#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ZBTB46	140685	genome.wustl.edu	37	20	62384159	62384159	+	Silent	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr20:62384159C>T	ENST00000245663.4	-	4	1428	c.1278G>A	c.(1276-1278)tcG>tcA	p.S426S	ZBTB46_ENST00000395104.1_Silent_p.S426S|ZBTB46_ENST00000302995.2_Silent_p.S426S	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	426					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					GGTGCATGGCCGAGAAGCTGC	0.602													ENSG00000130584																																					0													135.0	99.0	111.0					20																	62384159		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.1278G>A	20.37:g.62384159C>T			E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Silent	SNP	pfam_BTB_POZ,pfam_DUF3342,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S426	ENST00000245663.4	37	c.1278	CCDS13538.1	20																																																																																			-	ZBTB46	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.602	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB46	HGNC	protein_coding	OTTHUMT00000080232.2	0	0	0	60	60	53	0.00	0.00	C	NM_025224		62384159	-1	15	9	75	39	tier1	no_errors	ENST00000245663	ensembl	human	known	74_37	silent	16.67	18.75	SNP	0.494	T	15	75
AMFR	267	genome.wustl.edu	37	16	56438907	56438907	+	Missense_Mutation	SNP	C	C	T	rs187472781		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr16:56438907C>T	ENST00000290649.5	-	6	964	c.754G>A	c.(754-756)Gga>Aga	p.G252R		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	252					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						GTCCCCTTTCCTTCCCACGTC	0.443													ENSG00000159461	C|||	1	0.000199681	0.0	0.0014	5008	,	,		20531	0.0		0.0	False		,,,				2504	0.0				Pancreas(2;144 323 39528)												0													190.0	151.0	164.0					16																	56438907		2198	4300	6498	SO:0001583	missense	0			GMAF=0.0005	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.754G>A	16.37:g.56438907C>T	ENSP00000290649:p.Gly252Arg		P26442|Q8IZ70	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_CUE,pfscan_CUE,pfscan_Znf_RING	p.G252R	ENST00000290649.5	37	c.754	CCDS10758.1	16	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	15.72	2.915807	0.52546	.	.	ENSG00000159461	ENST00000290649	T	0.13657	2.57	6.06	6.06	0.98353	.	0.137727	0.64402	D	0.000003	T	0.12561	0.0305	L	0.35723	1.085	0.51012	D	0.999908	B	0.19935	0.04	B	0.22386	0.039	T	0.13710	-1.0499	10	0.16896	T	0.51	-17.3753	14.7385	0.69434	0.0:0.9315:0.0:0.0685	.	252	Q9UKV5	AMFR2_HUMAN	R	252	ENSP00000290649:G252R	ENSP00000290649:G252R	G	-	1	0	AMFR	54996408	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.599000	0.61076	2.871000	0.98454	0.655000	0.94253	GGA	rs187472781	AMFR	-	NULL		0.443	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMFR	HGNC	protein_coding	OTTHUMT00000256978.2	0	0	0	75	75	154	0.00	0.00	C			56438907	-1	91	161	65	92	tier1	no_errors	ENST00000290649	ensembl	human	known	74_37	missense	58.33	63.64	SNP	1.000	T	91	65
SLC25A35	399512	genome.wustl.edu	37	17	8194200	8194200	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr17:8194200C>T	ENST00000577745.1	-	4	1199	c.689G>A	c.(688-690)tGc>tAc	p.C230Y	SLC25A35_ENST00000396278.1_Missense_Mutation_p.C230Y|SLC25A35_ENST00000580340.1_Missense_Mutation_p.C230Y|SLC25A35_ENST00000380067.2_Missense_Mutation_p.C230Y|SLC25A35_ENST00000581320.1_5'Flank|SLC25A35_ENST00000579192.1_Missense_Mutation_p.C230Y			Q3KQZ1	S2535_HUMAN	solute carrier family 25, member 35	230					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(2)|large_intestine(2)|lung(2)	6						GAGCCTTGTGCAGGCCACATC	0.582													ENSG00000125434																																					0													115.0	100.0	105.0					17																	8194200		2203	4300	6503	SO:0001583	missense	0			-	AY498866	CCDS11138.1	17p13.1	2013-05-22			ENSG00000125434	ENSG00000125434		"""Solute carriers"""	31921	protein-coding gene	gene with protein product		610818					Standard	NM_201520		Approved	FLJ40217	uc002gku.1	Q3KQZ1		ENST00000577745.1:c.689G>A	17.37:g.8194200C>T	ENSP00000464231:p.Cys230Tyr		Q494X5|Q6RGS3|Q8N7Y5	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.C230Y	ENST00000577745.1	37	c.689		17	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890870	0.33348	.	.	ENSG00000125434	ENST00000380067;ENST00000396278	T;T	0.78707	-1.12;-1.2	5.04	5.04	0.67666	Mitochondrial carrier domain (2);	0.140999	0.64402	D	0.000006	T	0.74801	0.3764	L	0.39898	1.24	0.35952	D	0.833974	B;B	0.22604	0.025;0.072	B;B	0.33960	0.167;0.173	T	0.78326	-0.2247	10	0.66056	D	0.02	-0.9096	15.9113	0.79475	0.0:1.0:0.0:0.0	.	230;230	Q3KQZ1;Q3KQZ1-4	S2535_HUMAN;.	Y	230	ENSP00000369407:C230Y;ENSP00000379574:C230Y	ENSP00000369407:C230Y	C	-	2	0	SLC25A35	8134925	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.201000	0.77847	2.621000	0.88768	0.407000	0.27541	TGC	-	SLC25A35	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.582	SLC25A35-002	KNOWN	basic|appris_principal	protein_coding	SLC25A35	HGNC	protein_coding	OTTHUMT00000442146.1	0	0	0	54	54	51	0.00	0.00	C	NM_201520		8194200	-1	53	41	98	53	tier1	no_errors	ENST00000577745	ensembl	human	known	74_37	missense	35.10	43.62	SNP	1.000	T	53	98
