#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
DNM1P46	196968	genome.wustl.edu	37	15	100331972	100331972	+	RNA	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr15:100331972G>A	ENST00000341853.1	-	0	2219				RN7SL484P_ENST00000462651.2_RNA|AC090825.1_ENST00000408584.1_RNA	NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										GGAGCCAGTGGTCAGACACCA	0.557													ENSG00000182397																																					0													38.0	39.0	39.0					15																	100331972		876	1991	2867			0			-	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100331972G>A			Q3ZCN3	R	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			-	DNM1P46	-	-		0.557	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	0	0	0	119	119	17	0.00	0.00	G	NR_003260		100331972	-1	36	7	107	14	tier1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	25.17	33.33	SNP	0.316	A	36	107
OR4A15	81328	genome.wustl.edu	37	11	55135991	55135991	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr11:55135991C>T	ENST00000314706.3	+	1	632	c.632C>T	c.(631-633)cCc>cTc	p.P211L		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						GATTTGTATCCCTTATTGAAA	0.413													ENSG00000181958																																					0													138.0	128.0	131.0					11																	55135991		2201	4293	6494	SO:0001583	missense	0			-	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.632C>T	11.37:g.55135991C>T	ENSP00000325065:p.Pro211Leu		Q6IFL4|Q96R65	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P211L	ENST00000314706.3	37	c.632	CCDS31500.1	11	.	.	.	.	.	.	.	.	.	.	-	10.03	1.239170	0.22711	.	.	ENSG00000181958	ENST00000314706	T	0.00224	8.51	3.65	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000134	T	0.00468	0.0015	M	0.80028	2.48	0.09310	N	0.999999	D	0.67145	0.996	D	0.71414	0.973	T	0.36480	-0.9746	10	0.87932	D	0	.	8.7222	0.34447	0.0:0.8837:0.0:0.1163	.	211	Q8NGL6	O4A15_HUMAN	L	211	ENSP00000325065:P211L	ENSP00000325065:P211L	P	+	2	0	OR4A15	54892567	0.000000	0.05858	0.007000	0.13788	0.048000	0.14542	0.086000	0.14935	0.742000	0.32697	0.492000	0.49549	CCC	-	OR4A15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.413	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	0	0	0	205	205	62	0.00	0.00	C	NM_001005275		55135991	+1	46	23	83	28	tier1	no_errors	ENST00000314706	ensembl	human	known	74_37	missense	35.66	45.10	SNP	0.008	T	46	83
EML1	2009	genome.wustl.edu	37	14	100402664	100402664	+	Silent	SNP	C	C	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr14:100402664C>A	ENST00000262233.6	+	19	2227	c.2088C>A	c.(2086-2088)atC>atA	p.I696I	EML1_ENST00000327921.9_Silent_p.I684I|EML1_ENST00000334192.4_Silent_p.I715I	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	696	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				ACTACGAAATCCTCTACTGTG	0.507													ENSG00000066629																																					0													88.0	71.0	77.0					14																	100402664		2202	4300	6502	SO:0001819	synonymous_variant	0			-	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.2088C>A	14.37:g.100402664C>A			Q86U15|Q8N536|Q8N5C4|Q8WWL6	Silent	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I715	ENST00000262233.6	37	c.2145	CCDS32155.1	14																																																																																			-	EML1	-	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.507	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EML1	HGNC	protein_coding	OTTHUMT00000413943.1	0	0	0	53	53	147	0.00	0.00	C	NM_001008707		100402664	+1	13	64	84	374	tier1	no_errors	ENST00000334192	ensembl	human	known	74_37	silent	13.13	14.61	SNP	1.000	A	13	84
ATP1A4	480	genome.wustl.edu	37	1	160125005	160125005	+	Missense_Mutation	SNP	G	G	C	rs370755520	byFrequency	TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:160125005G>C	ENST00000368081.4	+	3	849	c.378G>C	c.(376-378)caG>caC	p.Q126H		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	126					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACAGCATCCAGATATATTTCA	0.498													ENSG00000132681																																					0													51.0	48.0	49.0					1																	160125005		2203	4300	6503	SO:0001583	missense	0			-	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.378G>C	1.37:g.160125005G>C	ENSP00000357060:p.Gln126His		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.Q126H	ENST00000368081.4	37	c.378	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	G	6.331	0.429149	0.11987	.	.	ENSG00000132681	ENST00000368081	D	0.88741	-2.42	4.25	2.36	0.29203	.	0.134244	0.50627	N	0.000101	T	0.81312	0.4796	M	0.81614	2.55	0.80722	D	1	B	0.15719	0.014	B	0.15052	0.012	T	0.78003	-0.2374	10	0.56958	D	0.05	.	8.0998	0.30850	0.2011:0.0:0.7989:0.0	.	126	Q13733	AT1A4_HUMAN	H	126	ENSP00000357060:Q126H	ENSP00000357060:Q126H	Q	+	3	2	ATP1A4	158391629	1.000000	0.71417	0.091000	0.20842	0.003000	0.03518	3.185000	0.50934	0.436000	0.26393	-0.208000	0.12717	CAG	-	ATP1A4	-	tigrfam_ATPase_P-typ_Na/K_IIC		0.498	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	0	0	1	73	73	53	0.00	1.85	G	NM_144699		160125005	+1	24	47	172	211	tier1	no_errors	ENST00000368081	ensembl	human	known	74_37	missense	12.18	18.08	SNP	0.934	C	24	172
PROM1	8842	genome.wustl.edu	37	4	16014945	16014945	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr4:16014945T>C	ENST00000510224.1	-	11	1342	c.1094A>G	c.(1093-1095)aAt>aGt	p.N365S	PROM1_ENST00000508167.1_Missense_Mutation_p.N356S|PROM1_ENST00000447510.2_Missense_Mutation_p.N365S|PROM1_ENST00000543373.1_Missense_Mutation_p.N356S|PROM1_ENST00000505450.1_Missense_Mutation_p.N356S|PROM1_ENST00000540805.1_Missense_Mutation_p.N365S|PROM1_ENST00000539194.1_Missense_Mutation_p.N365S			O43490	PROM1_HUMAN	prominin 1	365					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						AGGTATATCATTAAGGGATTG	0.388													ENSG00000007062																																					0													150.0	144.0	146.0					4																	16014945		1872	4117	5989	SO:0001583	missense	0			-	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1094A>G	4.37:g.16014945T>C	ENSP00000426809:p.Asn365Ser		Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	pfam_Prominin	p.N365S	ENST00000510224.1	37	c.1094	CCDS47029.1	4	.	.	.	.	.	.	.	.	.	.	T	14.98	2.698641	0.48307	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.03	3.83	0.44106	.	0.156359	0.56097	N	0.000023	T	0.38427	0.1040	L	0.43923	1.385	0.30319	N	0.787775	P;P;P;P;B;P	0.44429	0.835;0.835;0.739;0.835;0.264;0.624	P;P;B;P;B;B	0.45856	0.495;0.495;0.343;0.495;0.033;0.395	T	0.30679	-0.9970	10	0.30854	T	0.27	-25.1068	10.1948	0.43047	0.0:0.0:0.1677:0.8323	.	356;365;356;365;356;365	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	S	365;365;365;356;356;365;356	ENSP00000415481:N365S;ENSP00000438045:N365S;ENSP00000443620:N365S;ENSP00000426090:N356S;ENSP00000427346:N356S;ENSP00000426809:N365S;ENSP00000445526:N356S	ENSP00000415481:N365S	N	-	2	0	PROM1	15624043	0.997000	0.39634	0.002000	0.10522	0.529000	0.34654	3.652000	0.54439	0.748000	0.32831	0.455000	0.32223	AAT	-	PROM1	-	pfam_Prominin		0.388	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	HGNC	protein_coding	OTTHUMT00000359595.2	0	0	0	37	37	59	0.00	0.00	T	NM_006017		16014945	-1	8	16	23	44	tier1	no_errors	ENST00000447510	ensembl	human	known	74_37	missense	25.81	26.67	SNP	0.999	C	8	23
PAFAH2	5051	genome.wustl.edu	37	1	26308893	26308893	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:26308893T>G	ENST00000374282.3	-	7	807	c.628A>C	c.(628-630)Aac>Cac	p.N210H	PAFAH2_ENST00000493892.1_5'UTR|PAFAH2_ENST00000374284.1_Missense_Mutation_p.N210H	NM_000437.3	NP_000428.2	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2, 40kDa	210					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|phospholipid binding (GO:0005543)			NS(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	9		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAAGATGTTGAAGACAGTC	0.502													ENSG00000158006																																					0													139.0	121.0	127.0					1																	26308893		2203	4300	6503	SO:0001583	missense	0			-	D87845	CCDS270.1	1p34.3	2008-09-19	2002-08-29		ENSG00000158006	ENSG00000158006			8579	protein-coding gene	gene with protein product		602344	"""platelet-activating factor acetylhydrolase 2 (40kD)"""			8955149, 9494101	Standard	NM_000437		Approved	HSD-PLA2	uc001bld.4	Q99487	OTTHUMG00000007437	ENST00000374282.3:c.628A>C	1.37:g.26308893T>G	ENSP00000363400:p.Asn210His		D3DPK1|O15458|Q5SY02	Missense_Mutation	SNP	pfam_PAF_acetylhydro,pfam_Peptidase_S9,pirsf_PAF_acetylhydro_eukaryote	p.N210H	ENST00000374282.3	37	c.628	CCDS270.1	1	.	.	.	.	.	.	.	.	.	.	T	18.52	3.642886	0.67244	.	.	ENSG00000158006	ENST00000374282;ENST00000374284	T;T	0.58797	0.31;0.31	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000002	T	0.69566	0.3125	L	0.43923	1.385	0.41313	D	0.987124	D	0.89917	1.0	D	0.91635	0.999	T	0.72064	-0.4403	10	0.62326	D	0.03	-19.5164	15.0621	0.71964	0.0:0.0:0.0:1.0	.	210	Q99487	PAFA2_HUMAN	H	210	ENSP00000363400:N210H;ENSP00000363402:N210H	ENSP00000363400:N210H	N	-	1	0	PAFAH2	26181480	1.000000	0.71417	0.938000	0.37757	0.409000	0.31022	4.976000	0.63785	2.206000	0.71126	0.533000	0.62120	AAC	-	PAFAH2	-	pfam_PAF_acetylhydro,pirsf_PAF_acetylhydro_eukaryote		0.502	PAFAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH2	HGNC	protein_coding	OTTHUMT00000019544.1	0	0	0	52	52	70	0.00	0.00	T	NM_000437		26308893	-1	8	21	31	82	tier1	no_errors	ENST00000374282	ensembl	human	known	74_37	missense	20.51	20.39	SNP	0.998	G	8	31
BCAN	63827	genome.wustl.edu	37	1	156627954	156627954	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:156627954C>G	ENST00000329117.5	+	12	2664	c.2328C>G	c.(2326-2328)agC>agG	p.S776R	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	776	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGCCTGACAGCTACTTCCTGT	0.587											OREG0013880	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000132692																																					0													105.0	83.0	91.0					1																	156627954		2203	4300	6503	SO:0001583	missense	0			-	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2328C>G	1.37:g.156627954C>G	ENSP00000331210:p.Ser776Arg	1779	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom	p.S776R	ENST00000329117.5	37	c.2328	CCDS1149.1	1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551742	0.86127	.	.	ENSG00000132692	ENST00000329117	T	0.17213	2.29	5.35	5.35	0.76521	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.28962	0.0719	L	0.48986	1.54	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.00807	-1.1558	10	0.72032	D	0.01	-23.262	16.5911	0.84765	0.0:1.0:0.0:0.0	.	776	Q96GW7	PGCB_HUMAN	R	776	ENSP00000331210:S776R	ENSP00000331210:S776R	S	+	3	2	BCAN	154894578	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.784000	0.55416	2.781000	0.95711	0.655000	0.94253	AGC	-	BCAN	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.587	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	HGNC	protein_coding	OTTHUMT00000081844.2	0	0	0	105	105	59	0.00	0.00	C	NM_021948		156627954	+1	28	22	54	46	tier1	no_errors	ENST00000329117	ensembl	human	known	74_37	missense	34.15	31.43	SNP	1.000	G	28	54
DNAH5	1767	genome.wustl.edu	37	5	13727742	13727742	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr5:13727742C>T	ENST00000265104.4	-	70	12011	c.11907G>A	c.(11905-11907)tgG>tgA	p.W3969*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3969					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ACCAAATTTTCCACATTTTCT	0.383									Kartagener syndrome				ENSG00000039139																																					0													95.0	96.0	96.0					5																	13727742		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11907G>A	5.37:g.13727742C>T	ENSP00000265104:p.Trp3969*		Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.W3969*	ENST00000265104.4	37	c.11907	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	54	22.354201	0.99947	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3861	0.94556	0.0:1.0:0.0:0.0	.	.	.	.	X	3969	.	ENSP00000265104:W3969X	W	-	3	0	DNAH5	13780742	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.798000	0.85924	2.594000	0.87642	0.650000	0.86243	TGG	-	DH5	-	pfam_Dynein_heavy_dom		0.383	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	0	52	52	82	0.00	0.00	C	NM_001369		13727742	-1	31	39	24	54	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	nonsense	56.36	41.94	SNP	1.000	T	31	24
DNAH5	1767	genome.wustl.edu	37	5	13727766	13727766	+	Splice_Site	SNP	C	C	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr5:13727766C>A	ENST00000265104.4	-	70	11988		c.e70-1			NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTCTCGATATCTGAAAATACC	0.388									Kartagener syndrome				ENSG00000039139																																					0													81.0	82.0	82.0					5																	13727766		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11884-1G>T	5.37:g.13727766C>A			Q92860|Q96L74|Q9H5S7|Q9HCG9	Splice_Site	SNP	-	e70-1	ENST00000265104.4	37	c.11884-1	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280047	0.80692	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3861	0.94556	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH5	13780766	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.135000	0.77276	2.594000	0.87642	0.650000	0.86243	.	-	DH5	-	-		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	1	52	52	80	0.00	1.23	C	NM_001369	Intron	13727766	-1	31	33	21	51	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	splice_site	59.62	39.29	SNP	1.000	A	31	21
SLC5A11	115584	genome.wustl.edu	37	16	24909327	24909327	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr16:24909327C>A	ENST00000347898.3	+	10	1525	c.903C>A	c.(901-903)aaC>aaA	p.N301K	SLC5A11_ENST00000449109.2_Missense_Mutation_p.P169T|SLC5A11_ENST00000569071.1_Missense_Mutation_p.P169T|SLC5A11_ENST00000424767.2_Missense_Mutation_p.N266K|SLC5A11_ENST00000539472.1_Missense_Mutation_p.N237K|SLC5A11_ENST00000565769.1_Missense_Mutation_p.N237K|SLC5A11_ENST00000568579.1_Missense_Mutation_p.N231K|SLC5A11_ENST00000545376.1_Missense_Mutation_p.N231K|SLC5A11_ENST00000567758.1_Missense_Mutation_p.N266K	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		CTGCCAAGAACCTGTCCCATG	0.537													ENSG00000158865																																					0													216.0	188.0	198.0					16																	24909327		2197	4300	6497	SO:0001583	missense	0			-	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.903C>A	16.37:g.24909327C>A	ENSP00000289932:p.Asn301Lys			Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.N301K	ENST00000347898.3	37	c.903	CCDS10625.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.991181|3.991181	0.74703|0.74703	.|.	.|.	ENSG00000158865|ENSG00000158865	ENST00000347898;ENST00000424767;ENST00000545376;ENST00000539472|ENST00000449109	D;D;D;D|D	0.88431|0.83335	-2.26;-2.35;-2.34;-2.38|-1.71	5.53|5.53	4.57|4.57	0.56435|0.56435	.|.	0.130671|.	0.64402|.	D|.	0.000002|.	D|D	0.83995|0.83995	0.5375|0.5375	M|M	0.90252|0.90252	3.1|3.1	0.47374|0.47374	D|D	0.999407|0.999407	D;D;D|B	0.71674|0.19445	0.993;0.997;0.998|0.036	P;D;D|B	0.71870|0.10450	0.907;0.933;0.975|0.005	T|T	0.79427|0.79427	-0.1808|-0.1808	10|9	0.87932|0.19147	D|T	0|0.46	.|.	12.4963|12.4963	0.55929|0.55929	0.0:0.917:0.0:0.083|0.0:0.917:0.0:0.083	.|.	231;266;301|169	B7Z329;Q8WWX8-2;Q8WWX8|Q05BF1	.;.;SC5AB_HUMAN|.	K|T	301;266;231;237|169	ENSP00000289932:N301K;ENSP00000416782:N266K;ENSP00000441384:N231K;ENSP00000441018:N237K|ENSP00000389606:P169T	ENSP00000289932:N301K|ENSP00000389606:P169T	N|P	+|+	3|1	2|0	SLC5A11|SLC5A11	24816828|24816828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.627000|1.627000	0.37050|0.37050	2.612000|2.612000	0.88384|0.88384	0.655000|0.655000	0.94253|0.94253	AAC|CCT	-	SLC5A11	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.537	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	HGNC	protein_coding	OTTHUMT00000214091.3	0	0	0	50	50	84	0.00	0.00	C	NM_052944		24909327	+1	14	27	37	64	tier1	no_errors	ENST00000347898	ensembl	human	known	74_37	missense	27.45	29.67	SNP	1.000	A	14	37
AFF3	3899	genome.wustl.edu	37	2	100209926	100209926	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr2:100209926C>G	ENST00000409236.2	-	13	2309	c.2197G>C	c.(2197-2199)Gac>Cac	p.D733H	AFF3_ENST00000356421.2_Missense_Mutation_p.D758H|AFF3_ENST00000317233.4_Missense_Mutation_p.D733H|AFF3_ENST00000409579.1_Missense_Mutation_p.D758H			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	733					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TTGGCGATGTCACTGGTGGTC	0.597													ENSG00000144218																																					0													70.0	69.0	69.0					2																	100209926		2203	4300	6503	SO:0001583	missense	0			-	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2197G>C	2.37:g.100209926C>G	ENSP00000387207:p.Asp733His		B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.D758H	ENST00000409236.2	37	c.2272	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	C	18.09	3.545669	0.65198	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	4.75	4.75	0.60458	.	0.098151	0.44688	D	0.000439	T	0.76449	0.3989	L	0.51422	1.61	0.43292	D	0.995277	P;D;P	0.64830	0.828;0.994;0.454	P;D;B	0.63033	0.621;0.91;0.047	T	0.77675	-0.2499	10	0.52906	T	0.07	.	17.9343	0.89008	0.0:1.0:0.0:0.0	.	886;733;758	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	H	733;758;758;733;733;886;758	ENSP00000317421:D733H;ENSP00000348793:D758H;ENSP00000386834:D758H;ENSP00000387207:D733H	ENSP00000317421:D733H	D	-	1	0	AFF3	99576358	0.997000	0.39634	0.998000	0.56505	0.993000	0.82548	3.905000	0.56333	2.483000	0.83821	0.561000	0.74099	GAC	-	AFF3	-	pfam_TF_AF4/FMR2		0.597	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	0	0	0	72	72	37	0.00	0.00	C	NM_002285		100209926	-1	20	21	59	28	tier1	no_errors	ENST00000356421	ensembl	human	known	74_37	missense	25.32	42.86	SNP	0.997	G	20	59
