_Missense_Mutation_p.Q1112E	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1137					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGTTTTTCTTGGAGTTGCTGG	0.294													ENSG00000138778																																					0													41.0	40.0	40.0					4																	104070553		2202	4289	6491	SO:0001583	missense	0			-	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.3409C>G	4.37:g.104070553G>C	ENSP00000265148:p.Gln1137Glu		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q1137E	ENST00000265148.3	37	c.3409	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	G	8.538	0.872614	0.17322	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.68624	-0.34;-0.34	4.0	2.16	0.27623	.	.	.	.	.	T	0.59101	0.2169	L	0.60455	1.87	0.33166	D	0.547603	B;P	0.39391	0.041;0.671	B;B	0.38712	0.019;0.28	T	0.61734	-0.7002	9	0.20519	T	0.43	.	10.1788	0.42955	0.0:0.368:0.632:0.0	.	1112;1137	Q02224-3;Q02224	.;CENPE_HUMAN	E	1137;1137;1112	ENSP00000265148:Q1137E;ENSP00000369365:Q1112E	ENSP00000265148:Q1137E	Q	-	1	0	CENPE	104290002	0.156000	0.22821	0.992000	0.48379	0.997000	0.91878	0.751000	0.26348	0.399000	0.25367	0.591000	0.81541	CAA	-	CENPE	-	NULL		0.294	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		0	0	0	49	49	100	0.00	0.00	G			104070553	-1	5	25	10	44	tier1	no_errors	ENST00000265148	ensembl	human	known	74_37	missense	33.33	36.23	SNP	0.998	C	5	10
GCN1L1	10985	genome.wustl.edu	37	12	120569000	120569000	+	Missense_Mutation	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr12:120569000T>C	ENST00000300648.6	-	55	7564	c.7552A>G	c.(7552-7554)Acg>Gcg	p.T2518A		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2518					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGTCCGCCGTGGCACTGCTC	0.592													ENSG00000089154																																					0													74.0	79.0	78.0					12																	120569000		2113	4216	6329	SO:0001583	missense	0			-	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.7552A>G	12.37:g.120569000T>C	ENSP00000300648:p.Thr2518Ala		A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.T2518A	ENST00000300648.6	37	c.7552	CCDS41847.1	12	.	.	.	.	.	.	.	.	.	.	T	5.235	0.228807	0.09916	.	.	ENSG00000089154	ENST00000300648	T	0.32515	1.45	5.04	0.283	0.15696	Armadillo-type fold (1);	0.500789	0.20576	N	0.089633	T	0.13884	0.0336	N	0.24115	0.695	0.42596	D	0.993267	B	0.02656	0.0	B	0.01281	0.0	T	0.21586	-1.0241	10	0.06757	T	0.87	-0.9807	5.8908	0.18911	0.0:0.4311:0.1465:0.4224	.	2518	Q92616	GCN1L_HUMAN	A	2518	ENSP00000300648:T2518A	ENSP00000300648:T2518A	T	-	1	0	GCN1L1	119053383	0.584000	0.26766	0.885000	0.34714	0.854000	0.48673	0.749000	0.26320	0.085000	0.17107	0.528000	0.53228	ACG	-	GCN1L1	-	superfamily_ARM-type_fold		0.592	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	HGNC	protein_coding	OTTHUMT00000403592.1	0	0	0	64	64	96	0.00	0.00	T			120569000	-1	11	23	17	71	tier1	no_errors	ENST00000300648	ensembl	human	known	74_37	missense	39.29	24.47	SNP	0.978	C	11	17
GALK1	2584	genome.wustl.edu	37	17	73759480	73759480	+	Silent	SNP	T	T	G			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr17:73759480T>G	ENST00000588479.1	-	3	970	c.396A>C	c.(394-396)tcA>tcC	p.S132S	GALK1_ENST00000225614.2_Silent_p.S132S|GALK1_ENST00000437911.1_Silent_p.S162S			P51570	GALK1_HUMAN	galactokinase 1	132					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCAGGGGCACTGAGCTGACCA	0.642													ENSG00000108479																																					0													33.0	26.0	28.0					17																	73759480		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.396A>C	17.37:g.73759480T>G			B2RC07|B4E1G6	Silent	SNP	pfam_GalKase_gal-bd,pfam_GHMP_kinase_C_dom,pfam_GHMP_kinase_N_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galactokinase,prints_Galkinase,tigrfam_Galactokinase	p.S162	ENST00000588479.1	37	c.486	CCDS11728.1	17																																																																																			-	GALK1	-	pfam_GHMP_kinase_N_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galactokinase,prints_Galkinase,tigrfam_Galactokinase		0.642	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	GALK1	HGNC	protein_coding	OTTHUMT00000448430.1	0	0	0	78	78	42	0.00	0.00	T			73759480	-1	22	17	57	44	tier1	no_errors	ENST00000437911	ensembl	human	known	74_37	silent	27.85	27.87	SNP	0.994	G	22	57
MORC1	27136	genome.wustl.edu	37	3	108698399	108698399	+	Missense_Mutation	SNP	C	C	G			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:108698399C>G	ENST00000483760.1	-	23	2420	c.2377G>C	c.(2377-2379)Gtc>Ctc	p.V793L	MORC1_ENST00000232603.5_Missense_Mutation_p.V814L					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						GTTTCCTTGACAGGTGTGCTT	0.403													ENSG00000114487																																					0													118.0	121.0	120.0					3																	108698399		2203	4300	6503	SO:0001583	missense	0			-	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2377G>C	3.37:g.108698399C>G	ENSP00000417282:p.Val793Leu			Missense_Mutation	SNP	pfam_Znf_CW,superfamily_HATPase_ATP-bd,pfscan_Znf_CW	p.V814L	ENST00000483760.1	37	c.2440		3	.	.	.	.	.	.	.	.	.	.	C	6.889	0.533432	0.13188	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.08634	3.13;3.07	5.29	2.52	0.30459	.	1.066770	0.07389	N	0.888805	T	0.06142	0.0159	L	0.32530	0.975	0.09310	N	0.999991	P;P	0.37441	0.595;0.595	B;B	0.31016	0.123;0.123	T	0.41233	-0.9520	10	0.18276	T	0.48	-2.9732	7.3776	0.26837	0.0:0.7302:0.0:0.2698	.	793;814	E7ERX1;Q86VD1	.;MORC1_HUMAN	L	814;793	ENSP00000232603:V814L;ENSP00000417282:V793L	ENSP00000232603:V814L	V	-	1	0	MORC1	110181089	0.002000	0.14202	0.227000	0.23927	0.089000	0.18198	-0.258000	0.08733	0.374000	0.24650	0.655000	0.94253	GTC	-	MORC1	-	NULL		0.403	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	0	0	0	39	39	98	0.00	0.00	C			108698399	-1	4	24	16	82	tier1	no_errors	ENST00000232603	ensembl	human	known	74_37	missense	20.00	22.64	SNP	0.331	G	4	16
KLHL21	9903	genome.wustl.edu	37	1	6659372	6659372	+	Missense_Mutation	SNP	C	C	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:6659372C>A	ENST00000377658.4	-	2	1213	c.1162G>T	c.(1162-1164)Gcc>Tcc	p.A388S	KLHL21_ENST00000463043.1_Missense_Mutation_p.A21S|KLHL21_ENST00000467612.1_Missense_Mutation_p.A21S|KLHL21_ENST00000377663.3_Missense_Mutation_p.A388S	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	388					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		CTGTCGGCGGCCACCACGTAC	0.642													ENSG00000162413																																					0													111.0	101.0	105.0					1																	6659372		2203	4300	6503	SO:0001583	missense	0			-	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.1162G>T	1.37:g.6659372C>A	ENSP00000366886:p.Ala388Ser		B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A388S	ENST00000377658.4	37	c.1162	CCDS30575.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959829	0.74016	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	T;T	0.78003	-1.14;-1.14	5.14	5.14	0.70334	Galactose oxidase, beta-propeller (1);	0.050572	0.85682	D	0.000000	T	0.77491	0.4138	L	0.33245	0.995	0.80722	D	1	B;D	0.55385	0.058;0.971	B;P	0.50934	0.056;0.654	T	0.80854	-0.1196	10	0.87932	D	0	.	17.9782	0.89132	0.0:1.0:0.0:0.0	.	388;388	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	S	388	ENSP00000366886:A388S;ENSP00000366891:A388S	ENSP00000366886:A388S	A	-	1	0	KLHL21	6581959	1.000000	0.71417	0.994000	0.49952	0.909000	0.53808	7.818000	0.86416	2.557000	0.86248	0.655000	0.94253	GCC	-	KLHL21	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.642	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL21	HGNC	protein_coding	OTTHUMT00000004188.1	0	0	0	15	15	18	0.00	0.00	C	NM_014851		6659372	-1	8	5	18	20	tier1	no_errors	ENST00000377658	ensembl	human	known	74_37	missense	30.77	20.00	SNP	1.000	A	8	18
TMA16	55319	genome.wustl.edu	37	4	164415938	164415938	+	5'UTR	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr4:164415938C>T	ENST00000358572.5	+	0	326				TMA16_ENST00000508268.1_5'UTR|TMA16_ENST00000513134.1_5'UTR|TMA16_ENST00000511562.1_3'UTR|TMA16_ENST00000513272.1_5'UTR	NM_018352.2	NP_060822.2	Q96EY4	TMA16_HUMAN	translation machinery associated 16 homolog (S. cerevisiae)							nucleus (GO:0005634)											TGCTCCGTGGCCACGAGGACG	0.662													ENSG00000198498																																					0													54.0	64.0	60.0					4																	164415938		2095	4217	6312	SO:0001623	5_prime_UTR_variant	0			-		CCDS43278.1	4q32.3	2012-03-02	2012-03-02	2012-03-02	ENSG00000198498	ENSG00000198498			25638	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 43"""	C4orf43		12477932	Standard	NM_018352		Approved	FLJ11184	uc003iqq.4	Q96EY4	OTTHUMG00000161528	ENST00000358572.5:c.-16C>T	4.37:g.164415938C>T			Q0P6E4|Q0P6J1|Q9NUR7	R	SNP	-	NULL	ENST00000358572.5	37	NULL	CCDS43278.1	4																																																																																			-	TMA16	-	-		0.662	TMA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMA16	HGNC	protein_coding	OTTHUMT00000365208.1	0	0	0	119	119	53	0.00	0.00	C	NM_018352		164415938	+1	7	7	49	29	tier1	no_errors	ENST00000511562	ensembl	human	known	74_37	rna	12.50	19.44	SNP	0.002	T	7	49
SAMM50	25813	genome.wustl.edu	37	22	44395249	44395249	+	IGR	SNP	G	G	T	rs372081118		TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr22:44395249G>T	ENST00000350028.4	+	0	1717				PARVB_ENST00000406477.3_Missense_Mutation_p.R10I	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component						cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)				endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				GATCACCAAAGAGGAGAGAAA	0.363													ENSG00000188677																																					0													66.0	62.0	63.0					22																	44395249		1829	4092	5921	SO:0001628	intergenic_variant	0			-	AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557		22.37:g.44395249G>T			Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R10I	ENST00000350028.4	37	c.29	CCDS14055.1	22	.	.	.	.	.	.	.	.	.	.	G	11.10	1.539353	0.27475	.	.	ENSG00000188677	ENST00000406477	T	0.36340	1.26	2.15	-2.79	0.05841	.	.	.	.	.	T	0.19565	0.0470	N	0.22421	0.69	0.09310	N	1	B	0.27068	0.167	B	0.24848	0.056	T	0.22347	-1.0219	9	0.87932	D	0	.	3.3491	0.07146	0.4401:0.214:0.3459:0.0	.	10	Q9HBI1-2	.	I	10	ENSP00000384515:R10I	ENSP00000384515:R10I	R	+	2	0	PARVB	42726582	0.043000	0.20138	0.000000	0.03702	0.001000	0.01503	0.510000	0.22723	-0.622000	0.05626	-0.903000	0.02851	AGA	-	PARVB	-	NULL		0.363	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARVB	HGNC	protein_coding	OTTHUMT00000318898.2	0	0	0	77	77	149	0.00	0.00	G	NM_015380		44395249	+1	8	40	39	114	tier1	no_errors	ENST00000406477	ensembl	human	known	74_37	missense	17.02	25.97	SNP	0.000	T	8	39
PCDHB8	56128	genome.wustl.edu	37	5	140559053	140559053	+	Missense_Mutation	SNP	G	G	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr5:140559053G>C	ENST00000239444.2	+	1	1683	c.1438G>C	c.(1438-1440)Gac>Cac	p.D480H	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	480	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CACAGACAGAGACTCGGGCAC	0.657													ENSG00000120322																																					0													82.0	128.0	112.0					5																	140559053		2202	4295	6497	SO:0001583	missense	0			-	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1438G>C	5.37:g.140559053G>C	ENSP00000239444:p.Asp480His		B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D480H	ENST00000239444.2	37	c.1438	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	G	19.78	3.891035	0.72524	.	.	ENSG00000120322	ENST00000239444	T	0.74632	-0.86	4.22	4.22	0.49857	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.92358	0.7575	H	0.99555	4.625	0.51012	D	0.999903	D	0.89917	1.0	D	0.97110	1.0	D	0.95988	0.8983	9	0.87932	D	0	.	16.2834	0.82708	0.0:0.0:1.0:0.0	.	480	Q9UN66	PCDB8_HUMAN	H	480	ENSP00000239444:D480H	ENSP00000239444:D480H	D	+	1	0	PCDHB8	140539237	1.000000	0.71417	0.406000	0.26421	0.848000	0.48234	9.393000	0.97256	1.915000	0.55452	0.298000	0.19748	GAC	-	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.657	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	0	0	0	651	651	13	0.00	0.00	G	NM_019120		140559053	+1	54	3	423	15	tier1	no_errors	ENST00000239444	ensembl	human	known	74_37	missense	11.30	16.67	SNP	1.000	C	54	423
