#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
UHRF1	29128	genome.wustl.edu	37	19	4932853	4932853	+	RNA	SNP	A	A	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr19:4932853A>C	ENST00000592666.1	+	0	1246				MIR4747_ENST00000584057.1_RNA			Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		CCAGGTGGTCATGCTCAACTA	0.652													ENSG00000034063																																					0													51.0	63.0	59.0					19																	4932853		2075	4201	6276			0			-	AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4932853A>C			A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	R	SNP	-	NULL	ENST00000592666.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	A	23.8	4.457815	0.84317	.	.	ENSG00000034063	ENST00000262952;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	5.21	5.21	0.72293	Domain of unknown function DUF3590 (1);	0.000000	0.85682	D	0.000000	T	0.75199	0.3817	M	0.65975	2.015	0.42674	D	0.993522	P;B	0.45348	0.856;0.444	P;B	0.60949	0.881;0.405	T	0.77579	-0.2535	8	0.39692	T	0.17	-3.6619	15.0704	0.72030	1.0:0.0:0.0:0.0	.	237;224	Q2HIX7;Q96T88	.;UHRF1_HUMAN	L	224;224;224;237	.	ENSP00000262952:M224L	M	+	1	0	UHRF1	4883853	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.131000	0.94446	1.972000	0.57404	0.459000	0.35465	ATG	-	UHRF1	-	-		0.652	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	HGNC	processed_transcript	OTTHUMT00000450444.1	0	0	0	83	83	67	0.00	0.00	A	NM_001048201		4932853	+1	167	90	64	51	tier1	no_errors	ENST00000262952	ensembl	human	known	74_37	rna	72.29	63.83	SNP	1.000	C	167	64
HERC1	8925	genome.wustl.edu	37	15	63952050	63952050	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr15:63952050T>A	ENST00000443617.2	-	47	9396	c.9309A>T	c.(9307-9309)ttA>ttT	p.L3103F		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3103					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GCCGGTCATTTAAACCAAGCG	0.443													ENSG00000103657																																					0													93.0	86.0	88.0					15																	63952050		1901	4127	6028	SO:0001583	missense	0			-	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.9309A>T	15.37:g.63952050T>A	ENSP00000390158:p.Leu3103Phe		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.L3103F	ENST00000443617.2	37	c.9309	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	T	14.21	2.466651	0.43839	.	.	ENSG00000103657	ENST00000443617	T	0.38240	1.15	5.65	4.53	0.55603	.	0.000000	0.64402	D	0.000020	T	0.43743	0.1261	L	0.44542	1.39	0.49687	D	0.999819	D	0.71674	0.998	D	0.78314	0.991	T	0.45877	-0.9231	10	0.44086	T	0.13	.	2.2214	0.03973	0.127:0.1423:0.1318:0.5989	.	3103	Q15751	HERC1_HUMAN	F	3103	ENSP00000390158:L3103F	ENSP00000390158:L3103F	L	-	3	2	HERC1	61739103	0.989000	0.36119	1.000000	0.80357	0.998000	0.95712	0.091000	0.15046	0.964000	0.38108	0.528000	0.53228	TTA	-	HERC1	-	NULL		0.443	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	0	0	0	76	76	108	0.00	0.00	T	NM_003922		63952050	-1	15	20	46	64	tier1	no_errors	ENST00000443617	ensembl	human	known	74_37	missense	24.59	23.81	SNP	0.998	A	15	46
PDZD2	23037	genome.wustl.edu	37	5	32088673	32088673	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr5:32088673G>A	ENST00000438447.1	+	20	5507	c.5119G>A	c.(5119-5121)Gaa>Aaa	p.E1707K	PDZD2_ENST00000282493.3_Missense_Mutation_p.E1707K			O15018	PDZD2_HUMAN	PDZ domain containing 2	1707					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CTCAGCCATGGAAAACAGTCC	0.512													ENSG00000133401																																					0													103.0	89.0	94.0					5																	32088673		2203	4300	6503	SO:0001583	missense	0			-	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5119G>A	5.37:g.32088673G>A	ENSP00000402033:p.Glu1707Lys		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E1707K	ENST00000438447.1	37	c.5119	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352137	0.41700	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.07908	3.15;3.15	4.69	3.82	0.43975	.	0.523320	0.17515	N	0.171470	T	0.06005	0.0156	L	0.46157	1.445	0.09310	N	1	B	0.33694	0.421	B	0.27500	0.08	T	0.28776	-1.0033	10	0.02654	T	1	.	8.6812	0.34209	0.1069:0.0:0.8931:0.0	.	1707	O15018	PDZD2_HUMAN	K	1707;1508;1707	ENSP00000402033:E1707K;ENSP00000282493:E1707K	ENSP00000282493:E1707K	E	+	1	0	PDZD2	32124430	0.023000	0.18921	0.019000	0.16419	0.049000	0.14656	1.275000	0.33144	0.974000	0.38366	0.561000	0.74099	GAA	-	PDZD2	-	NULL		0.512	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	0	0	1	33	33	109	0.00	0.91	G			32088673	+1	47	167	55	130	tier1	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	46.08	56.04	SNP	0.034	A	47	55
SUPT6H	6830	genome.wustl.edu	37	17	27031194	27031194	+	IGR	SNP	G	G	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr17:27031194G>C	ENST00000314616.6	+	0	6518				PROCA1_ENST00000301039.2_Missense_Mutation_p.I131M|PROCA1_ENST00000581289.1_3'UTR|PROCA1_ENST00000439862.3_Missense_Mutation_p.I133M|PROCA1_ENST00000579650.1_5'UTR	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GTGGATGGTGGATCACTGCCA	0.577													ENSG00000167525																																					0													30.0	33.0	32.0					17																	27031194		2203	4294	6497	SO:0001628	intergenic_variant	0			-	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			17.37:g.27031194G>C			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_PLipase_A2,superfamily_PLipase_A2_dom	p.I133M	ENST00000314616.6	37	c.399	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	13.82	2.352552	0.41700	.	.	ENSG00000167525	ENST00000301039;ENST00000439862;ENST00000415329;ENST00000422880	T;T	0.05717	3.4;3.4	4.75	1.66	0.24008	Phospholipase A2 (2);	0.208186	0.41194	D	0.000928	T	0.14614	0.0353	L	0.50333	1.59	0.32285	N	0.567031	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.974;0.974	T	0.06215	-1.0839	10	0.72032	D	0.01	-14.3511	6.1363	0.20235	0.3285:0.0:0.6715:0.0	.	159;133;131	Q8NCQ7;G5E9R8;Q8NCQ7-2	PRCA1_HUMAN;.;.	M	131;133;159;133	ENSP00000301039:I131M;ENSP00000411400:I133M	ENSP00000301039:I131M	I	-	3	3	PROCA1	24055321	1.000000	0.71417	0.997000	0.53966	0.522000	0.34438	0.963000	0.29293	0.201000	0.20466	0.650000	0.86243	ATC	-	PROCA1	-	superfamily_PLipase_A2_dom		0.577	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROCA1	HGNC	protein_coding	OTTHUMT00000446422.2	0	0	0	39	39	88	0.00	0.00	G	NM_003170		27031194	-1	4	10	24	50	tier1	no_errors	ENST00000439862	ensembl	human	known	74_37	missense	14.29	16.39	SNP	0.996	C	4	24
RTP3	83597	genome.wustl.edu	37	3	46539582	46539582	+	Silent	SNP	A	A	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr3:46539582A>G	ENST00000296142.3	+	1	602	c.30A>G	c.(28-30)caA>caG	p.Q10Q		NM_031440.1	NP_113628.1	Q9BQQ7	RTP3_HUMAN	receptor (chemosensory) transporter protein 3	10					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TGTGGAAGCAAATGTTTCAGG	0.592													ENSG00000163825																																					0													104.0	94.0	98.0					3																	46539582		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ312776	CCDS2740.1	3p21.3	2014-02-20	2006-11-21	2006-02-07	ENSG00000163825	ENSG00000163825		"""Receptor transporter proteins"""	15572	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 3"""	607181	"""transmembrane protein 7"", ""receptor transporter protein 3"""	TMEM7		16271481, 15550249, 16720576	Standard	NM_031440		Approved	LTM1, Z3CXXC3	uc003cps.1	Q9BQQ7	OTTHUMG00000133483	ENST00000296142.3:c.30A>G	3.37:g.46539582A>G			A2RRP6	Silent	SNP	NULL	p.Q10	ENST00000296142.3	37	c.30	CCDS2740.1	3																																																																																			-	RTP3	-	NULL		0.592	RTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP3	HGNC	protein_coding	OTTHUMT00000257379.2	0	0	0	17	17	134	0.00	0.00	A	NM_031440		46539582	+1	4	17	11	71	tier1	no_errors	ENST00000296142	ensembl	human	known	74_37	silent	26.67	19.10	SNP	0.000	G	4	11
SCN9A	6335	genome.wustl.edu	37	2	167136889	167136889	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr2:167136889T>A	ENST00000409435.1	-	13	2320	c.2321A>T	c.(2320-2322)aAt>aTt	p.N774I	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.N763I|SCN9A_ENST00000303354.6_Missense_Mutation_p.N775I|SCN9A_ENST00000375387.4_Missense_Mutation_p.N775I			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	774					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGCAAGTACATTTTTGAATTC	0.308													ENSG00000169432																																					0													42.0	42.0	42.0					2																	167136889		1841	4082	5923	SO:0001583	missense	0			-	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.2321A>T	2.37:g.167136889T>A	ENSP00000386330:p.Asn774Ile		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.N775I	ENST00000409435.1	37	c.2324	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	T	7.326	0.618001	0.14129	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.97256	-4.31;-4.31;-4.31;-4.31	5.9	5.9	0.94986	.	0.256305	0.34777	N	0.003700	D	0.94794	0.8319	M	0.71581	2.175	0.34971	D	0.753139	P	0.43412	0.806	B	0.36719	0.231	D	0.95659	0.8713	10	0.42905	T	0.14	.	7.8215	0.29290	0.0:0.0695:0.1395:0.791	.	763	E7EUN6	.	I	763;775;775;774	ENSP00000386306:N763I;ENSP00000364536:N775I;ENSP00000304748:N775I;ENSP00000386330:N774I	ENSP00000304748:N775I	N	-	2	0	SCN9A	166845135	0.010000	0.17322	0.918000	0.36340	0.060000	0.15804	1.861000	0.39438	2.251000	0.74343	0.528000	0.53228	AAT	-	SCN9A	-	NULL		0.308	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	0	0	0	113	113	115	0.00	0.00	T	NM_002977		167136889	-1	12	21	64	85	tier1	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	15.79	19.81	SNP	0.718	A	12	64
IFNA17	3451	genome.wustl.edu	37	9	21227659	21227659	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr9:21227659T>C	ENST00000413767.2	-	1	562	c.514A>G	c.(514-516)Atg>Gtg	p.M172V		NM_021268.2	NP_067091.1	P01571	IFN17_HUMAN	interferon, alpha 17	172					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(2)|lung(4)|ovary(1)|skin(1)	9				Lung(24;2.13e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		AGAGATCTCATGATTTCTGCT	0.388													ENSG00000234829																																					0													151.0	188.0	175.0					9																	21227659		2195	4297	6492	SO:0001583	missense	0			-		CCDS6500.1	9p22	2010-12-10			ENSG00000234829	ENSG00000234829		"""Interferons"""	5422	protein-coding gene	gene with protein product		147583				1385305	Standard	NM_021268		Approved	LEIF2C1, IFN-alphaI	uc003zos.1	P01571	OTTHUMG00000019667	ENST00000413767.2:c.514A>G	9.37:g.21227659T>C	ENSP00000411940:p.Met172Val		Q14639|Q4KMT4|Q5VZ53|Q7M4Q4	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.M172V	ENST00000413767.2	37	c.514	CCDS6500.1	9	.	.	.	.	.	.	.	.	.	.	t	9.236	1.036984	0.19669	.	.	ENSG00000234829	ENST00000413767	T	0.03496	3.91	2.87	-5.74	0.02391	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.993651	0.08180	N	0.985650	T	0.07143	0.0181	M	0.87456	2.885	0.09310	N	1	B	0.27351	0.176	B	0.37047	0.24	T	0.44190	-0.9344	10	0.66056	D	0.02	.	0.2893	0.00256	0.3342:0.1475:0.1593:0.3589	.	172	P01571	IFN17_HUMAN	V	172	ENSP00000411940:M172V	ENSP00000411940:M172V	M	-	1	0	IFNA17	21217659	0.000000	0.05858	0.000000	0.03702	0.257000	0.26127	0.118000	0.15605	-1.558000	0.01690	-0.836000	0.03065	ATG	-	IF17	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta		0.388	IFNA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IF17	HGNC	protein_coding	OTTHUMT00000051896.1	0	0	0	102	102	30	0.00	0.00	T	NM_021268		21227659	-1	19	15	50	25	tier1	no_errors	ENST00000413767	ensembl	human	known	74_37	missense	27.54	37.50	SNP	0.000	C	19	50
TMEM182	130827	genome.wustl.edu	37	2	103414356	103414356	+	Silent	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr2:103414356G>A	ENST00000412401.2	+	4	571	c.366G>A	c.(364-366)ctG>ctA	p.L122L	TMEM182_ENST00000486293.1_3'UTR|TMEM182_ENST00000409528.1_Silent_p.L26L|TMEM182_ENST00000409173.1_Silent_p.L79L	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	122						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						TGATGCTCCTGGGGGTAGTTG	0.478													ENSG00000170417																																					0													112.0	114.0	113.0					2																	103414356		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.366G>A	2.37:g.103414356G>A			C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Silent	SNP	NULL	p.L122	ENST00000412401.2	37	c.366	CCDS2064.1	2																																																																																			-	TMEM182	-	NULL		0.478	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM182	HGNC	protein_coding	OTTHUMT00000253293.1	0	0	0	48	48	92	0.00	0.00	G	NM_144632		103414356	+1	15	25	38	62	tier1	no_errors	ENST00000412401	ensembl	human	known	74_37	silent	28.30	28.74	SNP	0.998	A	15	38
