#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
RTN3	10313	genome.wustl.edu	37	11	63525788	63525788	+	3'UTR	DEL	T	T	-			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr11:63525788delT	ENST00000377819.5	+	0	3368				RTN3_ENST00000341307.2_3'UTR|C11orf95_ENST00000433688.1_lincRNA|RTN3_ENST00000354497.4_Frame_Shift_Del_p.A190fs|RTN3_ENST00000356000.3_3'UTR|RTN3_ENST00000540798.1_3'UTR|RTN3_ENST00000339997.4_3'UTR|RTN3_ENST00000537981.1_3'UTR	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3						apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						CATTCCAAGCTTTTTTTTTAA	0.348													ENSG00000133318																																					0													48.0	49.0	49.0					11																	63525788		2201	4298	6499	SO:0001624	3_prime_UTR_variant	0				AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.*115T>-	11.37:g.63525788delT			B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Frame_Shift_Del	DEL	pfam_Reticulon,pfscan_Reticulon	p.L193fs	ENST00000377819.5	37	c.570	CCDS58141.1	11																																																																																				RTN3	-	NULL		0.348	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1	0	0		28	28		0.00		T	NM_006054		63525788	+1	2		23		tier1	no_errors	ENST00000354497	ensembl	human	putative	74_37	frame_shift_del	8.00		DEL	0.998	-	2	23
GYPB	2994	genome.wustl.edu	37	4	144917363	144917363	+	3'UTR	SNP	G	G	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr4:144917363G>T	ENST00000502664.1	-	0	416				GYPB_ENST00000513128.1_3'UTR|RP11-673E1.4_ENST00000506982.1_RNA|GYPB_ENST00000283126.7_3'UTR|GYPB_ENST00000510196.2_5'UTR	NM_002100.4	NP_002091	P06028	GLPB_HUMAN	glycophorin B (MNS blood group)							integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					ataagcaaaggaatagcaggt	0.453													ENSG00000250361																																					0													33.0	35.0	35.0					4																	144917363		690	1591	2281	SO:0001624	3_prime_UTR_variant	0			-		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000502664.1:c.*89C>A	4.37:g.144917363G>T			B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	R	SNP	-	NULL	ENST00000502664.1	37	NULL	CCDS54809.1	4																																																																																			-	GYPB	-	-		0.453	GYPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYPB	HGNC	protein_coding	OTTHUMT00000364791.1	0	0		18	18		0.00		G	NM_002100		144917363	-1	7		21		tier1	no_errors	ENST00000507009	ensembl	human	known	74_37	rna	25.00		SNP	0.006	T	7	21
BAZ2B	29994	genome.wustl.edu	37	2	160317645	160317645	+	Intron	DEL	T	T	-	rs532390970		TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr2:160317645delT	ENST00000392783.2	-	4	641				BAZ2B_ENST00000343439.5_Intron|BAZ2B_ENST00000355831.2_Intron|BAZ2B_ENST00000483316.1_5'UTR|BAZ2B_ENST00000392782.1_Intron	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CACAAACACGTTTTTTTTTTA	0.353													ENSG00000123636																																					0																																										SO:0001627	intron_variant	0				AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.146-7333A>-	2.37:g.160317645delT			D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	R	DEL	-	NULL	ENST00000392783.2	37	NULL	CCDS2209.2	2																																																																																				BAZ2B	-	-		0.353	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	0	0		12	12		0.00		T			160317645	-1	4		11		tier1	no_errors	ENST00000483316	ensembl	human	known	74_37	rna	26.67		DEL	0.155	-	4	11
EML5	161436	genome.wustl.edu	37	14	89168805	89168805	+	Silent	SNP	G	G	A	rs371578525		TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr14:89168805G>A	ENST00000380664.5	-	14	2222	c.2223C>T	c.(2221-2223)taC>taT	p.Y741Y	EML5_ENST00000554922.1_Silent_p.Y741Y|EML5_ENST00000352093.5_Silent_p.Y741Y			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	741						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CTGTTGCCACGTAGTCTTTCA	0.368													ENSG00000165521	G|||	1	0.000199681	0.0008	0.0	5008	,	,		14776	0.0		0.0	False		,,,				2504	0.0																0								G		2,3766		0,2,1882	88.0	81.0	83.0		2223	-2.2	1.0	14		83	0,8204		0,0,4102	no	coding-synonymous	EML5	NM_183387.2		0,2,5984	AA,AG,GG		0.0,0.0531,0.0167		741/1978	89168805	2,11970	1884	4102	5986	SO:0001819	synonymous_variant	0			-	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.2223C>T	14.37:g.89168805G>A			B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y741	ENST00000380664.5	37	c.2223	CCDS45148.1	14																																																																																			-	EML5	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.368	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	0	0		34	34		0.00		G			89168805	-1	17		15		tier1	no_errors	ENST00000554922	ensembl	human	known	74_37	silent	53.12		SNP	1.000	A	17	15
GNPAT	8443	genome.wustl.edu	37	1	231376805	231376805	+	5'Flank	SNP	A	A	C			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:231376805A>C	ENST00000366647.4	+	0	0				C1orf131_ENST00000471936.1_5'UTR|C1orf131_ENST00000366651.3_Missense_Mutation_p.L28R|GNPAT_ENST00000366646.3_5'Flank|C1orf131_ENST00000318906.2_Missense_Mutation_p.L28R|C1orf131_ENST00000366649.2_Missense_Mutation_p.L28R	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase						cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				AGCGTCAAGAAGTGTCGGAGA	0.607													ENSG00000143633																																					0													113.0	113.0	113.0					1																	231376805		2203	4300	6503	SO:0001631	upstream_gene_variant	0			-	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024		1.37:g.231376805A>C	Exception_encountered		B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	NULL	p.L28R	ENST00000366647.4	37	c.83	CCDS1592.1	1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.246800	0.59103	.	.	ENSG00000143633	ENST00000366649;ENST00000318906;ENST00000366651;ENST00000366648;ENST00000451322	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	5.06	2.68	0.31781	.	0.295055	0.27266	N	0.020149	T	0.28400	0.0702	M	0.68952	2.095	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.992;0.999;0.999;0.999	T	0.08513	-1.0718	10	0.87932	D	0	-13.3122	4.0123	0.09627	0.6352:0.1813:0.1836:0.0	.	28;28;28;28;28	B4E0F7;Q8NDD1-4;Q8NDD1;Q8NDD1-3;Q8NDD1-2	.;.;CA131_HUMAN;.;.	R	28;28;28;18;11	ENSP00000355609:L28R;ENSP00000321341:L28R;ENSP00000355611:L28R;ENSP00000401677:L11R	ENSP00000321341:L28R	L	-	2	0	C1orf131	229443428	0.491000	0.26019	0.004000	0.12327	0.013000	0.08279	1.749000	0.38319	0.382000	0.24878	0.528000	0.53228	CTT	-	C1orf131	-	NULL		0.607	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf131	HGNC	protein_coding	OTTHUMT00000092871.1	0	0		37	37		0.00		A			231376805	-1	12		32		tier1	no_errors	ENST00000366649	ensembl	human	known	74_37	missense	27.27		SNP	0.003	C	12	32
GEN1	348654	genome.wustl.edu	37	2	17962994	17962998	+	Frame_Shift_Del	DEL	AAGTT	AAGTT	-	rs113873109|rs149936944	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	AAGTT	AAGTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr2:17962994_17962998delAAGTT	ENST00000381254.2	+	14	2729_2733	c.2515_2519delAAGTT	c.(2515-2520)aagttgfs	p.KL839fs	SMC6_ENST00000402989.1_Intron|GEN1_ENST00000317402.7_Frame_Shift_Del_p.KL839fs	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	839					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGGCCATAACAAGTTGAGTAGCCCT	0.371								Homologous recombination					ENSG00000178295		297	0.0593051	0.0076	0.0548	5008	,	,		20614	0.1081		0.0905	False		,,,				2504	0.0501																0									,	107,4159		0,107,2026					,	3.6	0.0		dbSNP_131	57	906,7340		48,810,3265	no	frameshift,frameshift	GEN1	NM_182625.3,NM_001130009.1	,	48,917,5291	A1A1,A1R,RR		10.9871,2.5082,8.0962	,	,		1013,11499				SO:0001589	frameshift_variant	0				AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.2515_2519delAAGTT	2.37:g.17962994_17962998delAAGTT	ENSP00000370653:p.Lys839fs		Q17RS9|Q6ZN37	Frame_Shift_Del	DEL	pfam_XPG-I_dom,pfam_XPG_D_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_D_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.K839fs	ENST00000381254.2	37	c.2515_2519	CCDS1691.1	2																																																																																				GEN1	-	NULL		0.371	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GEN1	HGNC	protein_coding	OTTHUMT00000241661.2									AAGTT	NM_182625		17962998	+1					tier1	no_errors	ENST00000317402	ensembl	human	known	74_37	frame_shift_del			DEL	0.019:0.011:0.000:0.000:0.000	-		
KRT17P7	339258	genome.wustl.edu	37	17	20424277	20424277	+	RNA	SNP	G	G	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr17:20424277G>T	ENST00000582261.1	-	0	1778																											TGGTGCTCGTGGTCCTGGTGC	0.612													ENSG00000205215																																					0																																												0			-																													17.37:g.20424277G>T				R	SNP	-	NULL	ENST00000582261.1	37	NULL		17																																																																																			-	AC015818.3	-	-		0.612	AC015818.3-002	KNOWN	basic	processed_transcript	ENSG00000205215	Clone_based_vega_gene	pseudogene	OTTHUMT00000443767.1	0	0		73	73		0.00		G			20424277	-1	20		55		tier1	no_errors	ENST00000582261	ensembl	human	known	74_37	rna	26.67		SNP	0.706	T	20	55