PQLC2L	152078	genome.wustl.edu	37	3	157318113	157318113	+	3'UTR	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:157318113C>T	ENST00000449199.2	+	0	575				C3orf55_ENST00000426338.2_Silent_p.Y115Y|C3orf55_ENST00000461040.1_Intron	NM_001130002.2	NP_001123474.1	A1A4F0	CC055_HUMAN												breast(1)|lung(1)	2			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)			CTGGGTATTACAGTTGTTTAT	0.343													ENSG00000174899																																					0													95.0	84.0	87.0					3																	157318113		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			-																												ENST00000449199.2:c.*26C>T	3.37:g.157318113C>T			C9JP04|C9JXB5|Q8N6Q6	Silent	SNP	NULL	p.Y115	ENST00000449199.2	37	c.345	CCDS46943.1	3																																																																																			-	C3orf55	-	NULL		0.343	C3orf55-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf55	HGNC	protein_coding	OTTHUMT00000352018.1	0	0	0	64	64	138	0.00	0.00	C			157318113	+1	29	48	29	101	tier1	no_errors	ENST00000426338	ensembl	human	known	74_37	silent	50.00	32.21	SNP	0.000	T	29	29
LMF2	91289	genome.wustl.edu	37	22	50942780	50942780	+	Silent	SNP	A	A	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr22:50942780A>C	ENST00000474879.2	-	12	1722	c.1707T>G	c.(1705-1707)ccT>ccG	p.P569P	LMF2_ENST00000216080.5_Silent_p.P544P|LMF2_ENST00000505981.1_5'Flank|LMF2_ENST00000380796.3_Silent_p.P456P	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	569						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCTGCTCCCCAGGCTGGGAGA	0.687													ENSG00000100258																																					0													56.0	50.0	52.0					22																	50942780		2201	4300	6501	SO:0001819	synonymous_variant	0			-	BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.1707T>G	22.37:g.50942780A>C			A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Silent	SNP	pfam_LMF	p.P569	ENST00000474879.2	37	c.1707	CCDS14093.2	22	.	.	.	.	.	.	.	.	.	.	A	3.273	-0.148792	0.06627	.	.	ENSG00000100258	ENST00000487499	.	.	.	5.87	-1.7	0.08159	.	.	.	.	.	T	0.49949	0.1587	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39292	-0.9621	4	.	.	.	-15.9744	5.539	0.17028	0.4544:0.2532:0.2924:0.0	.	.	.	.	G	576	.	.	W	-	1	0	LMF2	49289646	0.359000	0.24955	0.916000	0.36221	0.010000	0.07245	0.204000	0.17335	-0.409000	0.07553	-0.242000	0.12053	TGG	-	LMF2	-	pfam_LMF		0.687	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMF2	HGNC	protein_coding	OTTHUMT00000316833.2	0	0	0	165	165	18	0.00	0.00	A	NM_033200		50942780	-1	45	10	64	15	tier1	no_errors	ENST00000474879	ensembl	human	known	74_37	silent	40.54	40.00	SNP	0.927	C	45	64
PTP4A1	7803	genome.wustl.edu	37	6	64286413	64286413	+	5'UTR	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr6:64286413C>T	ENST00000370651.3	+	0	781				PTP4A1_ENST00000578299.1_Missense_Mutation_p.H38Y|PTP4A1_ENST00000473334.1_3'UTR|PTP4A1_ENST00000370650.2_5'UTR	NM_003463.3	NP_003454.1	Q93096	TP4A1_HUMAN	protein tyrosine phosphatase type IVA, member 1						cell cycle (GO:0007049)|multicellular organismal development (GO:0007275)|positive regulation of cell migration (GO:0030335)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			large_intestine(3)|lung(4)|skin(1)	8	all_cancers(3;0.071)|all_epithelial(2;0.0146)|Lung NSC(77;0.175)		Epithelial(2;0.0365)|LUSC - Lung squamous cell carcinoma(74;0.0644)|all cancers(2;0.112)|Lung(124;0.13)			CCAGGCACAGCACGACCTCTA	0.438													ENSG00000112245																									Pancreas(91;1019 1502 28028 38110 51645)												0																																										SO:0001623	5_prime_UTR_variant	0			-	U48296	CCDS4965.1	6q12	2011-06-09			ENSG00000112245	ENSG00000112245		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9634	protein-coding gene	gene with protein product		601585				9642300	Standard	NM_003463		Approved	PTPCAAX1, PRL-1	uc003pel.3	Q93096	OTTHUMG00000014949	ENST00000370651.3:c.-373C>T	6.37:g.64286413C>T			B2R6C8|O00648|Q49A54	Missense_Mutation	SNP	NULL	p.H38Y	ENST00000370651.3	37	c.112	CCDS4965.1	6																																																																																			-	PTP4A1	-	NULL		0.438	PTP4A1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A1	HGNC	protein_coding	OTTHUMT00000041083.2	0	0	0	49	49	35	0.00	0.00	C			64286413	+1	11	26	17	29	tier1	no_errors	ENST00000578299	ensembl	human	putative	74_37	missense	39.29	47.27	SNP	1.000	T	11	17
SMARCA2	6595	genome.wustl.edu	37	9	2104085	2104085	+	Missense_Mutation	SNP	C	C	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr9:2104085C>A	ENST00000382203.1	+	23	3417	c.3208C>A	c.(3208-3210)Ctg>Atg	p.L1070M	SMARCA2_ENST00000349721.2_Missense_Mutation_p.L1070M|SMARCA2_ENST00000357248.2_Missense_Mutation_p.L1070M|SMARCA2_ENST00000382194.1_Missense_Mutation_p.L1070M			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1070	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TCACCGAGTGCTGCTTTTCTG	0.458													ENSG00000080503																																					0													233.0	210.0	218.0					9																	2104085		2203	4300	6503	SO:0001583	missense	0			-	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3208C>A	9.37:g.2104085C>A	ENSP00000371638:p.Leu1070Met		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_D-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_D-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.L1070M	ENST00000382203.1	37	c.3208	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460818	0.84317	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	5.69	3.83	0.44106	Helicase, C-terminal (1);	0.000000	0.64402	D	0.000012	D	0.93877	0.8041	H	0.98005	4.125	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.998	D;D;D	0.85130	0.927;0.997;0.994	D	0.94828	0.7993	10	0.72032	D	0.01	-22.1844	12.6625	0.56822	0.0:0.8789:0.0:0.1211	.	671;1070;1070	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	M	1070	ENSP00000265773:L1070M;ENSP00000349788:L1070M;ENSP00000371638:L1070M;ENSP00000371629:L1070M	ENSP00000265773:L1070M	L	+	1	2	SMARCA2	2094085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.984000	0.56923	2.683000	0.91414	0.563000	0.77884	CTG	-	SMARCA2	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.458	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	0	0	0	82	82	91	0.00	0.00	C	NM_003070		2104085	+1	42	86	23	31	tier1	no_errors	ENST00000349721	ensembl	human	known	74_37	missense	64.62	73.50	SNP	1.000	A	42	23
COL4A4	1286	genome.wustl.edu	37	2	227872807	227872807	+	Missense_Mutation	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr2:227872807T>C	ENST00000396625.3	-	47	4943	c.4736A>G	c.(4735-4737)cAc>cGc	p.H1579R	COL4A4_ENST00000329662.7_Missense_Mutation_p.H1576R	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1579	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GTCCTGGCTGTGCACCGCCAC	0.652													ENSG00000081052																																					0													27.0	32.0	30.0					2																	227872807		1981	4154	6135	SO:0001583	missense	0			-		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4736A>G	2.37:g.227872807T>C	ENSP00000379866:p.His1579Arg		A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.H1579R	ENST00000396625.3	37	c.4736	CCDS42828.1	2	.	.	.	.	.	.	.	.	.	.	T	21.5	4.162281	0.78226	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.94497	-3.44;-3.44	5.91	5.91	0.95273	C-type lectin fold (1);	.	.	.	.	D	0.98289	0.9433	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99402	1.0928	9	0.62326	D	0.03	.	16.3483	0.83171	0.0:0.0:0.0:1.0	.	1579	P53420	CO4A4_HUMAN	R	1579;1576	ENSP00000379866:H1579R;ENSP00000328553:H1576R	ENSP00000328553:H1576R	H	-	2	0	COL4A4	227581051	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	8.035000	0.88872	2.254000	0.74563	0.533000	0.62120	CAC	-	COL4A4	-	pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC		0.652	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	0	0	0	84	84	22	0.00	0.00	T	NM_000092		227872807	-1	6	4	30	12	tier1	no_errors	ENST00000396625	ensembl	human	known	74_37	missense	16.67	25.00	SNP	1.000	C	6	30
PIPSL	266971	genome.wustl.edu	37	10	95719666	95719666	+	RNA	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr10:95719666G>A	ENST00000480546.1	-	0	1631					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ACTCACTGTTGTCCACACTTG	0.507													ENSG00000180764																																					0																																												0			-	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95719666G>A			Q6NUK8	R	SNP	-	NULL	ENST00000480546.1	37	NULL		10																																																																																			-	PIPSL	-	-		0.507	PIPSL-002	PUTATIVE	basic	processed_transcript	PIPSL	HGNC	pseudogene	OTTHUMT00000351483.1	0	0	0	106	106	146	0.00	0.00	G	NR_002319		95719666	-1	18	27	52	106	tier1	no_errors	ENST00000480546	ensembl	human	putative	74_37	rna	25.35	20.30	SNP	1.000	A	18	52
MRGPRG-AS1	283303	genome.wustl.edu	37	11	3243183	3243183	+	RNA	SNP	C	C	G			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr11:3243183C>G	ENST00000420873.2	+	0	645				MRGPRG-AS1_ENST00000541883.1_RNA|MRGPRG-AS1_ENST00000434798.1_RNA			Q2M3A8	MRAS1_HUMAN	MRGPRG antisense RNA 1																		CTCGAGGTCACCGTCCAGGCC	0.617													ENSG00000236301																																					0																																												0			-	AK097749		11p15.4	2012-10-12	2012-08-15	2012-08-10	ENSG00000236301	ENSG00000236301		"""Long non-coding RNAs"""	26691	non-coding RNA	RNA, long non-coding			"""chromosome 11 open reading frame 36"", ""MRGPRG antisense RNA 1 (non-protein coding)"""	C11orf36			Standard	NR_027138		Approved	FLJ36102, HSD-40	uc001lxo.2	Q2M3A8	OTTHUMG00000011707		11.37:g.3243183C>G			Q6TF48|Q8N7R8|Q8N9X7	R	SNP	-	NULL	ENST00000420873.2	37	NULL		11	.	.	.	.	.	.	.	.	.	.	c	6.860	0.527923	0.13127	.	.	ENSG00000236301	ENST00000434798;ENST00000420873;ENST00000541883	.	.	.	0.822	0.822	0.18806	.	.	.	.	.	T	0.20740	0.0499	.	.	.	0.09310	N	1	P	0.34934	0.476	B	0.23275	0.045	T	0.17623	-1.0363	7	0.87932	D	0	.	4.9441	0.13980	0.0:1.0:0.0:0.0	.	81	Q2M3A8	CK036_HUMAN	A	81	.	ENSP00000436553:P81A	P	+	1	0	C11orf36	3199759	0.001000	0.12720	0.002000	0.10522	0.009000	0.06853	0.675000	0.25232	0.713000	0.32060	0.462000	0.41574	CCG	-	MRGPRG-AS1	-	-		0.617	MRGPRG-AS1-002	KNOWN	alternative_5_UTR|basic	antisense	MRGPRG-AS1	HGNC	antisense	OTTHUMT00000032345.2	0	0	0	85	85	60	0.00	0.00	C	NR_027138		3243183	+1	26	35	42	42	tier1	no_errors	ENST00000420873	ensembl	human	known	74_37	rna	38.24	45.45	SNP	0.001	G	26	42
RABGGTB	5876	genome.wustl.edu	37	1	76255463	76255463	+	Intron	SNP	G	G	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:76255463G>C	ENST00000319942.3	+	4	380				RABGGTB_ENST00000370826.3_Intron|SNORD45B_ENST00000364617.1_RNA|RABGGTB_ENST00000535300.1_Intron|RABGGTB_ENST00000496055.1_3'UTR|SNORD45A_ENST00000384512.1_RNA|SNORD45C_ENST00000383893.1_RNA	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						TTAAAGATTTGAGTTTTCTTG	0.308													ENSG00000137955																																					0																																										SO:0001627	intron_variant	0			-	U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.310-174G>C	1.37:g.76255463G>C			Q92697	R	SNP	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																			-	RABGGTB	-	-		0.308	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1	0	0	0	14	14	84	0.00	0.00	G	NM_004582		76255463	+1	5	15	13	94	tier1	no_errors	ENST00000461653	ensembl	human	known	74_37	rna	27.78	13.64	SNP	0.001	C	5	13
