#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
DNHD1	144132	genome.wustl.edu	37	11	6579248	6579248	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr11:6579248G>T	ENST00000527990.2	+	23	8723	c.8723G>T	c.(8722-8724)tGt>tTt	p.C2908F	DNHD1_ENST00000254579.6_Missense_Mutation_p.C2908F			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2908					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCTAGCATTTGTCAGGCCCAT	0.602													ENSG00000179532																																					0													65.0	52.0	56.0					11																	6579248		692	1591	2283	SO:0001583	missense	0			-	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.8723G>T	11.37:g.6579248G>T	ENSP00000436180:p.Cys2908Phe		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SRE	p.C2908F	ENST00000527990.2	37	c.8723	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	G	3.616	-0.078612	0.07141	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000534210	T;T	0.28255	1.62;1.62	5.6	2.65	0.31530	.	.	.	.	.	T	0.18882	0.0453	N	0.08118	0	0.28373	N	0.919926	P;P	0.45078	0.638;0.85	B;P	0.45276	0.078;0.475	T	0.07233	-1.0783	9	0.56958	D	0.05	.	7.6306	0.28236	0.1562:0.1348:0.709:0.0	.	2908;655	Q96M86;E9PHZ7	DNHD1_HUMAN;.	F	2908;2908;655	ENSP00000254579:C2908F;ENSP00000436180:C2908F	ENSP00000254579:C2908F	C	+	2	0	DNHD1	6535824	0.003000	0.15002	0.977000	0.42913	0.041000	0.13682	0.217000	0.17603	0.281000	0.22233	-0.142000	0.14014	TGT	-	DNHD1	-	superfamily_P-loop_NTPase		0.602	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	0	0	0	47	47	53	0.00	0.00	G	NM_144666		6579248	+1	17	6	39	28	tier1	no_errors	ENST00000254579	ensembl	human	known	74_37	missense	30.36	17.65	SNP	0.706	T	17	39
DNAJB9	4189	genome.wustl.edu	37	7	108213494	108213494	+	Silent	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:108213494C>A	ENST00000249356.3	+	3	915	c.369C>A	c.(367-369)ggC>ggA	p.G123G	DNAJB9_ENST00000465725.1_Intron	NM_012328.2	NP_036460.1	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9	123					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	misfolded protein binding (GO:0051787)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13						AAGACTTTGGCTTTTTTGGTC	0.388													ENSG00000128590																																					0													93.0	89.0	91.0					7																	108213494		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB026908	CCDS5752.1	7q31	2011-09-02			ENSG00000128590	ENSG00000128590		"""Heat shock proteins / DNAJ (HSP40)"""	6968	protein-coding gene	gene with protein product		602634		MDG1		9533036, 11147971	Standard	NM_012328		Approved		uc003vfn.3	Q9UBS3	OTTHUMG00000154866	ENST00000249356.3:c.369C>A	7.37:g.108213494C>A				Silent	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.G123	ENST00000249356.3	37	c.369	CCDS5752.1	7																																																																																			-	DJB9	-	NULL		0.388	DNAJB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DJB9	HGNC	protein_coding	OTTHUMT00000337414.1	0	0	0	27	27	102	0.00	0.00	C			108213494	+1	9	16	56	121	tier1	no_errors	ENST00000249356	ensembl	human	known	74_37	silent	13.85	11.68	SNP	0.993	A	9	56
CFTR	1080	genome.wustl.edu	37	7	117175332	117175332	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:117175332G>A	ENST00000003084.6	+	6	742	c.610G>A	c.(610-612)Gct>Act	p.A204T	CFTR_ENST00000454343.1_Missense_Mutation_p.A204T	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	204	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	CGTGTGGATCGCTCCTTTGCA	0.458									Cystic Fibrosis				ENSG00000001626																																					0													225.0	203.0	210.0					7																	117175332		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CF	-	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.610G>A	7.37:g.117175332G>A	ENSP00000003084:p.Ala204Thr		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.A204T	ENST00000003084.6	37	c.610	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	G	10.21	1.288342	0.23478	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.89270	-2.49;-2.49;-2.49	5.52	4.63	0.57726	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.206667	0.51477	D	0.000095	D	0.83839	0.5341	L	0.31752	0.955	0.27189	N	0.960463	B	0.21905	0.062	B	0.24155	0.051	T	0.74711	-0.3573	10	0.44086	T	0.13	-2.9439	15.8537	0.78956	0.0:0.0:0.8636:0.1364	.	204	P13569	CFTR_HUMAN	T	204;204;174	ENSP00000003084:A204T;ENSP00000403677:A204T;ENSP00000389119:A174T	ENSP00000003084:A204T	A	+	1	0	CFTR	116962568	1.000000	0.71417	0.614000	0.29051	0.030000	0.12068	4.798000	0.62510	1.307000	0.44944	0.650000	0.86243	GCT	-	CFTR	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel		0.458	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	0	0	0	115	115	68	0.00	0.00	G	NM_000492		117175332	+1	13	14	47	91	tier1	no_errors	ENST00000003084	ensembl	human	known	74_37	missense	21.67	13.33	SNP	0.969	A	13	47
IRF8	3394	genome.wustl.edu	37	16	85946797	85946797	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr16:85946797C>T	ENST00000268638.5	+	5	930	c.508C>T	c.(508-510)Cgg>Tgg	p.R170W	IRF8_ENST00000562492.1_5'Flank	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	170					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				GGAGGCCTGTCGGAGTCAGCT	0.617													ENSG00000140968																																					0													93.0	99.0	97.0					16																	85946797		2198	4300	6498	SO:0001583	missense	0			-	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.508C>T	16.37:g.85946797C>T	ENSP00000268638:p.Arg170Trp		A0AV82	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_D-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_D-bd_dom,prints_Interferon_reg_fact_D-bd_dom	p.R170W	ENST00000268638.5	37	c.508	CCDS10956.1	16	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740702	0.69304	.	.	ENSG00000140968	ENST00000268638	D	0.97041	-4.22	4.86	-0.244	0.13031	.	0.454767	0.24147	N	0.041114	D	0.94584	0.8255	L	0.55481	1.735	0.80722	D	1	B	0.26577	0.153	B	0.23275	0.045	D	0.87374	0.2352	10	0.33940	T	0.23	-35.7004	16.2275	0.82311	0.3233:0.6767:0.0:0.0	.	170	Q02556	IRF8_HUMAN	W	170	ENSP00000268638:R170W	ENSP00000268638:R170W	R	+	1	2	IRF8	84504298	0.911000	0.30947	0.966000	0.40874	0.984000	0.73092	0.094000	0.15107	-0.250000	0.09555	0.561000	0.74099	CGG	-	IRF8	-	NULL		0.617	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF8	HGNC	protein_coding	OTTHUMT00000269100.2	0	0	0	27	27	39	0.00	0.00	C	NM_002163		85946797	+1	5	6	32	34	tier1	no_errors	ENST00000268638	ensembl	human	known	74_37	missense	13.51	15.00	SNP	0.997	T	5	32
KCNC3	3748	genome.wustl.edu	37	19	50823861	50823861	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr19:50823861G>T	ENST00000477616.1	-	3	2453	c.2159C>A	c.(2158-2160)tCc>tAc	p.S720Y	KCNC3_ENST00000391818.2_Missense_Mutation_p.P57T|KCNC3_ENST00000376959.2_Missense_Mutation_p.S720Y|KCNC3_ENST00000474951.1_Missense_Mutation_p.S36Y	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	720					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	TTTTCGGATGGAGCCATCAGG	0.672													ENSG00000131398																									Melanoma(91;1496 2324 50908)												0													31.0	28.0	29.0					19																	50823861		2203	4299	6502	SO:0001583	missense	0			-	AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.2159C>A	19.37:g.50823861G>T	ENSP00000434241:p.Ser720Tyr			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_K_chnl_volt-dep_Kv3_ID,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3.3,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.S720Y	ENST00000477616.1	37	c.2159	CCDS12793.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.24|14.24	2.475346|2.475346	0.43942|0.43942	.|.	.|.	ENSG00000131398|ENSG00000131398	ENST00000391818|ENST00000376959;ENST00000474951;ENST00000477616;ENST00000443843	.|D;D	.|0.98135	.|-4.74;-4.74	2.72|2.72	2.72|2.72	0.32119|0.32119	.|.	.|0.882556	.|0.09294	.|U	.|0.821979	D|D	0.93207|0.93207	0.7836|0.7836	N|N	0.19112|0.19112	0.55|0.55	0.24779|0.24779	N|N	0.992826|0.992826	.|P;P	.|0.52316	.|0.952;0.704	.|B;B	.|0.39531	.|0.302;0.046	D|D	0.88308|0.88308	0.2954|0.2954	6|10	0.87932|0.72032	D|D	0|0.01	.|.	7.6948|7.6948	0.28587|0.28587	0.0:0.2636:0.7364:0.0|0.0:0.2636:0.7364:0.0	.|.	.|720;720	.|Q14003;E7ETH1	.|KCNC3_HUMAN;.	T|Y	57|720;36;720;534	.|ENSP00000366158:S720Y;ENSP00000434241:S720Y	ENSP00000375694:P57T|ENSP00000366158:S720Y	P|S	-|-	1|2	0|0	KCNC3|KCNC3	55515673|55515673	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	2.200000|2.200000	0.42724|0.42724	1.540000|1.540000	0.49301|0.49301	0.460000|0.460000	0.39030|0.39030	CCA|TCC	-	KCNC3	-	NULL		0.672	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNC3	HGNC	protein_coding	OTTHUMT00000314288.2	0	0	0	115	115	32	0.00	0.00	G	NM_004977		50823861	-1	24	5	182	23	tier1	no_errors	ENST00000477616	ensembl	human	known	74_37	missense	11.65	17.86	SNP	1.000	T	24	182
HRH2	3274	genome.wustl.edu	37	5	175112423	175112423	+	IGR	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr5:175112423G>T	ENST00000231683.2	+	0	3095				HRH2_ENST00000377291.2_Missense_Mutation_p.C363F	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2						digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	CCATGGCTTTGCCTTCCAGAA	0.423													ENSG00000113749																																					0													146.0	123.0	130.0					5																	175112423		692	1591	2283	SO:0001628	intergenic_variant	0			-		CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660		5.37:g.175112423G>T			B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Histamine_H2_rcpt,prints_GPCR_Rhodpsn,prints_5HT6_rcpt	p.C363F	ENST00000231683.2	37	c.1088	CCDS4395.1	5	.	.	.	.	.	.	.	.	.	.	G	5.389	0.256967	0.10239	.	.	ENSG00000113749	ENST00000377291	T	0.64260	-0.09	2.77	0.909	0.19332	.	.	.	.	.	T	0.46502	0.1396	.	.	.	0.09310	N	1	B	0.16166	0.016	B	0.16289	0.015	T	0.39035	-0.9633	8	0.56958	D	0.05	.	5.1863	0.15185	0.2906:0.0:0.7094:0.0	.	363	Q7Z5R9	.	F	363	ENSP00000366506:C363F	ENSP00000366506:C363F	C	+	2	0	HRH2	175045029	0.006000	0.16342	0.009000	0.14445	0.636000	0.38137	0.612000	0.24283	0.223000	0.20920	0.491000	0.48974	TGC	-	HRH2	-	NULL		0.423	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH2	HGNC	protein_coding	OTTHUMT00000253151.1	0	0	0	25	25	66	0.00	0.00	G			175112423	+1	9	15	45	70	tier1	no_errors	ENST00000377291	ensembl	human	known	74_37	missense	16.67	17.65	SNP	0.009	T	9	45
DNAH11	8701	genome.wustl.edu	37	7	21788256	21788256	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:21788256G>T	ENST00000409508.3	+	52	8600	c.8569G>T	c.(8569-8571)Ggg>Tgg	p.G2857W	DNAH11_ENST00000328843.6_Missense_Mutation_p.G2864W	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2864	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GGTTGGAGTTGGGGGCAGTGG	0.547									Kartagener syndrome				ENSG00000105877																																					0													69.0	72.0	71.0					7																	21788256		1976	4156	6132	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8569G>T	7.37:g.21788256G>T	ENSP00000475939:p.Gly2857Trp		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G2864W	ENST00000409508.3	37	c.8590		7	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803399	0.70682	.	.	ENSG00000105877	ENST00000328843	T	0.40476	1.03	5.95	5.07	0.68467	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.044949	0.85682	D	0.000000	T	0.66645	0.2810	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72347	-0.4321	9	0.87932	D	0	.	14.8948	0.70636	0.0683:0.0:0.9317:0.0	.	2864	Q96DT5	DYH11_HUMAN	W	2864	ENSP00000330671:G2864W	ENSP00000330671:G2864W	G	+	1	0	DNAH11	21754781	1.000000	0.71417	0.882000	0.34594	0.470000	0.32858	9.716000	0.98752	1.516000	0.48900	0.650000	0.86243	GGG	-	DH11	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.547	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DH11	HGNC	protein_coding	OTTHUMT00000326582.6	0	0	0	41	41	76	0.00	0.00	G	NM_003777		21788256	+1	10	17	21	50	tier1	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	32.26	25.37	SNP	0.999	T	10	21
SDK2	54549	genome.wustl.edu	37	17	71443849	71443849	+	Missense_Mutation	SNP	G	G	A	rs370909712		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr17:71443849G>A	ENST00000392650.3	-	5	518	c.518C>T	c.(517-519)aCg>aTg	p.T173M	SDK2_ENST00000388726.3_Missense_Mutation_p.T173M	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	173	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						AGGGGCCACCGTTGACAGGAT	0.567													ENSG00000069188																																					0								G	MET/THR	1,1383		0,1,691	137.0	112.0	119.0		518	4.8	0.2	17		119	0,3182		0,0,1591	no	missense	SDK2	NM_001144952.1	81	0,1,2282	AA,AG,GG		0.0,0.0723,0.0219	possibly-damaging	173/2173	71443849	1,4565	692	1591	2283	SO:0001583	missense	0			-	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.518C>T	17.37:g.71443849G>A	ENSP00000376421:p.Thr173Met		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T173M	ENST00000392650.3	37	c.518	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902667	0.33628	7.23E-4	0.0	ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.66995	-0.24;-0.24	4.8	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.083553	0.47093	U	0.000259	T	0.67896	0.2942	M	0.83384	2.64	0.19775	N	0.999958	P	0.48230	0.907	B	0.39617	0.305	T	0.70223	-0.4931	10	0.87932	D	0	.	13.2406	0.59995	0.0:0.1597:0.8402:0.0	.	173	Q58EX2	SDK2_HUMAN	M	173	ENSP00000376421:T173M;ENSP00000373378:T173M	ENSP00000324967:T173M	T	-	2	0	SDK2	68955444	1.000000	0.71417	0.186000	0.23195	0.693000	0.40251	4.222000	0.58580	2.220000	0.72140	0.313000	0.20887	ACG	-	SDK2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.567	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	0	0	0	61	61	83	0.00	0.00	G	NM_019064		71443849	-1	26	24	60	55	tier1	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	30.23	30.38	SNP	0.193	A	26	60
DGKG	1608	genome.wustl.edu	37	3	185979537	185979537	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr3:185979537G>T	ENST00000265022.3	-	15	1839	c.1300C>A	c.(1300-1302)Ccc>Acc	p.P434T	DGKG_ENST00000382164.4_Missense_Mutation_p.P395T|DGKG_ENST00000544847.1_Missense_Mutation_p.P375T|DGKG_ENST00000344484.4_Missense_Mutation_p.P434T	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	434	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	ACCAGCAGGGGGTGGGTACCC	0.502													ENSG00000058866																																					0													24.0	22.0	22.0					3																	185979537		2203	4300	6503	SO:0001583	missense	0			-	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1300C>A	3.37:g.185979537G>T	ENSP00000265022:p.Pro434Thr		B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.P434T	ENST00000265022.3	37	c.1300	CCDS3274.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.089601	0.94149	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	T;T;T;T	0.44881	0.92;0.91;0.92;0.92	5.52	5.52	0.82312	Diacylglycerol kinase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.78149	0.4238	H	0.97291	3.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86117	0.1566	10	0.87932	D	0	.	18.2113	0.89871	0.0:0.0:1.0:0.0	.	375;434;395;434	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	T	434;434;395;375;398	ENSP00000265022:P434T;ENSP00000339777:P434T;ENSP00000371599:P395T;ENSP00000440507:P375T	ENSP00000265022:P434T	P	-	1	0	DGKG	187462231	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.706000	0.98722	2.590000	0.87494	0.563000	0.77884	CCC	-	DGKG	-	smart_Diacylglycerol_kinase_cat_dom		0.502	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	HGNC	protein_coding	OTTHUMT00000344800.3	0	0	0	18	18	39	0.00	0.00	G			185979537	-1	7	10	32	30	tier1	no_errors	ENST00000265022	ensembl	human	known	74_37	missense	17.95	25.00	SNP	1.000	T	7	32