RALGPS1	9649	genome.wustl.edu	37	9	129796752	129796752	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr9:129796752C>G	ENST00000259351.5	+	5	526	c.259C>G	c.(259-261)Ctt>Gtt	p.L87V	RALGPS1_ENST00000424082.2_Missense_Mutation_p.L87V|RALGPS1_ENST00000373434.1_Missense_Mutation_p.L87V|RALGPS1_ENST00000373436.1_Missense_Mutation_p.L87V|RALGPS1_ENST00000394022.3_Missense_Mutation_p.L87V	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	87	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)			kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GAAACACAGTCTTGCCCCTAA	0.488													ENSG00000136828																																					0													223.0	154.0	177.0					9																	129796752		2203	4300	6503	SO:0001583	missense	0			-	AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.259C>G	9.37:g.129796752C>G	ENSP00000259351:p.Leu87Val		B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.L87V	ENST00000259351.5	37	c.259	CCDS35143.1	9	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577344	0.28180	.	.	ENSG00000136828	ENST00000259351;ENST00000424082;ENST00000394022;ENST00000373439;ENST00000319107;ENST00000373436;ENST00000373434	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	4.98	4.98	0.66077	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000006	T	0.33731	0.0873	L	0.46819	1.47	0.58432	D	0.99999	B;B;B;P	0.35700	0.018;0.015;0.071;0.516	B;B;B;B	0.40534	0.043;0.009;0.026;0.332	T	0.05241	-1.0897	10	0.28530	T	0.3	.	17.4041	0.87468	0.0:1.0:0.0:0.0	.	87;87;87;87	E9PBQ5;Q5JS13-3;Q5JS13-2;Q5JS13	.;.;.;RGPS1_HUMAN	V	87	ENSP00000259351:L87V;ENSP00000415630:L87V;ENSP00000377590:L87V;ENSP00000317149:L87V;ENSP00000362535:L87V;ENSP00000362533:L87V	ENSP00000259351:L87V	L	+	1	0	RALGPS1	128836573	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.186000	0.58337	2.470000	0.83445	0.563000	0.77884	CTT	-	RALGPS1	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.488	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS1	HGNC	protein_coding	OTTHUMT00000054133.1	0	0	0	61	61	140	0.00	0.00	C	NM_014636		129796752	+1	15	25	83	132	tier1	no_errors	ENST00000259351	ensembl	human	known	74_37	missense	15.31	15.92	SNP	0.999	G	15	83
DYRK4	8798	genome.wustl.edu	37	12	4677210	4677210	+	3'UTR	SNP	C	C	T	rs541540418		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:4677210C>T	ENST00000539490.1	+	0	90							Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4							cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			TTCACCTCTGCGAAGGTAAAG	0.473													ENSG00000010219	C|||	1	0.000199681	0.0	0.0014	5008	,	,		21905	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			-	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000539490.1:c.*87C>T	12.37:g.4677210C>T			A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	NULL	p.A43V	ENST00000539490.1	37	c.128		12	.	.	.	.	.	.	.	.	.	.	C	7.669	0.686531	0.14973	.	.	ENSG00000010219	ENST00000542744	T	0.60299	0.2	4.99	-3.17	0.05202	.	.	.	.	.	T	0.25005	0.0607	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29427	-1.0012	8	0.02654	T	1	.	6.104	0.20063	0.0:0.3235:0.1335:0.543	.	43	F5H6L9	.	V	43	ENSP00000437534:A43V	ENSP00000444842:A43V	A	+	2	0	DYRK4	4547471	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.020000	0.13466	-0.803000	0.04415	-0.792000	0.03331	GCG	-	DYRK4	-	NULL		0.473	DYRK4-010	KNOWN	basic	processed_transcript	DYRK4	HGNC	protein_coding	OTTHUMT00000398779.1	0	0	0	13	13	93	0.00	0.00	C			4677210	+1	4	32	13	49	tier1	no_errors	ENST00000539701	ensembl	human	known	74_37	missense	23.53	39.51	SNP	0.000	T	4	13
GKAP1	80318	genome.wustl.edu	37	9	86354626	86354626	+	Missense_Mutation	SNP	C	C	T	rs554092166		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr9:86354626C>T	ENST00000376371.2	-	13	1487	c.1087G>A	c.(1087-1089)Gac>Aac	p.D363N	GKAP1_ENST00000376365.3_Missense_Mutation_p.D312N|GKAP1_ENST00000376362.1_5'UTR	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	363					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						CTACACTGGTCGGATTCAGAG	0.328													ENSG00000165113	C|||	1	0.000199681	0.0	0.0	5008	,	,		13741	0.001		0.0	False		,,,				2504	0.0																0													86.0	84.0	85.0					9																	86354626		2203	4300	6503	SO:0001583	missense	0			-	BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.1087G>A	9.37:g.86354626C>T	ENSP00000365550:p.Asp363Asn		Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Missense_Mutation	SNP	NULL	p.D363N	ENST00000376371.2	37	c.1087	CCDS35049.1	9	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922819	0.52653	.	.	ENSG00000165113	ENST00000376371;ENST00000376365	.	.	.	6.17	5.28	0.74379	.	0.200471	0.51477	D	0.000089	T	0.44371	0.1290	L	0.31294	0.92	0.39554	D	0.969013	B;B	0.32893	0.108;0.389	B;B	0.25759	0.023;0.063	T	0.50651	-0.8803	9	0.72032	D	0.01	-21.2155	13.3032	0.60336	0.0:0.9272:0.0:0.0728	.	312;363	Q5VSY0-2;Q5VSY0	.;GKAP1_HUMAN	N	363;312	.	ENSP00000365544:D312N	D	-	1	0	GKAP1	85544446	0.999000	0.42202	0.996000	0.52242	0.988000	0.76386	2.844000	0.48246	1.630000	0.50440	0.655000	0.94253	GAC	-	GKAP1	-	NULL		0.328	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GKAP1	HGNC	protein_coding	OTTHUMT00000052839.2	0	0	0	50	50	84	0.00	0.00	C	NM_025211		86354626	-1	8	16	64	55	tier1	no_errors	ENST00000376371	ensembl	human	known	74_37	missense	11.11	21.92	SNP	1.000	T	8	64