CDCA7L	55536	genome.wustl.edu	37	7	21940719	21940719	+	3'UTR	SNP	C	C	T	rs72658836		TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr7:21940719C>T	ENST00000406877.3	-	0	2865				DNAH11_ENST00000328843.6_Silent_p.P4473P|CDCA7L_ENST00000356195.5_3'UTR|DNAH11_ENST00000409508.3_Silent_p.P4466P	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like						positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						AAGCCACCCCCGTGGACAGAC	0.562													ENSG00000105877																																					0													84.0	89.0	87.0					7																	21940719		1901	4117	6018	SO:0001624	3_prime_UTR_variant	0			-		CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.*1221G>A	7.37:g.21940719C>T			A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P4473	ENST00000406877.3	37	c.13419	CCDS5374.1	7																																																																																			rs72658836	DH11	-	pfam_Dynein_heavy_dom		0.562	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH11	HGNC	protein_coding	OTTHUMT00000250218.4	0	0	0	52	52	53	0.00	0.00	C	NM_018719		21940719	+1	15	23	20	55	tier1	no_errors	ENST00000328843	ensembl	human	known	74_37	silent	42.86	29.49	SNP	0.017	T	15	20
CADPS	8618	genome.wustl.edu	37	3	62578348	62578348	+	Silent	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:62578348T>C	ENST00000383710.4	-	7	1750	c.1401A>G	c.(1399-1401)acA>acG	p.T467T	CADPS_ENST00000283269.9_Silent_p.T467T|CADPS_ENST00000357948.3_Silent_p.T467T	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	467	C2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCAGGACGCCTGTGCTCTCTG	0.562													ENSG00000163618																																					0													155.0	136.0	142.0					3																	62578348		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1401A>G	3.37:g.62578348T>C			A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T467	ENST00000383710.4	37	c.1401	CCDS46858.1	3																																																																																			-	CADPS	-	superfamily_C2_dom		0.562	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	0	0	0	53	53	100	0.00	0.00	T	NM_003716, NM_183393, NM_183394		62578348	-1	9	33	42	111	tier1	no_errors	ENST00000383710	ensembl	human	known	74_37	silent	17.65	22.92	SNP	0.729	C	9	42
PGM5	5239	genome.wustl.edu	37	9	70999430	70999430	+	Missense_Mutation	SNP	G	G	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr9:70999430G>C	ENST00000396396.1	+	3	770	c.541G>C	c.(541-543)Gac>Cac	p.D181H	PGM5_ENST00000604870.2_3'UTR|PGM5_ENST00000396392.1_Missense_Mutation_p.D181H	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	181					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						ACAAGAATTTGACCTAGAAAA	0.388													ENSG00000154330																																					0													77.0	73.0	75.0					9																	70999430		2203	4299	6502	SO:0001583	missense	0			-	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.541G>C	9.37:g.70999430G>C	ENSP00000379678:p.Asp181His		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.D181H	ENST00000396396.1	37	c.541	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	.	16.95	3.263318	0.59431	.	.	ENSG00000154330	ENST00000396396;ENST00000396392	T;T	0.65364	0.43;-0.15	4.46	3.55	0.40652	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.050859	0.85682	U	0.000000	T	0.64605	0.2613	L	0.29908	0.895	0.80722	D	1	D	0.63046	0.992	P	0.58873	0.847	T	0.68387	-0.5422	10	0.87932	D	0	.	13.5718	0.61851	0.0:0.158:0.842:0.0	.	181	Q15124	PGM5_HUMAN	H	181	ENSP00000379678:D181H;ENSP00000379674:D181H	ENSP00000379674:D181H	D	+	1	0	PGM5	70189250	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.847000	0.86896	0.963000	0.38082	0.573000	0.79308	GAC	-	PGM5	-	superfamily_A-D-PHexomutase_a/b/a-I/II/III		0.388	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	0	0	0	126	126	67	0.00	0.00	G	NM_021965		70999430	+1	10	13	112	86	tier1	no_errors	ENST00000396396	ensembl	human	known	74_37	missense	8.20	13.13	SNP	1.000	C	10	112
OR4C16	219428	genome.wustl.edu	37	11	55340374	55340374	+	Silent	SNP	A	A	C	rs371509327		TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr11:55340374A>C	ENST00000314634.3	+	1	771	c.771A>C	c.(769-771)acA>acC	p.T257T		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TTATGTACACATGCCTTGCAA	0.403													ENSG00000181935																																					0								A		1,4401	2.1+/-5.4	0,1,2200	165.0	140.0	148.0		771	-3.4	0.8	11		148	0,8592		0,0,4296	no	coding-synonymous	OR4C16	NM_001004701.2		0,1,6496	CC,CA,AA		0.0,0.0227,0.0077		257/311	55340374	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	0			-	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.771A>C	11.37:g.55340374A>C			Q6IEV8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T257	ENST00000314634.3	37	c.771	CCDS31502.1	11																																																																																			-	OR4C16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.403	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	0	0	0	100	100	112	0.00	0.00	A	NM_001004701		55340374	+1	72	198	46	71	tier1	no_errors	ENST00000314634	ensembl	human	known	74_37	silent	61.02	73.61	SNP	0.002	C	72	46
FRS2	10818	genome.wustl.edu	37	12	69964267	69964267	+	Missense_Mutation	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr12:69964267G>A	ENST00000550389.1	+	4	469	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	FRS2_ENST00000549921.1_Missense_Mutation_p.E75K|FRS2_ENST00000299293.2_Missense_Mutation_p.E75K|FRS2_ENST00000397997.2_Missense_Mutation_p.E75K	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	75	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			CTTTTCTTTTGAAAGTGGTCG	0.383													ENSG00000166225																																					0													105.0	95.0	98.0					12																	69964267		1920	4119	6039	SO:0001583	missense	0			-	AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.223G>A	12.37:g.69964267G>A	ENSP00000447241:p.Glu75Lys		B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.E75K	ENST00000550389.1	37	c.223	CCDS41809.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.039405	0.97226	.	.	ENSG00000166225	ENST00000299293;ENST00000549921;ENST00000550389;ENST00000550937;ENST00000397997;ENST00000551325	D;D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65;-2.65	5.65	5.65	0.86999	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.85682	D	0.000000	D	0.96558	0.8877	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96713	0.9527	9	.	.	.	-21.0459	19.7056	0.96070	0.0:0.0:1.0:0.0	.	75	Q8WU20	FRS2_HUMAN	K	75	ENSP00000299293:E75K;ENSP00000450048:E75K;ENSP00000447241:E75K;ENSP00000447804:E75K;ENSP00000381083:E75K;ENSP00000449432:E75K	.	E	+	1	0	FRS2	68250534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.808000	0.99193	2.659000	0.90383	0.462000	0.41574	GAA	-	FRS2	-	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1		0.383	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS2	HGNC	protein_coding	OTTHUMT00000403760.1	0	0	0	63	63	109	0.00	0.00	G	NM_006654		69964267	+1	31	96	280	566	tier1	no_errors	ENST00000299293	ensembl	human	known	74_37	missense	9.97	14.50	SNP	1.000	A	31	280
TRIML2	205860	genome.wustl.edu	37	4	189026407	189026407	+	5'UTR	SNP	C	C	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr4:189026407C>A	ENST00000512729.1	-	0	340				TRIML2_ENST00000502707.1_5'Flank|TRIML2_ENST00000326754.3_5'Flank|TRIML2_ENST00000536972.1_Missense_Mutation_p.S39I	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2						protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GAAGCATTTGCTGCAGAGTGT	0.478													ENSG00000179046																																					0													207.0	182.0	190.0					4																	189026407		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.-35G>T	4.37:g.189026407C>A			B7Z6J6	Missense_Mutation	SNP	pfam_Znf_B-box,pfscan_Znf_B-box	p.S39I	ENST00000512729.1	37	c.116	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	C	11.80	1.748153	0.30955	.	.	ENSG00000179046	ENST00000536972	T	0.44083	0.93	5.05	-8.16	0.01061	.	.	.	.	.	T	0.15262	0.0368	.	.	.	0.09310	N	1	P	0.40515	0.719	B	0.28553	0.091	T	0.13737	-1.0498	8	0.21014	T	0.42	.	5.3606	0.16085	0.4082:0.1747:0.0:0.4171	.	39	B7Z6J6	.	I	39	ENSP00000441236:S39I	ENSP00000441236:S39I	S	-	2	0	TRIML2	189263401	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.293000	0.08320	-1.871000	0.01138	0.655000	0.94253	AGC	-	TRIML2	-	pfam_Znf_B-box,pfscan_Znf_B-box		0.478	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	0	0	0	67	67	85	0.00	0.00	C	NM_173553		189026407	-1	7	32	22	30	tier1	no_errors	ENST00000536972	ensembl	human	known	74_37	missense	24.14	50.79	SNP	0.000	A	7	22
ELOVL7	79993	genome.wustl.edu	37	5	60062402	60062402	+	Splice_Site	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr5:60062402G>A	ENST00000508821.1	-	6	706	c.392C>T	c.(391-393)aCg>aTg	p.T131M	ELOVL7_ENST00000505959.1_Splice_Site_p.T118M|ELOVL7_ENST00000425382.1_Splice_Site_p.T131M|ELOVL7_ENST00000438340.1_Splice_Site_p.T131M	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	131					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				TATACTCACCGTATCTAATAG	0.328													ENSG00000164181																																					0													95.0	94.0	94.0					5																	60062402		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.393+1C>T	5.37:g.60062402G>A			Q589T3|Q9H5D0|Q9NT66	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.T131M	ENST00000508821.1	37	c.392	CCDS34164.1	5	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177419	0.57692	.	.	ENSG00000164181	ENST00000508821;ENST00000438340;ENST00000425382;ENST00000505959;ENST00000507047;ENST00000511799	T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1	5.44	4.56	0.56223	.	0.049642	0.85682	D	0.000000	D	0.86314	0.5903	H	0.99573	4.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92228	0.5790	10	0.87932	D	0	-9.7281	14.8024	0.69926	0.0:0.0:0.855:0.145	.	118;131	D6RHD0;A1L3X0	.;ELOV7_HUMAN	M	131;131;131;118;131;131	ENSP00000424123:T131M;ENSP00000411255:T131M;ENSP00000402634:T131M;ENSP00000421043:T118M;ENSP00000426400:T131M;ENSP00000424081:T131M	ENSP00000402634:T131M	T	-	2	0	ELOVL7	60098159	1.000000	0.71417	1.000000	0.80357	0.252000	0.25951	8.758000	0.91663	1.512000	0.48834	-0.188000	0.12872	ACG	-	ELOVL7	-	pfam_GNS1_SUR4		0.328	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL7	HGNC	protein_coding	OTTHUMT00000368195.1	0	0	0	72	72	129	0.00	0.00	G		Missense_Mutation	60062402	-1	8	12	34	99	tier1	no_errors	ENST00000425382	ensembl	human	known	74_37	missense	19.05	10.81	SNP	1.000	A	8	34
ZFP69	339559	genome.wustl.edu	37	1	40960772	40960772	+	Missense_Mutation	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:40960772G>A	ENST00000372706.1	+	6	1628	c.622G>A	c.(622-624)Gat>Aat	p.D208N	RP11-656D10.3_ENST00000450713.1_RNA|ZFP69_ENST00000372705.3_Missense_Mutation_p.D208N			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TTGTATGAGAGATGTGAGACA	0.363													ENSG00000187815																																					0													81.0	80.0	80.0					1																	40960772		2203	4300	6503	SO:0001583	missense	0			-	AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.622G>A	1.37:g.40960772G>A	ENSP00000361791:p.Asp208Asn		Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D208N	ENST00000372706.1	37	c.622	CCDS30686.1	1	.	.	.	.	.	.	.	.	.	.	G	2.760	-0.258128	0.05791	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.04502	3.61;3.61	4.23	2.37	0.29283	.	0.517066	0.16268	N	0.221939	T	0.02807	0.0084	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44862	-0.9300	10	0.27785	T	0.31	-0.2144	6.204	0.20591	0.3044:0.0:0.6956:0.0	.	208	Q49AA0	ZN642_HUMAN	N	208	ENSP00000361791:D208N;ENSP00000361790:D208N	ENSP00000361790:D208N	D	+	1	0	ZNF642	40733359	0.000000	0.05858	0.068000	0.19968	0.845000	0.48019	0.159000	0.16442	0.747000	0.32809	0.563000	0.77884	GAT	-	ZFP69	-	NULL		0.363	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZFP69	HGNC	protein_coding	OTTHUMT00000019082.1	0	0	0	71	71	100	0.00	0.00	G	NM_198494		40960772	+1	14	63	29	72	tier1	no_errors	ENST00000372705	ensembl	human	known	74_37	missense	32.56	46.67	SNP	0.006	A	14	29