CCDC173	129881	genome.wustl.edu	37	2	170502675	170502675	+	Missense_Mutation	SNP	A	A	C	rs530914711	byFrequency	TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr2:170502675A>C	ENST00000447353.1	-	9	1440	c.1335T>G	c.(1333-1335)aaT>aaG	p.N445K		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	445																	CTTGCTTTGCATTAAACTTAT	0.323													ENSG00000154479																																					0													183.0	179.0	180.0					2																	170502675		1819	4075	5894	SO:0001583	missense	0			-	BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1335T>G	2.37:g.170502675A>C	ENSP00000391504:p.Asn445Lys		Q6PJF6	Missense_Mutation	SNP	NULL	p.N445K	ENST00000447353.1	37	c.1335	CCDS46445.1	2	.	.	.	.	.	.	.	.	.	.	A	0.246	-1.010242	0.02095	.	.	ENSG00000154479	ENST00000447353	T	0.07688	3.17	5.72	0.103	0.14526	.	.	.	.	.	T	0.03608	0.0103	N	0.21194	0.64	0.09310	N	1	B	0.09022	0.002	B	0.14578	0.011	T	0.45160	-0.9280	9	0.05833	T	0.94	.	0.3693	0.00376	0.3239:0.212:0.1401:0.324	.	445	Q0VFZ6	CB077_HUMAN	K	445	ENSP00000391504:N445K	ENSP00000391504:N445K	N	-	3	2	C2orf77	170210921	0.009000	0.17119	0.590000	0.28732	0.909000	0.53808	0.024000	0.13555	-0.146000	0.11274	-0.250000	0.11733	AAT	-	CCDC173	-	NULL		0.323	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC173	HGNC	protein_coding	OTTHUMT00000333954.2	0	0	0	79	79	91	0.00	0.00	A	NM_001085447		170502675	-1	18	14	44	66	tier1	no_errors	ENST00000447353	ensembl	human	known	74_37	missense	29.03	17.50	SNP	0.084	C	18	44
ZNF831	128611	genome.wustl.edu	37	20	57766916	57766916	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr20:57766916A>T	ENST00000371030.2	+	1	842	c.842A>T	c.(841-843)gAc>gTc	p.D281V		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	281							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCTCCTTGGGACTCTGCCCCC	0.667													ENSG00000124203																																					0													51.0	59.0	56.0					20																	57766916		2023	4181	6204	SO:0001583	missense	0			-	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.842A>T	20.37:g.57766916A>T	ENSP00000360069:p.Asp281Val		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D281V	ENST00000371030.2	37	c.842	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	A	7.926	0.739660	0.15642	.	.	ENSG00000124203	ENST00000371030	T	0.04809	3.55	5.12	2.82	0.32997	.	.	.	.	.	T	0.07683	0.0193	L	0.51422	1.61	0.09310	N	0.999995	D	0.56035	0.974	P	0.48982	0.597	T	0.29488	-1.0010	9	0.52906	T	0.07	-8.1128	5.049	0.14499	0.6687:0.1568:0.1745:0.0	.	281	Q5JPB2	ZN831_HUMAN	V	281	ENSP00000360069:D281V	ENSP00000360069:D281V	D	+	2	0	ZNF831	57200311	0.000000	0.05858	0.045000	0.18777	0.027000	0.11550	-0.056000	0.11787	0.282000	0.22254	0.533000	0.62120	GAC	-	ZNF831	-	NULL		0.667	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	0	0	0	93	93	29	0.00	0.00	A	NM_178457		57766916	+1	62	20	108	32	tier1	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	36.47	38.46	SNP	0.000	T	62	108
REXO4	57109	genome.wustl.edu	37	9	136272155	136272155	+	Silent	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr9:136272155C>T	ENST00000371942.3	-	8	1390	c.1191G>A	c.(1189-1191)gtG>gtA	p.V397V	REXO4_ENST00000371935.2_Silent_p.V225V	NM_020385.2	NP_065118.2	Q9GZR2	REXO4_HUMAN	REX4, RNA exonuclease 4 homolog (S. cerevisiae)	397					regulation of transcription, DNA-templated (GO:0006355)	nucleolus (GO:0005730)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	15				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		ACTCCTTCTTCACCATGACGT	0.607											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000148300																																					0													168.0	127.0	141.0					9																	136272155		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF273304	CCDS6969.1, CCDS65179.1	9q34	2008-02-05	2005-08-22	2005-08-22	ENSG00000148300	ENSG00000148300			12820	protein-coding gene	gene with protein product		602930	"""Xenopus prevents mitotic catatrophe 2 homolog"", ""XPMC2 prevents mitotic catastrophe 2 homolog (Xenopus laevis)"""	XPMC2H		9325058	Standard	NM_020385		Approved		uc004cdm.3	Q9GZR2	OTTHUMG00000020870	ENST00000371942.3:c.1191G>A	9.37:g.136272155C>T		1624	B2RAT2|Q5T8S4|Q5T8S5|Q5T8S6|Q9GZW3	Silent	SNP	pfam_Exonuclease_RNaseT/D_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.V397	ENST00000371942.3	37	c.1191	CCDS6969.1	9	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255185	0.39896	.	.	ENSG00000148300	ENST00000453165	T	0.21932	1.98	5.45	1.2	0.21068	.	.	.	.	.	T	0.25344	0.0616	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.07712	-1.0758	6	0.87932	D	0	.	3.1641	0.06530	0.1419:0.5673:0.1373:0.1535	.	.	.	.	K	353	ENSP00000403272:E353K	ENSP00000403272:E353K	E	-	1	0	REXO4	135261976	0.994000	0.37717	0.975000	0.42487	0.764000	0.43329	0.353000	0.20130	0.231000	0.21079	0.561000	0.74099	GAA	-	REXO4	-	superfamily_RNaseH-like_dom,smart_Exonuclease		0.607	REXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO4	HGNC	protein_coding	OTTHUMT00000054899.1	0	0	0	51	51	28	0.00	0.00	C			136272155	-1	71	40	53	27	tier1	no_errors	ENST00000371942	ensembl	human	known	74_37	silent	57.26	59.70	SNP	1.000	T	71	53
PAX4	5078	genome.wustl.edu	37	7	127253883	127253883	+	Silent	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:127253883C>A	ENST00000341640.2	-	4	670	c.465G>T	c.(463-465)cgG>cgT	p.R155R	PAX4_ENST00000338516.3_Silent_p.R163R|PAX4_ENST00000378740.2_Silent_p.R155R|PAX4_ENST00000463946.1_Silent_p.R153R	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	163					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GGTGGGTACCCCGGGGAGTCT	0.572													ENSG00000106331																									Ovarian(113;737 1605 7858 27720 34092)												0													71.0	68.0	69.0					7																	127253883		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.465G>T	7.37:g.127253883C>A			O95161|Q6B0H0	Silent	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.R155	ENST00000341640.2	37	c.465	CCDS5797.1	7																																																																																			-	PAX4	-	superfamily_Homeodomain-like		0.572	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1	0	0	0	53	53	78	0.00	0.00	C			127253883	-1	19	25	78	74	tier1	no_errors	ENST00000341640	ensembl	human	known	74_37	silent	19.59	25.25	SNP	0.998	A	19	78
RER1	11079	genome.wustl.edu	37	1	2332374	2332374	+	Splice_Site	SNP	G	G	C			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr1:2332374G>C	ENST00000605895.1	+	5	498	c.365G>C	c.(364-366)tGg>tCg	p.W122S	RER1_ENST00000378513.3_Splice_Site_p.G89R|RER1_ENST00000378512.1_Splice_Site_p.W122S|RER1_ENST00000378518.1_Splice_Site_p.G89R|RER1_ENST00000488353.1_Splice_Site_p.W122S	NM_007033.4	NP_008964.3	O15258	RER1_HUMAN	retention in endoplasmic reticulum sorting receptor 1	122					positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)	cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)				endometrium(3)|kidney(1)	4	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.28e-37)|OV - Ovarian serous cystadenocarcinoma(86;8.29e-23)|GBM - Glioblastoma multiforme(42;4.71e-08)|Colorectal(212;4.73e-05)|COAD - Colon adenocarcinoma(227;0.00021)|Kidney(185;0.00116)|BRCA - Breast invasive adenocarcinoma(365;0.00459)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0182)|Lung(427;0.204)		TTTAAATTTTGGTGAGCTAAT	0.463													ENSG00000157916																																					0													89.0	89.0	89.0					1																	2332374		1859	4094	5953	SO:0001630	splice_region_variant	0			-	AF157324	CCDS41232.1	1p36	2013-10-18	2013-10-18		ENSG00000157916	ENSG00000157916			30309	protein-coding gene	gene with protein product			"""RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)"""			9309388, 17668005	Standard	NM_007033		Approved		uc001aje.2	O15258	OTTHUMG00000001403	ENST00000605895.1:c.365+1G>C	1.37:g.2332374G>C			O95322	Missense_Mutation	SNP	pfam_Rer1,pirsf_Rer1	p.W122S	ENST00000605895.1	37	c.365	CCDS41232.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.188387|4.188387	0.78789|0.78789	.|.	.|.	ENSG00000157916|ENSG00000157916	ENST00000378518;ENST00000378513|ENST00000306256;ENST00000434662;ENST00000378512;ENST00000443438	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.000000	.|0.40554	.|U	.|0.001072	D|D	0.90373|0.90373	0.6987|0.6987	H|H	0.97758|0.97758	4.07|4.07	0.42761|0.42761	D|D	0.993802|0.993802	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.93521|0.93521	0.6861|0.6861	6|9	0.35671|0.87932	T|D	0.21|0	.|.	18.7848|18.7848	0.91949|0.91949	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|122;122	.|Q5T091;O15258	.|.;RER1_HUMAN	R|S	89|122	.|.	ENSP00000367774:G89R|ENSP00000302088:W122S	G|W	+|+	1|2	0|0	RER1|RER1	2322234|2322234	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	8.832000|8.832000	0.92079|0.92079	2.670000|2.670000	0.90874|0.90874	0.655000|0.655000	0.94253|0.94253	GGC|TGG	-	RER1	-	pfam_Rer1,pirsf_Rer1		0.463	RER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RER1	HGNC	protein_coding	OTTHUMT00000004061.2	0	0	0	59	59	123	0.00	0.00	G		Missense_Mutation	2332374	+1	35	29	47	56	tier1	no_errors	ENST00000488353	ensembl	human	known	74_37	missense	42.17	34.12	SNP	1.000	C	35	47
C5orf42	65250	genome.wustl.edu	37	5	37227105	37227105	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr5:37227105C>G	ENST00000508244.1	-	11	1685	c.1592G>C	c.(1591-1593)aGa>aCa	p.R531T	C5orf42_ENST00000274258.7_5'UTR|C5orf42_ENST00000425232.2_Missense_Mutation_p.R531T			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	531						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CACATCATCTCTTTTGTTCCA	0.368													ENSG00000197603																																					0													27.0	20.0	22.0					5																	37227105		691	1590	2281	SO:0001583	missense	0			-		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.1592G>C	5.37:g.37227105C>G	ENSP00000421690:p.Arg531Thr		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.R531T	ENST00000508244.1	37	c.1592	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	3.687	-0.064334	0.07273	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.23147	1.92;1.92	4.63	2.16	0.27623	.	0.385392	0.24209	U	0.040543	T	0.12860	0.0312	N	0.14661	0.345	0.09310	N	0.999996	B	0.32160	0.358	B	0.29716	0.106	T	0.15263	-1.0443	10	0.54805	T	0.06	.	6.5825	0.22602	0.0:0.397:0.0:0.603	.	531	E9PH94	.	T	531	ENSP00000421690:R531T;ENSP00000389014:R531T	ENSP00000389014:R531T	R	-	2	0	C5orf42	37262862	0.355000	0.24921	0.000000	0.03702	0.579000	0.36224	1.221000	0.32503	0.160000	0.19432	0.313000	0.20887	AGA	-	C5orf42	-	NULL		0.368	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	0	0	0	30	30	66	0.00	0.00	C	NM_023073		37227105	-1	7	24	41	144	tier1	no_errors	ENST00000425232	ensembl	human	known	74_37	missense	14.58	14.29	SNP	0.001	G	7	41
LOC284788	284788	genome.wustl.edu	37	20	22381195	22381195	+	lincRNA	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr20:22381195G>A	ENST00000377121.1	-	0	1459					NR_027089.1																						gccatggtgtggtatacatca	0.428													ENSG00000204684																																					0																																												0			-																													20.37:g.22381195G>A				R	SNP	-	NULL	ENST00000377121.1	37	NULL		20																																																																																			-	RP5-1004I9.1	-	-		0.428	RP5-1004I9.1-001	KNOWN	basic	lincRNA	LOC284788	Clone_based_vega_gene	lincRNA	OTTHUMT00000078288.2	0	0	0	116	116	87	0.00	0.00	G			22381195	-1	11	23	36	97	tier1	no_errors	ENST00000377121	ensembl	human	known	74_37	rna	23.40	18.85	SNP	0.000	A	11	36
TRPM8	79054	genome.wustl.edu	37	2	234875370	234875370	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr2:234875370C>A	ENST00000324695.4	+	15	2036	c.1996C>A	c.(1996-1998)Cag>Aag	p.Q666K	TRPM8_ENST00000433712.2_Missense_Mutation_p.Q354K	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	666					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GGCCACAGACCAGCATTTCAT	0.547													ENSG00000144481																																					0													81.0	72.0	75.0					2																	234875370		2203	4300	6503	SO:0001583	missense	0			-	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.1996C>A	2.37:g.234875370C>A	ENSP00000323926:p.Gln666Lys		A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.Q666K	ENST00000324695.4	37	c.1996	CCDS33407.1	2	.	.	.	.	.	.	.	.	.	.	C	4.804	0.149487	0.09185	.	.	ENSG00000144481	ENST00000324695;ENST00000433712;ENST00000456930	T;T;T	0.58506	0.33;0.33;0.33	5.61	4.72	0.59763	.	0.103207	0.44285	D	0.000477	T	0.43612	0.1255	N	0.21240	0.645	0.38868	D	0.956628	B;B	0.23377	0.011;0.084	B;B	0.19148	0.005;0.024	T	0.34976	-0.9807	10	0.28530	T	0.3	-17.0901	14.9282	0.70896	0.1443:0.8557:0.0:0.0	.	354;666	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	K	666;354;37	ENSP00000323926:Q666K;ENSP00000404423:Q354K;ENSP00000414198:Q37K	ENSP00000323926:Q666K	Q	+	1	0	TRPM8	234540109	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.924000	0.48876	1.479000	0.48272	-0.182000	0.12963	CAG	-	TRPM8	-	NULL		0.547	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	HGNC	protein_coding	OTTHUMT00000131005.4	0	0	0	40	40	60	0.00	0.00	C	NM_024080		234875370	+1	4	4	37	31	tier1	no_errors	ENST00000324695	ensembl	human	known	74_37	missense	9.76	11.43	SNP	1.000	A	4	37
CCDC178	374864	genome.wustl.edu	37	18	30928934	30928934	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr18:30928934C>A	ENST00000383096.3	-	8	559	c.377G>T	c.(376-378)aGa>aTa	p.R126I	CCDC178_ENST00000402325.1_Missense_Mutation_p.R126I|CCDC178_ENST00000403303.1_Missense_Mutation_p.R126I|CCDC178_ENST00000406524.2_Missense_Mutation_p.R126I|CCDC178_ENST00000300227.8_Missense_Mutation_p.R126I|CCDC178_ENST00000583930.1_Missense_Mutation_p.R126I|CCDC178_ENST00000579947.1_Missense_Mutation_p.R126I|CCDC178_ENST00000579916.1_Intron			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	126																	GGAAGAAGTTCTGCTCCTATA	0.343													ENSG00000166960																																					0													128.0	111.0	117.0					18																	30928934		2202	4300	6502	SO:0001583	missense	0			-	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.377G>T	18.37:g.30928934C>A	ENSP00000372576:p.Arg126Ile		A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	NULL	p.R126I	ENST00000383096.3	37	c.377	CCDS42424.1	18	.	.	.	.	.	.	.	.	.	.	C	7.978	0.750544	0.15778	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.48836	2.37;2.37;2.37;2.37;2.37;0.8	4.3	0.368	0.16146	.	.	.	.	.	T	0.33760	0.0874	L	0.48642	1.525	0.09310	N	1	B;B;B;B	0.32031	0.352;0.041;0.112;0.112	B;B;B;B	0.29176	0.099;0.046;0.028;0.028	T	0.23154	-1.0196	9	0.45353	T	0.12	-0.359	3.1622	0.06524	0.2399:0.517:0.1491:0.094	.	126;126;126;126	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	I	126	ENSP00000385591:R126I;ENSP00000372576:R126I;ENSP00000300227:R126I;ENSP00000385867:R126I;ENSP00000385234:R126I;ENSP00000382130:R126I	ENSP00000300227:R126I	R	-	2	0	C18orf34	29182932	0.000000	0.05858	0.001000	0.08648	0.198000	0.23893	-0.136000	0.10405	0.051000	0.15978	0.591000	0.81541	AGA	-	CCDC178	-	NULL		0.343	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	HGNC	protein_coding	OTTHUMT00000255373.2	0	0	0	31	31	91	0.00	0.00	C	NM_198995		30928934	-1	13	14	26	84	tier1	no_errors	ENST00000406524	ensembl	human	known	74_37	missense	33.33	14.29	SNP	0.005	A	13	26
NOP56	10528	genome.wustl.edu	37	20	2637331	2637331	+	Intron	SNP	G	G	C			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr20:2637331G>C	ENST00000329276.5	+	10	1675				SNORD56_ENST00000413522.1_RNA|SNORD86_ENST00000391196.1_RNA|SNORD110_ENST00000408189.1_RNA|IDH3B_ENST00000488299.1_5'Flank|SNORD57_ENST00000448188.1_RNA|SNORA51_ENST00000606420.1_RNA|NOP56_ENST00000492135.1_Intron	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						GAGACTCTGGGTCTGAGTGAA	0.537													ENSG00000229686																																					0													101.0	97.0	98.0					20																	2637331		876	1991	2867	SO:0001627	intron_variant	0			-	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.1160-89G>C	20.37:g.2637331G>C			Q2M3T6|Q9NQ05	R	SNP	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			-	SNORD56	-	-		0.537	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD56	HGNC	protein_coding	OTTHUMT00000077631.2	0	0	0	82	82	97	0.00	0.00	G	NM_006392		2637331	+1	11	11	95	72	tier1	no_errors	ENST00000413522	ensembl	human	known	74_37	rna	10.38	13.10	SNP	1.000	C	11	95