AMFR	267	genome.wustl.edu	37	16	56438954	56438954	+	Splice_Site	SNP	C	C	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr16:56438954C>G	ENST00000290649.5	-	6	918		c.e6-1			NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase						aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						AATTACGTATCTGTAATGAAG	0.398													ENSG00000159461																									Pancreas(2;144 323 39528)												0													132.0	114.0	120.0					16																	56438954		2198	4300	6498	SO:0001630	splice_region_variant	0			-	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.708-1G>C	16.37:g.56438954C>G			P26442|Q8IZ70	Splice_Site	SNP	-	e6-1	ENST00000290649.5	37	c.708-1	CCDS10758.1	16	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812556	0.50527	.	.	ENSG00000159461	ENST00000290649	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6282	0.99521	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AMFR	54996455	1.000000	0.71417	0.997000	0.53966	0.169000	0.22640	7.767000	0.85331	2.871000	0.98454	0.655000	0.94253	.	-	AMFR	-	-		0.398	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMFR	HGNC	protein_coding	OTTHUMT00000256978.2	0	0	0	81	81	142	0.00	0.00	C		Intron	56438954	-1	89	140	70	99	tier1	no_errors	ENST00000290649	ensembl	human	known	74_37	splice_site	55.62	58.58	SNP	1.000	G	89	70
TBC1D4	9882	genome.wustl.edu	37	13	75861109	75861109	+	Missense_Mutation	SNP	G	G	A	rs375003443		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr13:75861109G>A	ENST00000377636.3	-	21	4062	c.3716C>T	c.(3715-3717)aCg>aTg	p.T1239M	TBC1D4_ENST00000431480.2_Missense_Mutation_p.T1231M|TBC1D4_ENST00000425511.1_Missense_Mutation_p.T403M|TBC1D4_ENST00000377625.2_Missense_Mutation_p.T1176M	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	1239					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GGTCTCTCTCGTCAAAAGATT	0.428													ENSG00000136111																																					0								G	MET/THR	0,3620		0,0,1810	121.0	113.0	115.0		3716	4.7	1.0	13		115	1,8163		0,1,4081	no	missense	TBC1D4	NM_014832.2	81	0,1,5891	AA,AG,GG		0.0122,0.0,0.0085	benign	1239/1299	75861109	1,11783	1810	4082	5892	SO:0001583	missense	0			-	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.3716C>T	13.37:g.75861109G>A	ENSP00000366863:p.Thr1239Met		A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.T1239M	ENST00000377636.3	37	c.3716	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044296	0.55110	0.0	1.22E-4	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511	T;T;T;T	0.78246	3.89;3.9;3.9;-1.16	5.53	4.67	0.58626	.	0.088614	0.49305	D	0.000160	D	0.82921	0.5142	M	0.63843	1.955	0.41624	D	0.988982	P;P;D;D	0.71674	0.727;0.915;0.996;0.998	B;B;P;P	0.59115	0.216;0.348;0.852;0.794	D	0.84356	0.0535	10	0.62326	D	0.03	-19.0602	11.5415	0.50669	0.0:0.1352:0.7242:0.1406	.	403;1176;1231;1239	O60343-4;O60343-2;O60343-3;O60343	.;.;.;TBCD4_HUMAN	M	1239;1231;1176;403	ENSP00000366863:T1239M;ENSP00000395986:T1231M;ENSP00000366852:T1176M;ENSP00000390654:T403M	ENSP00000366852:T1176M	T	-	2	0	TBC1D4	74759110	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.316000	0.79007	1.411000	0.46957	0.655000	0.94253	ACG	-	TBC1D4	-	NULL		0.428	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	0	0	0	77	77	168	0.00	0.00	G	NM_014832		75861109	-1	7	27	49	91	tier1	no_errors	ENST00000377636	ensembl	human	known	74_37	missense	12.50	22.88	SNP	1.000	A	7	49
EPB41L3	23136	genome.wustl.edu	37	18	5415858	5415858	+	Missense_Mutation	SNP	C	C	T	rs371099425		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr18:5415858C>T	ENST00000341928.2	-	13	2366	c.2026G>A	c.(2026-2028)Gcc>Acc	p.A676T	EPB41L3_ENST00000342933.3_Missense_Mutation_p.A676T|EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000542146.1_Intron|EPB41L3_ENST00000542652.2_Intron|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000427684.2_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	676	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TCTAGGGAGGCGCTCAAGGAG	0.577													ENSG00000082397																																					0								C	THR/ALA	0,4406		0,0,2203	84.0	81.0	82.0		2026	5.5	1.0	18		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	EPB41L3	NM_012307.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	676/1088	5415858	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2026G>A	18.37:g.5415858C>T	ENSP00000343158:p.Ala676Thr		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.A676T	ENST00000341928.2	37	c.2026	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170163	0.78452	0.0	1.16E-4	ENSG00000082397	ENST00000341928;ENST00000342933	T;T	0.81415	-1.49;-1.49	5.52	5.52	0.82312	.	0.134805	0.47852	D	0.000213	T	0.82070	0.4957	N	0.12182	0.205	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.83216	-0.0071	10	0.38643	T	0.18	.	19.4559	0.94889	0.0:1.0:0.0:0.0	.	676	Q9Y2J2	E41L3_HUMAN	T	676	ENSP00000343158:A676T;ENSP00000341138:A676T	ENSP00000343158:A676T	A	-	1	0	EPB41L3	5405858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.950000	0.70265	2.586000	0.87340	0.563000	0.77884	GCC	-	EPB41L3	-	pirsf_Band_41_protein		0.577	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	0	0	0	34	34	77	0.00	0.00	C	NM_012307		5415858	-1	6	15	29	72	tier1	no_errors	ENST00000341928	ensembl	human	known	74_37	missense	17.14	17.05	SNP	1.000	T	6	29