THSD7B	80731	genome.wustl.edu	37	2	138378229	138378229	+	Silent	SNP	C	C	T	rs200261966		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr2:138378229C>T	ENST00000409968.1	+	20	3910	c.3732C>T	c.(3730-3732)tgC>tgT	p.C1244C	THSD7B_ENST00000272643.3_Silent_p.C1247C|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Silent_p.C1216C			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1246	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGGTGGAATGCGTGGTCAACT	0.468													ENSG00000144229																																					0								C		0,3854		0,0,1927	195.0	186.0	189.0		3645	-0.9	1.0	2		189	6,8302		0,6,4148	yes	coding-synonymous	THSD7B	NM_001080427.1		0,6,6075	TT,TC,CC		0.0722,0.0,0.0493		1215/1578	138378229	6,12156	1927	4154	6081	SO:0001819	synonymous_variant	0			-			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3732C>T	2.37:g.138378229C>T				Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.C1247	ENST00000409968.1	37	c.3741		2																																																																																			rs200261966	THSD7B	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt		0.468	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	0	0	0	80	80	81	0.00	0.00	C	XM_046570.9		138378229	+1	24	26	38	38	tier1	no_errors	ENST00000272643	ensembl	human	known	74_37	silent	38.71	40.62	SNP	1.000	T	24	38
MTG2	26164	genome.wustl.edu	37	20	60774287	60774287	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr20:60774287A>G	ENST00000370823.3	+	6	818	c.800A>G	c.(799-801)cAc>cGc	p.H267R	MTG2_ENST00000536470.1_Missense_Mutation_p.H39R|MTG2_ENST00000436421.2_Intron	NM_015666.3	NP_056481.1	Q9H4K7	MTG2_HUMAN	mitochondrial ribosome-associated GTPase 2	267	Localized in the mitochondria.|Not localized in the mitochondria.|OBG-type G.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)										GGGATCGTCCACTACGAAGGC	0.498													ENSG00000101181																																					0													59.0	58.0	59.0					20																	60774287		2203	4300	6503	SO:0001583	missense	0			-	AK001603	CCDS13492.1	20q13.33	2013-05-24	2013-05-24	2013-05-24	ENSG00000101181	ENSG00000101181			16239	protein-coding gene	gene with protein product		610919	"""GTP-binding protein 5 (putative)"", ""GTP binding protein 5 (putative)"""	GTPBP5		17054726, 23396448	Standard	NM_015666		Approved	FLJ10741, dJ1005F21.2, ObgH1		Q9H4K7	OTTHUMG00000032897	ENST00000370823.3:c.800A>G	20.37:g.60774287A>G	ENSP00000359859:p.His267Arg		A6NDR3|B4DR85|Q96I17|Q9NVG9|Q9UFR4	Missense_Mutation	SNP	pfam_GTP1_OBG_dom,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GTP1_OBG_dom,pirsf_GTP-bd_Obg/CgtA,prints_GTP_binding_domain,tigrfam_GTP-bd_Obg/CgtA,tigrfam_Small_GTP-bd_dom	p.H267R	ENST00000370823.3	37	c.800	CCDS13492.1	20	.	.	.	.	.	.	.	.	.	.	A	7.604	0.673403	0.14776	.	.	ENSG00000101181	ENST00000536470;ENST00000370823	T;T	0.16196	2.36;2.36	5.67	4.57	0.56435	Small GTP-binding protein domain (1);GTP-binding domain, HSR1-related (1);	0.474463	0.27730	N	0.018084	T	0.07458	0.0188	N	0.10733	0.035	0.28400	N	0.918665	B	0.10296	0.003	B	0.18263	0.021	T	0.35251	-0.9796	10	0.02654	T	1	-45.5597	10.3438	0.43895	0.8632:0.0:0.1368:0.0	.	267	Q9H4K7	GTPB5_HUMAN	R	39;267	ENSP00000445056:H39R;ENSP00000359859:H267R	ENSP00000359859:H267R	H	+	2	0	GTPBP5	60207682	0.998000	0.40836	0.812000	0.32479	0.244000	0.25665	4.112000	0.57845	0.968000	0.38212	0.459000	0.35465	CAC	-	MTG2	-	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,pirsf_GTP-bd_Obg/CgtA,tigrfam_GTP-bd_Obg/CgtA,tigrfam_Small_GTP-bd_dom		0.498	MTG2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	MTG2	HGNC	protein_coding	OTTHUMT00000079989.1	0	0	0	64	64	132	0.00	0.00	A	NM_015666		60774287	+1	17	40	40	93	tier1	no_errors	ENST00000370823	ensembl	human	known	74_37	missense	29.31	30.08	SNP	0.995	G	17	40
ITPR2	3709	genome.wustl.edu	37	12	26784883	26784883	+	Silent	SNP	G	G	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:26784883G>T	ENST00000381340.3	-	22	3266	c.2850C>A	c.(2848-2850)atC>atA	p.I950I	RP11-666F17.1_ENST00000414098.2_RNA|ITPR2_ENST00000545902.1_5'Flank	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	950					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGCTCGGGTGGATGCTGGGTG	0.547													ENSG00000123104																																					0													139.0	147.0	144.0					12																	26784883		2107	4227	6334	SO:0001819	synonymous_variant	0			-	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2850C>A	12.37:g.26784883G>T			O94773	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.I950	ENST00000381340.3	37	c.2850	CCDS41764.1	12																																																																																			-	ITPR2	-	superfamily_ARM-type_fold		0.547	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	0	0	0	93	93	48	0.00	0.00	G	NM_002223		26784883	-1	76	56	49	49	tier1	no_errors	ENST00000381340	ensembl	human	known	74_37	silent	60.32	52.83	SNP	0.001	T	76	49
SMPDL3B	27293	genome.wustl.edu	37	1	28282224	28282224	+	Silent	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:28282224G>C	ENST00000373894.3	+	6	911	c.720G>C	c.(718-720)ggG>ggC	p.G240G	RP11-460I13.2_ENST00000448015.1_RNA|SMPDL3B_ENST00000373888.4_Silent_p.G240G|SMPDL3B_ENST00000549094.1_Silent_p.G192G	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	240					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		TGCCCCCGGGGTTCTTTGAGA	0.537													ENSG00000130768																																					0													82.0	82.0	82.0					1																	28282224		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.720G>C	1.37:g.28282224G>C			B7ZB35|Q5T0Z0|Q96CB7	Silent	SNP	pfam_PEstase_dom,pirsf_ASM-like_Pdiesterase_prd	p.G240	ENST00000373894.3	37	c.720	CCDS30655.1	1																																																																																			-	SMPDL3B	-	pfam_PEstase_dom,pirsf_ASM-like_Pdiesterase_prd		0.537	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPDL3B	HGNC	protein_coding	OTTHUMT00000011170.1	0	0	0	41	41	91	0.00	0.00	G	NM_014474		28282224	+1	11	28	33	67	tier1	no_errors	ENST00000373894	ensembl	human	known	74_37	silent	25.00	29.47	SNP	0.057	C	11	33
FCRL5	83416	genome.wustl.edu	37	1	157504326	157504326	+	Intron	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:157504326G>C	ENST00000361835.3	-	8	1839				FCRL5_ENST00000368191.3_Intron|FCRL5_ENST00000368190.3_Intron|FCRL5_ENST00000368189.3_Missense_Mutation_p.L587V|FCRL5_ENST00000356953.4_Intron	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5						negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AAACTGGACAGTGCAAACAGA	0.493													ENSG00000143297																																					0																																										SO:0001627	intron_variant	0			-	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1681+77C>G	1.37:g.157504326G>C			A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L587V	ENST00000361835.3	37	c.1759	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	G	1.820	-0.472432	0.04445	.	.	ENSG00000143297	ENST00000368189	T	0.37752	1.18	2.94	-0.476	0.12100	.	.	.	.	.	T	0.27900	0.0687	.	.	.	0.09310	N	1	D	0.60575	0.988	D	0.64321	0.924	T	0.05354	-1.0890	8	0.40728	T	0.16	.	3.141	0.06456	0.2054:0.0:0.5385:0.2561	.	587	Q96RD9-4	.	V	587	ENSP00000357172:L587V	ENSP00000357172:L587V	L	-	1	2	FCRL5	155770950	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.171000	0.09883	-0.087000	0.12528	0.555000	0.69702	CTG	-	FCRL5	-	NULL		0.493	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	0	0	0	27	27	83	0.00	0.00	G	NM_031281		157504326	-1	8	45	30	97	tier1	no_errors	ENST00000368189	ensembl	human	known	74_37	missense	21.05	31.69	SNP	0.000	C	8	30
EP400NL	347918	genome.wustl.edu	37	12	132588667	132588667	+	Silent	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:132588667C>T	ENST00000376625.4	+	1	128	c.102C>T	c.(100-102)tcC>tcT	p.S34S	EP400NL_ENST00000361109.5_Silent_p.S34S|EP400NL_ENST00000392352.1_Silent_p.S34S|EP400NL_ENST00000389560.2_Silent_p.S34S|EP400NL_ENST00000443539.2_Silent_p.S34S			Q6ZTU2	E400N_HUMAN	EP400 N-terminal like	34										endometrium(1)|lung(1)|prostate(2)|urinary_tract(1)	5						CCCAGCCGTCCCTGCCCCTCA	0.692													ENSG00000185684																																					0													10.0	15.0	14.0					12																	132588667		690	1588	2278	SO:0001819	synonymous_variant	0			-	AK091234		12q24.33	2013-02-15			ENSG00000185684	ENSG00000185684			26602	protein-coding gene	gene with protein product						12477932	Standard	NR_003290		Approved	FLJ33915	uc009zyq.3	Q6ZTU2	OTTHUMG00000168251	ENST00000376625.4:c.102C>T	12.37:g.132588667C>T			A6NLB7|A8K0Z5|B3KQY2|Q6NXP1|Q8N253|Q8N7S7|Q9UFJ3	Silent	SNP	NULL	p.S34	ENST00000376625.4	37	c.102		12																																																																																			-	EP400NL	-	NULL		0.692	EP400NL-202	KNOWN	basic|appris_candidate_longest	protein_coding	EP400NL	HGNC	protein_coding		0	0	0	82	82	12	0.00	0.00	C	NM_182613		132588667	+1	13	8	93	30	tier1	no_errors	ENST00000376625	ensembl	human	known	74_37	silent	12.26	21.05	SNP	0.990	T	13	93
ATP9B	374868	genome.wustl.edu	37	18	76967012	76967012	+	Splice_Site	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr18:76967012G>C	ENST00000426216.2	+	10	1047	c.1030G>C	c.(1030-1032)Ggt>Cgt	p.G344R	ATP9B_ENST00000307671.7_Splice_Site_p.G344R	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	344					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TGTTGCATCAGGTAAGGAAAA	0.458													ENSG00000166377																																					0													130.0	118.0	122.0					18																	76967012		2203	4300	6503	SO:0001630	splice_region_variant	0			-	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.1030+1G>C	18.37:g.76967012G>C			O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G344R	ENST00000426216.2	37	c.1030	CCDS12014.1	18	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547588	0.65311	.	.	ENSG00000166377	ENST00000426216;ENST00000307671	D;D	0.94650	-3.48;-3.48	5.42	5.42	0.78866	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.97399	0.9149	M	0.82923	2.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97917	1.0312	10	0.72032	D	0.01	.	17.9923	0.89172	0.0:0.0:1.0:0.0	.	344;344	O43861;O43861-2	ATP9B_HUMAN;.	R	344	ENSP00000398076:G344R;ENSP00000304500:G344R	ENSP00000304500:G344R	G	+	1	0	ATP9B	75068000	1.000000	0.71417	0.992000	0.48379	0.169000	0.22640	7.963000	0.87922	2.550000	0.86006	0.455000	0.32223	GGT	-	ATP9B	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp		0.458	ATP9B-001	KNOWN	basic|CCDS	protein_coding	ATP9B	HGNC	protein_coding	OTTHUMT00000256402.3	0	0	0	102	102	121	0.00	0.00	G	NM_198531	Missense_Mutation	76967012	+1	79	75	275	286	tier1	no_errors	ENST00000426216	ensembl	human	known	74_37	missense	22.32	20.78	SNP	1.000	C	79	275
ATP1A4	480	genome.wustl.edu	37	1	160124877	160124877	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:160124877G>A	ENST00000368081.4	+	3	721	c.250G>A	c.(250-252)Gga>Aga	p.G84R		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	84					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GACTCGAGGTGGACCCAATAC	0.522													ENSG00000132681																																					0													134.0	134.0	134.0					1																	160124877		2203	4300	6503	SO:0001583	missense	0			-	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.250G>A	1.37:g.160124877G>A	ENSP00000357060:p.Gly84Arg		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.G84R	ENST00000368081.4	37	c.250	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461001	0.63513	.	.	ENSG00000132681	ENST00000368081	D	0.96011	-3.88	4.48	4.48	0.54585	ATPase, P-type cation-transporter, N-terminal (2);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.061424	0.64402	D	0.000005	D	0.98563	0.9520	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99414	1.0931	10	0.87932	D	0	.	14.7024	0.69164	0.0:0.0:1.0:0.0	.	84	Q13733	AT1A4_HUMAN	R	84	ENSP00000357060:G84R	ENSP00000357060:G84R	G	+	1	0	ATP1A4	158391501	1.000000	0.71417	0.982000	0.44146	0.133000	0.20885	9.601000	0.98297	2.312000	0.78011	0.655000	0.94253	GGA	-	ATP1A4	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N,tigrfam_ATPase_P-typ_Na/K_IIC		0.522	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	0	0	0	92	92	92	0.00	0.00	G	NM_144699		160124877	+1	43	73	194	314	tier1	no_errors	ENST00000368081	ensembl	human	known	74_37	missense	18.14	18.86	SNP	1.000	A	43	194
F11R	50848	genome.wustl.edu	37	1	160970505	160970505	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:160970505C>T	ENST00000368026.6	-	4	578	c.304G>A	c.(304-306)Gaa>Aaa	p.E102K	F11R_ENST00000537746.1_Intron|F11R_ENST00000472573.1_5'UTR|F11R_ENST00000289779.3_3'UTR	NM_016946.4	NP_058642.1	Q9Y624	JAM1_HUMAN	F11 receptor	102	Ig-like V-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)	12	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			CCAGTGTCTTCCCGTGTCACG	0.542													ENSG00000158769																																					0													184.0	128.0	147.0					1																	160970505		2203	4300	6503	SO:0001583	missense	0			-	AF111713	CCDS1213.1	1q21.2-q21.3	2013-01-29	2003-02-07	2003-02-14	ENSG00000158769	ENSG00000158769		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14685	protein-coding gene	gene with protein product		605721	"""junctional adhesion molecule 1"""	JAM1		10395639, 7646439	Standard	NM_016946		Approved	PAM-1, JCAM, JAM-1, JAM-A, JAMA, CD321	uc009wtt.3	Q9Y624	OTTHUMG00000028602	ENST00000368026.6:c.304G>A	1.37:g.160970505C>T	ENSP00000357005:p.Glu102Lys		B7Z941	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E102K	ENST00000368026.6	37	c.304	CCDS1213.1	1	.	.	.	.	.	.	.	.	.	.	C	0.105	-1.146215	0.01714	.	.	ENSG00000158769	ENST00000368026;ENST00000335772;ENST00000289779;ENST00000436182	T;T	0.32515	1.45;1.45	5.18	1.63	0.23807	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.376561	0.28760	N	0.014240	T	0.02380	0.0073	N	0.01761	-0.735	0.80722	D	1	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.09377	0.003;0.004;0.004;0.004	T	0.46735	-0.9170	10	0.02654	T	1	.	7.4737	0.27363	0.0:0.2751:0.0:0.7249	.	106;102;102;102	B7Z5W1;Q6FIB4;Q9Y624;D3DVF0	.;.;JAM1_HUMAN;.	K	102;102;102;106	ENSP00000357005:E102K;ENSP00000394809:E106K	ENSP00000289779:E102K	E	-	1	0	F11R	159237129	0.997000	0.39634	0.883000	0.34634	0.009000	0.06853	0.798000	0.27014	0.021000	0.15133	-0.471000	0.05019	GAA	-	F11R	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.542	F11R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11R	HGNC	protein_coding	OTTHUMT00000071458.3	0	0	0	48	48	105	0.00	0.00	C	NM_016946		160970505	-1	62	92	47	102	tier1	no_errors	ENST00000368026	ensembl	human	known	74_37	missense	56.88	46.94	SNP	0.990	T	62	47
OBP2A	29991	genome.wustl.edu	37	9	138441743	138441743	+	3'UTR	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr9:138441743C>T	ENST00000539850.1	+	0	865				OBP2A_ENST00000340780.3_Silent_p.L214L|OBP2A_ENST00000342114.4_3'UTR|OBP2A_ENST00000371776.1_3'UTR			Q9NY56	OBP2A_HUMAN	odorant binding protein 2A						response to stimulus (GO:0050896)|sensory perception of chemical stimulus (GO:0007606)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		CCCGGACCACCTGGACCTACC	0.647													ENSG00000122136																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AJ251029	CCDS6992.1	9q34	2014-01-22			ENSG00000122136	ENSG00000122136		"""Lipocalins"""	23380	protein-coding gene	gene with protein product		164320					Standard	NM_014582		Approved	hOBPIIa, OBP, LCN13	uc004cgb.3	Q9NY56	OTTHUMG00000020909	ENST00000539850.1:c.*326C>T	9.37:g.138441743C>T			Q5T8A3|Q9NY50|Q9NY53|Q9NY54|Q9NY55	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_von_Ebner_gland	p.L214	ENST00000539850.1	37	c.640	CCDS6992.1	9																																																																																			-	OBP2A	-	NULL		0.647	OBP2A-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	OBP2A	HGNC	protein_coding	OTTHUMT00000397904.1	0	0	0	166	166	50	0.00	0.00	C	NM_014582		138441743	+1	32	21	126	67	tier1	no_errors	ENST00000340780	ensembl	human	known	74_37	silent	20.25	23.60	SNP	0.235	T	32	126
CAB39	51719	genome.wustl.edu	37	2	231678816	231678816	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr2:231678816G>T	ENST00000258418.5	+	7	1109	c.680G>T	c.(679-681)aGa>aTa	p.R227I	CAB39_ENST00000410084.3_Missense_Mutation_p.R227I|CAB39_ENST00000409788.3_Missense_Mutation_p.R227I	NM_016289.3	NP_057373.1	Q9Y376	CAB39_HUMAN	calcium binding protein 39	227					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cellular hypotonic response (GO:0071476)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein heterooligomerization (GO:0051291)|signal transduction by phosphorylation (GO:0023014)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activator activity (GO:0043539)			central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		GTGACAAAAAGACAGTCACTG	0.338													ENSG00000135932																																					0													119.0	119.0	119.0					2																	231678816		2203	4300	6503	SO:0001583	missense	0			-	AF113536	CCDS2478.1	2q37.1	2008-02-05			ENSG00000135932	ENSG00000135932			20292	protein-coding gene	gene with protein product		612174					Standard	NM_016289		Approved	CGI-66, MO25	uc002vqx.3	Q9Y376	OTTHUMG00000133220	ENST00000258418.5:c.680G>T	2.37:g.231678816G>T	ENSP00000258418:p.Arg227Ile		A8K8L7	Missense_Mutation	SNP	pfam_Mo25,superfamily_ARM-type_fold	p.R227I	ENST00000258418.5	37	c.680	CCDS2478.1	2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790586	0.90367	.	.	ENSG00000135932	ENST00000258418;ENST00000409788;ENST00000410084	T;T;T	0.35789	1.29;1.29;1.29	5.25	5.25	0.73442	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70962	0.3284	H	0.94183	3.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79694	-0.1696	10	0.72032	D	0.01	.	16.6865	0.85310	0.0:0.0:1.0:0.0	.	227	Q9Y376	CAB39_HUMAN	I	227	ENSP00000258418:R227I;ENSP00000386238:R227I;ENSP00000386642:R227I	ENSP00000258418:R227I	R	+	2	0	CAB39	231387060	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.818000	0.99354	2.601000	0.87937	0.591000	0.81541	AGA	-	CAB39	-	pfam_Mo25,superfamily_ARM-type_fold		0.338	CAB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAB39	HGNC	protein_coding	OTTHUMT00000256955.2	0	0	0	67	67	54	0.00	0.00	G	NM_016289		231678816	+1	6	6	29	22	tier1	no_errors	ENST00000258418	ensembl	human	known	74_37	missense	17.14	21.43	SNP	1.000	T	6	29