PAGE5	90737	genome.wustl.edu	37	X	55248262	55248262	+	Silent	SNP	T	T	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chrX:55248262T>A	ENST00000289619.5	+	3	449	c.204T>A	c.(202-204)atT>atA	p.I68I	PAGE5_ENST00000374955.3_Silent_p.I48I|PAGE5_ENST00000374952.1_Intron	NM_130467.3	NP_569734.2	Q96GU1	PAGE5_HUMAN	P antigen family, member 5 (prostate associated)	68										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						ATCAGGGTATTGCACCTAGTG	0.453													ENSG00000158639																																					0													109.0	76.0	87.0					X																	55248262		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ344352	CCDS14368.1, CCDS35306.1	Xp11.22	2009-08-18			ENSG00000158639	ENSG00000158639			29992	protein-coding gene	gene with protein product	"""cancer/testis antigen family 16, member 1"", ""cancer/testis antigen family 16, member 2"""					11920606, 11992404	Standard	XM_006724613		Approved	PAGE-5, CT16.1, CT16.2	uc004duk.3	Q96GU1	OTTHUMG00000021650	ENST00000289619.5:c.204T>A	X.37:g.55248262T>A			Q2NL97|Q5JUL0|Q8WWL9	Silent	SNP	pfam_GAGE	p.I68	ENST00000289619.5	37	c.204	CCDS14368.1	X																																																																																			-	PAGE5	-	pfam_GAGE		0.453	PAGE5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAGE5	HGNC	protein_coding	OTTHUMT00000056861.1	0	0		27	27		0.00		T	NM_130467		55248262	+1	24		17		tier1	no_errors	ENST00000289619	ensembl	human	known	74_37	silent	58.54		SNP	0.004	A	24	17
CDO1	1036	genome.wustl.edu	37	5	115151960	115151960	+	Silent	SNP	G	G	A	rs199673192		TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr5:115151960G>A	ENST00000250535.4	-	1	691	c.135C>T	c.(133-135)acC>acT	p.T45T	CDO1_ENST00000502631.1_Intron	NM_001801.2	NP_001792.2	Q16878	CDO1_HUMAN	cysteine dioxygenase type 1	45			T -> I (in dbSNP:rs1042867). {ECO:0000269|PubMed:7524679, ECO:0000269|PubMed:9497919}.		cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|inflammatory response (GO:0006954)|L-cysteine catabolic process (GO:0019448)|lactation (GO:0007595)|oxidation-reduction process (GO:0055114)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid biosynthetic process (GO:0000097)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)	cytosol (GO:0005829)	cysteine dioxygenase activity (GO:0017172)|ferrous iron binding (GO:0008198)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|skin(5)	11		all_cancers(142;0.0046)|all_epithelial(76;0.000161)|Prostate(80;0.0132)|Ovarian(225;0.0776)		OV - Ovarian serous cystadenocarcinoma(64;7.8e-08)|Epithelial(69;7.32e-07)|all cancers(49;3.24e-05)	L-Cysteine(DB00151)	TTGCCCACTCGGTGGGGTCGC	0.612													ENSG00000129596																																					0								G		0,4404		0,0,2202	147.0	132.0	137.0		135	3.4	1.0	5		137	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CDO1	NM_001801.2		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		45/201	115151960	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	0			-		CCDS4121.1	5q23.2	2013-06-11	2013-06-11		ENSG00000129596	ENSG00000129596	1.13.11.20		1795	protein-coding gene	gene with protein product		603943	"""cysteine dioxygenase, type I"""			7524679	Standard	NM_001801		Approved		uc003krg.3	Q16878	OTTHUMG00000128891	ENST00000250535.4:c.135C>T	5.37:g.115151960G>A			B2RAK4|P78513|Q6FHZ8|Q8TB64	Silent	SNP	pfam_Cys_dOase_I,pfam_Cysteamine_dioxygenase,superfamily_RmlC_Cupin	p.T45	ENST00000250535.4	37	c.135	CCDS4121.1	5																																																																																			rs199673192	CDO1	-	pfam_Cys_dOase_I,superfamily_RmlC_Cupin		0.612	CDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDO1	HGNC	protein_coding	OTTHUMT00000250853.2	0	0		29	29		0.00		G	NM_001801		115151960	-1	11		18		tier1	no_errors	ENST00000250535	ensembl	human	known	74_37	silent	37.93		SNP	0.998	A	11	18
DNAH2	146754	genome.wustl.edu	37	17	7658285	7658285	+	Intron	DEL	A	A	-			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr17:7658285delA	ENST00000572933.1	+	13	3364				RPL29P2_ENST00000498671.1_RNA|DNAH2_ENST00000389173.2_Intron			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTGAGGCAGAAAAAAAAAAA	0.532													ENSG00000240480																																					0																																										SO:0001627	intron_variant	0				U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1905-2124A>-	17.37:g.7658285delA			A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	R	DEL	-	NULL	ENST00000572933.1	37	NULL	CCDS32551.1	17																																																																																				RPL29P2	-	-		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL29P2	HGNC	protein_coding	OTTHUMT00000440241.1	0	0		9	9		0.00		A	NM_020877		7658285	+1	3		21		tier1	no_errors	ENST00000498671	ensembl	human	known	74_37	rna	12.50		DEL	0.020	-	3	21
EXO1	9156	genome.wustl.edu	37	1	242030309	242030309	+	Frame_Shift_Del	DEL	G	G	-	rs532992049		TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:242030309delG	ENST00000366548.3	+	11	1812	c.1219delG	c.(1219-1221)gggfs	p.G407fs	EXO1_ENST00000348581.5_Frame_Shift_Del_p.G407fs|EXO1_ENST00000518483.1_Frame_Shift_Del_p.G407fs	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	407	Interaction with MLH1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TAGTACTAAAGGGTTAAATCT	0.403								Editing and processing nucleases					ENSG00000174371																																					0													73.0	68.0	70.0					1																	242030309		2203	4300	6503	SO:0001589	frameshift_variant	0				AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1219delG	1.37:g.242030309delG	ENSP00000355506:p.Gly407fs		O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Frame_Shift_Del	DEL	pfam_XPG-I_dom,pfam_XPG_D_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_D_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.L408fs	ENST00000366548.3	37	c.1219	CCDS1620.1	1																																																																																				EXO1	-	NULL		0.403	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	0	0		28	28		0.00		G	NM_006027		242030309	+1	5		19		tier1	no_errors	ENST00000348581	ensembl	human	known	74_37	frame_shift_del	20.83		DEL	0.896	-	5	19
ANTXRLP1	100996567	genome.wustl.edu	37	10	47640774	47640792	+	RNA	DEL	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG	-	rs144049238|rs139997534|rs59150445|rs59784451	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr10:47640774_47640792delAAGCTGAGTGTTGGGAGAG	ENST00000454837.1	-	0	17_35					NR_103827.1				anthrax toxin receptor-like pseudogene 1																		ATtgggagaaaagctgagtgttgggagagaagctgaggc	0.493													ENSG00000243536		2692	0.53754	0.5303	0.6484	5008	,	,		21433	0.2996		0.6461	False		,,,				2504	0.6022																0																																												0						10q11.22	2014-05-06			ENSG00000243536	ENSG00000263482			45004	pseudogene	pseudogene							Standard	NR_103827		Approved				OTTHUMG00000188317		10.37:g.47640774_47640792delAAGCTGAGTGTTGGGAGAG				R	DEL	-	NULL	ENST00000454837.1	37	NULL		10																																																																																				ANTXRLP1	-	-		0.493	ANTXRLP1-001	KNOWN	basic	processed_transcript	ANTXRLP1	HGNC	pseudogene	OTTHUMT00000047859.2									AAGCTGAGTGTTGGGAGAG			47640792	-1					tier1	no_errors	ENST00000454837	ensembl	human	known	74_37	rna			DEL	0.069:0.070:0.070:0.070:0.068:0.065:0.062:0.057:0.052:0.046:0.038:0.038:0.038:0.036:0.034:0.031:0.027:0.022:0.016	-		
HNRNPL	3191	genome.wustl.edu	37	19	39335855	39335856	+	Intron	INS	-	-	CCTGGCCAACAACCTGAAACCAC	rs148237305|rs79532862|rs56358540	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr19:39335855_39335856insCCTGGCCAACAACCTGAAACCAC	ENST00000221419.5	-	4	1077				HNRNPL_ENST00000600873.1_Intron|AC008982.2_ENST00000600473.1_RNA	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			ttcgaaaccagatctctactaa	0.47													ENSG00000269688		2860	0.571086	0.4788	0.5447	5008	,	,		13406	0.377		0.7157	False		,,,				2504	0.7658																0																																										SO:0001627	intron_variant	0				X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.710+433->GTGGTTTCAGGTTGTTGGCCAGG	19.37:g.39335855_39335856insCCTGGCCAACAACCTGAAACCAC			A6ND69|A6NIT8|Q9H3P3	R	INS	-	NULL	ENST00000221419.5	37	NULL	CCDS33015.1	19																																																																																				AC008982.2	-	-		0.470	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269688	Clone_based_vega_gene	protein_coding	OTTHUMT00000462670.1									-			39335856	-1					tier1	no_errors	ENST00000600473	ensembl	human	known	74_37	rna			INS	0.003:0.002	CCTGGCCAACAACCTGAAACCAC		
RP11-284J1.1	0	genome.wustl.edu	37	6	775405	775445	+	lincRNA	DEL	CCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCC	CCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCC	-	rs571978261|rs6903014|rs141041733|rs371431563|rs6937532|rs9392865|rs60718826	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	CCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCC	CCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr6:775405_775445delCCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCC	ENST00000606622.1	-	0	1737_1777				RP11-532F6.5_ENST00000607084.1_lincRNA																							TTTTGGCTCTCCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCCCCGTGCCCAC	0.573													ENSG00000272485																																					0																																												0																																6.37:g.775405_775445delCCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCC				R	DEL	-	NULL	ENST00000606622.1	37	NULL		6																																																																																				RP11-284J1.1	-	-		0.573	RP11-284J1.1-001	KNOWN	basic	lincRNA	ENSG00000272485	Clone_based_vega_gene	lincRNA	OTTHUMT00000470217.1									CCGTGCCCACATTCCTGCAGTGCGTCTGAGGTTTTGGATCC			775445	-1					tier1	no_errors	ENST00000606622	ensembl	human	known	74_37	rna			DEL	0.012:0.012:0.016:0.020:0.024:0.027:0.030:0.032:0.034:0.035:0.037:0.037:0.038:0.038:0.037:0.037:0.035:0.034:0.031:0.028:0.025:0.021:0.017:0.012:0.011:0.011:0.009:0.007:0.005:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-		