IFNLR1	163702	genome.wustl.edu	37	1	24484158	24484158	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:24484158G>A	ENST00000327535.1	-	7	1037	c.1025C>T	c.(1024-1026)cCc>cTc	p.P342L	IFNLR1_ENST00000374421.3_Missense_Mutation_p.P313L|IFNLR1_ENST00000327575.2_3'UTR	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	342					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)											TTCAATGTAGGGCTGGAAGCT	0.612													ENSG00000185436																																					0													144.0	134.0	137.0					1																	24484158		2203	4300	6503	SO:0001583	missense	0			-	AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.1025C>T	1.37:g.24484158G>A	ENSP00000327824:p.Pro342Leu		Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.P342L	ENST00000327535.1	37	c.1025	CCDS248.1	1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.912069	0.52439	.	.	ENSG00000185436	ENST00000327535;ENST00000374421	.	.	.	5.73	4.81	0.61882	.	1.117550	0.06518	N	0.739216	T	0.78162	0.4240	M	0.61703	1.905	0.80722	D	1	D;P	0.89917	1.0;0.765	D;B	0.91635	0.999;0.42	T	0.65788	-0.6083	9	0.87932	D	0	-19.266	10.8847	0.46960	0.0868:0.0:0.9132:0.0	.	342;313	Q8IU57;Q8IU57-2	I28RA_HUMAN;.	L	342;313	.	ENSP00000327824:P342L	P	-	2	0	IL28RA	24356745	1.000000	0.71417	1.000000	0.80357	0.272000	0.26649	2.899000	0.48679	1.547000	0.49401	0.655000	0.94253	CCC	-	IFNLR1	-	NULL		0.612	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFNLR1	HGNC	protein_coding	OTTHUMT00000008402.1	0	0	0	65	65	107	0.00	0.00	G	NM_170743		24484158	-1	17	28	54	49	tier1	no_errors	ENST00000327535	ensembl	human	known	74_37	missense	23.94	36.36	SNP	0.914	A	17	54
METTL21B	25895	genome.wustl.edu	37	12	58168434	58168434	+	Intron	SNP	G	G	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:58168434G>T	ENST00000300209.8	+	2	414				METTL21B_ENST00000551420.1_Intron|METTL1_ENST00000324871.7_5'Flank|RP11-571M6.15_ENST00000553083.1_Intron|RP11-571M6.15_ENST00000471530.1_Intron|METTL21B_ENST00000552307.1_3'UTR|AC025165.1_ENST00000582738.1_RNA|METTL1_ENST00000257848.7_5'Flank|METTL1_ENST00000548681.1_5'Flank|METTL21B_ENST00000333012.5_Missense_Mutation_p.E104D|METTL21B_ENST00000548256.1_Missense_Mutation_p.E62D	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						tagtgagggagacagaggacg	0.468													ENSG00000123427																																					0													90.0	70.0	77.0					12																	58168434		2203	4300	6503	SO:0001627	intron_variant	0			-	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459	ENST00000300209.8:c.289+1523G>T	12.37:g.58168434G>T			Q9H749|Q9Y3W2	Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.E104D	ENST00000300209.8	37	c.312	CCDS8957.1	12	.	.	.	.	.	.	.	.	.	.	G	2.059	-0.415733	0.04766	.	.	ENSG00000123427	ENST00000548256;ENST00000333012	T	0.13778	2.56	2.69	0.296	0.15757	.	.	.	.	.	T	0.04048	0.0113	.	.	.	0.09310	N	1	B	0.22146	0.065	B	0.22152	0.038	T	0.41822	-0.9487	8	0.02654	T	1	.	2.7765	0.05349	0.2412:0.2817:0.4771:0.0	.	104	Q96AZ1-2	.	D	62;104	ENSP00000327425:E104D	ENSP00000327425:E104D	E	+	3	2	METTL21B	56454701	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.532000	0.23067	0.062000	0.16340	0.563000	0.77884	GAG	-	METTL21B	-	NULL		0.468	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21B	HGNC	protein_coding	OTTHUMT00000409268.1	0	0	0	38	38	102	0.00	0.00	G	NM_015433		58168434	+1	145	204	462	919	tier1	no_errors	ENST00000333012	ensembl	human	known	74_37	missense	23.89	18.15	SNP	0.000	T	145	462
IL7R	3575	genome.wustl.edu	37	5	35873642	35873642	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr5:35873642A>G	ENST00000303115.3	+	5	727	c.598A>G	c.(598-600)Atg>Gtg	p.M200V	IL7R_ENST00000506850.1_Missense_Mutation_p.M200V|IL7R_ENST00000343305.4_Missense_Mutation_p.M200V	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	200	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			ACCGGCAGCAATGTATGAGAT	0.413			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency						ENSG00000168685																												Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	0													74.0	71.0	72.0					5																	35873642		2203	4300	6503	SO:0001583	missense	0			-	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.598A>G	5.37:g.35873642A>G	ENSP00000306157:p.Met200Val		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	p.M200V	ENST00000303115.3	37	c.598	CCDS3911.1	5	.	.	.	.	.	.	.	.	.	.	A	0.121	-1.125082	0.01770	.	.	ENSG00000168685	ENST00000303115;ENST00000343305;ENST00000506850;ENST00000505093	T;T;T;T	0.75367	0.45;0.45;0.45;-0.93	5.97	2.28	0.28536	Short hematopoietin receptor, family 1, conserved site (1);Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.670270	0.16366	N	0.217521	T	0.62938	0.2469	L	0.48362	1.52	0.34521	D	0.708124	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.59883	-0.7370	10	0.29301	T	0.29	-18.4596	6.9596	0.24590	0.7412:0.0:0.2588:0.0	.	200;200	D6RGV2;P16871	.;IL7RA_HUMAN	V	200;200;200;3	ENSP00000306157:M200V;ENSP00000345819:M200V;ENSP00000421207:M200V;ENSP00000426069:M3V	ENSP00000306157:M200V	M	+	1	0	IL7R	35909399	0.102000	0.21896	0.892000	0.35008	0.139000	0.21198	0.261000	0.18442	0.476000	0.27440	0.533000	0.62120	ATG	-	IL7R	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3		0.413	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7R	HGNC	protein_coding	OTTHUMT00000207577.2	0	0	0	34	34	57	0.00	0.00	A			35873642	+1	10	15	23	30	tier1	no_errors	ENST00000303115	ensembl	human	known	74_37	missense	30.30	33.33	SNP	0.804	G	10	23
BNC1	646	genome.wustl.edu	37	15	83932020	83932020	+	Silent	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr15:83932020C>T	ENST00000345382.2	-	4	2068	c.1983G>A	c.(1981-1983)ggG>ggA	p.G661G	BNC1_ENST00000569704.1_Silent_p.G654G|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	661					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GGGGTTCCATCCCAGGTGTGA	0.537													ENSG00000169594																																					0													94.0	95.0	94.0					15																	83932020		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1983G>A	15.37:g.83932020C>T			Q15840	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G661	ENST00000345382.2	37	c.1983	CCDS10324.1	15																																																																																			-	BNC1	-	NULL		0.537	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	0	0	0	48	48	91	0.00	0.00	C	NM_001717		83932020	-1	17	25	32	74	tier1	no_errors	ENST00000345382	ensembl	human	known	74_37	silent	34.00	25.25	SNP	0.000	T	17	32
UGT1A6	54578	genome.wustl.edu	37	2	234663718	234663718	+	Intron	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr2:234663718G>A	ENST00000305139.6	+	2	1000				UGT1A1_ENST00000373450.4_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A5_ENST00000373414.3_Intron|AC114812.5_ENST00000450901.1_RNA|UGT1A6_ENST00000406651.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A6_ENST00000480628.1_3'UTR|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609767.1_Intron	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	CGCCATAGCGGTCATAGATAT	0.622													ENSG00000178836																																					0																																										SO:0001627	intron_variant	0			-	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-11962G>A	2.37:g.234663718G>A			A6NKK6|B8K289|Q96TE7	R	SNP	-	NULL	ENST00000305139.6	37	NULL	CCDS2507.1	2																																																																																			-	AC114812.5	-	-		0.622	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100286922	Clone_based_vega_gene	protein_coding	OTTHUMT00000130988.1	0	0	0	88	88	53	0.00	0.00	G	NM_205862		234663718	-1	12	14	39	44	tier1	no_errors	ENST00000389816	ensembl	human	known	74_37	rna	23.53	24.14	SNP	1.000	A	12	39
USP30	84749	genome.wustl.edu	37	12	109511301	109511301	+	Silent	SNP	C	C	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:109511301C>G	ENST00000257548.5	+	7	777	c.684C>G	c.(682-684)ctC>ctG	p.L228L	USP30_ENST00000392784.2_Silent_p.L197L	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	228	USP.				mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						ATGGAAGACTCACTAGTAATA	0.393													ENSG00000135093																																					0													115.0	100.0	105.0					12																	109511301		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.684C>G	12.37:g.109511301C>G			Q8WTU7|Q96JX4|Q9BSS3	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.L228	ENST00000257548.5	37	c.684	CCDS9123.2	12																																																																																			-	USP30	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.393	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP30	HGNC	protein_coding	OTTHUMT00000257733.2	0	0	0	29	29	133	0.00	0.00	C	NM_032663		109511301	+1	8	39	21	58	tier1	no_errors	ENST00000257548	ensembl	human	known	74_37	silent	27.59	40.21	SNP	0.899	G	8	21
CD84	8832	genome.wustl.edu	37	1	160523553	160523553	+	Intron	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:160523553G>A	ENST00000311224.4	-	3	707				CD84_ENST00000368048.3_Intron|RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000368047.3_5'UTR|CD84_ENST00000368054.3_Intron|CD84_ENST00000534968.1_Intron|CD84_ENST00000368051.3_Intron	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule						blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TTCTTGGGAGGTGATGCCCTC	0.512													ENSG00000066294																																					0																																										SO:0001627	intron_variant	0			-	AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.640+131C>T	1.37:g.160523553G>A			B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	R	SNP	-	NULL	ENST00000311224.4	37	NULL	CCDS53396.1	1																																																																																			-	CD84	-	-		0.512	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	HGNC	protein_coding	OTTHUMT00000059092.1	0	0	0	19	19	94	0.00	0.00	G	NM_003874		160523553	-1	4	17	16	53	tier1	no_errors	ENST00000368047	ensembl	human	known	74_37	rna	20.00	24.29	SNP	0.000	A	4	16
METTL21B	25895	genome.wustl.edu	37	12	58168459	58168459	+	Intron	SNP	G	G	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:58168459G>C	ENST00000300209.8	+	2	414				METTL21B_ENST00000551420.1_Intron|METTL1_ENST00000324871.7_5'Flank|RP11-571M6.15_ENST00000553083.1_Intron|RP11-571M6.15_ENST00000471530.1_Intron|METTL21B_ENST00000552307.1_3'UTR|AC025165.1_ENST00000582738.1_RNA|METTL1_ENST00000257848.7_5'Flank|METTL1_ENST00000548681.1_5'Flank|METTL21B_ENST00000333012.5_Missense_Mutation_p.E113Q|METTL21B_ENST00000548256.1_Missense_Mutation_p.E71Q	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						catagaacaagaactctggcg	0.488													ENSG00000123427																																					0													122.0	90.0	101.0					12																	58168459		2203	4300	6503	SO:0001627	intron_variant	0			-	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459	ENST00000300209.8:c.289+1548G>C	12.37:g.58168459G>C			Q9H749|Q9Y3W2	Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.E113Q	ENST00000300209.8	37	c.337	CCDS8957.1	12	.	.	.	.	.	.	.	.	.	.	G	12.46	1.943635	0.34283	.	.	ENSG00000123427	ENST00000548256;ENST00000333012	T	0.23754	1.89	3.03	2.13	0.27403	.	.	.	.	.	T	0.23094	0.0558	.	.	.	0.09310	N	1	P	0.44816	0.844	B	0.43658	0.426	T	0.12091	-1.0561	8	0.87932	D	0	.	5.8227	0.18536	0.1487:0.0:0.8513:0.0	.	113	Q96AZ1-2	.	Q	71;113	ENSP00000327425:E113Q	ENSP00000327425:E113Q	E	+	1	0	METTL21B	56454726	0.000000	0.05858	0.002000	0.10522	0.027000	0.11550	-1.309000	0.02728	0.837000	0.34925	0.563000	0.77884	GAA	-	METTL21B	-	NULL		0.488	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21B	HGNC	protein_coding	OTTHUMT00000409268.1	0	0	0	38	38	99	0.00	0.00	G	NM_015433		58168459	+1	177	202	517	901	tier1	no_errors	ENST00000333012	ensembl	human	known	74_37	missense	25.47	18.28	SNP	0.002	C	177	517