GRAMD2	196996	genome.wustl.edu	37	15	72459382	72459382	+	Missense_Mutation	SNP	G	G	A	rs141536149	byFrequency	TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr15:72459382G>A	ENST00000309731.7	-	6	437	c.424C>T	c.(424-426)Cgg>Tgg	p.R142W	GRAMD2_ENST00000564184.1_5'Flank	NM_001012642.2	NP_001012660.1	Q8IUY3	GRAM2_HUMAN	GRAM domain containing 2	142						integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	13						GGAAGGAGCCGTGCCATCTTG	0.572													ENSG00000175318																																					0								G	TRP/ARG	1,4397	2.1+/-5.4	0,1,2198	201.0	142.0	162.0		424	3.5	0.8	15	dbSNP_134	162	2,8592	2.2+/-6.3	0,2,4295	yes	missense	GRAMD2	NM_001012642.2	101	0,3,6493	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	142/355	72459382	3,12989	2199	4297	6496	SO:0001583	missense	0			-	AK002016	CCDS32283.1	15q23	2006-11-29	2005-11-03	2005-11-03					27287	protein-coding gene	gene with protein product						12477932	Standard	NM_001012642		Approved		uc002atq.3	Q8IUY3		ENST00000309731.7:c.424C>T	15.37:g.72459382G>A	ENSP00000311657:p.Arg142Trp		B3KT68	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.R142W	ENST00000309731.7	37	c.424	CCDS32283.1	15	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924437	0.73213	2.27E-4	2.33E-4	ENSG00000175318	ENST00000309731	T	0.35048	1.33	5.62	3.55	0.40652	.	0.054690	0.85682	D	0.000000	T	0.41581	0.1165	N	0.22421	0.69	0.43617	D	0.995997	D	0.89917	1.0	D	0.78314	0.991	T	0.19745	-1.0296	10	0.37606	T	0.19	.	10.484	0.44711	0.0769:0.0:0.7817:0.1414	.	142	Q8IUY3	GRAM2_HUMAN	W	142	ENSP00000311657:R142W	ENSP00000311657:R142W	R	-	1	2	GRAMD2	70246436	1.000000	0.71417	0.839000	0.33178	0.995000	0.86356	3.951000	0.56684	1.376000	0.46267	0.561000	0.74099	CGG	rs141536149	GRAMD2	-	NULL		0.572	GRAMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD2	HGNC	protein_coding	OTTHUMT00000420040.1	0	0	0	93	93	92	0.00	0.00	G	NM_001012642		72459382	-1	13	35	37	45	tier1	no_errors	ENST00000309731	ensembl	human	known	74_37	missense	26.00	43.75	SNP	0.731	A	13	37
GLIPR1L1	256710	genome.wustl.edu	37	12	75728540	75728540	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr12:75728540G>A	ENST00000378695.4	+	1	122	c.32G>A	c.(31-33)tGg>tAg	p.W11*	CAPS2_ENST00000442339.2_Intron|GLIPR1L1_ENST00000312442.2_Nonsense_Mutation_p.W11*			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	11					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						AGTTGTTTATGGATCTTGGGT	0.493											OREG0021998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000173401																																					0													141.0	137.0	139.0					12																	75728540		2203	4300	6503	SO:0001587	stop_gained	0			-	BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.32G>A	12.37:g.75728540G>A	ENSP00000367967:p.Trp11*	1162	Q96L06	Nonsense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.W11*	ENST00000378695.4	37	c.32		12	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031109	0.93575	.	.	ENSG00000173401	ENST00000378695;ENST00000312442	.	.	.	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	14.7828	0.69779	0.0:0.0:1.0:0.0	.	.	.	.	X	11	.	ENSP00000310770:W11X	W	+	2	0	GLIPR1L1	74014807	0.999000	0.42202	0.612000	0.29024	0.027000	0.11550	2.075000	0.41538	2.225000	0.72522	0.563000	0.77884	TGG	-	GLIPR1L1	-	NULL		0.493	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	GLIPR1L1	HGNC	protein_coding	OTTHUMT00000405714.1	0	0	0	79	79	139	0.00	0.00	G	NM_152779		75728540	+1	39	78	136	301	tier1	no_errors	ENST00000378695	ensembl	human	known	74_37	nonsense	22.29	20.58	SNP	0.980	A	39	136
GBP1	2633	genome.wustl.edu	37	1	89520439	89520439	+	Missense_Mutation	SNP	G	G	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:89520439G>T	ENST00000370473.4	-	10	1810	c.1591C>A	c.(1591-1593)Ctg>Atg	p.L531M	GBP1_ENST00000484970.1_5'UTR	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	531					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		TTCTCAGTCAGTTGTTTCAAG	0.448													ENSG00000117228																																					0													325.0	330.0	328.0					1																	89520439		2203	4300	6503	SO:0001583	missense	0			-	BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1591C>A	1.37:g.89520439G>T	ENSP00000359504:p.Leu531Met		D3DT26|Q5T8M1	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.L531M	ENST00000370473.4	37	c.1591	CCDS718.1	1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.586815	0.28268	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.04502	3.61	4.67	-7.83	0.01201	Guanylate-binding protein, C-terminal (3);	0.522858	0.18397	N	0.142474	T	0.03305	0.0096	M	0.79343	2.45	0.09310	N	0.999998	P	0.46987	0.888	P	0.51193	0.662	T	0.00915	-1.1516	10	0.48119	T	0.1	.	6.1669	0.20396	0.2834:0.0:0.4816:0.235	.	531	P32455	GBP1_HUMAN	M	531;494	ENSP00000359504:L531M	ENSP00000359504:L531M	L	-	1	2	GBP1	89293027	0.000000	0.05858	0.013000	0.15412	0.416000	0.31233	-1.336000	0.02660	-1.141000	0.02873	0.491000	0.48974	CTG	-	GBP1	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C		0.448	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3	0	0	0	65	65	112	0.00	0.00	G	NM_002053		89520439	-1	5	12	34	85	tier1	no_errors	ENST00000370473	ensembl	human	known	74_37	missense	12.82	12.37	SNP	0.003	T	5	34
RNF216	54476	genome.wustl.edu	37	7	5780626	5780626	+	Missense_Mutation	SNP	A	A	G			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr7:5780626A>G	ENST00000425013.2	-	4	1075	c.851T>C	c.(850-852)gTt>gCt	p.V284A	RNF216_ENST00000389902.3_Missense_Mutation_p.V341A	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	284					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TAGTAGTTCAACGAGCTCTTG	0.363													ENSG00000011275																																					0													55.0	58.0	57.0					7																	5780626		2203	4300	6503	SO:0001583	missense	0			-	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.851T>C	7.37:g.5780626A>G	ENSP00000404602:p.Val284Ala		Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	smart_Znf_C6HC	p.V341A	ENST00000425013.2	37	c.1022	CCDS34595.1	7	.	.	.	.	.	.	.	.	.	.	A	11.91	1.780780	0.31502	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.52526	0.66;0.73	5.97	5.97	0.96955	.	0.648102	0.15048	N	0.283463	T	0.39332	0.1074	L	0.29908	0.895	0.25307	N	0.98923	B;B	0.23650	0.043;0.089	B;B	0.29862	0.049;0.108	T	0.36890	-0.9729	10	0.62326	D	0.03	-2.6838	9.8971	0.41324	0.9173:0.0:0.0827:0.0	.	284;341	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	A	284;341;96	ENSP00000404602:V284A;ENSP00000374552:V341A	ENSP00000374550:V284A	V	-	2	0	RNF216	5747152	0.956000	0.32656	0.938000	0.37757	0.277000	0.26821	2.452000	0.44961	2.289000	0.77006	0.459000	0.35465	GTT	-	RNF216	-	NULL		0.363	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF216	HGNC	protein_coding	OTTHUMT00000340374.1	0	0	0	40	40	107	0.00	0.00	A	NM_207111		5780626	-1	14	34	11	38	tier1	no_errors	ENST00000389902	ensembl	human	known	74_37	missense	56.00	47.22	SNP	0.960	G	14	11
LRRC53	100144878	genome.wustl.edu	37	1	74946127	74946127	+	Missense_Mutation	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:74946127T>C	ENST00000294635.4	-	3	728	c.614A>G	c.(613-615)cAg>cGg	p.Q205R	FPGT-TNNI3K_ENST00000557284.2_Intron|LRRC53_ENST00000416014.2_Missense_Mutation_p.Q205R|TNNI3K_ENST00000370891.2_Intron|TNNI3K_ENST00000326637.3_Intron			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53	205						integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						AAGGATTAACTGCTTCAGTGG	0.478													ENSG00000162621																																					0																																										SO:0001583	missense	0			-			1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.614A>G	1.37:g.74946127T>C	ENSP00000294635:p.Gln205Arg			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.Q205R	ENST00000294635.4	37	c.614		1	.	.	.	.	.	.	.	.	.	.	T	9.020	0.984550	0.18889	.	.	ENSG00000162621	ENST00000416014;ENST00000294635	T;T	0.51325	0.71;0.71	5.54	3.05	0.35203	.	0.429052	0.20863	N	0.084308	T	0.14527	0.0351	.	.	.	0.50039	D	0.999849	.	.	.	.	.	.	T	0.05566	-1.0877	7	0.08837	T	0.75	-1.0482	6.4333	0.21809	0.1454:0.0881:0.0:0.7665	.	.	.	.	R	205	ENSP00000391861:Q205R;ENSP00000294635:Q205R	ENSP00000294635:Q205R	Q	-	2	0	LRRC53	74718715	0.999000	0.42202	1.000000	0.80357	0.842000	0.47809	1.837000	0.39201	2.108000	0.64289	0.379000	0.24179	CAG	-	LRRC53	-	NULL		0.478	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC53	HGNC	protein_coding	OTTHUMT00000026515.2	0	0	0	34	34	139	0.00	0.00	T			74946127	-1	15	63	28	72	tier1	no_errors	ENST00000294635	ensembl	human	novel	74_37	missense	34.09	46.67	SNP	0.621	C	15	28
NBEAL1	65065	genome.wustl.edu	37	2	203972519	203972519	+	Silent	SNP	G	G	T	rs148705424	byFrequency	TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr2:203972519G>T	ENST00000449802.1	+	13	1803	c.1470G>T	c.(1468-1470)ggG>ggT	p.G490G		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	490										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CAAACATGGGGATTAGAATCA	0.408													ENSG00000144426																																					0													196.0	158.0	170.0					2																	203972519		692	1591	2283	SO:0001819	synonymous_variant	0			-	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.1470G>T	2.37:g.203972519G>T			A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G490	ENST00000449802.1	37	c.1470	CCDS46495.1	2																																																																																			-	NBEAL1	-	superfamily_ARM-type_fold		0.408	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	0	0	0	89	89	142	0.00	0.00	G			203972519	+1	22	34	27	90	tier1	no_errors	ENST00000449802	ensembl	human	known	74_37	silent	44.90	27.20	SNP	0.910	T	22	27
MKI67	4288	genome.wustl.edu	37	10	129914188	129914188	+	Missense_Mutation	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr10:129914188C>T	ENST00000368654.3	-	7	859	c.484G>A	c.(484-486)Gtc>Atc	p.V162I	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	162					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TCTTCTTTGACATTCTTGATA	0.403													ENSG00000148773																																					0													192.0	183.0	186.0					10																	129914188		2203	4300	6503	SO:0001583	missense	0			-	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.484G>A	10.37:g.129914188C>T	ENSP00000357643:p.Val162Ile		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.V162I	ENST00000368654.3	37	c.484	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	C	8.208	0.799697	0.16397	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.23348	1.91	3.69	-0.334	0.12666	.	1.000480	0.08067	N	0.999283	T	0.13072	0.0317	N	0.19112	0.55	0.09310	N	1	B	0.32781	0.384	B	0.30251	0.113	T	0.28996	-1.0026	9	.	.	.	.	4.0221	0.09670	0.0:0.3813:0.2549:0.3638	.	162	P46013	KI67_HUMAN	I	162	ENSP00000357643:V162I	.	V	-	1	0	MKI67	129804178	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.422000	0.07043	-0.051000	0.13334	-0.140000	0.14226	GTC	-	MKI67	-	NULL		0.403	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	0	0	0	57	57	106	0.00	0.00	C	NM_002417		129914188	-1	6	20	25	66	tier1	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	19.35	23.26	SNP	0.000	T	6	25