BPIFB4	149954	genome.wustl.edu	37	20	31690812	31690812	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr20:31690812A>T	ENST00000375483.3	+	13	1672	c.1672A>T	c.(1672-1674)Aac>Tac	p.N558Y		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	558						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										AAACGTGGGCAACTTTGATGT	0.512													ENSG00000186191																																					0													176.0	153.0	161.0					20																	31690812		2203	4300	6503	SO:0001583	missense	0			-	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1672A>T	20.37:g.31690812A>T	ENSP00000364632:p.Asn558Tyr		Q5TDX6	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.N558Y	ENST00000375483.3	37	c.1672	CCDS13213.2	20	.	.	.	.	.	.	.	.	.	.	A	14.13	2.443728	0.43429	.	.	ENSG00000186191	ENST00000375483	T	0.08807	3.05	5.67	5.67	0.87782	.	0.245463	0.36034	N	0.002835	T	0.25306	0.0615	M	0.65975	2.015	0.30055	N	0.811386	D	0.76494	0.999	D	0.71184	0.972	T	0.07424	-1.0773	10	0.59425	D	0.04	-30.8019	12.2906	0.54817	1.0:0.0:0.0:0.0	.	558	P59827	BPIB4_HUMAN	Y	558	ENSP00000364632:N558Y	ENSP00000364632:N558Y	N	+	1	0	BPIFB4	31154473	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	4.473000	0.60196	2.161000	0.67846	0.459000	0.35465	AAC	-	BPIFB4	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C		0.512	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB4	HGNC	protein_coding	OTTHUMT00000078655.5	1	1	0	102	102	83	0.97	0.00	A	NM_182519		31690812	+1	23	32	98	105	tier1	no_errors	ENST00000375483	ensembl	human	known	74_37	missense	19.01	23.36	SNP	1.000	T	23	98
EPHB1	2047	genome.wustl.edu	37	3	134884887	134884887	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr3:134884887T>G	ENST00000398015.3	+	8	2033	c.1663T>G	c.(1663-1665)Tcc>Gcc	p.S555A	EPHB1_ENST00000493838.1_Missense_Mutation_p.S116A	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	555					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GTTCGTTGTGTCCTTGGTGGC	0.577													ENSG00000154928																																					0													131.0	148.0	142.0					3																	134884887		2137	4257	6394	SO:0001583	missense	0			-	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1663T>G	3.37:g.134884887T>G	ENSP00000381097:p.Ser555Ala		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S555A	ENST00000398015.3	37	c.1663	CCDS46921.1	3	.	.	.	.	.	.	.	.	.	.	T	8.691	0.907336	0.17833	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.09350	2.99;2.99	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.03477	0.0100	N	0.00483	-1.445	0.80722	D	1	B	0.25563	0.129	B	0.24006	0.05	T	0.49688	-0.8913	10	0.09843	T	0.71	.	16.6288	0.85011	0.0:0.0:0.0:1.0	.	555	P54762	EPHB1_HUMAN	A	555;116	ENSP00000381097:S555A;ENSP00000419574:S116A	ENSP00000381097:S555A	S	+	1	0	EPHB1	136367577	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.273000	0.51623	2.326000	0.78906	0.533000	0.62120	TCC	-	EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt		0.577	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	0	0	0	140	140	50	0.00	0.00	T	NM_004441		134884887	+1	33	16	45	33	tier1	no_errors	ENST00000398015	ensembl	human	known	74_37	missense	42.31	32.65	SNP	1.000	G	33	45
DOCK8	81704	genome.wustl.edu	37	9	396912	396912	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr9:396912C>A	ENST00000453981.1	+	25	3210	c.3098C>A	c.(3097-3099)gCc>gAc	p.A1033D	DOCK8_ENST00000382331.1_Missense_Mutation_p.A335D|DOCK8_ENST00000382329.1_Missense_Mutation_p.A500D|DOCK8_ENST00000469391.1_Missense_Mutation_p.A933D|DOCK8_ENST00000432829.2_Missense_Mutation_p.A965D			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1033					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAAATTGCAGCCCTTTTAGTA	0.353													ENSG00000107099																																					0													125.0	122.0	123.0					9																	396912		2203	4300	6503	SO:0001583	missense	0			-	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.3098C>A	9.37:g.396912C>A	ENSP00000408464:p.Ala1033Asp		A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.A1033D	ENST00000453981.1	37	c.3098	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260531	0.59431	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382331;ENST00000382329	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	5.7	5.7	0.88788	.	0.202236	0.52532	D	0.000067	T	0.34716	0.0907	L	0.44542	1.39	0.49483	D	0.999798	D;B;B;B	0.54207	0.965;0.241;0.116;0.241	P;B;B;B	0.52481	0.7;0.101;0.065;0.065	T	0.01587	-1.1318	10	0.13853	T	0.58	.	19.8411	0.96685	0.0:1.0:0.0:0.0	.	335;933;500;1033	A2A370;E9PH09;A2A369;Q8NF50	.;.;.;DOCK8_HUMAN	D	1033;1001;965;933;335;500	ENSP00000408464:A1033D;ENSP00000394888:A965D;ENSP00000419438:A933D;ENSP00000371768:A335D;ENSP00000371766:A500D	ENSP00000287364:A1001D	A	+	2	0	DOCK8	386912	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	5.747000	0.68689	2.683000	0.91414	0.655000	0.94253	GCC	-	DOCK8	-	NULL		0.353	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	0	0	0	56	56	122	0.00	0.00	C	XM_036307		396912	+1	27	84	40	127	tier1	no_errors	ENST00000453981	ensembl	human	known	74_37	missense	39.71	39.81	SNP	1.000	A	27	40
SLC44A1	23446	genome.wustl.edu	37	9	108123581	108123581	+	Silent	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr9:108123581C>T	ENST00000374720.3	+	8	1117	c.870C>T	c.(868-870)ctC>ctT	p.L290L	SLC44A1_ENST00000343170.7_Silent_p.L82L|SLC44A1_ENST00000374723.1_Silent_p.L290L|SLC44A1_ENST00000374724.1_Silent_p.L290L	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	290					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	GGGCCCTCCTCATTTATGCCA	0.443													ENSG00000070214																																					0													144.0	139.0	140.0					9																	108123581		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.870C>T	9.37:g.108123581C>T			A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Silent	SNP	pfam_Choline_transptr-like	p.L290	ENST00000374720.3	37	c.870	CCDS6763.1	9																																																																																			-	SLC44A1	-	NULL		0.443	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	HGNC	protein_coding	OTTHUMT00000053500.1	1	1	0	189	189	121	0.53	0.00	C	NM_080546		108123581	+1	38	35	136	85	tier1	no_errors	ENST00000374720	ensembl	human	known	74_37	silent	21.71	29.17	SNP	1.000	T	38	136
ITPR2	3709	genome.wustl.edu	37	12	26784934	26784934	+	Silent	SNP	G	G	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:26784934G>T	ENST00000381340.3	-	22	3215	c.2799C>A	c.(2797-2799)ctC>ctA	p.L933L	RP11-666F17.1_ENST00000414098.2_RNA|ITPR2_ENST00000545902.1_5'Flank	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	933					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGCCTCTACTGAGTACCATCT	0.552													ENSG00000123104																																					0													129.0	133.0	132.0					12																	26784934		2070	4216	6286	SO:0001819	synonymous_variant	0			-	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2799C>A	12.37:g.26784934G>T			O94773	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.L933	ENST00000381340.3	37	c.2799	CCDS41764.1	12																																																																																			-	ITPR2	-	superfamily_ARM-type_fold		0.552	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	0	0	0	85	85	44	0.00	0.00	G	NM_002223		26784934	-1	83	65	48	46	tier1	no_errors	ENST00000381340	ensembl	human	known	74_37	silent	63.36	58.04	SNP	0.988	T	83	48
DDX1	1653	genome.wustl.edu	37	2	15769733	15769733	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr2:15769733A>C	ENST00000381341.2	+	25	2272	c.1883A>C	c.(1882-1884)tAc>tCc	p.Y628S	DDX1_ENST00000233084.3_Missense_Mutation_p.Y628S			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	628	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Necessary for interaction with HNRNPK.|Necessary for interaction with replicase polyprotein 1ab nsp14 of IBV.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TAGGTTTGGTACCATGTATGT	0.353													ENSG00000079785																																					0													78.0	72.0	74.0					2																	15769733		2203	4300	6503	SO:0001583	missense	0			-	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1883A>C	2.37:g.15769733A>C	ENSP00000370745:p.Tyr628Ser		B4DME8|B4DPN6	Missense_Mutation	SNP	pfam_D/R_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_ConA-like_lec_gl_sf,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,smart_Helicase_C,pfscan_B30.2/SPRY,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_R_helicase_DEAD_Q_motif	p.Y628S	ENST00000381341.2	37	c.1883	CCDS1686.1	2	.	.	.	.	.	.	.	.	.	.	A	25.0	4.590852	0.86851	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.43294	0.95;0.95	5.65	5.65	0.86999	Helicase, C-terminal (1);	0.104961	0.64402	D	0.000002	T	0.65964	0.2742	M	0.85945	2.785	0.80722	D	1	D	0.63046	0.992	P	0.61397	0.888	T	0.70432	-0.4873	10	0.52906	T	0.07	-17.5068	16.0399	0.80667	1.0:0.0:0.0:0.0	.	628	Q92499	DDX1_HUMAN	S	628;628;612	ENSP00000370745:Y628S;ENSP00000233084:Y628S	ENSP00000233084:Y628S	Y	+	2	0	DDX1	15687184	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.873000	0.69644	2.371000	0.80710	0.533000	0.62120	TAC	-	DDX1	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.353	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX1	HGNC	protein_coding	OTTHUMT00000207141.2	0	0	0	31	31	62	0.00	0.00	A	NM_004939		15769733	+1	5	18	13	21	tier1	no_errors	ENST00000233084	ensembl	human	known	74_37	missense	27.78	46.15	SNP	1.000	C	5	13
TDRD1	56165	genome.wustl.edu	37	10	115964595	115964595	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr10:115964595G>A	ENST00000369280.1	+	10	1700	c.1240G>A	c.(1240-1242)Gac>Aac	p.D414N	TDRD1_ENST00000251864.2_Missense_Mutation_p.D414N|TDRD1_ENST00000369282.1_Missense_Mutation_p.D414N|TDRD1_ENST00000369281.2_Missense_Mutation_p.D414N|TDRD1_ENST00000422662.1_Missense_Mutation_p.D75N			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	414					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		AAAGATTGTCGACATCTTGGA	0.393													ENSG00000095627																																					0													137.0	120.0	126.0					10																	115964595		2203	4300	6503	SO:0001583	missense	0			-	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1240G>A	10.37:g.115964595G>A	ENSP00000358286:p.Asp414Asn		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.D414N	ENST00000369280.1	37	c.1240		10	.	.	.	.	.	.	.	.	.	.	G	7.668	0.686356	0.14973	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.24350	2.97;2.95;2.08;1.86;2.98	6.03	2.22	0.28083	.	0.388867	0.27139	N	0.020759	T	0.17492	0.0420	L	0.35854	1.095	0.21184	N	0.999765	B;B;B;B;B	0.33171	0.4;0.1;0.005;0.161;0.052	B;B;B;B;B	0.30029	0.11;0.012;0.002;0.027;0.019	T	0.10894	-1.0610	10	0.44086	T	0.13	-7.149	8.5407	0.33390	0.3688:0.0:0.6312:0.0	.	75;414;414;414;414	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	N	414;414;414;75;414	ENSP00000358288:D414N;ENSP00000251864:D414N;ENSP00000358287:D414N;ENSP00000402794:D75N;ENSP00000358286:D414N	ENSP00000251864:D414N	D	+	1	0	TDRD1	115954585	0.331000	0.24713	0.082000	0.20525	0.018000	0.09664	1.102000	0.31050	0.163000	0.19507	-0.126000	0.14955	GAC	-	TDRD1	-	NULL		0.393	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	HGNC	protein_coding	OTTHUMT00000050457.2	0	0	0	58	58	73	0.00	0.00	G			115964595	+1	13	28	17	57	tier1	no_errors	ENST00000251864	ensembl	human	known	74_37	missense	43.33	32.94	SNP	0.138	A	13	17
PRKDC	5591	genome.wustl.edu	37	8	48733396	48733396	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr8:48733396G>A	ENST00000314191.2	-	67	9273	c.9217C>T	c.(9217-9219)Cag>Tag	p.Q3073*	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Nonsense_Mutation_p.Q3073*	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3074	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATCGCCTTCTGGAGCTCCCCG	0.478								Non-homologous end-joining					ENSG00000253729																									Esophageal Squamous(79;1091 1253 12329 31680 40677)												0													62.0	61.0	61.0					8																	48733396		1917	4138	6055	SO:0001587	stop_gained	0			-		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.9217C>T	8.37:g.48733396G>A	ENSP00000313420:p.Gln3073*		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Nonsense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q3073*	ENST00000314191.2	37	c.9217		8	.	.	.	.	.	.	.	.	.	.	G	48	14.395709	0.99793	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.16	5.16	0.70880	.	0.415723	0.24915	N	0.034581	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	12.2549	0.54619	0.0:0.0:0.7148:0.2852	.	.	.	.	X	3073	.	ENSP00000313420:Q3073X	Q	-	1	0	PRKDC	48895949	1.000000	0.71417	0.269000	0.24586	0.020000	0.10135	5.597000	0.67577	2.548000	0.85928	0.650000	0.86243	CAG	-	PRKDC	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT		0.478	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		0	0	0	84	84	34	0.00	0.00	G	NM_001081640		48733396	-1	17	16	51	51	tier1	no_errors	ENST00000314191	ensembl	human	known	74_37	nonsense	25.00	23.88	SNP	1.000	A	17	51
LRRN3	54674	genome.wustl.edu	37	7	110762970	110762970	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr7:110762970A>G	ENST00000422987.3	+	2	973	c.142A>G	c.(142-144)Atg>Gtg	p.M48V	IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.M48V|LRRN3_ENST00000451085.1_Missense_Mutation_p.M48V|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000489381.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	48	LRRNT.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		ATCCATTTATATGGAAGCATC	0.393													ENSG00000173114																																					0													150.0	138.0	142.0					7																	110762970		2203	4300	6503	SO:0001583	missense	0			-	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.142A>G	7.37:g.110762970A>G	ENSP00000412417:p.Met48Val		O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.M48V	ENST00000422987.3	37	c.142	CCDS5754.1	7	.	.	.	.	.	.	.	.	.	.	A	8.913	0.959243	0.18507	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	5.98	5.98	0.97165	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.15262	0.0368	N	0.17474	0.49	0.38648	D	0.951767	B	0.14438	0.01	B	0.15052	0.012	T	0.11299	-1.0593	10	0.25106	T	0.35	.	16.4781	0.84144	1.0:0.0:0.0:0.0	.	48	Q9H3W5	LRRN3_HUMAN	V	48	ENSP00000312001:M48V;ENSP00000397312:M48V;ENSP00000412417:M48V;ENSP00000407927:M48V	ENSP00000312001:M48V	M	+	1	0	LRRN3	110550206	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	5.139000	0.64801	2.288000	0.76882	0.528000	0.53228	ATG	-	LRRN3	-	pfam_LRR-contain_N,smart_LRR-contain_N		0.393	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	HGNC	protein_coding	OTTHUMT00000338171.2	0	0	0	46	46	131	0.00	0.00	A	NM_018334		110762970	+1	18	28	39	72	tier1	no_errors	ENST00000308478	ensembl	human	known	74_37	missense	31.58	28.00	SNP	1.000	G	18	39
HMOX2	3163	genome.wustl.edu	37	16	4559676	4559676	+	Silent	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr16:4559676G>C	ENST00000570646.1	+	6	1475	c.870G>C	c.(868-870)gtG>gtC	p.V290V	HMOX2_ENST00000406590.2_Silent_p.V290V|HMOX2_ENST00000398595.3_Silent_p.V290V|HMOX2_ENST00000458134.3_Silent_p.V290V|HMOX2_ENST00000219700.6_Silent_p.V290V|HMOX2_ENST00000575120.1_Silent_p.V261V|HMOX2_ENST00000414777.1_Silent_p.V290V	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	290					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						CTATGGCTGTGCTGAGGAAGC	0.597													ENSG00000103415																																					0													81.0	75.0	77.0					16																	4559676		2197	4300	6497	SO:0001819	synonymous_variant	0			-		CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.870G>C	16.37:g.4559676G>C			A8MT35|D3DUD5|I3L430|O60605	Silent	SNP	pfam_Haem_Oase-like,superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase,prints_Haem_Oase	p.V290	ENST00000570646.1	37	c.870	CCDS10517.1	16																																																																																			-	HMOX2	-	pirsf_Haem_Oase		0.597	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMOX2	HGNC	protein_coding	OTTHUMT00000251636.2	0	0	0	48	48	13	0.00	0.00	G			4559676	+1	76	70	15	18	tier1	no_errors	ENST00000219700	ensembl	human	known	74_37	silent	82.61	79.55	SNP	0.995	C	76	15
CUBN	8029	genome.wustl.edu	37	10	16870803	16870803	+	Splice_Site	SNP	C	C	A	rs374982220		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr10:16870803C>A	ENST00000377833.4	-	66	10830		c.e66+1			NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)						cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTTTTACTCACGCCTCCGCAG	0.408											OREG0020047	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000107611																																					0													80.0	80.0	80.0					10																	16870803		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10764+1G>T	10.37:g.16870803C>A		713	B0YIZ4|Q5VTA6|Q96RU9	Splice_Site	SNP	-	e66+1	ENST00000377833.4	37	c.10764+1	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289546	0.40494	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8831	0.88846	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CUBN	16910809	1.000000	0.71417	0.960000	0.40013	0.015000	0.08874	7.569000	0.82380	2.664000	0.90586	0.561000	0.74099	.	-	CUBN	-	-		0.408	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	0	0	0	49	49	24	0.00	0.00	C	NM_001081	Intron	16870803	-1	20	10	15	12	tier1	no_errors	ENST00000377833	ensembl	human	known	74_37	splice_site	57.14	45.45	SNP	1.000	A	20	15
PRLR	5618	genome.wustl.edu	37	5	35066042	35066042	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr5:35066042G>T	ENST00000382002.5	-	10	1444	c.1018C>A	c.(1018-1020)Ccc>Acc	p.P340T	PRLR_ENST00000511486.1_Missense_Mutation_p.P239T|PRLR_ENST00000231423.3_Intron|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000542609.1_Intron|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000310101.5_Intron|PRLR_ENST00000513753.1_Intron|PRLR_ENST00000342362.5_Missense_Mutation_p.P239T|PRLR_ENST00000509934.1_5'Flank	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	340					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	AGGTATGTGGGTTTCATACCT	0.498													ENSG00000113494																																					0													93.0	90.0	91.0					5																	35066042		2203	4300	6503	SO:0001583	missense	0			-		CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.1018C>A	5.37:g.35066042G>T	ENSP00000371432:p.Pro340Thr		B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P340T	ENST00000382002.5	37	c.1018	CCDS3909.1	5	.	.	.	.	.	.	.	.	.	.	G	4.238	0.043114	0.08196	.	.	ENSG00000113494	ENST00000342362;ENST00000382002;ENST00000511486	T;T;T	0.73681	-0.77;-0.77;-0.77	5.46	4.59	0.56863	.	0.374240	0.34435	N	0.003972	T	0.70798	0.3265	M	0.73217	2.22	0.22001	N	0.999428	B;P	0.38473	0.235;0.633	B;B	0.43360	0.18;0.417	T	0.62334	-0.6876	10	0.27785	T	0.31	-5.3467	2.722	0.05203	0.1582:0.1353:0.548:0.1585	.	340;239	P16471;P16471-2	PRLR_HUMAN;.	T	239;340;239	ENSP00000339213:P239T;ENSP00000371432:P340T;ENSP00000422556:P239T	ENSP00000339213:P239T	P	-	1	0	PRLR	35101799	0.992000	0.36948	0.118000	0.21660	0.619000	0.37552	1.733000	0.38156	1.298000	0.44778	0.655000	0.94253	CCC	-	PRLR	-	NULL		0.498	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	0	0	0	84	84	94	0.00	0.00	G			35066042	-1	51	67	124	189	tier1	no_errors	ENST00000382002	ensembl	human	known	74_37	missense	29.14	26.17	SNP	0.864	T	51	124
