#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
GABRG3	2567	genome.wustl.edu	37	15	27572085	27572085	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr15:27572085C>T	ENST00000333743.6	+	4	654	c.400C>T	c.(400-402)Cgc>Tgc	p.R134C	GABRG3_ENST00000555083.1_Missense_Mutation_p.R134C	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	134					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CACCATCTTCCGCAATTCTAA	0.473													ENSG00000182256																									NSCLC(114;800 1656 7410 37729 45293)												0													108.0	107.0	108.0					15																	27572085		1972	4184	6156	SO:0001583	missense	0			-		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.400C>T	15.37:g.27572085C>T	ENSP00000331912:p.Arg134Cys		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R134C	ENST00000333743.6	37	c.400	CCDS45195.1	15	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336239	0.60963	.	.	ENSG00000182256	ENST00000333743;ENST00000555083;ENST00000554696	T;T;T	0.78126	-1.15;-1.15;-1.15	5.79	5.79	0.91817	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.90113	0.6911	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.91127	0.4934	10	0.87932	D	0	.	19.0355	0.92976	0.0:1.0:0.0:0.0	.	134;134	Q99928;G3V594	GBRG3_HUMAN;.	C	134;134;76	ENSP00000331912:R134C;ENSP00000452244:R134C;ENSP00000451862:R76C	ENSP00000331912:R134C	R	+	1	0	GABRG3	25154831	1.000000	0.71417	0.998000	0.56505	0.435000	0.31806	2.160000	0.42348	2.722000	0.93159	0.655000	0.94253	CGC	-	GABRG3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel		0.473	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	HGNC	protein_coding	OTTHUMT00000103584.2	0	0	0	62	62	99	0.00	0.00	C			27572085	+1	20	46	42	53	tier1	no_errors	ENST00000333743	ensembl	human	known	74_37	missense	32.26	46.46	SNP	1.000	T	20	42
PCDHA12	56137	genome.wustl.edu	37	5	140256478	140256478	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr5:140256478T>C	ENST00000398631.2	+	1	1421	c.1421T>C	c.(1420-1422)aTc>aCc	p.I474T	PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	474	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCTGCCACATCTTCACGGTG	0.657													ENSG00000251664																									Pancreas(113;759 1672 13322 24104 50104)												0													77.0	82.0	80.0					5																	140256478		2203	4299	6502	SO:0001583	missense	0			-	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1421T>C	5.37:g.140256478T>C	ENSP00000381628:p.Ile474Thr		O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I474T	ENST00000398631.2	37	c.1421	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	T	17.08	3.297498	0.60086	.	.	ENSG00000251664	ENST00000398631	T	0.65178	-0.14	4.77	4.77	0.60923	Cadherin (3);Cadherin-like (1);	.	.	.	.	D	0.83640	0.5298	H	0.94462	3.54	0.24134	N	0.995757	D;D	0.71674	0.998;0.998	D;D	0.80764	0.974;0.994	T	0.76833	-0.2813	9	0.87932	D	0	.	11.864	0.52482	0.0:0.0:0.1457:0.8543	.	474;474	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	474	ENSP00000381628:I474T	ENSP00000381628:I474T	I	+	2	0	PCDHA12	140236662	0.432000	0.25554	1.000000	0.80357	0.989000	0.77384	2.975000	0.49281	1.920000	0.55613	0.529000	0.55759	ATC	-	PCDHA12	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.657	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	0	0	0	195	195	18	0.00	0.00	T	NM_018903		140256478	+1	32	3	128	23	tier1	no_errors	ENST00000398631	ensembl	human	known	74_37	missense	20.00	11.54	SNP	0.997	C	32	128
KLK13	26085	genome.wustl.edu	37	19	51560014	51560014	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr19:51560014G>C	ENST00000595793.1	-	5	706	c.664C>G	c.(664-666)Ctg>Gtg	p.L222V	KLK13_ENST00000595547.1_Missense_Mutation_p.L149V|KLK13_ENST00000335422.3_Missense_Mutation_p.L70V	NM_015596.1	NP_056411.1	Q9UKR3	KLK13_HUMAN	kallikrein-related peptidase 13	222	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				protein processing (GO:0016485)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)	hydrolase activity (GO:0016787)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	16		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		TTACAGACCAGGGGGCCCCCA	0.582													ENSG00000167759																																					0													55.0	59.0	58.0					19																	51560014		2203	4300	6503	SO:0001583	missense	0			-		CCDS12822.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167759		"""Kallikreins"""	6361	protein-coding gene	gene with protein product		605505	"""kallikrein 13"""			16800724, 16800723	Standard	NM_015596		Approved	KLK-L4	uc002pvn.3	Q9UKR3		ENST00000595793.1:c.664C>G	19.37:g.51560014G>C	ENSP00000470555:p.Leu222Val		A7UNK6|Q86VI8|Q9Y433	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L222V	ENST00000595793.1	37	c.664	CCDS12822.1	19	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743654	0.30865	.	.	ENSG00000167759	ENST00000156476;ENST00000335422	D	0.95622	-3.76	4.41	2.18	0.27775	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.38326	N	0.001729	D	0.96043	0.8711	M	0.79693	2.465	0.80722	D	1	D;P;D	0.89917	1.0;0.78;0.982	D;B;P	0.91635	0.999;0.429;0.755	D	0.94022	0.7293	10	0.05525	T	0.97	.	6.7989	0.23740	0.0958:0.3405:0.5637:0.0	.	70;149;222	Q86VI8;Q86VI7;Q9UKR3	.;.;KLK13_HUMAN	V	222;70	ENSP00000334079:L70V	ENSP00000156476:L222V	L	-	1	2	KLK13	56251826	0.790000	0.28787	0.996000	0.52242	0.522000	0.34438	0.986000	0.29590	0.584000	0.29591	-0.189000	0.12847	CTG	-	KLK13	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A		0.582	KLK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK13	HGNC	protein_coding	OTTHUMT00000464298.2	0	0	0	37	37	38	0.00	0.00	G	NM_015596		51560014	-1	15	4	25	23	tier1	no_errors	ENST00000595793	ensembl	human	known	74_37	missense	37.50	13.33	SNP	1.000	C	15	25
ZNF267	10308	genome.wustl.edu	37	16	31927606	31927606	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr16:31927606G>T	ENST00000300870.10	+	4	2245	c.2036G>T	c.(2035-2037)cGg>cTg	p.R679L		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	679					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						ACTACACATCGGAGAAGACAT	0.443													ENSG00000185947																																					0													108.0	97.0	101.0					16																	31927606		2197	4300	6497	SO:0001583	missense	0			-	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.2036G>T	16.37:g.31927606G>T	ENSP00000300870:p.Arg679Leu		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R679L	ENST00000300870.10	37	c.2036	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	10.69	1.422335	0.25639	.	.	ENSG00000185947	ENST00000300870	T	0.14391	2.51	0.468	-0.6	0.11642	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.00841	-1.15	0.09310	N	0.999999	B	0.12013	0.005	B	0.04013	0.001	T	0.37572	-0.9700	9	0.62326	D	0.03	.	3.7501	0.08563	0.6241:0.0:0.3759:0.0	.	679	Q14586	ZN267_HUMAN	L	679	ENSP00000300870:R679L	ENSP00000300870:R679L	R	+	2	0	ZNF267	31835107	0.000000	0.05858	0.097000	0.21041	0.092000	0.18411	-0.008000	0.12788	-0.344000	0.08338	-0.339000	0.08088	CGG	-	ZNF267	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	0	0	0	40	40	47	0.00	0.00	G	NM_003414		31927606	+1	5	15	34	52	tier1	no_errors	ENST00000300870	ensembl	human	known	74_37	missense	12.82	22.39	SNP	0.086	T	5	34
BSDC1	55108	genome.wustl.edu	37	1	32846818	32846818	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr1:32846818C>T	ENST00000455895.2	-	5	442	c.409G>A	c.(409-411)Gat>Aat	p.D137N	BSDC1_ENST00000413080.1_Missense_Mutation_p.D137N|BSDC1_ENST00000341071.7_Missense_Mutation_p.D154N|BSDC1_ENST00000446293.2_Missense_Mutation_p.D154N|BSDC1_ENST00000526031.1_Missense_Mutation_p.D42N|BSDC1_ENST00000449308.1_Missense_Mutation_p.D137N|BSDC1_ENST00000419121.2_Missense_Mutation_p.D81N	NM_001143888.1|NM_018045.6	NP_001137360.1|NP_060515.3	Q9NW68	BSDC1_HUMAN	BSD domain containing 1	137				D -> G (in Ref. 7; AAH26322). {ECO:0000305}.						breast(1)|central_nervous_system(2)|kidney(1)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTCTCACCATCTGGTTCATTA	0.532													ENSG00000160058																																					0													71.0	66.0	68.0					1																	32846818		2203	4300	6503	SO:0001583	missense	0			-	BX641056	CCDS363.2, CCDS44101.1, CCDS44102.1, CCDS44103.1, CCDS72752.1	1p35.1	2008-02-05			ENSG00000160058	ENSG00000160058			25501	protein-coding gene	gene with protein product						12477932	Standard	XM_005270985		Approved	FLJ10276, RP4-811H24.7	uc010ohg.2	Q9NW68	OTTHUMG00000007588	ENST00000455895.2:c.409G>A	1.37:g.32846818C>T	ENSP00000412173:p.Asp137Asn		B4DMS7|B4DTI7|B4DTP7|B4E2X8|Q49AT8|Q68DY6|Q6IAA3|Q6MZK1|Q6UXS1|Q9HAL9	Missense_Mutation	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.D154N	ENST00000455895.2	37	c.460	CCDS363.2	1	.	.	.	.	.	.	.	.	.	.	C	35	5.510510	0.96386	.	.	ENSG00000160058	ENST00000455895;ENST00000413080;ENST00000341071;ENST00000526031;ENST00000419121;ENST00000325745;ENST00000446293;ENST00000449308;ENST00000527163;ENST00000530485	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.78046	0.4222	M	0.67953	2.075	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.996;0.982;0.995;0.995;0.998	T	0.79386	-0.1825	9	0.72032	D	0.01	.	16.8365	0.85958	0.0:1.0:0.0:0.0	.	42;81;154;154;137	Q9NW68-9;Q9NW68-8;Q9NW68-7;Q9NW68-3;Q9NW68	.;.;.;.;BSDC1_HUMAN	N	137;137;154;42;81;137;154;137;71;98	.	ENSP00000317670:D137N	D	-	1	0	BSDC1	32619405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.920000	0.75799	2.724000	0.93272	0.563000	0.77884	GAT	-	BSDC1	-	NULL		0.532	BSDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSDC1	HGNC	protein_coding	OTTHUMT00000020056.3	0	0	0	51	51	121	0.00	0.00	C	NM_018045		32846818	-1	7	18	49	103	tier1	no_errors	ENST00000341071	ensembl	human	known	74_37	missense	12.50	14.63	SNP	1.000	T	7	49
MYH4	4622	genome.wustl.edu	37	17	10347962	10347962	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr17:10347962G>T	ENST00000255381.2	-	39	5736	c.5626C>A	c.(5626-5628)Caa>Aaa	p.Q1876K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1876					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						ACTTTGGTTTGCAATTTGTCC	0.448													ENSG00000264424																																					0													121.0	119.0	120.0					17																	10347962		2203	4300	6503	SO:0001583	missense	0			-		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5626C>A	17.37:g.10347962G>T	ENSP00000255381:p.Gln1876Lys			Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1876K	ENST00000255381.2	37	c.5626	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	G	26.0	4.696669	0.88830	.	.	ENSG00000141048	ENST00000255381	D	0.82803	-1.65	4.79	4.79	0.61399	Myosin tail (1);	0.000000	0.35772	U	0.002995	D	0.93831	0.8027	H	0.95679	3.705	0.58432	D	0.999997	D	0.76494	0.999	D	0.73708	0.981	D	0.95475	0.8555	10	0.87932	D	0	.	18.4037	0.90526	0.0:0.0:1.0:0.0	.	1876	Q9Y623	MYH4_HUMAN	K	1876	ENSP00000255381:Q1876K	ENSP00000255381:Q1876K	Q	-	1	0	MYH4	10288687	1.000000	0.71417	0.985000	0.45067	0.972000	0.66771	9.601000	0.98297	2.642000	0.89623	0.655000	0.94253	CAA	-	MYH4	-	pfam_Myosin_tail		0.448	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	0	0	1	78	78	81	0.00	1.22	G	NM_017533		10347962	-1	11	16	84	79	tier1	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	11.58	16.84	SNP	1.000	T	11	84
C4orf50	389197	genome.wustl.edu	37	4	5990841	5990841	+	5'Flank	SNP	C	C	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr4:5990841C>G	ENST00000324058.5	-	0	0				C4orf50_ENST00000531445.1_Missense_Mutation_p.D220H			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50											breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						CTGTGGTTATCCCGCTCGAGC	0.468													ENSG00000181215																																					0																																										SO:0001631	upstream_gene_variant	0			-	BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971		4.37:g.5990841C>G	Exception_encountered			Missense_Mutation	SNP	NULL	p.D220H	ENST00000324058.5	37	c.658		4	.	.	.	.	.	.	.	.	.	.	C	9.824	1.186675	0.21870	.	.	ENSG00000181215	ENST00000531445	T	0.38240	1.15	4.88	2.1	0.27182	.	.	.	.	.	T	0.35128	0.0921	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.24333	-1.0163	6	0.52906	T	0.07	.	6.8633	0.24079	0.0:0.5649:0.3401:0.095	.	.	.	.	H	220	ENSP00000437121:D220H	ENSP00000437121:D220H	D	-	1	0	C4orf50	6041742	0.019000	0.18553	0.004000	0.12327	0.008000	0.06430	0.764000	0.26532	0.099000	0.17552	0.655000	0.94253	GAT	-	C4orf50	-	NULL		0.468	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		0	0	0	65	65	49	0.00	0.00	C	NM_207405		5990841	-1	14	4	48	31	tier1	no_errors	ENST00000531445	ensembl	human	known	74_37	missense	22.58	11.11	SNP	0.014	G	14	48