DOCK3	1795	genome.wustl.edu	37	3	51315040	51315040	+	Splice_Site	SNP	A	A	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:51315040A>T	ENST00000266037.9	+	26	2701	c.2678A>T	c.(2677-2679)gAg>gTg	p.E893V		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	893					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCGCTCCAGGAGGCAGATGTC	0.547													ENSG00000088538																																					0													66.0	65.0	66.0					3																	51315040		2136	4252	6388	SO:0001630	splice_region_variant	0			-	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2677-1A>T	3.37:g.51315040A>T			O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.E893V	ENST00000266037.9	37	c.2678	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	A	17.24	3.338643	0.60963	.	.	ENSG00000088538	ENST00000266037	T	0.66995	-0.24	5.36	5.36	0.76844	.	0.096565	0.64402	D	0.000001	T	0.63885	0.2549	M	0.68952	2.095	0.80722	D	1	B	0.28439	0.212	B	0.23275	0.045	T	0.61623	-0.7025	10	0.27082	T	0.32	.	15.6687	0.77255	1.0:0.0:0.0:0.0	.	893	Q8IZD9	DOCK3_HUMAN	V	893	ENSP00000266037:E893V	ENSP00000266037:E893V	E	+	2	0	DOCK3	51290080	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.109000	0.94291	2.176000	0.68965	0.477000	0.44152	GAG	-	DOCK3	-	superfamily_ARM-type_fold		0.547	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	0	0	0	42	42	53	0.00	0.00	A	NM_004947	Missense_Mutation	51315040	+1	5	13	15	39	tier1	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	25.00	25.00	SNP	1.000	T	5	15
OBSCN	84033	genome.wustl.edu	37	1	228466604	228466604	+	Silent	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:228466604C>T	ENST00000422127.1	+	26	7118	c.7074C>T	c.(7072-7074)acC>acT	p.T2358T	RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Silent_p.T2787T|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000359599.6_Silent_p.T1205T|OBSCN_ENST00000284548.11_Silent_p.T2358T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2358	Ig-like 23.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACGAGGACACCTACACCTGTG	0.597													ENSG00000154358																																					0													64.0	67.0	66.0					1																	228466604		2170	4255	6425	SO:0001819	synonymous_variant	0			-	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7074C>T	1.37:g.228466604C>T			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.T2358	ENST00000422127.1	37	c.7074	CCDS58065.1	1																																																																																			-	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		0	0	0	64	64	90	0.00	0.00	C	NM_052843		228466604	+1	19	13	33	39	tier1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	36.54	25.00	SNP	0.286	T	19	33
FAM160A1	729830	genome.wustl.edu	37	4	152498908	152498908	+	Missense_Mutation	SNP	C	C	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr4:152498908C>A	ENST00000505231.1	+	3	571	c.412C>A	c.(412-414)Ccc>Acc	p.P138T	RN7SKP35_ENST00000517210.1_RNA|FAM160A1_ENST00000435205.1_Missense_Mutation_p.P138T			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	138										endometrium(2)|kidney(1)	3						GCACCACAAACCCATTCTGAA	0.493													ENSG00000164142																																					0													103.0	90.0	94.0					4																	152498908		692	1591	2283	SO:0001583	missense	0			-		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.412C>A	4.37:g.152498908C>A	ENSP00000421580:p.Pro138Thr		Q6ZUS2	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.P138T	ENST00000505231.1	37	c.412	CCDS47146.1	4	.	.	.	.	.	.	.	.	.	.	C	24.6	4.548027	0.86022	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.29917	1.55;1.55	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.55577	0.1929	M	0.73962	2.25	0.80722	D	1	P	0.51240	0.943	P	0.60415	0.874	T	0.50849	-0.8779	9	.	.	.	-29.1994	20.0607	0.97674	0.0:1.0:0.0:0.0	.	138	Q05DH4	F16A1_HUMAN	T	138	ENSP00000413196:P138T;ENSP00000421580:P138T	.	P	+	1	0	FAM160A1	152718358	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.733000	0.93635	0.650000	0.86243	CCC	-	FAM160A1	-	pfam_RetinoicA-induced_16-like		0.493	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	0	0	0	63	63	100	0.00	0.00	C	NM_001109977		152498908	+1	9	11	19	53	tier1	no_errors	ENST00000435205	ensembl	human	known	74_37	missense	32.14	17.19	SNP	1.000	A	9	19
DAPK2	23604	genome.wustl.edu	37	15	64204333	64204333	+	Missense_Mutation	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr15:64204333T>C	ENST00000457488.1	-	10	952	c.922A>G	c.(922-924)Aag>Gag	p.K308E	DAPK2_ENST00000261891.3_Missense_Mutation_p.K308E	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	308	Calmodulin-binding.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		ACATACTGCTTCCTGAAGTTC	0.627													ENSG00000035664																																					0													75.0	60.0	65.0					15																	64204333		2203	4300	6503	SO:0001583	missense	0			-	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.922A>G	15.37:g.64204333T>C	ENSP00000408277:p.Lys308Glu		E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K308E	ENST00000457488.1	37	c.922	CCDS10188.1	15	.	.	.	.	.	.	.	.	.	.	T	19.35	3.811318	0.70797	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.69040	-0.37;-0.37	5.15	5.15	0.70609	Protein kinase-like domain (1);	0.093975	0.41001	D	0.000963	T	0.60779	0.2295	L	0.55481	1.735	0.42665	D	0.993493	P	0.34757	0.467	B	0.32677	0.15	T	0.64601	-0.6369	10	0.52906	T	0.07	.	12.3647	0.55222	0.0:0.0:0.0:1.0	.	308	Q9UIK4	DAPK2_HUMAN	E	308	ENSP00000261891:K308E;ENSP00000408277:K308E	ENSP00000261891:K308E	K	-	1	0	DAPK2	61991386	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.588000	0.60999	1.940000	0.56252	0.496000	0.49642	AAG	-	DAPK2	-	superfamily_Kinase-like_dom		0.627	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	0	0	0	70	70	94	0.00	0.00	T	NM_014326		64204333	-1	15	15	22	34	tier1	no_errors	ENST00000261891	ensembl	human	known	74_37	missense	40.54	30.61	SNP	1.000	C	15	22
ZFP41	286128	genome.wustl.edu	37	8	144332442	144332442	+	Missense_Mutation	SNP	C	C	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr8:144332442C>A	ENST00000330701.4	+	2	798	c.429C>A	c.(427-429)ttC>ttA	p.F143L	ZFP41_ENST00000520584.1_Missense_Mutation_p.F143L|ZFP41_ENST00000522452.1_Missense_Mutation_p.F143L	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	143					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			AGAAGCCCTTCAAATGCGGGG	0.582													ENSG00000181638																																					0													113.0	112.0	112.0					8																	144332442		2203	4300	6503	SO:0001583	missense	0			-		CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.429C>A	8.37:g.144332442C>A	ENSP00000327427:p.Phe143Leu		D3DWJ5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F143L	ENST00000330701.4	37	c.429	CCDS6397.1	8	.	.	.	.	.	.	.	.	.	.	C	15.43	2.832436	0.50845	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.21932	1.98;1.98;1.98	3.2	-3.02	0.05446	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25865	0.0630	L	0.59912	1.85	0.09310	N	1	P	0.52170	0.951	P	0.48704	0.587	T	0.25117	-1.0141	9	0.87932	D	0	-9.3802	9.9525	0.41647	0.0:0.6476:0.0:0.3524	.	143	Q8N8Y5	ZFP41_HUMAN	L	143	ENSP00000430465:F143L;ENSP00000327427:F143L;ENSP00000428966:F143L	ENSP00000327427:F143L	F	+	3	2	ZFP41	144403817	0.000000	0.05858	0.006000	0.13384	0.642000	0.38348	-0.176000	0.09811	-0.698000	0.05085	-0.384000	0.06662	TTC	-	ZFP41	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.582	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZFP41	HGNC	protein_coding	OTTHUMT00000381114.2	0	0	0	29	29	93	0.00	0.00	C	NM_173832		144332442	+1	15	44	25	88	tier1	no_errors	ENST00000330701	ensembl	human	known	74_37	missense	37.50	33.33	SNP	0.005	A	15	25
DLX1	1745	genome.wustl.edu	37	2	172950416	172950416	+	Missense_Mutation	SNP	C	C	G			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr2:172950416C>G	ENST00000361725.4	+	1	463	c.11C>G	c.(10-12)aCc>aGc	p.T4S	DLX1_ENST00000341900.6_Missense_Mutation_p.T4S	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	4					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			ATGACCATGACCACCATGCCA	0.557													ENSG00000144355																																					0													121.0	129.0	126.0					2																	172950416		2203	4300	6503	SO:0001583	missense	0			-	BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.11C>G	2.37:g.172950416C>G	ENSP00000354478:p.Thr4Ser		D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.T4S	ENST00000361725.4	37	c.11	CCDS2247.2	2	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694032	0.48202	.	.	ENSG00000144355	ENST00000361609;ENST00000469444;ENST00000361725;ENST00000341900	D;D;D	0.95853	-3.83;-3.29;-3.02	5.59	5.59	0.84812	.	0.106857	0.64402	D	0.000005	D	0.96272	0.8784	L	0.37630	1.12	0.80722	D	1	B;D;B	0.56035	0.089;0.974;0.017	B;D;B	0.70487	0.17;0.969;0.007	D	0.95223	0.8335	10	0.32370	T	0.25	-22.3618	19.6027	0.95569	0.0:1.0:0.0:0.0	.	4;4;4	F8VXJ2;Q7Z724;P56177	.;.;DLX1_HUMAN	S	4	ENSP00000354865:T4S;ENSP00000448827:T4S;ENSP00000354478:T4S	ENSP00000341786:T4S	T	+	2	0	DLX1	172658662	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.459000	0.80802	2.638000	0.89438	0.460000	0.39030	ACC	-	DLX1	-	NULL		0.557	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX1	HGNC	protein_coding	OTTHUMT00000405916.1	0	0	0	75	75	153	0.00	0.00	C	XM_087198		172950416	+1	5	25	44	142	tier1	no_errors	ENST00000361725	ensembl	human	known	74_37	missense	10.20	14.97	SNP	1.000	G	5	44
KCTD10	83892	genome.wustl.edu	37	12	109895815	109895816	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	AA	AA	AA	-	AA	AA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr12:109895815_109895816delAA	ENST00000228495.6	-	4	736_737	c.455_456delTT	c.(454-456)cttfs	p.L152fs	KCTD10_ENST00000538161.1_5'UTR|KCTD10_ENST00000540089.1_5'UTR|KCTD10_ENST00000424763.2_5'UTR|KCTD10_ENST00000540411.1_Frame_Shift_Del_p.L149fs	NM_031954.3	NP_114160.1	Q9H3F6	BACD3_HUMAN	potassium channel tetramerization domain containing 10	152					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)				endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	10						AAGTCGCTATAAGTTTTTGTTC	0.396													ENSG00000110906																																					0																																										SO:0001589	frameshift_variant	0				BC040062	CCDS9128.1	12q24.12	2013-06-20	2013-06-20		ENSG00000110906	ENSG00000110906		"""BTB/POZ domain containing"""	23236	protein-coding gene	gene with protein product		613421	"""potassium channel tetramerisation domain containing 10"""			12477932	Standard	XM_005253946		Approved	MSTP028, BTBD28	uc001toi.1	Q9H3F6	OTTHUMG00000169253	ENST00000228495.6:c.455_456delTT	12.37:g.109895815_109895816delAA	ENSP00000228495:p.Leu152fs		Q53HN2|Q59FV1|Q6PL47|Q96SU0	Frame_Shift_Del	DEL	pfam_T1-type_BTB,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.L152fs	ENST00000228495.6	37	c.456_455	CCDS9128.1	12																																																																																				KCTD10	-	NULL		0.396	KCTD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD10	HGNC	protein_coding	OTTHUMT00000403099.1	0	0	0	70	70	161	0.00	0.00	AA	NM_031954		109895816	-1	10	26	34	102	tier1	no_errors	ENST00000228495	ensembl	human	known	74_37	frame_shift_del	22.73	20.31	DEL	0.921:1.000	-	10	34