ABCB7	22	genome.wustl.edu	37	X	74293529	74293529	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chrX:74293529C>A	ENST00000373394.3	-	8	1034	c.1027G>T	c.(1027-1029)Gtg>Ttg	p.V343L	ABCB7_ENST00000534570.1_5'UTR|ABCB7_ENST00000339447.4_Missense_Mutation_p.V303L|ABCB7_ENST00000253577.3_Missense_Mutation_p.V344L			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	343	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						ATTACCTTCACAGTTTCATAA	0.323													ENSG00000131269																																					0													122.0	108.0	113.0					X																	74293529		2203	4300	6503	SO:0001583	missense	0			-	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.1027G>T	X.37:g.74293529C>A	ENSP00000362492:p.Val343Leu		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.V344L	ENST00000373394.3	37	c.1030		X	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593641	0.86953	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62	5.38	5.38	0.77491	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98077	0.9366	H	0.94808	3.585	0.80722	D	1	D;D;D;D;D	0.89917	0.994;1.0;1.0;0.995;1.0	D;D;D;D;D	0.91635	0.919;0.999;0.999;0.951;0.999	D	0.99461	1.0943	10	0.87932	D	0	-23.9576	17.0046	0.86389	0.0:1.0:0.0:0.0	.	317;303;344;343;344	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	L	317;344;303;343;317	ENSP00000253577:V344L;ENSP00000343849:V303L;ENSP00000362492:V343L;ENSP00000436586:V317L	ENSP00000253577:V344L	V	-	1	0	ABCB7	74210254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.223000	0.72356	0.506000	0.49869	GTG	-	ABCB7	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom		0.323	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	ABCB7	HGNC	protein_coding	OTTHUMT00000057274.1	0	0		21	21		0.00		C	NM_004299		74293529	-1	10		6		tier1	no_errors	ENST00000253577	ensembl	human	known	74_37	missense	62.50		SNP	1.000	A	10	6
OR2A12	346525	genome.wustl.edu	37	7	143792436	143792436	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr7:143792436A>C	ENST00000408949.2	+	1	296	c.236A>C	c.(235-237)aAg>aCg	p.K79T		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					ACTGTCCCTAAGATGCTAGCA	0.453													ENSG00000221858																																					0													128.0	120.0	123.0					7																	143792436		2059	4206	6265	SO:0001583	missense	0			-		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.236A>C	7.37:g.143792436A>C	ENSP00000386174:p.Lys79Thr		Q6IF43	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K79T	ENST00000408949.2	37	c.236	CCDS43670.1	7	.	.	.	.	.	.	.	.	.	.	A	13.67	2.305176	0.40795	.	.	ENSG00000221858	ENST00000408949	T	0.09350	2.99	4.27	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.15219	0.0367	M	0.63843	1.955	0.21740	N	0.999561	B	0.23854	0.092	B	0.27170	0.077	T	0.10636	-1.0621	9	0.87932	D	0	-20.7084	11.3678	0.49681	1.0:0.0:0.0:0.0	.	79	Q8NGT7	O2A12_HUMAN	T	79	ENSP00000386174:K79T	ENSP00000386174:K79T	K	+	2	0	OR2A12	143423369	0.000000	0.05858	0.974000	0.42286	0.925000	0.55904	0.036000	0.13819	1.788000	0.52465	0.413000	0.27773	AAG	-	OR2A12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.453	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A12	HGNC	protein_coding	OTTHUMT00000349969.1	0	0		48	48		0.00		A			143792436	+1	8		43		tier1	no_errors	ENST00000408949	ensembl	human	known	74_37	missense	15.69		SNP	0.946	C	8	43
COL6A5	256076	genome.wustl.edu	37	3	130162343	130162343	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr3:130162343C>T	ENST00000432398.2	+	36	7005	c.6511C>T	c.(6511-6513)Ccg>Tcg	p.P2171S	COL6A5_ENST00000265379.6_Missense_Mutation_p.P2171S	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2171	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GTACCCACCACCGATGCTTGA	0.373													ENSG00000172752																																					0													95.0	90.0	92.0					3																	130162343		1852	4103	5955	SO:0001583	missense	0			-	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6511C>T	3.37:g.130162343C>T	ENSP00000390895:p.Pro2171Ser		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.P2171S	ENST00000432398.2	37	c.6511		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.850|6.850	0.526014|0.526014	0.13066|0.13066	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000432398;ENST00000265379;ENST00000373157;ENST00000512482|ENST00000512836	D;D;T;D|.	0.90324|.	-2.57;-2.65;-1.22;-1.61|.	4.67|4.67	1.67|1.67	0.24075|0.24075	.|.	0.598474|.	0.14883|.	N|.	0.292846|.	T|T	0.46092|0.46092	0.1375|0.1375	M|M	0.67953|0.67953	2.075|2.075	0.09310|0.09310	N|N	1|1	B;B|.	0.17465|.	0.022;0.017|.	B;B|.	0.17098|.	0.017;0.012|.	T|T	0.34675|0.34675	-0.9819|-0.9819	10|5	0.24483|.	T|.	0.36|.	.|.	7.5412|7.5412	0.27740|0.27740	0.0:0.4603:0.4445:0.0951|0.0:0.4603:0.4445:0.0951	.|.	2171;2171|.	A8TX70;A8TX70-2|.	CO6A5_HUMAN;.|.	S|I	2171;2171;114;6|422	ENSP00000390895:P2171S;ENSP00000265379:P2171S;ENSP00000362250:P114S;ENSP00000424968:P6S|.	ENSP00000265379:P2171S|.	P|T	+|+	1|2	0|0	COL6A5|COL6A5	131645033|131645033	0.001000|0.001000	0.12720|0.12720	0.142000|0.142000	0.22268|0.22268	0.159000|0.159000	0.22180|0.22180	0.385000|0.385000	0.20685|0.20685	0.687000|0.687000	0.31509|0.31509	-0.280000|-0.280000	0.10049|0.10049	CCG|ACC	-	COL6A5	-	NULL		0.373	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		0	0		29	29		0.00		C	NM_153264		130162343	+1	15		26		tier1	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	36.59		SNP	0.031	T	15	26
LRP1B	53353	genome.wustl.edu	37	2	141598583	141598583	+	Missense_Mutation	SNP	G	G	A	rs199519370	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr2:141598583G>A	ENST00000389484.3	-	30	5989	c.5018C>T	c.(5017-5019)aCg>aTg	p.T1673M		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1673					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.T1673K(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTAATTTGCGTTTCATCAAA	0.418										TSP Lung(27;0.18)			ENSG00000168702	G|||	2	0.000399361	0.0	0.0	5008	,	,		14938	0.001		0.0	False		,,,				2504	0.001				Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	lung(1)						G	MET/THR	0,4406		0,0,2203	136.0	123.0	127.0		5018	5.4	1.0	2		127	2,8598	2.2+/-6.3	0,2,4298	no	missense	LRP1B	NM_018557.2	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	1673/4600	141598583	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5018C>T	2.37:g.141598583G>A	ENSP00000374135:p.Thr1673Met		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T1673M	ENST00000389484.3	37	c.5018	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059924	0.76074	0.0	2.33E-4	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90261	-2.64	5.44	5.44	0.79542	Six-bladed beta-propeller, TolB-like (1);	0.074341	0.52532	U	0.000071	D	0.91808	0.7408	L	0.40543	1.245	0.44221	D	0.997051	D	0.76494	0.999	P	0.56088	0.791	D	0.91784	0.5438	10	0.49607	T	0.09	.	19.2577	0.93952	0.0:0.0:1.0:0.0	.	1673	Q9NZR2	LRP1B_HUMAN	M	1673;1611	ENSP00000374135:T1673M	ENSP00000374135:T1673M	T	-	2	0	LRP1B	141315053	1.000000	0.71417	0.998000	0.56505	0.882000	0.50991	5.345000	0.65987	2.563000	0.86464	0.460000	0.39030	ACG	rs199519370	LRP1B	-	smart_LDLR_classB_rpt		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0		64	64		0.00		G	NM_018557		141598583	-1	21		35		tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	37.50		SNP	1.000	A	21	35
CHDH	55349	genome.wustl.edu	37	3	53857426	53857426	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr3:53857426C>T	ENST00000315251.6	-	3	1047	c.610G>A	c.(610-612)Gag>Aag	p.E204K		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	204					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	TGCGTGGCCTCCAGGAATGCG	0.687													ENSG00000016391																																					0													38.0	39.0	39.0					3																	53857426		2201	4300	6501	SO:0001583	missense	0			-	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.610G>A	3.37:g.53857426C>T	ENSP00000319851:p.Glu204Lys		Q9NY17	Missense_Mutation	SNP	pfam_GMC_OxRdtase_N,pfam_GMC_OxRtase_C,pirsf_GMC_OxRdtase	p.E204K	ENST00000315251.6	37	c.610	CCDS2873.1	3	.	.	.	.	.	.	.	.	.	.	C	11.98	1.802071	0.31869	.	.	ENSG00000016391	ENST00000315251	T	0.40476	1.03	5.72	-0.019	0.13961	Glucose-methanol-choline oxidoreductase, N-terminal (1);	0.235426	0.42682	D	0.000670	T	0.29423	0.0733	L	0.41236	1.265	0.32765	N	0.504587	B	0.18013	0.025	B	0.19666	0.026	T	0.20140	-1.0284	10	0.32370	T	0.25	-16.5861	8.6626	0.34101	0.1083:0.3121:0.5158:0.0637	.	204	Q8NE62	CHDH_HUMAN	K	204	ENSP00000319851:E204K	ENSP00000319851:E204K	E	-	1	0	CHDH	53832466	1.000000	0.71417	0.886000	0.34754	0.160000	0.22226	2.392000	0.44433	-0.322000	0.08615	-0.312000	0.09012	GAG	-	CHDH	-	pfam_GMC_OxRdtase_N,pirsf_GMC_OxRdtase		0.687	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHDH	HGNC	protein_coding	OTTHUMT00000350567.2	0	0		57	57		0.00		C	NM_018397		53857426	-1	11		22		tier1	no_errors	ENST00000315251	ensembl	human	known	74_37	missense	33.33		SNP	0.998	T	11	22