MATN3	4148	genome.wustl.edu	37	2	20205563	20205563	+	Silent	SNP	G	G	A	rs371740669		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr2:20205563G>A	ENST00000407540.3	-	2	794	c.732C>T	c.(730-732)taC>taT	p.Y244Y	AC079145.4_ENST00000416575.1_RNA|MATN3_ENST00000421259.2_Silent_p.Y244Y	NM_002381.4	NP_002372.1	O15232	MATN3_HUMAN	matrilin 3	244	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGTCTCCACGTAGAAAACAT	0.493													ENSG00000132031																																					0								G		1,3963		0,1,1981	28.0	31.0	30.0		732	-6.4	0.6	2		30	0,8326		0,0,4163	no	coding-synonymous	MATN3	NM_002381.4		0,1,6144	AA,AG,GG		0.0,0.0252,0.0081		244/487	20205563	1,12289	1982	4163	6145	SO:0001819	synonymous_variant	0			-	AJ001047	CCDS46226.1	2p24-p23	2008-06-03			ENSG00000132031	ENSG00000132031			6909	protein-coding gene	gene with protein product		602109				9287130, 9350998	Standard	NM_002381		Approved	EDM5, HOA	uc002rdl.3	O15232	OTTHUMG00000151788	ENST00000407540.3:c.732C>T	2.37:g.20205563G>A			B2CPU0|Q4ZG02	Silent	SNP	pfam_VWF_A,pfam_Matrilin_coiled-coil_trimer,pfam_EGF-like_Ca-bd_dom,smart_VWF_A,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.Y244	ENST00000407540.3	37	c.732	CCDS46226.1	2																																																																																			-	MATN3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.493	MATN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN3	HGNC	protein_coding	OTTHUMT00000323925.1	0	0	0	50	50	89	0.00	0.00	G	NM_002381		20205563	-1	22	19	43	56	tier1	no_errors	ENST00000407540	ensembl	human	known	74_37	silent	33.85	25.33	SNP	0.372	A	22	43
DCDC1	341019	genome.wustl.edu	37	11	31128498	31128498	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr11:31128498T>A	ENST00000597505.1	-	11	1596	c.1597A>T	c.(1597-1599)Aag>Tag	p.K533*	DCDC1_ENST00000437348.1_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TGATGAATCTTGAGAAGTAAC	0.413											OREG0020856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000170959																																					0													48.0	45.0	46.0					11																	31128498		1830	4082	5912	SO:0001587	stop_gained	0			-	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1597A>T	11.37:g.31128498T>A	ENSP00000472625:p.Lys533*	822	A6PVL6|B7WNX6|Q6ZU04	Nonsense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.K533*	ENST00000597505.1	37	c.1597		11																																																																																			-	DCDC1	-	NULL		0.413	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	0	0	0	104	104	107	0.00	0.00	T	NM_181807		31128498	-1	11	26	22	83	tier1	no_errors	ENST00000597505	ensembl	human	putative	74_37	nonsense	33.33	23.85	SNP	0.111	A	11	22
DMBT1	1755	genome.wustl.edu	37	10	124335918	124335918	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr10:124335918C>A	ENST00000338354.3	+	7	393	c.287C>A	c.(286-288)tCt>tAt	p.S96Y	DMBT1_ENST00000368955.3_Missense_Mutation_p.S96Y|DMBT1_ENST00000359586.6_Missense_Mutation_p.S96Y|DMBT1_ENST00000344338.3_Missense_Mutation_p.S96Y|DMBT1_ENST00000368909.3_Missense_Mutation_p.S96Y|DMBT1_ENST00000368956.2_Missense_Mutation_p.S96Y|DMBT1_ENST00000330163.4_Missense_Mutation_p.S96Y			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	96					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCTCTAGGATCTGATTCTGGT	0.557													ENSG00000187908																									Ovarian(182;93 2026 18125 22222 38972)												0													110.0	112.0	111.0					10																	124335918		1994	4191	6185	SO:0001583	missense	0			-		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.287C>A	10.37:g.124335918C>A	ENSP00000342210:p.Ser96Tyr		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.S96Y	ENST00000338354.3	37	c.287		10	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414133	0.42817	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.26518	1.81;1.77;1.73;1.81;1.77;1.73;1.75	4.54	2.64	0.31445	Speract/scavenger receptor-related (1);	.	.	.	.	T	0.36608	0.0973	L	0.43646	1.37	0.09310	N	1	P;D;P;D;D	0.69078	0.714;0.977;0.495;0.997;0.979	B;P;B;D;P	0.69307	0.395;0.856;0.177;0.963;0.76	T	0.10543	-1.0625	9	0.66056	D	0.02	.	5.671	0.17723	0.1935:0.7032:0.0:0.1033	.	96;96;96;96;96	F8WEF7;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	Y	96	ENSP00000342210:S96Y;ENSP00000343175:S96Y;ENSP00000327747:S96Y;ENSP00000357905:S96Y;ENSP00000357951:S96Y;ENSP00000357952:S96Y;ENSP00000352593:S96Y	ENSP00000331522:S96Y	S	+	2	0	DMBT1	124325908	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	0.106000	0.15354	0.446000	0.26666	0.591000	0.81541	TCT	-	DMBT1	-	superfamily_Srcr_rcpt-rel		0.557	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	0	0	0	131	131	61	0.00	0.00	C	NM_004406		124335918	+1	42	17	126	27	tier1	no_errors	ENST00000338354	ensembl	human	known	74_37	missense	25.00	38.64	SNP	0.000	A	42	126
SPATA31D5P	347127	genome.wustl.edu	37	9	84533237	84533237	+	RNA	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr9:84533237C>T	ENST00000527857.1	+	0	3259					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		CTGATACTGACGAGGATCTTA	0.483													ENSG00000240632																																					0																																												0			-			9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84533237C>T				R	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			-	SPATA31D5P	-	-		0.483	SPATA31D5P-002	KNOWN	basic	processed_transcript	SPATA31D5P	HGNC	pseudogene	OTTHUMT00000052810.2	0	0	0	54	54	51	0.00	0.00	C	NR_026851		84533237	+1	14	23	20	19	tier1	no_errors	ENST00000527857	ensembl	human	known	74_37	rna	41.18	54.76	SNP	0.000	T	14	20
KRT73	319101	genome.wustl.edu	37	12	53005034	53005034	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr12:53005034C>T	ENST00000305748.3	-	6	1098	c.1064G>A	c.(1063-1065)cGt>cAt	p.R355H	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	355	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		TTGGATGAGACGGGTCAGCTC	0.537													ENSG00000186049																																					0													163.0	138.0	146.0					12																	53005034		2203	4300	6503	SO:0001583	missense	0			-	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.1064G>A	12.37:g.53005034C>T	ENSP00000307014:p.Arg355His		Q32MB2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.R355H	ENST00000305748.3	37	c.1064	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027819	0.75390	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	D;D	0.90504	-2.68;-2.68	5.61	5.61	0.85477	Filament (1);	0.000000	0.49916	D	0.000128	D	0.92721	0.7686	M	0.92026	3.265	0.41322	D	0.987184	P	0.45827	0.867	B	0.40940	0.344	D	0.94328	0.7559	10	0.87932	D	0	.	16.2836	0.82708	0.1329:0.8671:0.0:0.0	.	355	Q86Y46	K2C73_HUMAN	H	355;100	ENSP00000307014:R355H;ENSP00000449081:R100H	ENSP00000307014:R355H	R	-	2	0	KRT73	51291301	0.906000	0.30813	0.978000	0.43139	0.911000	0.54048	3.680000	0.54641	2.821000	0.97095	0.555000	0.69702	CGT	-	KRT73	-	pfam_IF,superfamily_Prefoldin		0.537	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1	0	0	0	69	69	90	0.00	0.00	C	NM_175068		53005034	-1	19	25	43	47	tier1	no_errors	ENST00000305748	ensembl	human	known	74_37	missense	30.65	34.72	SNP	0.964	T	19	43
CDH3	1001	genome.wustl.edu	37	16	68721584	68721584	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr16:68721584G>T	ENST00000264012.4	+	12	2284	c.1740G>T	c.(1738-1740)caG>caT	p.Q580H	CDH3_ENST00000429102.2_Missense_Mutation_p.Q580H|CDH3_ENST00000581171.1_Missense_Mutation_p.Q525H	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	580	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		CCCCTTTCCAGGCCCAGCTCA	0.607													ENSG00000062038																																					2	Unknown(2)	breast(2)											127.0	98.0	107.0					16																	68721584		2198	4300	6498	SO:0001583	missense	0			-	X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.1740G>T	16.37:g.68721584G>T	ENSP00000264012:p.Gln580His		B2R6F4|Q05DI6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q580H	ENST00000264012.4	37	c.1740	CCDS10868.1	16	.	.	.	.	.	.	.	.	.	.	G	11.15	1.552627	0.27739	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.60672	0.17;0.17	5.29	2.13	0.27403	Cadherin (1);Cadherin-like (1);	0.678066	0.12386	N	0.473492	T	0.43986	0.1272	L	0.48642	1.525	0.33599	D	0.602058	B	0.06786	0.001	B	0.06405	0.002	T	0.44298	-0.9337	10	0.22109	T	0.4	.	4.4997	0.11858	0.0808:0.2774:0.4973:0.1445	.	580	P22223	CADH3_HUMAN	H	580;580;525	ENSP00000398485:Q580H;ENSP00000264012:Q580H	ENSP00000264012:Q580H	Q	+	3	2	CDH3	67279085	0.015000	0.18098	0.996000	0.52242	0.980000	0.70556	0.086000	0.14935	0.619000	0.30197	0.563000	0.77884	CAG	-	CDH3	-	superfamily_Cadherin-like,pfscan_Cadherin		0.607	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH3	HGNC	protein_coding	OTTHUMT00000268896.2	0	0	0	29	29	117	0.00	0.00	G	NM_001793		68721584	+1	5	24	41	84	tier1	no_errors	ENST00000264012	ensembl	human	known	74_37	missense	10.87	22.22	SNP	0.988	T	5	41
FLG	2312	genome.wustl.edu	37	1	152277218	152277218	+	Missense_Mutation	SNP	G	G	A	rs147066553		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr1:152277218G>A	ENST00000368799.1	-	3	10179	c.10144C>T	c.(10144-10146)Cgt>Tgt	p.R3382C	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3382	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCCTGAACGTCCAGACCTT	0.597									Ichthyosis				ENSG00000143631	G|||	1	0.000199681	0.0	0.0014	5008	,	,		19061	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	257.0	279.0	272.0		10144	-1.4	0.0	1	dbSNP_134	272	0,8600		0,0,4300	no	missense	FLG	NM_002016.1	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	3382/4062	152277218	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	-	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10144C>T	1.37:g.152277218G>A	ENSP00000357789:p.Arg3382Cys		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.R3382C	ENST00000368799.1	37	c.10144	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.354762	0.24512	2.27E-4	0.0	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.00958	5.5	3.24	-1.37	0.09056	.	.	.	.	.	T	0.01222	0.0040	M	0.75447	2.3	0.09310	N	1	D	0.89917	1.0	D	0.69142	0.962	T	0.45585	-0.9251	9	0.66056	D	0.02	.	2.6372	0.04961	0.402:0.0:0.3838:0.2141	.	3382	P20930	FILA_HUMAN	C	3382;320	ENSP00000357789:R3382C	ENSP00000357786:R320C	R	-	1	0	FLG	150543842	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.323000	0.07997	-0.266000	0.09339	0.454000	0.30748	CGT	rs147066553	FLG	-	NULL		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	0	0	0	180	180	19	0.00	0.00	G	NM_002016		152277218	-1	46	3	131	22	tier1	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	25.99	12.00	SNP	0.000	A	46	131
C2orf43	60526	genome.wustl.edu	37	2	20939958	20939958	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr2:20939958C>T	ENST00000237822.3	-	5	555	c.476G>A	c.(475-477)cGt>cAt	p.R159H	C2orf43_ENST00000435420.2_Missense_Mutation_p.R111H|C2orf43_ENST00000440866.2_Intron|C2orf43_ENST00000381090.3_Missense_Mutation_p.R159H|C2orf43_ENST00000403006.2_Missense_Mutation_p.R29H|C2orf43_ENST00000541941.1_Missense_Mutation_p.R29H	NM_001282721.1|NM_021925.2	NP_001269650.1|NP_068744.1	Q9H6V9	CB043_HUMAN	chromosome 2 open reading frame 43	159										endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGAAAGGCACGAATTACCTG	0.378													ENSG00000118961																																					0													80.0	77.0	78.0					2																	20939958		2203	4300	6503	SO:0001583	missense	0			-	AK025473	CCDS1702.1, CCDS62864.1, CCDS74488.1, CCDS74489.1	2p24.1	2014-02-07			ENSG00000118961	ENSG00000118961			26145	protein-coding gene	gene with protein product		613570				17135363, 24357060	Standard	NM_001282723		Approved	FLJ21820	uc002rec.3	Q9H6V9	OTTHUMG00000122097	ENST00000237822.3:c.476G>A	2.37:g.20939958C>T	ENSP00000237822:p.Arg159His		B7ZA47|B7ZAJ5|D6W530|E7ESN0|Q53T37|Q53T58	Missense_Mutation	SNP	pfam_DUF2305	p.R159H	ENST00000237822.3	37	c.476	CCDS1702.1	2	.	.	.	.	.	.	.	.	.	.	C	6.264	0.416862	0.11870	.	.	ENSG00000118961	ENST00000403006;ENST00000381090;ENST00000237822;ENST00000435420;ENST00000541941;ENST00000432947;ENST00000412261	T;T;T;T	0.71934	0.88;1.47;0.88;-0.61	5.61	2.67	0.31697	.	0.170702	0.52532	N	0.000075	T	0.47154	0.1430	N	0.17474	0.49	0.32083	N	0.592878	B;B;B;B	0.21452	0.017;0.056;0.007;0.011	B;B;B;B	0.16722	0.016;0.016;0.013;0.013	T	0.41680	-0.9495	10	0.13853	T	0.58	-9.6733	6.6113	0.22753	0.0:0.5402:0.0:0.4598	.	117;111;159;159	B4DS38;B7ZAJ5;Q9H6V9;B5MDU6	.;.;CB043_HUMAN;.	H	29;159;159;111;29;29;111	ENSP00000384267:R29H;ENSP00000388635:R111H;ENSP00000440570:R29H;ENSP00000396911:R29H	ENSP00000237822:R159H	R	-	2	0	C2orf43	20803439	0.527000	0.26306	0.009000	0.14445	0.191000	0.23601	0.707000	0.25704	0.320000	0.23234	0.650000	0.86243	CGT	-	C2orf43	-	pfam_DUF2305		0.378	C2orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf43	HGNC	protein_coding	OTTHUMT00000242861.1	0	0	1	20	20	98	0.00	1.00	C	NM_021925		20939958	-1	4	27	9	79	tier1	no_errors	ENST00000237822	ensembl	human	known	74_37	missense	30.77	25.47	SNP	0.053	T	4	9
TRPS1	7227	genome.wustl.edu	37	8	116616855	116616855	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr8:116616855G>C	ENST00000220888.5	-	3	1461	c.1302C>G	c.(1300-1302)taC>taG	p.Y434*	TRPS1_ENST00000519076.1_Intron|TRPS1_ENST00000519674.1_Nonsense_Mutation_p.Y434*|TRPS1_ENST00000520276.1_Nonsense_Mutation_p.Y438*|TRPS1_ENST00000395715.3_Nonsense_Mutation_p.Y447*			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	434					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATTTACACCAGTAGTAACTGG	0.473									Langer-Giedion syndrome				ENSG00000104447																																					0													64.0	63.0	63.0					8																	116616855		1904	4130	6034	SO:0001587	stop_gained	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	-	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1302C>G	8.37:g.116616855G>C	ENSP00000220888:p.Tyr434*		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Nonsense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.Y447*	ENST00000220888.5	37	c.1341		8	.	.	.	.	.	.	.	.	.	.	G	37	6.634937	0.97722	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674	.	.	.	5.69	4.82	0.62117	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.836	0.70183	0.0689:0.0:0.9311:0.0	.	.	.	.	X	447;434;438;434	.	ENSP00000220888:Y434X	Y	-	3	2	TRPS1	116686030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.217000	0.58547	1.540000	0.49301	0.655000	0.94253	TAC	-	TRPS1	-	smart_Znf_C2H2-like		0.473	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	0	0	0	41	41	58	0.00	0.00	G	NM_014112		116616855	-1	4	23	14	37	tier1	no_errors	ENST00000395715	ensembl	human	known	74_37	nonsense	22.22	38.33	SNP	1.000	C	4	14
FAM83E	54854	genome.wustl.edu	37	19	49104467	49104467	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr19:49104467G>A	ENST00000263266.3	-	5	1525	c.1336C>T	c.(1336-1338)Cga>Tga	p.R446*		NM_017708.3	NP_060178.2	Q2M2I3	FA83E_HUMAN	family with sequence similarity 83, member E	446										NS(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(2)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		AACCGCCTTCGGGCTGGGGAC	0.706													ENSG00000105523																																					0													16.0	17.0	17.0					19																	49104467		1833	4076	5909	SO:0001587	stop_gained	0			-	AK000207	CCDS42587.1	19q13.33	2013-10-24			ENSG00000105523	ENSG00000105523			25972	protein-coding gene	gene with protein product							Standard	NM_017708		Approved	FLJ20200	uc002pjn.2	Q2M2I3	OTTHUMG00000183315	ENST00000263266.3:c.1336C>T	19.37:g.49104467G>A	ENSP00000263266:p.Arg446*		Q9NXK1	Nonsense_Mutation	SNP	pfam_DUF1669,superfamily_Acyl_CoA_acyltransferase	p.R446*	ENST00000263266.3	37	c.1336	CCDS42587.1	19	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779357	0.70107	.	.	ENSG00000105523	ENST00000263266	.	.	.	3.86	2.79	0.32731	.	0.339194	0.15976	U	0.235536	.	.	.	.	.	.	0.42438	D	0.992703	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.7737	9.0731	0.36504	0.0:0.0:0.7803:0.2197	.	.	.	.	X	446	.	ENSP00000263266:R446X	R	-	1	2	FAM83E	53796279	0.124000	0.22315	0.007000	0.13788	0.019000	0.09904	1.337000	0.33862	0.724000	0.32296	0.549000	0.68633	CGA	-	FAM83E	-	NULL		0.706	FAM83E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83E	HGNC	protein_coding	OTTHUMT00000466145.1	0	0	0	43	43	12	0.00	0.00	G	NM_017708		49104467	-1	6	9	64	26	tier1	no_errors	ENST00000263266	ensembl	human	known	74_37	nonsense	8.57	25.71	SNP	0.023	A	6	64