LRRN4	164312	genome.wustl.edu	37	20	6022395	6022395	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr20:6022395G>A	ENST00000378858.4	-	5	1720	c.1496C>T	c.(1495-1497)cCc>cTc	p.P499L		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	499					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						CCTCTGGCCGGGCTGAGGCGA	0.632													ENSG00000125872																																					0													107.0	116.0	113.0					20																	6022395		2203	4300	6503	SO:0001583	missense	0			-	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.1496C>T	20.37:g.6022395G>A	ENSP00000368135:p.Pro499Leu		A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P499L	ENST00000378858.4	37	c.1496	CCDS13097.1	20	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416316	0.25552	.	.	ENSG00000125872	ENST00000378858	T	0.55588	0.51	5.15	0.728	0.18260	.	1.382890	0.04748	N	0.424005	T	0.29588	0.0738	N	0.24115	0.695	0.09310	N	1	B	0.34103	0.437	B	0.26693	0.072	T	0.10177	-1.0641	10	0.09338	T	0.73	-9.0079	2.5398	0.04722	0.1708:0.1446:0.5359:0.1488	.	499	Q8WUT4	LRRN4_HUMAN	L	499	ENSP00000368135:P499L	ENSP00000368135:P499L	P	-	2	0	LRRN4	5970395	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.318000	0.08050	0.148000	0.19059	-0.305000	0.09177	CCC	-	LRRN4	-	NULL		0.632	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN4	HGNC	protein_coding	OTTHUMT00000077907.2	0	0	0	61	61	57	0.00	0.00	G	NM_152611		6022395	-1	18	10	25	43	tier1	no_errors	ENST00000378858	ensembl	human	known	74_37	missense	41.86	18.87	SNP	0.000	A	18	25
FCRLA	84824	genome.wustl.edu	37	1	161680486	161680486	+	3'UTR	SNP	C	C	T	rs544406885		TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:161680486C>T	ENST00000470841.1	+	0	408				FCRLA_ENST00000540926.1_Intron|FCRLA_ENST00000294796.4_Intron|FCRLA_ENST00000367959.2_Intron|FCRLA_ENST00000350710.3_Intron|FCRLA_ENST00000349527.4_Intron|FCRLA_ENST00000309691.6_Intron|FCRLA_ENST00000367950.1_Intron|FCRLA_ENST00000367957.2_Intron|FCRLA_ENST00000540521.1_Intron|FCRLA_ENST00000546024.1_Intron|FCRLA_ENST00000236938.6_Intron|FCRLA_ENST00000367953.3_Intron|FCRLA_ENST00000367949.2_Intron			Q7L513	FCRLA_HUMAN	Fc receptor-like A						cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			ATGGAGGAACCCTGTCCTCTT	0.473													ENSG00000132185																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000470841.1:c.*405C>T	1.37:g.161680486C>T			A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	R	SNP	-	NULL	ENST00000470841.1	37	NULL		1																																																																																			-	FCRLA	-	-		0.473	FCRLA-009	KNOWN	basic	processed_transcript	FCRLA	HGNC	protein_coding	OTTHUMT00000083582.1	0	0	0	47	47	98	0.00	0.00	C	NM_032738		161680486	+1	17	13	50	55	tier1	no_errors	ENST00000470841	ensembl	human	known	74_37	rna	25.37	19.12	SNP	0.002	T	17	50
TUSC3	7991	genome.wustl.edu	37	8	15508302	15508302	+	Silent	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr8:15508302G>A	ENST00000503731.1	+	3	553	c.405G>A	c.(403-405)gaG>gaA	p.E135E	TUSC3_ENST00000506802.1_Silent_p.E135E|TUSC3_ENST00000382020.4_Silent_p.E135E|TUSC3_ENST00000509380.1_Silent_p.E135E|TUSC3_ENST00000503191.1_Intron	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	135	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		ACTATGATGAGGGGACAGACG	0.363													ENSG00000104723																																					0													250.0	247.0	248.0					8																	15508302		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.405G>A	8.37:g.15508302G>A			A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Silent	SNP	pfam_OligosaccharylTrfase_OST3/OST6,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.E135	ENST00000503731.1	37	c.405	CCDS5994.1	8																																																																																			-	TUSC3	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold		0.363	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TUSC3	HGNC	protein_coding	OTTHUMT00000365367.1	0	0	0	152	152	107	0.00	0.00	G	NM_006765		15508302	+1	17	28	66	51	tier1	no_errors	ENST00000503731	ensembl	human	known	74_37	silent	20.24	35.44	SNP	0.997	A	17	66
OR4D10	390197	genome.wustl.edu	37	11	59245419	59245419	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr11:59245419G>A	ENST00000530162.1	+	1	574	c.517G>A	c.(517-519)Gtt>Att	p.V173I		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CGGACCCAATGTTCTTGACAC	0.502													ENSG00000254466																																					0													115.0	114.0	114.0					11																	59245419		2201	4295	6496	SO:0001583	missense	0			-	AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.517G>A	11.37:g.59245419G>A	ENSP00000436424:p.Val173Ile		B2RNH6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V173I	ENST00000530162.1	37	c.517	CCDS53636.1	11	.	.	.	.	.	.	.	.	.	.	G	3.360	-0.130702	0.06753	.	.	ENSG00000254466	ENST00000530162	T	0.00076	8.76	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.13140	0.3	0.09310	N	1	B	0.17038	0.02	B	0.24269	0.052	T	0.28808	-1.0032	9	0.37606	T	0.19	.	7.1501	0.25606	0.0937:0.1753:0.7309:0.0	.	173	Q8NGI6	OR4DA_HUMAN	I	173	ENSP00000436424:V173I	ENSP00000436424:V173I	V	+	1	0	OR4D10	59001995	0.000000	0.05858	0.931000	0.37212	0.038000	0.13279	0.138000	0.16016	2.311000	0.77944	0.655000	0.94253	GTT	-	OR4D10	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.502	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D10	HGNC	protein_coding	OTTHUMT00000394235.1	0	0	0	73	73	69	0.00	0.00	G	NM_001004705		59245419	+1	15	22	32	41	tier1	no_errors	ENST00000530162	ensembl	human	known	74_37	missense	31.91	34.92	SNP	0.169	A	15	32
ITPR2	3709	genome.wustl.edu	37	12	26755360	26755360	+	Silent	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:26755360C>T	ENST00000381340.3	-	28	4037	c.3621G>A	c.(3619-3621)ctG>ctA	p.L1207L		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1207					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CCATATTTTTCAGTAATCGTT	0.358													ENSG00000123104																																					0													103.0	97.0	99.0					12																	26755360		1824	4077	5901	SO:0001819	synonymous_variant	0			-	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3621G>A	12.37:g.26755360C>T			O94773	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.L1207	ENST00000381340.3	37	c.3621	CCDS41764.1	12																																																																																			-	ITPR2	-	pfam_Ca-rel_channel,superfamily_ARM-type_fold		0.358	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	0	0	0	21	21	113	0.00	0.00	C	NM_002223		26755360	-1	6	28	15	86	tier1	no_errors	ENST00000381340	ensembl	human	known	74_37	silent	28.57	24.14	SNP	1.000	T	6	15
TDRD12	91646	genome.wustl.edu	37	19	33240749	33240749	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr19:33240749C>A	ENST00000444215.2	+	6	876	c.556C>A	c.(556-558)Ctt>Att	p.L186I	TDRD12_ENST00000421545.2_Missense_Mutation_p.L186I			Q587J7	TDR12_HUMAN	tudor domain containing 12	186					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					TGAGGTTTACCTTTATGTAAC	0.274													ENSG00000173809																																					0													165.0	139.0	147.0					19																	33240749		692	1591	2283	SO:0001583	missense	0			-	AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.556C>A	19.37:g.33240749C>A	ENSP00000416248:p.Leu186Ile			Missense_Mutation	SNP	pfam_Tudor,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase	p.L186I	ENST00000444215.2	37	c.556		19	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098757	0.56183	.	.	ENSG00000173809	ENST00000444215;ENST00000421545	T	0.49720	0.77	5.23	5.23	0.72850	.	0.185726	0.38897	N	0.001539	T	0.69333	0.3099	M	0.78637	2.42	0.44508	D	0.997453	B;D	0.63880	0.297;0.993	B;D	0.76071	0.172;0.987	T	0.71272	-0.4642	10	0.52906	T	0.07	-23.2595	16.0704	0.80922	0.0:1.0:0.0:0.0	.	186;186	E9PAY0;Q587J7	.;TDR12_HUMAN	I	186	ENSP00000416248:L186I	ENSP00000390621:L186I	L	+	1	0	TDRD12	37932589	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.362000	0.59467	2.595000	0.87683	0.655000	0.94253	CTT	-	TDRD12	-	NULL		0.274	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1	0	0	0	21	21	112	0.00	0.00	C	NM_001015890		33240749	+1	5	21	22	70	tier1	no_errors	ENST00000444215	ensembl	human	known	74_37	missense	18.52	23.08	SNP	1.000	A	5	22
MKI67	4288	genome.wustl.edu	37	10	129910646	129910646	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr10:129910646G>T	ENST00000368654.3	-	9	2095	c.1720C>A	c.(1720-1722)Caa>Aaa	p.Q574K	MKI67_ENST00000368653.3_Missense_Mutation_p.Q214K|MKI67_ENST00000484853.1_5'UTR	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	574			Q -> P (in dbSNP:rs4471342).		cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ACCAAGCTTTGTGCCTTCACT	0.473													ENSG00000148773																																					0													138.0	145.0	143.0					10																	129910646		2203	4300	6503	SO:0001583	missense	0			-	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1720C>A	10.37:g.129910646G>T	ENSP00000357643:p.Gln574Lys		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.Q574K	ENST00000368654.3	37	c.1720	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	0.907	-0.720296	0.03182	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.01323	5.04;5.01	4.05	-2.6	0.06190	.	1.754660	0.03099	N	0.160782	T	0.01254	0.0041	L	0.44542	1.39	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.46816	-0.9164	10	0.02654	T	1	.	2.4228	0.04452	0.1757:0.463:0.2126:0.1487	.	574;214;574	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	K	574;214;574;149	ENSP00000357643:Q574K;ENSP00000357642:Q214K	ENSP00000357641:Q149K	Q	-	1	0	MKI67	129800636	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.394000	0.20834	-0.318000	0.08665	-0.224000	0.12420	CAA	-	MKI67	-	NULL		0.473	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	0	0	0	38	38	128	0.00	0.00	G	NM_002417		129910646	-1	13	48	31	99	tier1	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	28.26	32.65	SNP	0.000	T	13	31
SLTM	79811	genome.wustl.edu	37	15	59192056	59192056	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr15:59192056T>C	ENST00000380516.2	-	7	757	c.670A>G	c.(670-672)Aca>Gca	p.T224A	SLTM_ENST00000536328.1_Intron|SLTM_ENST00000557950.1_5'Flank	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	224	Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TCATGAGCTGTGTGATCAGCC	0.453													ENSG00000137776																																					0													127.0	111.0	116.0					15																	59192056		2192	4292	6484	SO:0001583	missense	0			-	BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.670A>G	15.37:g.59192056T>C	ENSP00000369887:p.Thr224Ala		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.T224A	ENST00000380516.2	37	c.670	CCDS10168.2	15	.	.	.	.	.	.	.	.	.	.	T	7.755	0.704138	0.15172	.	.	ENSG00000137776	ENST00000380516;ENST00000249736	D;D	0.89196	-2.48;-2.48	5.89	5.89	0.94794	.	0.000000	0.56097	D	0.000022	D	0.90614	0.7057	L	0.60455	1.87	0.80722	D	1	P;P	0.51791	0.948;0.948	P;P	0.52793	0.709;0.709	D	0.89333	0.3648	10	0.32370	T	0.25	.	15.4723	0.75449	0.0:0.0:0.0:1.0	.	206;224	C9IZZ3;Q9NWH9	.;SLTM_HUMAN	A	224;206	ENSP00000369887:T224A;ENSP00000249736:T206A	ENSP00000249736:T206A	T	-	1	0	SLTM	56979348	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.195000	0.58400	2.251000	0.74343	0.482000	0.46254	ACA	-	SLTM	-	NULL		0.453	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	HGNC	protein_coding	OTTHUMT00000157124.1	0	0	0	18	18	62	0.00	0.00	T	NM_024755		59192056	-1	6	29	9	44	tier1	no_errors	ENST00000380516	ensembl	human	known	74_37	missense	40.00	39.73	SNP	1.000	C	6	9
APOB	338	genome.wustl.edu	37	2	21263893	21263893	+	Silent	SNP	T	T	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr2:21263893T>C	ENST00000233242.1	-	4	427	c.300A>G	c.(298-300)aaA>aaG	p.K100K	APOB_ENST00000399256.4_Silent_p.K100K	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	100	Heparin-binding.|Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATACACCTCTTTCAGGGTGC	0.507													ENSG00000084674																																					0													71.0	63.0	66.0					2																	21263893		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.300A>G	2.37:g.21263893T>C			O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.K100	ENST00000233242.1	37	c.300	CCDS1703.1	2																																																																																			-	APOB	-	pfam_Lipid_transpt_N,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N		0.507	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	0	0	0	52	52	75	0.00	0.00	T			21263893	-1	8	21	24	53	tier1	no_errors	ENST00000233242	ensembl	human	known	74_37	silent	25.00	28.38	SNP	0.139	C	8	24