RNASEK	440400	genome.wustl.edu	37	17	6915970	6915970	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr17:6915970C>T	ENST00000548577.1	+	1	235	c.85C>T	c.(85-87)Ctt>Ttt	p.L29F	RNASEK_ENST00000552321.1_5'Flank|AC027763.2_ENST00000574377.1_5'Flank|AC040977.1_ENST00000593646.1_Silent_p.K160K|C17orf49_ENST00000546760.1_5'Flank|AC027763.2_ENST00000575727.1_5'Flank|C17orf49_ENST00000552402.1_5'Flank|C17orf49_ENST00000552775.1_5'Flank|AC027763.2_ENST00000573939.1_5'Flank|RNASEK_ENST00000402093.1_5'UTR|RP11-589P10.7_ENST00000572547.1_RNA|C17orf49_ENST00000439424.2_5'Flank|C17orf49_ENST00000546495.1_5'Flank|RNASEK-C17orf49_ENST00000547302.2_5'Flank|AC027763.2_ENST00000399541.2_5'Flank|AC027763.2_ENST00000399540.2_5'Flank	NM_001004333.4	NP_001004333.2	Q6P5S7	RNK_HUMAN	ribonuclease, RNase K	29					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA transcription (GO:0009303)	integral component of membrane (GO:0016021)	endoribonuclease activity (GO:0004521)			lung(1)	1						TCCGAGCCCGCTTGCACCTCG	0.711													ENSG00000219200																																					0													25.0	29.0	28.0					17																	6915970		1945	4133	6078	SO:0001583	missense	0			-	AK289930	CCDS45594.1, CCDS45594.2	17p13.1	2010-10-28				ENSG00000219200			33911	protein-coding gene	gene with protein product						17881363	Standard	NM_001004333		Approved	MGC71993		Q6P5S7		ENST00000548577.1:c.85C>T	17.37:g.6915970C>T	ENSP00000449500:p.Leu29Phe		G3V1Z9|Q502Z2	Missense_Mutation	SNP	NULL	p.L29F	ENST00000548577.1	37	c.85	CCDS45594.2	17	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535712	0.45176	.	.	ENSG00000219200	ENST00000548577	.	.	.	5.17	3.18	0.36537	.	.	.	.	.	T	0.19167	0.0460	N	0.08118	0	0.22330	N	0.999199	.	.	.	.	.	.	T	0.20739	-1.0266	6	0.28530	T	0.3	-10.9152	7.7887	0.29108	0.0:0.8124:0.0:0.1876	.	.	.	.	F	29	.	ENSP00000447072:L29F	L	+	1	0	RNASEK	6856694	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.229000	0.17833	0.755000	0.32990	0.563000	0.77884	CTT	-	RSEK	-	NULL		0.711	RNASEK-001	KNOWN	basic|CCDS	protein_coding	RSEK	HGNC	protein_coding	OTTHUMT00000407651.1	0	0	0	107	107	48	0.00	0.00	C	NM_001004333		6915970	+1	42	19	71	28	tier1	no_errors	ENST00000548577	ensembl	human	known	74_37	missense	37.17	40.43	SNP	0.001	T	42	71
FLRT3	23767	genome.wustl.edu	37	20	14306856	14306856	+	Missense_Mutation	SNP	T	T	C	rs201525960		TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr20:14306856T>C	ENST00000378053.3	-	2	1553	c.1297A>G	c.(1297-1299)Atg>Gtg	p.M433V	MACROD2_ENST00000217246.4_Intron|FLRT3_ENST00000462077.1_5'Flank|FLRT3_ENST00000341420.4_Missense_Mutation_p.M433V|MACROD2_ENST00000310348.4_Intron	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	433	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		AAAGCAGTCATAGGTAGAGCA	0.438													ENSG00000125848																																					0								T	,VAL/MET,VAL/MET	0,4406		0,0,2203	97.0	95.0	96.0		,1297,1297	4.8	1.0	20		96	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense,missense	FLRT3,MACROD2	NM_080676.5,NM_198391.2,NM_013281.3	,21,21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,benign,benign	,433/650,433/650	14306856	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.1297A>G	20.37:g.14306856T>C	ENSP00000367292:p.Met433Val		D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.M433V	ENST00000378053.3	37	c.1297	CCDS13121.1	20	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.870401	0.00542	0.0	1.16E-4	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.37235	1.21;1.21	5.96	4.83	0.62350	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.044525	0.85682	D	0.000000	T	0.21267	0.0512	N	0.24115	0.695	0.58432	D	0.999995	B	0.12630	0.006	B	0.08055	0.003	T	0.07481	-1.0770	10	0.02654	T	1	-10.2114	12.3588	0.55190	0.1265:0.0:0.0:0.8735	.	433	Q9NZU0	FLRT3_HUMAN	V	433	ENSP00000367292:M433V;ENSP00000339912:M433V	ENSP00000339912:M433V	M	-	1	0	FLRT3	14254856	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.119000	0.64679	1.020000	0.39573	0.528000	0.53228	ATG	rs201525960	FLRT3	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.438	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT3	HGNC	protein_coding	OTTHUMT00000078075.1	0	0	0	28	28	99	0.00	0.00	T	NM_013281		14306856	-1	17	39	16	68	tier1	no_errors	ENST00000341420	ensembl	human	known	74_37	missense	51.52	36.11	SNP	1.000	C	17	16
TTN	7273	genome.wustl.edu	37	2	179464295	179464295	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr2:179464295C>G	ENST00000591111.1	-	239	51634	c.51410G>C	c.(51409-51411)aGa>aCa	p.R17137T	TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R9905T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R9838T|TTN_ENST00000460472.2_Missense_Mutation_p.R9713T|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R18778T|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R16210T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17137	Ig-like 102.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACATTCAGTCTCATCTCCTT	0.383													ENSG00000155657																																					0													261.0	257.0	258.0					2																	179464295		1906	4121	6027	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51410G>C	2.37:g.179464295C>G	ENSP00000465570:p.Arg17137Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R16210T	ENST00000591111.1	37	c.48629		2	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803840	0.31869	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.4	5.4	0.78164	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65037	0.2653	L	0.31120	0.905	0.51233	D	0.999917	D;D;D;D	0.57571	0.98;0.98;0.98;0.98	P;P;P;P	0.53224	0.721;0.721;0.721;0.721	T	0.69304	-0.5180	9	0.87932	D	0	.	19.168	0.93565	0.0:1.0:0.0:0.0	.	9713;9838;9905;17137	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	16210;9713;9905;9838;9711	ENSP00000343764:R16210T;ENSP00000434586:R9713T;ENSP00000340554:R9905T;ENSP00000352154:R9838T	ENSP00000340554:R9905T	R	-	2	0	TTN	179172540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.553000	0.36255	2.532000	0.85374	0.650000	0.86243	AGA	-	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like_dom		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	47	47	112	0.00	0.00	C	NM_133378		179464295	-1	11	14	48	116	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	18.64	10.77	SNP	1.000	G	11	48
CELF3	11189	genome.wustl.edu	37	1	151679629	151679629	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr1:151679629G>C	ENST00000290583.4	-	8	1707	c.914C>G	c.(913-915)cCc>cGc	p.P305R	RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000290585.4_Intron|CELF3_ENST00000392706.3_Missense_Mutation_p.P122R|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	305					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						ACCTGGGTAGGGGTGAACCCC	0.647													ENSG00000159409																																					0													28.0	28.0	28.0					1																	151679629		2190	4286	6476	SO:0001583	missense	0			-	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.914C>G	1.37:g.151679629G>C	ENSP00000290583:p.Pro305Arg		B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P305R	ENST00000290583.4	37	c.914	CCDS1002.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.99|17.99	3.522512|3.522512	0.64747|0.64747	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000420342|ENST00000290583;ENST00000392706	T|T;T	0.15603|0.16597	2.41|2.33;3.29	3.86|3.86	3.86|3.86	0.44501|0.44501	.|.	0.067970|0.067970	0.64402|0.64402	D|D	0.000017|0.000017	T|T	0.33059|0.33059	0.0850|0.0850	M|M	0.79693|0.79693	2.465|2.465	0.50171|0.50171	D|D	0.999853|0.999853	.|D;P;P;P	.|0.69078	.|0.997;0.736;0.895;0.937	.|D;P;B;P	.|0.67382	.|0.951;0.692;0.347;0.549	T|T	0.29305|0.29305	-1.0016|-1.0016	8|10	0.34782|0.72032	T|D	0.22|0.01	-5.797|-5.797	14.5324|14.5324	0.67936|0.67936	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|122;305;305;304	.|B4DQL3;Q5SZQ8-2;Q5SZQ8;Q5SZQ8-3	.|.;.;CELF3_HUMAN;.	A|R	306|305;122	ENSP00000402503:P306A|ENSP00000290583:P305R;ENSP00000376470:P122R	ENSP00000402503:P306A|ENSP00000290583:P305R	P|P	-|-	1|2	0|0	CELF3|CELF3	149946253|149946253	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	7.279000|7.279000	0.78599|0.78599	2.008000|2.008000	0.58898|0.58898	0.555000|0.555000	0.69702|0.69702	CCT|CCC	-	CELF3	-	NULL		0.647	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF3	HGNC	protein_coding	OTTHUMT00000036663.2	0	0	0	40	40	37	0.00	0.00	G	NM_007185		151679629	-1	5	12	36	57	tier1	no_errors	ENST00000290583	ensembl	human	known	74_37	missense	12.20	17.39	SNP	1.000	C	5	36
WDR7	23335	genome.wustl.edu	37	18	54423947	54423947	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr18:54423947C>G	ENST00000254442.3	+	15	2334	c.2123C>G	c.(2122-2124)tCt>tGt	p.S708C	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.S708C	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	708					hematopoietic progenitor cell differentiation (GO:0002244)			p.S708F(1)		NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GAAGAAGCCTCTAGGCCGAAT	0.428													ENSG00000091157																																					1	Substitution - Missense(1)	lung(1)											77.0	80.0	79.0					18																	54423947		2203	4300	6503	SO:0001583	missense	0			-	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2123C>G	18.37:g.54423947C>G	ENSP00000254442:p.Ser708Cys		A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S708C	ENST00000254442.3	37	c.2123	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938254	0.73557	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.68331	-0.32;-0.31	5.96	5.96	0.96718	.	0.117676	0.64402	D	0.000010	T	0.64821	0.2633	N	0.19112	0.55	0.50313	D	0.999861	P;D	0.58620	0.473;0.983	B;P	0.50231	0.134;0.635	T	0.68435	-0.5409	10	0.66056	D	0.02	.	19.9958	0.97383	0.0:1.0:0.0:0.0	.	708;708	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	C	708	ENSP00000254442:S708C;ENSP00000350187:S708C	ENSP00000254442:S708C	S	+	2	0	WDR7	52574945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.053000	0.71089	2.826000	0.97356	0.655000	0.94253	TCT	-	WDR7	-	NULL		0.428	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	0	0	0	49	49	118	0.00	0.00	C			54423947	+1	12	13	37	72	tier1	no_errors	ENST00000254442	ensembl	human	known	74_37	missense	24.49	15.29	SNP	1.000	G	12	37
ABCC10	89845	genome.wustl.edu	37	6	43405672	43405672	+	Splice_Site	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr6:43405672G>T	ENST00000372530.4	+	7	2091	c.1876G>T	c.(1876-1878)Ggt>Tgt	p.G626C	ABCC10_ENST00000244533.3_Splice_Site_p.G598C	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	626	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	TTCCTTGCAGGGTATGCTGGT	0.597													ENSG00000124574																																					0													78.0	65.0	70.0					6																	43405672		2203	4300	6503	SO:0001630	splice_region_variant	0			-	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1876-1G>T	6.37:g.43405672G>T			Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.G626C	ENST00000372530.4	37	c.1876	CCDS56430.1	6	.	.	.	.	.	.	.	.	.	.	G	32	5.151832	0.94645	.	.	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.96396	-4.0;-4.0;-4.0	5.56	5.56	0.83823	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.99042	0.9672	H	0.98111	4.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99338	1.0911	9	.	.	.	-47.5666	19.5375	0.95260	0.0:0.0:1.0:0.0	.	598;626	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	C	182;626;598	ENSP00000361593:G182C;ENSP00000361608:G626C;ENSP00000244533:G598C	.	G	+	1	0	ABCC10	43513650	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.333000	0.96459	2.620000	0.88729	0.655000	0.94253	GGT	-	ABCC10	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.597	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC10	HGNC	protein_coding	OTTHUMT00000040603.2	0	0	1	68	68	62	0.00	1.59	G	NM_033450	Missense_Mutation	43405672	+1	9	12	61	61	tier1	no_errors	ENST00000372530	ensembl	human	known	74_37	missense	12.86	16.44	SNP	1.000	T	9	61
NETO1	81832	genome.wustl.edu	37	18	70450953	70450953	+	Silent	SNP	T	T	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr18:70450953T>A	ENST00000327305.6	-	7	1485	c.828A>T	c.(826-828)cgA>cgT	p.R276R	NETO1_ENST00000299430.2_Silent_p.R275R|NETO1_ENST00000583169.1_Silent_p.R276R	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	276	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		ATCGGCTGTTTCGACTGCCCT	0.458													ENSG00000166342																																					0													158.0	139.0	145.0					18																	70450953		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.828A>T	18.37:g.70450953T>A			Q86W85|Q8ND78|Q8TDF4	Silent	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.R276	ENST00000327305.6	37	c.828	CCDS12000.1	18																																																																																			-	NETO1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.458	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	0	0	0	62	62	81	0.00	0.00	T	NM_138999		70450953	-1	11	14	44	71	tier1	no_errors	ENST00000327305	ensembl	human	known	74_37	silent	20.00	16.28	SNP	0.009	A	11	44
AMHR2	269	genome.wustl.edu	37	12	53818234	53818234	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr12:53818234G>A	ENST00000257863.4	+	2	292	c.212G>A	c.(211-213)cGg>cAg	p.R71Q	AMHR2_ENST00000379791.3_Missense_Mutation_p.R71Q|AMHR2_ENST00000550311.1_Missense_Mutation_p.R71Q	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	71					Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	ACCCAAGACCGGGCACAGGTG	0.582													ENSG00000135409																																					0													31.0	32.0	32.0					12																	53818234		2203	4300	6503	SO:0001583	missense	0			-	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.212G>A	12.37:g.53818234G>A	ENSP00000257863:p.Arg71Gln		A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	pirsf_Anti-muellerian_hrmn_rcpt_II,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R71Q	ENST00000257863.4	37	c.212	CCDS8858.1	12	.	.	.	.	.	.	.	.	.	.	G	8.057	0.767338	0.15983	.	.	ENSG00000135409	ENST00000257863;ENST00000550311;ENST00000379791	D;D;D	0.97575	-4.44;-4.44;-4.44	3.98	-2.41	0.06562	TGF-beta receptor/activin receptor, type I/II (1);	0.865133	0.09448	N	0.800821	D	0.88485	0.6449	N	0.04880	-0.145	0.24495	N	0.994283	B;B	0.13145	0.0;0.007	B;B	0.04013	0.001;0.001	T	0.80331	-0.1427	10	0.14656	T	0.56	.	6.111	0.20100	0.213:0.0:0.6091:0.178	.	71;71	F8W1D2;Q16671	.;AMHR2_HUMAN	Q	71	ENSP00000257863:R71Q;ENSP00000446661:R71Q;ENSP00000369117:R71Q	ENSP00000257863:R71Q	R	+	2	0	AMHR2	52104501	0.176000	0.23096	0.995000	0.50966	0.996000	0.88848	-1.350000	0.02624	-0.288000	0.09051	-0.302000	0.09304	CGG	-	AMHR2	-	pirsf_Anti-muellerian_hrmn_rcpt_II,pfam_Activin_rcpt		0.582	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMHR2	HGNC	protein_coding	OTTHUMT00000407048.1	0	0	0	58	58	84	0.00	0.00	G	NM_020547		53818234	+1	7	25	39	67	tier1	no_errors	ENST00000257863	ensembl	human	known	74_37	missense	15.22	27.17	SNP	0.989	A	7	39
