#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
HERC2	8924	genome.wustl.edu	37	15	28380835	28380835	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr15:28380835A>C	ENST00000261609.7	-	79	12127	c.12019T>G	c.(12019-12021)Tat>Gat	p.Y4007D		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCAGTGGCATACAGCTAAGAA	0.383													ENSG00000128731																																					0													47.0	44.0	45.0					15																	28380835		2203	4300	6503	SO:0001583	missense	0			-	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12019T>G	15.37:g.28380835A>C	ENSP00000261609:p.Tyr4007Asp			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.Y4007D	ENST00000261609.7	37	c.12019	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	A	23.4	4.413786	0.83449	.	.	ENSG00000128731	ENST00000261609	D	0.91237	-2.81	5.68	5.68	0.88126	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.062472	0.64402	D	0.000003	D	0.96056	0.8715	M	0.93594	3.435	0.80722	D	1	P	0.52061	0.95	P	0.59357	0.856	D	0.97019	0.9742	10	0.87932	D	0	.	15.9225	0.79586	1.0:0.0:0.0:0.0	.	4007	O95714	HERC2_HUMAN	D	4007	ENSP00000261609:Y4007D	ENSP00000261609:Y4007D	Y	-	1	0	HERC2	26054430	1.000000	0.71417	0.992000	0.48379	0.947000	0.59692	9.335000	0.96500	2.156000	0.67533	0.460000	0.39030	TAT	-	HERC2	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,smart_Beta-propeller_rpt_TECPR,pfscan_Reg_chr_condens		0.383	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	0	0	0	34	34	61	0.00	0.00	A	NM_004667		28380835	-1	3	7	13	46	tier1	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	18.75	13.21	SNP	1.000	C	3	13
GRAMD2	196996	genome.wustl.edu	37	15	72454682	72454682	+	Silent	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr15:72454682C>T	ENST00000309731.7	-	11	1006	c.993G>A	c.(991-993)gcG>gcA	p.A331A	GRAMD2_ENST00000564184.1_5'Flank	NM_001012642.2	NP_001012660.1	Q8IUY3	GRAM2_HUMAN	GRAM domain containing 2	331						integral component of membrane (GO:0016021)		p.A331A(1)		cervix(2)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	13						AAATACGGAACGCCAGGTAGG	0.478													ENSG00000175318																																					1	Substitution - coding silent(1)	large_intestine(1)											88.0	80.0	82.0					15																	72454682		2199	4297	6496	SO:0001819	synonymous_variant	0			-	AK002016	CCDS32283.1	15q23	2006-11-29	2005-11-03	2005-11-03					27287	protein-coding gene	gene with protein product						12477932	Standard	NM_001012642		Approved		uc002atq.3	Q8IUY3		ENST00000309731.7:c.993G>A	15.37:g.72454682C>T			B3KT68	Silent	SNP	pfam_GRAM,smart_GRAM	p.A331	ENST00000309731.7	37	c.993	CCDS32283.1	15																																																																																			-	GRAMD2	-	NULL		0.478	GRAMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD2	HGNC	protein_coding	OTTHUMT00000420040.1	0	0	0	38	38	124	0.00	0.00	C	NM_001012642		72454682	-1	12	40	26	85	tier1	no_errors	ENST00000309731	ensembl	human	known	74_37	silent	31.58	31.75	SNP	0.927	T	12	26
ZFR2	23217	genome.wustl.edu	37	19	3825349	3825349	+	Silent	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr19:3825349C>T	ENST00000262961.4	-	7	1102	c.1092G>A	c.(1090-1092)ctG>ctA	p.L364L		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	364							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TCTCTGTGGCCAGTGCAGGCT	0.701													ENSG00000105278																																					0													10.0	14.0	13.0					19																	3825349		1947	4125	6072	SO:0001819	synonymous_variant	0			-	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.1092G>A	19.37:g.3825349C>T				Silent	SNP	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.L364	ENST00000262961.4	37	c.1092	CCDS45921.1	19																																																																																			-	ZFR2	-	NULL		0.701	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	HGNC	protein_coding	OTTHUMT00000453648.2	0	0	0	56	56	10	0.00	0.00	C	NM_015174		3825349	-1	69	12	71	10	tier1	no_errors	ENST00000262961	ensembl	human	known	74_37	silent	49.29	54.55	SNP	0.000	T	69	71
AGBL2	79841	genome.wustl.edu	37	11	47726171	47726171	+	Silent	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr11:47726171C>T	ENST00000525123.1	-	7	795	c.510G>A	c.(508-510)ttG>ttA	p.L170L	AGBL2_ENST00000298861.4_Silent_p.L170L|AGBL2_ENST00000357610.3_Silent_p.L170L|AGBL2_ENST00000529712.1_5'UTR|AGBL2_ENST00000528244.1_Silent_p.L132L	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2	170						cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						TCTTGGTAGACAAAATGGAAA	0.438													ENSG00000165923																																					0													132.0	125.0	127.0					11																	47726171		2201	4298	6499	SO:0001819	synonymous_variant	0			-		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.510G>A	11.37:g.47726171C>T			A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Silent	SNP	pfam_Peptidase_M14	p.L170	ENST00000525123.1	37	c.510	CCDS7944.1	11																																																																																			-	AGBL2	-	NULL		0.438	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	AGBL2	HGNC	protein_coding	OTTHUMT00000383726.2	0	0	0	83	83	128	0.00	0.00	C	NM_024783		47726171	-1	9	19	47	85	tier1	no_errors	ENST00000357610	ensembl	human	known	74_37	silent	16.07	18.27	SNP	0.001	T	9	47
CDK20	23552	genome.wustl.edu	37	9	90584819	90584819	+	Silent	SNP	G	G	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr9:90584819G>A	ENST00000325303.8	-	6	884	c.579C>T	c.(577-579)atC>atT	p.I193I	CDK20_ENST00000336654.5_Silent_p.I185I|CDK20_ENST00000375883.3_Silent_p.I172I|CDK20_ENST00000605159.1_Silent_p.I172I|CDK20_ENST00000375871.4_Intron	NM_001039803.2	NP_001034892.1	Q8IZL9	CDK20_HUMAN	cyclin-dependent kinase 20	193	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cell division (GO:0051301)|multicellular organismal development (GO:0007275)	cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			skin(1)	1						GCTCCCCCATGATGCAGCCCA	0.567													ENSG00000156345																																					0													80.0	79.0	80.0					9																	90584819		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF035013	CCDS6677.1, CCDS6678.1, CCDS35060.1, CCDS55324.1, CCDS65075.1	9q22.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000156345	ENSG00000156345		"""Cyclin-dependent kinases"""	21420	protein-coding gene	gene with protein product		610076	"""cell cycle related kinase"""	CCRK		19884882	Standard	NM_178432		Approved	p42	uc004apr.3	Q8IZL9	OTTHUMG00000020161	ENST00000325303.8:c.579C>T	9.37:g.90584819G>A			A2A389|A2A390|B4DQX1|O95137|Q5EDC4|Q5VYW1|Q9BUF4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I193	ENST00000325303.8	37	c.579	CCDS35060.1	9																																																																																			-	CDK20	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.567	CDK20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK20	HGNC	protein_coding	OTTHUMT00000214996.1	0	0	0	50	50	55	0.00	0.00	G	NM_012119		90584819	-1	7	12	39	56	tier1	no_errors	ENST00000325303	ensembl	human	known	74_37	silent	15.22	17.65	SNP	1.000	A	7	39