CD84	8832	genome.wustl.edu	37	1	160520931	160520931	+	Intron	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:160520931G>A	ENST00000311224.4	-	6	878				CD84_ENST00000368047.3_5'Flank|RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000534968.1_Intron|CD84_ENST00000368054.3_Intron|CD84_ENST00000368051.3_Intron|CD84_ENST00000368048.3_Intron	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule						blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			agcccccagggattaaatggc	0.428													ENSG00000066294																																					0																																										SO:0001627	intron_variant	0			-	AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.812-106C>T	1.37:g.160520931G>A			B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	R	SNP	-	NULL	ENST00000311224.4	37	NULL	CCDS53396.1	1																																																																																			-	CD84	-	-		0.428	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	HGNC	protein_coding	OTTHUMT00000059092.1	0	0		31	31		0.00		G	NM_003874		160520931	-1	23		169		tier1	no_errors	ENST00000466767	ensembl	human	known	74_37	rna	11.92		SNP	0.000	A	23	169
NDN	4692	genome.wustl.edu	37	15	23931596	23931596	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr15:23931596C>T	ENST00000331837.4	-	1	854	c.769G>A	c.(769-771)Gaa>Aaa	p.E257K		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	257	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E257K(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		AACTCGTATTCGGGCGGCTCC	0.567									Prader-Willi syndrome				ENSG00000182636																																					1	Substitution - Missense(1)	large_intestine(1)											34.0	35.0	35.0					15																	23931596		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	-	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.769G>A	15.37:g.23931596C>T	ENSP00000332643:p.Glu257Lys		B2R6Z5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.E257K	ENST00000331837.4	37	c.769	CCDS10014.1	15	.	.	.	.	.	.	.	.	.	.	C	14.68	2.609212	0.46527	.	.	ENSG00000182636	ENST00000331837	T	0.05081	3.5	3.5	2.56	0.30785	.	0.119074	0.53938	D	0.000044	T	0.11665	0.0284	L	0.32530	0.975	0.09310	N	0.999998	D	0.76494	0.999	D	0.76071	0.987	T	0.15665	-1.0429	10	0.22109	T	0.4	.	8.8655	0.35282	0.0:0.7704:0.2296:0.0	.	257	Q99608	NECD_HUMAN	K	257	ENSP00000332643:E257K	ENSP00000332643:E257K	E	-	1	0	NDN	21482689	0.985000	0.35326	0.041000	0.18516	0.541000	0.35023	3.429000	0.52800	1.022000	0.39626	0.561000	0.74099	GAA	-	NDN	-	pfam_MAGE,pfscan_MAGE		0.567	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2	0	0		62	62		0.00		C	NM_002487		23931596	-1	128		62		tier1	no_errors	ENST00000331837	ensembl	human	known	74_37	missense	67.37		SNP	0.055	T	128	62
FAM230B	642633	genome.wustl.edu	37	22	21538161	21538161	+	RNA	SNP	C	C	T	rs111441301	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr22:21538161C>T	ENST00000451257.1	+	0	1147									family with sequence similarity 230, member B (non-protein coding)																		GCATCGCCAGCGAGGACGCCG	0.741													ENSG00000215498																																					0																																												0			-	BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538161C>T				R	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			rs111441301	FAM230B	-	-		0.741	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	0	0		42	42		0.00		C	NR_108107		21538161	+1	4		23		tier1	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	14.81		SNP	0.000	T	4	23
PRKAB2	5565	genome.wustl.edu	37	1	146638473	146638473	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:146638473G>T	ENST00000254101.3	-	4	507	c.369C>A	c.(367-369)caC>caA	p.H123Q	PRKAB2_ENST00000425272.2_Missense_Mutation_p.H41Q	NM_005399.3	NP_005390.1	O43741	AAKB2_HUMAN	protein kinase, AMP-activated, beta 2 non-catalytic subunit	123					carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)|regulation of fatty acid biosynthetic process (GO:0042304)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.0487)				Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)	ACTTGTATTGGTGCTCTCCCT	0.448													ENSG00000131791																																					0													97.0	85.0	89.0					1																	146638473		2203	4300	6503	SO:0001583	missense	0			-	BC053610	CCDS925.1	1q21.2	2008-02-05			ENSG00000131791	ENSG00000131791			9379	protein-coding gene	gene with protein product	"""AMPK beta 2"""	602741				8557660	Standard	NM_005399		Approved		uc001epe.3	O43741	OTTHUMG00000014032	ENST00000254101.3:c.369C>A	1.37:g.146638473G>T	ENSP00000254101:p.His123Gln		A8K9V5|B4DH06|Q5VXY0	Missense_Mutation	SNP	pfam_AMP_prot_kin_bsu_interact-dom,superfamily_Ig_E-set	p.H123Q	ENST00000254101.3	37	c.369	CCDS925.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009658	0.75046	.	.	ENSG00000131791	ENST00000254101;ENST00000425272	.	.	.	5.79	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.72637	0.3485	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.989	T	0.76410	-0.2969	9	0.87932	D	0	.	8.3792	0.32461	0.243:0.0:0.757:0.0	.	41;41;123	B4E214;B4DH06;O43741	.;.;AAKB2_HUMAN	Q	123;41	.	ENSP00000254101:H123Q	H	-	3	2	PRKAB2	145105097	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.864000	0.39469	0.776000	0.33473	0.655000	0.94253	CAC	-	PRKAB2	-	superfamily_Ig_E-set		0.448	PRKAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAB2	HGNC	protein_coding	OTTHUMT00000039471.1	0	0		38	38		0.00		G	NM_005399		146638473	-1	3		23		tier1	no_errors	ENST00000254101	ensembl	human	known	74_37	missense	11.54		SNP	1.000	T	3	23
DNHD1	144132	genome.wustl.edu	37	11	6587557	6587557	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr11:6587557C>T	ENST00000527990.2	+	32	11140	c.11140C>T	c.(11140-11142)Ccc>Tcc	p.P3714S	DNHD1_ENST00000254579.6_Missense_Mutation_p.P3714S			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3714					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GCTGAGTCCACCCCAGGTGCA	0.587													ENSG00000179532																																					0													69.0	62.0	64.0					11																	6587557		692	1591	2283	SO:0001583	missense	0			-	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.11140C>T	11.37:g.6587557C>T	ENSP00000436180:p.Pro3714Ser		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SRE	p.P3714S	ENST00000527990.2	37	c.11140	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	C	14.45	2.537710	0.45176	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.25749	1.78;1.78	4.89	4.89	0.63831	.	.	.	.	.	T	0.32255	0.0823	N	0.14661	0.345	0.18873	N	0.999982	D	0.71674	0.998	D	0.64687	0.928	T	0.18681	-1.0329	9	0.66056	D	0.02	-7.0304	13.4354	0.61082	0.0:1.0:0.0:0.0	.	3714	Q96M86	DNHD1_HUMAN	S	3714	ENSP00000254579:P3714S;ENSP00000436180:P3714S	ENSP00000254579:P3714S	P	+	1	0	DNHD1	6544133	0.007000	0.16637	0.927000	0.36925	0.994000	0.84299	1.496000	0.35638	2.528000	0.85240	0.591000	0.81541	CCC	-	DNHD1	-	NULL		0.587	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	0	0		37	37		0.00		C	NM_144666		6587557	+1	23		27		tier1	no_errors	ENST00000254579	ensembl	human	known	74_37	missense	46.00		SNP	0.281	T	23	27
MT-ND2	4536	genome.wustl.edu	37	M	2226	2226	+	5'Flank	SNP	T	T	C			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chrM:2226T>C	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						ACACCCACTACCTAAAAAATC	0.363													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2226T>C	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	R	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.363	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		0	0		99	99		0.00		T	YP_003024027		2226	+1	208		79		tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	72.47		SNP	NULL	C	208	79
CD96	10225	genome.wustl.edu	37	3	111342635	111342635	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr3:111342635T>A	ENST00000283285.5	+	10	1394	c.1263T>A	c.(1261-1263)gaT>gaA	p.D421E	CD96_ENST00000352690.4_Missense_Mutation_p.D405E	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	421	Pro/Ser/Thr-rich.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						CCCTTGTAGATGTGAGTGCCT	0.378									Opitz Trigonocephaly syndrome				ENSG00000153283																																					0													99.0	89.0	92.0					3																	111342635		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	-	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1263T>A	3.37:g.111342635T>A	ENSP00000283285:p.Asp421Glu		Q5JPB3	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like_dom	p.D421E	ENST00000283285.5	37	c.1263	CCDS2959.1	3	.	.	.	.	.	.	.	.	.	.	T	15.73	2.919193	0.52546	.	.	ENSG00000153283	ENST00000352690;ENST00000283285	T;T	0.66815	-0.21;-0.23	4.0	0.246	0.15516	.	0.405915	0.22628	N	0.057607	T	0.46268	0.1384	L	0.29908	0.895	0.09310	N	1	B;B;B	0.23540	0.053;0.087;0.053	B;B;B	0.23018	0.019;0.043;0.019	T	0.36432	-0.9748	10	0.66056	D	0.02	-7.1982	2.6037	0.04873	0.1975:0.2214:0.0:0.5811	.	405;405;421	E9PEJ1;P40200-2;P40200	.;.;TACT_HUMAN	E	405;421	ENSP00000342040:D405E;ENSP00000283285:D421E	ENSP00000283285:D421E	D	+	3	2	CD96	112825325	0.005000	0.15991	0.003000	0.11579	0.003000	0.03518	-0.042000	0.12063	0.042000	0.15717	0.533000	0.62120	GAT	-	CD96	-	NULL		0.378	CD96-001	KNOWN	basic|CCDS	protein_coding	CD96	HGNC	protein_coding	OTTHUMT00000354312.2	0	0		19	19		0.00		T			111342635	+1	8		18		tier1	no_errors	ENST00000283285	ensembl	human	known	74_37	missense	30.77		SNP	0.004	A	8	18