C1orf168	199920	genome.wustl.edu	37	1	57185152	57185152	+	3'UTR	SNP	T	T	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr1:57185152T>G	ENST00000343433.6	-	0	2459					NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168											NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						AAGATAACCTTTTAGGAGTAA	0.318													ENSG00000187889																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.*192A>C	1.37:g.57185152T>G			Q63HM3|Q6ZUY6	R	SNP	-	NULL	ENST00000343433.6	37	NULL	CCDS30729.1	1																																																																																			-	C1orf168	-	-		0.318	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf168	HGNC	protein_coding	OTTHUMT00000022751.2	0	0	0	28	28	67	0.00	0.00	T	NM_001004303		57185152	-1	11	16	22	54	tier1	no_errors	ENST00000493000	ensembl	human	known	74_37	rna	33.33	22.86	SNP	0.001	G	11	22
MCM7	4176	genome.wustl.edu	37	7	99697360	99697360	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr7:99697360C>A	ENST00000303887.5	-	3	773	c.128G>T	c.(127-129)cGg>cTg	p.R43L	MCM7_ENST00000343023.6_Missense_Mutation_p.R43L|AP4M1_ENST00000422582.1_5'Flank|MCM7_ENST00000354230.3_5'UTR|AP4M1_ENST00000429084.1_5'Flank|AP4M1_ENST00000359593.4_5'Flank|AP4M1_ENST00000421755.1_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	43					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACCTGTTCCCGATGAGCCAG	0.532													ENSG00000166508																																					0													77.0	72.0	74.0					7																	99697360		2203	4300	6503	SO:0001583	missense	0			-		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.128G>T	7.37:g.99697360C>A	ENSP00000307288:p.Arg43Leu		A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	pfam_MCM_D-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_D-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_D-dep_ATPase,prints_MCM_D-dep_ATPase,prints_MCM7,prints_MCM_4	p.R43L	ENST00000303887.5	37	c.128	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	C	22.9	4.343736	0.82022	.	.	ENSG00000166508	ENST00000343023;ENST00000303887	T;T	0.13538	2.58;2.58	4.4	4.4	0.53042	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.41259	0.1151	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.41627	-0.9498	10	0.23302	T	0.38	.	14.5272	0.67897	0.0:1.0:0.0:0.0	.	43	P33993	MCM7_HUMAN	L	43	ENSP00000344006:R43L;ENSP00000307288:R43L	ENSP00000307288:R43L	R	-	2	0	MCM7	99535296	1.000000	0.71417	1.000000	0.80357	0.323000	0.28346	7.167000	0.77562	2.255000	0.74692	0.557000	0.71058	CGG	-	MCM7	-	superfamily_-bd_OB-fold		0.532	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	0	0	0	55	55	74	0.00	0.00	C			99697360	-1	7	12	45	73	tier1	no_errors	ENST00000303887	ensembl	human	known	74_37	missense	13.46	14.12	SNP	1.000	A	7	45
ABCB11	8647	genome.wustl.edu	37	2	169820724	169820724	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr2:169820724C>A	ENST00000263817.6	-	18	2294	c.2170G>T	c.(2170-2172)Gat>Tat	p.D724Y		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	724					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACCTTTCTATCTTCTTCATAG	0.478													ENSG00000073734																																					0													65.0	79.0	75.0					2																	169820724		1878	4117	5995	SO:0001583	missense	0			-	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.2170G>T	2.37:g.169820724C>A	ENSP00000263817:p.Asp724Tyr		Q53TL2|Q9UNB2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.D724Y	ENST00000263817.6	37	c.2170	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	C	12.56	1.973879	0.34848	.	.	ENSG00000073734	ENST00000263817	D	0.87412	-2.25	4.91	4.91	0.64330	.	2.252610	0.01501	N	0.017502	T	0.80182	0.4576	N	0.03608	-0.345	0.42755	D	0.993783	B;P	0.39131	0.181;0.661	B;B	0.43728	0.116;0.429	T	0.70403	-0.4881	10	0.87932	D	0	.	8.1607	0.31196	0.0:0.7542:0.1605:0.0853	.	166;724	B4DZQ8;O95342	.;ABCBB_HUMAN	Y	724	ENSP00000263817:D724Y	ENSP00000263817:D724Y	D	-	1	0	ABCB11	169528970	0.981000	0.34729	1.000000	0.80357	0.926000	0.56050	0.593000	0.23999	2.277000	0.76020	0.557000	0.71058	GAT	-	ABCB11	-	NULL		0.478	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	0	0	0	37	37	98	0.00	0.00	C	NM_003742		169820724	-1	6	40	35	68	tier1	no_errors	ENST00000263817	ensembl	human	known	74_37	missense	14.63	37.04	SNP	1.000	A	6	35
HYDIN	54768	genome.wustl.edu	37	16	70863604	70863604	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr16:70863604T>A	ENST00000393567.2	-	81	14179	c.14029A>T	c.(14029-14031)Acc>Tcc	p.T4677S		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4677					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCCTCCAGGGTGATGAACTCA	0.592													ENSG00000157423																																					0													1.0	1.0	1.0					16																	70863604		704	1865	2569	SO:0001583	missense	0			-	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.14029A>T	16.37:g.70863604T>A	ENSP00000377197:p.Thr4677Ser		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.T4677S	ENST00000393567.2	37	c.14029	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	T	6.830	0.522286	0.13066	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00856	5.61	5.2	4.09	0.47781	.	0.577219	0.12854	U	0.433734	T	0.00875	0.0029	N	0.17474	0.49	0.35119	D	0.766886	B	0.25169	0.119	B	0.35240	0.198	T	0.52749	-0.8534	10	0.19590	T	0.45	.	5.1746	0.15127	0.0:0.1643:0.2043:0.6314	.	4676	F8WD23	.	S	4677;4676	ENSP00000377197:T4677S	ENSP00000313052:T4676S	T	-	1	0	HYDIN	69421105	0.987000	0.35691	1.000000	0.80357	0.995000	0.86356	0.355000	0.20163	1.975000	0.57531	0.414000	0.27820	ACC	-	HYDIN	-	NULL		0.592	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	0	0	0	68	68	55	0.00	0.00	T			70863604	-1	24	14	49	26	tier1	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	32.43	35.00	SNP	0.293	A	24	49
SNX21	90203	genome.wustl.edu	37	20	44469010	44469010	+	Intron	SNP	A	A	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr20:44469010A>G	ENST00000491381.1	+	4	515				SNX21_ENST00000342644.5_Intron|SNX21_ENST00000372541.1_Intron|SNX21_ENST00000344780.4_Intron|SNX21_ENST00000372542.1_Intron|SNX21_ENST00000462307.1_Intron			Q969T3	SNX21_HUMAN	sorting nexin family member 21						protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	7		Myeloproliferative disorder(115;0.0122)				GTACAAAAAAAGGGGCAGCAG	0.517													ENSG00000124104																																					0													86.0	105.0	99.0					20																	44469010		692	1591	2283	SO:0001627	intron_variant	0			-	AK095851	CCDS13376.1, CCDS13377.1, CCDS42883.1	20q13.12	2013-01-10	2006-07-24	2006-07-24	ENSG00000124104	ENSG00000124104		"""Sorting nexins"", ""Tetratricopeptide (TTC) repeat domain containing"""	16154	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 161"""	C20orf161		12461558, 12459172	Standard	NM_152897		Approved	dJ337O18.4, SNX-L	uc002xpv.1	Q969T3	OTTHUMG00000032624	ENST00000491381.1:c.448-268A>G	20.37:g.44469010A>G			Q5JZH5|Q5JZH6|Q5JZH7|Q8WUR6|Q9BR16	R	SNP	-	NULL	ENST00000491381.1	37	NULL	CCDS13377.1	20																																																																																			-	SNX21	-	-		0.517	SNX21-010	KNOWN	basic|CCDS	protein_coding	SNX21	HGNC	protein_coding	OTTHUMT00000079534.1	0	0	0	79	79	66	0.00	0.00	A	NM_033421		44469010	+1	46	34	31	28	tier1	no_errors	ENST00000465997	ensembl	human	known	74_37	rna	59.74	54.84	SNP	0.001	G	46	31
LRRC16A	55604	genome.wustl.edu	37	6	25606292	25606292	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr6:25606292C>G	ENST00000329474.6	+	35	4006	c.3638C>G	c.(3637-3639)cCt>cGt	p.P1213R		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1213					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						ATCTTAGTGCCTAAACTGCAC	0.453													ENSG00000079691																																					0													37.0	40.0	39.0					6																	25606292		1852	4085	5937	SO:0001583	missense	0			-	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3638C>G	6.37:g.25606292C>G	ENSP00000331983:p.Pro1213Arg		B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.P1213R	ENST00000329474.6	37	c.3638	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932277	0.52866	.	.	ENSG00000079691	ENST00000329474	T	0.15372	2.43	5.85	5.85	0.93711	.	0.382752	0.26662	N	0.023149	T	0.12092	0.0294	L	0.57536	1.79	0.80722	D	1	B	0.32245	0.361	B	0.24006	0.05	T	0.02251	-1.1188	10	0.46703	T	0.11	-9.7339	20.1649	0.98147	0.0:1.0:0.0:0.0	.	1213	Q5VZK9	LR16A_HUMAN	R	1213	ENSP00000331983:P1213R	ENSP00000331983:P1213R	P	+	2	0	LRRC16A	25714271	0.748000	0.28294	1.000000	0.80357	0.873000	0.50193	4.131000	0.57970	2.753000	0.94483	0.655000	0.94253	CCT	-	LRRC16A	-	NULL		0.453	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	0	0	0	55	55	90	0.00	0.00	C	NM_017640		25606292	+1	11	16	29	70	tier1	no_errors	ENST00000329474	ensembl	human	novel	74_37	missense	26.83	18.60	SNP	0.998	G	11	29
OR51G1	79324	genome.wustl.edu	37	11	4944762	4944762	+	Silent	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr11:4944762G>A	ENST00000321961.2	-	1	875	c.808C>T	c.(808-810)Ctg>Ttg	p.L270L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACGCGGGGCAGATGTTCACCA	0.498													ENSG00000176879																																					0													204.0	165.0	178.0					11																	4944762		2201	4298	6499	SO:0001819	synonymous_variant	0			-	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.808C>T	11.37:g.4944762G>A			B9EGW8|Q6IFH6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L270	ENST00000321961.2	37	c.808	CCDS31366.1	11																																																																																			-	OR51G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.498	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	HGNC	protein_coding	OTTHUMT00000142345.1	0	0	0	50	50	77	0.00	0.00	G	NM_001005237		4944762	-1	16	16	76	106	tier1	no_errors	ENST00000321961	ensembl	human	known	74_37	silent	17.39	13.11	SNP	0.046	A	16	76
MGAM	8972	genome.wustl.edu	37	7	141730510	141730510	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr7:141730510A>G	ENST00000549489.2	+	12	1518	c.1423A>G	c.(1423-1425)Aag>Gag	p.K475E	MGAM_ENST00000475668.2_Missense_Mutation_p.K475E	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	475	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTCAGATATGAAGATATGGGT	0.463													ENSG00000257335																																					0													104.0	95.0	98.0					7																	141730510		1884	4122	6006	SO:0001583	missense	0			-	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1423A>G	7.37:g.141730510A>G	ENSP00000447378:p.Lys475Glu		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.K475E	ENST00000549489.2	37	c.1423	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	A	16.56	3.156092	0.57259	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.92858	-3.12	4.99	4.99	0.66335	Glycoside hydrolase, superfamily (1);	0.599063	0.15945	N	0.237003	D	0.86653	0.5984	L	0.39085	1.19	0.29670	N	0.842579	B	0.20550	0.046	B	0.27076	0.076	T	0.77332	-0.2627	10	0.18710	T	0.47	.	8.4636	0.32942	0.9121:0.0:0.0879:0.0	.	475	O43451	MGA_HUMAN	E	475;475;352	ENSP00000447378:K475E	ENSP00000316431:K352E	K	+	1	0	MGAM	141376979	0.998000	0.40836	0.968000	0.41197	0.990000	0.78478	3.411000	0.52672	2.096000	0.63516	0.460000	0.39030	AAG	-	MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF		0.463	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	0	0	0	57	57	96	0.00	0.00	A			141730510	+1	10	21	36	54	tier1	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	21.74	28.00	SNP	1.000	G	10	36
RD3	343035	genome.wustl.edu	37	1	211654609	211654609	+	Missense_Mutation	SNP	G	G	A	rs140156866		TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr1:211654609G>A	ENST00000367002.4	-	2	1312	c.149C>T	c.(148-150)gCg>gTg	p.A50V	RD3_ENST00000484910.1_Intron	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	50					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)					central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		CTTTCTGACCGCATTGCTGCG	0.622													ENSG00000198570																																					0													91.0	87.0	88.0					1																	211654609		2203	4300	6503	SO:0001583	missense	0			-	AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.149C>T	1.37:g.211654609G>A	ENSP00000355969:p.Ala50Val		A8K595	Missense_Mutation	SNP	NULL	p.A50V	ENST00000367002.4	37	c.149	CCDS1498.1	1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353122	0.24512	.	.	ENSG00000198570	ENST00000367002	T	0.14893	2.47	4.85	1.36	0.22044	.	0.259238	0.43416	D	0.000574	T	0.10981	0.0268	L	0.36672	1.1	0.09310	N	0.999991	B	0.26975	0.165	B	0.24974	0.057	T	0.17623	-1.0363	10	0.45353	T	0.12	-28.3592	4.7064	0.12851	0.1938:0.0:0.4501:0.356	.	50	Q7Z3Z2	RD3_HUMAN	V	50	ENSP00000355969:A50V	ENSP00000355969:A50V	A	-	2	0	RD3	209721232	0.092000	0.21681	0.001000	0.08648	0.061000	0.15899	2.720000	0.47252	0.570000	0.29347	-0.254000	0.11334	GCG	-	RD3	-	NULL		0.622	RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RD3	HGNC	protein_coding	OTTHUMT00000089837.1	0	0	0	33	33	37	0.00	0.00	G	NM_183059		211654609	-1	11	11	11	21	tier1	no_errors	ENST00000367002	ensembl	human	known	74_37	missense	50.00	34.38	SNP	0.427	A	11	11