TAPBPL	55080	genome.wustl.edu	37	12	6562370	6562370	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr12:6562370C>T	ENST00000266556.7	+	2	367	c.202C>T	c.(202-204)Cca>Tca	p.P68S	TAPBPL_ENST00000544021.1_Intron|CD27-AS1_ENST00000399492.2_RNA|CD27-AS1_ENST00000545339.1_RNA|TAPBPL_ENST00000545700.1_3'UTR	NM_018009.4	NP_060479.3	Q9BX59	TPSNR_HUMAN	TAP binding protein-like	68					negative regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			endometrium(2)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	6						GAAGCAGGTGCCAGTGCTGGA	0.602													ENSG00000139192																																					0													63.0	49.0	54.0					12																	6562370		2203	4300	6503	SO:0001583	missense	0			-	AK001005	CCDS8546.1	12p13.31	2013-01-11						"""Immunoglobulin superfamily / C1-set domain containing"""	30683	protein-coding gene	gene with protein product		607081				11920573	Standard	NM_018009		Approved	TAPBP-R, FLJ10143, TAPBPR	uc001qog.4	Q9BX59		ENST00000266556.7:c.202C>T	12.37:g.6562370C>T	ENSP00000266556:p.Pro68Ser		Q9NWB8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_C1-set,pfscan_Ig-like_dom	p.P68S	ENST00000266556.7	37	c.202	CCDS8546.1	12	.	.	.	.	.	.	.	.	.	.	C	16.48	3.135908	0.56936	.	.	ENSG00000139192	ENST00000266556	T	0.07021	3.23	4.05	4.05	0.47172	.	0.351841	0.29572	N	0.011772	T	0.08133	0.0203	L	0.48877	1.53	0.37117	D	0.900626	P	0.40660	0.726	B	0.37888	0.26	T	0.35699	-0.9778	10	0.19590	T	0.45	-11.5478	11.9318	0.52851	0.0:1.0:0.0:0.0	.	68	Q9BX59	TPSNR_HUMAN	S	68	ENSP00000266556:P68S	ENSP00000266556:P68S	P	+	1	0	TAPBPL	6432631	0.962000	0.33011	1.000000	0.80357	0.888000	0.51559	1.148000	0.31614	2.276000	0.75962	0.655000	0.94253	CCA	-	TAPBPL	-	NULL		0.602	TAPBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAPBPL	HGNC	protein_coding	OTTHUMT00000399263.1	0	0	0	59	59	43	0.00	0.00	C	NM_018009		6562370	+1	81	49	131	87	tier1	no_errors	ENST00000266556	ensembl	human	known	74_37	missense	38.21	36.03	SNP	1.000	T	81	131
ZFAT	57623	genome.wustl.edu	37	8	135545136	135545136	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr8:135545136T>A	ENST00000377838.3	-	12	3230	c.3056A>T	c.(3055-3057)aAt>aTt	p.N1019I	ZFAT_ENST00000520356.1_Missense_Mutation_p.N1007I|ZFAT_ENST00000523399.1_Missense_Mutation_p.N957I|ZFAT_ENST00000517307.1_5'UTR|ZFAT_ENST00000520727.1_Missense_Mutation_p.N1007I|ZFAT_ENST00000429442.2_Missense_Mutation_p.N1007I|ZFAT_ENST00000520214.1_Missense_Mutation_p.N1007I	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1019					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			ATACTCCTCATTAGGGTGCTT	0.622													ENSG00000066827																																					0													55.0	56.0	55.0					8																	135545136		2038	4171	6209	SO:0001583	missense	0			-	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.3056A>T	8.37:g.135545136T>A	ENSP00000367069:p.Asn1019Ile		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N1019I	ENST00000377838.3	37	c.3056	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	T	13.65	2.301024	0.40694	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399	T;T;T;T;T;T	0.10668	2.92;2.86;2.88;2.85;2.86;2.89	5.58	1.81	0.25067	Zinc finger, C2H2 (1);	0.573533	0.20914	N	0.083412	T	0.11067	0.0270	L	0.57536	1.79	0.09310	N	1	P;P;P;B	0.47302	0.855;0.893;0.664;0.437	B;B;B;B	0.41619	0.289;0.361;0.216;0.109	T	0.15521	-1.0434	10	0.66056	D	0.02	-17.4915	6.0845	0.19960	0.0:0.1447:0.1374:0.7179	.	138;957;1007;1019	B7Z741;E9PER3;E9PBN4;Q9P243	.;.;.;ZFAT_HUMAN	I	1007;1007;1007;1019;1007;906;957	ENSP00000427879:N1007I;ENSP00000427831:N1007I;ENSP00000394501:N1007I;ENSP00000367069:N1019I;ENSP00000428483:N1007I;ENSP00000429091:N957I	ENSP00000326997:N906I	N	-	2	0	ZFAT	135614318	0.838000	0.29461	0.931000	0.37212	0.266000	0.26442	2.406000	0.44557	0.077000	0.16863	0.477000	0.44152	AAT	-	ZFAT	-	pfscan_Znf_C2H2		0.622	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1	0	0	0	71	71	49	0.00	0.00	T	NM_001029939		135545136	-1	14	12	115	102	tier1	no_errors	ENST00000377838	ensembl	human	known	74_37	missense	10.85	10.53	SNP	0.050	A	14	115
USP34	9736	genome.wustl.edu	37	2	61633120	61633120	+	Missense_Mutation	SNP	G	G	A	rs566351854		TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr2:61633120G>A	ENST00000398571.2	-	3	351	c.275C>T	c.(274-276)tCc>tTc	p.S92F		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	92					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTGCCACGTGGAATCTATGTT	0.358													ENSG00000115464	G|||	1	0.000199681	0.0008	0.0	5008	,	,		16401	0.0		0.0	False		,,,				2504	0.0																0													184.0	165.0	171.0					2																	61633120		1882	4107	5989	SO:0001583	missense	0			-	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.275C>T	2.37:g.61633120G>A	ENSP00000381577:p.Ser92Phe		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.S92F	ENST00000398571.2	37	c.275	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104055	0.56291	.	.	ENSG00000115464	ENST00000398571	T	0.15139	2.45	6.17	6.17	0.99709	.	.	.	.	.	T	0.16854	0.0405	L	0.36672	1.1	0.39900	D	0.973885	P	0.40476	0.718	B	0.34242	0.178	T	0.01401	-1.1364	9	0.42905	T	0.14	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	92	Q70CQ2	UBP34_HUMAN	F	92	ENSP00000381577:S92F	ENSP00000381577:S92F	S	-	2	0	USP34	61486624	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.335000	0.65929	2.941000	0.99782	0.655000	0.94253	TCC	-	USP34	-	NULL		0.358	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	0	0	0	56	56	58	0.00	0.00	G			61633120	-1	6	11	34	61	tier1	no_errors	ENST00000398571	ensembl	human	known	74_37	missense	15.00	15.28	SNP	1.000	A	6	34