PABPC3	5042	genome.wustl.edu	37	13	25671937	25671937	+	Missense_Mutation	SNP	T	T	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr13:25671937T>A	ENST00000281589.3	+	1	1638	c.1601T>A	c.(1600-1602)gTa>gAa	p.V534E		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	534					mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		GCTGTTCATGTACAAGGTCAG	0.483													ENSG00000151846																																					0													99.0	91.0	94.0					13																	25671937		2203	4300	6503	SO:0001583	missense	0			-	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.1601T>A	13.37:g.25671937T>A	ENSP00000281589:p.Val534Glu		Q8NHV0|Q9H086	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.V534E	ENST00000281589.3	37	c.1601	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	T	5.791	0.330283	0.10956	.	.	ENSG00000151846	ENST00000281589	T	0.46063	0.88	0.875	0.875	0.19130	Polyadenylate-binding protein/Hyperplastic disc protein (1);	0.000000	0.40385	U	0.001109	T	0.35278	0.0926	M	0.78456	2.415	0.50039	D	0.999841	B	0.10296	0.003	B	0.15052	0.012	T	0.10405	-1.0631	10	0.11794	T	0.64	.	5.8995	0.18957	0.0:0.0:0.0:1.0	.	534	Q9H361	PABP3_HUMAN	E	534	ENSP00000281589:V534E	ENSP00000281589:V534E	V	+	2	0	PABPC3	24569937	1.000000	0.71417	0.989000	0.46669	0.057000	0.15508	5.455000	0.66658	0.632000	0.30432	0.260000	0.18958	GTA	-	PABPC3	-	superfamily_PABP_HYD,tigrfam_PABP_1234		0.483	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	0	0	0	95	95	23	0.00	0.00	T	NM_030979		25671937	+1	29	17	14	4	tier1	no_errors	ENST00000281589	ensembl	human	known	74_37	missense	65.91	80.95	SNP	1.000	A	29	14
TMEM123	114908	genome.wustl.edu	37	11	102323281	102323281	+	Missense_Mutation	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr11:102323281G>A	ENST00000398136.2	-	1	494	c.74C>T	c.(73-75)gCc>gTc	p.A25V	TMEM123_ENST00000361236.3_Missense_Mutation_p.A25V|RP11-315O6.1_ENST00000528717.1_RNA|TMEM123_ENST00000525577.1_Intron|TMEM123_ENST00000532161.1_5'Flank	NM_052932.2	NP_443164.2	Q8N131	PORIM_HUMAN	transmembrane protein 123	25					oncosis (GO:0070267)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(3)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9	all_cancers(8;0.00027)|all_epithelial(12;0.0021)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0314)|Lung(13;0.109)|all cancers(10;0.12)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0149)		TTCATGGGCGGCCCCCAGCAG	0.706													ENSG00000152558																																					0													6.0	10.0	9.0					11																	102323281		1881	4018	5899	SO:0001583	missense	0			-	AL050161	CCDS41702.1	11q22.1	2014-01-02			ENSG00000152558	ENSG00000152558			30138	protein-coding gene	gene with protein product	"""pro oncosis receptor inducing membrane injury gene"""	606356				11481458, 24318988	Standard	NM_052932		Approved	PORIMIN, KCT3	uc001pha.3	Q8N131	OTTHUMG00000167326	ENST00000398136.2:c.74C>T	11.37:g.102323281G>A	ENSP00000381204:p.Ala25Val		Q8IWS2|Q96QV2	Missense_Mutation	SNP	NULL	p.A25V	ENST00000398136.2	37	c.74	CCDS41702.1	11	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635154	0.29068	.	.	ENSG00000152558	ENST00000361236;ENST00000398136	T;T	0.49432	1.5;0.78	4.16	1.94	0.25998	.	0.775945	0.10852	N	0.627002	T	0.35537	0.0935	L	0.38175	1.15	0.09310	N	0.999991	B;B	0.23891	0.035;0.093	B;B	0.18561	0.013;0.022	T	0.24977	-1.0145	10	0.48119	T	0.1	0.9557	7.5402	0.27733	0.1648:0.0:0.8352:0.0	.	25;25	Q8N131-2;Q8N131	.;PORIM_HUMAN	V	25	ENSP00000355285:A25V;ENSP00000381204:A25V	ENSP00000355285:A25V	A	-	2	0	TMEM123	101828491	0.000000	0.05858	0.017000	0.16124	0.056000	0.15407	0.052000	0.14163	0.341000	0.23771	0.591000	0.81541	GCC	-	TMEM123	-	NULL		0.706	TMEM123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM123	HGNC	protein_coding	OTTHUMT00000394178.1	0	0	0	27	27	5	0.00	0.00	G	NM_052932		102323281	-1	6	2	2	0	tier1	no_errors	ENST00000398136	ensembl	human	known	74_37	missense	75.00	100.00	SNP	0.006	A	6	2
DOCK7	85440	genome.wustl.edu	37	1	63009394	63009394	+	Missense_Mutation	SNP	C	C	G	rs376417713		TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:63009394C>G	ENST00000340370.5	-	23	2806	c.2789G>C	c.(2788-2790)cGt>cCt	p.R930P	DOCK7_ENST00000251157.5_Missense_Mutation_p.R961P	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	961					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CGAAGACATACGATTACAACT	0.398													ENSG00000116641																																					0													134.0	122.0	126.0					1																	63009394		2203	4300	6503	SO:0001583	missense	0			-		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.2789G>C	1.37:g.63009394C>G	ENSP00000340742:p.Arg930Pro		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.R961P	ENST00000340370.5	37	c.2882	CCDS30734.1	1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684541	0.68157	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370	T;T	0.24723	1.84;1.84	5.3	5.3	0.74995	.	0.059391	0.64402	D	0.000001	T	0.42268	0.1195	L	0.53249	1.67	0.80722	D	1	D;P;D;D;P	0.59767	0.963;0.881;0.986;0.986;0.923	P;B;P;P;P	0.55824	0.614;0.408;0.785;0.706;0.479	T	0.08597	-1.0714	10	0.44086	T	0.13	.	19.136	0.93428	0.0:1.0:0.0:0.0	.	961;930;930;930;961	Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.;.;.;.;.	P	961;961;930	ENSP00000251157:R961P;ENSP00000340742:R930P	ENSP00000251157:R961P	R	-	2	0	DOCK7	62781982	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.754000	0.94517	0.650000	0.86243	CGT	-	DOCK7	-	NULL		0.398	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	0	0	0	68	68	129	0.00	0.00	C	NM_033407		63009394	-1	6	14	50	157	tier1	no_errors	ENST00000251157	ensembl	human	known	74_37	missense	10.71	8.14	SNP	1.000	G	6	50
KCNH8	131096	genome.wustl.edu	37	3	19492831	19492831	+	Missense_Mutation	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:19492831C>T	ENST00000328405.2	+	10	2026	c.1760C>T	c.(1759-1761)gCc>gTc	p.A587V	KCNH8_ENST00000537696.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	587					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						GCTTTGCAGGCCATCTACTTT	0.493													ENSG00000183960																									NSCLC(124;1625 1765 8018 24930 42026)												0													89.0	91.0	90.0					3																	19492831		2203	4300	6503	SO:0001583	missense	0			-	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1760C>T	3.37:g.19492831C>T	ENSP00000328813:p.Ala587Val		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tR-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.A587V	ENST00000328405.2	37	c.1760	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.653038	0.96724	.	.	ENSG00000183960	ENST00000328405	D	0.92699	-3.09	5.68	5.68	0.88126	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.31392	U	0.007734	D	0.96185	0.8756	M	0.81497	2.545	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	D	0.95571	0.8638	9	.	.	.	.	19.7897	0.96452	0.0:1.0:0.0:0.0	.	587	Q96L42	KCNH8_HUMAN	V	587	ENSP00000328813:A587V	.	A	+	2	0	KCNH8	19467835	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.694000	0.91930	0.467000	0.42956	GCC	-	KCNH8	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.493	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	0	0	0	63	63	99	0.00	0.00	C	NM_144633		19492831	+1	5	6	46	116	tier1	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	9.80	4.92	SNP	1.000	T	5	46
SSH3	54961	genome.wustl.edu	37	11	67075389	67075389	+	Silent	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr11:67075389G>A	ENST00000308127.4	+	8	1042	c.864G>A	c.(862-864)ctG>ctA	p.L288L	SSH3_ENST00000376757.5_Silent_p.L288L|SSH3_ENST00000308298.7_Intron|SSH3_ENST00000532181.1_3'UTR	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	288					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TCAGTGACCTGGAGAGTGTCA	0.622													ENSG00000172830																																					0													76.0	74.0	75.0					11																	67075389		2200	4295	6495	SO:0001819	synonymous_variant	0			-	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.864G>A	11.37:g.67075389G>A			Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.L288	ENST00000308127.4	37	c.864	CCDS8157.1	11																																																																																			-	SSH3	-	pfam_DEK_C		0.622	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH3	HGNC	protein_coding	OTTHUMT00000393167.1	0	0	0	64	64	70	0.00	0.00	G	NM_018276		67075389	+1	9	12	91	148	tier1	no_errors	ENST00000308127	ensembl	human	known	74_37	silent	9.00	7.50	SNP	1.000	A	9	91
MYH7	4625	genome.wustl.edu	37	14	23898537	23898537	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr14:23898537G>T	ENST00000355349.3	-	13	1320	c.1158C>A	c.(1156-1158)taC>taA	p.Y386*		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	386	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GCCCCATGAGGTAGGCAGACT	0.562													ENSG00000092054																																					0													85.0	74.0	78.0					14																	23898537		2203	4300	6503	SO:0001587	stop_gained	0			-	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1158C>A	14.37:g.23898537G>T	ENSP00000347507:p.Tyr386*		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Y386*	ENST00000355349.3	37	c.1158	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	g	38	6.722127	0.97788	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	.	.	.	4.04	3.14	0.36123	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5476	0.50702	0.088:0.0:0.912:0.0	.	.	.	.	X	386	.	ENSP00000347507:Y386X	Y	-	3	2	MYH7	22968377	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	2.825000	0.48096	0.902000	0.36520	0.455000	0.32223	TAC	-	MYH7	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.562	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	0	0	0	35	35	92	0.00	0.00	G	NM_000257		23898537	-1	4	10	24	91	tier1	no_errors	ENST00000355349	ensembl	human	known	74_37	nonsense	14.29	9.90	SNP	1.000	T	4	24
SSH3	54961	genome.wustl.edu	37	11	67075390	67075390	+	Missense_Mutation	SNP	G	G	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr11:67075390G>A	ENST00000308127.4	+	8	1043	c.865G>A	c.(865-867)Gag>Aag	p.E289K	SSH3_ENST00000376757.5_Missense_Mutation_p.E289K|SSH3_ENST00000308298.7_Intron|SSH3_ENST00000532181.1_3'UTR	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	289					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CAGTGACCTGGAGAGTGTCAC	0.622													ENSG00000172830																																					0													75.0	74.0	74.0					11																	67075390		2200	4295	6495	SO:0001583	missense	0			-	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.865G>A	11.37:g.67075390G>A	ENSP00000312081:p.Glu289Lys		Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.E289K	ENST00000308127.4	37	c.865	CCDS8157.1	11	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295393	0.60086	.	.	ENSG00000172830	ENST00000308127;ENST00000376757;ENST00000527821	T;T;T	0.24350	3.49;3.6;1.86	4.5	3.58	0.41010	DEK, C-terminal (1);	0.912692	0.09095	N	0.849254	T	0.42404	0.1201	L	0.58810	1.83	0.44762	D	0.997763	P;P	0.46277	0.787;0.875	B;P	0.53185	0.359;0.72	T	0.19712	-1.0297	10	0.72032	D	0.01	-3.8302	13.8019	0.63206	0.0:0.1551:0.8449:0.0	.	143;289	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	K	289;289;41	ENSP00000312081:E289K;ENSP00000365948:E289K;ENSP00000433902:E41K	ENSP00000312081:E289K	E	+	1	0	SSH3	66831966	1.000000	0.71417	0.975000	0.42487	0.018000	0.09664	7.989000	0.88205	1.033000	0.39918	0.462000	0.41574	GAG	-	SSH3	-	pfam_DEK_C		0.622	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH3	HGNC	protein_coding	OTTHUMT00000393167.1	0	0	0	68	68	68	0.00	0.00	G	NM_018276		67075390	+1	9	12	92	146	tier1	no_errors	ENST00000308127	ensembl	human	known	74_37	missense	8.91	7.59	SNP	1.000	A	9	92