OPA1	4976	genome.wustl.edu	37	3	193361213	193361213	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr3:193361213G>T	ENST00000392438.3	+	12	1426	c.1192G>T	c.(1192-1194)Gac>Tac	p.D398Y	OPA1_ENST00000361715.2_Missense_Mutation_p.D417Y|OPA1_ENST00000361908.3_Missense_Mutation_p.D435Y|OPA1_ENST00000361150.2_Missense_Mutation_p.D399Y|OPA1_ENST00000361828.2_Missense_Mutation_p.D416Y|OPA1_ENST00000361510.2_Missense_Mutation_p.D453Y	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	398	Dynamin-type G.				apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GGTGCTTGTTGACTTACCAGG	0.303													ENSG00000198836																																					0													78.0	84.0	82.0					3																	193361213		2203	4299	6502	SO:0001583	missense	0			-	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.1192G>T	3.37:g.193361213G>T	ENSP00000376233:p.Asp398Tyr		D3DNW4	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.D453Y	ENST00000392438.3	37	c.1357	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852029	0.91355	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.99909	-7.84;-7.84;-7.84;-7.84;-7.84;-7.84	5.79	5.79	0.91817	Dynamin, GTPase domain (2);	0.000000	0.85682	D	0.000000	D	0.99947	0.9977	H	0.98769	4.325	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.96228	0.9166	10	0.87932	D	0	-19.1912	19.0145	0.92888	0.0:0.0:1.0:0.0	.	362;398;380;399;416;435;417;453	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	Y	435;398;453;417;416;399	ENSP00000354681:D435Y;ENSP00000376233:D398Y;ENSP00000355324:D453Y;ENSP00000355311:D417Y;ENSP00000354429:D416Y;ENSP00000354781:D399Y	ENSP00000354781:D399Y	D	+	1	0	OPA1	194843907	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.910000	0.87451	2.735000	0.93741	0.655000	0.94253	GAC	-	OPA1	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF		0.303	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	0	0	1	23	23	80	0.00	1.23	G	NM_130837		193361213	+1	4	14	25	61	tier1	no_errors	ENST00000361510	ensembl	human	known	74_37	missense	13.79	18.67	SNP	1.000	T	4	25
TTC28	23331	genome.wustl.edu	37	22	28394729	28394729	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr22:28394729C>T	ENST00000397906.2	-	16	5059	c.4918G>A	c.(4918-4920)Gcg>Acg	p.A1640T	TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000433317.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000426594.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000434221.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1640					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CTTGTCAGCGCGATGACCCCG	0.612													ENSG00000100154																																					0													29.0	30.0	30.0					22																	28394729		692	1591	2283	SO:0001583	missense	0			-	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.4918G>A	22.37:g.28394729C>T	ENSP00000381003:p.Ala1640Thr		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A1640T	ENST00000397906.2	37	c.4918	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	C	14.30	2.495603	0.44352	.	.	ENSG00000100154	ENST00000397906	D	0.88046	-2.33	4.76	4.76	0.60689	.	0.068828	0.56097	D	0.000027	T	0.81664	0.4870	L	0.38175	1.15	0.44825	D	0.997837	P	0.34997	0.479	B	0.32724	0.151	T	0.82874	-0.0241	10	0.52906	T	0.07	-17.2309	15.3094	0.74019	0.0:1.0:0.0:0.0	.	1640	Q96AY4	TTC28_HUMAN	T	1640	ENSP00000381003:A1640T	ENSP00000381003:A1640T	A	-	1	0	TTC28	26724729	1.000000	0.71417	0.612000	0.29024	0.075000	0.17131	7.441000	0.80485	2.367000	0.80283	0.462000	0.41574	GCG	-	TTC28	-	NULL		0.612	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	0	0	0	40	40	14	0.00	0.00	C	XM_929318		28394729	-1	11	5	54	32	tier1	no_errors	ENST00000397906	ensembl	human	novel	74_37	missense	16.92	13.51	SNP	0.997	T	11	54
DQX1	165545	genome.wustl.edu	37	2	74750508	74750508	+	Missense_Mutation	SNP	A	A	C	rs150732366		TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr2:74750508A>C	ENST00000404568.3	-	5	1192	c.973T>G	c.(973-975)Tgg>Ggg	p.W325G	DQX1_ENST00000495597.1_5'UTR|DQX1_ENST00000393951.2_Missense_Mutation_p.W325G	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	325	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TCAGCCAGCCAGTGAGTGACC	0.572													ENSG00000144045																																					0													219.0	200.0	207.0					2																	74750508		2203	4300	6503	SO:0001583	missense	0			-	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.973T>G	2.37:g.74750508A>C	ENSP00000384621:p.Trp325Gly		Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.W325G	ENST00000404568.3	37	c.973	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	A	13.79	2.342133	0.41498	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.02323	4.34;4.34	5.05	5.05	0.67936	Helicase, C-terminal (1);	0.404876	0.23698	N	0.045443	T	0.02767	0.0083	N	0.25647	0.755	0.32729	N	0.509269	P	0.38504	0.634	B	0.33121	0.158	T	0.25916	-1.0118	10	0.87932	D	0	-15.7956	12.7586	0.57350	1.0:0.0:0.0:0.0	.	325	Q8TE96	DQX1_HUMAN	G	325	ENSP00000377523:W325G;ENSP00000384621:W325G	ENSP00000377523:W325G	W	-	1	0	DQX1	74604016	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.095000	0.41729	1.897000	0.54924	0.459000	0.35465	TGG	-	DQX1	-	superfamily_P-loop_NTPase		0.572	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	HGNC	protein_coding	OTTHUMT00000252230.3	0	0	0	62	62	111	0.00	0.00	A	NM_133637		74750508	-1	11	17	73	102	tier1	no_errors	ENST00000393951	ensembl	human	known	74_37	missense	13.10	14.29	SNP	1.000	C	11	73
LOC101928517	101928517	genome.wustl.edu	37	19	51675387	51675387	+	RNA	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr19:51675387G>A	ENST00000600074.1	-	0	493				SIGLEC17P_ENST00000598286.1_RNA																							TGAAGATCCTGCTTCTCTGCC	0.542													ENSG00000171101																																					0																																												0			-																													19.37:g.51675387G>A				R	SNP	-	NULL	ENST00000600074.1	37	NULL		19																																																																																			-	SIGLEC17P	-	-		0.542	CTD-3187F8.14-001	KNOWN	basic	antisense	SIGLEC17P	HGNC	antisense	OTTHUMT00000465635.1	0	0	0	166	166	122	0.00	0.00	G			51675387	+1	19	19	165	124	tier1	no_errors	ENST00000341811	ensembl	human	known	74_37	rna	10.33	13.29	SNP	0.004	A	19	165
UPF2	26019	genome.wustl.edu	37	10	12071314	12071314	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr10:12071314T>A	ENST00000356352.2	-	2	1048	c.575A>T	c.(574-576)gAt>gTt	p.D192V	UPF2_ENST00000357604.5_Missense_Mutation_p.D192V|UPF2_ENST00000397053.2_Missense_Mutation_p.D192V			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	192	MIF4G 1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				GCCATTAAAATCATGGGACAA	0.388													ENSG00000151461																																					0													90.0	94.0	92.0					10																	12071314		2203	4300	6503	SO:0001583	missense	0			-	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.575A>T	10.37:g.12071314T>A	ENSP00000348708:p.Asp192Val		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.D192V	ENST00000356352.2	37	c.575	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628215	0.66901	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000379172;ENST00000397053;ENST00000313977	T;T;T	0.44482	0.92;0.92;0.92	5.74	5.74	0.90152	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.66228	0.2768	M	0.78285	2.405	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75020	0.943;0.985	T	0.70498	-0.4855	10	0.87932	D	0	.	16.3426	0.83092	0.0:0.0:0.0:1.0	.	162;192	Q9HAU5-2;Q9HAU5	.;RENT2_HUMAN	V	192;192;162;192;162	ENSP00000348708:D192V;ENSP00000350221:D192V;ENSP00000380244:D192V	ENSP00000313617:D162V	D	-	2	0	UPF2	12111320	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.948000	0.87774	2.317000	0.78254	0.460000	0.39030	GAT	-	UPF2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3		0.388	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	0	0	0	70	70	118	0.00	0.00	T			12071314	-1	22	37	54	73	tier1	no_errors	ENST00000356352	ensembl	human	known	74_37	missense	28.95	33.64	SNP	1.000	A	22	54
TTC39A	22996	genome.wustl.edu	37	1	51787459	51787459	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr1:51787459C>G	ENST00000447632.2	-	2	131	c.83G>C	c.(82-84)tGc>tCc	p.C28S	TTC39A_ENST00000371750.5_Missense_Mutation_p.C28S|TTC39A_ENST00000451380.1_Missense_Mutation_p.C27S|TTC39A_ENST00000262676.5_Missense_Mutation_p.C24S|TTC39A_ENST00000262675.7_5'UTR|TTC39A_ENST00000413473.2_Missense_Mutation_p.C31S|TTC39A_ENST00000371747.3_Missense_Mutation_p.C27S			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	28								p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						GGCGGTCATGCACTGGTCCAG	0.637													ENSG00000085831																																					2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											60.0	61.0	61.0					1																	51787459		1976	4174	6150	SO:0001583	missense	0			-	AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.83G>C	1.37:g.51787459C>G	ENSP00000393952:p.Cys28Ser		B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.C28S	ENST00000447632.2	37	c.83		1	.	.	.	.	.	.	.	.	.	.	c	17.16	3.317926	0.60524	.	.	ENSG00000085831	ENST00000447632;ENST00000413473;ENST00000451380;ENST00000371750;ENST00000371747;ENST00000262676;ENST00000439482;ENST00000401051;ENST00000527205	T;T;T;T;T	0.50277	0.8;0.87;0.87;0.87;0.75	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.56247	0.1972	L	0.34521	1.04	0.51233	D	0.99991	B;B;D;D;B;P	0.89917	0.357;0.243;1.0;0.997;0.243;0.538	B;B;D;D;B;B	0.91635	0.444;0.258;0.999;0.926;0.258;0.351	T	0.54990	-0.8210	10	0.40728	T	0.16	-21.6358	13.2391	0.59987	0.0:1.0:0.0:0.0	.	31;27;24;27;28;28	Q5SRH9-4;E7EQY9;Q5SRH9-3;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;TT39A_HUMAN;.	S	28;31;27;28;27;24;27;31;55	ENSP00000393952:C28S;ENSP00000406144:C31S;ENSP00000397207:C27S;ENSP00000360815:C28S;ENSP00000360812:C27S	ENSP00000262676:C24S	C	-	2	0	TTC39A	51560047	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	5.492000	0.66893	2.155000	0.67459	0.176000	0.17051	TGC	-	TTC39A	-	NULL		0.637	TTC39A-004	KNOWN	basic	protein_coding	TTC39A	HGNC	protein_coding	OTTHUMT00000022434.2	0	0	0	76	76	44	0.00	0.00	C			51787459	-1	16	9	54	31	tier1	no_errors	ENST00000447632	ensembl	human	known	74_37	missense	22.86	22.50	SNP	1.000	G	16	54
SH3PXD2B	285590	genome.wustl.edu	37	5	171809057	171809057	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr5:171809057G>T	ENST00000311601.5	-	5	554	c.384C>A	c.(382-384)gaC>gaA	p.D128E	SH3PXD2B_ENST00000519643.1_Missense_Mutation_p.D128E	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	128	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGGATTCAGGTCCTCAGGTC	0.567													ENSG00000174705																																					0													26.0	27.0	27.0					5																	171809057		2203	4300	6503	SO:0001583	missense	0			-	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.384C>A	5.37:g.171809057G>T	ENSP00000309714:p.Asp128Glu		B6F0V2|Q9P2Q1	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac-type,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.D128E	ENST00000311601.5	37	c.384	CCDS34291.1	5	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032460	0.75504	.	.	ENSG00000174705	ENST00000519643;ENST00000311601	T;T	0.72394	-0.65;-0.65	5.79	4.74	0.60224	Phox homologous domain (3);	0.000000	0.85682	D	0.000000	D	0.84065	0.5390	M	0.88570	2.965	0.54753	D	0.999987	D	0.89917	1.0	D	0.80764	0.994	D	0.85599	0.1251	10	0.87932	D	0	-42.9529	8.839	0.35131	0.1719:0.0:0.8281:0.0	.	128	A1X283	SPD2B_HUMAN	E	128	ENSP00000430890:D128E;ENSP00000309714:D128E	ENSP00000309714:D128E	D	-	3	2	SH3PXD2B	171741662	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.189000	0.58358	2.731000	0.93534	0.650000	0.86243	GAC	-	SH3PXD2B	-	superfamily_Phox,pfscan_Phox		0.567	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	0	0	0	56	56	50	0.00	0.00	G	NM_017963		171809057	-1	9	9	59	31	tier1	no_errors	ENST00000311601	ensembl	human	known	74_37	missense	13.24	22.50	SNP	1.000	T	9	59
AK8	158067	genome.wustl.edu	37	9	135668027	135668027	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr9:135668027G>A	ENST00000298545.3	-	11	1636	c.1115C>T	c.(1114-1116)cCc>cTc	p.P372L	AK8_ENST00000477396.1_5'UTR	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	372	Adenylate kinase 2.				nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						TCACCTGTTGGGATTGTAGCC	0.662													ENSG00000165695																																					0													18.0	17.0	17.0					9																	135668027		2171	4252	6423	SO:0001583	missense	0			-	AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.1115C>T	9.37:g.135668027G>A	ENSP00000298545:p.Pro372Leu		A8K821|Q8N9W9	Missense_Mutation	SNP	pfam_Adenylate_kin,superfamily_P-loop_NTPase,superfamily_Adenylate_kinase_lid-dom,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin	p.P372L	ENST00000298545.3	37	c.1115	CCDS6954.1	9	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463690	0.63513	.	.	ENSG00000165695	ENST00000298545	T	0.74106	-0.81	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.77329	0.4114	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70267	-0.4919	10	0.02654	T	1	-18.8307	16.2823	0.82697	0.0:0.0:1.0:0.0	.	372	Q96MA6	KAD8_HUMAN	L	372	ENSP00000298545:P372L	ENSP00000298545:P372L	P	-	2	0	AK8	134657848	1.000000	0.71417	0.998000	0.56505	0.354000	0.29330	6.785000	0.75089	2.590000	0.87494	0.561000	0.74099	CCC	-	AK8	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase		0.662	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK8	HGNC	protein_coding	OTTHUMT00000055413.1	0	0	0	64	64	17	0.00	0.00	G	NM_152572		135668027	-1	15	4	44	17	tier1	no_errors	ENST00000298545	ensembl	human	known	74_37	missense	25.42	19.05	SNP	1.000	A	15	44