NRG3	10718	genome.wustl.edu	37	10	84744599	84744599	+	Silent	SNP	C	C	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr10:84744599C>A	ENST00000404547.1	+	9	1644	c.1644C>A	c.(1642-1644)ccC>ccA	p.P548P	NRG3_ENST00000404576.2_Intron|NRG3_ENST00000372142.2_Silent_p.P327P|NRG3_ENST00000545131.1_Intron|NRG3_ENST00000556918.1_Intron|NRG3_ENST00000537893.1_Intron|NRG3_ENST00000372141.2_Intron			P56975	NRG3_HUMAN	neuregulin 3	548					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ttgaaagacccctggacttaa	0.438													ENSG00000185737																																					0													133.0	115.0	120.0					10																	84744599		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1644C>A	10.37:g.84744599C>A			A4D7U1|Q0PEH2|Q5VYH3	Silent	SNP	pfscan_EG-like_dom	p.P548	ENST00000404547.1	37	c.1644	CCDS31233.1	10																																																																																			-	NRG3	-	NULL		0.438	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1	0	0	0	60	60	88	0.00	0.00	C	XM_166086		84744599	+1	7	19	35	61	tier1	no_errors	ENST00000404547	ensembl	human	known	74_37	silent	16.67	23.75	SNP	1.000	A	7	35
DMXL1	1657	genome.wustl.edu	37	5	118451988	118451988	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr5:118451988G>A	ENST00000311085.8	+	7	780	c.700G>A	c.(700-702)Gta>Ata	p.V234I	DMXL1_ENST00000539542.1_Missense_Mutation_p.V234I	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	234										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TCCTCGAGCAGTAAATGGATT	0.413													ENSG00000172869																																					0													153.0	144.0	147.0					5																	118451988		2202	4300	6502	SO:0001583	missense	0			-	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.700G>A	5.37:g.118451988G>A	ENSP00000309690:p.Val234Ile			Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V234I	ENST00000311085.8	37	c.700	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591125	0.86851	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.67171	-0.25;-0.22;2.6	4.96	4.09	0.47781	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.060135	0.64402	N	0.000003	T	0.79161	0.4399	M	0.66506	2.035	0.54753	D	0.99998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.80553	-0.1331	10	0.56958	D	0.05	-6.785	13.5794	0.61893	0.0758:0.0:0.9242:0.0	.	234;234	F5H269;Q9Y485	.;DMXL1_HUMAN	I	234	ENSP00000427692:V234I;ENSP00000309690:V234I;ENSP00000439479:V234I	ENSP00000309690:V234I	V	+	1	0	DMXL1	118479887	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.354000	0.73036	1.231000	0.43661	0.655000	0.94253	GTA	-	DMXL1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat		0.413	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	0	0	0	32	32	136	0.00	0.00	G	NM_005509		118451988	+1	105	351	34	125	tier1	no_errors	ENST00000539542	ensembl	human	known	74_37	missense	75.54	73.43	SNP	1.000	A	105	34
PTCD1	26024	genome.wustl.edu	37	7	99017740	99017740	+	Silent	SNP	A	A	G			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr7:99017740A>G	ENST00000292478.4	-	8	2203	c.1953T>C	c.(1951-1953)atT>atC	p.I651I	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.I700I|PTCD1_ENST00000555673.1_Silent_p.I700I	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	651					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGAAGCCGTCAATCTTCTCCA	0.547													ENSG00000248919																																					0													108.0	115.0	113.0					7																	99017740		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1953T>C	7.37:g.99017740A>G			Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	pfam_Pentatricopeptide_repeat,pfam_F1F0-ATPsyn_F_prd,tigrfam_Pentatricopeptide_repeat	p.I700	ENST00000292478.4	37	c.2100	CCDS34691.1	7																																																																																			-	ATP5J2-PTCD1	-	NULL		0.547	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5J2-PTCD1	HGNC	protein_coding	OTTHUMT00000336391.1	0	0	0	42	42	62	0.00	0.00	A	NM_015545		99017740	-1	7	12	36	63	tier1	no_errors	ENST00000413834	ensembl	human	known	74_37	silent	16.28	16.00	SNP	0.689	G	7	36
HERC2	8924	genome.wustl.edu	37	15	28478362	28478362	+	Silent	SNP	T	T	C			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr15:28478362T>C	ENST00000261609.7	-	30	4713	c.4605A>G	c.(4603-4605)aaA>aaG	p.K1535K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AACTTAACAATTTAAACTTAG	0.388													ENSG00000128731																																					0													54.0	63.0	60.0					15																	28478362		2201	4295	6496	SO:0001819	synonymous_variant	0			-	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.4605A>G	15.37:g.28478362T>C				Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.K1535	ENST00000261609.7	37	c.4605	CCDS10021.1	15																																																																																			-	HERC2	-	NULL		0.388	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	0	0	0	187	187	16	0.00	0.00	T	NM_004667		28478362	-1	20	6	149	24	tier1	no_errors	ENST00000261609	ensembl	human	known	74_37	silent	11.83	20.00	SNP	0.986	C	20	149
SOCS6	9306	genome.wustl.edu	37	18	67992094	67992094	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr18:67992094G>A	ENST00000397942.3	+	2	506	c.190G>A	c.(190-192)Gga>Aga	p.G64R	SOCS6_ENST00000582322.1_Missense_Mutation_p.G64R	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	64					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				TGAAAAAGGCGGAAAAAACAG	0.468													ENSG00000170677																									Melanoma(84;1024 1361 24382 36583 42651)												0													99.0	101.0	100.0					18																	67992094		2203	4300	6503	SO:0001583	missense	0			-	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.190G>A	18.37:g.67992094G>A	ENSP00000381034:p.Gly64Arg		Q8WUM3	Missense_Mutation	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.G64R	ENST00000397942.3	37	c.190	CCDS11998.1	18	.	.	.	.	.	.	.	.	.	.	G	6.100	0.386785	0.11524	.	.	ENSG00000170677	ENST00000397942	T	0.25749	1.78	5.49	4.62	0.57501	.	0.572237	0.16499	N	0.211758	T	0.22820	0.0551	L	0.48642	1.525	0.40367	D	0.979301	P	0.36315	0.547	B	0.26693	0.072	T	0.07309	-1.0779	10	0.87932	D	0	-7.8817	14.3933	0.66994	0.0708:0.0:0.9292:0.0	.	64	O14544	SOCS6_HUMAN	R	64	ENSP00000381034:G64R	ENSP00000381034:G64R	G	+	1	0	SOCS6	66143074	1.000000	0.71417	0.037000	0.18230	0.077000	0.17291	5.667000	0.68067	1.321000	0.45227	0.561000	0.74099	GGA	-	SOCS6	-	NULL		0.468	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS6	HGNC	protein_coding	OTTHUMT00000256270.2	0	0	0	35	35	85	0.00	0.00	G			67992094	+1	4	12	27	104	tier1	no_errors	ENST00000397942	ensembl	human	known	74_37	missense	12.90	10.26	SNP	0.984	A	4	27