CCDC134	79879	genome.wustl.edu	37	22	42205909	42205909	+	Missense_Mutation	SNP	C	C	T	rs369237416		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr22:42205909C>T	ENST00000255784.5	+	3	234	c.130C>T	c.(130-132)Cgg>Tgg	p.R44W	CCDC134_ENST00000402061.3_Missense_Mutation_p.R44W	NM_024821.2	NP_079097.1	Q9H6E4	CC134_HUMAN	coiled-coil domain containing 134	44						extracellular region (GO:0005576)|membrane (GO:0016020)				large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						GGTGAAGCGGCGGGAGCAGCT	0.527													ENSG00000100147																																					0								C	TRP/ARG	0,4406		0,0,2203	64.0	58.0	60.0		130	-0.2	0.3	22		60	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC134	NM_024821.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	44/230	42205909	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AL021453	CCDS33654.1	22q13.2	2010-12-24			ENSG00000100147	ENSG00000100147			26185	protein-coding gene	gene with protein product						18087676	Standard	NM_024821		Approved	FLJ22349	uc003bbh.1	Q9H6E4	OTTHUMG00000151262	ENST00000255784.5:c.130C>T	22.37:g.42205909C>T	ENSP00000255784:p.Arg44Trp			Missense_Mutation	SNP	NULL	p.R44W	ENST00000255784.5	37	c.130	CCDS33654.1	22	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001659	0.54254	0.0	1.16E-4	ENSG00000100147	ENST00000402061;ENST00000255784;ENST00000429249	.	.	.	4.84	-0.245	0.13027	.	0.057402	0.64402	D	0.000003	T	0.61540	0.2355	L	0.38175	1.15	0.40408	D	0.979722	D;D	0.76494	0.998;0.999	P;P	0.62491	0.903;0.9	T	0.66752	-0.5844	9	0.87932	D	0	-23.4126	14.2999	0.66339	0.7444:0.2556:0.0:0.0	.	44;44	B0QY51;Q9H6E4	.;CC134_HUMAN	W	44	.	ENSP00000255784:R44W	R	+	1	2	CCDC134	40535855	1.000000	0.71417	0.282000	0.24776	0.500000	0.33767	3.152000	0.50677	0.282000	0.22254	-0.181000	0.13052	CGG	-	CCDC134	-	NULL		0.527	CCDC134-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CCDC134	HGNC	protein_coding	OTTHUMT00000321964.1	0	0	0	37	37	83	0.00	0.00	C	NM_024821		42205909	+1	12	12	46	23	tier1	no_errors	ENST00000255784	ensembl	human	known	74_37	missense	20.69	34.29	SNP	0.934	T	12	46
GALNTL6	442117	genome.wustl.edu	37	4	173734827	173734827	+	Silent	SNP	C	C	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr4:173734827C>A	ENST00000506823.1	+	7	1533	c.876C>A	c.(874-876)atC>atA	p.I292I	GALNTL6_ENST00000508122.1_Silent_p.I275I	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	292					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.I292I(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						ACAAAAGAATCCCCATCCCTC	0.562													ENSG00000174473																																					1	Substitution - coding silent(1)	lung(1)											83.0	80.0	81.0					4																	173734827		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.876C>A	4.37:g.173734827C>A			Q2L4S6	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.I292	ENST00000506823.1	37	c.876	CCDS34104.1	4																																																																																			-	GALNTL6	-	pfam_Glyco_trans_2		0.562	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	HGNC	protein_coding	OTTHUMT00000362395.1	0	0	1	23	23	95	0.00	1.04	C	NM_001034845		173734827	+1	8	10	23	37	tier1	no_errors	ENST00000506823	ensembl	human	known	74_37	silent	25.81	21.28	SNP	0.973	A	8	23
NLRP4	147945	genome.wustl.edu	37	19	56370443	56370443	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr19:56370443G>T	ENST00000301295.6	+	3	2106	c.1684G>T	c.(1684-1686)Gat>Tat	p.D562Y	NLRP4_ENST00000346986.5_Missense_Mutation_p.D562Y|NLRP4_ENST00000587891.1_Missense_Mutation_p.D487Y	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	562					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TGAAATGCAGGATCCTGCCTT	0.468													ENSG00000160505																																					0													76.0	75.0	75.0					19																	56370443		2203	4300	6503	SO:0001583	missense	0			-	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1684G>T	19.37:g.56370443G>T	ENSP00000301295:p.Asp562Tyr		Q86W87|Q96AY6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.D562Y	ENST00000301295.6	37	c.1684	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213030	0.39102	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.89270	-2.49;-2.49	4.15	-1.43	0.08884	.	.	.	.	.	D	0.90239	0.6948	L	0.50333	1.59	0.09310	N	1	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.69142	0.94;0.962;0.91	T	0.80937	-0.1159	9	0.87932	D	0	.	7.1414	0.25558	0.4897:0.0:0.5103:0.0	.	562;487;562	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	Y	562	ENSP00000301295:D562Y;ENSP00000344787:D562Y	ENSP00000301295:D562Y	D	+	1	0	NLRP4	61062255	0.131000	0.22433	0.001000	0.08648	0.072000	0.16883	1.153000	0.31676	-0.242000	0.09667	0.591000	0.81541	GAT	-	NLRP4	-	NULL		0.468	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	0	0	0	69	69	156	0.00	0.00	G	NM_134444		56370443	+1	36	35	76	104	tier1	no_errors	ENST00000301295	ensembl	human	known	74_37	missense	32.14	25.18	SNP	0.000	T	36	76
SPRY3	10251	genome.wustl.edu	37	X	155003566	155003566	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chrX:155003566A>T	ENST00000302805.2	+	2	464	c.33A>T	c.(31-33)caA>caT	p.Q11H		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	11					multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATTTTCAACAAATTCTGCCTA	0.488													ENSG00000168939																																					0													194.0	192.0	193.0					X																	155003566		2203	4296	6499	SO:0001583	missense	0			-	AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.33A>T	X.37:g.155003566A>T	ENSP00000302978:p.Gln11His		A8K0H8	Missense_Mutation	SNP	pfam_Sprouty	p.Q11H	ENST00000302805.2	37	c.33	CCDS14769.4	X	.	.	.	.	.	.	.	.	.	.	A	0.058	-1.230765	0.01518	.	.	ENSG00000168939	ENST00000302805;ENST00000369437	T	0.55234	0.53	3.14	1.88	0.25563	.	0.542911	0.17911	N	0.157838	T	0.40015	0.1100	.	.	.	0.09310	N	1	D;P	0.58268	0.982;0.742	P;B	0.44518	0.452;0.102	T	0.21965	-1.0230	9	0.38643	T	0.18	-0.1133	4.8695	0.13625	0.7109:0.0:0.2891:0.0	.	11;11	Q6ZUP3;O43610	.;SPY3_HUMAN	H	11	ENSP00000302978:Q11H	ENSP00000302978:Q11H	Q	+	3	2	SPRY3	154656760	0.996000	0.38824	0.999000	0.59377	0.966000	0.64601	0.397000	0.20883	0.268000	0.21939	0.231000	0.17811	CAA	-	SPRY3	-	NULL		0.488	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY3	HGNC	protein_coding	OTTHUMT00000058823.2	0	0	0	93	93	57	0.00	0.00	A	NM_005840		155003566	+1	34	32	112	65	tier1	no_errors	ENST00000302805	ensembl	human	known	74_37	missense	23.29	32.99	SNP	0.998	T	34	112