FLJ36000	284124	genome.wustl.edu	37	17	21911095	21911095	+	lincRNA	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr17:21911095C>T	ENST00000581223.2	+	0	1820					NR_027084.1																						gggtgagtctccccagaagtc	0.627													ENSG00000266795																																					0																																												0			-																													17.37:g.21911095C>T				R	SNP	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			-	RP11-744K17.9	-	-		0.627	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	Clone_based_vega_gene	lincRNA	OTTHUMT00000451067.1	0	0	0	18	18	14	0.00	0.00	C			21911095	+1	8	3	17	11	tier1	no_errors	ENST00000581223	ensembl	human	known	74_37	rna	30.77	21.43	SNP	0.224	T	8	17
DGKK	139189	genome.wustl.edu	37	X	50134456	50134456	+	RNA	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chrX:50134456G>T	ENST00000376025.2	-	0	1882							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					CCTCACACTAGCCTGCTCCAC	0.512													ENSG00000204466																																					0													183.0	170.0	174.0					X																	50134456		2057	4172	6229			0			-	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50134456G>T			B2RP91	R	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			-	DGKK	-	-		0.512	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	0	0	0	46	46	44	0.00	0.00	G	NM_001013742		50134456	-1	5	9	15	58	tier1	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	25.00	13.43	SNP	1.000	T	5	15
ADAMTS9	56999	genome.wustl.edu	37	3	64527528	64527528	+	Missense_Mutation	SNP	C	C	T	rs202044216		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr3:64527528C>T	ENST00000498707.1	-	33	5525	c.5183G>A	c.(5182-5184)cGt>cAt	p.R1728H	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.R1700H	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1728	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		ATAGACATTACGGCAGGTTTT	0.413													ENSG00000163638																																					0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	147.0	143.0	144.0		5183	3.3	0.5	3		144	0,8600		0,0,4300	no	missense	ADAMTS9	NM_182920.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	1728/1936	64527528	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5183G>A	3.37:g.64527528C>T	ENSP00000418735:p.Arg1728His		A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1728H	ENST00000498707.1	37	c.5183	CCDS2903.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.049|4.049	0.006828|0.006828	0.07866|0.07866	2.27E-4|2.27E-4	0.0|0.0	ENSG00000163638|ENSG00000163638	ENST00000295903;ENST00000498707|ENST00000481060	T;T|.	0.59502|.	0.26;0.28|.	5.7|5.7	3.26|3.26	0.37387|0.37387	.|.	0.208186|.	0.42964|.	N|.	0.000640|.	T|T	0.26159|0.26159	0.0638|0.0638	N|N	0.02412|0.02412	-0.56|-0.56	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.0;0.001|.	T|T	0.04153|0.04153	-1.0973|-1.0973	10|5	0.02654|.	T|.	1|.	.|.	9.8378|9.8378	0.40980|0.40980	0.0:0.144:0.0:0.856|0.0:0.144:0.0:0.856	.|.	1700;1728|.	B7ZVX9;Q9P2N4|.	.;ATS9_HUMAN|.	H|I	1700;1728|784	ENSP00000295903:R1700H;ENSP00000418735:R1728H|.	ENSP00000295903:R1700H|.	R|V	-|-	2|1	0|0	ADAMTS9|ADAMTS9	64502568|64502568	0.991000|0.991000	0.36638|0.36638	0.492000|0.492000	0.27490|0.27490	0.428000|0.428000	0.31595|0.31595	2.429000|2.429000	0.44758|0.44758	0.407000|0.407000	0.25591|0.25591	-0.469000|-0.469000	0.05056|0.05056	CGT|GTA	rs202044216	ADAMTS9	-	pfam_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.413	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	0	0	0	74	74	107	0.00	0.00	C			64527528	-1	18	33	46	96	tier1	no_errors	ENST00000498707	ensembl	human	known	74_37	missense	28.12	25.58	SNP	0.894	T	18	46
REXO4	57109	genome.wustl.edu	37	9	136272961	136272961	+	Silent	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr9:136272961C>A	ENST00000371942.3	-	7	1318	c.1119G>T	c.(1117-1119)ggG>ggT	p.G373G	REXO4_ENST00000371935.2_Silent_p.G201G	NM_020385.2	NP_065118.2	Q9GZR2	REXO4_HUMAN	REX4, RNA exonuclease 4 homolog (S. cerevisiae)	373	Exonuclease.				regulation of transcription, DNA-templated (GO:0006355)	nucleolus (GO:0005730)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	15				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		GGACCTGGAGCCCAAGGATCT	0.597													ENSG00000148300																																					0													75.0	57.0	63.0					9																	136272961		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF273304	CCDS6969.1, CCDS65179.1	9q34	2008-02-05	2005-08-22	2005-08-22	ENSG00000148300	ENSG00000148300			12820	protein-coding gene	gene with protein product		602930	"""Xenopus prevents mitotic catatrophe 2 homolog"", ""XPMC2 prevents mitotic catastrophe 2 homolog (Xenopus laevis)"""	XPMC2H		9325058	Standard	NM_020385		Approved		uc004cdm.3	Q9GZR2	OTTHUMG00000020870	ENST00000371942.3:c.1119G>T	9.37:g.136272961C>A			B2RAT2|Q5T8S4|Q5T8S5|Q5T8S6|Q9GZW3	Silent	SNP	pfam_Exonuclease_RNaseT/D_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.G373	ENST00000371942.3	37	c.1119	CCDS6969.1	9																																																																																			-	REXO4	-	pfam_Exonuclease_RNaseT/D_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease		0.597	REXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO4	HGNC	protein_coding	OTTHUMT00000054899.1	0	0	0	40	40	84	0.00	0.00	C			136272961	-1	97	118	110	118	tier1	no_errors	ENST00000371942	ensembl	human	known	74_37	silent	46.86	50.00	SNP	0.013	A	97	110
CACNA2D1	781	genome.wustl.edu	37	7	81643716	81643716	+	Splice_Site	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:81643716C>T	ENST00000356253.5	-	13	1478		c.e13+1		CACNA2D1_ENST00000464354.1_Splice_Site|CACNA2D1_ENST00000356860.3_Splice_Site|MIR1255B1_ENST00000439234.1_RNA|MIR1255B1_ENST00000454066.1_RNA			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1						calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AGATTTGTTACCTTTGTTTTC	0.313													ENSG00000153956																																					0													68.0	66.0	66.0					7																	81643716		2203	4300	6503	SO:0001630	splice_region_variant	0			-	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.1222+1G>A	7.37:g.81643716C>T			Q17R45|Q9UD80|Q9UD81|Q9UD82	Splice_Site	SNP	-	e13+1	ENST00000356253.5	37	c.1222+1		7	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748291	0.69533	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5849	0.87978	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CACNA2D1	81481652	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.647000	0.67923	2.451000	0.82905	0.305000	0.20034	.	-	CAC2D1	-	-		0.313	CACNA2D1-201	KNOWN	basic	protein_coding	CAC2D1	HGNC	protein_coding		0	0	0	52	52	79	0.00	0.00	C		Intron	81643716	-1	8	17	15	70	tier1	no_errors	ENST00000356253	ensembl	human	known	74_37	splice_site	34.78	19.54	SNP	1.000	T	8	15
XPNPEP1	7511	genome.wustl.edu	37	10	111667471	111667471	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr10:111667471A>T	ENST00000502935.1	-	3	343	c.224T>A	c.(223-225)aTc>aAc	p.I75N	XPNPEP1_ENST00000369683.1_5'UTR|XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.I32N|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.I75N					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TCCCGATGGGATGATGTAGGC	0.502													ENSG00000108039																																					0													241.0	200.0	214.0					10																	111667471		2203	4300	6503	SO:0001583	missense	0			-		CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.224T>A	10.37:g.111667471A>T	ENSP00000421566:p.Ile75Asn			Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.I75N	ENST00000502935.1	37	c.224	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	A	23.3	4.405333	0.83230	.	.	ENSG00000108039	ENST00000502935;ENST00000322238;ENST00000369680;ENST00000403138;ENST00000423625	.	.	.	5.33	5.33	0.75918	Creatinase (1);	0.130078	0.50627	D	0.000106	D	0.85031	0.5604	M	0.92219	3.285	0.45129	D	0.998144	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.997	D	0.88429	0.3034	9	0.87932	D	0	-14.0668	12.8205	0.57690	1.0:0.0:0.0:0.0	.	75;75;32	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	N	75;75;32;32;32	.	ENSP00000324011:I75N	I	-	2	0	XPNPEP1	111657461	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.458000	0.73509	2.025000	0.59659	0.533000	0.62120	ATC	-	XPNPEP1	-	pfam_Creatinase		0.502	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2	0	0	1	61	61	75	0.00	1.30	A			111667471	-1	6	13	43	61	tier1	no_errors	ENST00000502935	ensembl	human	known	74_37	missense	12.24	17.57	SNP	1.000	T	6	43
TCF12	6938	genome.wustl.edu	37	15	57578959	57578959	+	3'UTR	SNP	T	T	C			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr15:57578959T>C	ENST00000267811.5	+	0	2969				TCF12_ENST00000452095.2_3'UTR|TCF12_ENST00000557843.1_3'UTR|TCF12_ENST00000438423.2_3'UTR|TCF12_ENST00000333725.5_3'UTR|TCF12_ENST00000343827.3_3'UTR	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12						immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TAGGAAAATATTACTTGGTAT	0.328			T	TEC	extraskeletal myxoid chondrosarcoma								ENSG00000140262																												Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0																																										SO:0001624	3_prime_UTR_variant	0			-	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.*616T>C	15.37:g.57578959T>C			Q7Z3D9|Q86TC1|Q86VM2	R	SNP	-	NULL	ENST00000267811.5	37	NULL	CCDS10159.1	15																																																																																			-	TCF12	-	-		0.328	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	0	0	0	23	23	71	0.00	0.00	T	NM_003205		57578959	+1	9	19	19	49	tier1	no_errors	ENST00000560191	ensembl	human	putative	74_37	rna	32.14	27.94	SNP	1.000	C	9	19
USH2A	7399	genome.wustl.edu	37	1	215953333	215953333	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr1:215953333G>T	ENST00000307340.3	-	55	11177	c.10791C>A	c.(10789-10791)agC>agA	p.S3597R	USH2A_ENST00000366943.2_Missense_Mutation_p.S3597R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3597	Fibronectin type-III 21. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGGCTGTGATGCTTGGTGGCA	0.488										HNSCC(13;0.011)			ENSG00000042781																																					0													129.0	106.0	114.0					1																	215953333		2203	4300	6503	SO:0001583	missense	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10791C>A	1.37:g.215953333G>T	ENSP00000305941:p.Ser3597Arg		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.S3597R	ENST00000307340.3	37	c.10791	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	0.691	-0.794638	0.02862	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.57907	0.37;0.37	5.79	-1.2	0.09554	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.966828	0.08491	N	0.938012	T	0.22322	0.0538	N	0.03238	-0.38	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17715	-1.0360	10	0.13853	T	0.58	.	3.9014	0.09162	0.0966:0.1198:0.3882:0.3954	.	3597	O75445	USH2A_HUMAN	R	3597	ENSP00000305941:S3597R;ENSP00000355910:S3597R	ENSP00000305941:S3597R	S	-	3	2	USH2A	214019956	0.000000	0.05858	0.000000	0.03702	0.550000	0.35303	-0.190000	0.09615	-0.480000	0.06803	-0.265000	0.10407	AGC	-	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.488	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	28	28	57	0.00	0.00	G	NM_007123		215953333	-1	4	9	21	36	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	16.00	20.00	SNP	0.000	T	4	21
AMBRA1	55626	genome.wustl.edu	37	11	46564792	46564792	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr11:46564792G>T	ENST00000458649.2	-	7	1193	c.775C>A	c.(775-777)Caa>Aaa	p.Q259K	AMBRA1_ENST00000426438.1_Missense_Mutation_p.Q259K|AMBRA1_ENST00000314845.3_Intron|AMBRA1_ENST00000528950.1_Missense_Mutation_p.Q259K|AMBRA1_ENST00000298834.3_Missense_Mutation_p.Q259K|AMBRA1_ENST00000534300.1_Missense_Mutation_p.Q259K|AMBRA1_ENST00000533727.1_Intron			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	259					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		ACTGTGCTTTGCTCTCCCACC	0.632													ENSG00000110497																																					0													60.0	56.0	57.0					11																	46564792		2201	4299	6500	SO:0001583	missense	0			-	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.775C>A	11.37:g.46564792G>T	ENSP00000415327:p.Gln259Lys		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q259K	ENST00000458649.2	37	c.775		11	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156290	0.57259	.	.	ENSG00000110497	ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	T;T;T;T;T	0.68025	-0.17;-0.3;-0.17;-0.27;-0.3	5.94	5.94	0.96194	.	0.177740	0.50627	D	0.000114	T	0.60818	0.2298	.	.	.	0.58432	D	0.999997	B;B;B	0.28636	0.139;0.218;0.218	B;B;B	0.30782	0.056;0.12;0.12	T	0.54077	-0.8347	8	.	.	.	.	19.9544	0.97215	0.0:0.0:1.0:0.0	.	259;259;259	Q9C0C7;Q9C0C7-3;Q9C0C7-2	AMRA1_HUMAN;.;.	K	259	ENSP00000431926:Q259K;ENSP00000410899:Q259K;ENSP00000298834:Q259K;ENSP00000415327:Q259K;ENSP00000433945:Q259K	.	Q	-	1	0	AMBRA1	46521368	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.355000	0.73041	2.822000	0.97130	0.557000	0.71058	CAA	-	AMBRA1	-	NULL		0.632	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	0	0	0	16	16	26	0.00	0.00	G	NM_017749		46564792	-1	10	7	26	24	tier1	no_errors	ENST00000458649	ensembl	human	known	74_37	missense	27.78	22.58	SNP	1.000	T	10	26
PGK2	5232	genome.wustl.edu	37	6	49754699	49754699	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr6:49754699C>A	ENST00000304801.3	-	1	354	c.202G>T	c.(202-204)Gat>Tat	p.D68Y		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	68					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					GGAACACCATCAGGCCGACCT	0.488													ENSG00000170950																																					0													190.0	158.0	169.0					6																	49754699		2203	4300	6503	SO:0001583	missense	0			-	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.202G>T	6.37:g.49754699C>A	ENSP00000305995:p.Asp68Tyr		B2R6Y8|Q9H107	Missense_Mutation	SNP	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase,prints_Phosphoglycerate_kinase	p.D68Y	ENST00000304801.3	37	c.202	CCDS4930.1	6	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702953	0.68501	.	.	ENSG00000170950	ENST00000304801	D	0.92249	-3.0	4.09	4.09	0.47781	Phosphoglycerate kinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95705	0.8603	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95895	0.8910	10	0.87932	D	0	-30.2176	14.5839	0.68310	0.0:1.0:0.0:0.0	.	68	P07205	PGK2_HUMAN	Y	68	ENSP00000305995:D68Y	ENSP00000305995:D68Y	D	-	1	0	PGK2	49862658	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.066000	0.76734	2.562000	0.86427	0.585000	0.79938	GAT	-	PGK2	-	pfam_Phosphoglycerate_kinase,superfamily_Phosphoglycerate_kinase		0.488	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK2	HGNC	protein_coding	OTTHUMT00000040872.1	0	0	0	55	55	74	0.00	0.00	C			49754699	-1	4	27	7	45	tier1	no_errors	ENST00000304801	ensembl	human	known	74_37	missense	36.36	37.50	SNP	1.000	A	4	7
CFAP54	144535	genome.wustl.edu	37	12	97254611	97254611	+	Silent	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr12:97254611C>A	ENST00000524981.4	+	67	9209	c.9186C>A	c.(9184-9186)atC>atA	p.I3062I				Q96N23	CL055_HUMAN		0																	CATTTGATATCTCACTGCCGT	0.348													ENSG00000188596																																					0																																										SO:0001819	synonymous_variant	0			-																												ENST00000524981.4:c.9186C>A	12.37:g.97254611C>A				Silent	SNP	superfamily_Fibronectin_type3	p.I3062	ENST00000524981.4	37	c.9186		12																																																																																			-	C12orf55	-	NULL		0.348	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	0	0	1	58	58	62	0.00	1.59	C			97254611	+1	8	23	42	106	tier1	no_errors	ENST00000524981	ensembl	human	putative	74_37	silent	16.00	17.83	SNP	0.185	A	8	42