MMP3	4314	genome.wustl.edu	37	11	102714172	102714172	+	Splice_Site	SNP	C	C	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr11:102714172C>A	ENST00000299855.5	-	1	362		c.e1+1			NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)						cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	GTGTTAATTACCTGAACAAGG	0.488													ENSG00000149968																																					0													115.0	97.0	103.0					11																	102714172		2203	4299	6502	SO:0001630	splice_region_variant	0			-	X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.105+1G>T	11.37:g.102714172C>A			B2R8B8|Q3B7S0|Q6GRF8	Splice_Site	SNP	-	e1+1	ENST00000299855.5	37	c.105+1	CCDS8323.1	11	.	.	.	.	.	.	.	.	.	.	C	8.079	0.772059	0.16051	.	.	ENSG00000149968	ENST00000299855	.	.	.	5.18	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1729	0.59609	0.1608:0.8392:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MMP3	102219382	1.000000	0.71417	0.999000	0.59377	0.037000	0.13140	4.614000	0.61183	1.537000	0.49254	-0.188000	0.12872	.	-	MMP3	-	-		0.488	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP3	HGNC	protein_coding	OTTHUMT00000109758.2	0	0	0	74	74	81	0.00	0.00	C	NM_002422	Intron	102714172	-1	11	10	59	40	tier1	no_errors	ENST00000299855	ensembl	human	known	74_37	splice_site	15.71	20.00	SNP	1.000	A	11	59
PHLDB1	23187	genome.wustl.edu	37	11	118509660	118509660	+	Missense_Mutation	SNP	G	G	T	rs577320042		TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr11:118509660G>T	ENST00000361417.2	+	12	2998	c.2587G>T	c.(2587-2589)Gtg>Ttg	p.V863L	PHLDB1_ENST00000527898.1_5'UTR|PHLDB1_ENST00000356063.5_Missense_Mutation_p.V863L|AP002954.3_ENST00000530198.1_RNA|PHLDB1_ENST00000524713.1_5'Flank|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	863										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GGCTCAGGCCGTGCAGGAATC	0.622													ENSG00000019144																																					0													36.0	34.0	35.0					11																	118509660		2200	4295	6495	SO:0001583	missense	0			-		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2587G>T	11.37:g.118509660G>T	ENSP00000354498:p.Val863Leu		B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V863L	ENST00000361417.2	37	c.2587	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	17.02	3.283177	0.59867	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063	T;T	0.41400	1.0;1.0	4.22	4.22	0.49857	.	0.714896	0.13053	N	0.417505	T	0.40670	0.1126	L	0.36672	1.1	0.80722	D	1	P;P;P;P	0.45348	0.63;0.856;0.705;0.737	B;P;B;B	0.48654	0.095;0.585;0.181;0.242	T	0.04242	-1.0966	10	0.19590	T	0.45	-23.0964	12.3827	0.55315	0.0852:0.0:0.9148:0.0	.	607;863;863;863	Q5W9G0;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	L	863;622;227;863	ENSP00000354498:V863L;ENSP00000348359:V863L	ENSP00000348359:V863L	V	+	1	0	PHLDB1	118014870	0.989000	0.36119	0.957000	0.39632	0.886000	0.51366	1.917000	0.39996	2.171000	0.68590	0.563000	0.77884	GTG	-	PHLDB1	-	NULL		0.622	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	0	0	0	104	104	39	0.00	0.00	G	NM_015157		118509660	+1	8	7	90	43	tier1	no_errors	ENST00000361417	ensembl	human	known	74_37	missense	8.16	14.00	SNP	0.839	T	8	90
FUT9	10690	genome.wustl.edu	37	6	96651911	96651911	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr6:96651911T>A	ENST00000302103.5	+	3	1206	c.880T>A	c.(880-882)Tct>Act	p.S294T		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	294					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		AGATTATAACTCTCCCAGTGA	0.383													ENSG00000172461																									Melanoma(98;1369 1476 6592 22940 26587)												0													67.0	66.0	67.0					6																	96651911		2203	4300	6503	SO:0001583	missense	0			-	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.880T>A	6.37:g.96651911T>A	ENSP00000302599:p.Ser294Thr		Q5T0W4	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.S294T	ENST00000302103.5	37	c.880	CCDS5033.1	6	.	.	.	.	.	.	.	.	.	.	T	18.05	3.537307	0.65085	.	.	ENSG00000172461	ENST00000302103	T	0.35605	1.3	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	L	0.53729	1.69	0.80722	D	1	P	0.50943	0.94	P	0.58391	0.838	T	0.27434	-1.0074	10	0.48119	T	0.1	-15.9225	14.7805	0.69764	0.0:0.0:0.0:1.0	.	294	Q9Y231	FUT9_HUMAN	T	294	ENSP00000302599:S294T	ENSP00000302599:S294T	S	+	1	0	FUT9	96758632	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.091000	0.63221	0.383000	0.25322	TCT	-	FUT9	-	pfam_Glyco_trans_10		0.383	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT9	HGNC	protein_coding	OTTHUMT00000041554.2	0	0	0	20	20	91	0.00	0.00	T	NM_006581		96651911	+1	6	16	26	111	tier1	no_errors	ENST00000302103	ensembl	human	known	74_37	missense	18.75	12.60	SNP	1.000	A	6	26
MYO18B	84700	genome.wustl.edu	37	22	26176054	26176054	+	Silent	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr22:26176054C>T	ENST00000407587.2	+	9	2269	c.2100C>T	c.(2098-2100)ctC>ctT	p.L700L	MYO18B_ENST00000536101.1_Silent_p.L700L|MYO18B_ENST00000335473.7_Silent_p.L700L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	700	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TCACTGTCCTCCGGGCCTTCG	0.627													ENSG00000133454																																					0													19.0	23.0	21.0					22																	26176054		2078	4190	6268	SO:0001819	synonymous_variant	0			-	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2100C>T	22.37:g.26176054C>T			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tR-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L700	ENST00000407587.2	37	c.2100		22																																																																																			-	MYO18B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom		0.627	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	0	0	0	77	77	31	0.00	0.00	C	NM_032608		26176054	+1	43	14	64	25	tier1	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	40.19	35.90	SNP	0.843	T	43	64
PLB1	151056	genome.wustl.edu	37	2	28812626	28812626	+	Missense_Mutation	SNP	T	T	A	rs376120544		TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr2:28812626T>A	ENST00000327757.5	+	28	2049	c.2005T>A	c.(2005-2007)Tgg>Agg	p.W669R	PLB1_ENST00000422425.2_Missense_Mutation_p.W658R|PLB1_ENST00000329020.6_Missense_Mutation_p.W357R	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	669	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					CAGTGCTCTCTGGAACAATAT	0.532													ENSG00000163803																																					0													62.0	63.0	62.0					2																	28812626		2203	4300	6503	SO:0001583	missense	0			-		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2005T>A	2.37:g.28812626T>A	ENSP00000330442:p.Trp669Arg		A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	pfam_Lipase_GDSL	p.W658R	ENST00000327757.5	37	c.1972	CCDS33168.1	2	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940710	0.52972	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.73	5.73	0.89815	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	M	0.94142	3.5	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.85249	0.1043	10	0.87932	D	0	-13.4894	13.8321	0.63386	0.0:0.0:0.0:1.0	.	658;669;357;669	Q6P1J6-3;Q6P1J6-4;Q6P1J6-2;Q6P1J6	.;.;.;PLB1_HUMAN	R	669;658;379;357	ENSP00000330442:W669R;ENSP00000416440:W658R;ENSP00000392493:W379R;ENSP00000330729:W357R	ENSP00000330442:W669R	W	+	1	0	PLB1	28666130	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	6.756000	0.74919	2.308000	0.77769	0.533000	0.62120	TGG	-	PLB1	-	NULL		0.532	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PLB1	HGNC	protein_coding	OTTHUMT00000353348.2	0	0	0	22	22	39	0.00	0.00	T			28812626	+1	6	13	16	40	tier1	no_errors	ENST00000422425	ensembl	human	known	74_37	missense	27.27	24.53	SNP	1.000	A	6	16
ZNF267	10308	genome.wustl.edu	37	16	31927605	31927605	+	Silent	SNP	C	C	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr16:31927605C>A	ENST00000300870.10	+	4	2244	c.2035C>A	c.(2035-2037)Cgg>Agg	p.R679R		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	679					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						CACTACACATCGGAGAAGACA	0.443													ENSG00000185947																																					0													107.0	97.0	100.0					16																	31927605		2197	4300	6497	SO:0001819	synonymous_variant	0			-	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.2035C>A	16.37:g.31927605C>A			A0JNZ9|Q8NE41|Q9NRJ0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R679	ENST00000300870.10	37	c.2035	CCDS32440.1	16																																																																																			-	ZNF267	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	0	0	0	40	40	44	0.00	0.00	C	NM_003414		31927605	+1	5	15	34	51	tier1	no_errors	ENST00000300870	ensembl	human	known	74_37	silent	12.82	22.73	SNP	0.090	A	5	34
CACNA1C	775	genome.wustl.edu	37	12	2224604	2224604	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr12:2224604A>T	ENST00000347598.4	+	2	264	c.264A>T	c.(262-264)aaA>aaT	p.K88N	CACNA1C_ENST00000399637.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399617.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399655.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000402845.3_Missense_Mutation_p.K88N|CACNA1C_ENST00000399634.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399629.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399597.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000480911.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000335762.5_Missense_Mutation_p.K88N|CACNA1C_ENST00000399641.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399621.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399649.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399644.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000406454.3_Missense_Mutation_p.K88N|CACNA1C_ENST00000344100.3_Missense_Mutation_p.K88N|CACNA1C_ENST00000399606.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000327702.7_Missense_Mutation_p.K88N|CACNA1C_ENST00000399591.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399601.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399595.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399638.1_Missense_Mutation_p.K88N|CACNA1C_ENST00000399603.1_Missense_Mutation_p.K88N	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	88					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AATATGGGAAACCCAAGAAGC	0.652													ENSG00000151067																																					0													26.0	35.0	32.0					12																	2224604		2175	4280	6455	SO:0001583	missense	0			-	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.264A>T	12.37:g.2224604A>T	ENSP00000266376:p.Lys88Asn		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.K88N	ENST00000347598.4	37	c.264	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	A	23.8	4.457075	0.84317	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56	5.58	-7.55	0.01327	.	0.278854	0.30320	N	0.009895	T	0.59418	0.2192	L	0.45285	1.41	0.43579	D	0.995912	D;D;P;D;D;D;D;D;D;D;D;D;P;D;B;D;D;D;D;D	0.89917	1.0;1.0;0.645;0.996;0.996;1.0;0.997;0.98;0.999;0.996;1.0;0.998;0.887;0.996;0.367;1.0;0.996;0.996;1.0;1.0	D;D;B;D;D;D;D;D;D;D;D;D;P;D;B;D;D;D;D;D	0.83275	0.996;0.996;0.299;0.99;0.99;0.996;0.993;0.93;0.972;0.99;0.996;0.995;0.578;0.99;0.157;0.996;0.99;0.99;0.996;0.996	T	0.69150	-0.5221	9	.	.	.	.	20.1811	0.98205	0.3025:0.0:0.6975:0.0	.	88;88;88;88;88;88;88;88;88;88;88;88;88;88;88;88;88;88;88;88	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	N	88	ENSP00000336982:K88N;ENSP00000382563:K88N;ENSP00000437936:K88N;ENSP00000382552:K88N;ENSP00000382547:K88N;ENSP00000382506:K88N;ENSP00000382530:K88N;ENSP00000382546:K88N;ENSP00000382500:K88N;ENSP00000382549:K88N;ENSP00000266376:K88N;ENSP00000382515:K88N;ENSP00000382510:K88N;ENSP00000341092:K88N;ENSP00000382537:K88N;ENSP00000329877:K88N;ENSP00000382557:K88N;ENSP00000385724:K88N;ENSP00000382512:K88N;ENSP00000382542:K88N;ENSP00000382526:K88N;ENSP00000385896:K88N;ENSP00000382504:K88N	.	K	+	3	2	CACNA1C	2094865	0.236000	0.23804	0.870000	0.34147	0.962000	0.63368	-0.342000	0.07801	-1.483000	0.01858	-0.375000	0.07067	AAA	-	CAC1C	-	NULL		0.652	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CAC1C	HGNC	protein_coding	OTTHUMT00000317035.1	0	0	0	66	66	37	0.00	0.00	A	NM_000719		2224604	+1	7	7	68	40	tier1	no_errors	ENST00000399634	ensembl	human	known	74_37	missense	9.09	14.89	SNP	0.697	T	7	68