RP1	6101	genome.wustl.edu	37	8	55541922	55541922	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr8:55541922C>G	ENST00000220676.1	+	4	5628	c.5480C>G	c.(5479-5481)tCa>tGa	p.S1827*		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1827					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GGTAGTGACTCAGAACCTTTT	0.443													ENSG00000104237																									Colon(91;1014 1389 7634 14542 40420)												0													81.0	75.0	77.0					8																	55541922		2203	4300	6503	SO:0001587	stop_gained	0			-	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5480C>G	8.37:g.55541922C>G	ENSP00000220676:p.Ser1827*			Nonsense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.S1827*	ENST00000220676.1	37	c.5480	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	44	11.043106	0.99507	.	.	ENSG00000104237	ENST00000220676	.	.	.	5.83	4.95	0.65309	.	0.156606	0.30455	N	0.009600	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	14.3418	0.66633	0.0:0.9295:0.0:0.0705	.	.	.	.	X	1827	.	ENSP00000220676:S1827X	S	+	2	0	RP1	55704475	1.000000	0.71417	0.953000	0.39169	0.624000	0.37722	5.772000	0.68889	2.756000	0.94617	0.655000	0.94253	TCA	-	RP1	-	NULL		0.443	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	0	0	0	32	32	85	0.00	0.00	C	NM_006269		55541922	+1	7	22	24	68	tier1	no_errors	ENST00000220676	ensembl	human	known	74_37	nonsense	22.58	24.44	SNP	0.993	G	7	24
PAPOLG	64895	genome.wustl.edu	37	2	61020798	61020798	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr2:61020798G>C	ENST00000238714.3	+	18	1965	c.1716G>C	c.(1714-1716)aaG>aaC	p.K572N		NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	572					mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			TTGTGGAGAAGCCACTGAGTG	0.323													ENSG00000115421																									GBM(183;1497 2932 21839 46797)												0													48.0	46.0	46.0					2																	61020798		2203	4300	6503	SO:0001583	missense	0			-	AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.1716G>C	2.37:g.61020798G>C	ENSP00000238714:p.Lys572Asn		B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Missense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_R-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.K572N	ENST00000238714.3	37	c.1716	CCDS1863.1	2	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942829	0.34283	.	.	ENSG00000115421	ENST00000238714;ENST00000378104;ENST00000412217	.	.	.	5.61	2.83	0.33086	.	0.398489	0.32015	N	0.006716	T	0.46502	0.1396	L	0.51422	1.61	0.30277	N	0.791673	P;D;B	0.55605	0.454;0.972;0.079	B;P;B	0.56398	0.038;0.797;0.065	T	0.43327	-0.9398	9	0.32370	T	0.25	-11.2571	8.3153	0.32097	0.2482:0.0:0.7518:0.0	.	261;106;572	E9PEP5;Q53T81;Q9BWT3	.;.;PAPOG_HUMAN	N	572;261;240	.	ENSP00000238714:K572N	K	+	3	2	PAPOLG	60874302	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.677000	0.46892	0.838000	0.34948	-0.136000	0.14681	AAG	-	PAPOLG	-	pirsf_PolyA_polymerase		0.323	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLG	HGNC	protein_coding	OTTHUMT00000251577.3	0	0	0	117	117	55	0.00	0.00	G	NM_022894		61020798	+1	15	5	91	38	tier1	no_errors	ENST00000238714	ensembl	human	known	74_37	missense	14.15	11.63	SNP	1.000	C	15	91
F11R	50848	genome.wustl.edu	37	1	160970420	160970420	+	Splice_Site	SNP	C	C	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:160970420C>A	ENST00000368026.6	-	4	663		c.e4+1		F11R_ENST00000537746.1_Intron|F11R_ENST00000472573.1_Splice_Site|F11R_ENST00000289779.3_Splice_Site	NM_016946.4	NP_058642.1	Q9Y624	JAM1_HUMAN	F11 receptor						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)	12	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			GGGGCACGTACCAAGCACGAT	0.532													ENSG00000158769																																					0													204.0	146.0	165.0					1																	160970420		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF111713	CCDS1213.1	1q21.2-q21.3	2013-01-29	2003-02-07	2003-02-14	ENSG00000158769	ENSG00000158769		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14685	protein-coding gene	gene with protein product		605721	"""junctional adhesion molecule 1"""	JAM1		10395639, 7646439	Standard	NM_016946		Approved	PAM-1, JCAM, JAM-1, JAM-A, JAMA, CD321	uc009wtt.3	Q9Y624	OTTHUMG00000028602	ENST00000368026.6:c.388+1G>T	1.37:g.160970420C>A			B7Z941	Splice_Site	SNP	-	e4+1	ENST00000368026.6	37	c.388+1	CCDS1213.1	1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.125461	0.56721	.	.	ENSG00000158769	ENST00000368026;ENST00000335772;ENST00000289779;ENST00000436182	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5755	0.84635	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	F11R	159237044	1.000000	0.71417	0.999000	0.59377	0.610000	0.37248	4.173000	0.58249	2.495000	0.84180	0.563000	0.77884	.	-	F11R	-	-		0.532	F11R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11R	HGNC	protein_coding	OTTHUMT00000071458.3	0	0	0	50	50	98	0.00	0.00	C	NM_016946	Intron	160970420	-1	132	233	56	102	tier1	no_errors	ENST00000368026	ensembl	human	known	74_37	splice_site	70.21	69.55	SNP	1.000	A	132	56
KCNH3	23416	genome.wustl.edu	37	12	49944060	49944060	+	Silent	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:49944060C>G	ENST00000257981.6	+	10	2126	c.1866C>G	c.(1864-1866)gtC>gtG	p.V622V		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	622					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						TCTACTTTGTCTGCTCTGGCT	0.662													ENSG00000135519																																					0													75.0	67.0	70.0					12																	49944060		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1866C>G	12.37:g.49944060C>G			Q9UQ06	Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.V622	ENST00000257981.6	37	c.1866	CCDS8786.1	12																																																																																			-	KCNH3	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.662	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	HGNC	protein_coding	OTTHUMT00000404571.2	0	0	0	59	59	25	0.00	0.00	C	NM_012284		49944060	+1	26	30	32	16	tier1	no_errors	ENST00000257981	ensembl	human	known	74_37	silent	44.83	65.22	SNP	1.000	G	26	32
GRIP1	23426	genome.wustl.edu	37	12	66856716	66856716	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:66856716C>A	ENST00000398016.3	-	9	1098	c.1030G>T	c.(1030-1032)Ggg>Tgg	p.G344W	GRIP1_ENST00000359742.4_Missense_Mutation_p.G344W|GRIP1_ENST00000286445.7_Missense_Mutation_p.G344W	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TGGTCGGGCCCCTTTAGGGCC	0.557													ENSG00000155974																																					0													81.0	78.0	79.0					12																	66856716		1906	4133	6039	SO:0001583	missense	0			-	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1030G>T	12.37:g.66856716C>A	ENSP00000381098:p.Gly344Trp		B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G344W	ENST00000398016.3	37	c.1030	CCDS41807.1	12	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.14|17.14|17.14	3.312768|3.312768|3.312768	0.60414|0.60414|0.60414	.|.|.	.|.|.	ENSG00000155974|ENSG00000155974|ENSG00000155974	ENST00000543172|ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215|ENST00000538164	.|T;T;T;T;T;T|.	.|0.21361|.	.|2.01;2.12;2.12;2.02;2.11;2.22|.	5.21|5.21|5.21	5.21|5.21|5.21	0.72293|0.72293|0.72293	.|PDZ/DHR/GLGF (1);|.	0.048459|0.048459|.	0.85682|0.85682|.	D|D|.	0.000000|0.000000|.	T|T|T	0.70701|0.70701|0.70701	0.3254|0.3254|0.3254	L|L|L	0.51422|0.51422|0.51422	1.61|1.61|1.61	0.58432|0.58432|0.58432	D|D|D	0.999996|0.999996|0.999996	.|D;D;D;D|.	.|0.71674|.	.|0.998;0.998;0.995;0.998|.	.|D;D;P;D|.	.|0.68765|.	.|0.96;0.944;0.879;0.948|.	T|T|T	0.66148|0.66148|0.66148	-0.5996|-0.5996|-0.5996	6|9|5	.|.|.	.|.|.	.|.|.	-15.9187|-15.9187|-15.9187	19.6542|19.6542|19.6542	0.95830|0.95830|0.95830	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|344;344;344;344|.	.|F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2|.	.|.;GRIP1_HUMAN;.;.|.	V|W|S	164|344;344;344;344;288;288|158	.|ENSP00000381098:G344W;ENSP00000352780:G344W;ENSP00000286445:G344W;ENSP00000446047:G344W;ENSP00000446024:G288W;ENSP00000446011:G288W|.	.|.|.	G|G|R	-|-|-	2|1|3	0|0|2	GRIP1|GRIP1|GRIP1	65142983|65142983|65142983	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.475000|0.475000|0.475000	0.33008|0.33008|0.33008	7.654000|7.654000|7.654000	0.83653|0.83653|0.83653	2.816000|2.816000|2.816000	0.96949|0.96949|0.96949	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GGG|GGG|AGG	-	GRIP1	-	superfamily_PDZ		0.557	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP1	HGNC	protein_coding	OTTHUMT00000401975.2	0	0	0	88	88	81	0.00	0.00	C			66856716	-1	51	55	190	236	tier1	no_errors	ENST00000359742	ensembl	human	known	74_37	missense	21.16	18.84	SNP	1.000	A	51	190
CSMD1	64478	genome.wustl.edu	37	8	3245123	3245123	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr8:3245123C>G	ENST00000520002.1	-	19	3233	c.2678G>C	c.(2677-2679)aGg>aCg	p.R893T	CSMD1_ENST00000400186.3_Missense_Mutation_p.R893T|CSMD1_ENST00000542608.1_Missense_Mutation_p.R892T|CSMD1_ENST00000602557.1_Missense_Mutation_p.R893T|CSMD1_ENST00000539096.1_Missense_Mutation_p.R892T|CSMD1_ENST00000537824.1_Missense_Mutation_p.R892T|CSMD1_ENST00000602723.1_Missense_Mutation_p.R893T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	893	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CACTGTGGACCTGATGCCAAA	0.597													ENSG00000183117																																					0													46.0	53.0	51.0					8																	3245123		2117	4227	6344	SO:0001583	missense	0			-			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.2678G>C	8.37:g.3245123C>G	ENSP00000430733:p.Arg893Thr		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R893T	ENST00000520002.1	37	c.2678		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.76|10.76	1.440181|1.440181	0.25900|0.25900	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.64991	.|-0.13;-0.13;-0.13;-0.13;-0.13	5.11|5.11	3.28|3.28	0.37604|0.37604	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.326661	.|0.27961	.|N	.|0.017151	T|T	0.63022|0.63022	0.2476|0.2476	N|N	0.17345|0.17345	0.48|0.48	0.21604|0.21604	N|N	0.999627|0.999627	.|D;B;B	.|0.71674	.|0.998;0.146;0.115	.|D;B;B	.|0.79784	.|0.993;0.139;0.082	T|T	0.56019|0.56019	-0.8048|-0.8048	5|10	.|0.72032	.|D	.|0.01	.|.	11.1668|11.1668	0.48547|0.48547	0.0:0.849:0.0:0.151|0.0:0.849:0.0:0.151	.|.	.|893;893;893	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	H|T	372|893;893;755;892;892;892	.|ENSP00000383047:R893T;ENSP00000430733:R893T;ENSP00000441462:R892T;ENSP00000446243:R892T;ENSP00000441675:R892T	.|ENSP00000320445:R755T	Q|R	-|-	3|2	2|0	CSMD1|CSMD1	3232530|3232530	0.125000|0.125000	0.22332|0.22332	0.005000|0.005000	0.12908|0.12908	0.011000|0.011000	0.07611|0.07611	3.930000|3.930000	0.56522|0.56522	1.137000|1.137000	0.42214|0.42214	0.650000|0.650000	0.86243|0.86243	CAG|AGG	-	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.597	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	0	0	0	54	54	53	0.00	0.00	C	NM_033225		3245123	-1	12	12	51	68	tier1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	19.05	15.00	SNP	0.353	G	12	51
HOXB7	3217	genome.wustl.edu	37	17	46685168	46685168	+	3'UTR	SNP	T	T	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr17:46685168T>C	ENST00000239165.7	-	0	788				HOXB-AS3_ENST00000466037.2_RNA|HOXB6_ENST00000225648.3_5'Flank|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000491264.1_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB7_ENST00000567101.2_5'UTR|HOXB-AS3_ENST00000494420.1_RNA|HOXB6_ENST00000484302.2_5'Flank|HOXB3_ENST00000552000.2_5'Flank	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7						anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						ttcctctccctttctcatgtc	0.478													ENSG00000260027																																					0													22.0	26.0	24.0					17																	46685168		2199	4297	6496	SO:0001624	3_prime_UTR_variant	0			-		CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.*36A>G	17.37:g.46685168T>C			A8K3N8|Q15957|Q53FN3|Q96BQ6	R	SNP	-	NULL	ENST00000239165.7	37	NULL	CCDS11532.1	17																																																																																			-	HOXB7	-	-		0.478	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB7	HGNC	protein_coding	OTTHUMT00000358097.3	0	0	0	26	26	60	0.00	0.00	T			46685168	-1	13	16	20	47	tier1	no_errors	ENST00000567101	ensembl	human	known	74_37	rna	39.39	25.40	SNP	0.000	C	13	20
ERMN	57471	genome.wustl.edu	37	2	158178133	158178133	+	Missense_Mutation	SNP	C	C	A	rs374683748		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr2:158178133C>A	ENST00000410096.1	-	3	796	c.505G>T	c.(505-507)Gac>Tac	p.D169Y	ERMN_ENST00000420719.2_Missense_Mutation_p.D149Y|ERMN_ENST00000535935.1_Missense_Mutation_p.D63Y|ERMN_ENST00000397283.2_Missense_Mutation_p.D182Y	NM_020711.1	NP_065762.1	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein	169					actin filament organization (GO:0007015)|morphogenesis of a branching structure (GO:0001763)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|internode region of axon (GO:0033269)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|paranode region of axon (GO:0033270)				endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12						TGTAACATGTCAGCTTGGCTA	0.413													ENSG00000136541																																					0								C	TYR/ASP,TYR/ASP	0,3882		0,0,1941	177.0	167.0	170.0		544,505	2.9	0.0	2		170	1,8285		0,1,4142	no	missense,missense	ERMN	NM_001009959.1,NM_020711.1	160,160	0,1,6083	AA,AC,CC		0.0121,0.0,0.0082	possibly-damaging,possibly-damaging	182/298,169/285	158178133	1,12167	1941	4143	6084	SO:0001583	missense	0			-	AB033015	CCDS42764.1, CCDS46431.1	2q24	2008-02-05	2008-01-15	2008-01-15	ENSG00000136541	ENSG00000136541			29208	protein-coding gene	gene with protein product	"""juxtanodin"", ""ermin"""	610072	"""KIAA1189"""	KIAA1189		16051705, 16421295	Standard	NM_020711		Approved	JN, ERMIN	uc002tzi.3	Q8TAM6	OTTHUMG00000153843	ENST00000410096.1:c.505G>T	2.37:g.158178133C>A	ENSP00000387047:p.Asp169Tyr		B4DKA6|Q9ULN1	Missense_Mutation	SNP	superfamily_Moesin_tail	p.D182Y	ENST00000410096.1	37	c.544	CCDS46431.1	2	.	.	.	.	.	.	.	.	.	.	C	12.20	1.865276	0.32977	0.0	1.21E-4	ENSG00000136541	ENST00000410096;ENST00000397283;ENST00000535935;ENST00000420719	.	.	.	5.83	2.92	0.33932	.	0.560739	0.18340	N	0.144213	T	0.28699	0.0711	L	0.27053	0.805	0.09310	N	1	P;P;P	0.49090	0.919;0.919;0.919	P;P;P	0.46208	0.507;0.507;0.507	T	0.08229	-1.0732	9	0.87932	D	0	-5.8505	7.9375	0.29939	0.0:0.6104:0.3063:0.0833	.	149;182;169	B4DIZ1;Q8TAM6-2;Q8TAM6	.;.;ERMIN_HUMAN	Y	169;182;63;149	.	ENSP00000380453:D182Y	D	-	1	0	ERMN	157886379	0.000000	0.05858	0.002000	0.10522	0.783000	0.44284	0.463000	0.21972	0.785000	0.33685	0.655000	0.94253	GAC	-	ERMN	-	NULL		0.413	ERMN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMN	HGNC	protein_coding	OTTHUMT00000332659.1	0	0	0	86	86	88	0.00	0.00	C	NM_001009959		158178133	-1	17	26	34	41	tier1	no_errors	ENST00000397283	ensembl	human	known	74_37	missense	33.33	38.81	SNP	0.001	A	17	34
PLEKHA8P1	51054	genome.wustl.edu	37	12	45567096	45567096	+	RNA	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:45567096C>G	ENST00000256692.5	-	0	1589					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTAACGCGGCCACAAAATCTT	0.488													ENSG00000134297																																					0													103.0	97.0	99.0					12																	45567096		2203	4300	6503			0			-	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567096C>G				R	SNP	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			-	PLEKHA8P1	-	-		0.488	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	HGNC	pseudogene	OTTHUMT00000404814.1	1	1	0	103	103	35	0.96	0.00	C	NR_037144		45567096	-1	21	18	62	28	tier1	no_errors	ENST00000256692	ensembl	human	known	74_37	rna	25.30	39.13	SNP	0.994	G	21	62
OR10A7	121364	genome.wustl.edu	37	12	55615732	55615732	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:55615732A>T	ENST00000326258.1	+	1	924	c.924A>T	c.(922-924)aaA>aaT	p.K308N		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						TCACTCAAAAAGTCTTACAGA	0.418													ENSG00000179919																																					0													66.0	52.0	57.0					12																	55615732		2203	4299	6502	SO:0001583	missense	0			-	BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.924A>T	12.37:g.55615732A>T	ENSP00000326718:p.Lys308Asn		Q6IFD5|Q96R19	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K308N	ENST00000326258.1	37	c.924	CCDS31815.1	12	.	.	.	.	.	.	.	.	.	.	a	8.722	0.914690	0.17907	.	.	ENSG00000179919	ENST00000326258	T	0.39406	1.08	3.42	-1.61	0.08399	.	0.604609	0.13205	N	0.405623	T	0.22975	0.0555	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.14839	-1.0458	10	0.28530	T	0.3	.	4.8147	0.13360	0.4449:0.1706:0.3845:0.0	.	308	Q8NGE5	O10A7_HUMAN	N	308	ENSP00000326718:K308N	ENSP00000326718:K308N	K	+	3	2	OR10A7	53901999	0.206000	0.23470	0.267000	0.24556	0.020000	0.10135	0.216000	0.17585	-0.171000	0.10797	-0.340000	0.08031	AAA	-	OR10A7	-	NULL		0.418	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A7	HGNC	protein_coding	OTTHUMT00000406308.1	0	0	0	18	18	90	0.00	0.00	A			55615732	+1	7	23	18	89	tier1	no_errors	ENST00000326258	ensembl	human	known	74_37	missense	28.00	20.35	SNP	0.002	T	7	18
LRRC8E	80131	genome.wustl.edu	37	19	7963872	7963872	+	Silent	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr19:7963872G>A	ENST00000306708.6	+	3	566	c.465G>A	c.(463-465)aaG>aaA	p.K155K	AC010336.1_ENST00000539278.1_3'UTR	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	155					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						TCCTGGGCAAGTGTTTCGACT	0.567													ENSG00000171017																																					0													109.0	110.0	109.0					19																	7963872		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.465G>A	19.37:g.7963872G>A			B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Silent	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.K155	ENST00000306708.6	37	c.465	CCDS12189.1	19																																																																																			-	LRRC8E	-	NULL		0.567	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8E	HGNC	protein_coding	OTTHUMT00000461354.1	0	0	0	62	62	87	0.00	0.00	G	NM_025061		7963872	+1	21	45	47	102	tier1	no_errors	ENST00000306708	ensembl	human	known	74_37	silent	30.88	30.41	SNP	1.000	A	21	47