NOS3	4846	genome.wustl.edu	37	7	150710438	150710438	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:150710438G>T	ENST00000297494.3	+	25	3583	c.3226G>T	c.(3226-3228)Gcc>Tcc	p.A1076S	ATG9B_ENST00000377974.2_3'UTR|NOS3_ENST00000461406.1_Missense_Mutation_p.A870S|ATG9B_ENST00000444312.1_3'UTR|ATG9B_ENST00000494791.1_5'UTR|NOS3_ENST00000477227.1_3'UTR|ATG9B_ENST00000605938.1_3'UTR	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGTCCTCACCGCCTTCTCCCG	0.627											OREG0018443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000164867																																					0													58.0	54.0	55.0					7																	150710438		2203	4300	6503	SO:0001583	missense	0			-		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.3226G>T	7.37:g.150710438G>T	ENSP00000297494:p.Ala1076Ser	1734	Q495E5	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/D-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.A1076S	ENST00000297494.3	37	c.3226	CCDS5912.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.117092	0.94385	.	.	ENSG00000164867	ENST00000297494;ENST00000461406	T;T	0.81078	-1.45;-1.45	4.18	4.18	0.49190	Oxidoreductase FAD/NAD(P)-binding (1);	0.000000	0.64402	D	0.000012	D	0.90772	0.7103	M	0.89840	3.065	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.989	D	0.92649	0.6131	10	0.87932	D	0	-8.9076	14.3911	0.66978	0.0:0.0:1.0:0.0	.	870;1076	E7ESA7;P29474	.;NOS3_HUMAN	S	1076;870	ENSP00000297494:A1076S;ENSP00000417143:A870S	ENSP00000297494:A1076S	A	+	1	0	NOS3	150341371	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.629000	0.98417	2.323000	0.78572	0.484000	0.47621	GCC	-	NOS3	-	pfam_OxRdtase_FAD/D-bd,pirsf_NOS_euk		0.627	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS3	HGNC	protein_coding	OTTHUMT00000350750.2	0	0	0	62	62	58	0.00	0.00	G	NM_000603		150710438	+1	15	15	72	24	tier1	no_errors	ENST00000297494	ensembl	human	known	74_37	missense	17.24	38.46	SNP	1.000	T	15	72
PRKCQ	5588	genome.wustl.edu	37	10	6540493	6540493	+	Missense_Mutation	SNP	G	G	A	rs374126448		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr10:6540493G>A	ENST00000263125.5	-	5	506	c.407C>T	c.(406-408)aCg>aTg	p.T136M	PRKCQ_ENST00000539722.1_Missense_Mutation_p.T11M|PRKCQ_ENST00000397176.2_Missense_Mutation_p.T136M	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	136					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GAAGCCTTCCGTCTCAAATTC	0.517													ENSG00000065675																									Ovarian(50;572 1126 10530 25349 30594)												0								G	MET/THR,MET/THR	1,4405		0,1,2202	159.0	135.0	143.0		407,407	1.6	0.0	10		143	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PRKCQ	NM_001242413.1,NM_006257.3	81,81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,benign	136/644,136/707	6540493	2,13004	2203	4300	6503	SO:0001583	missense	0			-	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.407C>T	10.37:g.6540493G>A	ENSP00000263125:p.Thr136Met		B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T136M	ENST00000263125.5	37	c.407	CCDS7079.1	10	.	.	.	.	.	.	.	.	.	.	G	3.163	-0.171790	0.06421	2.27E-4	1.16E-4	ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722	T;T;T	0.68765	-0.35;-0.29;-0.34	5.62	1.6	0.23607	.	0.574935	0.18767	N	0.131716	T	0.54464	0.1860	L	0.36672	1.1	0.09310	N	1	B;B;B	0.11235	0.004;0.003;0.002	B;B;B	0.12156	0.007;0.002;0.003	T	0.46233	-0.9206	10	0.46703	T	0.11	.	11.3015	0.49309	0.0626:0.0:0.3362:0.6012	.	11;136;136	B4DF52;Q04759-2;Q04759	.;.;KPCT_HUMAN	M	136;136;11	ENSP00000263125:T136M;ENSP00000380361:T136M;ENSP00000441752:T11M	ENSP00000263125:T136M	T	-	2	0	PRKCQ	6580499	0.000000	0.05858	0.009000	0.14445	0.001000	0.01503	-0.204000	0.09425	0.028000	0.15324	-0.126000	0.14955	ACG	-	PRKCQ	-	pirsf_Prot_kin_PKC_delta		0.517	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	HGNC	protein_coding	OTTHUMT00000046665.1	0	0	0	63	63	86	0.00	0.00	G	NM_006257		6540493	-1	5	5	45	38	tier1	no_errors	ENST00000263125	ensembl	human	known	74_37	missense	10.00	11.63	SNP	0.000	A	5	45
SEMA6B	10501	genome.wustl.edu	37	19	4556091	4556091	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr19:4556091C>T	ENST00000586582.1	-	6	690	c.380G>A	c.(379-381)cGa>cAa	p.R127Q	SEMA6B_ENST00000586965.1_Missense_Mutation_p.R127Q|SEMA6B_ENST00000301293.3_Missense_Mutation_p.R127Q	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	127	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		TACGAAGTTTCGACACTCGCC	0.612													ENSG00000167680																																					0													98.0	74.0	82.0					19																	4556091		2203	4300	6503	SO:0001583	missense	0			-	AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.380G>A	19.37:g.4556091C>T	ENSP00000467290:p.Arg127Gln		A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,pfscan_Semap_dom	p.R127Q	ENST00000586582.1	37	c.380	CCDS12131.1	19	.	.	.	.	.	.	.	.	.	.	c	29.4	5.001781	0.93227	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.09538	2.97	3.67	3.67	0.42095	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.068023	0.64402	U	0.000016	T	0.20455	0.0492	L	0.31804	0.96	0.34917	D	0.748043	D;D	0.89917	0.995;1.0	P;D	0.75484	0.864;0.986	T	0.21042	-1.0257	10	0.72032	D	0.01	.	13.2872	0.60249	0.0:1.0:0.0:0.0	.	127;127	B4DT36;Q9H3T3	.;SEM6B_HUMAN	Q	127	ENSP00000301293:R127Q	ENSP00000301292:R127Q	R	-	2	0	SEMA6B	4507091	0.338000	0.24775	0.998000	0.56505	0.703000	0.40648	0.952000	0.29149	2.076000	0.62316	0.298000	0.19748	CGA	-	SEMA6B	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.612	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6B	HGNC	protein_coding	OTTHUMT00000458656.2	0	0	0	61	61	45	0.00	0.00	C	NM_032108		4556091	-1	19	20	57	46	tier1	no_errors	ENST00000301293	ensembl	human	known	74_37	missense	25.00	30.30	SNP	1.000	T	19	57
PTPRH	5794	genome.wustl.edu	37	19	55720830	55720830	+	5'Flank	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr19:55720830G>T	ENST00000376350.3	-	0	0				PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_5'Flank	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GGACCCAGGAGTCCCAGGCCT	0.642													ENSG00000080031																																					0													5.0	6.0	6.0					19																	55720830		2090	4091	6181	SO:0001631	upstream_gene_variant	0			-		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43			19.37:g.55720830G>T	Exception_encountered		C9JCH2|Q15426|Q2NKN9|Q2NKP0	R	SNP	-	NULL	ENST00000376350.3	37	NULL	CCDS33110.1	19																																																																																			-	PTPRH	-	-		0.642	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	0	0	0	14	14	57	0.00	0.00	G			55720830	-1	6	17	27	75	tier1	no_errors	ENST00000587662	ensembl	human	known	74_37	rna	18.18	18.48	SNP	0.124	T	6	27
TLN2	83660	genome.wustl.edu	37	15	63029191	63029191	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr15:63029191G>A	ENST00000561311.1	+	28	3703	c.3473G>A	c.(3472-3474)cGa>cAa	p.R1158Q	TLN2_ENST00000559908.1_3'UTR|TLN2_ENST00000306829.6_Missense_Mutation_p.R1158Q			Q9Y4G6	TLN2_HUMAN	talin 2	1158	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GATTCTGCTCGAGACGTGATG	0.617													ENSG00000171914																																					0													55.0	54.0	54.0					15																	63029191		2203	4300	6503	SO:0001583	missense	0			-	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3473G>A	15.37:g.63029191G>A	ENSP00000453508:p.Arg1158Gln		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.R1158Q	ENST00000561311.1	37	c.3473	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502819	0.64298	.	.	ENSG00000171914	ENST00000306829	T	0.12361	2.69	5.12	5.12	0.69794	.	0.115726	0.56097	D	0.000033	T	0.14917	0.0360	L	0.41824	1.3	0.48830	D	0.999712	B	0.18610	0.029	B	0.09377	0.004	T	0.03344	-1.1046	10	0.40728	T	0.16	-11.5678	18.947	0.92626	0.0:0.0:1.0:0.0	.	1158	Q9Y4G6	TLN2_HUMAN	Q	1158	ENSP00000303476:R1158Q	ENSP00000303476:R1158Q	R	+	2	0	TLN2	60816483	0.990000	0.36364	0.988000	0.46212	0.981000	0.71138	6.467000	0.73547	2.545000	0.85829	0.591000	0.81541	CGA	-	TLN2	-	superfamily_Vinculin/catenin		0.617	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	0	0	0	55	55	47	0.00	0.00	G			63029191	+1	11	4	55	36	tier1	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	16.67	10.00	SNP	0.875	A	11	55
LRRC66	339977	genome.wustl.edu	37	4	52862055	52862055	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr4:52862055G>A	ENST00000343457.3	-	4	1139	c.1133C>T	c.(1132-1134)gCg>gTg	p.A378V		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	378						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						CAGGCACACCGCCAGAGCCAG	0.567													ENSG00000188993																																					0													40.0	43.0	42.0					4																	52862055		1981	4162	6143	SO:0001583	missense	0			-	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1133C>T	4.37:g.52862055G>A	ENSP00000341944:p.Ala378Val			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A378V	ENST00000343457.3	37	c.1133	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	G	17.02	3.283123	0.59867	.	.	ENSG00000188993	ENST00000343457	T	0.47177	0.85	4.67	4.67	0.58626	.	0.000000	0.45867	D	0.000335	T	0.65533	0.2700	M	0.63843	1.955	0.38985	D	0.95903	D	0.89917	1.0	D	0.91635	0.999	T	0.71220	-0.4657	10	0.87932	D	0	-15.966	14.6507	0.68794	0.0:0.0:1.0:0.0	.	378	Q68CR7	LRC66_HUMAN	V	378	ENSP00000341944:A378V	ENSP00000341944:A378V	A	-	2	0	LRRC66	52556812	1.000000	0.71417	0.731000	0.30826	0.188000	0.23474	6.117000	0.71577	2.306000	0.77630	0.467000	0.42956	GCG	-	LRRC66	-	NULL		0.567	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	0	0	0	45	45	66	0.00	0.00	G	NM_001024611		52862055	-1	9	13	44	59	tier1	no_errors	ENST00000343457	ensembl	human	known	74_37	missense	16.67	18.06	SNP	0.974	A	9	44
TP53	7157	genome.wustl.edu	37	17	7578515	7578515	+	Missense_Mutation	SNP	T	T	C	rs137852794		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr17:7578515T>C	ENST00000269305.4	-	5	604	c.415A>G	c.(415-417)Aag>Gag	p.K139E	TP53_ENST00000413465.2_Missense_Mutation_p.K139E|TP53_ENST00000445888.2_Missense_Mutation_p.K139E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.K139E|TP53_ENST00000455263.2_Missense_Mutation_p.K139E|TP53_ENST00000420246.2_Missense_Mutation_p.K139E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	139	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:14660794}.|K -> Q (in sporadic cancers; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K139E(5)|p.A138_P142delAKTCP(4)|p.C135fs*9(3)|p.K139_T140delKT(3)|p.K139Q(2)|p.K139fs*9(2)|p.N131fs*27(2)|p.K139*(2)|p.A138fs*31(1)|p.L137_W146del10(1)|p.K46_T47delKT(1)|p.F134_T140>S(1)|p.A45_P49delAKTCP(1)|p.K7_T8delKT(1)|p.V73fs*9(1)|p.K139fs*31(1)|p.C3fs*9(1)|p.A6_P10delAKTCP(1)|p.A138_V143delAKTCPV(1)|p.K139fs*11(1)|p.K139fs*4(1)|p.C42fs*9(1)|p.K46E(1)|p.Q136_K139delQLAK(1)|p.C135_T140delCQLAKT(1)|p.K139fs*29(1)|p.K7E(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAGGTCTTGGCCAGTTGG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	50	Deletion - In frame(15)|Deletion - Frameshift(13)|Substitution - Missense(9)|Whole gene deletion(8)|Substitution - Nonsense(2)|Insertion - Frameshift(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	ovary(8)|urinary_tract(6)|breast(6)|NS(5)|liver(5)|central_nervous_system(4)|lung(4)|bone(4)|upper_aerodigestive_tract(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|skin(1)|oesophagus(1)											54.0	54.0	54.0					17																	7578515		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.415A>G	17.37:g.7578515T>C	ENSP00000269305:p.Lys139Glu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K139E	ENST00000269305.4	37	c.415	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396596	0.62177	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99812	-6.88;-6.88;-6.88;-6.88;-6.88;-6.88;-6.88;-6.88;-6.88	5.27	4.12	0.48240	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99582	0.9849	M	0.66297	2.02	0.51482	D	0.999927	D;D;P;D;D;D;D	0.76494	0.982;0.998;0.923;0.988;0.999;0.993;0.989	P;D;P;P;D;D;P	0.78314	0.841;0.984;0.846;0.709;0.991;0.991;0.74	D	0.97679	1.0171	10	0.87932	D	0	-25.2607	10.2984	0.43637	0.0:0.0:0.1653:0.8347	.	100;139;139;46;139;139;139	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	139;139;139;139;139;139;128;46;7;46;7;139	ENSP00000410739:K139E;ENSP00000352610:K139E;ENSP00000269305:K139E;ENSP00000398846:K139E;ENSP00000391127:K139E;ENSP00000391478:K139E;ENSP00000425104:K7E;ENSP00000423862:K46E;ENSP00000424104:K139E	ENSP00000269305:K139E	K	-	1	0	TP53	7519240	1.000000	0.71417	0.967000	0.41034	0.120000	0.20174	5.052000	0.64263	2.120000	0.65058	0.533000	0.62120	AAG	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	43	43	61	0.00	0.00	T	NM_000546		7578515	-1	35	52	25	34	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	58.33	60.47	SNP	1.000	C	35	25
BAI3	577	genome.wustl.edu	37	6	69943233	69943233	+	Silent	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr6:69943233C>A	ENST00000370598.1	+	18	3353	c.2532C>A	c.(2530-2532)acC>acA	p.T844T	BAI3_ENST00000238918.8_Silent_p.T50T	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	844	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CTGTGCTTACCGATGCATCCC	0.483													ENSG00000135298																																					0													204.0	182.0	189.0					6																	69943233		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2532C>A	6.37:g.69943233C>A			B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.T844	ENST00000370598.1	37	c.2532	CCDS4968.1	6																																																																																			-	BAI3	-	pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom		0.483	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	0	0	0	62	62	96	0.00	0.00	C			69943233	+1	14	24	53	87	tier1	no_errors	ENST00000370598	ensembl	human	known	74_37	silent	20.90	21.62	SNP	1.000	A	14	53
LCP1	3936	genome.wustl.edu	37	13	46717508	46717508	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr13:46717508G>T	ENST00000398576.2	-	15	1673	c.1285C>A	c.(1285-1287)Ctc>Atc	p.L429I	LCP1_ENST00000435666.2_5'Flank|LCP1_ENST00000323076.2_Missense_Mutation_p.L429I			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	429	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TTTTCATAGAGCTGGAAGATG	0.423			T	BCL6	NHL								ENSG00000136167																												Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	0													144.0	127.0	132.0					13																	46717508		2203	4300	6503	SO:0001583	missense	0			-	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1285C>A	13.37:g.46717508G>T	ENSP00000381581:p.Leu429Ile		B2R613|B4DUA0|Q5TBN4	Missense_Mutation	SNP	pfam_CH-domain,pfam_EF_hand_dom,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.L429I	ENST00000398576.2	37	c.1285	CCDS9403.1	13	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698436	0.88830	.	.	ENSG00000136167	ENST00000323076;ENST00000398576	D;D	0.97575	-4.44;-4.44	5.65	5.65	0.86999	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98172	0.9396	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.97628	1.0140	10	0.37606	T	0.19	-12.3178	12.0752	0.53638	0.0779:0.0:0.9221:0.0	.	429	P13796	PLSL_HUMAN	I	429	ENSP00000315757:L429I;ENSP00000381581:L429I	ENSP00000315757:L429I	L	-	1	0	LCP1	45615509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.061000	0.89467	2.660000	0.90430	0.555000	0.69702	CTC	-	LCP1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.423	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP1	HGNC	protein_coding	OTTHUMT00000044800.3	0	0	0	77	77	125	0.00	0.00	G	NM_002298		46717508	-1	11	24	58	70	tier1	no_errors	ENST00000323076	ensembl	human	known	74_37	missense	15.94	25.53	SNP	1.000	T	11	58