BRD7	29117	genome.wustl.edu	37	16	50357558	50357558	+	Silent	SNP	A	A	G			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr16:50357558A>G	ENST00000394688.3	-	12	1542	c.1383T>C	c.(1381-1383)gaT>gaC	p.D461D	BRD7_ENST00000394689.2_Silent_p.D461D			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	461					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CCAGTAAACTATCTGCCATGA	0.423													ENSG00000166164																																					0													126.0	106.0	113.0					16																	50357558		2198	4300	6498	SO:0001819	synonymous_variant	0			-	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1383T>C	16.37:g.50357558A>G			Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Silent	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D461	ENST00000394688.3	37	c.1383	CCDS10742.1	16																																																																																			-	BRD7	-	pfam_DUF3512		0.423	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	HGNC	protein_coding	OTTHUMT00000256874.3	0	0		54	54		0.00		A	NM_013263		50357558	-1	21		42		tier1	no_errors	ENST00000394689	ensembl	human	known	74_37	silent	33.33		SNP	0.919	G	21	42
FBN2	2201	genome.wustl.edu	37	5	127712460	127712460	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr5:127712460C>G	ENST00000508053.1	-	20	2910	c.1936G>C	c.(1936-1938)Gga>Cga	p.G646R	FBN2_ENST00000511489.1_5'UTR|FBN2_ENST00000262464.4_Missense_Mutation_p.G646R|FBN2_ENST00000508989.1_Missense_Mutation_p.G613R			P35556	FBN2_HUMAN	fibrillin 2	646	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AAGACAAATCCTGGTTTGCAG	0.408													ENSG00000138829																																					0													253.0	214.0	227.0					5																	127712460		2203	4300	6503	SO:0001583	missense	0			-	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1936G>C	5.37:g.127712460C>G	ENSP00000424571:p.Gly646Arg		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G646R	ENST00000508053.1	37	c.1936	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	30	5.049740	0.93740	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.92595	-3.07;-3.07;-3.07	4.63	4.63	0.57726	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000002	D	0.97492	0.9179	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98249	1.0492	10	0.87932	D	0	.	18.8146	0.92072	0.0:1.0:0.0:0.0	.	613;646	D6RJI3;P35556	.;FBN2_HUMAN	R	646;646;613	ENSP00000262464:G646R;ENSP00000424571:G646R;ENSP00000425596:G613R	ENSP00000262464:G646R	G	-	1	0	FBN2	127740359	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.609000	0.82925	2.865000	0.98341	0.655000	0.94253	GGA	-	FBN2	-	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.408	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	0	0		36	36		0.00		C	NM_001999		127712460	-1	10		23		tier1	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	30.30		SNP	1.000	G	10	23
COL5A1	1289	genome.wustl.edu	37	9	137600586	137600586	+	Intron	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr9:137600586G>A	ENST00000371817.3	+	4	1068				COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1						axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ATGAtctcctgggactgctgc	0.587													ENSG00000130635																																					0													10.0	9.0	9.0					9																	137600586		864	1972	2836	SO:0001627	intron_variant	0			-	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.654+7407G>A	9.37:g.137600586G>A			Q15094|Q5SUX4	R	SNP	-	NULL	ENST00000371817.3	37	NULL	CCDS6982.1	9																																																																																			-	COL5A1	-	-		0.587	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	0	0		36	36		0.00		G	NM_000093		137600586	+1	11		35		tier1	no_errors	ENST00000464187	ensembl	human	known	74_37	rna	23.91		SNP	0.033	A	11	35
KIAA1549	57670	genome.wustl.edu	37	7	138554310	138554310	+	Silent	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr7:138554310G>A	ENST00000422774.1	-	14	4797	c.4749C>T	c.(4747-4749)ccC>ccT	p.P1583P	KIAA1549_ENST00000440172.1_Silent_p.P1583P|KIAA1549_ENST00000242365.4_Silent_p.P1533P			Q9HCM3	K1549_HUMAN	KIAA1549	1583						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TGAACACGGAGGGCACGCTGG	0.677			O	BRAF	pilocytic astrocytoma								ENSG00000122778																									NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													24.0	28.0	27.0					7																	138554310		2026	4153	6179	SO:0001819	synonymous_variant	0			-		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4749C>T	7.37:g.138554310G>A			B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	NULL	p.P1583	ENST00000422774.1	37	c.4749	CCDS56513.1	7																																																																																			-	KIAA1549	-	NULL		0.677	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	0	0		33	33		0.00		G			138554310	-1	13		14		tier1	no_errors	ENST00000422774	ensembl	human	known	74_37	silent	48.15		SNP	0.992	A	13	14
OR4S1	256148	genome.wustl.edu	37	11	48327964	48327964	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr11:48327964T>G	ENST00000319988.1	+	1	190	c.190T>G	c.(190-192)Ttg>Gtg	p.L64V		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						CCTGAGCCAGTTGTCTTTTGC	0.453													ENSG00000176555																																					0													208.0	165.0	180.0					11																	48327964		2201	4287	6488	SO:0001583	missense	0			-	AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.190T>G	11.37:g.48327964T>G	ENSP00000321447:p.Leu64Val		Q6IFB4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L64V	ENST00000319988.1	37	c.190	CCDS31488.1	11	.	.	.	.	.	.	.	.	.	.	T	14.63	2.594246	0.46214	.	.	ENSG00000176555	ENST00000319988	T	0.00587	6.38	5.02	-3.67	0.04476	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.04634	0.0126	H	0.98048	4.135	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.00419	-1.1751	9	0.87932	D	0	.	11.949	0.52944	0.0:0.4349:0.0:0.5651	.	64	Q8NGB4	OR4S1_HUMAN	V	64	ENSP00000321447:L64V	ENSP00000321447:L64V	L	+	1	2	OR4S1	48284540	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-2.242000	0.01195	-0.667000	0.05303	-0.912000	0.02778	TTG	-	OR4S1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.453	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S1	HGNC	protein_coding	OTTHUMT00000390556.1	0	0		68	68		0.00		T	NM_001004725		48327964	+1	7		65		tier1	no_errors	ENST00000319988	ensembl	human	known	74_37	missense	9.72		SNP	0.000	G	7	65
PDE4DIP	9659	genome.wustl.edu	37	1	144879468	144879468	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:144879468C>T	ENST00000369354.3	-	27	4171	c.3982G>A	c.(3982-3984)Gag>Aag	p.E1328K	PDE4DIP_ENST00000530740.1_Missense_Mutation_p.E1464K|AL138796.1_ENST00000582173.1_RNA|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.E1464K|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.E1328K|RP4-791M13.5_ENST00000531288.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.E1284K			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1328					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGCTTCCTCTCAGAGGAACTA	0.527			T	PDGFRB	MPD								ENSG00000178104																												Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													121.0	142.0	135.0					1																	144879468		2203	4295	6498	SO:0001583	missense	0			-	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3982G>A	1.37:g.144879468C>T	ENSP00000358360:p.Glu1328Lys		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.E1328K	ENST00000369354.3	37	c.3982	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	C	3.567	-0.088535	0.07097	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01538	4.79;4.9;4.9;4.89;4.89	5.64	-2.83	0.05769	.	.	.	.	.	T	0.00271	0.0008	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41161	-0.9524	9	0.06099	T	0.92	.	6.8006	0.23748	0.0:0.354:0.2419:0.4041	.	1284;1328	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	K	1284;1328;1328;1464;1464	ENSP00000327209:E1284K;ENSP00000358360:E1328K;ENSP00000358363:E1328K;ENSP00000435654:E1464K;ENSP00000358366:E1464K	ENSP00000327209:E1284K	E	-	1	0	PDE4DIP	143590825	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.308000	0.08156	-0.452000	0.07087	-0.907000	0.02831	GAG	-	PDE4DIP	-	NULL		0.527	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	0	0		148	148		0.00		C	NM_022359		144879468	-1	20		111		tier1	no_errors	ENST00000369356	ensembl	human	known	74_37	missense	15.27		SNP	0.000	T	20	111
GCNT6	644378	genome.wustl.edu	37	6	10634162	10634162	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr6:10634162G>C	ENST00000417671.1	+	1	170	c.170G>C	c.(169-171)gGg>gCg	p.G57A				Q5T4J0	GCNT6_HUMAN	glucosaminyl (N-acetyl) transferase 6	57					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)			breast(1)	1						GCCCTAAATGGGAAGACGGTG	0.448													ENSG00000205318																																					0																																										SO:0001583	missense	0			-			6p24.2	2013-02-25			ENSG00000205318	ENSG00000205318		"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	21623	protein-coding gene	gene with protein product							Standard			Approved	bA421M1.3		Q5T4J0	OTTHUMG00000014243	ENST00000417671.1:c.170G>C	6.37:g.10634162G>C	ENSP00000398277:p.Gly57Ala			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.G57A	ENST00000417671.1	37	c.170		6	.	.	.	.	.	.	.	.	.	.	G	9.166	1.019998	0.19433	.	.	ENSG00000205318	ENST00000417671;ENST00000379591	T;T	0.12465	2.84;2.68	3.49	-1.9	0.07665	.	.	.	.	.	T	0.06416	0.0165	L	0.46157	1.445	0.09310	N	1	.	.	.	.	.	.	T	0.31696	-0.9934	7	0.59425	D	0.04	.	9.026	0.36230	0.4253:0.0:0.5747:0.0	.	.	.	.	A	57;2	ENSP00000398277:G57A;ENSP00000368910:G2A	ENSP00000368910:G2A	G	+	2	0	GCNT6	10742148	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.525000	0.06214	-0.653000	0.05401	0.655000	0.94253	GGG	-	GCNT6	-	NULL		0.448	GCNT6-201	KNOWN	basic|appris_principal	protein_coding	GCNT6	HGNC	protein_coding		0	0		36	36		0.00		G			10634162	+1	7		20		tier1	no_errors	ENST00000417671	ensembl	human	known	74_37	missense	25.93		SNP	0.015	C	7	20