RGPD4	285190	genome.wustl.edu	37	2	108479404	108479404	+	Splice_Site	SNP	G	G	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr2:108479404G>T	ENST00000408999.3	+	17	2462		c.e17-1		RGPD4_ENST00000354986.4_Splice_Site	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4						protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TTTTTTTTTAGTATTCTCCCA	0.313													ENSG00000196862																																					0													79.0	58.0	65.0					2																	108479404		692	1590	2282	SO:0001630	splice_region_variant	0			-	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2386-1G>T	2.37:g.108479404G>T			B9A029	Splice_Site	SNP	-	e17-1	ENST00000408999.3	37	c.2386-1	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	4.820	0.152379	0.09185	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	.	.	.	2.3	2.3	0.28687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5619	0.50782	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RGPD4	107845836	1.000000	0.71417	0.965000	0.40720	0.545000	0.35147	8.300000	0.89948	1.299000	0.44798	0.152000	0.16155	.	-	RGPD4	-	-		0.313	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	0	0	0	137	137	16	0.00	0.00	G	XM_496581	Intron	108479404	+1	31	3	168	19	tier1	no_errors	ENST00000354986	ensembl	human	known	74_37	splice_site	15.58	13.64	SNP	1.000	T	31	168
HNF1A	6927	genome.wustl.edu	37	12	121416794	121416794	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:121416794G>A	ENST00000257555.6	+	1	449	c.223G>A	c.(223-225)Gac>Aac	p.D75N	HNF1A-AS1_ENST00000537361.1_RNA|HNF1A-AS1_ENST00000535301.1_RNA|HNF1A_ENST00000543427.1_Intron|HNF1A_ENST00000538626.1_Intron|HNF1A-AS1_ENST00000433033.2_RNA|HNF1A_ENST00000544413.1_Missense_Mutation_p.D75N|HNF1A_ENST00000402929.1_Missense_Mutation_p.D75N|HNF1A_ENST00000400024.2_Missense_Mutation_p.D75N|HNF1A_ENST00000541395.1_Missense_Mutation_p.D75N			P20823	HNF1A_HUMAN	HNF1 homeobox A	75	Asp/Glu-rich (acidic; potential involvement with transcription).				glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGACGAGACGGACGACGATGG	0.672									Hepatic Adenoma, Familial Clustering of				ENSG00000135100																																					0													28.0	31.0	30.0					12																	121416794		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	-	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.223G>A	12.37:g.121416794G>A	ENSP00000257555:p.Asp75Asn		A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.D75N	ENST00000257555.6	37	c.223	CCDS9209.1	12	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325628	0.60743	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D	0.98437	-4.93;-4.93;-4.93	4.34	3.37	0.38596	Hepatocyte nuclear factor 1, N-terminal (1);	0.201266	0.31859	N	0.006955	D	0.93416	0.7900	N	0.22421	0.69	0.80722	D	1	P;P;P;P	0.43231	0.728;0.611;0.801;0.458	B;B;B;B	0.38156	0.23;0.142;0.266;0.142	D	0.91764	0.5422	10	0.11794	T	0.64	-26.2195	9.5275	0.39173	0.0:0.0:0.5928:0.4072	.	75;75;75;75	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	N	75	ENSP00000257555:D75N;ENSP00000443112:D75N;ENSP00000438804:D75N	ENSP00000257555:D75N	D	+	1	0	HNF1A	119901177	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	4.200000	0.58433	1.954000	0.56735	0.591000	0.81541	GAC	-	HNF1A	-	pfam_HNF-1_N		0.672	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	0	0	0	24	24	54	0.00	0.00	G	NM_000545		121416794	+1	22	29	64	158	tier1	no_errors	ENST00000257555	ensembl	human	known	74_37	missense	25.58	15.51	SNP	1.000	A	22	64
PARK2	5071	genome.wustl.edu	37	6	162864388	162864388	+	Missense_Mutation	SNP	C	C	T	rs368134308	byFrequency	TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr6:162864388C>T	ENST00000366898.1	-	2	227	c.125G>A	c.(124-126)cGt>cAt	p.R42H	PARK2_ENST00000366896.1_Missense_Mutation_p.R42H|PARK2_ENST00000338468.3_De_novo_Start_InFrame|PARK2_ENST00000366894.1_De_novo_Start_OutOfFrame|PARK2_ENST00000366892.1_Missense_Mutation_p.R42H|PARK2_ENST00000366897.1_Missense_Mutation_p.R42H	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	42	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.		R -> P (in PARK2; induces a conformational change in the PSMD4- binding site of Ubl resulting in impaired proteasomal binding). {ECO:0000269|PubMed:11971093, ECO:0000269|PubMed:15584030}.		adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GAAAATCACACGCAACTGGTC	0.582													ENSG00000185345	C|||	3	0.000599042	0.0	0.0	5008	,	,		17803	0.0		0.0	False		,,,				2504	0.0031																0			GRCh37	CM002386|CM066955	PARK2	M		C	HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	149.0	127.0	134.0		125,125,125	4.7	1.0	6		134	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PARK2	NM_004562.2,NM_013987.2,NM_013988.2	29,29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign,benign	42/466,42/438,42/317	162864388	2,13004	2203	4300	6503	SO:0001583	missense	0			-		CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.125G>A	6.37:g.162864388C>T	ENSP00000355865:p.Arg42His		A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Znf_C6HC,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,smart_Znf_C6HC,pirsf_Parkin,pfscan_Ubiquitin_supergroup,prints_Parkin,prints_Ubiquitin	p.R42H	ENST00000366898.1	37	c.125	CCDS5281.1	6	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248028	0.59103	2.27E-4	1.16E-4	ENSG00000185345	ENST00000366898;ENST00000366897;ENST00000366896;ENST00000366892;ENST00000542682	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	5.63	4.74	0.60224	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	T	0.71451	0.3341	M	0.87971	2.92	0.39257	D	0.964146	B;P;B;B	0.40660	0.305;0.726;0.228;0.139	B;B;B;B	0.33196	0.07;0.159;0.091;0.117	T	0.77349	-0.2621	10	0.41790	T	0.15	.	15.4714	0.75441	0.0:0.9302:0.0:0.0698	.	42;42;42;42	O60260-5;Q5VVX3;Q5VVX4;O60260	.;.;.;PRKN2_HUMAN	H	42;42;42;42;41	ENSP00000355865:R42H;ENSP00000355863:R42H;ENSP00000355862:R42H;ENSP00000355858:R42H	ENSP00000355858:R42H	R	-	2	0	PARK2	162784378	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	0.727000	0.25999	2.805000	0.96524	0.655000	0.94253	CGT	-	PARK2	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pirsf_Parkin,pfscan_Ubiquitin_supergroup,prints_Parkin,prints_Ubiquitin		0.582	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PARK2	HGNC	protein_coding	OTTHUMT00000042995.1	0	0	1	41	41	85	0.00	1.16	C			162864388	-1	14	13	67	79	tier1	no_errors	ENST00000366898	ensembl	human	known	74_37	missense	17.28	14.13	SNP	1.000	T	14	67
SULF1	23213	genome.wustl.edu	37	8	70533467	70533467	+	Silent	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr8:70533467G>A	ENST00000260128.4	+	14	2292	c.1575G>A	c.(1573-1575)ttG>ttA	p.L525L	SULF1_ENST00000458141.2_Silent_p.L525L|SULF1_ENST00000402687.4_Silent_p.L525L|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Silent_p.L525L	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	525					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GGCAATTCTTGAGAAACCAGG	0.502													ENSG00000137573																																					0													50.0	52.0	52.0					8																	70533467		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1575G>A	8.37:g.70533467G>A			Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.L525	ENST00000260128.4	37	c.1575	CCDS6204.1	8																																																																																			-	SULF1	-	superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase		0.502	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	0	0	0	29	29	130	0.00	0.00	G	NM_015170		70533467	+1	6	19	17	83	tier1	no_errors	ENST00000260128	ensembl	human	known	74_37	silent	25.00	18.63	SNP	1.000	A	6	17
PREP	5550	genome.wustl.edu	37	6	105821433	105821433	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr6:105821433C>T	ENST00000369110.3	-	5	598	c.406G>A	c.(406-408)Ggt>Agt	p.G136S		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	136					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	AAATATTCACCATCTTCGCTG	0.463													ENSG00000085377																																					0													96.0	85.0	89.0					6																	105821433		2203	4300	6503	SO:0001583	missense	0			-		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.406G>A	6.37:g.105821433C>T	ENSP00000358106:p.Gly136Ser		Q8N6D4	Missense_Mutation	SNP	pfam_Pept_S9A_N,pfam_Peptidase_S9,prints_Peptidase_S9A	p.G136S	ENST00000369110.3	37	c.406	CCDS5053.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.839316	0.97009	.	.	ENSG00000085377	ENST00000369110	T	0.60920	0.15	6.02	6.02	0.97574	Peptidase S9A, oligopeptidase, N-terminal (1);Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.000000	0.85682	D	0.000000	D	0.83344	0.5234	H	0.95950	3.745	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.87352	0.2338	10	0.87932	D	0	-19.659	20.5373	0.99239	0.0:1.0:0.0:0.0	.	136	P48147	PPCE_HUMAN	S	136	ENSP00000358106:G136S	ENSP00000358106:G136S	G	-	1	0	PREP	105928126	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	GGT	-	PREP	-	pfam_Pept_S9A_N		0.463	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREP	HGNC	protein_coding	OTTHUMT00000041658.1	0	0	0	36	36	75	0.00	0.00	C			105821433	-1	19	21	44	89	tier1	no_errors	ENST00000369110	ensembl	human	known	74_37	missense	30.16	18.92	SNP	1.000	T	19	44
PRB2	653247	genome.wustl.edu	37	12	11546647	11546647	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:11546647G>T	ENST00000389362.4	-	3	400	c.365C>A	c.(364-366)cCc>cAc	p.P122H	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	122	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TCCTTGTGGGGGTGGTCCTTG	0.612													ENSG00000121335																																					0													315.0	310.0	312.0					12																	11546647		2202	4300	6502	SO:0001583	missense	0			-	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.365C>A	12.37:g.11546647G>T	ENSP00000374013:p.Pro122His		O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.P122H	ENST00000389362.4	37	c.365	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	9.207	1.029840	0.19512	.	.	ENSG00000121335	ENST00000389362	T	0.27557	1.66	1.42	0.0232	0.14136	.	50.339300	0.02518	N	0.092287	T	0.45597	0.1350	M	0.77313	2.365	0.22156	N	0.999324	D	0.71674	0.998	P	0.52514	0.701	T	0.34428	-0.9829	10	0.35671	T	0.21	.	6.6308	0.22855	0.0:0.3011:0.6989:0.0	.	122	P02812	PRB2_HUMAN	H	122	ENSP00000374013:P122H	ENSP00000374013:P122H	P	-	2	0	PRB2	11437914	0.886000	0.30341	0.032000	0.17829	0.090000	0.18270	1.340000	0.33896	0.688000	0.31529	0.186000	0.17326	CCC	-	PRB2	-	NULL		0.612	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	1	1	0	179	179	33	0.56	0.00	G	NM_006248		11546647	-1	31	7	147	26	tier1	no_errors	ENST00000389362	ensembl	human	known	74_37	missense	17.42	21.21	SNP	0.680	T	31	147