SRRT	51593	genome.wustl.edu	37	7	100482417	100482417	+	Silent	SNP	C	C	T	rs201815722		TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr7:100482417C>T	ENST00000347433.4	+	8	1157	c.999C>T	c.(997-999)gaC>gaT	p.D333D	SRRT_ENST00000457580.2_Silent_p.D333D|SRRT_ENST00000388793.4_Silent_p.D333D|SRRT_ENST00000432932.1_Silent_p.D333D			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	333	Glu-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GTGATGGGGACAAGGAAGAGA	0.522													ENSG00000087087	C|||	1	0.000199681	0.0	0.0	5008	,	,		14453	0.0		0.001	False		,,,				2504	0.0																0													78.0	82.0	81.0					7																	100482417		2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.999C>T	7.37:g.100482417C>T			A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.D333	ENST00000347433.4	37	c.999	CCDS34709.1	7																																																																																			rs201815722	SRRT	-	NULL		0.522	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	0	0	0	65	65	85	0.00	0.00	C	NM_015908		100482417	+1	17	16	31	37	tier1	no_errors	ENST00000388793	ensembl	human	known	74_37	silent	35.42	30.19	SNP	0.989	T	17	31
PDZD2	23037	genome.wustl.edu	37	5	32089053	32089053	+	Silent	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr5:32089053G>A	ENST00000438447.1	+	20	5887	c.5499G>A	c.(5497-5499)aaG>aaA	p.K1833K	PDZD2_ENST00000282493.3_Silent_p.K1833K			O15018	PDZD2_HUMAN	PDZ domain containing 2	1833					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.K1833N(1)		NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCGACTCCAAGATTCAGATGG	0.443													ENSG00000133401																																					1	Substitution - Missense(1)	breast(1)											100.0	106.0	104.0					5																	32089053		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5499G>A	5.37:g.32089053G>A			Q9BXD4	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K1833	ENST00000438447.1	37	c.5499	CCDS34137.1	5																																																																																			-	PDZD2	-	NULL		0.443	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	0	0	0	31	31	154	0.00	0.00	G			32089053	+1	9	128	11	155	tier1	no_errors	ENST00000282493	ensembl	human	known	74_37	silent	42.86	45.23	SNP	0.074	A	9	11
ZNF610	162963	genome.wustl.edu	37	19	52869387	52869387	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr19:52869387A>C	ENST00000403906.3	+	6	1212	c.756A>C	c.(754-756)agA>agC	p.R252S	ZNF610_ENST00000321287.8_Missense_Mutation_p.R252S|ZNF610_ENST00000601151.1_Missense_Mutation_p.R209S|ZNF610_ENST00000327920.8_Missense_Mutation_p.R252S	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		AACATTGGAGAATTCATACTG	0.388													ENSG00000167554																																					0													59.0	59.0	59.0					19																	52869387		2203	4300	6503	SO:0001583	missense	0			-	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.756A>C	19.37:g.52869387A>C	ENSP00000383922:p.Arg252Ser		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R252S	ENST00000403906.3	37	c.756	CCDS12851.1	19	.	.	.	.	.	.	.	.	.	.	A	8.436	0.849767	0.17034	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.24151	1.87;1.87	1.82	-0.804	0.10882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21841	0.0526	L	0.49699	1.58	0.09310	N	1	P;P	0.51147	0.932;0.942	B;B	0.41510	0.359;0.334	T	0.09751	-1.0660	9	0.62326	D	0.03	.	7.7639	0.28968	0.6695:0.0:0.3305:0.0	.	209;252	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	S	252;209;252	ENSP00000383922:R252S;ENSP00000327597:R252S	ENSP00000324441:R209S	R	+	3	2	ZNF610	57561199	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-0.588000	0.05774	-1.267000	0.02443	-1.486000	0.00981	AGA	-	ZNF610	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	HGNC	protein_coding	OTTHUMT00000462880.1	0	0	0	41	41	77	0.00	0.00	A	NM_173530		52869387	+1	8	12	18	40	tier1	no_errors	ENST00000321287	ensembl	human	known	74_37	missense	30.77	23.08	SNP	0.004	C	8	18
TMTC3	160418	genome.wustl.edu	37	12	88582692	88582692	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:88582692C>G	ENST00000266712.6	+	11	1725	c.1505C>G	c.(1504-1506)tCt>tGt	p.S502C		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	502					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						GCTGAAGAATCTTACATGATG	0.289													ENSG00000139324																																					0													75.0	80.0	78.0					12																	88582692		2203	4288	6491	SO:0001583	missense	0			-		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.1505C>G	12.37:g.88582692C>G	ENSP00000266712:p.Ser502Cys		Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,pfam_DUF1736,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S502C	ENST00000266712.6	37	c.1505	CCDS9032.1	12	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328788	0.60743	.	.	ENSG00000139324	ENST00000266712	T	0.59502	0.26	5.37	5.37	0.77165	.	0.102903	0.64402	D	0.000002	T	0.47377	0.1442	N	0.26162	0.8	0.58432	D	0.999997	B	0.17038	0.02	B	0.19391	0.025	T	0.34650	-0.9820	9	.	.	.	-19.0287	19.1051	0.93291	0.0:1.0:0.0:0.0	.	502	Q6ZXV5-2	.	C	502	ENSP00000266712:S502C	.	S	+	2	0	TMTC3	87106823	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.305000	0.78891	2.513000	0.84729	0.655000	0.94253	TCT	-	TMTC3	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.289	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC3	HGNC	protein_coding	OTTHUMT00000406421.1	0	0	0	15	15	66	0.00	0.00	C	NM_181783		88582692	+1	106	386	8	51	tier1	no_errors	ENST00000266712	ensembl	human	known	74_37	missense	92.98	88.13	SNP	1.000	G	106	8
CEP170P1	645455	genome.wustl.edu	37	4	119475261	119475261	+	RNA	SNP	T	T	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr4:119475261T>C	ENST00000412784.2	+	0	972					NR_003135.2		Q96L14	C170L_HUMAN	centrosomal protein 170kDa pseudogene 1								identical protein binding (GO:0042802)										AATGACTTTCTCTTGATTGTT	0.383													ENSG00000154608																																					0																																												0			-	BC014590		4q26	2010-10-11	2010-10-11	2010-10-11	ENSG00000154608	ENSG00000154608			28364	pseudogene	pseudogene			"""KIAA0470-like"", ""centrosomal protein 170kDa-like"""	KIAA0470L, CEP170L			Standard	NR_003135		Approved	MGC26143, FAM68B	uc003icb.3	Q96L14	OTTHUMG00000132958		4.37:g.119475261T>C				R	SNP	-	NULL	ENST00000412784.2	37	NULL		4																																																																																			-	CEP170P1	-	-		0.383	CEP170P1-002	KNOWN	basic	processed_transcript	CEP170P1	HGNC	pseudogene	OTTHUMT00000364033.2	0	0	0	29	29	74	0.00	0.00	T	NR_003135.2		119475261	+1	12	19	16	59	tier1	no_errors	ENST00000412784	ensembl	human	known	74_37	rna	42.86	24.36	SNP	0.475	C	12	16
ZNF827	152485	genome.wustl.edu	37	4	146700609	146700609	+	Missense_Mutation	SNP	T	T	C	rs532396743		TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr4:146700609T>C	ENST00000508784.1	-	9	2665	c.2438A>G	c.(2437-2439)aAt>aGt	p.N813S	ZNF827_ENST00000513320.1_Missense_Mutation_p.N463S|ZNF827_ENST00000379448.4_Missense_Mutation_p.N813S			Q17R98	ZN827_HUMAN	zinc finger protein 827	813					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					AAGCTGGTCATTGAATTTCCA	0.468													ENSG00000151612																																					0													115.0	104.0	108.0					4																	146700609		2203	4300	6503	SO:0001583	missense	0			-	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.2438A>G	4.37:g.146700609T>C	ENSP00000421863:p.Asn813Ser		B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N813S	ENST00000508784.1	37	c.2438		4	.	.	.	.	.	.	.	.	.	.	T	14.15	2.449651	0.43531	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	T;T;T	0.07216	3.27;3.21;3.31	5.76	3.12	0.35913	.	0.170237	0.64402	N	0.000006	T	0.04815	0.0130	N	0.17082	0.46	0.39542	D	0.968836	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.36383	-0.9750	10	0.38643	T	0.18	-13.8059	5.9554	0.19271	0.0:0.142:0.1392:0.7188	.	463;813;813	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	S	813;463;813;812;463	ENSP00000421863:N813S;ENSP00000423130:N463S;ENSP00000368761:N813S	ENSP00000281318:N812S	N	-	2	0	ZNF827	146920059	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.616000	0.46376	0.972000	0.38314	0.482000	0.46254	AAT	-	ZNF827	-	NULL		0.468	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF827	HGNC	protein_coding	OTTHUMT00000364654.2	0	0	0	56	56	121	0.00	0.00	T	NM_178835		146700609	-1	8	41	40	77	tier1	no_errors	ENST00000508784	ensembl	human	known	74_37	missense	16.67	34.75	SNP	1.000	C	8	40
PDZD2	23037	genome.wustl.edu	37	5	32088856	32088856	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr5:32088856G>A	ENST00000438447.1	+	20	5690	c.5302G>A	c.(5302-5304)Gga>Aga	p.G1768R	PDZD2_ENST00000282493.3_Missense_Mutation_p.G1768R			O15018	PDZD2_HUMAN	PDZ domain containing 2	1768					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCCTAAGAATGGAGAATCTGT	0.463													ENSG00000133401																																					0													94.0	87.0	90.0					5																	32088856		2203	4300	6503	SO:0001583	missense	0			-	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5302G>A	5.37:g.32088856G>A	ENSP00000402033:p.Gly1768Arg		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G1768R	ENST00000438447.1	37	c.5302	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902522	0.52227	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.07908	3.15;3.15	5.58	1.82	0.25136	.	0.625902	0.15133	N	0.278748	T	0.17365	0.0417	L	0.59436	1.845	0.09310	N	1	D	0.63880	0.993	P	0.58721	0.844	T	0.06625	-1.0816	10	0.66056	D	0.02	.	7.6395	0.28286	0.3447:0.0:0.6553:0.0	.	1768	O15018	PDZD2_HUMAN	R	1768;1569;1768	ENSP00000402033:G1768R;ENSP00000282493:G1768R	ENSP00000282493:G1768R	G	+	1	0	PDZD2	32124613	0.101000	0.21875	0.000000	0.03702	0.042000	0.13812	0.895000	0.28363	0.049000	0.15920	0.561000	0.74099	GGA	-	PDZD2	-	NULL		0.463	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	0	0	0	92	92	121	0.00	0.00	G			32088856	+1	74	172	69	152	tier1	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	51.75	53.09	SNP	0.000	A	74	69
CXorf40A	91966	genome.wustl.edu	37	X	148628297	148628297	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chrX:148628297T>G	ENST00000441248.1	+	4	1853	c.266T>G	c.(265-267)aTt>aGt	p.I89S	CXorf40A_ENST00000393985.3_Missense_Mutation_p.I89S|CXorf40A_ENST00000423540.2_Missense_Mutation_p.I89S|CXorf40A_ENST00000434353.2_Missense_Mutation_p.I89S|CXorf40A_ENST00000423421.1_Missense_Mutation_p.I89S|CXorf40A_ENST00000428236.1_Missense_Mutation_p.I27S|CXorf40A_ENST00000359293.5_Missense_Mutation_p.I89S|CXorf40A_ENST00000514208.1_Missense_Mutation_p.I89S|CXorf40A_ENST00000422892.2_Missense_Mutation_p.I89S|RP5-937E21.8_ENST00000431993.1_RNA|CXorf40A_ENST00000450602.2_Missense_Mutation_p.I89S			Q8TE69	CX04A_HUMAN	chromosome X open reading frame 40A	89										breast(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CTCGTTGACATTGGGGAAACT	0.463													ENSG00000197620																																					0													15.0	12.0	13.0					X																	148628297		2165	4209	6374	SO:0001583	missense	0			-	AF011889	CCDS14687.1, CCDS55522.1	Xq28	2010-03-16	2005-09-13	2005-09-13	ENSG00000197620	ENSG00000197620			28089	protein-coding gene	gene with protein product	"""endothelial-overexpressed lipopolysaccharide-associated factor 1"""		"""chromosome X open reading frame 40"""	CXorf40		8717057, 9147653, 16383041	Standard	XM_005278212		Approved	EOLA1	uc004fdg.3	Q8TE69	OTTHUMG00000022622	ENST00000441248.1:c.266T>G	X.37:g.148628297T>G	ENSP00000423099:p.Ile89Ser		A8K784|B7Z6H6|B7ZL96|D6RA72|E7ENU3|Q2M3E9	Missense_Mutation	SNP	superfamily_PUA-like_domain	p.I89S	ENST00000441248.1	37	c.266	CCDS14687.1	X	.	.	.	.	.	.	.	.	.	.	T	13.69	2.313472	0.40996	.	.	ENSG00000197620	ENST00000450602;ENST00000441248;ENST00000393985;ENST00000423421;ENST00000423540;ENST00000434353;ENST00000514208;ENST00000428236;ENST00000422892;ENST00000359293	T;T;T;T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04	4.16	4.16	0.48862	PUA-like domain (1);	0.428711	0.25792	N	0.028276	T	0.30324	0.0761	M	0.67953	2.075	0.40909	D	0.984218	P;P;P	0.52061	0.95;0.828;0.899	P;B;B	0.48227	0.571;0.395;0.395	T	0.19418	-1.0306	10	0.87932	D	0	.	11.7887	0.52057	0.0:0.0:0.0:1.0	.	89;89;89	Q8TE69;E7ENU3;D6RA72	CX04A_HUMAN;.;.	S	89;89;89;89;89;89;89;27;89;89	ENSP00000427540:I89S;ENSP00000423099:I89S;ENSP00000421745:I89S;ENSP00000422512:I89S;ENSP00000425520:I89S;ENSP00000423160:I89S;ENSP00000423708:I89S;ENSP00000426158:I27S;ENSP00000422312:I89S;ENSP00000420882:I89S	ENSP00000420882:I89S	I	+	2	0	CXorf40A	148436202	0.979000	0.34478	0.006000	0.13384	0.110000	0.19582	3.279000	0.51670	1.639000	0.50556	0.446000	0.29264	ATT	-	CXorf40A	-	superfamily_PUA-like_domain		0.463	CXorf40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf40A	HGNC	protein_coding	OTTHUMT00000058699.3	0	0	0	76	76	75	0.00	0.00	T	NM_178124		148628297	+1	13	13	52	30	tier1	no_errors	ENST00000359293	ensembl	human	known	74_37	missense	20.00	30.23	SNP	0.893	G	13	52