SLC9A2	6549	genome.wustl.edu	37	2	103274131	103274131	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr2:103274131C>T	ENST00000233969.2	+	2	540	c.398C>T	c.(397-399)cCc>cTc	p.P133L		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	133					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						GAGAAGTCTCCCCCTGCAATG	0.463													ENSG00000115616																																					0													216.0	198.0	204.0					2																	103274131		2203	4300	6503	SO:0001583	missense	0			-		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.398C>T	2.37:g.103274131C>T	ENSP00000233969:p.Pro133Leu		B2RMS2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.P133L	ENST00000233969.2	37	c.398	CCDS2062.1	2	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544609	0.86022	.	.	ENSG00000115616	ENST00000233969	T	0.57107	0.42	5.73	5.73	0.89815	Cation/H+ exchanger (1);	0.049157	0.85682	N	0.000000	T	0.60130	0.2245	L	0.43646	1.37	0.80722	D	1	D	0.54964	0.969	P	0.59487	0.858	T	0.54622	-0.8266	10	0.35671	T	0.21	.	13.4768	0.61314	0.0:0.9285:0.0:0.0715	.	133	Q9UBY0	SL9A2_HUMAN	L	133	ENSP00000233969:P133L	ENSP00000233969:P133L	P	+	2	0	SLC9A2	102640563	1.000000	0.71417	0.948000	0.38648	0.909000	0.53808	7.770000	0.85390	2.854000	0.98071	0.655000	0.94253	CCC	-	SLC9A2	-	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger		0.463	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	HGNC	protein_coding	OTTHUMT00000253292.2	0	0	0	152	152	128	0.00	0.00	C			103274131	+1	27	20	100	115	tier1	no_errors	ENST00000233969	ensembl	human	known	74_37	missense	21.26	14.81	SNP	1.000	T	27	100
ZFP69B	65243	genome.wustl.edu	37	1	40929111	40929111	+	Silent	SNP	G	G	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr1:40929111G>A	ENST00000411995.2	+	6	1830	c.1455G>A	c.(1453-1455)agG>agA	p.R485R	ZFP69B_ENST00000361584.3_Silent_p.R383R|RP1-228H13.5_ENST00000565390.1_RNA|ZFP69B_ENST00000484445.1_3'UTR	NM_023070.2	NP_075558.2	Q9UJL9	ZF69B_HUMAN	ZFP69 zinc finger protein B	485					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AAGCCTTTAGGCATGATTCAT	0.398													ENSG00000187801																																					0													83.0	81.0	81.0					1																	40929111		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC017498	CCDS452.1, CCDS452.2	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187801	ENSG00000187801		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	28053	protein-coding gene	gene with protein product			"""zinc finger protein 643"""	ZNF643			Standard	NM_023070		Approved	ZKSCAN23B, FLJ34293, ZSCAN54B	uc001cfn.2	Q9UJL9	OTTHUMG00000007302	ENST00000411995.2:c.1455G>A	1.37:g.40929111G>A			Q5QPL4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R485	ENST00000411995.2	37	c.1455	CCDS452.2	1																																																																																			-	ZFP69B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.398	ZFP69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP69B	HGNC	protein_coding	OTTHUMT00000019078.2	0	0	0	34	34	54	0.00	0.00	G	NM_023070		40929111	+1	4	16	13	62	tier1	no_errors	ENST00000411995	ensembl	human	known	74_37	silent	23.53	20.51	SNP	0.044	A	4	13
BRINP2	57795	genome.wustl.edu	37	1	177249691	177249691	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr1:177249691T>A	ENST00000361539.4	+	8	1691	c.1379T>A	c.(1378-1380)tTg>tAg	p.L460*	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	460					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											CCATGTGCCTTGGGCGAAGGG	0.637													ENSG00000198797																																					0													39.0	37.0	38.0					1																	177249691		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1379T>A	1.37:g.177249691T>A	ENSP00000354481:p.Leu460*		O95560|Q6ZWC1|Q7LCZ9|Q8N360	Nonsense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.L460*	ENST00000361539.4	37	c.1379	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	T	37	6.442492	0.97572	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	.	.	.	5.21	5.21	0.72293	.	0.260506	0.32736	N	0.005705	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-10.7368	14.7454	0.69488	0.0:0.0:0.0:1.0	.	.	.	.	X	213;460	.	ENSP00000354481:L460X	L	+	2	0	FAM5B	175516314	1.000000	0.71417	1.000000	0.80357	0.531000	0.34715	7.930000	0.87610	1.965000	0.57142	0.260000	0.18958	TTG	-	BRINP2	-	NULL		0.637	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	HGNC	protein_coding	OTTHUMT00000084599.1	0	0	0	43	43	39	0.00	0.00	T	NM_021165		177249691	+1	13	15	27	35	tier1	no_errors	ENST00000361539	ensembl	human	known	74_37	nonsense	32.50	30.00	SNP	1.000	A	13	27
COBL	23242	genome.wustl.edu	37	7	51287560	51287560	+	Silent	SNP	G	G	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr7:51287560G>A	ENST00000265136.7	-	2	288	c.123C>T	c.(121-123)caC>caT	p.H41H	COBL_ENST00000395542.2_Silent_p.H41H|COBL_ENST00000441453.1_Silent_p.H41H|COBL_ENST00000395540.2_Silent_p.H41H	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	41					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GGGCCCCATCGTGGGGGGGCT	0.602													ENSG00000106078																									NSCLC(189;2119 2138 12223 30818 34679)												0													41.0	43.0	42.0					7																	51287560		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.123C>T	7.37:g.51287560G>A			A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	pfam_Cordon-bleu_ubiquitin_domain,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.H41	ENST00000265136.7	37	c.123	CCDS34637.1	7																																																																																			-	COBL	-	pfam_Cordon-bleu_ubiquitin_domain		0.602	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	HGNC	protein_coding	OTTHUMT00000342682.1	0	0	0	41	41	22	0.00	0.00	G	NM_015198		51287560	-1	7	3	39	16	tier1	no_errors	ENST00000395542	ensembl	human	known	74_37	silent	15.22	15.79	SNP	0.000	A	7	39
GRID2	2895	genome.wustl.edu	37	4	93225735	93225735	+	5'UTR	SNP	A	A	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr4:93225735A>T	ENST00000282020.4	+	0	186				GRID2_ENST00000505687.1_3'UTR|RP11-9B6.1_ENST00000504213.1_5'Flank|GRID2_ENST00000510992.1_5'Flank	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		CGTGACCTCAAACTCTTTGGA	0.413													ENSG00000152208																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.-73A>T	4.37:g.93225735A>T			E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	R	SNP	-	NULL	ENST00000282020.4	37	NULL	CCDS3637.1	4																																																																																			-	GRID2	-	-		0.413	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	0	0	0	32	32	51	0.00	0.00	A			93225735	+1	4	4	24	30	tier1	no_errors	ENST00000505687	ensembl	human	known	74_37	rna	14.29	11.76	SNP	1.000	T	4	24