ITPR2	3709	genome.wustl.edu	37	12	26780989	26780989	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:26780989G>A	ENST00000381340.3	-	23	3457	c.3041C>T	c.(3040-3042)tCt>tTt	p.S1014F	RP11-666F17.1_ENST00000414098.2_RNA|ITPR2_ENST00000545902.1_5'UTR	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1014					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGTGTCTGGAGATCCACTGGC	0.353													ENSG00000123104																																					0													248.0	237.0	240.0					12																	26780989		1858	4102	5960	SO:0001583	missense	0			-	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3041C>T	12.37:g.26780989G>A	ENSP00000370744:p.Ser1014Phe		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.S1014F	ENST00000381340.3	37	c.3041	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732177	0.30684	.	.	ENSG00000123104	ENST00000381340	T	0.44881	0.91	4.55	4.55	0.56014	.	0.636814	0.16484	N	0.212409	T	0.29684	0.0741	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09400	-1.0676	10	0.54805	T	0.06	.	15.657	0.77144	0.0:0.0:1.0:0.0	.	1014	Q14571	ITPR2_HUMAN	F	1014	ENSP00000370744:S1014F	ENSP00000370744:S1014F	S	-	2	0	ITPR2	26672256	0.880000	0.30214	0.999000	0.59377	0.504000	0.33889	3.918000	0.56432	2.529000	0.85273	0.650000	0.86243	TCT	-	ITPR2	-	superfamily_ARM-type_fold		0.353	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	0	0	0	43	43	80	0.00	0.00	G	NM_002223		26780989	-1	33	133	19	82	tier1	no_errors	ENST00000381340	ensembl	human	known	74_37	missense	63.46	61.86	SNP	0.916	A	33	19
EML1	2009	genome.wustl.edu	37	14	100402591	100402591	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr14:100402591C>G	ENST00000262233.6	+	19	2154	c.2015C>G	c.(2014-2016)tCc>tGc	p.S672C	EML1_ENST00000327921.9_Missense_Mutation_p.S660C|EML1_ENST00000334192.4_Missense_Mutation_p.S691C	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	672	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CAGGGTCATTCCAGCTTCATT	0.483													ENSG00000066629																																					0													107.0	93.0	98.0					14																	100402591		2203	4300	6503	SO:0001583	missense	0			-	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.2015C>G	14.37:g.100402591C>G	ENSP00000262233:p.Ser672Cys		Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S691C	ENST00000262233.6	37	c.2072	CCDS32155.1	14	.	.	.	.	.	.	.	.	.	.	C	17.46	3.396139	0.62177	.	.	ENSG00000066629	ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T	0.61859	0.07;0.07;0.07	5.2	5.2	0.72013	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75213	0.3819	M	0.93550	3.43	0.80722	D	1	B;B;B	0.32338	0.009;0.365;0.009	B;B;B	0.41691	0.015;0.364;0.016	T	0.80430	-0.1386	10	0.87932	D	0	-24.2813	17.709	0.88316	0.0:1.0:0.0:0.0	.	660;672;691	F8W717;O00423;O00423-3	.;EMAL1_HUMAN;.	C	660;672;691;691	ENSP00000327384:S660C;ENSP00000262233:S672C;ENSP00000334314:S691C	ENSP00000262233:S672C	S	+	2	0	EML1	99472344	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.624000	0.83124	2.429000	0.82318	0.561000	0.74099	TCC	-	EML1	-	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.483	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EML1	HGNC	protein_coding	OTTHUMT00000413943.1	0	0	0	67	67	166	0.00	0.00	C	NM_001008707		100402591	+1	27	66	115	405	tier1	no_errors	ENST00000334192	ensembl	human	known	74_37	missense	19.01	13.98	SNP	1.000	G	27	115
TARSL2	123283	genome.wustl.edu	37	15	102211786	102211786	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr15:102211786C>G	ENST00000335968.3	-	15	2086	c.1870G>C	c.(1870-1872)Gac>Cac	p.D624H		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	624					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATTTTTATGTCAATCTACAAA	0.338													ENSG00000185418																																					0													133.0	132.0	132.0					15																	102211786		2203	4300	6503	SO:0001583	missense	0			-	AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1870G>C	15.37:g.102211786C>G	ENSP00000338093:p.Asp624His		B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	pfam_aa-tR-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tR_SAD,superfamily_Thr/Ala-tR-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tR_SAD,pfscan_aa-tR-synth_II,prints_Thr-tR-ligase_IIa,tigrfam_Thr-tR-ligase_IIa	p.D624H	ENST00000335968.3	37	c.1870	CCDS10394.1	15	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938541	0.73557	.	.	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	.	.	.	5.11	5.11	0.69529	Aminoacyl-tRNA synthetase, class II (1);	0.048102	0.85682	D	0.000000	D	0.89904	0.6850	H	0.98682	4.3	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.68039	0.91;0.955	D	0.93790	0.7091	9	0.87932	D	0	-22.0922	16.1038	0.81205	0.0:1.0:0.0:0.0	.	624;529	A2RTX5;A2RTX5-2	SYTC2_HUMAN;.	H	624;529;624	.	ENSP00000329291:D529H	D	-	1	0	TARSL2	100029309	1.000000	0.71417	0.997000	0.53966	0.833000	0.47200	7.388000	0.79795	2.399000	0.81585	0.585000	0.79938	GAC	-	TARSL2	-	pfscan_aa-tR-synth_II,prints_Thr-tR-ligase_IIa,tigrfam_Thr-tR-ligase_IIa		0.338	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARSL2	HGNC	protein_coding	OTTHUMT00000313619.3	0	0	0	51	51	71	0.00	0.00	C	NM_152334		102211786	-1	10	14	45	48	tier1	no_errors	ENST00000335968	ensembl	human	known	74_37	missense	18.18	22.58	SNP	1.000	G	10	45
PROS1	5627	genome.wustl.edu	37	3	93605266	93605266	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr3:93605266G>T	ENST00000394236.3	-	11	1553	c.1237C>A	c.(1237-1239)Ctt>Att	p.L413I	PROS1_ENST00000407433.1_Missense_Mutation_p.L282I	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	413	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.L413I(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GGCTTAAAAAGGGGTCCAGGT	0.363													ENSG00000184500																																					1	Substitution - Missense(1)	lung(1)											142.0	156.0	151.0					3																	93605266		2203	4300	6503	SO:0001583	missense	0			-		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1237C>A	3.37:g.93605266G>T	ENSP00000377783:p.Leu413Ile		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,pfam_GLA_domain,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.L413I	ENST00000394236.3	37	c.1237	CCDS2923.1	3	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076435	0.76415	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	T;T	0.76709	-1.04;-1.04	3.42	3.42	0.39159	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.85682	U	0.000000	D	0.87696	0.6242	M	0.79805	2.47	0.58432	D	0.999998	D	0.69078	0.997	D	0.85130	0.997	D	0.89783	0.3962	10	0.66056	D	0.02	.	15.0387	0.71770	0.0:0.0:1.0:0.0	.	413	P07225	PROS_HUMAN	I	413;282	ENSP00000377783:L413I;ENSP00000385794:L282I	ENSP00000377783:L413I	L	-	1	0	PROS1	95087956	1.000000	0.71417	0.992000	0.48379	0.923000	0.55619	8.859000	0.92264	1.735000	0.51646	0.655000	0.94253	CTT	-	PROS1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.363	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROS1	HGNC	protein_coding	OTTHUMT00000317762.1	0	0	0	56	56	107	0.00	0.00	G	NM_000313		93605266	-1	14	24	28	49	tier1	no_errors	ENST00000394236	ensembl	human	known	74_37	missense	33.33	32.88	SNP	0.999	T	14	28
CRYGS	1427	genome.wustl.edu	37	3	186256495	186256495	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr3:186256495A>G	ENST00000392499.2	-	4	866	c.527T>C	c.(526-528)aTt>aCt	p.I176T	CRYGS_ENST00000307944.5_Missense_Mutation_p.I176T	NM_017541.2	NP_060011.1	P22914	CRBS_HUMAN	crystallin, gamma S	176	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|morphogenesis of an epithelium (GO:0002009)		structural constituent of eye lens (GO:0005212)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	11	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)		TTACTCCACAATGCGGCGGAA	0.547													ENSG00000213139																																					0													67.0	64.0	65.0					3																	186256495		2203	4300	6503	SO:0001583	missense	0			-		CCDS3275.1	3q27.3	2013-02-14			ENSG00000213139	ENSG00000213139			2417	protein-coding gene	gene with protein product	"""crystallin, gamma 8"""	123730		CRYG8			Standard	NM_017541		Approved		uc003fqe.3	P22914	OTTHUMG00000156615	ENST00000392499.2:c.527T>C	3.37:g.186256495A>G	ENSP00000376287:p.Ile176Thr		B2RAF8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.I176T	ENST00000392499.2	37	c.527	CCDS3275.1	3	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578847	0.65878	.	.	ENSG00000213139	ENST00000392499;ENST00000307944	T;T	0.79454	-1.27;-1.27	5.76	5.76	0.90799	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.287414	0.28146	U	0.016425	D	0.88923	0.6569	M	0.90198	3.095	0.43084	D	0.994749	P	0.50443	0.935	D	0.64042	0.921	D	0.90759	0.4663	10	0.66056	D	0.02	.	12.4499	0.55671	1.0:0.0:0.0:0.0	.	176	P22914	CRBS_HUMAN	T	176	ENSP00000376287:I176T;ENSP00000312099:I176T	ENSP00000312099:I176T	I	-	2	0	CRYGS	187739189	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	8.548000	0.90669	2.196000	0.70406	0.460000	0.39030	ATT	-	CRYGS	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin		0.547	CRYGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGS	HGNC	protein_coding	OTTHUMT00000344784.1	0	0	0	76	76	83	0.00	0.00	A	NM_017541		186256495	-1	17	29	32	40	tier1	no_errors	ENST00000307944	ensembl	human	known	74_37	missense	34.69	42.03	SNP	1.000	G	17	32
CPAMD8	27151	genome.wustl.edu	37	19	17086945	17086945	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr19:17086945G>A	ENST00000443236.1	-	16	1947	c.1916C>T	c.(1915-1917)tCa>tTa	p.S639L	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	592						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CTCATTTGCTGAATACGTCAC	0.542													ENSG00000160111																																					0													41.0	44.0	43.0					19																	17086945		2052	4197	6249	SO:0001583	missense	0			-	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1916C>T	19.37:g.17086945G>A	ENSP00000402505:p.Ser639Leu		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.S639L	ENST00000443236.1	37	c.1916	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.54|14.54	2.566419|2.566419	0.45694|0.45694	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	2.89|2.89	2.89|2.89	0.33648|0.33648	.|Alpha-2-macroglobulin, N-terminal 2 (1);	.|0.000000	.|0.56097	.|D	.|0.000030	.|D	.|0.84124	.|0.5403	M|M	0.91768|0.91768	3.24|3.24	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	.|D	.|0.88134	.|0.2840	.|9	.|0.72032	.|D	.|0.01	.|.	14.0561|14.0561	0.64769|0.64769	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|592	.|Q8IZJ3	.|CPMD8_HUMAN	X|L	650|639	.|.	.|ENSP00000291440:S639L	Q|S	-|-	1|2	0|0	CPAMD8|CPAMD8	16947945|16947945	1.000000|1.000000	0.71417|0.71417	0.672000|0.672000	0.29872|0.29872	0.174000|0.174000	0.22865|0.22865	6.513000|6.513000	0.73742|0.73742	1.351000|1.351000	0.45789|0.45789	0.561000|0.561000	0.74099|0.74099	CAG|TCA	-	CPAMD8	-	pfam_A2M_N_2		0.542	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	0	0	0	34	34	26	0.00	0.00	G	NM_015692		17086945	-1	16	16	33	33	tier1	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	32.65	32.65	SNP	0.971	A	16	33
CCDC181	57821	genome.wustl.edu	37	1	169366506	169366506	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:169366506C>G	ENST00000367806.3	-	5	1491	c.1339G>C	c.(1339-1341)Gga>Cga	p.G447R	CCDC181_ENST00000367805.3_Missense_Mutation_p.G446R|CCDC181_ENST00000545005.1_Missense_Mutation_p.G446R	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	447						nucleus (GO:0005634)											CCTTCTGTTCCTTTAAGGAAG	0.388													ENSG00000117477																																					0													120.0	107.0	111.0					1																	169366506		2203	4300	6503	SO:0001583	missense	0			-	AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.1339G>C	1.37:g.169366506C>G	ENSP00000356780:p.Gly447Arg		O60780|Q53FD5|Q5TID9|Q8TC48	Missense_Mutation	SNP	NULL	p.G447R	ENST00000367806.3	37	c.1339		1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.349173	0.24426	.	.	ENSG00000117477	ENST00000367805;ENST00000367806;ENST00000545005	T;T;T	0.21734	1.99;1.99;1.99	5.76	4.86	0.63082	.	0.155796	0.64402	D	0.000012	T	0.05640	0.0148	L	0.31120	0.905	0.29218	N	0.874113	B;B	0.15141	0.012;0.012	B;B	0.16722	0.016;0.016	T	0.26395	-1.0104	9	0.23302	T	0.38	-28.1596	8.4956	0.33125	0.0:0.793:0.0:0.207	.	447;446	Q5TID7;Q5TID7-3	CA114_HUMAN;.	R	446;447;446	ENSP00000356779:G446R;ENSP00000356780:G447R;ENSP00000442297:G446R	ENSP00000356779:G446R	G	-	1	0	C1orf114	167633130	1.000000	0.71417	0.894000	0.35097	0.966000	0.64601	1.923000	0.40055	1.581000	0.49865	-0.143000	0.13931	GGA	-	CCDC181	-	NULL		0.388	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC181	HGNC	protein_coding	OTTHUMT00000086099.1	0	0	0	20	20	55	0.00	0.00	C	NM_021179		169366506	-1	11	24	40	81	tier1	no_errors	ENST00000367806	ensembl	human	known	74_37	missense	21.57	22.86	SNP	0.885	G	11	40
SLITRK1	114798	genome.wustl.edu	37	13	84454233	84454233	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr13:84454233C>T	ENST00000377084.2	-	1	2295	c.1410G>A	c.(1408-1410)atG>atA	p.M470I		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	470					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TCAGTTTGGGCATGGCATTGA	0.557													ENSG00000178235																																					0													73.0	67.0	69.0					13																	84454233		2203	4300	6503	SO:0001583	missense	0			-	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1410G>A	13.37:g.84454233C>T	ENSP00000366288:p.Met470Ile		Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.M470I	ENST00000377084.2	37	c.1410	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574971	0.65878	.	.	ENSG00000178235	ENST00000377084	T	0.58210	0.35	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.62332	0.2419	M	0.72624	2.21	0.80722	D	1	P	0.38420	0.63	P	0.44732	0.459	T	0.66854	-0.5818	10	0.72032	D	0.01	-18.6145	17.693	0.88273	0.0:1.0:0.0:0.0	.	470	Q96PX8	SLIK1_HUMAN	I	470	ENSP00000366288:M470I	ENSP00000366288:M470I	M	-	3	0	SLITRK1	83352234	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.047000	0.71038	2.603000	0.88011	0.655000	0.94253	ATG	-	SLITRK1	-	smart_Leu-rich_rpt_typical-subtyp		0.557	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	HGNC	protein_coding	OTTHUMT00000045396.1	0	0	0	77	77	76	0.00	0.00	C	NM_052910		84454233	-1	16	22	47	68	tier1	no_errors	ENST00000377084	ensembl	human	known	74_37	missense	25.40	24.44	SNP	1.000	T	16	47
RTP2	344892	genome.wustl.edu	37	3	187416376	187416376	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr3:187416376G>C	ENST00000358241.1	-	2	1016	c.588C>G	c.(586-588)ttC>ttG	p.F196L		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	196					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		GAAGAGACAAGAAGTTGTAGC	0.582													ENSG00000198471																																					0													84.0	90.0	88.0					3																	187416376		2203	4300	6503	SO:0001583	missense	0			-	AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.588C>G	3.37:g.187416376G>C	ENSP00000350976:p.Phe196Leu		Q6NVH4	Missense_Mutation	SNP	NULL	p.F196L	ENST00000358241.1	37	c.588	CCDS33911.1	3	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611789	0.46631	.	.	ENSG00000198471	ENST00000358241	T	0.14144	2.53	3.93	3.06	0.35304	.	0.000000	0.64402	D	0.000002	T	0.21267	0.0512	L	0.36672	1.1	0.31569	N	0.656542	D	0.71674	0.998	D	0.72625	0.978	T	0.05131	-1.0904	10	0.31617	T	0.26	-41.1132	7.6559	0.28375	0.1145:0.0:0.8855:0.0	.	196	Q5QGT7	RTP2_HUMAN	L	196	ENSP00000350976:F196L	ENSP00000350976:F196L	F	-	3	2	RTP2	188899070	1.000000	0.71417	1.000000	0.80357	0.441000	0.31987	2.943000	0.49026	1.256000	0.44068	0.462000	0.41574	TTC	-	RTP2	-	NULL		0.582	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP2	HGNC	protein_coding	OTTHUMT00000344259.1	0	0	0	77	77	65	0.00	0.00	G	NM_001004312		187416376	-1	29	22	30	19	tier1	no_errors	ENST00000358241	ensembl	human	known	74_37	missense	49.15	53.66	SNP	1.000	C	29	30
PRRC2B	84726	genome.wustl.edu	37	9	134349905	134349905	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr9:134349905T>G	ENST00000357304.4	+	15	2444	c.2389T>G	c.(2389-2391)Ttt>Gtt	p.F797V	PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	797							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCGCGATCTCTTTGAGGAGAG	0.488													ENSG00000130723																																					0													97.0	100.0	99.0					9																	134349905		1898	4118	6016	SO:0001583	missense	0			-	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.2389T>G	9.37:g.134349905T>G	ENSP00000349856:p.Phe797Val		O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.F797V	ENST00000357304.4	37	c.2389	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	T	13.07	2.128755	0.37533	.	.	ENSG00000130723	ENST00000357304;ENST00000418650;ENST00000456307	T;T	0.09350	2.99;2.99	5.46	1.88	0.25563	.	.	.	.	.	T	0.06462	0.0166	N	0.24115	0.695	0.80722	D	1	B;B	0.22683	0.073;0.018	B;B	0.25291	0.059;0.025	T	0.33828	-0.9853	9	0.15499	T	0.54	.	7.2327	0.26051	0.0:0.3261:0.0:0.6739	.	93;797	Q5H9R5;Q5JSZ5	.;PRC2B_HUMAN	V	797;93;66	ENSP00000349856:F797V;ENSP00000400608:F66V	ENSP00000349856:F797V	F	+	1	0	PRRC2B	133339726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.810000	0.47979	0.437000	0.26423	0.533000	0.62120	TTT	-	PRRC2B	-	NULL		0.488	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		0	0	0	70	70	71	0.00	0.00	T			134349905	+1	28	21	52	66	tier1	no_errors	ENST00000357304	ensembl	human	known	74_37	missense	35.00	24.14	SNP	1.000	G	28	52