SOX30	11063	genome.wustl.edu	37	5	157075723	157075723	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr5:157075723C>A	ENST00000265007.6	-	2	1490	c.1149G>T	c.(1147-1149)aaG>aaT	p.K383N	SOX30_ENST00000311371.5_Missense_Mutation_p.K383N|SOX30_ENST00000519442.1_Missense_Mutation_p.K78N	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	383					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AATAGGGTTTCTTTTGTTCTT	0.393													ENSG00000039600																									Esophageal Squamous(31;525 799 19355 21125 41744)												0													228.0	245.0	239.0					5																	157075723		2203	4300	6503	SO:0001583	missense	0			-	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1149G>T	5.37:g.157075723C>A	ENSP00000265007:p.Lys383Asn		O94995|Q8IYX6	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K383N	ENST00000265007.6	37	c.1149	CCDS4339.1	5	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685950	0.68157	.	.	ENSG00000039600	ENST00000311371;ENST00000265007;ENST00000519442	D;D;D	0.99515	-6.06;-6.06;-6.06	5.67	5.67	0.87782	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	H	0.97758	4.07	0.42518	D	0.992993	D;D;D	0.76494	0.997;0.999;0.999	D;D;D	0.83275	0.981;0.986;0.996	D	0.97869	1.0285	10	0.87932	D	0	.	11.1967	0.48717	0.0:0.8579:0.0:0.1421	.	78;383;383	B4DXW7;O94993-2;O94993	.;.;SOX30_HUMAN	N	383;383;78	ENSP00000309343:K383N;ENSP00000265007:K383N;ENSP00000427984:K78N	ENSP00000265007:K383N	K	-	3	2	SOX30	157008301	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.729000	0.38115	2.665000	0.90641	0.555000	0.69702	AAG	-	SOX30	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom		0.393	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SOX30	HGNC	protein_coding	OTTHUMT00000252571.2	0	0	0	52	52	129	0.00	0.00	C	NM_007017		157075723	-1	26	29	90	106	tier1	no_errors	ENST00000265007	ensembl	human	known	74_37	missense	22.41	21.48	SNP	1.000	A	26	90
GPR6	2830	genome.wustl.edu	37	6	110300822	110300822	+	Silent	SNP	C	C	G			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr6:110300822C>G	ENST00000275169.3	+	1	525	c.507C>G	c.(505-507)tcC>tcG	p.S169S	GPR6_ENST00000414000.2_Silent_p.S184S	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	169					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		GCTACCTGTCCCTGTATAACG	0.652													ENSG00000146360																																					0													76.0	76.0	76.0					6																	110300822		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.507C>G	6.37:g.110300822C>G			B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR6,prints_GPR_3/6/12_orphan,prints_GPCR_Rhodpsn	p.S184	ENST00000275169.3	37	c.552	CCDS5079.1	6																																																																																			-	GPR6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR_3/6/12_orphan,prints_GPCR_Rhodpsn		0.652	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR6	HGNC	protein_coding	OTTHUMT00000041774.1	0	0	0	38	38	43	0.00	0.00	C			110300822	+1	6	4	52	36	tier1	no_errors	ENST00000414000	ensembl	human	known	74_37	silent	10.34	10.00	SNP	0.895	G	6	52
PIGR	5284	genome.wustl.edu	37	1	207110639	207110639	+	Silent	SNP	G	G	A	rs142351595		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr1:207110639G>A	ENST00000356495.4	-	4	1029	c.846C>T	c.(844-846)gtC>gtT	p.V282V		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	282	Ig-like V-type 3.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGTGTTGACGACCACGTCAC	0.597													ENSG00000162896																																					0								G		0,4406		0,0,2203	80.0	77.0	78.0		846	3.8	0.8	1	dbSNP_134	78	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PIGR	NM_002644.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		282/765	207110639	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.846C>T	1.37:g.207110639G>A			Q68D81|Q8IZY7	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.V282	ENST00000356495.4	37	c.846	CCDS1474.1	1																																																																																			rs142351595	PIGR	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr		0.597	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGR	HGNC	protein_coding	OTTHUMT00000088975.1	0	0	0	43	43	76	0.00	0.00	G	NM_002644		207110639	-1	8	5	43	39	tier1	no_errors	ENST00000356495	ensembl	human	known	74_37	silent	15.69	11.36	SNP	0.767	A	8	43
FAM27L	284123	genome.wustl.edu	37	17	21825355	21825355	+	lincRNA	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr17:21825355C>T	ENST00000426869.3	+	0	59					NR_028336.1		Q8N5T8	FA27L_HUMAN	family with sequence similarity 27-like											central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (53;0.11)|BRCA - Breast invasive adenocarcinoma(1;0.00463)		ccagggttgtcgtagaaacca	0.617													ENSG00000178130																																					0																																												0			-	BC031617		17p11.2	2014-01-28				ENSG00000178130			32410	protein-coding gene	gene with protein product							Standard	NR_028336		Approved	MGC35151	uc002gyz.4	Q8N5T8			17.37:g.21825355C>T				R	SNP	-	NULL	ENST00000426869.3	37	NULL		17																																																																																			-	FAM27L	-	-		0.617	FAM27L-001	KNOWN	basic	lincRNA	FAM27L	HGNC	lincRNA	OTTHUMT00000389059.2	0	0	0	27	27	61	0.00	0.00	C	NM_203392		21825355	+1	4	4	27	33	tier1	no_errors	ENST00000426869	ensembl	human	known	74_37	rna	12.90	10.81	SNP	0.001	T	4	27
SORCS3	22986	genome.wustl.edu	37	10	106970991	106970991	+	Silent	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr10:106970991C>T	ENST00000369701.3	+	17	2585	c.2358C>T	c.(2356-2358)agC>agT	p.S786S	SORCS3_ENST00000369699.4_Silent_p.S72S	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	786					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TTGGTCAAAGCTACCTTAACA	0.468													ENSG00000156395																									NSCLC(116;1497 1690 7108 13108 14106)												0													104.0	84.0	91.0					10																	106970991		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2358C>T	10.37:g.106970991C>T			Q5VXF9|Q9NQJ2	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.S786	ENST00000369701.3	37	c.2358	CCDS7558.1	10																																																																																			-	SORCS3	-	smart_VPS10		0.468	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	0	0	0	42	42	138	0.00	0.00	C	NM_014978		106970991	+1	7	30	20	120	tier1	no_errors	ENST00000369701	ensembl	human	known	74_37	silent	25.93	20.00	SNP	1.000	T	7	20
HNRNPL	3191	genome.wustl.edu	37	19	39329656	39329656	+	Splice_Site	SNP	C	C	G			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr19:39329656C>G	ENST00000221419.5	-	9	1600		c.e9-1		AC104534.3_ENST00000594769.1_Splice_Site|HNRNPL_ENST00000600873.1_Splice_Site	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			TGAATTTCACCTTGGGGAGAG	0.572													ENSG00000104824																																					0													63.0	65.0	64.0					19																	39329656		2203	4300	6503	SO:0001630	splice_region_variant	0			-	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1234-1G>C	19.37:g.39329656C>G			A6ND69|A6NIT8|Q9H3P3	Splice_Site	SNP	-	e9-1	ENST00000221419.5	37	c.1234-1	CCDS33015.1	19	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486950	0.84854	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2309	0.93839	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HNRNPL	44021496	1.000000	0.71417	0.998000	0.56505	0.818000	0.46254	7.561000	0.82288	2.842000	0.97951	0.655000	0.94253	.	-	HNRNPL	-	-		0.572	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPL	HGNC	protein_coding	OTTHUMT00000462670.1	0	0	0	45	45	58	0.00	0.00	C		Intron	39329656	-1	14	12	89	60	tier1	no_errors	ENST00000221419	ensembl	human	known	74_37	splice_site	13.59	16.67	SNP	1.000	G	14	89
SDSL	113675	genome.wustl.edu	37	12	113875883	113875883	+	Nonstop_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr12:113875883G>T	ENST00000403593.4	+	8	1251	c.989G>T	c.(988-990)tGa>tTa	p.*330L	SDSL_ENST00000345635.4_Nonstop_Mutation_p.*330L			Q96GA7	SDSL_HUMAN	serine dehydratase-like	0					cellular amino acid metabolic process (GO:0006520)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|pyridoxal phosphate binding (GO:0030170)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	15						GGCCAGGTCTGAGGGGTCCCA	0.592													ENSG00000139410																																					0													63.0	70.0	68.0					12																	113875883		2203	4300	6503	SO:0001578	stop_lost	0			-	AF134473	CCDS9170.1	12q24.21	2014-06-24				ENSG00000139410			30404	protein-coding gene	gene with protein product						16580895	Standard	NM_138432		Approved	SDS-RS1, cSDH	uc001tvi.3	Q96GA7		ENST00000403593.4:c.989G>T	12.37:g.113875883G>T	ENSP00000385790:p.*330Leuext*64			Nonstop_Mutation	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF	p.*330L	ENST00000403593.4	37	c.989	CCDS9170.1	12	.	.	.	.	.	.	.	.	.	.	G	7.336	0.619970	0.14193	.	.	ENSG00000139410	ENST00000403593;ENST00000345635	.	.	.	4.34	2.42	0.29668	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6173	0.22784	0.241:0.0:0.759:0.0	.	.	.	.	L	330	.	.	X	+	2	2	SDSL	112360266	0.967000	0.33354	0.022000	0.16811	0.011000	0.07611	0.711000	0.25764	0.375000	0.24679	0.561000	0.74099	TGA	-	SDSL	-	NULL		0.592	SDSL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SDSL	HGNC	protein_coding	OTTHUMT00000404782.1	0	0	0	51	51	71	0.00	0.00	G	NM_138432		113875883	+1	8	11	56	43	tier1	no_errors	ENST00000345635	ensembl	human	known	74_37	nonstop	12.50	20.37	SNP	0.242	T	8	56
BRINP2	57795	genome.wustl.edu	37	1	177245380	177245380	+	Silent	SNP	T	T	C			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr1:177245380T>C	ENST00000361539.4	+	6	1134	c.822T>C	c.(820-822)gcT>gcC	p.A274A	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	274	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GCTTTGTAGCTGCAGCACTCA	0.547													ENSG00000198797																																					0													70.0	61.0	64.0					1																	177245380		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.822T>C	1.37:g.177245380T>C			O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	pfam_MACPF,smart_MACPF	p.A274	ENST00000361539.4	37	c.822	CCDS1320.1	1																																																																																			-	BRINP2	-	smart_MACPF		0.547	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	HGNC	protein_coding	OTTHUMT00000084599.1	0	0	0	58	58	18	0.00	0.00	T	NM_021165		177245380	+1	13	3	37	10	tier1	no_errors	ENST00000361539	ensembl	human	known	74_37	silent	26.00	23.08	SNP	0.001	C	13	37
TEX2	55852	genome.wustl.edu	37	17	62223815	62223815	+	IGR	SNP	A	A	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr17:62223815A>T	ENST00000583097.1	-	0	4852				SNORA76_ENST00000408535.2_lincRNA|SNORD104_ENST00000362883.1_RNA			Q8IWB9	TEX2_HUMAN	testis expressed 2						signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CGGCCTTTTTAACCGCGAGCG	0.617													ENSG00000266402																																					0													119.0	126.0	124.0					17																	62223815		876	1991	2867	SO:0001628	intergenic_variant	0			-	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9			17.37:g.62223815A>T			Q6AHZ5|Q8N3L0|Q9C0C5	R	SNP	-	NULL	ENST00000583097.1	37	NULL		17																																																																																			-	SNORA76	-	-		0.617	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	SNORA76	HGNC	protein_coding	OTTHUMT00000443745.1	0	0	0	45	45	48	0.00	0.00	A	NM_018469		62223815	+1	34	19	28	20	tier1	no_errors	ENST00000408535	ensembl	human	known	74_37	rna	54.84	48.72	SNP	1.000	T	34	28
FLNB	2317	genome.wustl.edu	37	3	58120362	58120362	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr3:58120362C>T	ENST00000295956.4	+	27	4699	c.4534C>T	c.(4534-4536)Ctt>Ttt	p.L1512F	FLNB_ENST00000358537.3_Missense_Mutation_p.L1512F|FLNB_ENST00000429972.2_Missense_Mutation_p.L1512F|FLNB_ENST00000348383.5_Missense_Mutation_p.L1512F|FLNB_ENST00000493452.1_Missense_Mutation_p.L1343F|FLNB_ENST00000419752.2_Missense_Mutation_p.L1343F|FLNB_ENST00000490882.1_Missense_Mutation_p.L1543F|FLNB_ENST00000357272.4_Missense_Mutation_p.L1512F	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1512					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGTCAAGGTCCTTCCCACATA	0.493													ENSG00000136068																																					0													201.0	188.0	192.0					3																	58120362		2203	4300	6503	SO:0001583	missense	0			-	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.4534C>T	3.37:g.58120362C>T	ENSP00000295956:p.Leu1512Phe		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.L1512F	ENST00000295956.4	37	c.4534	CCDS2885.1	3	.	.	.	.	.	.	.	.	.	.	C	19.92	3.915833	0.73098	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.92348	-3.02;-3.02;-2.99;-3.02;-3.02;-3.02;-2.99;-3.02	5.81	5.81	0.92471	Immunoglobulin E-set (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.95494	0.8536	M	0.76838	2.35	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;0.997;0.997;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.994;0.98;0.996;0.998;0.998;0.998	D	0.94507	0.7715	10	0.40728	T	0.16	.	13.298	0.60309	0.0:0.928:0.0:0.072	.	1512;1543;1343;1343;1512;1512	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	F	1512;1543;1512;1512;1512;1512;1343;1343	ENSP00000295956:L1512F;ENSP00000420213:L1543F;ENSP00000351339:L1512F;ENSP00000415599:L1512F;ENSP00000232447:L1512F;ENSP00000349819:L1512F;ENSP00000418510:L1343F;ENSP00000414532:L1343F	ENSP00000295956:L1512F	L	+	1	0	FLNB	58095402	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.674000	0.46867	2.738000	0.93877	0.655000	0.94253	CTT	-	FLNB	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.493	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	0	0	0	67	67	80	0.00	0.00	C	NM_001457		58120362	+1	23	14	60	49	tier1	no_errors	ENST00000295956	ensembl	human	known	74_37	missense	27.71	22.22	SNP	1.000	T	23	60
NGB	58157	genome.wustl.edu	37	14	77732947	77732947	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr14:77732947G>A	ENST00000298352.4	-	4	762	c.388C>T	c.(388-390)Cgg>Tgg	p.R130W	MIR1260A_ENST00000408827.1_RNA	NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	130	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		CAGGCAGCCCGTGTGGCTGGT	0.632													ENSG00000165553																																					0													54.0	49.0	51.0					14																	77732947		2203	4300	6503	SO:0001583	missense	0			-	AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.388C>T	14.37:g.77732947G>A	ENSP00000298352:p.Arg130Trp			Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin	p.R130W	ENST00000298352.4	37	c.388	CCDS9856.1	14	.	.	.	.	.	.	.	.	.	.	G	15.19	2.761353	0.49468	.	.	ENSG00000165553	ENST00000298352	.	.	.	4.76	-0.357	0.12579	Globin-like (1);Globin, structural domain (1);	0.115150	0.64402	D	0.000012	T	0.46502	0.1396	M	0.68952	2.095	0.26678	N	0.971606	D	0.61697	0.99	P	0.48304	0.573	T	0.55029	-0.8204	9	0.72032	D	0.01	.	14.6407	0.68723	0.0:0.0:0.4725:0.5275	.	130	Q9NPG2	NGB_HUMAN	W	130	.	ENSP00000298352:R130W	R	-	1	2	NGB	76802700	0.981000	0.34729	0.003000	0.11579	0.542000	0.35054	2.294000	0.43567	0.031000	0.15407	-0.397000	0.06425	CGG	-	NGB	-	superfamily_Globin-like,pfscan_Globin		0.632	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGB	HGNC	protein_coding	OTTHUMT00000414194.1	0	0	0	68	68	22	0.00	0.00	G	NM_021257		77732947	-1	17	2	68	11	tier1	no_errors	ENST00000298352	ensembl	human	known	74_37	missense	20.00	15.38	SNP	0.054	A	17	68
FKBP9P1	360132	genome.wustl.edu	37	7	55750501	55750501	+	RNA	SNP	G	G	A	rs200141514		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:55750501G>A	ENST00000455909.1	-	0	716					NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5						CCACCTGGGCGTGAATGTACT	0.537													ENSG00000176826																																					0													39.0	39.0	39.0					7																	55750501		692	1590	2282			0			-																													7.37:g.55750501G>A			B2R7H1	R	SNP	-	NULL	ENST00000455909.1	37	NULL		7																																																																																			rs200141514	FKBP9L	-	-		0.537	FKBP9L-002	KNOWN	basic	processed_transcript	FKBP9L	HGNC	pseudogene	OTTHUMT00000251473.2	0	0	0	62	62	57	0.00	0.00	G			55750501	-1	34	24	74	38	tier1	no_errors	ENST00000455909	ensembl	human	known	74_37	rna	31.19	38.71	SNP	0.951	A	34	74
PCDH11Y	83259	genome.wustl.edu	37	Y	4967352	4967352	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chrY:4967352G>T	ENST00000333703.4	+	5	2213	c.1700G>T	c.(1699-1701)gGg>gTg	p.G567V	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.G578V|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.G578V	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	578	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AAAGATAATGGGGTACCACCC	0.378													ENSG00000099715																																					0																																										SO:0001583	missense	0			-	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1700G>T	Y.37:g.4967352G>T	ENSP00000330552:p.Gly567Val		Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G578V	ENST00000333703.4	37	c.1733	CCDS14776.1	Y																																																																																			-	PCDH11Y	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.378	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH11Y	HGNC	protein_coding	OTTHUMT00000084979.2	0	0	0	16	16	45	0.00	0.00	G	NM_032973		4967352	+1	6	22	5	25	tier1	no_errors	ENST00000215473	ensembl	human	known	74_37	missense	54.55	46.81	SNP	0.997	T	6	5