CCL14	6358	genome.wustl.edu	37	17	34311580	34311580	+	Intron	SNP	A	A	G			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr17:34311580A>G	ENST00000394509.4	-	2	188				CCL15-CCL14_ENST00000481427.2_Intron|CTB-186H2.3_ENST00000593057.1_Intron|CCL14_ENST00000536149.1_Intron|CCL14_ENST00000586216.1_Intron|CTB-186H2.3_ENST00000591669.1_5'Flank|CCL14_ENST00000480944.2_Silent_p.P18P|CCL14_ENST00000435911.2_Intron			Q16627	CCL14_HUMAN	chemokine (C-C motif) ligand 14						cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|immune response (GO:0006955)|positive regulation of cell proliferation (GO:0008284)	extracellular space (GO:0005615)				large_intestine(1)|lung(6)	7		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGAGGAGGGAAGGAAGGAGGA	0.557													ENSG00000213494																																					0																																										SO:0001627	intron_variant	0			-	Z49270	CCDS32624.1, CCDS45652.1	17q11.2	2014-04-10	2002-08-22	2002-08-23	ENSG00000213494	ENSG00000276409		"""Chemokine ligands"", ""Endogenous ligands"""	10612	protein-coding gene	gene with protein product		601392	"""small inducible cytokine subfamily A (Cys-Cys), member 14"""	SCYA14		8661057	Standard	NM_032963		Approved	HCC-1, HCC-3, NCC-2, SCYL2, CKb1, MCIF	uc010wcq.1	Q16627	OTTHUMG00000188403	ENST00000394509.4:c.80-92T>C	17.37:g.34311580A>G			E1P649|E1P650|Q13954	Silent	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.P18	ENST00000394509.4	37	c.54	CCDS32624.1	17																																																																																			-	CCL14	-	NULL		0.557	CCL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL14	HGNC	protein_coding	OTTHUMT00000272892.2	0	0	0	30	30	78	0.00	0.00	A	NM_032962		34311580	-1	4	15	24	79	tier1	no_errors	ENST00000480944	ensembl	human	putative	74_37	silent	14.29	15.96	SNP	0.000	G	4	24
TPPP	11076	genome.wustl.edu	37	5	666157	666157	+	Silent	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr5:666157C>T	ENST00000360578.5	-	3	514	c.393G>A	c.(391-393)aaG>aaA	p.K131K	CEP72_ENST00000514507.1_3'UTR|AC026740.1_ENST00000594226.1_5'Flank	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	131					microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CCTCGCTGCTCTTGTCTTTGA	0.637													ENSG00000171368																																					0													102.0	91.0	95.0					5																	666157		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.393G>A	5.37:g.666157C>T				Silent	SNP	pfam_P25-alpha	p.K131	ENST00000360578.5	37	c.393	CCDS3856.1	5																																																																																			-	TPPP	-	pfam_P25-alpha		0.637	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPPP	HGNC	protein_coding	OTTHUMT00000253645.3	0	0	0	73	73	36	0.00	0.00	C	NM_007030		666157	-1	22	7	83	44	tier1	no_errors	ENST00000360578	ensembl	human	known	74_37	silent	20.95	13.73	SNP	1.000	T	22	83
CCDC93	54520	genome.wustl.edu	37	2	118753041	118753041	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr2:118753041T>C	ENST00000376300.2	-	6	637	c.500A>G	c.(499-501)aAg>aGg	p.K167R	CCDC93_ENST00000319432.5_Missense_Mutation_p.K167R|AC009303.1_ENST00000413179.1_RNA|CCDC93_ENST00000460781.1_5'UTR|AC009303.1_ENST00000588042.1_RNA|AC009303.1_ENST00000585381.3_RNA|AC009303.1_ENST00000590516.1_RNA|RP11-98C1.1_ENST00000588733.1_RNA	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	167										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						CACAACTGTCTTGATGGCCTT	0.438													ENSG00000125633																																					0													157.0	144.0	149.0					2																	118753041		2203	4300	6503	SO:0001583	missense	0			-	BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.500A>G	2.37:g.118753041T>C	ENSP00000365477:p.Lys167Arg		A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Missense_Mutation	SNP	pfam_DUF2037	p.K167R	ENST00000376300.2	37	c.500	CCDS2121.2	2	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818143	0.32145	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	T;T	0.43688	0.94;0.94	5.34	-1.61	0.08399	.	0.302038	0.41605	N	0.000848	T	0.21062	0.0507	N	0.16743	0.435	0.27724	N	0.945036	B	0.02656	0.0	B	0.11329	0.006	T	0.19128	-1.0315	10	0.20046	T	0.44	-5.9139	9.2425	0.37504	0.0:0.4257:0.0:0.5743	.	167	Q567U6	CCD93_HUMAN	R	167	ENSP00000365477:K167R;ENSP00000324135:K167R	ENSP00000324135:K167R	K	-	2	0	CCDC93	118469511	1.000000	0.71417	0.985000	0.45067	0.961000	0.63080	0.694000	0.25512	-0.302000	0.08869	0.528000	0.53228	AAG	-	CCDC93	-	pfam_DUF2037		0.438	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC93	HGNC	protein_coding	OTTHUMT00000129615.1	0	0	0	52	52	103	0.00	0.00	T	NM_019044		118753041	-1	12	55	74	244	tier1	no_errors	ENST00000376300	ensembl	human	known	74_37	missense	13.95	18.27	SNP	0.996	C	12	74
CSMD3	114788	genome.wustl.edu	37	8	113651036	113651036	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr8:113651036A>C	ENST00000297405.5	-	21	3659	c.3415T>G	c.(3415-3417)Tca>Gca	p.S1139A	CSMD3_ENST00000455883.2_Missense_Mutation_p.S1035A|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1139A|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1099A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1139	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGAAGATCTGAACCAGTCAGG	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			ENSG00000164796																																					0													112.0	109.0	110.0					8																	113651036		2203	4300	6503	SO:0001583	missense	0			-	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3415T>G	8.37:g.113651036A>C	ENSP00000297405:p.Ser1139Ala		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S1139A	ENST00000297405.5	37	c.3415	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	A	14.77	2.633245	0.47049	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22	5.36	5.36	0.76844	CUB (5);	0.200742	0.33457	N	0.004889	T	0.32194	0.0821	L	0.54323	1.7	0.24552	N	0.994019	B;B;P	0.35011	0.078;0.095;0.48	B;B;P	0.52957	0.053;0.088;0.714	T	0.22208	-1.0223	10	0.16896	T	0.51	.	15.343	0.74311	1.0:0.0:0.0:0.0	.	1035;1139;1099	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	A	1099;1139;479;1035;1139	ENSP00000345799:S1099A;ENSP00000297405:S1139A;ENSP00000341558:S479A;ENSP00000412263:S1035A;ENSP00000343124:S1139A	ENSP00000297405:S1139A	S	-	1	0	CSMD3	113720212	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	4.827000	0.62723	2.045000	0.60652	0.402000	0.26972	TCA	-	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.403	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	0	0	0	62	62	68	0.00	0.00	A	NM_052900		113651036	-1	12	22	65	122	tier1	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	15.58	15.28	SNP	1.000	C	12	65