UHRF1BP1L	23074	genome.wustl.edu	37	12	100453644	100453644	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:100453644T>G	ENST00000279907.7	-	13	1939	c.1727A>C	c.(1726-1728)gAt>gCt	p.D576A	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.D226A	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	576										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						CATTAAGCCATCAACTCGAAC	0.303													ENSG00000111647																																					0													140.0	128.0	132.0					12																	100453644		2203	4300	6503	SO:0001583	missense	0			-		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1727A>C	12.37:g.100453644T>G	ENSP00000279907:p.Asp576Ala		A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	NULL	p.D576A	ENST00000279907.7	37	c.1727	CCDS31882.1	12	.	.	.	.	.	.	.	.	.	.	T	17.54	3.414833	0.62511	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.15834	2.47;2.39	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.43590	0.1254	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.42344	-0.9457	10	0.87932	D	0	-18.7149	15.5763	0.76392	0.0:0.0:0.0:1.0	.	576	A0JNW5	UH1BL_HUMAN	A	576;226	ENSP00000279907:D576A;ENSP00000444824:D226A	ENSP00000279907:D576A	D	-	2	0	UHRF1BP1L	98977775	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.040000	0.89188	2.091000	0.63221	0.477000	0.44152	GAT	-	UHRF1BP1L	-	NULL		0.303	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	0	0	0	41	41	121	0.00	0.00	T	NM_001006947		100453644	-1	122	272	360	773	tier1	no_errors	ENST00000279907	ensembl	human	known	74_37	missense	25.31	25.98	SNP	1.000	G	122	360
ATRX	546	genome.wustl.edu	37	X	76937963	76937963	+	Nonsense_Mutation	SNP	G	G	A	rs3088074	byFrequency	TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chrX:76937963G>A	ENST00000373344.5	-	9	2999	c.2785C>T	c.(2785-2787)Cag>Tag	p.Q929*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.Q891*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	929			Q -> E (in dbSNP:rs3088074). {ECO:0000269|Ref.4}.		ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GTAAAACTCTGCTCTTTCCCA	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											131.0	131.0	131.0					X																	76937963		2203	4296	6499	SO:0001587	stop_gained	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2785C>T	X.37:g.76937963G>A	ENSP00000362441:p.Gln929*		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q929*	ENST00000373344.5	37	c.2785	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	41	8.960934	0.99018	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.79	4.93	0.64822	.	0.479810	0.21799	N	0.068943	.	.	.	.	.	.	0.19300	N	0.999978	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-2.338	9.9408	0.41578	0.0:0.5498:0.3778:0.0724	.	.	.	.	X	929;891;856	.	ENSP00000362441:Q929X	Q	-	1	0	ATRX	76824619	0.004000	0.15560	0.426000	0.26672	0.158000	0.22134	0.278000	0.18753	0.607000	0.29982	-0.273000	0.10243	CAG	-	ATRX	-	NULL		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	22	22	50	0.00	0.00	G	NM_000489		76937963	-1	9	25	12	13	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	42.86	64.10	SNP	0.205	A	9	12
MUC17	140453	genome.wustl.edu	37	7	100678114	100678114	+	Silent	SNP	T	T	C			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr7:100678114T>C	ENST00000306151.4	+	3	3481	c.3417T>C	c.(3415-3417)agT>agC	p.S1139S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1139	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTGAAGCCAGTTCATCTCCTA	0.547													ENSG00000169876																																					0													381.0	337.0	352.0					7																	100678114		2203	4298	6501	SO:0001819	synonymous_variant	0			-	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3417T>C	7.37:g.100678114T>C			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S1139	ENST00000306151.4	37	c.3417	CCDS34711.1	7																																																																																			-	MUC17	-	NULL		0.547	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	0	0	0	95	95	36	0.00	0.00	T	NM_001040105		100678114	+1	24	9	87	40	tier1	no_errors	ENST00000306151	ensembl	human	known	74_37	silent	21.62	18.37	SNP	0.002	C	24	87
BMP1	649	genome.wustl.edu	37	8	22064428	22064428	+	Silent	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr8:22064428C>T	ENST00000306385.5	+	17	2965	c.2295C>T	c.(2293-2295)gaC>gaT	p.D765D	BMP1_ENST00000354870.5_3'UTR	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	765	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		ACTGGCCTGACAAGTATCCCA	0.622													ENSG00000168487																																					0													107.0	79.0	88.0					8																	22064428		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.2295C>T	8.37:g.22064428C>T			A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Silent	SNP	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,prints_Peptidase_M12A,pfscan_CUB_dom,pfscan_EG-like_dom	p.D765	ENST00000306385.5	37	c.2295	CCDS6026.1	8																																																																																			-	BMP1	-	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.622	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP1	HGNC	protein_coding	OTTHUMT00000214995.2	0	0	0	50	50	76	0.00	0.00	C	NM_006132		22064428	+1	10	14	39	34	tier1	no_errors	ENST00000306385	ensembl	human	known	74_37	silent	20.41	29.17	SNP	1.000	T	10	39