HYDIN	54768	genome.wustl.edu	37	16	70926319	70926319	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr16:70926319A>T	ENST00000393567.2	-	56	9512	c.9362T>A	c.(9361-9363)tTc>tAc	p.F3121Y		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3121					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGCATGGAAGAAAACTTGGAC	0.463													ENSG00000157423																																					0													147.0	158.0	154.0					16																	70926319		1869	4097	5966	SO:0001583	missense	0			-	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.9362T>A	16.37:g.70926319A>T	ENSP00000377197:p.Phe3121Tyr		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.F3121Y	ENST00000393567.2	37	c.9362	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	A	11.86	1.765338	0.31228	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00848	5.62	4.86	1.36	0.22044	.	1.206350	0.06741	U	0.778335	T	0.00845	0.0028	L	0.44542	1.39	0.09310	N	1	P	0.43788	0.817	B	0.30716	0.119	T	0.47509	-0.9112	10	0.12430	T	0.62	.	7.4832	0.27417	0.7313:0.0:0.2687:0.0	.	3120	F8WD23	.	Y	3121;3120	ENSP00000377197:F3121Y	ENSP00000313052:F3120Y	F	-	2	0	HYDIN	69483820	0.037000	0.19845	0.480000	0.27341	0.512000	0.34134	0.817000	0.27281	0.693000	0.31634	0.358000	0.22013	TTC	-	HYDIN	-	NULL		0.463	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	0	0	0	112	112	181	0.00	0.00	A			70926319	-1	9	21	98	154	tier1	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	8.41	12.00	SNP	0.012	T	9	98
GRM3	2913	genome.wustl.edu	37	7	86415655	86415655	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr7:86415655C>T	ENST00000361669.2	+	3	1646	c.547C>T	c.(547-549)Cgc>Tgc	p.R183C	GRM3_ENST00000536043.1_Missense_Mutation_p.R55C|GRM3_ENST00000546348.1_Intron|AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000439827.1_Missense_Mutation_p.R183C|GRM3_ENST00000394720.2_Missense_Mutation_p.R181C|AC005009.2_ENST00000418031.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	183					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R183C(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGATAAGTCGCGCTATGATTA	0.562													ENSG00000198822																									GBM(52;969 1098 3139 52280)												1	Substitution - Missense(1)	pancreas(1)											134.0	129.0	131.0					7																	86415655		2203	4300	6503	SO:0001583	missense	0			-		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.547C>T	7.37:g.86415655C>T	ENSP00000355316:p.Arg183Cys		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.R183C	ENST00000361669.2	37	c.547	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837511	0.91117	.	.	ENSG00000198822	ENST00000361669;ENST00000454217;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93	5.83	5.83	0.93111	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.94722	0.8297	M	0.93808	3.46	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.95413	0.8500	10	0.87932	D	0	.	19.122	0.93367	0.0:1.0:0.0:0.0	.	55;183;183	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	C	183;55;55;183;181	ENSP00000355316:R183C;ENSP00000405427:R55C;ENSP00000441407:R55C;ENSP00000398767:R183C;ENSP00000378209:R181C	ENSP00000355316:R183C	R	+	1	0	GRM3	86253591	1.000000	0.71417	0.968000	0.41197	0.981000	0.71138	4.667000	0.61561	2.770000	0.95276	0.655000	0.94253	CGC	-	GRM3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3		0.562	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	0	0	0	51	51	79	0.00	0.00	C			86415655	+1	32	41	59	53	tier1	no_errors	ENST00000361669	ensembl	human	known	74_37	missense	35.16	43.62	SNP	1.000	T	32	59
USP47	55031	genome.wustl.edu	37	11	11970051	11970052	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr11:11970051_11970052insA	ENST00000399455.2	+	23	3474_3475	c.3354_3355insA	c.(3355-3357)aaafs	p.K1119fs	USP47_ENST00000339865.5_Frame_Shift_Ins_p.K1031fs|USP47_ENST00000527733.1_Frame_Shift_Ins_p.K1099fs|USP47_ENST00000539466.1_5'UTR	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	1119					base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		GGAGAGCACTTAAAAAAGGAGA	0.307													ENSG00000170242																																					0																																										SO:0001589	frameshift_variant	0				AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.3360dupA	11.37:g.11970057_11970057dupA	ENSP00000382382:p.Lys1119fs		B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Frame_Shift_Ins	INS	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.G1120fs	ENST00000399455.2	37	c.3354_3355		11																																																																																				USP47	-	NULL		0.307	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	USP47	HGNC	protein_coding	OTTHUMT00000385853.2	0	0	0	21	21	84	0.00	0.00	-	NM_017944		11970052	+1	5	19	13	70	tier1	no_errors	ENST00000399455	ensembl	human	known	74_37	frame_shift_ins	27.78	21.35	INS	0.999:1.000	A	5	13
ATP12A	479	genome.wustl.edu	37	13	25265371	25265371	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr13:25265371C>T	ENST00000381946.3	+	8	1218	c.1051C>T	c.(1051-1053)Ctc>Ttc	p.L351F	ATP12A_ENST00000218548.6_Missense_Mutation_p.L357F			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	351					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GCCCGAGGGCCTCCTGGCCAC	0.562													ENSG00000075673																									Pancreas(156;1582 1935 18898 22665 26498)												0													69.0	52.0	58.0					13																	25265371		2203	4300	6503	SO:0001583	missense	0			-	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1051C>T	13.37:g.25265371C>T	ENSP00000371372:p.Leu351Phe		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.L357F	ENST00000381946.3	37	c.1069	CCDS31948.1	13	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195914	0.58126	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.97598	-4.45;-4.45	5.16	4.32	0.51571	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.64402	D	0.000008	D	0.98741	0.9577	H	0.96604	3.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98703	1.0701	10	0.87932	D	0	.	7.7346	0.28806	0.0:0.8168:0.0:0.1832	.	357;351	P54707-2;P54707	.;AT12A_HUMAN	F	357;351	ENSP00000218548:L357F;ENSP00000371372:L351F	ENSP00000218548:L357F	L	+	1	0	ATP12A	24163371	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	5.732000	0.68563	1.414000	0.47017	0.462000	0.41574	CTC	-	ATP12A	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase		0.562	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	HGNC	protein_coding	OTTHUMT00000044199.1	0	0	0	29	29	10	0.00	0.00	C	NM_001676		25265371	+1	14	7	17	5	tier1	no_errors	ENST00000218548	ensembl	human	known	74_37	missense	45.16	58.33	SNP	1.000	T	14	17
CHD1	1105	genome.wustl.edu	37	5	98236915	98236915	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr5:98236915C>A	ENST00000284049.3	-	5	711	c.562G>T	c.(562-564)Gtc>Ttc	p.V188F		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	188					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CTGCTTTTGACTTTGTTTTTT	0.348													ENSG00000153922																																					0													212.0	201.0	205.0					5																	98236915		2203	4300	6503	SO:0001583	missense	0			-	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.562G>T	5.37:g.98236915C>A	ENSP00000284049:p.Val188Phe		Q17RZ3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V188F	ENST00000284049.3	37	c.562	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323230	0.60634	.	.	ENSG00000153922	ENST00000284049;ENST00000540681	D	0.89939	-2.59	5.76	4.0	0.46444	.	0.000000	0.30639	U	0.009192	D	0.87059	0.6083	L	0.36672	1.1	0.48830	D	0.999713	D	0.56287	0.975	P	0.50754	0.649	D	0.86389	0.1734	10	0.56958	D	0.05	.	11.4402	0.50092	0.0:0.8762:0.0:0.1238	.	188	O14646	CHD1_HUMAN	F	188	ENSP00000284049:V188F	ENSP00000284049:V188F	V	-	1	0	CHD1	98264815	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.558000	0.45879	0.906000	0.36621	0.650000	0.86243	GTC	-	CHD1	-	NULL		0.348	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	HGNC	protein_coding	OTTHUMT00000370295.1	0	0	0	52	52	129	0.00	0.00	C	NM_001270		98236915	-1	9	9	103	113	tier1	no_errors	ENST00000284049	ensembl	human	known	74_37	missense	8.04	7.38	SNP	1.000	A	9	103
TLR1	7096	genome.wustl.edu	37	4	38798892	38798892	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr4:38798892C>A	ENST00000502213.2	-	3	1790	c.1561G>T	c.(1561-1563)Gca>Tca	p.A521S	TLR1_ENST00000308979.2_Missense_Mutation_p.A521S|TLR1_ENST00000510552.1_5'Flank			Q15399	TLR1_HUMAN	toll-like receptor 1	521					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TTGTCCCCTGCTTTTATTGAC	0.428													ENSG00000174125																									GBM(5;216 373 40795 46382)												0													194.0	202.0	199.0					4																	38798892		2203	4300	6503	SO:0001583	missense	0			-	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1561G>T	4.37:g.38798892C>A	ENSP00000421259:p.Ala521Ser		D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.A521S	ENST00000502213.2	37	c.1561	CCDS33973.1	4	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479150	0.63849	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.18810	2.19;2.19	4.75	4.75	0.60458	.	0.000000	0.64402	D	0.000005	T	0.41096	0.1144	M	0.89287	3.02	0.42647	D	0.993434	D	0.61080	0.989	P	0.47251	0.542	T	0.58222	-0.7674	10	0.87932	D	0	.	18.3059	0.90180	0.0:1.0:0.0:0.0	.	521	Q15399	TLR1_HUMAN	S	521	ENSP00000354932:A521S;ENSP00000421259:A521S	ENSP00000354932:A521S	A	-	1	0	TLR1	38475287	0.999000	0.42202	0.759000	0.31340	0.919000	0.55068	4.579000	0.60936	2.636000	0.89361	0.650000	0.86243	GCA	-	TLR1	-	pirsf_Toll-like_receptor		0.428	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	HGNC	protein_coding	OTTHUMT00000360510.3	0	0	0	98	98	69	0.00	0.00	C			38798892	-1	13	9	99	96	tier1	no_errors	ENST00000308979	ensembl	human	known	74_37	missense	11.61	8.57	SNP	0.887	A	13	99
NLRP4	147945	genome.wustl.edu	37	19	56369584	56369584	+	Silent	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr19:56369584G>T	ENST00000301295.6	+	3	1247	c.825G>T	c.(823-825)ctG>ctT	p.L275L	NLRP4_ENST00000587891.1_Silent_p.L200L|NLRP4_ENST00000346986.5_Silent_p.L275L	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	275	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AGGCCTCCCTGCTCATCGCTA	0.562													ENSG00000160505																																					0													67.0	74.0	72.0					19																	56369584		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.825G>T	19.37:g.56369584G>T			Q86W87|Q96AY6	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.L275	ENST00000301295.6	37	c.825	CCDS12936.1	19																																																																																			-	NLRP4	-	superfamily_P-loop_NTPase,pfscan_CHT_NTPase		0.562	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	0	0	1	61	61	106	0.00	0.93	G	NM_134444		56369584	+1	8	7	80	134	tier1	no_errors	ENST00000301295	ensembl	human	known	74_37	silent	9.09	4.96	SNP	0.965	T	8	80
RPL3L	6123	genome.wustl.edu	37	16	2003015	2003015	+	Silent	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr16:2003015C>T	ENST00000268661.7	-	3	319	c.225G>A	c.(223-225)gcG>gcA	p.A75A	RPL3L_ENST00000566484.1_5'Flank	NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like	75					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						CAATTGTCACCGCCTCCACCT	0.617													ENSG00000140986																																					0													59.0	52.0	54.0					16																	2003015		2199	4300	6499	SO:0001819	synonymous_variant	0			-	U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685	ENST00000268661.7:c.225G>A	16.37:g.2003015C>T				Silent	SNP	pfam_Ribosomal_L3,superfamily_Transl_B-barrel	p.A75	ENST00000268661.7	37	c.225	CCDS10450.1	16																																																																																			-	RPL3L	-	pfam_Ribosomal_L3,superfamily_Transl_B-barrel		0.617	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL3L	HGNC	protein_coding	OTTHUMT00000250582.2	0	0	0	32	32	76	0.00	0.00	C	NM_005061		2003015	-1	9	6	60	55	tier1	no_errors	ENST00000268661	ensembl	human	known	74_37	silent	13.04	9.84	SNP	0.002	T	9	60
GSTCD	79807	genome.wustl.edu	37	4	106763272	106763272	+	Silent	SNP	A	A	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr4:106763272A>T	ENST00000515279.1	+	11	1966	c.1746A>T	c.(1744-1746)ccA>ccT	p.P582P	GSTCD_ENST00000394728.3_Silent_p.P582P|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000394730.3_Silent_p.P495P|GSTCD_ENST00000360505.5_Silent_p.P582P			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	582						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		TCCAGCTCCCACCCCAACGAA	0.413													ENSG00000138780																																					0													111.0	104.0	106.0					4																	106763272		1903	4133	6036	SO:0001819	synonymous_variant	0			-	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1746A>T	4.37:g.106763272A>T			A8K8J0|A8MVD3|H9KV97|Q9H8S3	Silent	SNP	pfam_rR_ssu_MeTfrase_G,pfam_Small_mtfrase_dom,superfamily_Glutathione-S-Trfase_C-like	p.P582	ENST00000515279.1	37	c.1746	CCDS43257.1	4																																																																																			-	GSTCD	-	NULL		0.413	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	HGNC	protein_coding	OTTHUMT00000363981.1	0	0	0	24	24	91	0.00	0.00	A	NM_024751		106763272	+1	8	9	37	128	tier1	no_errors	ENST00000360505	ensembl	human	known	74_37	silent	17.78	6.52	SNP	0.729	T	8	37
PSD2	84249	genome.wustl.edu	37	5	139197095	139197095	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr5:139197095A>T	ENST00000274710.3	+	5	1251	c.1046A>T	c.(1045-1047)gAg>gTg	p.E349V		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	349	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGCCGGGGAGTACCTCAGT	0.572													ENSG00000146005																																					0													96.0	89.0	91.0					5																	139197095		2203	4300	6503	SO:0001583	missense	0			-	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1046A>T	5.37:g.139197095A>T	ENSP00000274710:p.Glu349Val		D3DQD3|Q8N3J8	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.E349V	ENST00000274710.3	37	c.1046	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	a	25.8	4.675403	0.88445	.	.	ENSG00000146005	ENST00000274710	T	0.57907	0.37	4.5	4.5	0.54988	SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.77246	0.4102	H	0.94503	3.545	0.80722	D	1	P	0.45348	0.856	P	0.58660	0.843	D	0.83994	0.0339	10	0.87932	D	0	.	14.1354	0.65284	1.0:0.0:0.0:0.0	.	349	Q9BQI7	PSD2_HUMAN	V	349	ENSP00000274710:E349V	ENSP00000274710:E349V	E	+	2	0	PSD2	139177279	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.756000	0.91651	1.794000	0.52575	0.378000	0.23410	GAG	-	PSD2	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom		0.572	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	0	0	0	71	71	88	0.00	0.00	A	NM_032289		139197095	+1	11	6	119	105	tier1	no_errors	ENST00000274710	ensembl	human	known	74_37	missense	8.40	5.41	SNP	1.000	T	11	119
MMAA	166785	genome.wustl.edu	37	4	146575181	146575181	+	Silent	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr4:146575181G>T	ENST00000281317.5	+	6	2065	c.855G>T	c.(853-855)ctG>ctT	p.L285L	MMAA_ENST00000541599.1_Silent_p.L4L	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	285					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGCAGATCTGGTAGCTGTAA	0.403													ENSG00000151611																																					0													207.0	201.0	203.0					4																	146575181		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.855G>T	4.37:g.146575181G>T			B3KX40|Q495G7	Missense_Mutation	SNP	pfam_ArgK,superfamily_P-loop_NTPase	p.G257C	ENST00000281317.5	37	c.769	CCDS3766.1	4																																																																																			-	MMAA	-	NULL		0.403	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMAA	HGNC	protein_coding	OTTHUMT00000364668.2	0	0	0	41	41	73	0.00	0.00	G			146575181	+1	6	5	66	64	tier1	no_errors	ENST00000511969	ensembl	human	known	74_37	missense	8.33	7.25	SNP	1.000	T	6	66