AVIL	10677	genome.wustl.edu	37	12	58200182	58200182	+	Silent	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr12:58200182C>T	ENST00000257861.3	-	13	2062	c.1632G>A	c.(1630-1632)ctG>ctA	p.L544L	RNU6-1083P_ENST00000384022.1_RNA|RP11-571M6.17_ENST00000602802.1_lincRNA|TSFM_ENST00000548851.1_Intron|AVIL_ENST00000550083.1_5'UTR|AVIL_ENST00000537081.1_Silent_p.L537L	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	544	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GAGTTCGCAGCAGAAAGACAT	0.542													ENSG00000135407																																					0													144.0	122.0	130.0					12																	58200182		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1632G>A	12.37:g.58200182C>T			B2RAU7|Q2NKM9	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.L544	ENST00000257861.3	37	c.1632	CCDS8959.1	12																																																																																			-	AVIL	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin		0.542	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	0	0	0	26	26	60	0.00	0.00	C	NM_006576		58200182	-1	68	150	305	951	tier1	no_errors	ENST00000257861	ensembl	human	known	74_37	silent	18.23	13.60	SNP	1.000	T	68	305
ANKRD18DP	348840	genome.wustl.edu	37	3	197790619	197790619	+	RNA	SNP	C	C	T	rs576708584		TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr3:197790619C>T	ENST00000435620.2	-	0	1035					NR_003291.1				ankyrin repeat domain 18D, pseudogene																		TTCTTTCAAGCGTTTCTTGCT	0.328													ENSG00000226435																																					0																																												0			-	BC042518		3q29	2011-11-23			ENSG00000226435	ENSG00000226435			28016	pseudogene	pseudogene							Standard	NR_003291		Approved		uc003fyx.3		OTTHUMG00000150228		3.37:g.197790619C>T				R	SNP	-	NULL	ENST00000435620.2	37	NULL		3																																																																																			-	ANKRD18DP	-	-		0.328	ANKRD18DP-001	KNOWN	basic	processed_transcript	ANKRD18DP	HGNC	pseudogene	OTTHUMT00000316910.2	0	0	0	31	31	51	0.00	0.00	C	NR_003291		197790619	-1	8	17	20	51	tier1	no_errors	ENST00000335478	ensembl	human	known	74_37	rna	28.57	25.00	SNP	0.000	T	8	20
GEMIN4	50628	genome.wustl.edu	37	17	651068	651068	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr17:651068A>T	ENST00000319004.5	-	2	333	c.215T>A	c.(214-216)aTc>aAc	p.I72N	GEMIN4_ENST00000576778.1_Missense_Mutation_p.I61N|GEMIN4_ENST00000437269.1_Missense_Mutation_p.I72N	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	72					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GGCCCAGATGATGATCAGGGC	0.607													ENSG00000179409																																					0													55.0	59.0	58.0					17																	651068		2017	4165	6182	SO:0001583	missense	0			-	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.215T>A	17.37:g.651068A>T	ENSP00000321706:p.Ile72Asn		Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	NULL	p.I72N	ENST00000319004.5	37	c.215	CCDS45559.1	17	.	.	.	.	.	.	.	.	.	.	A	17.81	3.479861	0.63849	.	.	ENSG00000179409	ENST00000319004;ENST00000437269	T;T	0.26660	1.72;1.72	5.66	4.58	0.56647	.	0.422970	0.25329	N	0.031449	T	0.45875	0.1364	M	0.64997	1.995	0.41415	D	0.987761	P;D	0.89917	0.925;1.0	P;D	0.76575	0.466;0.988	T	0.42224	-0.9464	10	0.87932	D	0	-12.4742	10.4214	0.44352	0.9228:0.0:0.0772:0.0	.	72;72	E7EN12;P57678	.;GEMI4_HUMAN	N	72	ENSP00000321706:I72N;ENSP00000392460:I72N	ENSP00000321706:I72N	I	-	2	0	GEMIN4	597818	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	4.300000	0.59079	0.985000	0.38656	0.533000	0.62120	ATC	-	GEMIN4	-	NULL		0.607	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1	0	0	0	70	70	41	0.00	0.00	A	NM_015721		651068	-1	9	12	38	31	tier1	no_errors	ENST00000319004	ensembl	human	known	74_37	missense	19.15	27.91	SNP	0.986	T	9	38
EPB41L5	57669	genome.wustl.edu	37	2	120918392	120918392	+	Intron	SNP	C	C	A			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr2:120918392C>A	ENST00000263713.5	+	21	2007				EPB41L5_ENST00000443902.2_Intron|EPB41L5_ENST00000488691.1_3'UTR|EPB41L5_ENST00000452780.1_Intron	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5						actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TAAGCCCTTTCTTTGAAAATC	0.378													ENSG00000115109																																					0																																										SO:0001627	intron_variant	0			-	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1794-65C>A	2.37:g.120918392C>A			Q7Z5S1|Q8IZ12|Q9H975	R	SNP	-	NULL	ENST00000263713.5	37	NULL	CCDS2130.1	2																																																																																			-	EPB41L5	-	-		0.378	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	0	0	1	75	75	92	0.00	1.08	C	NM_020909		120918392	+1	12	28	41	66	tier1	no_errors	ENST00000488691	ensembl	human	known	74_37	rna	22.64	29.79	SNP	0.003	A	12	41
OSBPL3	26031	genome.wustl.edu	37	7	24902873	24902873	+	Silent	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr7:24902873C>T	ENST00000313367.2	-	9	1267	c.816G>A	c.(814-816)tcG>tcA	p.S272S	OSBPL3_ENST00000353930.1_Silent_p.S272S|OSBPL3_ENST00000431825.2_Intron|OSBPL3_ENST00000396429.1_Silent_p.S272S|OSBPL3_ENST00000396431.1_Intron|OSBPL3_ENST00000352860.1_Intron|OSBPL3_ENST00000409069.1_Intron	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	272					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						ACCTCCTGTGCGATCTTTTTT	0.463													ENSG00000070882																																					0													127.0	110.0	116.0					7																	24902873		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.816G>A	7.37:g.24902873C>T			A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S272	ENST00000313367.2	37	c.816	CCDS5390.1	7																																																																																			-	OSBPL3	-	NULL		0.463	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	HGNC	protein_coding	OTTHUMT00000214085.2	0	0	0	67	67	93	0.00	0.00	C			24902873	-1	8	24	35	105	tier1	no_errors	ENST00000313367	ensembl	human	known	74_37	silent	18.60	18.60	SNP	0.000	T	8	35