LRP1B	53353	genome.wustl.edu	37	2	141004703	141004703	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr2:141004703A>G	ENST00000389484.3	-	87	14247	c.13276T>C	c.(13276-13278)Tgt>Cgt	p.C4426R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4426	EGF-like 22. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGCCTTTCACACTGTGTGCCT	0.388										TSP Lung(27;0.18)			ENSG00000168702																									Colon(99;50 2074 2507 20106)												0													104.0	97.0	99.0					2																	141004703		2203	4300	6503	SO:0001583	missense	0			-	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13276T>C	2.37:g.141004703A>G	ENSP00000374135:p.Cys4426Arg		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.C4426R	ENST00000389484.3	37	c.13276	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	A	22.9	4.346974	0.82022	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.84660	-1.88	5.8	5.8	0.92144	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.93900	0.8048	M	0.91406	3.205	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	D	0.95090	0.8221	10	0.87932	D	0	.	16.1537	0.81640	1.0:0.0:0.0:0.0	.	4426	Q9NZR2	LRP1B_HUMAN	R	4426;4364	ENSP00000374135:C4426R	ENSP00000374135:C4426R	C	-	1	0	LRP1B	140721173	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.051000	0.89446	2.213000	0.71641	0.528000	0.53228	TGT	-	LRP1B	-	smart_EG-like_dom,pfscan_EG-like_dom		0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	0	0		34	34		0.00		A	NM_018557		141004703	-1	10		15		tier1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	40.00		SNP	1.000	G	10	15
NXPH1	30010	genome.wustl.edu	37	7	8791537	8791537	+	3'UTR	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr7:8791537C>T	ENST00000405863.1	+	0	1865				NXPH1_ENST00000497400.1_3'UTR	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1							extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		GCAAAATACACTAGTGGAAAA	0.418													ENSG00000122584																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.*138C>T	7.37:g.8791537C>T			Q8NB31	R	SNP	-	NULL	ENST00000405863.1	37	NULL	CCDS47540.1	7																																																																																			-	NXPH1	-	-		0.418	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH1	HGNC	protein_coding	OTTHUMT00000324591.1	0	0		21	21		0.00		C	NM_152745		8791537	+1	9		58		tier1	no_errors	ENST00000497400	ensembl	human	known	74_37	rna	13.43		SNP	0.797	T	9	58
STRN3	29966	genome.wustl.edu	37	14	31364784	31364784	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr14:31364784G>A	ENST00000357479.5	-	18	2423	c.2227C>T	c.(2227-2229)Cat>Tat	p.H743Y	STRN3_ENST00000355683.5_Missense_Mutation_p.H659Y	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	743					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		GAACAGTCATGGCCTGTAAAA	0.338													ENSG00000196792																																					0													80.0	74.0	76.0					14																	31364784		2203	4300	6503	SO:0001583	missense	0			-		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.2227C>T	14.37:g.31364784G>A	ENSP00000350071:p.His743Tyr		A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H743Y	ENST00000357479.5	37	c.2227	CCDS41938.1	14	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249329	0.80024	.	.	ENSG00000196792	ENST00000355683;ENST00000357479	T;T	0.59772	0.24;0.24	5.5	5.5	0.81552	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68229	0.2978	L	0.31157	0.91	0.80722	D	1	D;D	0.62365	0.957;0.991	P;D	0.76575	0.828;0.988	T	0.71437	-0.4593	10	0.87932	D	0	-9.4596	19.4117	0.94675	0.0:0.0:1.0:0.0	.	659;743	Q13033-2;Q13033	.;STRN3_HUMAN	Y	659;743	ENSP00000347909:H659Y;ENSP00000350071:H743Y	ENSP00000347909:H659Y	H	-	1	0	STRN3	30434535	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.814000	0.99346	2.580000	0.87095	0.467000	0.42956	CAT	-	STRN3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.338	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	STRN3	HGNC	protein_coding	OTTHUMT00000409713.1	0	0		45	45		0.00		G	NM_014574		31364784	-1	15		33		tier1	no_errors	ENST00000357479	ensembl	human	known	74_37	missense	31.25		SNP	1.000	A	15	33
CLPB	81570	genome.wustl.edu	37	11	72091328	72091328	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr11:72091328C>T	ENST00000294053.3	-	4	816	c.643G>A	c.(643-645)Gaa>Aaa	p.E215K	CLPB_ENST00000543042.1_Missense_Mutation_p.E44K|CLPB_ENST00000445069.2_Missense_Mutation_p.E111K|CLPB_ENST00000437826.2_Missense_Mutation_p.E170K|CLPB_ENST00000538039.1_Missense_Mutation_p.E215K|CLPB_ENST00000340729.5_Missense_Mutation_p.E186K	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	215					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						CACTTACCTTCCAAAGAATGG	0.512													ENSG00000162129																																					0													124.0	118.0	120.0					11																	72091328		2200	4293	6493	SO:0001583	missense	0			-	BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.643G>A	11.37:g.72091328C>T	ENSP00000294053:p.Glu215Lys		B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Missense_Mutation	SNP	pfam_ATPase_AAA-2,pfam_Ankyrin_rpt,pfam_Clp_ATPase_C,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,pfam_Zeta_toxin_domain,pfam_Sigma_54_int,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_AAA+_ATPase,prints_ClpA/B,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E215K	ENST00000294053.3	37	c.643	CCDS8215.1	11	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512430	0.85389	.	.	ENSG00000162129	ENST00000294053;ENST00000538039;ENST00000535990;ENST00000340729;ENST00000437826;ENST00000543042;ENST00000544683;ENST00000539148	T;T;T;T;T;T;T;T	0.67865	1.92;0.04;2.12;0.04;2.47;0.07;0.04;-0.29	5.79	5.79	0.91817	Ankyrin repeat-containing domain (2);	0.058297	0.64402	D	0.000002	T	0.57844	0.2081	N	0.08118	0	0.43308	D	0.995313	P;P;P;P;D	0.55172	0.669;0.936;0.894;0.936;0.97	B;P;B;P;P	0.50049	0.265;0.595;0.391;0.595;0.629	T	0.66240	-0.5973	10	0.66056	D	0.02	.	16.7694	0.85533	0.0:1.0:0.0:0.0	.	44;186;170;215;215	B4DXW4;F8W7P6;E7EWN6;Q9H078-2;Q9H078	.;.;.;.;CLPB_HUMAN	K	215;215;220;186;170;44;69;69	ENSP00000294053:E215K;ENSP00000441518:E215K;ENSP00000443822:E220K;ENSP00000340385:E186K;ENSP00000407296:E170K;ENSP00000439746:E44K;ENSP00000442651:E69K;ENSP00000445327:E69K	ENSP00000294053:E215K	E	-	1	0	CLPB	71768976	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	6.356000	0.73046	2.736000	0.93811	0.561000	0.74099	GAA	-	CLPB	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.512	CLPB-001	KNOWN	basic|CCDS	protein_coding	CLPB	HGNC	protein_coding	OTTHUMT00000396889.1	0	0		35	35		0.00		C	NM_030813		72091328	-1	10		13		tier1	no_errors	ENST00000294053	ensembl	human	known	74_37	missense	43.48		SNP	1.000	T	10	13
COL11A1	1301	genome.wustl.edu	37	1	103345239	103345239	+	Splice_Site	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:103345239C>T	ENST00000370096.3	-	66	5586	c.5274G>A	c.(5272-5274)gcG>gcA	p.A1758A	COL11A1_ENST00000358392.2_Splice_Site_p.A1770A|COL11A1_ENST00000512756.1_Splice_Site_p.A1642A|COL11A1_ENST00000353414.4_Splice_Site_p.A1719A	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1758	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.			A -> T (in Ref. 1; AAA51891). {ECO:0000305}.	cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTATACTCACCGCACAACCAT	0.433													ENSG00000060718																																					0													121.0	111.0	115.0					1																	103345239		2203	4300	6503	SO:0001630	splice_region_variant	0			-	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.5274+1G>A	1.37:g.103345239C>T			B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.A1770	ENST00000370096.3	37	c.5310	CCDS778.1	1																																																																																			-	COL11A1	-	pfam_Fib_collagen_C,smart_Fib_collagen_C		0.433	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	0	0		36	36		0.00		C	NM_080630	Silent	103345239	-1	4		36		tier1	no_errors	ENST00000358392	ensembl	human	known	74_37	silent	10.00		SNP	0.998	T	4	36
LMF1	64788	genome.wustl.edu	37	16	1025977	1025978	+	lincRNA	INS	-	-	CAAGGAGCCTCATGAACTCTGTGGACATT	rs371006218|rs141146619|rs72434848|rs71142795	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr16:1025977_1025978insCAAGGAGCCTCATGAACTCTGTGGACATT	ENST00000565467.1	-	0	3508_3509																											GACATTCCGGGCAAGGGGCCTC	0.515													ENSG00000260807		2542	0.507588	0.6921	0.4582	5008	,	,		20034	0.3978		0.3439	False		,,,				2504	0.5746																0																																												0																																16.37:g.1025977_1025978insCAAGGAGCCTCATGAACTCTGTGGACATT				R	INS	-	NULL	ENST00000565467.1	37	NULL		16																																																																																				RP11-161M6.2	-	-		0.515	RP11-161M6.2-001	KNOWN	basic	lincRNA	LMF1	Clone_based_vega_gene	lincRNA	OTTHUMT00000420706.1									-			1025978	-1					tier1	no_errors	ENST00000562570	ensembl	human	known	74_37	rna			INS	0.005:0.013	CAAGGAGCCTCATGAACTCTGTGGACATT		