NFASC	23114	genome.wustl.edu	37	1	204945807	204945807	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:204945807A>C	ENST00000401399.1	+	15	1914	c.1715A>C	c.(1714-1716)aAg>aCg	p.K572T	NFASC_ENST00000513543.1_Missense_Mutation_p.K583T|NFASC_ENST00000338586.6_Missense_Mutation_p.K572T|NFASC_ENST00000539706.1_Missense_Mutation_p.K583T|NFASC_ENST00000367169.4_Missense_Mutation_p.K572T|NFASC_ENST00000367170.4_Missense_Mutation_p.K572T|NFASC_ENST00000403080.1_Missense_Mutation_p.K572T|NFASC_ENST00000367172.4_Missense_Mutation_p.K572T|NFASC_ENST00000360049.4_Missense_Mutation_p.K583T|NFASC_ENST00000367171.4_Missense_Mutation_p.K572T|NFASC_ENST00000338515.6_Missense_Mutation_p.K572T|NFASC_ENST00000339876.6_Missense_Mutation_p.K572T|NFASC_ENST00000404076.1_Missense_Mutation_p.K566T|NFASC_ENST00000404907.1_Missense_Mutation_p.K583T			O94856	NFASC_HUMAN	neurofascin	572	Ig-like C2-type 6.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGGATGAAGAAGGAAGACGAC	0.602													ENSG00000163531																																					0													209.0	192.0	198.0					1																	204945807		2203	4300	6503	SO:0001583	missense	0			-	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1715A>C	1.37:g.204945807A>C	ENSP00000385637:p.Lys572Thr		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K572T	ENST00000401399.1	37	c.1715	CCDS53460.1	1	.	.	.	.	.	.	.	.	.	.	A	12.98	2.099539	0.37048	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.13	4.0	0.46444	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000029	T	0.63379	0.2506	N	0.25647	0.755	0.47441	D	0.999424	B;P;B;B;P;B;D	0.76494	0.063;0.539;0.051;0.051;0.789;0.452;0.999	B;B;B;B;B;B;D	0.72982	0.163;0.236;0.062;0.101;0.045;0.13;0.979	T	0.57069	-0.7874	10	0.20519	T	0.43	.	10.3757	0.44081	0.9216:0.0:0.0784:0.0	.	572;583;583;572;572;583;572	O94856;O94856-11;O94856-8;F8W791;O94856-9;O94856-3;O94856-2	NFASC_HUMAN;.;.;.;.;.;.	T	572;572;572;572;572;572;583;583;583;572;572;566;572;583;583;559	ENSP00000356140:K572T;ENSP00000356139:K572T;ENSP00000356138:K572T;ENSP00000342128:K572T;ENSP00000344786:K572T;ENSP00000343509:K572T;ENSP00000438614:K583T;ENSP00000353154:K583T;ENSP00000356137:K572T;ENSP00000384875:K572T;ENSP00000385676:K566T;ENSP00000385637:K572T;ENSP00000384061:K583T;ENSP00000425908:K583T;ENSP00000415031:K559T	ENSP00000295776:K583T	K	+	2	0	NFASC	203212430	1.000000	0.71417	0.994000	0.49952	0.691000	0.40173	4.879000	0.63100	0.809000	0.34255	0.459000	0.35465	AAG	-	NFASC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.602	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	0	0	0	64	64	117	0.00	0.00	A	NM_001005388		204945807	+1	7	11	46	79	tier1	no_errors	ENST00000367172	ensembl	human	known	74_37	missense	13.21	12.22	SNP	1.000	C	7	46
MYOCD	93649	genome.wustl.edu	37	17	12666834	12666834	+	Missense_Mutation	SNP	C	C	T	rs139170912		TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr17:12666834C>T	ENST00000343344.4	+	13	2690	c.2690C>T	c.(2689-2691)cCg>cTg	p.P897L	MYOCD_ENST00000425538.1_Missense_Mutation_p.P945L|RP11-1090M7.1_ENST00000584772.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	897					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GACCTCACTCCGCCAAATTCC	0.512													ENSG00000141052	C|||	1	0.000199681	0.0008	0.0	5008	,	,		17530	0.0		0.0	False		,,,				2504	0.0																0								C	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	68.0	61.0	63.0		2834,2690	6.1	0.9	17	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MYOCD	NM_001146312.1,NM_153604.2	98,98	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	945/987,897/939	12666834	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2690C>T	17.37:g.12666834C>T	ENSP00000341835:p.Pro897Leu		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.P945L	ENST00000343344.4	37	c.2834	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679565	0.68042	2.27E-4	1.16E-4	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	T;T	0.46451	0.89;0.87	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.58323	0.2114	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.992;1.0;0.999	T	0.49542	-0.8929	10	0.02654	T	1	-20.3272	19.4349	0.94788	0.0:1.0:0.0:0.0	.	621;945;897	E9PEP9;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	L	621;945;897;607	ENSP00000341835:P897L;ENSP00000400148:P607L	ENSP00000341835:P897L	P	+	2	0	MYOCD	12607559	1.000000	0.71417	0.946000	0.38457	0.430000	0.31655	7.440000	0.80464	2.894000	0.99253	0.655000	0.94253	CCG	rs139170912	MYOCD	-	NULL		0.512	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	0	0	0	55	55	71	0.00	0.00	C	NM_153604		12666834	+1	18	19	20	60	tier1	no_errors	ENST00000425538	ensembl	human	known	74_37	missense	47.37	24.05	SNP	1.000	T	18	20
EPB41	2035	genome.wustl.edu	37	1	29365852	29365852	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:29365852C>G	ENST00000343067.4	+	11	1677	c.1550C>G	c.(1549-1551)aCc>aGc	p.T517S	EPB41_ENST00000347529.3_Missense_Mutation_p.T482S|EPB41_ENST00000356093.2_Missense_Mutation_p.T517S|EPB41_ENST00000349460.4_Missense_Mutation_p.T308S|EPB41_ENST00000398863.2_Missense_Mutation_p.T517S|EPB41_ENST00000373797.1_Missense_Mutation_p.T517S|EPB41_ENST00000373800.3_Missense_Mutation_p.T308S|EPB41_ENST00000373798.1_Missense_Mutation_p.T517S	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	517	Hydrophilic.				actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		CAAGCTCAGACCAGGCAAGCT	0.502													ENSG00000159023																																					0													99.0	98.0	99.0					1																	29365852		2203	4300	6503	SO:0001583	missense	0			-	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.1550C>G	1.37:g.29365852C>G	ENSP00000345259:p.Thr517Ser		B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain	p.T517S	ENST00000343067.4	37	c.1550	CCDS53288.1	1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264104	0.80358	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000349460;ENST00000373800;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11;-2.11	5.69	5.69	0.88448	FERM adjacent (FA) (1);	0.046924	0.85682	D	0.000000	D	0.89870	0.6840	L	0.28192	0.835	0.58432	D	0.999992	D;B;P;D;P;P;D;P;D;P	0.63046	0.99;0.41;0.927;0.99;0.911;0.911;0.972;0.911;0.992;0.675	P;B;P;P;P;P;P;P;D;B	0.75484	0.871;0.326;0.679;0.871;0.55;0.55;0.823;0.55;0.986;0.386	D	0.90597	0.4541	10	0.59425	D	0.04	.	18.8047	0.92032	0.0:1.0:0.0:0.0	.	411;517;517;517;517;517;534;482;308;308	E9PEX0;E9PEW9;C9JTS2;P11171;P11171-2;P11171-7;Q59F12;P11171-5;P11171-4;P11171-3	.;.;.;41_HUMAN;.;.;.;.;.;.	S	534;517;517;517;411;517;308;308;482;517;517	ENSP00000345259:T517S;ENSP00000348397:T517S;ENSP00000381839:T517S;ENSP00000317597:T308S;ENSP00000362906:T308S;ENSP00000290100:T482S;ENSP00000362904:T517S;ENSP00000362903:T517S	ENSP00000345259:T517S	T	+	2	0	EPB41	29238439	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.854000	0.62918	2.687000	0.91594	0.650000	0.86243	ACC	-	EPB41	-	pirsf_Band_41_protein,pfam_FERM-adjacent		0.502	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	0	0	0	62	62	83	0.00	0.00	C	NM_203342		29365852	+1	6	13	44	80	tier1	no_errors	ENST00000343067	ensembl	human	known	74_37	missense	12.00	13.98	SNP	1.000	G	6	44
CUL4B	8450	genome.wustl.edu	37	X	119672572	119672572	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chrX:119672572C>A	ENST00000404115.3	-	15	2250	c.1849G>T	c.(1849-1851)Gtc>Ttc	p.V617F	CUL4B_ENST00000336592.6_Missense_Mutation_p.V604F|CUL4B_ENST00000371322.5_Missense_Mutation_p.V599F	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	617					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CTCTTTCCGACTAACAGGCGC	0.343													ENSG00000158290																																					0													108.0	107.0	107.0					X																	119672572		2203	4300	6503	SO:0001583	missense	0			-	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.1849G>T	X.37:g.119672572C>A	ENSP00000384109:p.Val617Phe		B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.V617F	ENST00000404115.3	37	c.1849	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	C	18.09	3.547096	0.65311	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	T;T;T	0.73363	-0.74;-0.74;-0.74	5.51	4.62	0.57501	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	L	0.29908	0.895	0.80722	D	1	B;D;D	0.69078	0.03;0.997;0.997	B;D;D	0.74023	0.031;0.982;0.969	T	0.75602	-0.3261	9	.	.	.	-16.5321	13.4952	0.61421	0.1562:0.8438:0.0:0.0	.	421;617;599	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	F	599;604;617	ENSP00000360373:V599F;ENSP00000338919:V604F;ENSP00000384109:V617F	.	V	-	1	0	CUL4B	119556600	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	6.066000	0.71185	2.315000	0.78130	0.594000	0.82650	GTC	-	CUL4B	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology		0.343	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	0	0	0	74	74	99	0.00	0.00	C	NM_003588		119672572	-1	24	17	52	60	tier1	no_errors	ENST00000404115	ensembl	human	known	74_37	missense	31.58	22.08	SNP	1.000	A	24	52
HR	55806	genome.wustl.edu	37	8	21986391	21986391	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr8:21986391C>T	ENST00000381418.4	-	2	1773	c.293G>A	c.(292-294)cGc>cAc	p.R98H	HR_ENST00000312841.8_Missense_Mutation_p.R98H|HR_ENST00000518377.1_5'Flank	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	98					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CTCCTTCCAGCGCAGTCCCTC	0.652													ENSG00000168453																																					0													54.0	52.0	53.0					8																	21986391		2202	4300	6502	SO:0001583	missense	0			-	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.293G>A	8.37:g.21986391C>T	ENSP00000370826:p.Arg98His		Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.R98H	ENST00000381418.4	37	c.293	CCDS6022.1	8	.	.	.	.	.	.	.	.	.	.	C	13.80	2.344423	0.41498	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.74106	-0.8;-0.81	4.72	2.85	0.33270	.	0.160475	0.29692	N	0.011458	T	0.59459	0.2195	L	0.34521	1.04	0.27888	N	0.939439	B;B;B	0.18741	0.023;0.03;0.017	B;B;B	0.14578	0.004;0.011;0.005	T	0.52852	-0.8520	10	0.51188	T	0.08	-7.088	6.2548	0.20867	0.0:0.7605:0.0:0.2395	.	98;98;98	A6NCE3;O43593-2;O43593	.;.;HAIR_HUMAN	H	98	ENSP00000370826:R98H;ENSP00000326765:R98H	ENSP00000326765:R98H	R	-	2	0	HR	22042336	0.048000	0.20356	0.996000	0.52242	0.905000	0.53344	-0.070000	0.11523	0.549000	0.28973	-0.258000	0.10820	CGC	-	HR	-	NULL		0.652	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	HGNC	protein_coding	OTTHUMT00000214213.1	0	0	0	64	64	57	0.00	0.00	C			21986391	-1	9	15	44	31	tier1	no_errors	ENST00000381418	ensembl	human	known	74_37	missense	16.98	31.91	SNP	0.988	T	9	44
ABCC10	89845	genome.wustl.edu	37	6	43403588	43403588	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr6:43403588C>T	ENST00000372530.4	+	5	1923	c.1708C>T	c.(1708-1710)Cgg>Tgg	p.R570W	ABCC10_ENST00000244533.3_Missense_Mutation_p.R527W	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	570					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GTCCTTGGACCGGATCCAGCT	0.567													ENSG00000124574																																					0													114.0	102.0	106.0					6																	43403588		2203	4300	6503	SO:0001583	missense	0			-	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1708C>T	6.37:g.43403588C>T	ENSP00000361608:p.Arg570Trp		Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.R570W	ENST00000372530.4	37	c.1708	CCDS56430.1	6	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392994	0.83011	.	.	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.97279	-4.32;-3.98;-3.98	5.3	5.3	0.74995	ABC transporter, transmembrane domain, type 1 (1);	0.072532	0.56097	D	0.000025	D	0.99111	0.9694	H	0.97051	3.93	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99331	1.0909	10	0.87932	D	0	-36.0171	18.9723	0.92719	0.0:1.0:0.0:0.0	.	527;570	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	W	126;570;527	ENSP00000361593:R126W;ENSP00000361608:R570W;ENSP00000244533:R527W	ENSP00000244533:R527W	R	+	1	2	ABCC10	43511566	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	3.776000	0.55356	2.492000	0.84095	0.462000	0.41574	CGG	-	ABCC10	-	superfamily_ABC1_TM_dom		0.567	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC10	HGNC	protein_coding	OTTHUMT00000040603.2	0	0	0	40	40	146	0.00	0.00	C	NM_033450		43403588	+1	6	35	22	76	tier1	no_errors	ENST00000372530	ensembl	human	known	74_37	missense	21.43	31.53	SNP	1.000	T	6	22