CHAF1A	10036	genome.wustl.edu	37	19	4442306	4442306	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr19:4442306A>C	ENST00000301280.5	+	14	2839	c.2738A>C	c.(2737-2739)gAc>gCc	p.D913A		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	913	Binds to p60.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		gaggaggGCGACTGTATGATC	0.582								Chromatin Structure					ENSG00000167670																																					0													131.0	88.0	103.0					19																	4442306		2203	4300	6503	SO:0001583	missense	0			-	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.2738A>C	19.37:g.4442306A>C	ENSP00000301280:p.Asp913Ala		Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A	p.D913A	ENST00000301280.5	37	c.2738	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	A	14.74	2.625144	0.46840	.	.	ENSG00000167670	ENST00000301280	T	0.33654	1.4	5.02	3.96	0.45880	.	.	.	.	.	T	0.52757	0.1754	M	0.65498	2.005	0.51233	D	0.999918	D	0.76494	0.999	P	0.61874	0.895	T	0.54873	-0.8228	9	0.87932	D	0	-28.1626	11.1284	0.48333	0.8449:0.1551:0.0:0.0	.	913	Q13111	CAF1A_HUMAN	A	913	ENSP00000301280:D913A	ENSP00000301280:D913A	D	+	2	0	CHAF1A	4393306	1.000000	0.71417	0.249000	0.24280	0.030000	0.12068	5.367000	0.66127	0.806000	0.34183	0.459000	0.35465	GAC	-	CHAF1A	-	NULL		0.582	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	0	0	0	68	68	23	0.00	0.00	A	NM_005483		4442306	+1	7	8	68	28	tier1	no_errors	ENST00000301280	ensembl	human	known	74_37	missense	9.33	22.22	SNP	1.000	C	7	68
ZNF311	282890	genome.wustl.edu	37	6	28963898	28963898	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr6:28963898C>T	ENST00000377179.3	-	7	1393	c.881G>A	c.(880-882)cGg>cAg	p.R294Q	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						GTGGATTATCCGGTGCATAGA	0.443													ENSG00000197935																																					0													81.0	88.0	85.0					6																	28963898		1511	2707	4218	SO:0001583	missense	0			-	AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.881G>A	6.37:g.28963898C>T	ENSP00000366384:p.Arg294Gln		A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R294Q	ENST00000377179.3	37	c.881	CCDS34357.1	6	.	.	.	.	.	.	.	.	.	.	T	1.237	-0.622456	0.03636	.	.	ENSG00000197935	ENST00000377179;ENST00000535083	T	0.17691	2.26	3.55	-3.62	0.04543	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01870	0.0059	N	0.25789	0.76	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46148	-0.9212	9	0.02654	T	1	-0.0075	6.3348	0.21291	0.1664:0.5455:0.0:0.2882	.	294	Q5JNZ3	ZN311_HUMAN	Q	294;202	ENSP00000366384:R294Q	ENSP00000366384:R294Q	R	-	2	0	ZNF311	29071877	0.000000	0.05858	0.123000	0.21794	0.800000	0.45204	-0.428000	0.06991	-1.061000	0.03185	-0.524000	0.04348	CGG	-	ZNF311	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF311	HGNC	protein_coding	OTTHUMT00000076631.3	0	0	0	59	59	123	0.00	0.00	C	XM_212581		28963898	-1	8	20	67	99	tier1	no_errors	ENST00000377179	ensembl	human	known	74_37	missense	10.67	16.81	SNP	0.864	T	8	67
MYO5B	4645	genome.wustl.edu	37	18	47421361	47421361	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr18:47421361G>T	ENST00000285039.7	-	22	3294	c.2995C>A	c.(2995-2997)Cgc>Agc	p.R999S	MYO5B_ENST00000324581.6_Missense_Mutation_p.R140S	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	999					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AAGATCTTGCGCTCCGAGTGG	0.647													ENSG00000167306																																					0													64.0	69.0	67.0					18																	47421361		2080	4200	6280	SO:0001583	missense	0			-	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.2995C>A	18.37:g.47421361G>T	ENSP00000285039:p.Arg999Ser		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R999S	ENST00000285039.7	37	c.2995	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	21.3	4.131949	0.77662	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.20200	2.09;2.09	5.81	4.87	0.63330	.	0.309199	0.32608	N	0.005874	T	0.17704	0.0425	L	0.40543	1.245	0.53688	D	0.999971	B;D	0.54397	0.04;0.966	B;B	0.43916	0.031;0.436	T	0.01639	-1.1306	10	0.15499	T	0.54	.	11.3569	0.49621	0.0:0.0:0.6245:0.3755	.	999;140	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	S	999;140	ENSP00000285039:R999S;ENSP00000315531:R140S	ENSP00000285039:R999S	R	-	1	0	MYO5B	45675359	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	3.770000	0.55310	2.746000	0.94184	0.591000	0.81541	CGC	-	MYO5B	-	NULL		0.647	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	0	0	0	75	75	27	0.00	0.00	G			47421361	-1	5	5	48	23	tier1	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	9.43	17.86	SNP	1.000	T	5	48
PTPRU	10076	genome.wustl.edu	37	1	29587188	29587188	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr1:29587188T>A	ENST00000345512.3	+	7	1046	c.917T>A	c.(916-918)cTc>cAc	p.L306H	PTPRU_ENST00000356870.3_Missense_Mutation_p.L306H|PTPRU_ENST00000323874.8_Missense_Mutation_p.L306H|PTPRU_ENST00000373779.3_Missense_Mutation_p.L306H|PTPRU_ENST00000428026.2_Missense_Mutation_p.L306H|PTPRU_ENST00000460170.2_Missense_Mutation_p.L306H	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	306	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ATCATCCAGCTCAACACCAAC	0.677													ENSG00000060656																																					0													79.0	74.0	76.0					1																	29587188		2203	4300	6503	SO:0001583	missense	0			-	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.917T>A	1.37:g.29587188T>A	ENSP00000334941:p.Leu306His		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.L306H	ENST00000345512.3	37	c.917	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.045018	0.93685	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56	5.12	5.12	0.69794	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000005	T	0.73745	0.3626	M	0.83692	2.655	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.997;0.997;0.997;0.998;0.998	T	0.77227	-0.2665	9	.	.	.	.	14.1051	0.65083	0.0:0.0:0.0:1.0	.	306;306;306;306;306	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	H	306	ENSP00000334941:L306H;ENSP00000362884:L306H;ENSP00000349333:L306H;ENSP00000314987:L306H;ENSP00000392332:L306H;ENSP00000432906:L306H	.	L	+	2	0	PTPRU	29459775	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.025000	0.88777	1.913000	0.55393	0.379000	0.24179	CTC	-	PTPRU	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.677	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	0	0	0	85	85	23	0.00	0.00	T			29587188	+1	9	3	66	20	tier1	no_errors	ENST00000345512	ensembl	human	known	74_37	missense	12.00	13.04	SNP	1.000	A	9	66
FLRT3	23767	genome.wustl.edu	37	20	14307796	14307796	+	Silent	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr20:14307796G>A	ENST00000378053.3	-	2	613	c.357C>T	c.(355-357)atC>atT	p.I119I	MACROD2_ENST00000217246.4_Intron|FLRT3_ENST00000462077.1_5'Flank|FLRT3_ENST00000341420.4_Silent_p.I119I|MACROD2_ENST00000310348.4_Intron	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	119					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		AATCATAAGTGATAGTCCTTA	0.348													ENSG00000125848																																					0													145.0	151.0	149.0					20																	14307796		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.357C>T	20.37:g.14307796G>A			D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.I119	ENST00000378053.3	37	c.357	CCDS13121.1	20																																																																																			-	FLRT3	-	NULL		0.348	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT3	HGNC	protein_coding	OTTHUMT00000078075.1	0	0	0	44	44	108	0.00	0.00	G	NM_013281		14307796	-1	9	17	43	88	tier1	no_errors	ENST00000341420	ensembl	human	known	74_37	silent	17.31	16.19	SNP	1.000	A	9	43
LAIR2	3904	genome.wustl.edu	37	19	55019149	55019149	+	Silent	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr19:55019149G>T	ENST00000301202.2	+	3	236	c.114G>T	c.(112-114)gtG>gtT	p.V38V	LAIR2_ENST00000351841.2_Silent_p.V38V	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	38	Ig-like C2-type.					extracellular region (GO:0005576)				central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		CAGGCACTGTGATCTCCCCGG	0.572													ENSG00000167618																																					0													108.0	119.0	115.0					19																	55019149		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.114G>T	19.37:g.55019149G>T			Q6PEZ4	Silent	SNP	smart_Ig_sub	p.V38	ENST00000301202.2	37	c.114	CCDS12897.1	19																																																																																			-	LAIR2	-	smart_Ig_sub		0.572	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR2	HGNC	protein_coding	OTTHUMT00000140801.1	0	0	0	30	30	16	0.00	0.00	G			55019149	+1	5	3	43	17	tier1	no_errors	ENST00000301202	ensembl	human	known	74_37	silent	10.42	15.00	SNP	0.003	T	5	43
ASAP1	50807	genome.wustl.edu	37	8	131149206	131149206	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr8:131149206G>T	ENST00000518721.1	-	14	1386	c.1159C>A	c.(1159-1161)Ctg>Atg	p.L387M	ASAP1_ENST00000357668.1_Missense_Mutation_p.L387M	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	387	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CGTGATATCAGGTCAAAAGAT	0.438													ENSG00000153317																																					0													186.0	173.0	178.0					8																	131149206		2203	4300	6503	SO:0001583	missense	0			-	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1159C>A	8.37:g.131149206G>T	ENSP00000429900:p.Leu387Met		B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.L387M	ENST00000518721.1	37	c.1159	CCDS6362.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.5|27.5	4.839159|4.839159	0.91117|0.91117	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721|ENST00000524124	T;T|.	0.78595|.	-1.19;-1.19|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87285|0.87285	0.6139|0.6139	M|M	0.93197|0.93197	3.39|3.39	0.80722|0.80722	D|D	1|1	D;D;D|.	0.69078|.	0.997;0.997;0.997|.	D;D;D|.	0.91635|.	0.999;0.999;0.998|.	D|D	0.89589|0.89589	0.3826|0.3826	10|5	0.72032|.	D|.	0.01|.	.|.	19.3629|19.3629	0.94448|0.94448	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	387;387;390|.	B2RNV3;Q9ULH1;Q9ULH1-2|.	.;ASAP1_HUMAN;.|.	M|H	390;387;387|207	ENSP00000350297:L387M;ENSP00000429900:L387M|.	ENSP00000344591:L390M|.	L|P	-|-	1|2	2|0	ASAP1|ASAP1	131218388|131218388	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.595000|7.595000	0.82710|0.82710	2.817000|2.817000	0.96982|0.96982	0.563000|0.563000	0.77884|0.77884	CTG|CCT	-	ASAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.438	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	0	0	0	55	55	134	0.00	0.00	G	NM_018482		131149206	-1	5	17	54	139	tier1	no_errors	ENST00000357668	ensembl	human	known	74_37	missense	8.47	10.90	SNP	1.000	T	5	54
NPAS3	64067	genome.wustl.edu	37	14	33836422	33836422	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr14:33836422G>T	ENST00000356141.4	+	4	416	c.416G>T	c.(415-417)aGt>aTt	p.S139I	NPAS3_ENST00000341321.4_Missense_Mutation_p.S139I|NPAS3_ENST00000547068.1_Missense_Mutation_p.S35I|NPAS3_ENST00000551008.1_Missense_Mutation_p.S37I|NPAS3_ENST00000357798.5_Missense_Mutation_p.S126I|NPAS3_ENST00000551492.1_Missense_Mutation_p.S144I|NPAS3_ENST00000548645.1_Missense_Mutation_p.S109I|NPAS3_ENST00000346562.2_Missense_Mutation_p.S107I			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	139					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		AGAAGCCCCAGTGCACTAGCC	0.348													ENSG00000151322																																					0													59.0	58.0	59.0					14																	33836422		2203	4300	6503	SO:0001583	missense	0			-	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.416G>T	14.37:g.33836422G>T	ENSP00000348460:p.Ser139Ile		Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pfscan_PAS,pfscan_bHLH_dom	p.S139I	ENST00000356141.4	37	c.416	CCDS53891.1	14	.	.	.	.	.	.	.	.	.	.	G	16.86	3.240498	0.58995	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798;ENST00000547068;ENST00000551008;ENST00000546849	T;T;T;T;T;T;T	0.48836	3.36;3.16;3.18;0.8;3.23;3.22;3.16	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.38161	0.1030	N	0.19112	0.55	0.52501	D	0.999952	B;P;P;P;P	0.46784	0.253;0.884;0.815;0.884;0.806	B;B;B;B;B	0.40901	0.168;0.283;0.147;0.283;0.343	T	0.29119	-1.0022	10	0.46703	T	0.11	.	19.4614	0.94918	0.0:0.0:1.0:0.0	.	37;109;139;107;126	F8W0C2;Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;.;NPAS3_HUMAN;.;.	I	116;144;107;139;109;139;126;35;37;49	ENSP00000448373:S116I;ENSP00000450392:S144I;ENSP00000319610:S107I;ENSP00000344158:S139I;ENSP00000448916:S109I;ENSP00000348460:S139I;ENSP00000350446:S126I	ENSP00000344158:S139I	S	+	2	0	NPAS3	32906173	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.138000	0.71717	2.607000	0.88179	0.655000	0.94253	AGT	-	NPAS3	-	NULL		0.348	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	HGNC	protein_coding	OTTHUMT00000276645.1	0	0	0	50	50	85	0.00	0.00	G			33836422	+1	7	13	29	57	tier1	no_errors	ENST00000356141	ensembl	human	known	74_37	missense	19.44	18.57	SNP	1.000	T	7	29
DNAH14	127602	genome.wustl.edu	37	1	225586340	225586340	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr1:225586340T>A	ENST00000445597.2	+	60	10280	c.10280T>A	c.(10279-10281)tTt>tAt	p.F3427Y	DNAH14_ENST00000439375.2_Missense_Mutation_p.F4435Y|DNAH14_ENST00000430092.1_Missense_Mutation_p.F4435Y			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3427					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TGCTGTGATTTTCCCGACATA	0.418													ENSG00000185842																																					0													131.0	109.0	116.0					1																	225586340		692	1591	2283	SO:0001583	missense	0			-	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.10280T>A	1.37:g.225586340T>A	ENSP00000409472:p.Phe3427Tyr		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.F4435Y	ENST00000445597.2	37	c.13304		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.3|23.3	4.396913|4.396913	0.83120|0.83120	.|.	.|.	ENSG00000185842|ENSG00000185842	ENST00000428003|ENST00000445597;ENST00000430092;ENST00000439375	.|T;T;T	.|0.08458	.|3.09;3.09;3.09	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|.	.|.	.|.	.|.	T|T	0.20455|0.20455	0.0492|0.0492	L|L	0.43923|0.43923	1.385|1.385	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.71656	.|0.974	T|T	0.00294|0.00294	-1.1840|-1.1840	5|9	.|0.87932	.|D	.|0	.|.	13.1239|13.1239	0.59342|0.59342	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|4435	.|Q0VDD8-4	.|.	L|Y	138|3427;4435;4435	.|ENSP00000409472:F3427Y;ENSP00000414402:F4435Y;ENSP00000392061:F4435Y	.|ENSP00000414402:F4435Y	F|F	+|+	3|2	2|0	DNAH14|DNAH14	223652963|223652963	0.965000|0.965000	0.33210|0.33210	0.987000|0.987000	0.45799|0.45799	0.667000|0.667000	0.39255|0.39255	4.074000|4.074000	0.57577|0.57577	2.239000|2.239000	0.73571|0.73571	0.383000|0.383000	0.25322|0.25322	TTT|TTT	-	DH14	-	pfam_Dynein_heavy_dom		0.418	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DH14	HGNC	protein_coding	OTTHUMT00000331217.3	0	0	0	40	40	90	0.00	0.00	T	XM_059166		225586340	+1	5	22	46	92	tier1	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	9.80	19.13	SNP	0.976	A	5	46