DYRK2	8445	genome.wustl.edu	37	12	68052027	68052027	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr12:68052027A>G	ENST00000344096.3	+	3	1753	c.1340A>G	c.(1339-1341)gAt>gGt	p.D447G	DYRK2_ENST00000393555.3_Missense_Mutation_p.D374G|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	447	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		AAACTGCTGGATGCATCCAAA	0.542													ENSG00000127334																																					0													68.0	61.0	63.0					12																	68052027		2203	4300	6503	SO:0001583	missense	0			-	Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.1340A>G	12.37:g.68052027A>G	ENSP00000342105:p.Asp447Gly		B2R9V9|Q9BRB5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D447G	ENST00000344096.3	37	c.1340	CCDS8978.1	12	.	.	.	.	.	.	.	.	.	.	A	10.97	1.501728	0.26949	.	.	ENSG00000127334	ENST00000344096;ENST00000393555	T;T	0.65916	-0.18;-0.18	5.05	5.05	0.67936	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043892	0.85682	D	0.000000	T	0.49592	0.1566	N	0.25332	0.735	0.80722	D	1	B	0.09022	0.002	B	0.20384	0.029	T	0.41928	-0.9481	9	.	.	.	.	15.5002	0.75691	1.0:0.0:0.0:0.0	.	447	Q92630	DYRK2_HUMAN	G	447;374	ENSP00000342105:D447G;ENSP00000377186:D374G	.	D	+	2	0	DYRK2	66338294	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.256000	0.78350	2.209000	0.71365	0.254000	0.18369	GAT	-	DYRK2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.542	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK2	HGNC	protein_coding	OTTHUMT00000402218.1	0	0	0	32	32	72	0.00	0.00	A			68052027	+1	287	633	650	1776	tier1	no_errors	ENST00000344096	ensembl	human	known	74_37	missense	30.56	26.25	SNP	1.000	G	287	650
TMEM132E	124842	genome.wustl.edu	37	17	32963185	32963185	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr17:32963185G>A	ENST00000321639.5	+	9	2195	c.1867G>A	c.(1867-1869)Gct>Act	p.A623T		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	623						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		AGCCACCACAGCTGCCCAACA	0.627													ENSG00000181291																																					0													49.0	39.0	43.0					17																	32963185		2203	4299	6502	SO:0001583	missense	0			-	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1867G>A	17.37:g.32963185G>A	ENSP00000316532:p.Ala623Thr		Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.A623T	ENST00000321639.5	37	c.1867	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	G	4.452	0.083620	0.08533	.	.	ENSG00000181291	ENST00000321639	T	0.16597	2.33	5.56	4.59	0.56863	.	0.172114	0.52532	N	0.000071	T	0.07999	0.0200	N	0.16130	0.375	0.40291	D	0.978506	B	0.12630	0.006	B	0.13407	0.009	T	0.19224	-1.0312	10	0.09590	T	0.72	-12.0999	6.1945	0.20542	0.1549:0.0:0.6938:0.1513	.	623	Q6IEE7	T132E_HUMAN	T	623	ENSP00000316532:A623T	ENSP00000316532:A623T	A	+	1	0	TMEM132E	29987298	0.861000	0.29849	0.137000	0.22149	0.882000	0.50991	2.580000	0.46068	1.347000	0.45714	0.551000	0.68910	GCT	-	TMEM132E	-	NULL		0.627	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	0	0	0	71	71	19	0.00	0.00	G	NM_207313		32963185	+1	35	21	46	20	tier1	no_errors	ENST00000321639	ensembl	human	known	74_37	missense	43.21	51.22	SNP	0.737	A	35	46
MYO1F	4542	genome.wustl.edu	37	19	8601180	8601180	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr19:8601180A>T	ENST00000338257.8	-	19	2266	c.1999T>A	c.(1999-2001)Tac>Aac	p.Y667N		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	667	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						CCCATCTGGTACTGGTCGGGC	0.602													ENSG00000142347																																					0													74.0	76.0	75.0					19																	8601180		2016	4211	6227	SO:0001583	missense	0			-	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1999T>A	19.37:g.8601180A>T	ENSP00000344871:p.Tyr667Asn		Q8WWN7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.Y667N	ENST00000338257.8	37	c.1999	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	A	27.8	4.866958	0.91511	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.95980	-3.87	4.51	4.51	0.55191	Myosin head, motor domain (2);	0.157596	0.44097	D	0.000490	D	0.98197	0.9404	H	0.96833	3.89	0.80722	D	1	D	0.54601	0.967	P	0.61658	0.892	D	0.99129	1.0852	10	0.87932	D	0	.	13.0366	0.58875	1.0:0.0:0.0:0.0	.	667	O00160	MYO1F_HUMAN	N	712;667	ENSP00000344871:Y667N	ENSP00000304899:Y712N	Y	-	1	0	MYO1F	8507180	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.257000	0.95545	1.687000	0.51057	0.372000	0.22366	TAC	-	MYO1F	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.602	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	0	0	0	98	98	32	0.00	0.00	A			8601180	-1	50	27	66	43	tier1	no_errors	ENST00000338257	ensembl	human	known	74_37	missense	43.10	38.57	SNP	1.000	T	50	66
NMNAT3	349565	genome.wustl.edu	37	3	139301903	139301903	+	Intron	SNP	C	C	T	rs528456325		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr3:139301903C>T	ENST00000296202.7	-	4	491				NMNAT3_ENST00000512391.1_Intron|RP11-319G6.1_ENST00000515247.1_RNA|NMNAT3_ENST00000406164.1_Intron|NMNAT3_ENST00000413939.2_Intron|RN7SKP124_ENST00000364730.1_RNA|NMNAT3_ENST00000406824.1_Intron|NMNAT3_ENST00000507242.1_5'UTR|RP11-319G6.1_ENST00000381790.3_RNA|NMNAT3_ENST00000511444.1_Intron|NMNAT3_ENST00000339837.5_Intron			Q96T66	NMNA3_HUMAN	nicotinamide nucleotide adenylyltransferase 3						NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)	9						AGTTCTTTTGCGTTTAAAAGA	0.333													ENSG00000163864																																					0																																										SO:0001627	intron_variant	0			-	AF345564	CCDS3111.1, CCDS56282.1	3q23	2013-09-20			ENSG00000163864	ENSG00000163864			20989	protein-coding gene	gene with protein product		608702				12574164	Standard	NM_178177		Approved	PNAT3	uc003etk.3	Q96T66	OTTHUMG00000159951	ENST00000296202.7:c.110-4006G>A	3.37:g.139301903C>T			B3KVR6|D3DNF2|D3DNF3|Q8N4G1	R	SNP	-	NULL	ENST00000296202.7	37	NULL		3																																																																																			-	NMT3	-	-		0.333	NMNAT3-004	KNOWN	basic|appris_principal	protein_coding	NMT3	HGNC	protein_coding	OTTHUMT00000358469.1	0	0	0	46	46	61	0.00	0.00	C	NM_178177		139301903	-1	16	17	17	30	tier1	no_errors	ENST00000507242	ensembl	human	known	74_37	rna	48.48	36.17	SNP	0.985	T	16	17
SV2C	22987	genome.wustl.edu	37	5	75621242	75621242	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr5:75621242G>A	ENST00000502798.2	+	13	2496	c.2054G>A	c.(2053-2055)gGa>gAa	p.G685E	SV2C_ENST00000322285.7_Intron	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	685					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GCCGTCCTGGGAAACTTAATA	0.512													ENSG00000122012																																					0													120.0	115.0	116.0					5																	75621242		1988	4167	6155	SO:0001583	missense	0			-	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.2054G>A	5.37:g.75621242G>A	ENSP00000423541:p.Gly685Glu		Q496K1|Q9UPU8	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	p.G685E	ENST00000502798.2	37	c.2054	CCDS43331.1	5	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861940	0.91433	.	.	ENSG00000122012	ENST00000502798	T	0.70986	-0.53	5.62	5.62	0.85841	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.85801	0.5781	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87035	0.2137	10	0.87932	D	0	-15.537	19.6758	0.95932	0.0:0.0:1.0:0.0	.	685	Q496J9	SV2C_HUMAN	E	685	ENSP00000423541:G685E	ENSP00000423541:G685E	G	+	2	0	SV2C	75656998	1.000000	0.71417	0.895000	0.35142	0.736000	0.42039	9.837000	0.99465	2.644000	0.89710	0.561000	0.74099	GGA	-	SV2C	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2		0.512	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2C	HGNC	protein_coding	OTTHUMT00000368700.4	0	0	0	54	54	37	0.00	0.00	G			75621242	+1	8	24	34	51	tier1	no_errors	ENST00000502798	ensembl	human	known	74_37	missense	19.05	32.00	SNP	1.000	A	8	34
HMCN1	83872	genome.wustl.edu	37	1	185902757	185902757	+	Silent	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:185902757C>T	ENST00000271588.4	+	11	1858	c.1629C>T	c.(1627-1629)atC>atT	p.I543I	HMCN1_ENST00000367492.2_Silent_p.I543I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	543	Ig-like C2-type 2.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CATGTCTCATCATCAGTGCGG	0.463													ENSG00000143341																																					0													103.0	98.0	100.0					1																	185902757		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1629C>T	1.37:g.185902757C>T			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.I543	ENST00000271588.4	37	c.1629	CCDS30956.1	1																																																																																			-	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.463	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	0	0	0	71	71	62	0.00	0.00	C	NM_031935		185902757	+1	35	25	137	174	tier1	no_errors	ENST00000271588	ensembl	human	known	74_37	silent	20.35	12.56	SNP	0.891	T	35	137
PRSS42	339906	genome.wustl.edu	37	3	46874437	46874437	+	Splice_Site	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr3:46874437G>A	ENST00000429665.1	-	3	630	c.631C>T	c.(631-633)Cga>Tga	p.R211*	PRSS42_ENST00000447340.1_Intron	NM_182702.1	NP_874361.1	Q7Z5A4	PRS42_HUMAN	protease, serine, 42	211	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				germ cell development (GO:0007281)|spermatogenesis (GO:0007283)	anchored component of plasma membrane (GO:0046658)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	8						GTCTCACCACGTTCTGGTGTT	0.542													ENSG00000178055																																					0													82.0	80.0	81.0					3																	46874437		2051	4196	6247	SO:0001630	splice_region_variant	0			-		CCDS46816.1	3p21.31	2010-05-07			ENSG00000178055	ENSG00000178055		"""Serine peptidases / Serine peptidases"""	30716	protein-coding gene	gene with protein product	"""testis serine protease 2"""					12838346	Standard	NM_182702		Approved	TESSP2	uc011bap.2	Q7Z5A4	OTTHUMG00000156496	ENST00000429665.1:c.631+1C>T	3.37:g.46874437G>A				Nonsense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R211*	ENST00000429665.1	37	c.631	CCDS46816.1	3	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348940	0.24426	.	.	ENSG00000178055	ENST00000429665	.	.	.	3.67	-3.25	0.05079	.	2.281760	0.02329	N	0.073733	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.9721	0.01418	0.2886:0.3095:0.2281:0.1738	.	.	.	.	X	211	.	.	R	-	1	2	PRSS42	46849441	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.200000	0.01237	-0.760000	0.04677	-2.617000	0.00157	CGA	-	PRSS42	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.542	PRSS42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS42	HGNC	protein_coding	OTTHUMT00000344347.1	1	1	0	109	109	81	0.91	0.00	G	NM_182702	Nonsense_Mutation	46874437	-1	33	34	49	80	tier1	no_errors	ENST00000429665	ensembl	human	known	74_37	nonsense	40.24	29.31	SNP	0.001	A	33	49
MPO	4353	genome.wustl.edu	37	17	56357978	56357978	+	Missense_Mutation	SNP	C	C	T	rs200249653		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr17:56357978C>T	ENST00000225275.3	-	1	318	c.142G>A	c.(142-144)Ggt>Agt	p.G48S	MPO_ENST00000340482.3_Missense_Mutation_p.G48S|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	48					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GGAGCAGCACCTTCAGAGGGC	0.592													ENSG00000005381																																					0								C	SER/GLY	4,4402	8.1+/-20.4	0,4,2199	63.0	55.0	58.0		142	1.1	0.0	17		58	0,8600		0,0,4300	yes	missense	MPO	NM_000250.1	56	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign	48/746	56357978	4,13002	2203	4300	6503	SO:0001583	missense	0			-		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.142G>A	17.37:g.56357978C>T	ENSP00000225275:p.Gly48Ser		A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.G48S	ENST00000225275.3	37	c.142	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	C	5.229	0.227758	0.09916	9.08E-4	0.0	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.68479	-0.33;-0.32	5.36	1.15	0.20763	.	0.853612	0.10298	N	0.691450	T	0.48554	0.1506	N	0.21448	0.665	0.09310	N	1	B	0.19331	0.035	B	0.17722	0.019	T	0.25502	-1.0130	10	0.12430	T	0.62	-0.3179	10.1937	0.43041	0.0:0.7017:0.0:0.2983	.	48	P05164	PERM_HUMAN	S	48	ENSP00000344419:G48S;ENSP00000225275:G48S	ENSP00000225275:G48S	G	-	1	0	MPO	53712977	0.001000	0.12720	0.000000	0.03702	0.240000	0.25518	0.313000	0.19415	-0.196000	0.10366	-1.134000	0.01955	GGT	rs200249653	MPO	-	NULL		0.592	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	0	0	0	39	39	93	0.00	0.00	C			56357978	-1	10	35	29	80	tier1	no_errors	ENST00000340482	ensembl	human	known	74_37	missense	25.64	30.43	SNP	0.000	T	10	29
GUSBP1	728411	genome.wustl.edu	37	5	21459642	21459642	+	RNA	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr5:21459642G>A	ENST00000607545.1	+	0	0					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										CTGTCTCTGTGGCTGGTTCTG	0.652											OREG0016459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000183666																																					0																																												0			-	BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21459642G>A		748	A6NLY8|A8K1B7|Q969T8|Q9BUH2	R	SNP	-	NULL	ENST00000607545.1	37	NULL		5																																																																																			-	GUSBP1	-	-		0.652	GUSBP1-006	KNOWN	basic	processed_transcript	GUSBP1	HGNC	pseudogene	OTTHUMT00000470546.1	0	0	0	145	145	43	0.00	0.00	G	NG_008324		21459642	+1	41	15	94	35	tier1	no_errors	ENST00000508973	ensembl	human	known	74_37	rna	30.37	30.00	SNP	0.000	A	41	94
GSDMC	56169	genome.wustl.edu	37	8	130760915	130760915	+	Silent	SNP	G	G	A	rs373227533		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr8:130760915G>A	ENST00000276708.4	-	14	2240	c.1359C>T	c.(1357-1359)ctC>ctT	p.L453L		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	453						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GGAGTGGGGCGAGGAGCTCAG	0.542													ENSG00000147697																																					0													83.0	82.0	82.0					8																	130760915		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.1359C>T	8.37:g.130760915G>A			Q5XKF3|Q6P494	Silent	SNP	pfam_Gasdermin	p.L453	ENST00000276708.4	37	c.1359	CCDS6360.1	8																																																																																			-	GSDMC	-	pfam_Gasdermin		0.542	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	0	0	0	52	52	88	0.00	0.00	G			130760915	-1	20	48	16	33	tier1	no_errors	ENST00000276708	ensembl	human	known	74_37	silent	55.56	59.26	SNP	0.000	A	20	16
OLFML2B	25903	genome.wustl.edu	37	1	161976156	161976156	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr1:161976156G>C	ENST00000294794.3	-	4	1077	c.654C>G	c.(652-654)atC>atG	p.I218M	OLFML2B_ENST00000367940.2_Missense_Mutation_p.I218M	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	218					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TGCTATCTAGGATGTTTTCAG	0.498													ENSG00000162745																																					0													219.0	199.0	206.0					1																	161976156		2203	4300	6503	SO:0001583	missense	0			-	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.654C>G	1.37:g.161976156G>C	ENSP00000294794:p.Ile218Met		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_-bd_OB-fold,smart_Olfac-like,pfscan_Olfac-like	p.I218M	ENST00000294794.3	37	c.654	CCDS1236.1	1	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.363402	0.01235	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	T;T	0.45668	0.89;1.0	4.74	-0.935	0.10423	.	.	.	.	.	T	0.07279	0.0184	L	0.38175	1.15	0.25359	N	0.988798	P;P	0.35923	0.468;0.528	B;B	0.30401	0.115;0.107	T	0.24404	-1.0161	8	0.02654	T	1	.	5.4068	0.16326	0.3435:0.1384:0.5181:0.0	.	218;218	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	M	218	ENSP00000294794:I218M;ENSP00000356917:I218M	ENSP00000294794:I218M	I	-	3	3	OLFML2B	160242780	0.031000	0.19500	0.000000	0.03702	0.034000	0.12701	1.826000	0.39092	-0.059000	0.13154	-0.291000	0.09656	ATC	-	OLFML2B	-	NULL		0.498	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OLFML2B	HGNC	protein_coding	OTTHUMT00000060552.2	0	0	0	76	76	47	0.00	0.00	G	NM_015441		161976156	-1	21	12	61	32	tier1	no_errors	ENST00000294794	ensembl	human	known	74_37	missense	25.61	27.27	SNP	0.000	C	21	61
CASC5	57082	genome.wustl.edu	37	15	40907552	40907552	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr15:40907552G>C	ENST00000346991.5	+	9	766	c.376G>C	c.(376-378)Gaa>Caa	p.E126Q	RN7SL376P_ENST00000578594.1_RNA|CASC5_ENST00000527044.1_Missense_Mutation_p.E98Q|CASC5_ENST00000399668.2_Missense_Mutation_p.E100Q			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	126	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TAAGAAATTAGAAGATAATTA	0.274													ENSG00000137812																																					0													24.0	23.0	24.0					15																	40907552		1770	4037	5807	SO:0001583	missense	0			-	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.376G>C	15.37:g.40907552G>C	ENSP00000335463:p.Glu126Gln		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.E126Q	ENST00000346991.5	37	c.376	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	G	14.67	2.603773	0.46423	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000527044;ENST00000399668	T;T;T	0.41758	3.19;1.54;0.99	4.71	4.71	0.59529	.	0.355098	0.23378	N	0.048838	T	0.55194	0.1905	L	0.43152	1.355	0.24298	N	0.995138	D;D;D	0.76494	0.996;0.996;0.999	D;D;D	0.68943	0.93;0.93;0.961	T	0.49214	-0.8963	10	0.62326	D	0.03	.	14.7248	0.69336	0.0:0.0:1.0:0.0	.	100;126;100	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	Q	126;100;98;100	ENSP00000335463:E126Q;ENSP00000432654:E98Q;ENSP00000382576:E100Q	ENSP00000260369:E100Q	E	+	1	0	CASC5	38694844	1.000000	0.71417	0.960000	0.40013	0.452000	0.32318	5.138000	0.64795	2.331000	0.79229	0.455000	0.32223	GAA	-	CASC5	-	NULL		0.274	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	0	0	0	89	89	50	0.00	0.00	G	NM_144508		40907552	+1	15	28	48	49	tier1	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	23.81	36.36	SNP	0.983	C	15	48
CNTN6	27255	genome.wustl.edu	37	3	1415693	1415693	+	Silent	SNP	C	C	T	rs148069303	byFrequency	TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr3:1415693C>T	ENST00000446702.2	+	16	2658	c.2031C>T	c.(2029-2031)gcC>gcT	p.A677A	CNTN6_ENST00000350110.2_Silent_p.A677A|CNTN6_ENST00000539053.1_Silent_p.A605A			Q9UQ52	CNTN6_HUMAN	contactin 6	677	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GTGTTGTTGCCGGCAACAGCA	0.383													ENSG00000134115																																					0								C		0,4406		0,0,2203	139.0	132.0	135.0		2031	-0.5	1.0	3	dbSNP_134	135	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	CNTN6	NM_014461.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		677/1029	1415693	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2031C>T	3.37:g.1415693C>T			Q2KHM2	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A677	ENST00000446702.2	37	c.2031	CCDS2557.1	3																																																																																			rs148069303	CNTN6	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.383	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	0	0	0	66	66	116	0.00	0.00	C	NM_014461		1415693	+1	17	33	28	69	tier1	no_errors	ENST00000350110	ensembl	human	known	74_37	silent	37.78	32.35	SNP	0.339	T	17	28