MRPS30	10884	genome.wustl.edu	37	5	44809252	44809252	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr5:44809252T>G	ENST00000507110.1	+	1	226	c.188T>G	c.(187-189)aTc>aGc	p.I63S	RP11-53O19.1_ENST00000505302.1_RNA|RP11-53O19.1_ENST00000503452.1_RNA|RP11-53O19.1_ENST00000503179.1_RNA|RP11-53O19.1_ENST00000508945.1_RNA|RP11-53O19.1_ENST00000505401.1_RNA|RP11-53O19.1_ENST00000505637.1_RNA|RP11-53O19.1_ENST00000508123.1_RNA|RP11-53O19.1_ENST00000514597.1_RNA	NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	63					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					CTGCGGCGGATCGAGCGCTGG	0.632													ENSG00000112996																																					0													13.0	17.0	16.0					5																	44809252		2195	4278	6473	SO:0001583	missense	0			-	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.188T>G	5.37:g.44809252T>G	ENSP00000424328:p.Ile63Ser		Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Missense_Mutation	SNP	pfam_Ribosomal_L37/S30	p.I63S	ENST00000507110.1	37	c.188	CCDS3951.1	5	.	.	.	.	.	.	.	.	.	.	T	10.07	1.249244	0.22880	.	.	ENSG00000112996	ENST00000507110	T	0.16457	2.34	5.44	4.25	0.50352	.	0.560066	0.18639	N	0.135350	T	0.10895	0.0266	N	0.14661	0.345	0.09310	N	1	B	0.27625	0.183	B	0.25614	0.062	T	0.20940	-1.0260	10	0.41790	T	0.15	-0.869	11.9385	0.52886	0.0:0.0:0.2744:0.7256	.	63	Q9NP92	RT30_HUMAN	S	63	ENSP00000424328:I63S	ENSP00000424328:I63S	I	+	2	0	MRPS30	44845009	0.940000	0.31905	0.615000	0.29064	0.002000	0.02628	0.566000	0.23593	1.036000	0.39998	0.533000	0.62120	ATC	-	MRPS30	-	pfam_Ribosomal_L37/S30		0.632	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS30	HGNC	protein_coding	OTTHUMT00000214033.2	0	0	0	48	48	9	0.00	0.00	T	NM_016640		44809252	+1	7	7	37	7	tier1	no_errors	ENST00000507110	ensembl	human	known	74_37	missense	15.91	50.00	SNP	0.122	G	7	37
NT5E	4907	genome.wustl.edu	37	6	86160038	86160038	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr6:86160038G>C	ENST00000257770.3	+	1	230	c.181G>C	c.(181-183)Gtg>Ctg	p.V61L	NT5E_ENST00000369651.3_Missense_Mutation_p.V61L|NT5E_ENST00000369646.3_Missense_Mutation_p.V61L	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	61					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	CATGGGTGGCGTGGCTCGGCT	0.637													ENSG00000135318																									Melanoma(140;797 1765 2035 2752 18208)												0													14.0	13.0	14.0					6																	86160038		2174	4252	6426	SO:0001583	missense	0			-	X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.181G>C	6.37:g.86160038G>C	ENSP00000257770:p.Val61Leu		B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	pfam_5'-Nucleotdase_C,pfam_PEstase_dom,superfamily_5'-Nucleotdase_C,prints_5_nucleotidase/apyrase	p.V61L	ENST00000257770.3	37	c.181	CCDS5002.1	6	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490212	0.64074	.	.	ENSG00000135318	ENST00000257770;ENST00000369646;ENST00000369651	T;T	0.52057	0.68;0.71	4.13	4.13	0.48395	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.36552	0.0971	L	0.33245	0.995	0.58432	D	0.999997	P;P;P	0.47910	0.902;0.838;0.876	P;P;P	0.52554	0.702;0.508;0.576	T	0.16778	-1.0391	10	0.39692	T	0.17	-10.7561	13.8826	0.63689	0.0:0.0:1.0:0.0	.	61;61;61	B3KQI8;P21589;Q96B60	.;5NTD_HUMAN;.	L	61	ENSP00000257770:V61L;ENSP00000358665:V61L	ENSP00000257770:V61L	V	+	1	0	NT5E	86216757	1.000000	0.71417	1.000000	0.80357	0.205000	0.24178	6.797000	0.75150	1.845000	0.53610	0.462000	0.41574	GTG	-	NT5E	-	pfam_PEstase_dom		0.637	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5E	HGNC	protein_coding	OTTHUMT00000041388.1	0	0	0	11	11	11	0.00	0.00	G			86160038	+1	6	6	8	5	tier1	no_errors	ENST00000257770	ensembl	human	known	74_37	missense	42.86	54.55	SNP	1.000	C	6	8
RGPD4	285190	genome.wustl.edu	37	2	108487407	108487407	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr2:108487407G>C	ENST00000408999.3	+	20	3024	c.2947G>C	c.(2947-2949)Gga>Cga	p.G983R	RGPD4_ENST00000354986.4_Missense_Mutation_p.G983R	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	983					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TTCAGGAGAAGGATTTCAGTT	0.393													ENSG00000196862																																					0													1.0	1.0	1.0					2																	108487407		58	317	375	SO:0001583	missense	0			-	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2947G>C	2.37:g.108487407G>C	ENSP00000386810:p.Gly983Arg		B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.G983R	ENST00000408999.3	37	c.2947	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	10.40	1.339296	0.24339	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.42900	0.96;0.96	2.33	2.33	0.28932	.	.	.	.	.	T	0.51958	0.1705	M	0.72118	2.19	0.28260	N	0.924877	D	0.61080	0.989	P	0.54590	0.756	T	0.45991	-0.9223	9	0.23302	T	0.38	-30.1516	11.5771	0.50869	0.0:0.0:1.0:0.0	.	983	Q7Z3J3	RGPD4_HUMAN	R	983;983;741	ENSP00000347081:G983R;ENSP00000386810:G983R	ENSP00000347081:G983R	G	+	1	0	RGPD4	107853839	1.000000	0.71417	1.000000	0.80357	0.232000	0.25224	5.042000	0.64202	1.303000	0.44873	0.162000	0.16502	GGA	-	RGPD4	-	NULL		0.393	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	0	0	0	78	78	5	0.00	0.00	G	XM_496581		108487407	+1	25	4	39	6	tier1	no_errors	ENST00000354986	ensembl	human	known	74_37	missense	39.06	40.00	SNP	1.000	C	25	39
APC2	10297	genome.wustl.edu	37	19	1455427	1455427	+	Silent	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr19:1455427C>T	ENST00000535453.1	+	5	2280	c.567C>T	c.(565-567)ttC>ttT	p.F189F	CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000233607.2_Silent_p.F189F|APC2_ENST00000238483.4_Intron			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCTTGAGTTCGAGGCCCAGC	0.716													ENSG00000115266																																					0													19.0	17.0	18.0					19																	1455427		2193	4296	6489	SO:0001819	synonymous_variant	0			-		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.567C>T	19.37:g.1455427C>T			C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	pfam_APC_basic_dom,pfam_APC_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.F189	ENST00000535453.1	37	c.567	CCDS12068.1	19																																																																																			-	APC2	-	pfam_APC_dom		0.716	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	0	0	0	47	47	23	0.00	0.00	C	NM_005883		1455427	+1	4	0	39	4	tier1	no_errors	ENST00000233607	ensembl	human	known	74_37	silent	9.30	0.00	SNP	1.000	T	4	39
CSPG4P5	114817	genome.wustl.edu	37	15	84957462	84957466	+	RNA	DEL	GTGGC	GTGGC	-	rs578077920|rs540048240|rs376565740|rs145189308	byFrequency	TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	GTGGC	GTGGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr15:84957462_84957466delGTGGC	ENST00000558801.1	-	0	7263_7267									DNM1 pseudogene 51																		CACTTGTAGGGTGGCATCTGTGTGC	0.571													ENSG00000235370																																					0																																												0						15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84957462_84957466delGTGGC				R	DEL	-	NULL	ENST00000558801.1	37	NULL		15																																																																																				DNM1P51	-	-		0.571	DNM1P51-001	KNOWN	basic	processed_transcript	DNM1P51	HGNC	pseudogene	OTTHUMT00000471721.1	0	0	0	2	2	2	0.00	0.00	GTGGC			84957466	-1	0	0	2	2	tier1	no_errors	ENST00000558801	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.944:0.935:0.925:0.912:0.907	-	0	2