SKIL	6498	genome.wustl.edu	37	3	170078753	170078753	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr3:170078753C>T	ENST00000458537.3	+	1	1343	c.634C>T	c.(634-636)Cca>Tca	p.P212S	SKIL_ENST00000413427.2_Missense_Mutation_p.P212S|SKIL_ENST00000259119.4_Missense_Mutation_p.P212S|SKIL_ENST00000426052.2_Missense_Mutation_p.P192S	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	212					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			GGGCATACTTCCATTCAATGC	0.398													ENSG00000136603																																					0													110.0	102.0	105.0					3																	170078753		2203	4300	6503	SO:0001583	missense	0			-	X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.634C>T	3.37:g.170078753C>T	ENSP00000415243:p.Pro212Ser		A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_D-bd_dom_put	p.P212S	ENST00000458537.3	37	c.634	CCDS33890.1	3	.	.	.	.	.	.	.	.	.	.	C	17.88	3.498104	0.64186	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.51	5.51	0.81932	DNA binding domain, putative (1);Transforming protein Ski (2);	0.000000	0.85682	D	0.000000	D	0.92133	0.7506	M	0.83774	2.66	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	D	0.92816	0.6268	10	0.87932	D	0	-7.2864	19.4767	0.94992	0.0:1.0:0.0:0.0	.	212;212	P12757-3;P12757	.;SKIL_HUMAN	S	212;192;212;212	ENSP00000259119:P212S;ENSP00000406520:P192S;ENSP00000400193:P212S;ENSP00000415243:P212S	ENSP00000259119:P212S	P	+	1	0	SKIL	171561447	1.000000	0.71417	1.000000	0.80357	0.305000	0.27757	7.487000	0.81328	2.612000	0.88384	0.644000	0.83932	CCA	-	SKIL	-	pfam_Transform_Ski,superfamily_D-bd_dom_put		0.398	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIL	HGNC	protein_coding	OTTHUMT00000352351.4	0	0	0	24	24	81	0.00	0.00	C	NM_005414		170078753	+1	6	24	13	41	tier1	no_errors	ENST00000259119	ensembl	human	known	74_37	missense	31.58	36.36	SNP	1.000	T	6	13
POU2F1	5451	genome.wustl.edu	37	1	167381363	167381363	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:167381363C>T	ENST00000541643.3	+	15	1816	c.1654C>T	c.(1654-1656)Cct>Tct	p.P552S	POU2F1_ENST00000429375.2_Missense_Mutation_p.P512S|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367862.5_Missense_Mutation_p.P564S|POU2F1_ENST00000420254.3_Missense_Mutation_p.P552S|POU2F1_ENST00000367866.2_Missense_Mutation_p.P575S			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	552					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						CACCTCCACTCCTTTGTCCTC	0.602													ENSG00000143190																																					0													118.0	81.0	93.0					1																	167381363		2203	4300	6503	SO:0001583	missense	0			-	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.1654C>T	1.37:g.167381363C>T	ENSP00000441285:p.Pro552Ser		B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.P575S	ENST00000541643.3	37	c.1723		1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.117230	0.37339	.	.	ENSG00000143190	ENST00000367866;ENST00000429375;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	D;D;T;T;T;T;T	0.85556	-2.0;-1.96;1.11;1.11;1.11;1.11;1.11	5.5	3.45	0.39498	.	0.630757	0.15448	N	0.261843	T	0.55816	0.1944	N	0.14661	0.345	0.32023	N	0.600507	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.001;0.0	B;B;B;B;B	0.08055	0.001;0.002;0.002;0.003;0.001	T	0.24261	-1.0165	9	0.29301	T	0.29	.	10.3104	0.43706	0.1707:0.7619:0.0:0.0674	.	512;552;564;550;552	B4E029;P14859-4;P14859-2;P14859-3;P14859	.;.;.;.;PO2F1_HUMAN	S	575;512;550;552;552;564;460	ENSP00000356840:P575S;ENSP00000401217:P512S;ENSP00000356839:P550S;ENSP00000414660:P552S;ENSP00000441285:P552S;ENSP00000356836:P564S;ENSP00000415993:P460S	ENSP00000356836:P564S	P	+	1	0	POU2F1	165647987	1.000000	0.71417	0.698000	0.30274	0.999000	0.98932	3.436000	0.52856	0.599000	0.29845	0.650000	0.86243	CCT	-	POU2F1	-	NULL		0.602	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		0	0	0	48	48	94	0.00	0.00	C	NM_002697		167381363	+1	15	51	103	264	tier1	no_errors	ENST00000367866	ensembl	human	known	74_37	missense	12.71	16.19	SNP	0.999	T	15	103
RHCG	51458	genome.wustl.edu	37	15	90020057	90020057	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr15:90020057G>A	ENST00000268122.4	-	9	1308	c.1240C>T	c.(1240-1242)Ctc>Ttc	p.L414F	RHCG_ENST00000544600.1_Missense_Mutation_p.L414F	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	414					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					CTCAAAATGAGCCCTACAGAA	0.532													ENSG00000140519																																					0													91.0	83.0	86.0					15																	90020057		2200	4299	6499	SO:0001583	missense	0			-	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.1240C>T	15.37:g.90020057G>A	ENSP00000268122:p.Leu414Phe		A8K4D4|Q6X3Y4	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.L414F	ENST00000268122.4	37	c.1240	CCDS10351.1	15	.	.	.	.	.	.	.	.	.	.	G	6.979	0.550697	0.13374	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.25085	1.82;1.82	5.54	-11.1	0.00147	Ammonium transporter AmtB-like (3);	1.823320	0.02404	N	0.080918	T	0.10981	0.0268	N	0.17474	0.49	0.09310	N	1	B	0.16802	0.019	B	0.17979	0.02	T	0.14839	-1.0458	9	.	.	.	-1.8156	2.7534	0.05287	0.4049:0.2985:0.2076:0.089	.	414	Q9UBD6	RHCG_HUMAN	F	414;414;405	ENSP00000438123:L414F;ENSP00000268122:L414F	.	L	-	1	0	RHCG	87821061	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-3.441000	0.00470	-4.177000	0.00067	-0.312000	0.09012	CTC	-	RHCG	-	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom		0.532	RHCG-001	KNOWN	basic|CCDS	protein_coding	RHCG	HGNC	protein_coding	OTTHUMT00000312855.2	0	0	0	30	30	86	0.00	0.00	G	NM_016321		90020057	-1	8	22	30	73	tier1	no_errors	ENST00000268122	ensembl	human	known	74_37	missense	21.05	22.92	SNP	0.000	A	8	30
SMG7	9887	genome.wustl.edu	37	1	183497112	183497112	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:183497112G>T	ENST00000347615.2	+	6	625	c.506G>T	c.(505-507)aGc>aTc	p.S169I	SMG7_ENST00000508461.1_Missense_Mutation_p.S127I|SMG7_ENST00000456731.2_Missense_Mutation_p.S127I|SMG7_ENST00000507406.1_3'UTR|SMG7_ENST00000367537.3_Missense_Mutation_p.S198I|SMG7_ENST00000507469.1_Missense_Mutation_p.S169I|SMG7_ENST00000515829.2_Missense_Mutation_p.S169I	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	169					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						AACCAGACCAGCCAGGCAGAG	0.408													ENSG00000116698																																					0													93.0	77.0	82.0					1																	183497112		2203	4300	6503	SO:0001583	missense	0			-	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.506G>T	1.37:g.183497112G>T	ENSP00000340766:p.Ser169Ile		B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	pfam_EST1	p.S169I	ENST00000347615.2	37	c.506	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528793	0.85706	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19	5.76	5.76	0.90799	Tetratricopeptide-like helical (1);Telomerase activating protein Est1 (1);	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D;D	0.64830	0.994;0.988;0.988;0.985;0.994;0.988	D;P;P;P;D;P	0.65233	0.933;0.813;0.865;0.85;0.933;0.798	T	0.12293	-1.0553	10	0.51188	T	0.08	-10.2344	19.9759	0.97304	0.0:0.0:1.0:0.0	.	127;198;127;169;169;169	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	I	127;198;127;127;169;169;169	ENSP00000407629:S127I;ENSP00000356507:S198I;ENSP00000426915:S127I;ENSP00000388390:S127I;ENSP00000340766:S169I;ENSP00000425133:S169I;ENSP00000421358:S169I	ENSP00000340766:S169I	S	+	2	0	SMG7	181763735	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.191000	0.94940	2.713000	0.92767	0.655000	0.94253	AGC	-	SMG7	-	pfam_EST1		0.408	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1	0	0	0	26	26	79	0.00	0.00	G	NM_014837		183497112	+1	8	15	19	46	tier1	no_errors	ENST00000507469	ensembl	human	known	74_37	missense	29.63	24.59	SNP	1.000	T	8	19
METTL21B	25895	genome.wustl.edu	37	12	58168428	58168428	+	Intron	SNP	G	G	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:58168428G>T	ENST00000300209.8	+	2	414				METTL21B_ENST00000551420.1_Intron|METTL1_ENST00000324871.7_5'Flank|RP11-571M6.15_ENST00000553083.1_Intron|RP11-571M6.15_ENST00000471530.1_Intron|METTL21B_ENST00000552307.1_3'UTR|AC025165.1_ENST00000582738.1_RNA|METTL1_ENST00000257848.7_5'Flank|METTL1_ENST00000548681.1_5'Flank|METTL21B_ENST00000333012.5_Silent_p.V102V|METTL21B_ENST00000548256.1_Silent_p.V60V	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						atggtctagtgagggagacag	0.458													ENSG00000123427																																					0													81.0	64.0	70.0					12																	58168428		2203	4300	6503	SO:0001627	intron_variant	0			-	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459	ENST00000300209.8:c.289+1517G>T	12.37:g.58168428G>T			Q9H749|Q9Y3W2	Silent	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.V102	ENST00000300209.8	37	c.306	CCDS8957.1	12																																																																																			-	METTL21B	-	NULL		0.458	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21B	HGNC	protein_coding	OTTHUMT00000409268.1	0	0	0	37	37	99	0.00	0.00	G	NM_015433		58168428	+1	143	201	451	895	tier1	no_errors	ENST00000333012	ensembl	human	known	74_37	silent	24.03	18.31	SNP	0.010	T	143	451
TFDP3	51270	genome.wustl.edu	37	X	132351355	132351355	+	Silent	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chrX:132351355G>A	ENST00000310125.4	-	1	1021	c.933C>T	c.(931-933)gcC>gcT	p.A311A		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	311					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					TAAGGTCTTCGGCAGAGCAGC	0.498													ENSG00000183434																																					0													64.0	65.0	65.0					X																	132351355		2202	4298	6500	SO:0001819	synonymous_variant	0			-	AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.933C>T	X.37:g.132351355G>A			Q6DK49|Q9NZ54	Silent	SNP	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcrpt_fac_DP	p.A311	ENST00000310125.4	37	c.933	CCDS14636.2	X																																																																																			-	TFDP3	-	pfam_Transc_factor_DP_C,pirsf_Transcrpt_fac_DP		0.498	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFDP3	HGNC	protein_coding	OTTHUMT00000058337.1	0	0	0	40	40	59	0.00	0.00	G	NM_016521		132351355	-1	10	11	32	21	tier1	no_errors	ENST00000310125	ensembl	human	known	74_37	silent	23.81	34.38	SNP	0.998	A	10	32
TTN	7273	genome.wustl.edu	37	2	179476124	179476124	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr2:179476124T>A	ENST00000591111.1	-	219	46133	c.45909A>T	c.(45907-45909)gaA>gaT	p.E15303D	TTN_ENST00000589042.1_Missense_Mutation_p.E16944D|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E14376D|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E8004D|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E7879D|TTN_ENST00000342175.6_Missense_Mutation_p.E8071D|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15303	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAACCACATTTTCAGAGATTT	0.383													ENSG00000155657																																					0													76.0	72.0	73.0					2																	179476124		1987	4175	6162	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45909A>T	2.37:g.179476124T>A	ENSP00000465570:p.Glu15303Asp		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E14376D	ENST00000591111.1	37	c.43128		2	.	.	.	.	.	.	.	.	.	.	T	11.91	1.778298	0.31502	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.95	4.82	0.62117	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54886	0.1886	N	0.25647	0.755	0.43152	D	0.994923	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.72625	0.978;0.978;0.978;0.978	T	0.59075	-0.7522	9	0.87932	D	0	.	6.3574	0.21408	0.0:0.2319:0.0:0.7681	.	7879;8004;8071;15303	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	14376;7879;8071;8004;7879	ENSP00000343764:E14376D;ENSP00000434586:E7879D;ENSP00000340554:E8071D;ENSP00000352154:E8004D	ENSP00000340554:E8071D	E	-	3	2	TTN	179184369	0.994000	0.37717	1.000000	0.80357	0.986000	0.74619	0.254000	0.18314	2.279000	0.76181	0.533000	0.62120	GAA	-	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	23	23	70	0.00	0.00	T	NM_133378		179476124	-1	7	13	24	37	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	22.58	26.00	SNP	1.000	A	7	24