OR5V1	81696	genome.wustl.edu	37	6	29323624	29323624	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr6:29323624C>T	ENST00000377154.1	-	4	648	c.349G>A	c.(349-351)Gca>Aca	p.A117T	OR5V1_ENST00000543825.1_Missense_Mutation_p.A117T			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TATGCCATTGCTGCCAGTAGG	0.413													ENSG00000243729																									Ovarian(32;43 883 21137 32120 42650)												0													67.0	68.0	68.0					6																	29323624		2203	4299	6502	SO:0001583	missense	0			-		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.349G>A	6.37:g.29323624C>T	ENSP00000366359:p.Ala117Thr		A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A117T	ENST00000377154.1	37	c.349	CCDS4657.1	6	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761457	0.49468	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.01369	4.97;4.97	4.37	1.51	0.23008	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32719	N	0.005724	T	0.00845	0.0028	L	0.56199	1.76	0.09310	N	1	P	0.50156	0.932	P	0.47573	0.55	T	0.52697	-0.8541	10	0.45353	T	0.12	-32.6884	5.676	0.17749	0.4433:0.4356:0.0:0.1211	.	117	Q9UGF6	OR5V1_HUMAN	T	117	ENSP00000366359:A117T;ENSP00000443309:A117T	ENSP00000366356:A117T	A	-	1	0	OR5V1	29431603	0.000000	0.05858	0.987000	0.45799	0.791000	0.44710	-0.080000	0.11339	0.542000	0.28846	0.543000	0.68304	GCA	-	OR5V1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.413	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	HGNC	protein_coding	OTTHUMT00000076398.3	0	0	0	41	41	92	0.00	0.00	C			29323624	-1	22	63	5	22	tier1	no_errors	ENST00000377154	ensembl	human	known	74_37	missense	81.48	74.12	SNP	0.002	T	22	5
KIR3DL1	3811	genome.wustl.edu	37	19	55331443	55331443	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr19:55331443G>A	ENST00000391728.4	+	4	664	c.631G>A	c.(631-633)Gat>Aat	p.D211N	KIR3DL1_ENST00000358178.4_Missense_Mutation_p.D116N|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.D211N|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.D211N|KIR3DL1_ENST00000538269.1_Missense_Mutation_p.D211N|KIR3DL1_ENST00000541392.1_Missense_Mutation_p.D211N	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	211					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		AGCTCCCAGTGATCCCCTGGA	0.532													ENSG00000167633																																					0													112.0	94.0	100.0					19																	55331443		2183	4145	6328	SO:0001583	missense	0			-	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.631G>A	19.37:g.55331443G>A	ENSP00000375608:p.Asp211Asn		O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.D211N	ENST00000391728.4	37	c.631	CCDS42621.1	19	.	.	.	.	.	.	.	.	.	.	-	13.37	2.215651	0.39102	.	.	ENSG00000167633	ENST00000402254;ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T;T	0.00873	5.59;5.59;5.59;5.59;5.59;5.59	1.44	1.44	0.22558	Immunoglobulin-like fold (1);	0.810514	0.09957	U	0.733958	T	0.02888	0.0086	L	0.45698	1.435	0.09310	N	0.999997	D;D;D;P	0.71674	0.991;0.991;0.998;0.94	D;D;D;B	0.80764	0.92;0.953;0.994;0.39	T	0.51148	-0.8742	10	0.87932	D	0	.	6.3394	0.21314	0.0:0.0:1.0:0.0	.	211;116;211;211	Q15702;Q14946;F6QF33;P43629	.;.;.;KI3L1_HUMAN	N	211;211;211;189;211;211;116	ENSP00000384528:D211N;ENSP00000443350:D211N;ENSP00000442355:D211N;ENSP00000375608:D211N;ENSP00000326868:D211N;ENSP00000350901:D116N	ENSP00000326868:D211N	D	+	1	0	KIR3DL1	60023255	0.439000	0.25610	0.422000	0.26621	0.010000	0.07245	-0.022000	0.12480	1.138000	0.42230	0.184000	0.17185	GAT	-	KIR3DL1	-	NULL		0.532	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIR3DL1	HGNC	protein_coding	OTTHUMT00000141238.1	1	1	0	116	116	31	0.85	0.00	G	NM_013289		55331443	+1	40	19	54	32	tier1	no_errors	ENST00000402254	ensembl	human	known	74_37	missense	42.55	37.25	SNP	0.430	A	40	54
AKR1B10	57016	genome.wustl.edu	37	7	134215401	134215401	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr7:134215401C>G	ENST00000359579.4	+	2	393	c.73C>G	c.(73-75)Ctt>Gtt	p.L25V	AKR1B10_ENST00000475559.1_3'UTR	NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	25					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						TCAGTCTCCTCTTGGCAAAGT	0.488													ENSG00000198074																																					0													78.0	80.0	79.0					7																	134215401		2203	4300	6503	SO:0001583	missense	0			-	AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.73C>G	7.37:g.134215401C>G	ENSP00000352584:p.Leu25Val		A4D1P1|O75890|Q6FHF3|Q8IWZ1	Missense_Mutation	SNP	pfam_DP_OxRdtase_dom,superfamily_DP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.L25V	ENST00000359579.4	37	c.73	CCDS5832.1	7	.	.	.	.	.	.	.	.	.	.	C	10.43	1.349396	0.24426	.	.	ENSG00000198074	ENST00000359579	T	0.16743	2.32	4.55	3.67	0.42095	NADP-dependent oxidoreductase domain (3);	0.237933	0.42964	D	0.000627	T	0.11580	0.0282	N	0.16201	0.385	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23868	-1.0176	10	0.72032	D	0.01	.	14.0869	0.64962	0.0:0.8481:0.1519:0.0	.	25	O60218	AK1BA_HUMAN	V	25	ENSP00000352584:L25V	ENSP00000352584:L25V	L	+	1	0	AKR1B10	133865941	0.010000	0.17322	0.001000	0.08648	0.046000	0.14306	1.707000	0.37888	1.043000	0.40175	-0.462000	0.05337	CTT	-	AKR1B10	-	pfam_DP_OxRdtase_dom,superfamily_DP_OxRdtase_dom		0.488	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1B10	HGNC	protein_coding	OTTHUMT00000339615.1	0	0	0	73	73	34	0.00	0.00	C	NM_020299		134215401	+1	19	10	31	13	tier1	no_errors	ENST00000359579	ensembl	human	known	74_37	missense	38.00	43.48	SNP	0.192	G	19	31
DNAH5	1767	genome.wustl.edu	37	5	13727719	13727719	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr5:13727719delT	ENST00000265104.4	-	70	12034	c.11930delA	c.(11929-11931)aacfs	p.N3977fs		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3977					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTCCTCCGGGTTTTCCTTATC	0.413									Kartagener syndrome				ENSG00000039139																																					0													102.0	104.0	103.0					5																	13727719		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome		AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11930delA	5.37:g.13727719delT	ENSP00000265104:p.Asn3977fs		Q92860|Q96L74|Q9H5S7|Q9HCG9	Frame_Shift_Del	DEL	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.N3977fs	ENST00000265104.4	37	c.11930	CCDS3882.1	5																																																																																				DH5	-	pfam_Dynein_heavy_dom		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	0	58	58	81	0.00	0.00	T	NM_001369		13727719	-1	28	36	30	60	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	frame_shift_del	48.28	37.50	DEL	0.996	-	28	30
XIST	7503	genome.wustl.edu	37	X	73071941	73071941	+	lincRNA	DEL	A	A	-			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chrX:73071941delA	ENST00000429829.1	-	0	647					NR_001564.2				X inactive specific transcript (non-protein coding)																		AAGGAAAAATAAAAAAAAAAA	0.448													ENSG00000229807																																					0													11.0	12.0	11.0					X																	73071941		868	1980	2848			0				M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071941delA				R	DEL	-	NULL	ENST00000429829.1	37	NULL		X																																																																																				XIST	-	-		0.448	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	0	0	0	29	29	15	0.00	0.00	A	NR_001564		73071941	-1	3	3	21	24	tier1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	12.50	11.11	DEL	0.531	-	3	21
CBLN2	147381	genome.wustl.edu	37	18	70205471	70205471	+	Silent	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr18:70205471G>C	ENST00000269503.4	-	5	1388	c.615C>G	c.(613-615)ggC>ggG	p.G205G	CBLN2_ENST00000581073.1_Silent_p.G91G|CBLN2_ENST00000585159.1_Silent_p.G205G|CBLN2_ENST00000584764.1_Silent_p.G89G|CBLN2_ENST00000583651.1_5'UTR	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	205	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CCATGAGGTTGCCTCTCTCAA	0.522													ENSG00000141668																																					0													110.0	106.0	108.0					18																	70205471		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.615C>G	18.37:g.70205471G>C			Q53Z56	Silent	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.G205	ENST00000269503.4	37	c.615	CCDS11999.1	18																																																																																			-	CBLN2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q		0.522	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN2	HGNC	protein_coding	OTTHUMT00000256288.1	0	0	1	38	38	68	0.00	1.45	G	NM_182511		70205471	-1	7	24	8	7	tier1	no_errors	ENST00000269503	ensembl	human	known	74_37	silent	46.67	77.42	SNP	1.000	C	7	8
CDH22	64405	genome.wustl.edu	37	20	44879759	44879759	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr20:44879759G>A	ENST00000372262.3	-	1	575	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C	CDH22_ENST00000537909.1_Missense_Mutation_p.R59C	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	59					brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CGTTTGACGCGGCCGGCTCCC	0.726													ENSG00000149654																																					0													15.0	18.0	17.0					20																	44879759		2183	4256	6439	SO:0001583	missense	0			-	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.175C>T	20.37:g.44879759G>A	ENSP00000361336:p.Arg59Cys		B9EGK7|O43205	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R59C	ENST00000372262.3	37	c.175	CCDS13395.1	20	.	.	.	.	.	.	.	.	.	.	g	19.77	3.889678	0.72524	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.00587	6.38;6.38	3.29	3.29	0.37713	.	0.000000	0.64402	U	0.000001	T	0.00936	0.0031	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.82647	-0.0354	10	0.87932	D	0	.	11.8488	0.52399	0.0:0.0:1.0:0.0	.	59	Q9UJ99	CAD22_HUMAN	C	59	ENSP00000361336:R59C;ENSP00000437790:R59C	ENSP00000361336:R59C	R	-	1	0	CDH22	44313166	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	3.889000	0.56212	1.679000	0.50963	0.187000	0.17357	CGC	-	CDH22	-	NULL		0.726	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	0	0	0	24	24	13	0.00	0.00	G	NM_021248		44879759	-1	17	18	8	9	tier1	no_errors	ENST00000372262	ensembl	human	known	74_37	missense	68.00	66.67	SNP	1.000	A	17	8
DNAH3	55567	genome.wustl.edu	37	16	21073855	21073855	+	Missense_Mutation	SNP	G	G	A	rs370381549		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr16:21073855G>A	ENST00000261383.3	-	25	3667	c.3668C>T	c.(3667-3669)tCg>tTg	p.S1223L	DNAH3_ENST00000415178.1_Missense_Mutation_p.S1223L	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1223	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTCTTTTTCCGAGCTGATCAT	0.428													ENSG00000158486																																					0								G	LEU/SER	1,4401	2.1+/-5.4	0,1,2200	160.0	148.0	152.0		3668	5.9	1.0	16		152	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNAH3	NM_017539.1	145	0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging	1223/4117	21073855	2,13000	2201	4300	6501	SO:0001583	missense	0			-	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3668C>T	16.37:g.21073855G>A	ENSP00000261383:p.Ser1223Leu		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.S1223L	ENST00000261383.3	37	c.3668	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513196	0.85389	2.27E-4	1.16E-4	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.62498	0.02;0.02	5.9	5.9	0.94986	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	D	0.000002	T	0.80649	0.4663	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	T	0.80301	-0.1440	10	0.54805	T	0.06	.	20.2768	0.98488	0.0:0.0:1.0:0.0	.	1223	Q8TD57	DYH3_HUMAN	L	1223	ENSP00000261383:S1223L;ENSP00000394245:S1223L	ENSP00000261383:S1223L	S	-	2	0	DNAH3	20981356	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	6.207000	0.72159	2.797000	0.96272	0.655000	0.94253	TCG	-	DH3	-	pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase		0.428	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH3	HGNC	protein_coding	OTTHUMT00000207361.1	0	0	0	44	44	100	0.00	0.00	G	NM_017539		21073855	-1	29	58	3	8	tier1	no_errors	ENST00000261383	ensembl	human	known	74_37	missense	90.62	87.88	SNP	0.998	A	29	3
IRS4	8471	genome.wustl.edu	37	X	107979563	107979563	+	Silent	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chrX:107979563G>A	ENST00000372129.2	-	1	88	c.12C>T	c.(10-12)tgC>tgT	p.C4C	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	4					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GAGTGAAGGAGCAACTCGCCA	0.597													ENSG00000133124																																					0													36.0	36.0	36.0					X																	107979563		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.12C>T	X.37:g.107979563G>A				Silent	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.C4	ENST00000372129.2	37	c.12	CCDS14544.1	X																																																																																			-	IRS4	-	NULL		0.597	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	0	0	0	56	56	25	0.00	0.00	G	NM_003604		107979563	-1	19	21	14	2	tier1	no_errors	ENST00000372129	ensembl	human	known	74_37	silent	57.58	91.30	SNP	0.881	A	19	14
NXPE2	120406	genome.wustl.edu	37	11	114550437	114550437	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr11:114550437A>T	ENST00000389586.4	+	2	275	c.85A>T	c.(85-87)Atc>Ttc	p.I29F	NXPE2_ENST00000375475.5_Missense_Mutation_p.I29F	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	29						integral component of membrane (GO:0016021)											GTTGACATTTATCTTAATTTT	0.333													ENSG00000204361																																					0													186.0	144.0	157.0					11																	114550437		692	1590	2282	SO:0001583	missense	0			-	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.85A>T	11.37:g.114550437A>T	ENSP00000374237:p.Ile29Phe		Q2NKI8	Missense_Mutation	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.I29F	ENST00000389586.4	37	c.85	CCDS44738.1	11	.	.	.	.	.	.	.	.	.	.	A	13.32	2.202068	0.38905	.	.	ENSG00000204361	ENST00000389586;ENST00000375475;ENST00000505358	T;T	0.21191	2.56;2.02	4.1	-5.41	0.02648	.	1.197790	0.06241	N	0.690402	T	0.14442	0.0349	L	0.52573	1.65	0.09310	N	1	B	0.22276	0.067	B	0.12837	0.008	T	0.41233	-0.9520	10	0.72032	D	0.01	.	0.6038	0.00749	0.2442:0.1509:0.3095:0.2955	.	29	Q96DL1	FA55B_HUMAN	F	29	ENSP00000374237:I29F;ENSP00000364624:I29F	ENSP00000364624:I29F	I	+	1	0	FAM55B	114055647	0.000000	0.05858	0.000000	0.03702	0.333000	0.28666	-0.996000	0.03709	-0.725000	0.04901	0.397000	0.26171	ATC	-	NXPE2	-	NULL		0.333	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NXPE2	HGNC	protein_coding	OTTHUMT00000399181.1	0	0	0	60	60	82	0.00	0.00	A	NM_182495		114550437	+1	15	22	12	6	tier1	no_errors	ENST00000389586	ensembl	human	known	74_37	missense	55.56	78.57	SNP	0.000	T	15	12
OXR1	55074	genome.wustl.edu	37	8	107718618	107718618	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr8:107718618A>T	ENST00000442977.2	+	8	971	c.872A>T	c.(871-873)gAt>gTt	p.D291V	OXR1_ENST00000517566.2_Missense_Mutation_p.D290V|OXR1_ENST00000312046.6_Missense_Mutation_p.D283V|OXR1_ENST00000497705.1_Missense_Mutation_p.D223V|OXR1_ENST00000531443.1_Missense_Mutation_p.D290V|OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000445937.1_Missense_Mutation_p.D290V	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	291					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			AGAGATATAGATCAGCTATCA	0.328													ENSG00000164830																																					0													53.0	55.0	55.0					8																	107718618		2203	4298	6501	SO:0001583	missense	0			-	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.872A>T	8.37:g.107718618A>T	ENSP00000405424:p.Asp291Val		A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	pfam_TLDc,pfam_LysM_dom,pfam_GRAM,smart_LysM_dom,smart_TLDc	p.D291V	ENST00000442977.2	37	c.872	CCDS56548.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.45|16.45	3.125772|3.125772	0.56721|0.56721	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977;ENST00000497705;ENST00000312046|ENST00000519415	T;T;T;T;T;T|.	0.28666|.	2.49;2.49;2.48;2.48;1.6;2.45|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.479994|.	0.22344|.	N|.	0.061290|.	T|T	0.63803|0.63803	0.2542|0.2542	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	P;P;D;P|.	0.56521|.	0.817;0.868;0.976;0.817|.	P;B;P;P|.	0.54100|.	0.636;0.432;0.742;0.636|.	T|T	0.63161|0.63161	-0.6699|-0.6699	10|5	0.52906|.	T|.	0.07|.	-25.6691|-25.6691	10.9084|10.9084	0.47094|0.47094	0.9305:0.0:0.0695:0.0|0.9305:0.0:0.0695:0.0	.|.	283;291;223;290|.	Q8N573-2;Q8N573;Q8N573-3;Q8N573-5|.	.;OXR1_HUMAN;.;.|.	V|F	290;290;290;291;223;283|4	ENSP00000402918:D290V;ENSP00000431966:D290V;ENSP00000429205:D290V;ENSP00000405424:D291V;ENSP00000431014:D223V;ENSP00000311026:D283V|.	ENSP00000311026:D283V|.	D|I	+|+	2|1	0|0	OXR1|OXR1	107787794|107787794	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	5.908000|5.908000	0.69916|0.69916	2.333000|2.333000	0.79357|0.79357	0.482000|0.482000	0.46254|0.46254	GAT|ATC	-	OXR1	-	NULL		0.328	OXR1-201	KNOWN	basic|CCDS	protein_coding	OXR1	HGNC	protein_coding		0	0	0	28	28	47	0.00	0.00	A	NM_181354		107718618	+1	5	11	10	9	tier1	no_errors	ENST00000442977	ensembl	human	known	74_37	missense	33.33	55.00	SNP	1.000	T	5	10