SCG3	29106	genome.wustl.edu	37	15	51987959	51987960	+	Intron	INS	-	-	A	rs78233272|rs370571693		TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr15:51987959_51987960insA	ENST00000220478.3	+	8	1271				SCG3_ENST00000542355.2_Intron|RP11-313P18.2_ENST00000559918.1_lincRNA	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		cctcgtctttgaaaaaaaaaaa	0.401													ENSG00000259241																																					0																																										SO:0001627	intron_variant	0				AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.869-112->A	15.37:g.51987970_51987970dupA			A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	R	INS	-	NULL	ENST00000220478.3	37	NULL	CCDS10142.1	15																																																																																				RP11-313P18.2	-	-		0.401	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259241	Clone_based_vega_gene	protein_coding	OTTHUMT00000254670.2	0	0	0	14	14	0	0.00	0.00	-	NM_013243		51987960	-1	4	0	10	0	tier1	no_errors	ENST00000559918	ensembl	human	known	74_37	rna	28.57	0.00	INS	0.003:0.006	A	4	10
ZAP70	7535	genome.wustl.edu	37	2	98340753	98340753	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr2:98340753A>C	ENST00000264972.5	+	3	469	c.254A>C	c.(253-255)gAg>gCg	p.E85A	ZAP70_ENST00000442208.1_5'Flank	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	85	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						GAGCTCTGCGAGTTCTACTCG	0.687													ENSG00000115085																																					0													14.0	14.0	14.0					2																	98340753		2198	4296	6494	SO:0001583	missense	0			-	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.254A>C	2.37:g.98340753A>C	ENSP00000264972:p.Glu85Ala		A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E85A	ENST00000264972.5	37	c.254	CCDS33254.1	2	.	.	.	.	.	.	.	.	.	.	A	11.58	1.680318	0.29872	.	.	ENSG00000115085	ENST00000264972	T	0.27720	1.65	4.9	4.9	0.64082	SH2 motif (4);	0.133234	0.33217	N	0.005148	T	0.31949	0.0813	L	0.53671	1.685	0.80722	D	1	B;B	0.18166	0.026;0.006	B;B	0.24848	0.056;0.03	T	0.12426	-1.0548	10	0.54805	T	0.06	.	12.7795	0.57469	1.0:0.0:0.0:0.0	.	85;85	B4E0E2;P43403	.;ZAP70_HUMAN	A	85	ENSP00000264972:E85A	ENSP00000264972:E85A	E	+	2	0	ZAP70	97707185	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	8.895000	0.92512	1.982000	0.57802	0.383000	0.25322	GAG	-	ZAP70	-	pfam_SH2,smart_SH2,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2		0.687	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	HGNC	protein_coding	OTTHUMT00000329278.1	0	0	0	34	34	4	0.00	0.00	A			98340753	+1	7	3	15	5	tier1	no_errors	ENST00000264972	ensembl	human	known	74_37	missense	31.82	37.50	SNP	1.000	C	7	15
COPS4	51138	genome.wustl.edu	37	4	83978556	83978556	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr4:83978556C>T	ENST00000264389.2	+	6	845	c.710C>T	c.(709-711)tCa>tTa	p.S237L	COPS4_ENST00000511653.1_Missense_Mutation_p.S237L|COPS4_ENST00000509093.1_Missense_Mutation_p.S237L|COPS4_ENST00000503682.1_Missense_Mutation_p.S237L	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	237	PCI.				cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				ATCTTAGCATCAGCAGGTAAA	0.358													ENSG00000138663																																					0													72.0	70.0	70.0					4																	83978556		2203	4300	6503	SO:0001583	missense	0			-	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.710C>T	4.37:g.83978556C>T	ENSP00000264389:p.Ser237Leu		B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.S237L	ENST00000264389.2	37	c.710	CCDS3600.1	4	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033182	0.93575	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000509317;ENST00000503682;ENST00000511653	T;T;T;T;T	0.46063	0.88;0.9;0.91;0.88;0.88	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.64450	0.2599	M	0.78637	2.42	0.80722	D	1	P;D;D;P	0.71674	0.847;0.991;0.998;0.848	B;P;P;P	0.59761	0.421;0.758;0.863;0.638	T	0.68762	-0.5323	10	0.87932	D	0	-7.3394	19.3834	0.94546	0.0:1.0:0.0:0.0	.	237;237;237;237	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	L	237;237;125;237;237	ENSP00000425976:S237L;ENSP00000264389:S237L;ENSP00000425486:S125L;ENSP00000424791:S237L;ENSP00000424655:S237L	ENSP00000264389:S237L	S	+	2	0	COPS4	84197580	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.428000	0.80296	2.593000	0.87608	0.591000	0.81541	TCA	-	COPS4	-	NULL		0.358	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS4	HGNC	protein_coding	OTTHUMT00000252643.1	0	0	0	38	38	113	0.00	0.00	C			83978556	+1	4	2	38	152	tier1	no_errors	ENST00000264389	ensembl	human	known	74_37	missense	9.52	1.29	SNP	1.000	T	4	38
CCDC126	90693	genome.wustl.edu	37	7	23650855	23650855	+	5'UTR	DEL	T	T	-			TCGA-DX-A1KZ-01A-11D-A24N-09	TCGA-DX-A1KZ-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	aacfaf58-eb86-443a-a1d0-54c121ca3733	11c93f95-9863-4cb0-a348-f35a54b2071a	g.chr7:23650855delT	ENST00000307471.3	+	0	378				CCDC126_ENST00000486109.1_3'UTR|CCDC126_ENST00000410069.1_5'UTR|CCDC126_ENST00000409765.1_5'UTR	NM_138771.3	NP_620126.2	Q96EE4	CC126_HUMAN	coiled-coil domain containing 126						protein N-linked glycosylation (GO:0006487)	extracellular region (GO:0005576)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(3)|kidney(1)|large_intestine(1)|ovary(1)|skin(1)	7						TATTTTTTTCTTTTTTTTTTC	0.289													ENSG00000169193																																					0																																										SO:0001623	5_prime_UTR_variant	0				BC012427	CCDS5384.1	7p15.3	2006-08-15			ENSG00000169193	ENSG00000169193			22398	protein-coding gene	gene with protein product						12477932	Standard	NM_138771		Approved	FLJ23031	uc003swl.3	Q96EE4	OTTHUMG00000128461	ENST00000307471.3:c.-80T>-	7.37:g.23650855delT			A8K1J6|Q6UWP1|Q75MQ6	R	DEL	-	NULL	ENST00000307471.3	37	NULL	CCDS5384.1	7																																																																																				CCDC126	-	-		0.289	CCDC126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC126	HGNC	protein_coding	OTTHUMT00000250259.1	0	0	0	26	26	52	0.00	0.00	T	NM_138771		23650855	+1	4	2	13	61	tier1	no_errors	ENST00000486109	ensembl	human	putative	74_37	rna	23.53	3.17	DEL	0.020	-	4	13