SI	6476	genome.wustl.edu	37	3	164786611	164786611	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr3:164786611C>T	ENST00000264382.3	-	5	444	c.382G>A	c.(382-384)Gcc>Acc	p.A128T		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	128	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTTAATTTGGCTTCAACTCCT	0.313										HNSCC(35;0.089)			ENSG00000090402																																					0													103.0	107.0	106.0					3																	164786611		2203	4300	6503	SO:0001583	missense	0			-	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.382G>A	3.37:g.164786611C>T	ENSP00000264382:p.Ala128Thr		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.A128T	ENST00000264382.3	37	c.382	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	C	14.62	2.588405	0.46110	.	.	ENSG00000090402	ENST00000264382	D	0.86366	-2.11	5.5	2.75	0.32379	Glycoside hydrolase-type carbohydrate-binding (1);	0.399837	0.25543	N	0.029951	D	0.89656	0.6778	H	0.94222	3.51	0.41908	D	0.990451	B	0.29716	0.255	B	0.29862	0.108	D	0.87025	0.2131	10	0.59425	D	0.04	.	10.6071	0.45400	0.0:0.792:0.0:0.208	.	128	P14410	SUIS_HUMAN	T	128	ENSP00000264382:A128T	ENSP00000264382:A128T	A	-	1	0	SI	166269305	0.988000	0.35896	0.797000	0.32132	0.529000	0.34654	1.310000	0.33551	0.385000	0.24970	0.467000	0.42956	GCC	-	SI	-	superfamily_Gal_mutarotase_SF_dom		0.313	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	0	0	0	63	63	68	0.00	0.00	C	NM_001041		164786611	-1	21	21	37	56	tier1	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	36.21	27.27	SNP	0.990	T	21	37
PRLHR	2834	genome.wustl.edu	37	10	120353829	120353829	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr10:120353829G>T	ENST00000369169.1	-	1	927	c.928C>A	c.(928-930)Cct>Act	p.P310T	PRLHR_ENST00000239032.2_Missense_Mutation_p.P310T			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	310					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		AAGGCGTAAGGGTCGATGGCG	0.637													ENSG00000119973																																					0													48.0	47.0	48.0					10																	120353829		2203	4300	6503	SO:0001583	missense	0			-	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.928C>A	10.37:g.120353829G>T	ENSP00000358167:p.Pro310Thr		O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.P310T	ENST00000369169.1	37	c.928	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588096	0.28268	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.53640	0.61;0.61	4.38	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.188220	0.44902	D	0.000401	T	0.20577	0.0495	N	0.04508	-0.205	0.31653	N	0.646619	B	0.22276	0.067	B	0.27380	0.079	T	0.10109	-1.0644	10	0.21014	T	0.42	.	2.8764	0.05632	0.094:0.1413:0.4749:0.2899	.	310	P49683	PRLHR_HUMAN	T	310	ENSP00000239032:P310T;ENSP00000358167:P310T	ENSP00000239032:P310T	P	-	1	0	PRLHR	120343819	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.781000	0.55394	1.051000	0.40369	0.561000	0.74099	CCT	-	PRLHR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt		0.637	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	HGNC	protein_coding	OTTHUMT00000050610.1	0	0	0	73	73	29	0.00	0.00	G	NM_004248		120353829	-1	10	6	42	15	tier1	no_errors	ENST00000239032	ensembl	human	known	74_37	missense	19.23	28.57	SNP	1.000	T	10	42
MMP3	4314	genome.wustl.edu	37	11	102712894	102712894	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr11:102712894delC	ENST00000299855.5	-	4	872	c.616delG	c.(616-618)gatfs	p.D206fs		NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	206					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	CCTGTTGTATCCTTTGTCCAT	0.393													ENSG00000149968																																					0													138.0	127.0	131.0					11																	102712894		2203	4299	6502	SO:0001589	frameshift_variant	0				X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.616delG	11.37:g.102712894delC	ENSP00000299855:p.Asp206fs		B2R8B8|Q3B7S0|Q6GRF8	Frame_Shift_Del	DEL	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.D206fs	ENST00000299855.5	37	c.616	CCDS8323.1	11																																																																																				MMP3	-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo		0.393	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP3	HGNC	protein_coding	OTTHUMT00000109758.2	0	0	0	52	52	106	0.00	0.00	C	NM_002422		102712894	-1	14	20	34	68	tier1	no_errors	ENST00000299855	ensembl	human	known	74_37	frame_shift_del	29.17	22.73	DEL	0.219	-	14	34
ZNRF4	148066	genome.wustl.edu	37	19	5456046	5456046	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr19:5456046G>A	ENST00000222033.4	+	1	621	c.544G>A	c.(544-546)Gcg>Acg	p.A182T		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	182	PA.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CGGCTTCGAGGCGGCCATCGT	0.652													ENSG00000105428																																					0													42.0	44.0	44.0					19																	5456046		2136	4245	6381	SO:0001583	missense	0			-	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.544G>A	19.37:g.5456046G>A	ENSP00000222033:p.Ala182Thr		A8K886|O75866	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.A182T	ENST00000222033.4	37	c.544	CCDS42475.1	19	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604191	0.66445	.	.	ENSG00000105428	ENST00000222033	T	0.12569	2.67	4.65	4.65	0.58169	Protease-associated domain, PA (1);	0.000000	0.85682	U	0.000000	T	0.50154	0.1599	H	0.96239	3.79	0.45118	D	0.998136	D	0.89917	1.0	D	0.80764	0.994	T	0.67138	-0.5746	10	0.87932	D	0	-20.7566	14.2204	0.65823	0.0:0.0:1.0:0.0	.	182	Q8WWF5	ZNRF4_HUMAN	T	182	ENSP00000222033:A182T	ENSP00000222033:A182T	A	+	1	0	ZNRF4	5407046	0.962000	0.33011	0.049000	0.19019	0.429000	0.31625	3.865000	0.56033	2.140000	0.66376	0.491000	0.48974	GCG	-	ZNRF4	-	pfam_Protease-assoc_domain		0.652	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF4	HGNC	protein_coding	OTTHUMT00000450924.1	0	0	0	32	32	41	0.00	0.00	G	NM_181710		5456046	+1	8	3	32	5	tier1	no_errors	ENST00000222033	ensembl	human	known	74_37	missense	20.00	37.50	SNP	0.748	A	8	32
SMC4	10051	genome.wustl.edu	37	3	160148853	160148853	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr3:160148853A>G	ENST00000357388.3	+	20	3425	c.2974A>G	c.(2974-2976)Aat>Gat	p.N992D	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Intron|SMC4_ENST00000344722.5_Missense_Mutation_p.N992D|SMC4_ENST00000469762.1_Missense_Mutation_p.N967D|SMC4_ENST00000360111.2_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	992					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGAACATCGCAATCTGCTTCA	0.333													ENSG00000113810																																					0													53.0	55.0	55.0					3																	160148853		2203	4298	6501	SO:0001583	missense	0			-	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2974A>G	3.37:g.160148853A>G	ENSP00000349961:p.Asn992Asp		A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.N992D	ENST00000357388.3	37	c.2974	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	A	5.522	0.281283	0.10458	.	.	ENSG00000113810	ENST00000357388;ENST00000469762;ENST00000344722;ENST00000545277	T;T;T	0.77358	-1.09;-0.76;-1.09	5.95	2.19	0.27852	RecF/RecN/SMC (1);	0.558447	0.22235	N	0.062762	T	0.56717	0.2004	N	0.13327	0.33	0.09310	N	1	B;B;B	0.24675	0.001;0.001;0.109	B;B;B	0.30943	0.004;0.003;0.122	T	0.41197	-0.9522	10	0.13108	T	0.6	-8.3679	5.7999	0.18408	0.6986:0.0:0.1877:0.1137	.	967;967;992	B3KXX5;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	D	992;967;992;586	ENSP00000349961:N992D;ENSP00000417964:N967D;ENSP00000341382:N992D	ENSP00000341382:N992D	N	+	1	0	SMC4	161631547	0.000000	0.05858	0.617000	0.29091	0.627000	0.37826	0.348000	0.20031	0.138000	0.18790	-0.256000	0.11100	AAT	-	SMC4	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase		0.333	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	0	0	0	49	49	95	0.00	0.00	A			160148853	+1	6	4	29	75	tier1	no_errors	ENST00000344722	ensembl	human	known	74_37	missense	17.14	5.06	SNP	0.000	G	6	29
HIST2H2AB	317772	genome.wustl.edu	37	1	149859187	149859187	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:149859187G>C	ENST00000331128.3	-	1	279	c.280C>G	c.(280-282)Ctc>Gtc	p.L94V	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_175065.2	NP_778235.1	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	94						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			AACTTGTTGAGCTCTTCGTCA	0.587													ENSG00000184270																																					0													113.0	104.0	107.0					1																	149859187		2203	4300	6503	SO:0001583	missense	0			-	AY131972	CCDS938.1	1q21.2	2011-01-27	2006-10-11		ENSG00000184270	ENSG00000184270		"""Histones / Replication-dependent"""	20508	protein-coding gene	gene with protein product		615014	"""histone 2, H2ab"""			12408966	Standard	NM_175065		Approved		uc001ete.3	Q8IUE6	OTTHUMG00000012085	ENST00000331128.3:c.280C>G	1.37:g.149859187G>C	ENSP00000332790:p.Leu94Val			Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.L94V	ENST00000331128.3	37	c.280	CCDS938.1	1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617891	0.46736	.	.	ENSG00000184270	ENST00000331128	T	0.52983	0.64	5.02	5.02	0.67125	Histone-fold (2);Histone H2A (1);	0.000000	0.52532	D	0.000069	T	0.58018	0.2093	M	0.80422	2.495	0.42111	D	0.991385	D	0.64830	0.994	P	0.60173	0.87	T	0.65026	-0.6268	10	0.87932	D	0	.	12.0084	0.53272	0.0:0.1746:0.8254:0.0	.	94	Q8IUE6	H2A2B_HUMAN	V	94	ENSP00000332790:L94V	ENSP00000332790:L94V	L	-	1	0	HIST2H2AB	148125811	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.773000	0.98989	2.480000	0.83734	0.561000	0.74099	CTC	-	HIST2H2AB	-	superfamily_Histone-fold,smart_Histone_H2A		0.587	HIST2H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AB	HGNC	protein_coding	OTTHUMT00000033440.1	0	0	0	54	54	82	0.00	0.00	G	NM_175065		149859187	-1	6	6	43	66	tier1	no_errors	ENST00000331128	ensembl	human	known	74_37	missense	12.24	8.22	SNP	1.000	C	6	43
CPNE8	144402	genome.wustl.edu	37	12	39124125	39124125	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:39124125C>T	ENST00000331366.5	-	11	854	c.758G>A	c.(757-759)aGg>aAg	p.R253K	CPNE8_ENST00000360449.3_Missense_Mutation_p.R241K	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	253						extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				AGAAAGTTCCCTATAGCTTGT	0.279													ENSG00000139117																																					0													91.0	93.0	92.0					12																	39124125		2203	4295	6498	SO:0001583	missense	0			-	AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.758G>A	12.37:g.39124125C>T	ENSP00000329748:p.Arg253Lys		Q2TB41|Q86VY2	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.R253K	ENST00000331366.5	37	c.758	CCDS8733.1	12	.	.	.	.	.	.	.	.	.	.	C	14.88	2.668869	0.47677	.	.	ENSG00000139117	ENST00000331366;ENST00000360449	T;T	0.38722	1.12;1.12	4.43	4.43	0.53597	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.34424	0.0897	L	0.41236	1.265	0.58432	D	0.999992	B	0.17465	0.022	B	0.18871	0.023	T	0.12863	-1.0531	10	0.13470	T	0.59	-14.2098	16.6826	0.85296	0.0:1.0:0.0:0.0	.	253	Q86YQ8	CPNE8_HUMAN	K	253;241	ENSP00000329748:R253K;ENSP00000353633:R241K	ENSP00000329748:R253K	R	-	2	0	CPNE8	37410392	1.000000	0.71417	0.987000	0.45799	0.994000	0.84299	4.595000	0.61048	2.382000	0.81193	0.655000	0.94253	AGG	-	CPNE8	-	superfamily_C2_dom,smart_C2_dom		0.279	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	0	0	0	82	82	102	0.00	0.00	C	NM_153634		39124125	-1	9	10	67	95	tier1	no_errors	ENST00000331366	ensembl	human	known	74_37	missense	11.84	9.52	SNP	1.000	T	9	67