TRDN	10345	genome.wustl.edu	37	6	123687301	123687301	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr6:123687301C>A	ENST00000398178.3	-	20	1321	c.1300G>T	c.(1300-1302)Ggt>Tgt	p.G434C	TRDN_ENST00000334268.4_Missense_Mutation_p.G434C	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	434					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		GAAACCGCACCAATCTCCTCT	0.328													ENSG00000186439																																					0													93.0	88.0	90.0					6																	123687301		1812	4083	5895	SO:0001583	missense	0			-	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1300G>T	6.37:g.123687301C>A	ENSP00000381240:p.Gly434Cys		A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom	p.G434C	ENST00000398178.3	37	c.1300	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492108	0.26774	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268	T;T	0.18502	2.21;2.21	5.55	2.73	0.32206	.	0.800098	0.11207	N	0.588133	T	0.04724	0.0128	N	0.08118	0	0.20074	N	0.999931	D;D;D	0.55172	0.97;0.97;0.97	P;P;P	0.49708	0.62;0.62;0.62	T	0.22941	-1.0202	10	0.56958	D	0.05	-0.0734	6.7044	0.23242	0.0:0.698:0.0:0.302	.	434;435;434	Q5SWK9;Q8IVK2;Q13061	.;.;TRDN_HUMAN	C	434;436;434	ENSP00000381240:G434C;ENSP00000333984:G434C	ENSP00000333984:G434C	G	-	1	0	TRDN	123729000	0.001000	0.12720	0.151000	0.22473	0.176000	0.22953	0.582000	0.23834	0.404000	0.25506	0.655000	0.94253	GGT	-	TRDN	-	NULL		0.328	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding		0	0	0	62	62	131	0.00	0.00	C			123687301	-1	9	21	72	93	tier1	no_errors	ENST00000398178	ensembl	human	known	74_37	missense	11.11	18.42	SNP	0.315	A	9	72
SLITRK3	22865	genome.wustl.edu	37	3	164908086	164908086	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr3:164908086A>T	ENST00000475390.1	-	2	976	c.533T>A	c.(532-534)cTg>cAg	p.L178Q	SLITRK3_ENST00000241274.3_Missense_Mutation_p.L178Q			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	178					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						ATTTAAAATCAGAACCCTCAA	0.383										HNSCC(40;0.11)			ENSG00000121871																																					0													71.0	71.0	71.0					3																	164908086		2203	4300	6503	SO:0001583	missense	0			-	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.533T>A	3.37:g.164908086A>T	ENSP00000420091:p.Leu178Gln		Q1RMY6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L178Q	ENST00000475390.1	37	c.533	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578664	0.65878	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.75154	-0.91;-0.91	5.99	5.99	0.97316	.	0.000000	0.30302	N	0.009939	D	0.91851	0.7421	H	0.98542	4.26	0.53688	D	0.999971	D	0.71674	0.998	D	0.81914	0.995	D	0.94853	0.8015	10	0.87932	D	0	-9.732	16.4892	0.84195	1.0:0.0:0.0:0.0	.	178	O94933	SLIK3_HUMAN	Q	178	ENSP00000420091:L178Q;ENSP00000241274:L178Q	ENSP00000241274:L178Q	L	-	2	0	SLITRK3	166390780	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.339000	0.96797	2.296000	0.77279	0.533000	0.62120	CTG	-	SLITRK3	-	smart_Leu-rich_rpt_typical-subtyp		0.383	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	0	0	0	35	35	146	0.00	0.00	A	NM_014926		164908086	-1	10	28	20	128	tier1	no_errors	ENST00000241274	ensembl	human	known	74_37	missense	33.33	17.95	SNP	1.000	T	10	20
FCGBP	8857	genome.wustl.edu	37	19	40392869	40392869	+	Silent	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr19:40392869G>A	ENST00000221347.6	-	16	7642	c.7635C>T	c.(7633-7635)aaC>aaT	p.N2545N		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2545	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGATCTGGCCGTTGGCCAGCA	0.587													ENSG00000090920																																					0													1.0	1.0	1.0					19																	40392869		1250	2373	3623	SO:0001819	synonymous_variant	0			-	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7635C>T	19.37:g.40392869G>A			O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.N2545	ENST00000221347.6	37	c.7635	CCDS12546.1	19																																																																																			-	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D		0.587	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	0	0	0	45	45	13	0.00	0.00	G	NM_003890		40392869	-1	9	4	44	11	tier1	no_errors	ENST00000221347	ensembl	human	known	74_37	silent	16.98	26.67	SNP	0.003	A	9	44
NLRP5	126206	genome.wustl.edu	37	19	56530761	56530761	+	Missense_Mutation	SNP	C	C	A	rs565850613		TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr19:56530761C>A	ENST00000390649.3	+	5	619	c.619C>A	c.(619-621)Caa>Aaa	p.Q207K		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	207					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GACAGAAGAACAAGGTGAGGA	0.378													ENSG00000171487	C|||	1	0.000199681	0.0	0.0	5008	,	,		23607	0.0		0.001	False		,,,				2504	0.0																0													72.0	73.0	73.0					19																	56530761		1840	4085	5925	SO:0001583	missense	0			-	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.619C>A	19.37:g.56530761C>A	ENSP00000375063:p.Gln207Lys		A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.Q207K	ENST00000390649.3	37	c.619	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.068350	0.00382	.	.	ENSG00000171487	ENST00000390649	T	0.71461	-0.57	2.04	0.996	0.19844	.	.	.	.	.	T	0.42245	0.1194	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.08055	0.003	T	0.25676	-1.0125	9	0.08381	T	0.77	.	5.9005	0.18964	0.3117:0.6883:0.0:0.0	.	207	P59047	NALP5_HUMAN	K	207	ENSP00000375063:Q207K	ENSP00000375063:Q207K	Q	+	1	0	NLRP5	61222573	0.886000	0.30341	0.257000	0.24404	0.008000	0.06430	0.549000	0.23329	0.454000	0.26884	-0.122000	0.15005	CAA	-	NLRP5	-	NULL		0.378	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	0	0	0	59	59	94	0.00	0.00	C	NM_153447		56530761	+1	19	26	49	66	tier1	no_errors	ENST00000390649	ensembl	human	known	74_37	missense	27.94	28.26	SNP	0.266	A	19	49
MAP3K19	80122	genome.wustl.edu	37	2	135757570	135757570	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr2:135757570A>G	ENST00000375845.3	-	4	281	c.251T>C	c.(250-252)gTa>gCa	p.V84A	MAP3K19_ENST00000392918.3_Missense_Mutation_p.V84A|MAP3K19_ENST00000392915.1_Missense_Mutation_p.V101A|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Missense_Mutation_p.V84A|MAP3K19_ENST00000392917.3_Missense_Mutation_p.V84A|MAP3K19_ENST00000358371.4_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	84							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										TGGAAAAGTTACAGTGATCTC	0.378													ENSG00000176601																																					0													150.0	139.0	143.0					2																	135757570		2203	4300	6503	SO:0001583	missense	0			-	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.251T>C	2.37:g.135757570A>G	ENSP00000365005:p.Val84Ala		B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V84A	ENST00000375845.3	37	c.251	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	A	12.43	1.934375	0.34096	.	.	ENSG00000176601	ENST00000375845;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915;ENST00000425952	T;T;T;T;T	0.76186	-0.92;-1.0;-0.68;-0.56;1.45	4.55	4.55	0.56014	.	0.558674	0.14980	N	0.287283	T	0.78654	0.4317	M	0.69823	2.125	0.80722	D	1	B;P;P;D;P;P	0.56035	0.39;0.93;0.72;0.974;0.72;0.622	B;P;B;P;B;B	0.52189	0.132;0.561;0.199;0.692;0.199;0.112	T	0.76921	-0.2780	10	0.37606	T	0.19	.	10.4602	0.44575	1.0:0.0:0.0:0.0	.	84;84;84;101;84;84	B7ZMH9;Q56UN5-2;Q56UN5-4;A8MWG7;Q56UN5-5;Q56UN5	.;.;.;.;.;YSK4_HUMAN	A	84;84;84;84;101;56	ENSP00000365005:V84A;ENSP00000365004:V84A;ENSP00000376650:V84A;ENSP00000376649:V84A;ENSP00000376647:V101A	ENSP00000365004:V84A	V	-	2	0	YSK4	135474040	1.000000	0.71417	1.000000	0.80357	0.387000	0.30353	3.719000	0.54926	2.052000	0.61016	0.533000	0.62120	GTA	-	MAP3K19	-	NULL		0.378	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K19	HGNC	protein_coding	OTTHUMT00000158244.1	0	0	0	44	44	138	0.00	0.00	A	NM_025052		135757570	-1	4	14	40	103	tier1	no_errors	ENST00000375845	ensembl	human	known	74_37	missense	9.09	11.97	SNP	1.000	G	4	40
UTY	7404	genome.wustl.edu	37	Y	15591265	15591265	+	Intron	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chrY:15591265C>T	ENST00000331397.4	-	2	1160				UTY_ENST00000537580.1_Intron|UTY_ENST00000329134.5_Intron|UTY_ENST00000545955.1_Intron|UTY_ENST00000382893.1_Intron|UTY_ENST00000382896.4_Intron|UTY_ENST00000538878.1_Intron|UTY_ENST00000474365.1_5'UTR|UTY_ENST00000540140.1_Intron|UTY_ENST00000362096.4_Intron	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked						regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)			kidney(1)|lung(6)	7						CTTCCCGAGTCCAAGAGCGAC	0.562													ENSG00000183878																									Colon(103;1740 2135 40732 45171)												0													39.0	45.0	44.0					Y																	15591265		177	794	971	SO:0001627	intron_variant	0			-	AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.153-68G>A	Y.37:g.15591265C>T			A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	R	SNP	-	NULL	ENST00000331397.4	37	NULL	CCDS14783.1	Y																																																																																			-	UTY	-	-		0.562	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UTY	HGNC	protein_coding	OTTHUMT00000088394.1	0	0	0	11	11	19	0.00	0.00	C	NM_182660		15591265	-1	5	9	4	8	tier1	no_errors	ENST00000474365	ensembl	human	known	74_37	rna	55.56	52.94	SNP	0.062	T	5	4
PDIA2	64714	genome.wustl.edu	37	16	335673	335673	+	Silent	SNP	C	C	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr16:335673C>T	ENST00000219406.6	+	7	1107	c.1089C>T	c.(1087-1089)ttC>ttT	p.F363F	PDIA2_ENST00000404312.1_Silent_p.F360F	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	363					cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				TCACTGCTTTCTGCCATGCAG	0.597													ENSG00000185615																																					0													49.0	58.0	55.0					16																	335673		2076	4205	6281	SO:0001819	synonymous_variant	0			-	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.1089C>T	16.37:g.335673C>T			A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Silent	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Prot_disulphide_isomerase	p.F363	ENST00000219406.6	37	c.1089	CCDS42089.1	16																																																																																			-	PDIA2	-	superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase		0.597	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDIA2	HGNC	protein_coding	OTTHUMT00000139315.3	0	0	0	77	77	70	0.00	0.00	C	NM_006849		335673	+1	14	5	65	57	tier1	no_errors	ENST00000219406	ensembl	human	known	74_37	silent	17.72	8.06	SNP	1.000	T	14	65
GUCY2C	2984	genome.wustl.edu	37	12	14827569	14827569	+	Silent	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr12:14827569G>A	ENST00000261170.3	-	8	1210	c.1074C>T	c.(1072-1074)ctC>ctT	p.L358L	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	358					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CTTCAAAAGTGAGATTCCTGA	0.388													ENSG00000070019																																					0													114.0	121.0	119.0					12																	14827569		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1074C>T	12.37:g.14827569G>A			B2RMY6	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_A/G_cyclase,superfamily_Peripla_BP_I,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.L358	ENST00000261170.3	37	c.1074	CCDS8664.1	12																																																																																			-	GUCY2C	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.388	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1	0	0	0	86	86	109	0.00	0.00	G			14827569	-1	18	4	100	108	tier1	no_errors	ENST00000261170	ensembl	human	known	74_37	silent	15.00	3.57	SNP	1.000	A	18	100
PCLO	27445	genome.wustl.edu	37	7	82474639	82474639	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr7:82474639G>T	ENST00000333891.9	-	13	14331	c.13994C>A	c.(13993-13995)cCt>cAt	p.P4665H	PCLO_ENST00000423517.2_Missense_Mutation_p.P4665H|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGGTTGCCCAGGGCTGGGAAC	0.507													ENSG00000186472																																					0													66.0	66.0	66.0					7																	82474639		2002	4166	6168	SO:0001583	missense	0			-	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13994C>A	7.37:g.82474639G>T	ENSP00000334319:p.Pro4665His			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.P4665H	ENST00000333891.9	37	c.13994	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	16.32	3.091051	0.55968	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.18657	2.2;2.21	5.53	5.53	0.82687	.	.	.	.	.	T	0.46444	0.1393	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.998	T	0.34800	-0.9814	9	0.87932	D	0	.	19.827	0.96621	0.0:0.0:1.0:0.0	.	4665;4665;95;162	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	H	4665;4665;161	ENSP00000334319:P4665H;ENSP00000388393:P4665H	ENSP00000334319:P4665H	P	-	2	0	PCLO	82312575	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.110000	0.94302	2.759000	0.94783	0.561000	0.74099	CCT	-	PCLO	-	NULL		0.507	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	0	0	0	111	111	66	0.00	0.00	G	NM_014510		82474639	-1	10	6	83	60	tier1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	10.53	9.09	SNP	1.000	T	10	83