P2RY4	5030	genome.wustl.edu	37	X	69479070	69479070	+	Silent	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chrX:69479070C>T	ENST00000374519.2	-	1	584	c.405G>A	c.(403-405)ctG>ctA	p.L135L		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	135					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						GGCAGATGCCCAGGTAGCGGT	0.602													ENSG00000186912																																					0													55.0	50.0	51.0					X																	69479070		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.405G>A	X.37:g.69479070C>T			Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y4_rcpt,prints_GPCR_Rhodpsn,prints_P2Y2_rcpt	p.L135	ENST00000374519.2	37	c.405	CCDS14398.1	X																																																																																			-	P2RY4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.602	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY4	HGNC	protein_coding	OTTHUMT00000057058.2	0	0	0	35	35	14	0.00	0.00	C	NM_002565		69479070	-1	12	4	18	7	tier1	no_errors	ENST00000374519	ensembl	human	known	74_37	silent	40.00	36.36	SNP	1.000	T	12	18
PASK	23178	genome.wustl.edu	37	2	242046865	242046865	+	Silent	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr2:242046865G>A	ENST00000405260.1	-	17	4415	c.3717C>T	c.(3715-3717)cgC>cgT	p.R1239R	PASK_ENST00000539818.1_Silent_p.R1023R|PASK_ENST00000475666.1_5'Flank|PASK_ENST00000358649.4_Silent_p.R1246R|PASK_ENST00000234040.4_Silent_p.R1239R|PASK_ENST00000544142.1_Silent_p.R1053R	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1239	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CCAAGGTGGTGCGTCTCTCAG	0.532													ENSG00000115687																																					0													156.0	148.0	151.0					2																	242046865		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3717C>T	2.37:g.242046865G>A			G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,superfamily_PAS,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_dom,tigrfam_PAS	p.R1246	ENST00000405260.1	37	c.3738	CCDS2545.1	2																																																																																			-	PASK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.532	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	0	0	0	83	83	64	0.00	0.00	G	NM_015148		242046865	-1	29	18	12	9	tier1	no_errors	ENST00000358649	ensembl	human	known	74_37	silent	70.73	66.67	SNP	0.995	A	29	12
MUC12	10071	genome.wustl.edu	37	7	100643281	100643281	+	Missense_Mutation	SNP	C	C	T	rs571550208		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr7:100643281C>T	ENST00000379442.3	+	5	9866	c.9866C>T	c.(9865-9867)aCa>aTa	p.T3289I	MUC12_ENST00000536621.1_Missense_Mutation_p.T3146I			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3289	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACGCACACAACAGCATTCCCT	0.587													ENSG00000205277																																					0													196.0	186.0	189.0					7																	100643281		692	1578	2270	SO:0001583	missense	0			-	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.9866C>T	7.37:g.100643281C>T	ENSP00000368755:p.Thr3289Ile		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.T3146I	ENST00000379442.3	37	c.9437		7	.	.	.	.	.	.	.	.	.	.	C	5.699	0.313578	0.10789	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11821	2.74;2.74	0.86	0.86	0.19042	.	.	.	.	.	T	0.06735	0.0172	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.36187	-0.9758	7	0.42905	T	0.14	.	5.0838	0.14671	0.0:1.0:0.0:0.0	.	.	.	.	I	3289;3146	ENSP00000368755:T3289I;ENSP00000441929:T3146I	ENSP00000368755:T3289I	T	+	2	0	MUC12	100430001	0.000000	0.05858	0.003000	0.11579	0.008000	0.06430	0.077000	0.14738	0.775000	0.33450	0.184000	0.17185	ACA	-	MUC12	-	NULL		0.587	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	0	0	0	222	222	143	0.00	0.00	C	XM_379904		100643281	+1	20	18	193	178	tier1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	9.39	9.18	SNP	0.003	T	20	193
DUPD1	338599	genome.wustl.edu	37	10	76797662	76797662	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr10:76797662G>A	ENST00000338487.5	-	3	594	c.595C>T	c.(595-597)Cag>Tag	p.Q199*		NM_001003892.1	NP_001003892.1	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase domain containing 1	199	Tyrosine-protein phosphatase.				protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(2)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TGCACCAGCTGCTTGTCCAGC	0.652													ENSG00000188716																																					0													60.0	60.0	60.0					10																	76797662		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS31223.1	10q22.3	2011-06-09			ENSG00000188716	ENSG00000188716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	23481	protein-coding gene	gene with protein product							Standard	NM_001003892		Approved	DUSP27	uc001jwq.1	Q68J44	OTTHUMG00000018512	ENST00000338487.5:c.595C>T	10.37:g.76797662G>A	ENSP00000340609:p.Gln199*		B2RP93	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP_famA,prints_Atypical_DUSP	p.Q199*	ENST00000338487.5	37	c.595	CCDS31223.1	10	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985259	0.53934	.	.	ENSG00000188716	ENST00000338487	.	.	.	4.97	4.06	0.47325	.	0.386495	0.29273	N	0.012634	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-24.9479	10.4934	0.44764	0.0:0.2824:0.5871:0.1305	.	.	.	.	X	199	.	ENSP00000340609:Q199X	Q	-	1	0	DUPD1	76467668	0.759000	0.28416	1.000000	0.80357	0.989000	0.77384	1.119000	0.31258	1.312000	0.45043	0.555000	0.69702	CAG	-	DUPD1	-	smart_Dual-sp_phosphatase_subgr_cat,pfscan_Dual-sp_phosphatase_subgr_cat		0.652	DUPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUPD1	HGNC	protein_coding	OTTHUMT00000048777.2	0	0	0	83	83	8	0.00	0.00	G	XM_291741		76797662	-1	10	1	24	0	tier1	no_errors	ENST00000338487	ensembl	human	known	74_37	nonsense	29.41	100.00	SNP	0.869	A	10	24
ITPRIPL2	162073	genome.wustl.edu	37	16	19126010	19126010	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr16:19126010C>A	ENST00000381440.3	+	1	757	c.227C>A	c.(226-228)cCc>cAc	p.P76H	CTD-2349B8.1_ENST00000564808.2_Silent_p.A57A	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	76						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						CGCTTCCTGCCCGGGTCTCCC	0.657													ENSG00000205730																																					0													20.0	21.0	20.0					16																	19126010		2197	4299	6496	SO:0001583	missense	0			-		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.227C>A	16.37:g.19126010C>A	ENSP00000370849:p.Pro76His			Missense_Mutation	SNP	NULL	p.P76H	ENST00000381440.3	37	c.227	CCDS32395.1	16	.	.	.	.	.	.	.	.	.	.	C	7.684	0.689723	0.14973	.	.	ENSG00000205730	ENST00000381440	T	0.15718	2.4	3.9	2.86	0.33363	.	0.160076	0.20589	U	0.089385	T	0.08537	0.0212	N	0.14661	0.345	0.18873	N	0.999986	P	0.39964	0.697	B	0.35353	0.201	T	0.19128	-1.0315	10	0.54805	T	0.06	-12.3666	7.6176	0.28167	0.0:0.7374:0.1669:0.0956	.	76	Q3MIP1	IPIL2_HUMAN	H	76	ENSP00000370849:P76H	ENSP00000370849:P76H	P	+	2	0	ITPRIPL2	19033511	0.906000	0.30813	0.741000	0.31004	0.202000	0.24057	1.660000	0.37397	1.896000	0.54893	0.467000	0.42956	CCC	-	ITPRIPL2	-	NULL		0.657	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPRIPL2	HGNC	protein_coding	OTTHUMT00000435827.3	0	0	0	15	15	6	0.00	0.00	C	NM_001034841		19126010	+1	6	0	10	3	tier1	no_errors	ENST00000381440	ensembl	human	known	74_37	missense	37.50	0.00	SNP	0.206	A	6	10
CCNA1	8900	genome.wustl.edu	37	13	37006164	37006164	+	5'Flank	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr13:37006164G>A	ENST00000255465.4	+	0	0				CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000449823.1_5'UTR|CCNA1_ENST00000418263.1_5'Flank|CCNA1_ENST00000440264.1_5'UTR			P78396	CCNA1_HUMAN	cyclin A1						G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		CGGACCAGAGGGGACGTGTGC	0.731													ENSG00000133101																																					0																																										SO:0001631	upstream_gene_variant	0			-	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733		13.37:g.37006164G>A	Exception_encountered		B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	R	SNP	-	NULL	ENST00000255465.4	37	NULL	CCDS9357.1	13																																																																																			-	CC1	-	-		0.731	CCNA1-001	KNOWN	basic|CCDS	protein_coding	CC1	HGNC	protein_coding	OTTHUMT00000044514.2	0	0	0	25	25	3	0.00	0.00	G	NM_003914		37006164	+1	7	0	6	1	tier1	no_errors	ENST00000463403	ensembl	human	known	74_37	rna	53.85	0.00	SNP	0.004	A	7	6
KLF13	51621	genome.wustl.edu	37	15	31664456	31664456	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr15:31664456G>A	ENST00000307145.3	+	2	1179	c.821G>A	c.(820-822)cGc>cAc	p.R274H	KLF13_ENST00000560473.1_Missense_Mutation_p.R86H	NM_015995.2	NP_057079.2	Q9Y2Y9	KLF13_HUMAN	Kruppel-like factor 13	274	Ser-rich.				negative regulation of cell proliferation (GO:0008285)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)	2		all_lung(180;3.71e-11)		all cancers(64;1.11e-18)|Epithelial(43;1.73e-14)|GBM - Glioblastoma multiforme(186;0.00016)|Colorectal(1;0.00158)|BRCA - Breast invasive adenocarcinoma(123;0.00255)|COAD - Colon adenocarcinoma(236;0.0446)|READ - Rectum adenocarcinoma(1;0.13)|Lung(196;0.171)		GACTACAGCCGCTCCGACGCC	0.731													ENSG00000169926																																					0													3.0	5.0	4.0					15																	31664456		1715	3530	5245	SO:0001583	missense	0			-	AF132599	CCDS10025.1	15q13.3	2013-01-08			ENSG00000169926	ENSG00000169926		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	13672	protein-coding gene	gene with protein product		605328				10415854, 10023774	Standard	NM_015995		Approved	RFLAT-1, BTEB3, NSLP1, FKLF-2	uc001zfo.3	Q9Y2Y9	OTTHUMG00000172224	ENST00000307145.3:c.821G>A	15.37:g.31664456G>A	ENSP00000302456:p.Arg274His		Q9Y356	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R274H	ENST00000307145.3	37	c.821	CCDS10025.1	15	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591859	0.86953	.	.	ENSG00000169926	ENST00000307145	T	0.11169	2.8	5.11	5.11	0.69529	.	0.000000	0.64402	U	0.000001	T	0.23727	0.0574	L	0.36672	1.1	0.46203	D	0.99892	D	0.89917	1.0	D	0.64410	0.925	T	0.00583	-1.1659	10	0.42905	T	0.14	.	18.9051	0.92456	0.0:0.0:1.0:0.0	.	274	Q9Y2Y9	KLF13_HUMAN	H	274	ENSP00000302456:R274H	ENSP00000302456:R274H	R	+	2	0	KLF13	29451748	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.051000	0.71072	2.543000	0.85770	0.655000	0.94253	CGC	-	KLF13	-	NULL		0.731	KLF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF13	HGNC	protein_coding	OTTHUMT00000251381.1	0	0	0	26	26	0	0.00	0.00	G	NM_015995		31664456	+1	6	0	5	2	tier1	no_errors	ENST00000307145	ensembl	human	known	74_37	missense	54.55	0.00	SNP	1.000	A	6	5
KRTAP4-8	728224	genome.wustl.edu	37	17	39254149	39254149	+	Missense_Mutation	SNP	G	G	C	rs201246375		TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr17:39254149G>C	ENST00000333822.4	-	1	244	c.188C>G	c.(187-189)aCc>aGc	p.T63S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	63	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						GCGACAGCAGGTGGGCTGGCA	0.652													ENSG00000204880																																					0													7.0	10.0	9.0					17																	39254149		651	1515	2166	SO:0001583	missense	0			-	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.188C>G	17.37:g.39254149G>C	ENSP00000328444:p.Thr63Ser		A8MSH3	Missense_Mutation	SNP	pfam_Keratin-assoc	p.T63S	ENST00000333822.4	37	c.188	CCDS45674.1	17	.	.	.	.	.	.	.	.	.	.	.	3.249	-0.153662	0.06585	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.01215	5.16	3.11	-1.04	0.10068	.	1.573260	0.03861	N	0.273912	T	0.00724	0.0024	N	0.10809	0.05	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.43637	-0.9379	10	0.05721	T	0.95	.	4.7356	0.12986	0.2319:0.434:0.3341:0.0	.	63	Q9BYQ9	KRA48_HUMAN	S	63	ENSP00000328444:T63S	ENSP00000414561:T63S	T	-	2	0	KRTAP4-8	36507675	0.000000	0.05858	0.109000	0.21407	0.234000	0.25298	-2.396000	0.01052	-0.528000	0.06366	0.449000	0.29647	ACC	rs201246375	KRTAP4-8	-	pfam_Keratin-assoc		0.652	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	KRTAP4-8	HGNC	protein_coding	OTTHUMT00000257684.1	0	0	0	109	109	3	0.00	0.00	G	NM_031960		39254149	-1	11	0	100	5	tier1	no_errors	ENST00000333822	ensembl	human	known	74_37	missense	9.91	0.00	SNP	0.004	C	11	100
PNLIPRP3	119548	genome.wustl.edu	37	10	118236296	118236296	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr10:118236296A>T	ENST00000369230.3	+	11	1451	c.1305A>T	c.(1303-1305)gaA>gaT	p.E435D		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	435	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		TGGGAGCAGAAATGGTGATAA	0.308													ENSG00000203837																																					0													93.0	98.0	96.0					10																	118236296		2203	4300	6503	SO:0001583	missense	0			-	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1305A>T	10.37:g.118236296A>T	ENSP00000358232:p.Glu435Asp			Missense_Mutation	SNP	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.E435D	ENST00000369230.3	37	c.1305	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204757	0.38905	.	.	ENSG00000203837	ENST00000369230	T	0.66280	-0.2	4.07	0.271	0.15640	Lipoxygenase, LH2 (2);Lipase/lipooxygenase, PLAT/LH2 (1);	0.954246	0.08564	N	0.927180	T	0.47655	0.1457	L	0.43923	1.385	0.21675	N	0.999599	B	0.19583	0.037	B	0.15870	0.014	T	0.40961	-0.9535	10	0.48119	T	0.1	.	1.6508	0.02771	0.552:0.177:0.1:0.1709	.	435	Q17RR3	LIPR3_HUMAN	D	435	ENSP00000358232:E435D	ENSP00000358232:E435D	E	+	3	2	PNLIPRP3	118226286	0.988000	0.35896	0.993000	0.49108	0.926000	0.56050	0.922000	0.28734	0.165000	0.19558	0.533000	0.62120	GAA	-	PNLIPRP3	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH		0.308	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	0	0	0	57	57	115	0.00	0.00	A	XM_058404		118236296	+1	6	2	58	116	tier1	no_errors	ENST00000369230	ensembl	human	known	74_37	missense	9.38	1.69	SNP	0.997	T	6	58
ZNF215	7762	genome.wustl.edu	37	11	6953570	6953570	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr11:6953570G>C	ENST00000278319.5	+	3	655	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000529903.1_Missense_Mutation_p.E23Q|ZNF215_ENST00000414517.2_Missense_Mutation_p.E23Q	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	23					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		TGAACAAAGAGAGGTTCTGAG	0.463													ENSG00000149054																																					0													88.0	91.0	90.0					11																	6953570		2201	4296	6497	SO:0001583	missense	0			-	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.67G>C	11.37:g.6953570G>C	ENSP00000278319:p.Glu23Gln		Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E23Q	ENST00000278319.5	37	c.67	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	G	11.56	1.675414	0.29783	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.05855	3.38;3.38;5.92	4.15	3.24	0.37175	.	0.200899	0.24604	N	0.037115	T	0.06188	0.0160	L	0.29908	0.895	0.22317	N	0.999203	P;B;B	0.45348	0.856;0.025;0.141	B;B;B	0.43623	0.425;0.021;0.033	T	0.30880	-0.9963	10	0.37606	T	0.19	-9.0217	10.2497	0.43362	0.0:0.2008:0.7992:0.0	.	23;23;23	B4DYW9;Q96C84;Q9UL58	.;.;ZN215_HUMAN	Q	23	ENSP00000278319:E23Q;ENSP00000393202:E23Q;ENSP00000432306:E23Q	ENSP00000278319:E23Q	E	+	1	0	ZNF215	6910146	0.956000	0.32656	0.915000	0.36163	0.002000	0.02628	0.616000	0.24344	1.330000	0.45394	-0.121000	0.15023	GAG	-	ZNF215	-	NULL		0.463	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	0	0	0	33	33	70	0.00	0.00	G			6953570	+1	4	3	29	80	tier1	no_errors	ENST00000278319	ensembl	human	known	74_37	missense	12.12	3.61	SNP	0.946	C	4	29
NXPE4	54827	genome.wustl.edu	37	11	114453019	114453019	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr11:114453019A>G	ENST00000375478.3	-	3	1001	c.821T>C	c.(820-822)cTc>cCc	p.L274P	NXPE4_ENST00000424261.2_Intron	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	274						extracellular vesicular exosome (GO:0070062)											CCTTTCAAAGAGGCTCTTTTC	0.363													ENSG00000137634																																					0													75.0	71.0	72.0					11																	114453019		1857	4102	5959	SO:0001583	missense	0			-	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.821T>C	11.37:g.114453019A>G	ENSP00000364627:p.Leu274Pro		Q6QDB4|Q9NXP5	Missense_Mutation	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.L274P	ENST00000375478.3	37	c.821	CCDS41718.1	11	.	.	.	.	.	.	.	.	.	.	A	19.59	3.857096	0.71834	.	.	ENSG00000137634	ENST00000375478	T	0.17854	2.25	5.25	5.25	0.73442	.	0.285942	0.26220	N	0.025640	T	0.43656	0.1257	M	0.81497	2.545	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.39840	-0.9594	10	0.51188	T	0.08	.	13.4358	0.61084	1.0:0.0:0.0:0.0	.	274	Q6UWF7	FA55D_HUMAN	P	274	ENSP00000364627:L274P	ENSP00000364627:L274P	L	-	2	0	FAM55D	113958229	1.000000	0.71417	0.884000	0.34674	0.985000	0.73830	6.208000	0.72165	2.105000	0.64084	0.533000	0.62120	CTC	-	NXPE4	-	NULL		0.363	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NXPE4	HGNC	protein_coding	OTTHUMT00000399179.1	0	0	0	109	109	68	0.00	0.00	A	NM_017678		114453019	-1	4	2	44	35	tier1	no_errors	ENST00000375478	ensembl	human	known	74_37	missense	8.33	5.41	SNP	0.994	G	4	44
ATOH1	474	genome.wustl.edu	37	4	94750585	94750585	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L0-01A-11D-A24N-09	TCGA-DX-A1L0-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	1c188bf5-2c99-4eb4-a774-59c75d53e643	e64c9084-028a-460d-8ebc-5587c4601ea8	g.chr4:94750585C>T	ENST00000306011.3	+	1	544	c.508C>T	c.(508-510)Cgc>Tgc	p.R170C		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	170	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		CAGGGAGCGGCGCAGGATGCA	0.597													ENSG00000172238																																					0													48.0	49.0	48.0					4																	94750585		2203	4300	6503	SO:0001583	missense	0			-	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.508C>T	4.37:g.94750585C>T	ENSP00000302216:p.Arg170Cys		Q14CT9	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R170C	ENST00000306011.3	37	c.508	CCDS3638.1	4	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137497	0.37728	.	.	ENSG00000172238	ENST00000306011	D	0.98493	-4.96	4.41	3.48	0.39840	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98083	0.9368	M	0.85197	2.74	0.58432	D	0.999999	D	0.55800	0.973	P	0.54060	0.741	D	0.97700	1.0184	10	0.87932	D	0	-16.0569	6.9789	0.24692	0.2652:0.6404:0.0:0.0944	.	170	Q92858	ATOH1_HUMAN	C	170	ENSP00000302216:R170C	ENSP00000302216:R170C	R	+	1	0	ATOH1	94969608	0.957000	0.32711	1.000000	0.80357	0.998000	0.95712	0.860000	0.27871	2.291000	0.77112	0.549000	0.68633	CGC	-	ATOH1	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom		0.597	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH1	HGNC	protein_coding	OTTHUMT00000253585.1	0	0	0	85	85	31	0.00	0.00	C	NM_005172		94750585	+1	11	2	52	26	tier1	no_errors	ENST00000306011	ensembl	human	known	74_37	missense	17.46	7.14	SNP	1.000	T	11	52