CARD14	79092	genome.wustl.edu	37	17	78169122	78169122	+	Missense_Mutation	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr17:78169122T>C	ENST00000573882.1	+	12	2025	c.1489T>C	c.(1489-1491)Tgg>Cgg	p.W497R	CARD14_ENST00000573754.1_3'UTR|CARD14_ENST00000344227.2_Missense_Mutation_p.W497R|CARD14_ENST00000570421.1_Missense_Mutation_p.W497R|CARD14_ENST00000392434.2_Missense_Mutation_p.W260R			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	497					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGAAGAACCCTGGTCTTTCAG	0.652													ENSG00000141527																																					0													38.0	41.0	40.0					17																	78169122		2203	4300	6503	SO:0001583	missense	0			-	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.1489T>C	17.37:g.78169122T>C	ENSP00000458715:p.Trp497Arg		B8QQJ3|Q9BVB5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,superfamily_PDZ,pfscan_CARD,pfscan_PDZ,pfscan_Guanylate_kin-like	p.W497R	ENST00000573882.1	37	c.1489	CCDS11768.1	17	.	.	.	.	.	.	.	.	.	.	T	1.339	-0.594696	0.03771	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	T;T	0.24350	1.86;2.54	4.38	2.02	0.26589	.	2.218360	0.01937	N	0.041640	T	0.16171	0.0389	N	0.22421	0.69	0.09310	N	1	B;B;B	0.29508	0.054;0.246;0.022	B;B;B	0.24155	0.007;0.051;0.007	T	0.18366	-1.0339	10	0.13108	T	0.6	-0.64	5.198	0.15249	0.1628:0.0:0.1964:0.6408	.	497;260;497	B8QQJ3;E7ETJ2;Q9BXL6	.;.;CAR14_HUMAN	R	497;260;260	ENSP00000344549:W497R;ENSP00000376229:W260R	ENSP00000308507:W260R	W	+	1	0	CARD14	75783717	0.000000	0.05858	0.158000	0.22627	0.249000	0.25844	0.128000	0.15810	0.773000	0.33404	0.533000	0.62120	TGG	-	CARD14	-	NULL		0.652	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD14	HGNC	protein_coding	OTTHUMT00000437507.1	0	0	0	75	75	71	0.00	0.00	T			78169122	+1	8	7	79	76	tier1	no_errors	ENST00000344227	ensembl	human	known	74_37	missense	9.20	8.43	SNP	0.075	C	8	79
SPATA18	132671	genome.wustl.edu	37	4	52948721	52948721	+	Intron	SNP	T	T	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr4:52948721T>A	ENST00000295213.4	+	10	1853				SPATA18_ENST00000419395.2_Intron	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18						cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			AGTGTTTGATTCACAAGTTCG	0.398													ENSG00000163071																																					0													77.0	76.0	76.0					4																	52948721		2203	4300	6503	SO:0001627	intron_variant	0			-	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.1479+45T>A	4.37:g.52948721T>A			B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Silent	SNP	NULL	p.I508	ENST00000295213.4	37	c.1524	CCDS3489.1	4																																																																																			-	SPATA18	-	NULL		0.398	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA18	HGNC	protein_coding	OTTHUMT00000250597.2	0	0	0	63	63	142	0.00	0.00	T	NM_145263		52948721	+1	4	16	33	183	tier1	no_errors	ENST00000505320	ensembl	human	known	74_37	silent	10.81	8.04	SNP	0.986	A	4	33
PDE11A	50940	genome.wustl.edu	37	2	178592479	178592479	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr2:178592479C>T	ENST00000286063.6	-	12	2267	c.1950G>A	c.(1948-1950)tgG>tgA	p.W650*	PDE11A_ENST00000449286.2_Nonsense_Mutation_p.W292*|PDE11A_ENST00000358450.4_Nonsense_Mutation_p.W400*|PDE11A_ENST00000389683.3_Nonsense_Mutation_p.W206*|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000409504.1_Nonsense_Mutation_p.W292*	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	650	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CTGTCAAAAGCCACCTACACA	0.468									Primary Pigmented Nodular Adrenocortical Disease, Familial				ENSG00000128655																																					0													145.0	126.0	133.0					2																	178592479		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	-	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1950G>A	2.37:g.178592479C>T	ENSP00000286063:p.Trp650*		Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Nonsense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.W650*	ENST00000286063.6	37	c.1950	CCDS33334.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.714517|5.714517	0.96830|0.96830	.|.	.|.	ENSG00000128655|ENSG00000128655	ENST00000433879|ENST00000286063;ENST00000358450;ENST00000409504;ENST00000389683;ENST00000449286	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.48205|.	0.1487|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37502|.	-0.9703|.	4|.	.|0.02654	.|T	.|1	.|.	19.773|19.773	0.96379|0.96379	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	258|650;400;292;206;292	.|.	.|ENSP00000286063:W650X	G|W	-|-	2|3	0|0	PDE11A|PDE11A	178300725|178300725	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	7.484000|7.484000	0.81180|0.81180	2.677000|2.677000	0.91161|0.91161	0.655000|0.655000	0.94253|0.94253	GGC|TGG	-	PDE11A	-	NULL		0.468	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	HGNC	protein_coding	OTTHUMT00000334313.2	0	0	0	79	79	148	0.00	0.00	C			178592479	-1	6	11	54	101	tier1	no_errors	ENST00000286063	ensembl	human	known	74_37	nonsense	10.00	9.82	SNP	1.000	T	6	54
SDHAP3	728609	genome.wustl.edu	37	5	1589412	1589412	+	RNA	SNP	A	A	G			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr5:1589412A>G	ENST00000436493.2	-	0	466									succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 3																		CCATCAGCAAATCTCAATTTG	0.438													ENSG00000185986																																					0																																												0			-			5p15.33	2014-03-20	2006-11-21	2006-11-21	ENSG00000185986	ENSG00000185986			18781	pseudogene	pseudogene	"""similar to succinate dehydrogenase flavoprotein subunit"""		"""succinate dehydrogenase complex, subunit A, flavoprotein-like"", ""SDHA C-terminal like"""	SDHAL, SDHACL			Standard	NR_003263		Approved		uc011cmd.2		OTTHUMG00000161733		5.37:g.1589412A>G				R	SNP	-	NULL	ENST00000436493.2	37	NULL		5																																																																																			-	SDHAP3	-	-		0.438	SDHAP3-002	KNOWN	basic	processed_transcript	SDHAP3	HGNC	pseudogene	OTTHUMT00000365894.1	0	0	0	111	111	103	0.00	0.00	A			1589412	-1	8	4	63	92	tier1	no_errors	ENST00000436493	ensembl	human	known	74_37	rna	11.27	4.17	SNP	1.000	G	8	63
ATP13A4	84239	genome.wustl.edu	37	3	193130047	193130047	+	Missense_Mutation	SNP	A	A	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:193130047A>C	ENST00000342695.4	-	27	3450	c.3128T>G	c.(3127-3129)tTc>tGc	p.F1043C	ATP13A4_ENST00000400270.2_Missense_Mutation_p.F59C|ATP13A4_ENST00000482964.1_5'UTR|ATP13A4_ENST00000392443.3_Missense_Mutation_p.F1024C	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	1043						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TGTTCCCAAGAACCAGACTGT	0.393													ENSG00000127249																																					0													242.0	234.0	237.0					3																	193130047		2203	4300	6503	SO:0001583	missense	0			-	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.3128T>G	3.37:g.193130047A>C	ENSP00000339182:p.Phe1043Cys		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.F1043C	ENST00000342695.4	37	c.3128	CCDS3304.2	3	.	.	.	.	.	.	.	.	.	.	A	20.7	4.027122	0.75390	.	.	ENSG00000127249	ENST00000400270;ENST00000392443;ENST00000342695	D;D;D	0.92595	-3.07;-3.07;-3.07	5.7	5.7	0.88788	.	0.087250	0.49916	D	0.000128	D	0.92028	0.7474	L	0.33485	1.01	0.80722	D	1	D	0.64830	0.994	P	0.58928	0.848	D	0.91407	0.5148	10	0.37606	T	0.19	-24.6051	13.9317	0.64001	1.0:0.0:0.0:0.0	.	1043	Q4VNC1	AT134_HUMAN	C	59;1024;1043	ENSP00000383129:F59C;ENSP00000376238:F1024C;ENSP00000339182:F1043C	ENSP00000339182:F1043C	F	-	2	0	ATP13A4	194612741	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.084000	0.50143	2.185000	0.69588	0.528000	0.53228	TTC	-	ATP13A4	-	tigrfam_ATPase_P-typ_Cation_typ_V		0.393	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	HGNC	protein_coding	OTTHUMT00000157244.4	0	0	0	65	65	144	0.00	0.00	A	NM_032279		193130047	-1	10	15	64	149	tier1	no_errors	ENST00000342695	ensembl	human	known	74_37	missense	13.51	9.09	SNP	1.000	C	10	64
ZNF341	84905	genome.wustl.edu	37	20	32346565	32346565	+	Silent	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr20:32346565T>C	ENST00000375200.1	+	7	1346	c.981T>C	c.(979-981)tgT>tgC	p.C327C	ZNF341_ENST00000342427.2_Silent_p.C320C	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						GCTCATACTGTGACAAGTCAT	0.557													ENSG00000131061																																					0													96.0	73.0	81.0					20																	32346565		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.981T>C	20.37:g.32346565T>C			A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C327	ENST00000375200.1	37	c.981		20																																																																																			-	ZNF341	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.557	ZNF341-201	KNOWN	basic	protein_coding	ZNF341	HGNC	protein_coding		0	0	0	41	41	35	0.00	0.00	T			32346565	+1	4	5	31	51	tier1	no_errors	ENST00000375200	ensembl	human	known	74_37	silent	11.43	8.93	SNP	1.000	C	4	31
GLIPR1L1	256710	genome.wustl.edu	37	12	75728541	75728541	+	Missense_Mutation	SNP	G	G	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr12:75728541G>T	ENST00000378695.4	+	1	123	c.33G>T	c.(31-33)tgG>tgT	p.W11C	CAPS2_ENST00000442339.2_Intron|GLIPR1L1_ENST00000312442.2_Missense_Mutation_p.W11C			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1	11					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						GTTGTTTATGGATCTTGGGTC	0.498											OREG0021998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000173401																																					0													142.0	138.0	139.0					12																	75728541		2203	4300	6503	SO:0001583	missense	0			-	BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755	ENST00000378695.4:c.33G>T	12.37:g.75728541G>T	ENSP00000367967:p.Trp11Cys	1162	Q96L06	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.W11C	ENST00000378695.4	37	c.33		12	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097339	0.56075	.	.	ENSG00000173401	ENST00000378695;ENST00000312442	T;T	0.08458	3.12;3.09	4.81	4.81	0.61882	CAP domain (1);	0.000000	0.64402	D	0.000001	T	0.18718	0.0449	L	0.36672	1.1	0.53005	D	0.999966	D;D	0.76494	0.999;0.999	P;D	0.66847	0.894;0.947	T	0.00728	-1.1591	10	0.51188	T	0.08	.	14.7828	0.69779	0.0:0.0:1.0:0.0	.	11;11	Q6UWM5;Q6UWM5-2	GPRL1_HUMAN;.	C	11	ENSP00000367967:W11C;ENSP00000310770:W11C	ENSP00000310770:W11C	W	+	3	0	GLIPR1L1	74014808	0.998000	0.40836	0.587000	0.28692	0.028000	0.11728	3.171000	0.50824	2.225000	0.72522	0.563000	0.77884	TGG	-	GLIPR1L1	-	NULL		0.498	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	GLIPR1L1	HGNC	protein_coding	OTTHUMT00000405714.1	0	0	2	78	78	138	0.00	1.43	G	NM_152779		75728541	+1	38	77	136	300	tier1	no_errors	ENST00000378695	ensembl	human	known	74_37	missense	21.84	20.42	SNP	0.964	T	38	136
BNIP3L	665	genome.wustl.edu	37	8	26240684	26240686	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	ACA	ACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr8:26240684_26240686delACA	ENST00000380629.2	+	1	271_273	c.38_40delACA	c.(37-42)cacaac>cac	p.N18del	BNIP3L_ENST00000520409.1_5'Flank|SDAD1P1_ENST00000519902.1_RNA|BNIP3L_ENST00000523515.1_5'Flank	NM_004331.2	NP_004322.1	O60238	BNI3L_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3-like	18					defense response to virus (GO:0051607)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(3)|lung(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0019)|Epithelial(17;1.59e-12)|all cancers(2;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(2;2.57e-08)|Colorectal(74;0.135)		CCGCCCCTGCACAACAACAACAA	0.655													ENSG00000104765																																					0																																										SO:0001651	inframe_deletion	0				AB004788	CCDS6050.1	8p21	2014-05-13	2002-08-29		ENSG00000104765	ENSG00000104765			1085	protein-coding gene	gene with protein product		605368	"""BCL2/adenovirus E1B 19kD-interacting protein 3-like"""			9523198, 9973195	Standard	NM_004331		Approved	Nix, BNIP3a	uc003xex.1	O60238	OTTHUMG00000099433	ENST00000380629.2:c.38_40delACA	8.37:g.26240693_26240695delACA	ENSP00000370003:p.Asn18del		B0AZS9|Q5JW63|Q8NF87	In_Frame_Del	DEL	pfam_BNIP3	p.N17in_frame_del	ENST00000380629.2	37	c.38_40	CCDS6050.1	8																																																																																				BNIP3L	-	NULL		0.655	BNIP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNIP3L	HGNC	protein_coding	OTTHUMT00000216895.1	0	0	0	33	33	17	0.00	0.00	ACA	NM_004331		26240686	+1	2	0	16	7	tier1	no_errors	ENST00000380629	ensembl	human	known	74_37	in_frame_del	11.11	0.00	DEL	0.999:1.000:1.000	-	2	16