TMCC3	57458	genome.wustl.edu	37	12	94975900	94975900	+	Missense_Mutation	SNP	G	G	A	rs374305237		TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr12:94975900G>A	ENST00000261226.4	-	2	624	c.493C>T	c.(493-495)Cgc>Tgc	p.R165C	TMCC3_ENST00000551457.1_Missense_Mutation_p.R134C	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	165						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						TTCAAAGAGCGATGTATATCC	0.498													ENSG00000057704																																					0													99.0	102.0	101.0					12																	94975900		2203	4300	6503	SO:0001583	missense	0			-	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.493C>T	12.37:g.94975900G>A	ENSP00000261226:p.Arg165Cys		Q8IWB2	Missense_Mutation	SNP	pfam_Predicted_TM_coiled-coil_2	p.R165C	ENST00000261226.4	37	c.493	CCDS31877.1	12	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342027	0.41498	.	.	ENSG00000057704	ENST00000261226;ENST00000551457	T;T	0.44482	0.92;0.92	4.65	3.76	0.43208	.	0.525520	0.23828	N	0.044165	T	0.32496	0.0831	L	0.29908	0.895	0.32110	N	0.589425	B	0.23591	0.088	B	0.17979	0.02	T	0.47018	-0.9149	10	0.87932	D	0	-12.1157	14.1137	0.65139	0.0738:0.0:0.9262:0.0	.	165	Q9ULS5	TMCC3_HUMAN	C	165;134	ENSP00000261226:R165C;ENSP00000449888:R134C	ENSP00000261226:R165C	R	-	1	0	TMCC3	93500031	0.831000	0.29352	0.199000	0.23439	0.787000	0.44495	3.675000	0.54605	1.572000	0.49736	0.561000	0.74099	CGC	-	TMCC3	-	pfam_Predicted_TM_coiled-coil_2		0.498	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC3	HGNC	protein_coding	OTTHUMT00000408113.1	0	0	0	54	54	96	0.00	0.00	G	NM_020698		94975900	-1	7	6	68	92	tier1	no_errors	ENST00000261226	ensembl	human	known	74_37	missense	9.33	6.12	SNP	0.935	A	7	68
DIDO1	11083	genome.wustl.edu	37	20	61512209	61512209	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr20:61512209delT	ENST00000266070.4	-	16	5424	c.5099delA	c.(5098-5100)tatfs	p.Y1700fs	DIDO1_ENST00000395343.1_Frame_Shift_Del_p.Y1700fs	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1700					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TGGGTCCTCATACTGGGCTGA	0.652													ENSG00000101191																									Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													53.0	61.0	58.0					20																	61512209		2203	4300	6503	SO:0001589	frameshift_variant	0				AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5099delA	20.37:g.61512209delT	ENSP00000266070:p.Tyr1700fs		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Frame_Shift_Del	DEL	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.Y1700fs	ENST00000266070.4	37	c.5099	CCDS33506.1	20																																																																																				DIDO1	-	NULL		0.652	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	0	0	0	42	42	34	0.00	0.00	T	NM_080796		61512209	-1	10	4	68	42	tier1	no_errors	ENST00000266070	ensembl	human	known	74_37	frame_shift_del	12.82	8.70	DEL	0.475	-	10	68
ECEL1P2	347694	genome.wustl.edu	37	2	233251555	233251555	+	RNA	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr2:233251555G>A	ENST00000461596.1	-	0	199					NR_028501.1				endothelin converting enzyme-like 1, pseudogene 2																		CCGCCGCGCCGCGCAGGTCCC	0.662													ENSG00000244280																																					0																																												0			-	BC067110		2q37.1	2013-01-17			ENSG00000244280	ENSG00000244280			14019	pseudogene	pseudogene						11352565, 10698686	Standard	NR_028501		Approved	ECEL2	uc021vyg.2		OTTHUMG00000153343		2.37:g.233251555G>A				R	SNP	-	NULL	ENST00000461596.1	37	NULL		2																																																																																			-	ECEL1P2	-	-		0.662	ECEL1P2-002	PUTATIVE	mRNA_end_NF|basic	processed_transcript	ECEL1P2	HGNC	pseudogene	OTTHUMT00000330820.1	0	0	0	61	61	14	0.00	0.00	G	NR_028501		233251555	-1	6	0	64	7	tier1	no_errors	ENST00000461596	ensembl	human	putative	74_37	rna	8.57	0.00	SNP	1.000	A	6	64
HIST2H2BF	440689	genome.wustl.edu	37	1	149783702	149783702	+	Silent	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr1:149783702G>A	ENST00000369167.1	-	1	212	c.177C>T	c.(175-177)gcC>gcT	p.A59A	HIST2H2BF_ENST00000469483.1_5'UTR|HIST2H2BF_ENST00000545683.1_Silent_p.A59A|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000427880.2_Silent_p.A59A	NM_001024599.4	NP_001019770.1	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf	59					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)					TGATGCCCATGGCCTTGGACG	0.607													ENSG00000203814																																					0													136.0	125.0	129.0					1																	149783702		2203	4297	6500	SO:0001819	synonymous_variant	0			-	BC110793	CCDS30846.1, CCDS53359.1	1q21.2	2013-06-03	2006-10-11		ENSG00000203814	ENSG00000203814		"""Histones / Replication-dependent"""	24700	protein-coding gene	gene with protein product			"""histone 2, H2bf"""				Standard	NM_001161334		Approved		uc010pbj.2	Q5QNW6	OTTHUMG00000183159	ENST00000369167.1:c.177C>T	1.37:g.149783702G>A			A8K0U9|B4DLA9	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.A59	ENST00000369167.1	37	c.177	CCDS30846.1	1																																																																																			-	HIST2H2BF	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B		0.607	HIST2H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2BF	HGNC	protein_coding	OTTHUMT00000033453.2	0	0	0	110	110	5	0.00	0.00	G	NM_001024599		149783702	-1	90	1	67	0	tier1	no_errors	ENST00000427880	ensembl	human	known	74_37	silent	57.32	100.00	SNP	1.000	A	90	67
RP11-754I20.1	0	genome.wustl.edu	37	14	19114730	19114730	+	RNA	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr14:19114730G>T	ENST00000553170.1	+	0	82																											GCTGTGCAATGCCAGAGGGAA	0.328													ENSG00000215398																																					0																																												0			-																													14.37:g.19114730G>T				R	SNP	-	NULL	ENST00000553170.1	37	NULL		14																																																																																			-	RP11-754I20.1	-	-		0.328	RP11-754I20.1-002	KNOWN	basic	processed_transcript	ENSG00000215398	Clone_based_vega_gene	pseudogene	OTTHUMT00000408394.1	0	0	0	196	196	1	0.00	0.00	G			19114730	+1	18	0	142	1	tier1	no_errors	ENST00000553170	ensembl	human	known	74_37	rna	11.25	0.00	SNP	1.000	T	18	142
KRTAP5-2	440021	genome.wustl.edu	37	11	1619355	1619355	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr11:1619355A>T	ENST00000412090.1	-	1	169	c.126T>A	c.(124-126)tgT>tgA	p.C42*	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	42						keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCAGCCCCCACAGCCAGAGC	0.682													ENSG00000205867																																					0													35.0	44.0	41.0					11																	1619355		2168	4234	6402	SO:0001587	stop_gained	0			-	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.126T>A	11.37:g.1619355A>T	ENSP00000400041:p.Cys42*		A9JTZ1	Nonsense_Mutation	SNP	NULL	p.C42*	ENST00000412090.1	37	c.126	CCDS31331.1	11	.	.	.	.	.	.	.	.	.	.	-	29.2	4.983474	0.93044	.	.	ENSG00000205867	ENST00000412090	.	.	.	3.13	-2.24	0.06909	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.0584	0.09827	0.3419:0.3026:0.3556:0.0	.	.	.	.	X	42	.	ENSP00000400041:C42X	C	-	3	2	KRTAP5-2	1575931	0.000000	0.05858	0.735000	0.30896	0.706000	0.40770	-0.196000	0.09532	-0.367000	0.08052	0.367000	0.22151	TGT	-	KRTAP5-2	-	NULL		0.682	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-2	HGNC	protein_coding	OTTHUMT00000384775.1	0	0	0	84	84	3	0.00	0.00	A	NM_001004325		1619355	-1	22	0	65	1	tier1	no_errors	ENST00000412090	ensembl	human	known	74_37	nonsense	23.91	0.00	SNP	0.868	T	22	65
RP11-435B5.5	0	genome.wustl.edu	37	1	143378853	143378853	+	lincRNA	SNP	C	C	T	rs200183428	byFrequency	TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr1:143378853C>T	ENST00000428624.1	+	0	1573				RP11-435B5.4_ENST00000423249.1_lincRNA|RP11-435B5.3_ENST00000430699.1_lincRNA																							AGCTAATGAACGAATGTGATC	0.313													ENSG00000238261																																					0																																												0			-																													1.37:g.143378853C>T				R	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			rs200183428	RP11-435B5.5	-	-		0.313	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	1	1	0	144	144	0	0.69	0.00	C			143378853	+1	6	0	31	0	tier1	no_errors	ENST00000423394	ensembl	human	known	74_37	rna	16.22	0.00	SNP	0.001	T	6	31
RP11-166B2.1	0	genome.wustl.edu	37	16	12021609	12021609	+	Missense_Mutation	SNP	G	G	A	rs560635478	byFrequency	TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr16:12021609G>A	ENST00000399147.4	-	8	814	c.815C>T	c.(814-816)aCt>aTt	p.T272I																	lung(2)	2						GGAGTTATCAGTTATAGAATG	0.517													ENSG00000234719	g|||	2	0.000399361	0.0008	0.0	5008	,	,		22132	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001583	missense	0			-																												ENST00000399147.4:c.815C>T	16.37:g.12021609G>A	ENSP00000382101:p.Thr272Ile			Missense_Mutation	SNP	NULL	p.T272I	ENST00000399147.4	37	c.815		16	.	.	.	.	.	.	.	.	.	.	g	1.198	-0.633299	0.03584	.	.	ENSG00000234719	ENST00000399147;ENST00000547494	T;T	0.42513	0.97;0.97	.	.	.	.	.	.	.	.	T	0.51941	0.1704	.	.	.	.	.	.	.	.	.	.	.	.	T	0.67440	-0.5670	2	0.87932	D	0	.	.	.	.	.	.	.	.	I	272;255	ENSP00000382101:T272I;ENSP00000448752:T255I	ENSP00000382101:T272I	T	-	2	0	RP11-166B2.1	11929110	0.274000	0.24191	.	.	.	.	0.075000	0.14686	.	.	.	.	ACT	-	RP11-166B2.1	-	NULL		0.517	RP11-166B2.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000234719	Clone_based_vega_gene	protein_coding	OTTHUMT00000388781.3	0	0	0	37	37	3	0.00	0.00	G			12021609	-1	5	2	30	1	tier1	no_errors	ENST00000399147	ensembl	human	putative	74_37	missense	13.89	66.67	SNP	0.000	A	5	30
PCDHB6	56130	genome.wustl.edu	37	5	140531234	140531234	+	Silent	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr5:140531234C>T	ENST00000231136.1	+	1	1396	c.1396C>T	c.(1396-1398)Ctg>Ttg	p.L466L	PCDHB6_ENST00000543635.1_Silent_p.L330L	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	466	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGCCCCGCCCTGCACATCGG	0.637													ENSG00000113211																																					0													83.0	94.0	90.0					5																	140531234		2203	4298	6501	SO:0001819	synonymous_variant	0			-	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1396C>T	5.37:g.140531234C>T			B2R8R9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L466	ENST00000231136.1	37	c.1396	CCDS4248.1	5																																																																																			-	PCDHB6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.637	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	0	0	0	108	108	4	0.00	0.00	C	NM_018939		140531234	+1	37	2	191	7	tier1	no_errors	ENST00000231136	ensembl	human	known	74_37	silent	16.23	22.22	SNP	0.198	T	37	191
SLC1A6	6511	genome.wustl.edu	37	19	15083667	15083667	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr19:15083667C>T	ENST00000221742.3	-	1	63	c.56G>A	c.(55-57)cGg>cAg	p.R19Q	SLC1A6_ENST00000600144.1_Missense_Mutation_p.R19Q|SLC1A6_ENST00000430939.2_Silent_p.P23P|SLC1A6_ENST00000598504.1_Missense_Mutation_p.R19Q|SLC1A6_ENST00000544886.2_Missense_Mutation_p.R19Q	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	19					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						CCAGCCCACCCGGCCCAGCCG	0.677													ENSG00000105143																																					0													7.0	8.0	8.0					19																	15083667		1929	3841	5770	SO:0001583	missense	0			-		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.56G>A	19.37:g.15083667C>T	ENSP00000221742:p.Arg19Gln		Q8N753	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.R19Q	ENST00000221742.3	37	c.56	CCDS12321.1	19	.	.	.	.	.	.	.	.	.	.	C	11.11	1.541573	0.27563	.	.	ENSG00000105143	ENST00000221742;ENST00000544886;ENST00000542610	T;T	0.55234	0.53;1.26	4.25	1.94	0.25998	.	1.075590	0.07237	N	0.863609	T	0.25791	0.0628	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.15141	0.002;0.012;0.004	B;B;B	0.08055	0.001;0.003;0.001	T	0.22068	-1.0227	10	0.10902	T	0.67	-0.7962	6.5908	0.22646	0.2079:0.5909:0.2012:0.0	.	19;20;19	Q8N753;Q59GB0;P48664	.;.;EAA4_HUMAN	Q	19;19;20	ENSP00000221742:R19Q;ENSP00000446175:R19Q	ENSP00000221742:R19Q	R	-	2	0	SLC1A6	14944667	0.000000	0.05858	0.407000	0.26434	0.894000	0.52154	0.768000	0.26590	0.357000	0.24183	0.313000	0.20887	CGG	-	SLC1A6	-	NULL		0.677	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	HGNC	protein_coding	OTTHUMT00000466283.1	0	0	0	10	10	1	0.00	0.00	C	NM_005071		15083667	-1	11	2	9	4	tier1	no_errors	ENST00000221742	ensembl	human	known	74_37	missense	55.00	33.33	SNP	0.022	T	11	9
EDN3	1908	genome.wustl.edu	37	20	57896081	57896081	+	Silent	SNP	G	G	T			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr20:57896081G>T	ENST00000337938.2	+	3	761	c.375G>T	c.(373-375)gtG>gtT	p.V125V	EDN3_ENST00000395654.3_Silent_p.V125V|EDN3_ENST00000371028.2_Silent_p.V125V|EDN3_ENST00000311585.7_Silent_p.V125V|EDN3_ENST00000371025.3_Silent_p.V125V	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	125					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					GACAGACGGTGCCCTATGGAC	0.617													ENSG00000124205																																					0													85.0	72.0	76.0					20																	57896081		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.375G>T	20.37:g.57896081G>T			E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Silent	SNP	pfam_Endothln-like_toxin,smart_Endothln-like_toxin,prints_Bibrotoxin/Sarafotoxin-D	p.V125	ENST00000337938.2	37	c.375	CCDS13477.1	20																																																																																			-	EDN3	-	prints_Bibrotoxin/Sarafotoxin-D		0.617	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDN3	HGNC	protein_coding	OTTHUMT00000079919.2	0	0	0	49	49	61	0.00	0.00	G	NM_000114		57896081	+1	16	3	106	109	tier1	no_errors	ENST00000337938	ensembl	human	known	74_37	silent	13.11	2.68	SNP	1.000	T	16	106
RIC8A	60626	genome.wustl.edu	37	11	212446	212446	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L1-01A-11D-A24N-09	TCGA-DX-A1L1-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	30c48200-0b11-4628-a643-ecba777aad1c	5bdd61e4-1fc4-453c-aeda-9c0a0408914e	g.chr11:212446G>A	ENST00000526104.1	+	6	2344	c.1000G>A	c.(1000-1002)Gtg>Atg	p.V334M	RIC8A_ENST00000527696.1_Missense_Mutation_p.V328M|RIC8A_ENST00000325207.5_Missense_Mutation_p.V334M			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	334					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGTAGCTCCCGTGCTGAGCGT	0.587													ENSG00000177963																																					0													65.0	56.0	59.0					11																	212446		2202	4300	6502	SO:0001583	missense	0			-	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.1000G>A	11.37:g.212446G>A	ENSP00000432008:p.Val334Met		Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.V334M	ENST00000526104.1	37	c.1000		11	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836459	0.71373	.	.	ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000527696	T;T;T	0.52295	0.67;0.67;0.67	3.89	3.89	0.44902	Synembryn (1);Armadillo-type fold (1);	0.380493	0.26542	N	0.023790	T	0.70107	0.3186	M	0.83483	2.645	0.48762	D	0.999709	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.977;0.968;0.946	T	0.76822	-0.2817	10	0.72032	D	0.01	-25.4202	15.7484	0.77965	0.0:0.0:1.0:0.0	.	328;334;334	Q9NPQ8-2;Q9NPQ8;Q9NPQ8-3	.;RIC8A_HUMAN;.	M	334;334;328	ENSP00000432008:V334M;ENSP00000325941:V334M;ENSP00000434833:V328M	ENSP00000325941:V334M	V	+	1	0	RIC8A	202446	1.000000	0.71417	0.968000	0.41197	0.965000	0.64279	3.971000	0.56831	2.130000	0.65690	0.561000	0.74099	GTG	-	RIC8A	-	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn		0.587	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	0	0	0	60	60	44	0.00	0.00	G	NM_021932		212446	+1	10	3	61	31	tier1	no_errors	ENST00000325207	ensembl	human	known	74_37	missense	14.08	8.82	SNP	0.993	A	10	61