MUC16	94025	genome.wustl.edu	37	19	9091072	9091072	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr19:9091072G>A	ENST00000397910.4	-	1	946	c.743C>T	c.(742-744)tCc>tTc	p.S248F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	248	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S248F(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCACCTCTGGAATTTGGGGT	0.468													ENSG00000181143																																					1	Substitution - Missense(1)	lung(1)											120.0	118.0	118.0					19																	9091072		1904	4133	6037	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.743C>T	19.37:g.9091072G>A	ENSP00000381008:p.Ser248Phe		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S248F	ENST00000397910.4	37	c.743	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.418	-0.573756	0.03882	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.49	-0.828	0.10799	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	.	.	.	B	0.23540	0.087	B	0.18263	0.021	T	0.43310	-0.9399	8	0.87932	D	0	.	3.9786	0.09486	0.4468:0.0:0.5532:0.0	.	248	B5ME49	.	F	248	ENSP00000381008:S248F	ENSP00000381008:S248F	S	-	2	0	MUC16	8952072	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.391000	0.20784	-0.170000	0.10816	0.313000	0.20887	TCC	-	MUC16	-	NULL		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	1	63	63	119	0.00	0.83	G	NM_024690		9091072	-1	9	12	50	140	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	15.25	7.89	SNP	0.000	A	9	50
CHD7	55636	genome.wustl.edu	37	8	61743078	61743078	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr8:61743078C>G	ENST00000423902.2	+	15	4199	c.3720C>G	c.(3718-3720)aaC>aaG	p.N1240K	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1240					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ACGTACCTAACCTATTAAACA	0.423													ENSG00000171316																																					0													107.0	102.0	104.0					8																	61743078		1945	4145	6090	SO:0001583	missense	0			-	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.3720C>G	8.37:g.61743078C>G	ENSP00000392028:p.Asn1240Lys		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.N1240K	ENST00000423902.2	37	c.3720	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016904	0.75161	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.92752	-3.1	5.77	3.95	0.45737	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.90889	0.7137	N	0.20357	0.565	0.58432	D	0.999998	D	0.71674	0.998	D	0.74348	0.983	D	0.90484	0.4462	10	0.87932	D	0	-23.6902	7.5588	0.27839	0.0:0.6538:0.0:0.3462	.	1240	Q9P2D1	CHD7_HUMAN	K	1240	ENSP00000392028:N1240K	ENSP00000307304:N1240K	N	+	3	2	CHD7	61905632	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.715000	0.37971	1.438000	0.47492	0.591000	0.81541	AAC	-	CHD7	-	pfam_SNF2_N,superfamily_P-loop_NTPase		0.423	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	0	0	0	42	42	80	0.00	0.00	C	XM_098762		61743078	+1	7	5	47	119	tier1	no_errors	ENST00000423902	ensembl	human	known	74_37	missense	12.96	4.03	SNP	1.000	G	7	47
CHM	1121	genome.wustl.edu	37	X	85118101	85118101	+	3'UTR	DEL	T	T	-			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chrX:85118101delT	ENST00000357749.2	-	0	3525				CHM_ENST00000467744.2_Splice_Site	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)						blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TACAGCCCCCttttttttttt	0.453													ENSG00000188419																																					0																																										SO:0001624	3_prime_UTR_variant	0				X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.*1534A>-	X.37:g.85118101delT			A1L4D2|O43732	Splice_Site	DEL	-	NULL	ENST00000357749.2	37	c.NULL	CCDS14454.1	X																																																																																				CHM	-	-		0.453	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	0	0	0	24	24	6	0.00	0.00	T	NM_000390		85118101	-1	4	1	21	5	tier1	no_errors	ENST00000467744	ensembl	human	known	74_37	splice_site_del	16.00	16.67	DEL	0.003	-	4	21
SMG1P4	100507526	genome.wustl.edu	37	16	21896553	21896553	+	RNA	SNP	C	C	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr16:21896553C>G	ENST00000540706.1	-	0	1449																											AGGTGAGCACCGATTTGTCAA	0.433													ENSG00000185710																																					0																																												0			-																													16.37:g.21896553C>G				R	SNP	-	NULL	ENST00000540706.1	37	NULL		16																																																																																			-	RP11-645C24.2	-	-		0.433	RP11-645C24.2-003	KNOWN	basic	processed_transcript	ENSG00000185710	Clone_based_vega_gene	pseudogene	OTTHUMT00000402428.1	0	0	0	114	114	6	0.00	0.00	C			21896553	-1	14	0	85	5	tier1	no_errors	ENST00000380598	ensembl	human	known	74_37	rna	14.14	0.00	SNP	0.999	G	14	85
GAPVD1	26130	genome.wustl.edu	37	9	128025963	128025989	+	Intron	DEL	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT	-	rs551743640|rs71374244|rs143312600	byFrequency	TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr9:128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT	ENST00000495955.1	+	1	92				GAPVD1_ENST00000469528.1_3'UTR|GAPVD1_ENST00000394105.2_Intron|GAPVD1_ENST00000394084.1_Intron|GAPVD1_ENST00000297933.6_Intron|GAPVD1_ENST00000265956.4_Intron|GAPVD1_ENST00000470056.1_Intron|GAPVD1_ENST00000394083.2_Intron|GAPVD1_ENST00000394104.2_Intron			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTAAGTGGCACAGCACTCCATCTGTAGGTATGTCTGTCAGCACTCCA	0.564													ENSG00000165219		2105	0.420327	0.4516	0.3818	5008	,	,		19587	0.4454		0.3777	False		,,,				2504	0.4233																0																																										SO:0001627	intron_variant	0					CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.-199+1725CAGCACTCCATCTGTAGGTATGTCTGT>-	9.37:g.128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT			A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Splice_Site	DEL	-	NULL	ENST00000495955.1	37	c.NULL		9																																																																																				GAPVD1	-	-		0.564	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1	0	0	0	6	6	6	0.00	0.00	CAGCACTCCATCTGTAGGTATGTCTGT			128025989	+1	1	1	6	6	tier1	no_errors	ENST00000469528	ensembl	human	known	74_37	splice_site_del	14.29	14.29	DEL	1.000:1.000:1.000:1.000:1.000:0.999:0.996:0.980:0.970:0.963:0.961:0.959:0.952:0.948:0.947:0.950:0.961:0.966:0.966:0.969:0.974:0.982:0.984:0.985:0.984:0.985:0.993	-	1	6
TOPORS	10210	genome.wustl.edu	37	9	32552413	32552413	+	Intron	SNP	A	A	G			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr9:32552413A>G	ENST00000360538.2	-	1	120				TOPORS_ENST00000379858.1_Intron|TOPORS-AS1_ENST00000453396.1_RNA|TOPORS-AS1_ENST00000540066.1_RNA|TOPORS-AS1_ENST00000450093.1_RNA|TOPORS-AS1_ENST00000458036.1_RNA|TOPORS-AS1_ENST00000425533.1_RNA	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		GCTCCCGCGGACTGCTGCCGC	0.667													ENSG00000235453																																					0													13.0	14.0	14.0					9																	32552413		2203	4298	6501	SO:0001627	intron_variant	0			-	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.3+18T>C	9.37:g.32552413A>G			O43273|Q6P987|Q9NS55|Q9UNR9	R	SNP	-	NULL	ENST00000360538.2	37	NULL	CCDS6527.1	9																																																																																			-	TOPORS-AS1	-	-		0.667	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS-AS1	HGNC	protein_coding	OTTHUMT00000052007.1	0	0	0	46	46	11	0.00	0.00	A	NM_005802		32552413	+1	6	0	33	6	tier1	no_errors	ENST00000425533	ensembl	human	known	74_37	rna	15.38	0.00	SNP	0.000	G	6	33
DSPP	1834	genome.wustl.edu	37	4	88536934	88536934	+	Silent	SNP	C	C	T	rs200948555		TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr4:88536934C>T	ENST00000282478.7	+	4	3153	c.3120C>T	c.(3118-3120)agC>agT	p.S1040S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1040S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1040	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcgatagcagtg	0.527													ENSG00000152591																																					0								C		2,3110		0,2,1554	57.0	65.0	62.0		3120	-2.8	0.7	4	dbSNP_134	62	7,5519		0,7,2756	no	coding-synonymous	DSPP	NM_014208.3		0,9,4310	TT,TC,CC		0.1267,0.0643,0.1042		1040/1302	88536934	9,8629	1556	2763	4319	SO:0001819	synonymous_variant	0			-	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3120C>T	4.37:g.88536934C>T			A8MUI0|O95815	Silent	SNP	NULL	p.S1040	ENST00000282478.7	37	c.3120	CCDS43248.1	4																																																																																			rs200948555	DSPP	-	NULL		0.527	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	0	0	0	46	46	4	0.00	0.00	C	NM_014208		88536934	+1	9	1	38	3	tier1	no_errors	ENST00000282478	ensembl	human	known	74_37	silent	19.15	25.00	SNP	0.968	T	9	38
SCN11A	11280	genome.wustl.edu	37	3	38948879	38948880	+	Intron	INS	-	-	CT	rs191305441	byFrequency	TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr3:38948879_38948880insCT	ENST00000302328.3	-	10	1672				SCN11A_ENST00000444237.2_Intron|SCN11A_ENST00000456224.3_Intron|SCN11A_ENST00000450244.1_Intron|AC116038.1_ENST00000401122.1_RNA	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	acacacacacacTTTGATGCCC	0.386													ENSG00000215941																																					0																																										SO:0001627	intron_variant	0				AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+559->AG	3.37:g.38948880_38948881dupCT			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	R	INS	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																				AC116038.1	-	-		0.386	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000109746.4	0	0	0	19	19	0	0.00	0.00	-	NM_014139		38948880	+1	6	0	18	0	tier1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	25.00	0.00	INS	0.002:0.002	CT	6	18
ZSCAN10	84891	genome.wustl.edu	37	16	3139121	3139121	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr16:3139121G>A	ENST00000252463.2	-	5	2236	c.2149C>T	c.(2149-2151)Cgc>Tgc	p.R717C	RP11-473M20.9_ENST00000571404.1_lincRNA|RNU1-22P_ENST00000363334.1_RNA|ZSCAN10_ENST00000575108.1_Missense_Mutation_p.R378C|ZSCAN10_ENST00000538082.2_Missense_Mutation_p.R635C	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	717					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GCGTGGGTGCGCAGGTGGCGC	0.716													ENSG00000130182																																					0													12.0	13.0	13.0					16																	3139121		2159	4262	6421	SO:0001583	missense	0			-	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.2149C>T	16.37:g.3139121G>A	ENSP00000252463:p.Arg717Cys		B3KQD3|H0YFS6|Q1WWM2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R717C	ENST00000252463.2	37	c.2149	CCDS10493.1	16	.	.	.	.	.	.	.	.	.	.	G	17.47	3.396608	0.62177	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	T	0.58506	0.33	4.95	2.77	0.32553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48286	D	0.000188	T	0.75989	0.3925	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.995;1.0;0.998	T	0.76597	-0.2901	10	0.87932	D	0	-20.4977	9.8594	0.41105	0.0:0.0:0.6261:0.3739	.	378;650;717	Q96SZ4-2;Q1WWM2;Q96SZ4	.;.;ZSC10_HUMAN	C	650;717	ENSP00000252463:R717C	ENSP00000252463:R717C	R	-	1	0	ZSCAN10	3079122	0.000000	0.05858	0.978000	0.43139	0.981000	0.71138	-0.234000	0.09028	0.380000	0.24823	0.561000	0.74099	CGC	-	ZSCAN10	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.716	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN10	HGNC	protein_coding	OTTHUMT00000437124.2	0	0	0	26	26	2	0.00	0.00	G	NM_032805		3139121	-1	4	1	21	4	tier1	no_errors	ENST00000252463	ensembl	human	known	74_37	missense	16.00	20.00	SNP	0.988	A	4	21
SPHKAP	80309	genome.wustl.edu	37	2	228883839	228883839	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A1KU-01A-32D-A24N-09	TCGA-DX-A1KU-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c556f81b-8a6c-4bbb-876f-2e2ce570c185	82655523-70c2-4b8d-83cd-bf3dfa800b4a	g.chr2:228883839delT	ENST00000392056.3	-	7	1777	c.1731delA	c.(1729-1731)gaafs	p.E578fs	SPHKAP_ENST00000344657.5_Frame_Shift_Del_p.E578fs	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	578						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ATGTCACCTCTTCTCTTTCAC	0.547													ENSG00000153820																																					0													81.0	75.0	77.0					2																	228883839		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1731delA	2.37:g.228883839delT	ENSP00000375909:p.Glu578fs		Q68DA3|Q68DR8|Q9C0I5	Frame_Shift_Del	DEL	pfam_AKAP_110_C	p.E578fs	ENST00000392056.3	37	c.1731	CCDS46537.1	2																																																																																				SPHKAP	-	NULL		0.547	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	0	0	0	34	34	50	0.00	0.00	T	NM_030623		228883839	-1	6	3	24	50	tier1	no_errors	ENST00000392056	ensembl	human	known	74_37	frame_shift_del	20.00	5.66	DEL	0.397	-	6	24