COL6A3	1293	genome.wustl.edu	37	2	238285620	238285620	+	Silent	SNP	A	A	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr2:238285620A>T	ENST00000295550.4	-	7	3317	c.2865T>A	c.(2863-2865)cgT>cgA	p.R955R	COL6A3_ENST00000347401.3_Silent_p.R754R|COL6A3_ENST00000392003.2_Silent_p.R548R|COL6A3_ENST00000346358.4_Silent_p.R755R|COL6A3_ENST00000353578.4_Silent_p.R749R|COL6A3_ENST00000392004.3_Silent_p.R749R|COL6A3_ENST00000472056.1_Silent_p.R348R|COL6A3_ENST00000409809.1_Silent_p.R749R	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	955	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCCCATCCACACGGTCAGATG	0.542													ENSG00000163359																																					0													165.0	132.0	143.0					2																	238285620		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.2865T>A	2.37:g.238285620A>T			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R955	ENST00000295550.4	37	c.2865	CCDS33412.1	2																																																																																			-	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.542	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	0	0		36	36		0.00		A	NM_004369		238285620	-1	13		29		tier1	no_errors	ENST00000295550	ensembl	human	known	74_37	silent	30.95		SNP	0.001	T	13	29
GGA2	23062	genome.wustl.edu	37	16	23499974	23499974	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr16:23499974G>A	ENST00000309859.4	-	6	614	c.532C>T	c.(532-534)Ccc>Tcc	p.P178S	GGA2_ENST00000567468.1_Missense_Mutation_p.P178S	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	178					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		TTGGGCCAGGGAGATGGTGGG	0.418													ENSG00000103365																																					0													187.0	183.0	185.0					16																	23499974		2197	4300	6497	SO:0001583	missense	0			-	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.532C>T	16.37:g.23499974G>A	ENSP00000311962:p.Pro178Ser		D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ENTH_VHS,superfamily_Coatomer/clathrin_app_Ig-like,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.P178S	ENST00000309859.4	37	c.532	CCDS10611.1	16	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813461	0.70912	.	.	ENSG00000103365	ENST00000309859	T	0.16196	2.36	5.11	5.11	0.69529	.	0.541750	0.21480	N	0.073846	T	0.23688	0.0573	L	0.29908	0.895	0.47308	D	0.999386	D	0.53312	0.959	P	0.53689	0.732	T	0.00726	-1.1592	10	0.40728	T	0.16	-19.8505	16.4099	0.83704	0.0:0.0:1.0:0.0	.	178	Q9UJY4	GGA2_HUMAN	S	178	ENSP00000311962:P178S	ENSP00000311962:P178S	P	-	1	0	GGA2	23407475	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.857000	0.92250	2.538000	0.85594	0.643000	0.83706	CCC	-	GGA2	-	NULL		0.418	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA2	HGNC	protein_coding	OTTHUMT00000214019.1	0	0		70	70		0.00		G			23499974	-1	26		81		tier1	no_errors	ENST00000309859	ensembl	human	known	74_37	missense	24.30		SNP	1.000	A	26	81
KIAA0125	9834	genome.wustl.edu	37	14	106391170	106391170	+	IGR	SNP	T	T	C			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr14:106391170T>C	ENST00000449410.1	+	0	533				KIAA0125_ENST00000482999.1_3'UTR			Q9NZY2	K0125_HUMAN	KIAA0125																		GATGTGACTGTGGGAATGGCG	0.567													ENSG00000226777																																					0																																										SO:0001628	intergenic_variant	0			-	AB019441		14q32.33	2014-04-01			ENSG00000226777	ENSG00000226777			19955	other	unknown			"""family with sequence similarity 30, member A"", ""chromosome 14 open reading frame 110"""	FAM30A, C14orf110		8590280	Standard	NR_026800		Approved	HSPC053	uc001ysq.3	Q9NZY2	OTTHUMG00000152318		14.37:g.106391170T>C			C9J8W9	R	SNP	-	NULL	ENST00000449410.1	37	NULL		14																																																																																			-	KIAA0125	-	-		0.567	KIAA0125-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	KIAA0125	HGNC	protein_coding	OTTHUMT00000325876.1	0	0		114	114		0.00		T	NM_014792		106391170	+1	49		82		tier1	no_errors	ENST00000482999	ensembl	human	known	74_37	rna	37.40		SNP	0.246	C	49	82
ETV3	2117	genome.wustl.edu	37	1	157105270	157105270	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:157105270C>T	ENST00000368192.4	-	3	341	c.277G>A	c.(277-279)Gcc>Acc	p.A93T	ETV3_ENST00000460850.1_5'UTR|ETV3_ENST00000326786.4_Missense_Mutation_p.A93T	NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	93					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				TACCTGAGGGCCCGGCTCAGC	0.468													ENSG00000117036																																					0													62.0	63.0	63.0					1																	157105270		2203	4300	6503	SO:0001583	missense	0			-	BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.277G>A	1.37:g.157105270C>T	ENSP00000357175:p.Ala93Thr		B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.A93T	ENST00000368192.4	37	c.277	CCDS44250.1	1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830626	0.91036	.	.	ENSG00000117036	ENST00000368192;ENST00000326786	T;T	0.71817	-0.6;-0.6	5.47	5.47	0.80525	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (5);	0.000000	0.64402	D	0.000001	D	0.85784	0.5777	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88370	0.2994	10	0.87932	D	0	.	18.0939	0.89482	0.0:1.0:0.0:0.0	.	93;93	P41162-2;P41162	.;ETV3_HUMAN	T	93	ENSP00000357175:A93T;ENSP00000327316:A93T	ENSP00000327316:A93T	A	-	1	0	ETV3	155371894	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.768000	0.85345	2.566000	0.86566	0.655000	0.94253	GCC	-	ETV3	-	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom		0.468	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3	HGNC	protein_coding	OTTHUMT00000082843.2	0	0		60	60		0.00		C	NM_005240		157105270	-1	364		65		tier1	no_errors	ENST00000368192	ensembl	human	known	74_37	missense	84.65		SNP	1.000	T	364	65
MAP7D3	79649	genome.wustl.edu	37	X	135318413	135318413	+	Silent	SNP	C	C	T			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chrX:135318413C>T	ENST00000316077.9	-	7	946	c.726G>A	c.(724-726)agG>agA	p.R242R	MAP7D3_ENST00000370661.1_Silent_p.R207R|MAP7D3_ENST00000370663.5_Silent_p.R224R	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	242					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CACGTGGCTTCCTTTCGGCTT	0.333													ENSG00000129680																																					0													97.0	87.0	90.0					X																	135318413		1825	4075	5900	SO:0001819	synonymous_variant	0			-	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.726G>A	X.37:g.135318413C>T			A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Silent	SNP	pfam_MAP7	p.R224	ENST00000316077.9	37	c.672	CCDS44004.1	X																																																																																			-	MAP7D3	-	NULL		0.333	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	HGNC	protein_coding	OTTHUMT00000058487.2	0	0		52	52		0.00		C			135318413	-1	35		20		tier1	no_errors	ENST00000370663	ensembl	human	known	74_37	silent	63.64		SNP	0.000	T	35	20
PSME4	23198	genome.wustl.edu	37	2	54092486	54092486	+	3'UTR	DEL	A	A	-	rs398080264|rs56006630	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr2:54092486delA	ENST00000404125.1	-	0	5816				PSME4_ENST00000476586.1_5'UTR|PSME4_ENST00000421748.2_3'UTR	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CAGATGCCTCAAAAAAAAAAA	0.393													ENSG00000068878	|||unknown(HR)	1777	0.354832	0.236	0.2579	5008	,	,		17325	0.4772		0.3131	False		,,,				2504	0.501																0																																										SO:0001624	3_prime_UTR_variant	0				D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.*229T>-	2.37:g.54092486delA			Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	R	DEL	-	NULL	ENST00000404125.1	37	NULL	CCDS33197.2	2																																																																																				PSME4	-	-		0.393	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	0	0		11	11		0.00		A	XM_040158		54092486	-1	2		21		tier1	no_errors	ENST00000476586	ensembl	human	known	74_37	rna	8.70		DEL	0.998	-	2	21
ATP2B4	493	genome.wustl.edu	37	1	203680135	203680135	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:203680135G>A	ENST00000357681.5	+	12	3053	c.1930G>A	c.(1930-1932)Gac>Aac	p.D644N	ATP2B4_ENST00000367218.3_Missense_Mutation_p.D644N|ATP2B4_ENST00000341360.2_Missense_Mutation_p.D644N|ATP2B4_ENST00000391954.2_Missense_Mutation_p.D644N|ATP2B4_ENST00000367219.3_Missense_Mutation_p.D632N	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	644					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGCTTACCGGGACTTCGATGA	0.532													ENSG00000058668																																					0													117.0	99.0	105.0					1																	203680135		2203	4300	6503	SO:0001583	missense	0			-	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.1930G>A	1.37:g.203680135G>A	ENSP00000350310:p.Asp644Asn		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.D644N	ENST00000357681.5	37	c.1930	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699854	0.88924	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.96992	-4.2;-4.2;-4.2;-4.2;-4.2	5.33	5.33	0.75918	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.115683	0.38837	N	0.001554	D	0.97266	0.9106	M	0.74467	2.265	0.80722	D	1	P;P;P	0.51147	0.942;0.898;0.698	P;P;B	0.53313	0.723;0.72;0.409	D	0.97822	1.0257	10	0.87932	D	0	-18.9857	18.9784	0.92746	0.0:0.0:1.0:0.0	.	644;644;644	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	N	644;644;632;644;644	ENSP00000350310:D644N;ENSP00000356187:D644N;ENSP00000356188:D632N;ENSP00000375816:D644N;ENSP00000340930:D644N	ENSP00000340930:D644N	D	+	1	0	ATP2B4	201946758	1.000000	0.71417	0.998000	0.56505	0.819000	0.46315	9.555000	0.98123	2.641000	0.89580	0.637000	0.83480	GAC	-	ATP2B4	-	superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_plasma		0.532	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	0	0		33	33		0.00		G	NM_001001396		203680135	+1	106		36		tier1	no_errors	ENST00000357681	ensembl	human	known	74_37	missense	74.65		SNP	1.000	A	106	36