LYZ	4069	genome.wustl.edu	37	12	69744056	69744056	+	Intron	SNP	A	A	G			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr12:69744056A>G	ENST00000261267.2	+	2	369				LYZ_ENST00000548839.1_Missense_Mutation_p.K102R|LYZ_ENST00000549690.1_Intron	NM_000239.2	NP_000230.1	P61626	LYSC_HUMAN	lysozyme						cell wall macromolecule catabolic process (GO:0016998)|cytolysis (GO:0019835)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|lysozyme activity (GO:0003796)			endometrium(2)|lung(1)|upper_aerodigestive_tract(1)	4	all_epithelial(5;2.98e-35)|Lung NSC(4;9.93e-33)|all_lung(4;5.66e-31)|Breast(13;2.56e-06)|Esophageal squamous(21;0.187)		Epithelial(6;8.26e-19)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00503)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)		L-Aspartic Acid(DB00128)	TGCAGTGGTAAGACAAGCTAA	0.388													ENSG00000090382																																					0													110.0	98.0	102.0					12																	69744056		2203	4300	6503	SO:0001627	intron_variant	0			-	X14008	CCDS8989.1	12q15	2014-09-17	2010-04-29			ENSG00000090382	3.2.1.17		6740	protein-coding gene	gene with protein product	"""renal amyloidosis"""	153450	"""lysozyme (renal amyloidosis)"""			8464497, 2546758	Standard	NM_000239		Approved		uc001suw.2	P61626	OTTHUMG00000169342	ENST00000261267.2:c.301+4A>G	12.37:g.69744056A>G			P00695|Q13170|Q9UCF8	Missense_Mutation	SNP	pfam_Glyco_hydro_22,pfam_TGlycosylase-like_SLT,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22_lys,prints_Glyco_hydro_22	p.K102R	ENST00000261267.2	37	c.305	CCDS8989.1	12	.	.	.	.	.	.	.	.	.	.	A	2.633	-0.285859	0.05605	.	.	ENSG00000090382	ENST00000548839	T	0.70282	-0.47	5.64	5.64	0.86602	.	.	.	.	.	T	0.71762	0.3378	.	.	.	0.28842	N	0.89656	.	.	.	.	.	.	T	0.67444	-0.5669	5	.	.	.	.	14.1079	0.65104	1.0:0.0:0.0:0.0	.	.	.	.	R	102	ENSP00000449969:K102R	.	K	+	2	0	LYZ	68030323	1.000000	0.71417	0.999000	0.59377	0.188000	0.23474	3.695000	0.54749	2.275000	0.75901	0.528000	0.53228	AAG	-	LYZ	-	smart_Glyco_hydro_22,prints_Glyco_hydro_22		0.388	LYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYZ	HGNC	protein_coding	OTTHUMT00000403624.2	0	0	0	29	29	91	0.00	0.00	A	NM_000239		69744056	+1	39	165	439	1728	tier1	no_errors	ENST00000548839	ensembl	human	putative	74_37	missense	8.16	8.72	SNP	1.000	G	39	439
GIGYF1	64599	genome.wustl.edu	37	7	100279600	100279600	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr7:100279600C>T	ENST00000275732.5	-	23	4151	c.2942G>A	c.(2941-2943)aGc>aAc	p.S981N	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	981					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CAGCGAGGCGCTGCTCAGCCA	0.677													ENSG00000146830																																					0													31.0	29.0	30.0					7																	100279600		2202	4300	6502	SO:0001583	missense	0			-	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.2942G>A	7.37:g.100279600C>T	ENSP00000275732:p.Ser981Asn		Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.S981N	ENST00000275732.5	37	c.2942	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	10.56	1.383309	0.25031	.	.	ENSG00000146830	ENST00000539430;ENST00000275732	T	0.63255	-0.03	5.14	3.27	0.37495	.	0.270358	0.41500	D	0.000877	T	0.37972	0.1023	N	0.14661	0.345	0.24871	N	0.992281	B	0.02656	0.0	B	0.01281	0.0	T	0.12837	-1.0532	10	0.17369	T	0.5	-4.3766	7.1004	0.25333	0.0:0.6406:0.263:0.0964	.	981	O75420	PERQ1_HUMAN	N	700;981	ENSP00000275732:S981N	ENSP00000275732:S981N	S	-	2	0	GIGYF1	100117536	0.968000	0.33430	0.815000	0.32552	0.791000	0.44710	2.753000	0.47524	1.402000	0.46780	-0.263000	0.10527	AGC	-	GIGYF1	-	NULL		0.677	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	0	0	0	72	72	9	0.00	0.00	C	NM_022574		100279600	-1	19	0	42	3	tier1	no_errors	ENST00000275732	ensembl	human	known	74_37	missense	30.65	0.00	SNP	0.960	T	19	42
KIAA1279	26128	genome.wustl.edu	37	10	70748980	70748980	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr10:70748980C>T	ENST00000361983.4	+	1	494	c.392C>T	c.(391-393)tCg>tTg	p.S131L		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	131					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						TACCGGCTCTCGCACGACTGC	0.677													ENSG00000198954																																					0													17.0	20.0	19.0					10																	70748980		2203	4296	6499	SO:0001583	missense	0			-	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.392C>T	10.37:g.70748980C>T	ENSP00000354848:p.Ser131Leu		A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	pfam_KBP	p.S131L	ENST00000361983.4	37	c.392	CCDS7284.1	10	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680441	0.68042	.	.	ENSG00000198954	ENST00000361983	T	0.46063	0.88	5.62	3.63	0.41609	Tetratricopeptide-like helical (1);	0.628598	0.17527	N	0.171025	T	0.30916	0.0780	L	0.54323	1.7	0.43467	D	0.995674	P	0.44006	0.824	B	0.27887	0.084	T	0.25187	-1.0139	10	0.30078	T	0.28	-26.7439	13.4339	0.61073	0.1282:0.7585:0.1133:0.0	.	131	Q96EK5	KBP_HUMAN	L	131	ENSP00000354848:S131L	ENSP00000354848:S131L	S	+	2	0	KIAA1279	70418986	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	4.499000	0.60380	2.665000	0.90641	0.579000	0.79373	TCG	-	KIAA1279	-	NULL		0.677	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1279	HGNC	protein_coding	OTTHUMT00000048370.1	0	0	0	43	43	18	0.00	0.00	C	NM_015634		70748980	+1	4	0	34	6	tier1	no_errors	ENST00000361983	ensembl	human	known	74_37	missense	10.53	0.00	SNP	0.989	T	4	34
SCN11A	11280	genome.wustl.edu	37	3	38948802	38948813	+	Intron	DEL	TGTGTGTGTGTG	TGTGTGTGTGTG	-	rs141158768		TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	TGTGTGTGTGTG	TGTGTGTGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr3:38948802_38948813delTGTGTGTGTGTG	ENST00000302328.3	-	10	1672				AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000456224.3_Intron|SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000444237.2_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ccAACATATAtgtgtgtgtgtgtgtgtgtgtg	0.373													ENSG00000215941																																					0																																										SO:0001627	intron_variant	0				AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+626CACACACACACA>-	3.37:g.38948802_38948813delTGTGTGTGTGTG			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	R	DEL	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																				AC116038.1	-	-		0.373	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000109746.4	0	0	0	0	0	0	0.00	0.00	TGTGTGTGTGTG	NM_014139		38948813	+1	0	0	0	0	tier1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.000:0.001:0.005:0.007:0.015:0.028:0.021:0.020:0.022:0.022:0.028:0.032	-	0	0
RP11-435B5.5	0	genome.wustl.edu	37	1	143378289	143378289	+	lincRNA	SNP	G	G	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr1:143378289G>T	ENST00000428624.1	+	0	1009				RP11-435B5.3_ENST00000430699.1_lincRNA|RP11-435B5.4_ENST00000423249.1_lincRNA																							GAAGGAAGAAGAAAGCAACAA	0.383													ENSG00000238261																																					0																																												0			-																													1.37:g.143378289G>T				R	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	RP11-435B5.5	-	-		0.383	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	0	0	0	123	123	1	0.00	0.00	G			143378289	+1	21	0	75	0	tier1	no_errors	ENST00000428624	ensembl	human	known	74_37	rna	21.88	0.00	SNP	0.026	T	21	75
MUC4	4585	genome.wustl.edu	37	3	195509286	195509286	+	Silent	SNP	G	G	A	rs71291872|rs199497029	byFrequency	TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr3:195509286G>A	ENST00000463781.3	-	2	9624	c.9165C>T	c.(9163-9165)aaC>aaT	p.N3055N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.N3055N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	996					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CATGAAGAGGGTTGGCGTGAC	0.627													ENSG00000145113																																					0													29.0	15.0	19.0					3																	195509286		629	1559	2188	SO:0001819	synonymous_variant	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9165C>T	3.37:g.195509286G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.N3055	ENST00000463781.3	37	c.9165	CCDS54700.1	3																																																																																			-	MUC4	-	NULL		0.627	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	168	168	2	0.00	0.00	G	NM_018406		195509286	-1	17	0	110	4	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	13.39	0.00	SNP	0.001	A	17	110
PRR21	643905	genome.wustl.edu	37	2	240982144	240982144	+	Frame_Shift_Del	DEL	T	T	-	rs79314166	byFrequency	TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr2:240982144delT	ENST00000408934.1	-	1	255	c.256delA	c.(256-258)agtfs	p.S86fs		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	86	Pro-rich.							p.S86fs*291(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GATGAAGGACTGTGGGTGAAG	0.617													ENSG00000221961																																					2	Deletion - Frameshift(2)	upper_aerodigestive_tract(2)											162.0	154.0	157.0					2																	240982144		2058	4126	6184	SO:0001589	frameshift_variant	0				AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.256delA	2.37:g.240982144delT	ENSP00000386166:p.Ser86fs			Frame_Shift_Del	DEL	NULL	p.S86fs	ENST00000408934.1	37	c.256	CCDS33417.1	2																																																																																				PRR21	-	NULL		0.617	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR21	HGNC	protein_coding		0	0	0	15	15	0	0.00	0.00	T	NM_001080835		240982144	-1	3	0	7	2	tier1	no_errors	ENST00000408934	ensembl	human	known	74_37	frame_shift_del	30.00	0.00	DEL	0.000	-	3	7
TRAM1	23471	genome.wustl.edu	37	8	71520527	71520527	+	5'UTR	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr8:71520527C>T	ENST00000262213.2	-	0	77				TRAM1_ENST00000521049.1_5'UTR|TRAM1_ENST00000521425.1_5'Flank|TRAM1_ENST00000536748.1_5'UTR|RP11-382J12.1_ENST00000499227.2_5'Flank	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1						cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			GCTGGCTGCTCCTCACGGCCC	0.706													ENSG00000067167																									Ovarian(85;984 1334 5116 12432 40638)												0																																										SO:0001623	5_prime_UTR_variant	0			-	X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.-93G>A	8.37:g.71520527C>T			B4E0K2	R	SNP	-	NULL	ENST00000262213.2	37	NULL	CCDS6207.1	8																																																																																			-	TRAM1	-	-		0.706	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM1	HGNC	protein_coding	OTTHUMT00000378738.1	0	0	0	11	11	1	0.00	0.00	C	NM_014294		71520527	-1	6	1	5	1	tier1	no_errors	ENST00000520700	ensembl	human	known	74_37	rna	54.55	50.00	SNP	0.009	T	6	5
CFTR	1080	genome.wustl.edu	37	7	117188766	117188766	+	Silent	SNP	C	C	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr7:117188766C>T	ENST00000003084.6	+	10	1413	c.1281C>T	c.(1279-1281)agC>agT	p.S427S	CFTR_ENST00000454343.1_Intron	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	427	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GTGATGACAGCCTCTTCTTCA	0.373									Cystic Fibrosis				ENSG00000001626																																					0													27.0	27.0	27.0					7																	117188766		2202	4280	6482	SO:0001819	synonymous_variant	0	Familial Cancer Database	CF	-	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1281C>T	7.37:g.117188766C>T			Q20BG8|Q20BH2|Q2I0A1|Q2I102	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.S427	ENST00000003084.6	37	c.1281	CCDS5773.1	7																																																																																			-	CFTR	-	superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,pfscan_ABC_transporter-like,tigrfam_cAMP_cl_channel		0.373	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	0	0	0	105	105	55	0.00	0.00	C	NM_000492		117188766	+1	9	3	75	38	tier1	no_errors	ENST00000003084	ensembl	human	known	74_37	silent	10.71	7.32	SNP	0.424	T	9	75
CEACAM20	125931	genome.wustl.edu	37	19	45029180	45029180	+	RNA	SNP	A	A	T			TCGA-DX-A1L3-01A-11D-A24N-09	TCGA-DX-A1L3-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	18ec066e-8510-4921-9e35-45d85fb01e38	7f34c3a1-efee-47c6-bd61-502061fec7e3	g.chr19:45029180A>T	ENST00000454753.1	-	0	428							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				TCCCAAACACAGGCAGAACAA	0.557													ENSG00000176395																																					0													113.0	119.0	117.0					19																	45029180		2043	4193	6236			0			-	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45029180A>T				R	SNP	-	NULL	ENST00000454753.1	37	NULL		19																																																																																			-	CEACAM20	-	-		0.557	CEACAM20-001	KNOWN	basic	processed_transcript	CEACAM20	HGNC	processed_transcript	OTTHUMT00000323032.1	0	0	0	67	67	104	0.00	0.00	A	NM_198444		45029180	-1	6	3	63	105	tier1	no_errors	ENST00000316962	ensembl	human	known	74_37	rna	8.70	2.78	SNP	0.001	T	6	63