LHFPL4	375323	genome.wustl.edu	37	3	9594382	9594384	+	5'UTR	DEL	CGG	CGG	-	rs569344244|rs545721976	byFrequency	TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	CGG	CGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr3:9594382_9594384delCGG	ENST00000287585.6	-	0	265_267				LHFPL4_ENST00000495730.1_5'Flank	NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					gaggcggggccggcggcggcggc	0.764													ENSG00000156959																																					0																																										SO:0001623	5_prime_UTR_variant	0				AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.-21CCG>-	3.37:g.9594391_9594393delCGG			A1L383|A4D0Q5	R	DEL	-	NULL	ENST00000287585.6	37	NULL	CCDS33691.1	3																																																																																				LHFPL4	-	-		0.764	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL4	HGNC	protein_coding	OTTHUMT00000338298.1	0	0	0	27	27	14	0.00	0.00	CGG	NM_198560		9594384	-1	2	0	22	8	tier1	no_errors	ENST00000498277	ensembl	human	known	74_37	rna	8.33	0.00	DEL	1.000:1.000:1.000	-	2	22
SOX12	6666	genome.wustl.edu	37	20	307372	307372	+	Silent	SNP	C	C	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr20:307372C>T	ENST00000342665.2	+	1	1134	c.804C>T	c.(802-804)agC>agT	p.S268S	RP5-1103G7.4_ENST00000414676.1_RNA|SOX12_ENST00000544632.1_Silent_p.S268S|RP5-1103G7.4_ENST00000442637.1_RNA	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12	268					cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TGGACTGCAGCGCCCTGGATC	0.701													ENSG00000177732																																					0													18.0	21.0	20.0					20																	307372		2192	4296	6488	SO:0001819	synonymous_variant	0			-	U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623	ENST00000342665.2:c.804C>T	20.37:g.307372C>T			Q5D038|Q9NUD4	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.S268	ENST00000342665.2	37	c.804	CCDS12995.1	20																																																																																			-	SOX12	-	pirsf_SOX-12/11/4a		0.701	SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX12	HGNC	protein_coding	OTTHUMT00000077435.2	0	0	0	35	35	7	0.00	0.00	C	NM_006943		307372	+1	7	0	20	2	tier1	no_errors	ENST00000342665	ensembl	human	known	74_37	silent	25.93	0.00	SNP	1.000	T	7	20
DCAF12L2	340578	genome.wustl.edu	37	X	125299630	125299630	+	Missense_Mutation	SNP	T	T	C			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chrX:125299630T>C	ENST00000360028.2	-	1	304	c.278A>G	c.(277-279)gAc>gGc	p.D93G	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.D93G			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	93										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GGTGCCCAGGTCCAGCTGGCG	0.677													ENSG00000198354																																					0													49.0	45.0	46.0					X																	125299630		2203	4300	6503	SO:0001583	missense	0			-	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.278A>G	X.37:g.125299630T>C	ENSP00000353128:p.Asp93Gly		B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D93G	ENST00000360028.2	37	c.278	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	t	6.087	0.384372	0.11524	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.32023	1.47;1.47	3.28	-0.877	0.10621	WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.16471	0.0396	L	0.29908	0.895	0.09310	N	0.999999	B	0.09022	0.002	B	0.09377	0.004	T	0.31558	-0.9939	9	0.17369	T	0.5	.	3.5739	0.07927	0.2289:0.0:0.2542:0.5169	.	93	Q5VW00	DC122_HUMAN	G	93	ENSP00000441489:D93G;ENSP00000353128:D93G	ENSP00000353128:D93G	D	-	2	0	DCAF12L2	125127311	0.968000	0.33430	0.028000	0.17463	0.838000	0.47535	2.173000	0.42472	-0.358000	0.08162	0.237000	0.17872	GAC	-	DCAF12L2	-	superfamily_WD40_repeat_dom		0.677	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	0	0	0	46	46	1	0.00	0.00	T	NM_001013628		125299630	-1	8	0	18	1	tier1	no_errors	ENST00000360028	ensembl	human	known	74_37	missense	30.77	0.00	SNP	0.382	C	8	18
MTMR12	54545	genome.wustl.edu	37	5	32312936	32312936	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr5:32312936delC	ENST00000382142.3	-	1	179	c.9delG	c.(7-9)gggfs	p.G3fs	MTMR12_ENST00000264934.5_Frame_Shift_Del_p.G3fs|MTMR12_ENST00000280285.5_Frame_Shift_Del_p.G3fs	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	3						cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CTACTCCTTTCCCCAGCATAC	0.746													ENSG00000150712																																					0													20.0	21.0	21.0					5																	32312936		2158	4239	6397	SO:0001589	frameshift_variant	0				AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.9delG	5.37:g.32312936delC	ENSP00000371577:p.Gly3fs		Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Frame_Shift_Del	DEL	pfam_Myotubularin_assoc	p.G5fs	ENST00000382142.3	37	c.9	CCDS34138.1	5																																																																																				MTMR12	-	NULL		0.746	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	HGNC	protein_coding	OTTHUMT00000366579.1	0	0	0	19	19	3	0.00	0.00	C	NM_019061		32312936	-1	2	0	9	4	tier1	no_errors	ENST00000382142	ensembl	human	known	74_37	frame_shift_del	18.18	0.00	DEL	1.000	-	2	9
PRDM6	93166	genome.wustl.edu	37	5	122425971	122425972	+	In_Frame_Ins	INS	-	-	CCTCCGCCT	rs368034022|rs199942027|rs70988558	byFrequency	TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr5:122425971_122425972insCCTCCGCCT	ENST00000407847.4	+	2	676_677	c.262_263insCCTCCGCCT	c.(262-264)acc>aCCTCCGCCTcc	p.94_95insSAS	AC106786.1_ENST00000458103.2_RNA|AC106786.1_ENST00000442777.2_RNA	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	94					negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						Ttcctcttccacctccgcctcc	0.782													ENSG00000061455		1116	0.222843	0.2784	0.2637	5008	,	,		7182	0.0337		0.3966	False		,,,				2504	0.135																0										191,705		83,25,340						1.8	1.0			1	597,1391		268,61,665	no	coding	PRDM6	NM_001136239.1		351,86,1005	A1A1,A1R,RR		30.0302,21.317,27.3232				788,2096				SO:0001652	inframe_insertion	0				AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.272_280dupCCTCCGCCT	5.37:g.122425972_122425980dupCCTCCGCCT	ENSP00000384725:p.Ser92_Ser94dup		B5MCJ4|Q9NQW9	In_Frame_Ins	INS	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.92in_frame_insSAS	ENST00000407847.4	37	c.262_263	CCDS47259.1	5																																																																																				PRDM6	-	NULL		0.782	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM6	HGNC	protein_coding	OTTHUMT00000318226.2	0	0	0	2	2	2	0.00	0.00	-	XM_049619		122425972	+1	0	0	3	3	tier1	no_errors	ENST00000407847	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.997:1.000	CCTCCGCCT	0	3
PCDHB4	56131	genome.wustl.edu	37	5	140503455	140503455	+	Silent	SNP	C	C	A			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr5:140503455C>A	ENST00000194152.1	+	1	1875	c.1875C>A	c.(1873-1875)acC>acA	p.T625T		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	625	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGTGCGCACCGCCAGGCTGC	0.697													ENSG00000081818																																					0													27.0	27.0	27.0					5																	140503455		1988	3984	5972	SO:0001819	synonymous_variant	0			-	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1875C>A	5.37:g.140503455C>A			Q4V761	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T625	ENST00000194152.1	37	c.1875	CCDS4246.1	5																																																																																			-	PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.697	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	0	0	0	185	185	0	0.00	0.00	C	NM_018938		140503455	+1	20	0	110	0	tier1	no_errors	ENST00000194152	ensembl	human	known	74_37	silent	15.38	0.00	SNP	0.002	A	20	110
NUDT17	200035	genome.wustl.edu	37	1	145588455	145588455	+	Missense_Mutation	SNP	G	G	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr1:145588455G>T	ENST00000334513.5	-	4	429	c.418C>A	c.(418-420)Ctt>Att	p.L140I	NUDT17_ENST00000444015.2_5'UTR	NM_001012758.2	NP_001012776.1	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 17	140	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(2)	9	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AGTTCTCGAAGCCCTCCGTCC	0.587											OREG0013751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000186364																																					0													65.0	66.0	66.0					1																	145588455		2203	4300	6503	SO:0001583	missense	0			-	BC046352	CCDS72865.1	1q21.1	2008-02-05			ENSG00000186364	ENSG00000186364		"""Nudix motif containing"""	26618	protein-coding gene	gene with protein product						12477932	Standard	NM_001012758		Approved	FLJ34433	uc001eoe.3	P0C025	OTTHUMG00000013752	ENST00000334513.5:c.418C>A	1.37:g.145588455G>T	ENSP00000334437:p.Leu140Ile	1695		Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.L140I	ENST00000334513.5	37	c.418	CCDS30830.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.624|9.624	1.134572|1.134572	0.21123|0.21123	.|.	.|.	ENSG00000186364|ENSG00000186364	ENST00000444015|ENST00000334513	.|T	.|0.08546	.|3.08	4.27|4.27	2.34|2.34	0.29019|0.29019	.|NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	.|0.076921	.|0.51477	.|D	.|0.000096	T|T	0.03520|0.03520	0.0101|0.0101	N|N	0.21194|0.21194	0.64|0.64	0.09310|0.09310	N|N	1|1	.|D	.|0.57257	.|0.979	.|P	.|0.53689	.|0.732	T|T	0.35549|0.35549	-0.9784|-0.9784	5|10	.|0.46703	.|T	.|0.11	-3.0538|-3.0538	6.9616|6.9616	0.24599|0.24599	0.2176:0.0:0.7824:0.0|0.2176:0.0:0.7824:0.0	.|.	.|140	.|P0C025	.|NUD17_HUMAN	D|I	33|140	.|ENSP00000334437:L140I	.|ENSP00000334437:L140I	A|L	-|-	2|1	0|0	NUDT17|NUDT17	144299812|144299812	0.996000|0.996000	0.38824|0.38824	0.036000|0.036000	0.18154|0.18154	0.005000|0.005000	0.04900|0.04900	3.997000|3.997000	0.57016|0.57016	0.412000|0.412000	0.25729|0.25729	-0.140000|-0.140000	0.14226|0.14226	GCT|CTT	-	NUDT17	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like		0.587	NUDT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT17	HGNC	protein_coding	OTTHUMT00000038541.3	0	0	0	53	53	81	0.00	0.00	G	XM_496395		145588455	-1	4	2	44	132	tier1	no_errors	ENST00000334513	ensembl	human	known	74_37	missense	8.33	1.49	SNP	0.064	T	4	44
CTNNA3	29119	genome.wustl.edu	37	10	68139076	68139076	+	Silent	SNP	G	G	T			TCGA-3R-A8YX-01A-11D-A37C-09	TCGA-3R-A8YX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1b8bbbbc-18c8-4599-8f06-6963740cb2ed	e26d0fc4-07ec-4e1d-816c-6d4df7e3996c	g.chr10:68139076G>T	ENST00000433211.2	-	12	1740	c.1566C>A	c.(1564-1566)atC>atA	p.I522I	CTNNA3_ENST00000373744.4_Silent_p.I522I	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TTAAGGCTATGATACACTTGT	0.423													ENSG00000183230																																					0													121.0	122.0	121.0					10																	68139076		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1566C>A	10.37:g.68139076G>T				Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.I522	ENST00000433211.2	37	c.1566	CCDS7269.1	10																																																																																			-	CTN3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.423	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTN3	HGNC	protein_coding	OTTHUMT00000048282.2	0	0	0	57	57	85	0.00	0.00	G	NM_013266		68139076	-1	4	2	38	94	tier1	no_errors	ENST00000373744	ensembl	human	known	74_37	silent	9.52	2.08	SNP	1.000	T	4	38