ATP8B3	148229	genome.wustl.edu	37	19	1799764	1799764	+	Intron	DEL	A	A	-			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr19:1799764delA	ENST00000310127.6	-	14	1791				ATP8B3_ENST00000526092.2_Frame_Shift_Del_p.F525fs|ATP8B3_ENST00000525591.1_Intron|ATP8B3_ENST00000539485.1_Intron	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actctgcctcaaaaaaaaaaa	0.547													ENSG00000130270																																					0																																										SO:0001627	intron_variant	0				AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1552+181T>-	19.37:g.1799764delA			Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Frame_Shift_Del	DEL	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom	p.F525fs	ENST00000310127.6	37	c.1575	CCDS45901.1	19																																																																																				ATP8B3	-	NULL		0.547	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	0	0		11	11		0.00		A	NM_138813		1799764	-1	4		15		tier1	no_errors	ENST00000526092	ensembl	human	putative	74_37	frame_shift_del	21.05		DEL	0.016	-	4	15
MROH2B	133558	genome.wustl.edu	37	5	41007433	41007433	+	Silent	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr5:41007433G>A	ENST00000399564.4	-	34	4182	c.3732C>T	c.(3730-3732)ggC>ggT	p.G1244G	MROH2B_ENST00000506092.2_Silent_p.G799G	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1244																	GTGAACATACGCCTATGTGGT	0.438													ENSG00000171495																																					0													57.0	54.0	55.0					5																	41007433		1886	4080	5966	SO:0001819	synonymous_variant	0			-		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3732C>T	5.37:g.41007433G>A			Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	superfamily_ARM-type_fold	p.G1244	ENST00000399564.4	37	c.3732	CCDS47202.1	5																																																																																			-	MROH2B	-	superfamily_ARM-type_fold		0.438	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	0	0		107	107		0.00		G	NM_173489		41007433	-1	28		51		tier1	no_errors	ENST00000399564	ensembl	human	known	74_37	silent	35.44		SNP	0.957	A	28	51
NBPF9	400818	genome.wustl.edu	37	1	144826711	144826711	+	Intron	SNP	T	T	C			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:144826711T>C	ENST00000468645.1	+	13	1601				NBPF9_ENST00000281815.8_Intron|NBPF9_ENST00000338347.4_Intron|NBPF9_ENST00000440491.2_Intron			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						tgtgtgtgtgtgtgtgtgtgt	0.453													ENSG00000168614																																					0																																										SO:0001627	intron_variant	0			-		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.1602-222T>C	1.37:g.144826711T>C				R	SNP	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			-	NBPF9	-	-		0.453	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	HGNC	protein_coding	OTTHUMT00000038846.1	0	0		28	28		0.00		T	NM_001037675		144826711	+1	13		63		tier1	no_errors	ENST00000488888	ensembl	human	known	74_37	rna	17.11		SNP	0.003	C	13	63
TTYH3	80727	genome.wustl.edu	37	7	2696139	2696139	+	Silent	SNP	C	C	T	rs200862283		TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr7:2696139C>T	ENST00000258796.7	+	11	1426	c.1221C>T	c.(1219-1221)tgC>tgT	p.C407C	TTYH3_ENST00000403167.1_Silent_p.C236C|TTYH3_ENST00000407643.1_Silent_p.C375C	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	407					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		CCATCGTCTGCAGCGTCCCGC	0.642													ENSG00000136295																																					0													74.0	65.0	68.0					7																	2696139		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.1221C>T	7.37:g.2696139C>T			A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Silent	SNP	pfam_Tweety	p.C407	ENST00000258796.7	37	c.1221	CCDS34588.1	7																																																																																			rs200862283	TTYH3	-	pfam_Tweety		0.642	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTYH3	HGNC	protein_coding	OTTHUMT00000325082.2	0	0		42	42		0.00		C	XM_166523		2696139	+1	9		79		tier1	no_errors	ENST00000258796	ensembl	human	known	74_37	silent	10.23		SNP	1.000	T	9	79
ATP2B4	493	genome.wustl.edu	37	1	203680134	203680134	+	Silent	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr1:203680134G>A	ENST00000357681.5	+	12	3052	c.1929G>A	c.(1927-1929)cgG>cgA	p.R643R	ATP2B4_ENST00000367218.3_Silent_p.R643R|ATP2B4_ENST00000341360.2_Silent_p.R643R|ATP2B4_ENST00000391954.2_Silent_p.R643R|ATP2B4_ENST00000367219.3_Silent_p.R631R	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	643					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TAGCTTACCGGGACTTCGATG	0.532													ENSG00000058668																																					0													116.0	98.0	104.0					1																	203680134		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.1929G>A	1.37:g.203680134G>A			B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.R643	ENST00000357681.5	37	c.1929	CCDS1440.1	1																																																																																			-	ATP2B4	-	superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_plasma		0.532	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	0	0		32	32		0.00		G	NM_001001396		203680134	+1	107		36		tier1	no_errors	ENST00000357681	ensembl	human	known	74_37	silent	74.83		SNP	0.997	A	107	36
RP11-678G14.3	0	genome.wustl.edu	37	19	21752033	21752033	+	lincRNA	DEL	G	G	-			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr19:21752033delG	ENST00000596996.1	-	0	2356				RP11-678G14.2_ENST00000594564.1_RNA																							CGGAGACAAAGGCCCCCATAT	0.557													ENSG00000268081																																					0																																												0																																19.37:g.21752033delG				R	DEL	-	NULL	ENST00000596996.1	37	NULL		19																																																																																				RP11-678G14.2	-	-		0.557	RP11-678G14.3-001	KNOWN	basic	lincRNA	ENSG00000268081	Clone_based_vega_gene	lincRNA	OTTHUMT00000464022.1	0	0		63	63		0.00		G			21752033	-1	12		56		tier1	no_errors	ENST00000594564	ensembl	human	known	74_37	rna	17.65		DEL	0.040	-	12	56
DDX24	57062	genome.wustl.edu	37	14	94517533	94517534	+	3'UTR	INS	-	-	CACGG	rs35895367|rs201835082|rs7291|rs112814907|rs34699499	byFrequency	TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr14:94517533_94517534insCACGG	ENST00000330836.5	-	0	2714_2715				DDX24_ENST00000553400.1_5'UTR|DDX24_ENST00000544005.1_3'UTR|DDX24_ENST00000555054.1_3'UTR	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24						RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		ACACACTTGACCAGTTAATTTG	0.485											OREG0022891	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000089737		1536	0.306709	0.2148	0.4481	5008	,	,		18780	0.3343		0.3211	False		,,,				2504	0.2873																0										1085,1656,1523		148,418,371,328,582,285						0.3	0.0		dbSNP_126	86	2643,730,4875		459,235,1490,38,419,1483	no	utr-3	DDX24	NM_020414.3		607,653,1861,366,1001,1768	A1A1,A1A2,A1R,A2A2,A2R,RR		40.8948,61.1632,48.8651				3728,2386,6398				SO:0001624	3_prime_UTR_variant	0				AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.*4->CCGTG	14.37:g.94517533_94517534insCACGG		1306	E7EMJ4|Q4V9L5	R	INS	-	NULL	ENST00000330836.5	37	NULL	CCDS9918.1	14																																																																																				DDX24	-	-		0.485	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1									-	NM_020414		94517534	-1					tier1	no_errors	ENST00000553400	ensembl	human	putative	74_37	rna			INS	0.000:0.000	CACGG		
N4BP2	55728	genome.wustl.edu	37	4	40099030	40099030	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23U-01A-11D-A26G-09	TCGA-DX-A23U-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	571ba70b-dd96-423d-bd14-2160fe033925	0d978ebb-cdad-48a2-bc30-1d9abdd6e645	g.chr4:40099030G>A	ENST00000261435.6	+	3	486	c.70G>A	c.(70-72)Gta>Ata	p.V24I		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	24					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						GGAAGTTGTCGTATCCAGTGT	0.438													ENSG00000078177																																					0													144.0	135.0	138.0					4																	40099030		2203	4300	6503	SO:0001583	missense	0			-	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.70G>A	4.37:g.40099030G>A	ENSP00000261435:p.Val24Ile		A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.V24I	ENST00000261435.6	37	c.70	CCDS3457.1	4	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079112	0.55753	.	.	ENSG00000078177	ENST00000261435	T	0.19394	2.15	5.2	3.35	0.38373	.	0.858860	0.09476	N	0.796984	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	P	0.39404	0.672	B	0.22753	0.041	T	0.13361	-1.0512	10	0.54805	T	0.06	.	5.4239	0.16415	0.0767:0.141:0.6365:0.1457	.	24	Q86UW6	N4BP2_HUMAN	I	24	ENSP00000261435:V24I	ENSP00000261435:V24I	V	+	1	0	N4BP2	39775425	0.945000	0.32115	0.292000	0.24919	0.819000	0.46315	1.644000	0.37228	1.172000	0.42781	0.655000	0.94253	GTA	-	N4BP2	-	NULL		0.438	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2	0	0		33	33		0.00		G	NM_018177		40099030	+1	11		29		tier1	no_errors	ENST00000261435	ensembl	human	known	74_37	missense	27.50		SNP	0.035	A	11	29