AEBP1	165	genome.wustl.edu	37	7	44153422	44153422	+	Silent	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr7:44153422C>T	ENST00000223357.3	+	21	3344	c.3039C>T	c.(3037-3039)ccC>ccT	p.P1013P	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Silent_p.P588P	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1013	Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CTATGACCCCCCAACAGCGAC	0.662													ENSG00000106624																																					0													97.0	101.0	100.0					7																	44153422		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3039C>T	7.37:g.44153422C>T			Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.P1013	ENST00000223357.3	37	c.3039	CCDS5476.1	7																																																																																			-	AEBP1	-	NULL		0.662	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	0	0	0	38	38	56	0.00	0.00	C	NM_001129		44153422	+1	44	19	46	33	tier1	no_errors	ENST00000223357	ensembl	human	known	74_37	silent	48.89	36.54	SNP	1.000	T	44	46
NWD1	284434	genome.wustl.edu	37	19	16860451	16860451	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr19:16860451A>G	ENST00000552788.1	+	4	998	c.998A>G	c.(997-999)cAg>cGg	p.Q333R	NWD1_ENST00000549814.1_Missense_Mutation_p.Q333R|NWD1_ENST00000523826.1_Missense_Mutation_p.Q127R|NWD1_ENST00000339803.6_Missense_Mutation_p.Q198R|NWD1_ENST00000379808.3_Missense_Mutation_p.Q333R|NWD1_ENST00000524140.2_Missense_Mutation_p.Q333R			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	333							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GACAGCAAGCAGCACACCCCC	0.617													ENSG00000188039																																					0													42.0	45.0	44.0					19																	16860451		2203	4300	6503	SO:0001583	missense	0			-	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.998A>G	19.37:g.16860451A>G	ENSP00000447224:p.Gln333Arg		C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q333R	ENST00000552788.1	37	c.998		19	.	.	.	.	.	.	.	.	.	.	N	1.233	-0.623550	0.03636	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41;-1.41	4.36	-0.68	0.11346	.	1.060050	0.07261	N	0.867436	T	0.57460	0.2055	N	0.08118	0	0.09310	N	1	B;B;B	0.23650	0.089;0.08;0.048	B;B;B	0.26416	0.051;0.069;0.031	T	0.46830	-0.9163	10	0.17832	T	0.49	-6.9271	2.6694	0.05063	0.3684:0.3374:0.0:0.2942	.	333;333;198	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	R	198;333;333;333;127;333;198	ENSP00000428579:Q333R;ENSP00000447548:Q333R;ENSP00000369136:Q333R;ENSP00000428955:Q127R;ENSP00000447224:Q333R;ENSP00000340159:Q198R	ENSP00000340159:Q198R	Q	+	2	0	NWD1	16721451	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.287000	0.18920	0.397000	0.25310	-0.924000	0.02725	CAG	-	NWD1	-	superfamily_P-loop_NTPase		0.617	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	0	0	0	34	34	40	0.00	0.00	A	NM_001007525		16860451	+1	5	8	23	25	tier1	no_errors	ENST00000379808	ensembl	human	known	74_37	missense	17.86	24.24	SNP	0.000	G	5	23
SMTN	6525	genome.wustl.edu	37	22	31486830	31486830	+	Missense_Mutation	SNP	C	C	T	rs372214262		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr22:31486830C>T	ENST00000347557.2	+	9	1120	c.902C>T	c.(901-903)tCg>tTg	p.S301L	SMTN_ENST00000404574.1_5'Flank|SMTN_ENST00000358743.1_Missense_Mutation_p.S301L|SMTN_ENST00000333137.7_Missense_Mutation_p.S301L	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	301					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CGCTCCCTGTCGGTGCTCAGC	0.627													ENSG00000183963																																					0													105.0	108.0	107.0					22																	31486830		2203	4300	6503	SO:0001583	missense	0			-	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.902C>T	22.37:g.31486830C>T	ENSP00000328635:p.Ser301Leu		O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	pfam_Smoothelin,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.S301L	ENST00000347557.2	37	c.902	CCDS13886.1	22	.	.	.	.	.	.	.	.	.	.	C	12.68	2.009397	0.35415	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	T;T;T	0.69306	0.03;-0.39;-0.39	4.2	3.18	0.36537	.	0.000000	0.33075	N	0.005305	T	0.67135	0.2861	L	0.29908	0.895	0.27124	N	0.962078	D;D;D;D;D;D	0.76494	0.997;0.999;0.999;0.997;0.998;0.999	P;D;D;P;D;D	0.72625	0.74;0.978;0.978;0.74;0.945;0.94	T	0.57177	-0.7856	10	0.72032	D	0.01	-6.559	5.791	0.18361	0.0:0.6942:0.1988:0.107	.	357;355;293;301;301;301	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	L	301;301;301;301;293	ENSP00000351593:S301L;ENSP00000328635:S301L;ENSP00000329532:S301L	ENSP00000329393:S301L	S	+	2	0	SMTN	29816830	0.002000	0.14202	0.055000	0.19348	0.193000	0.23685	0.438000	0.21559	1.118000	0.41863	0.555000	0.69702	TCG	-	SMTN	-	NULL		0.627	SMTN-001	KNOWN	basic|CCDS	protein_coding	SMTN	HGNC	protein_coding	OTTHUMT00000321766.1	0	0	0	61	61	39	0.00	0.00	C	NM_134270		31486830	+1	31	4	58	20	tier1	no_errors	ENST00000347557	ensembl	human	known	74_37	missense	34.83	16.67	SNP	0.369	T	31	58
UTP20	27340	genome.wustl.edu	37	12	101728256	101728256	+	Silent	SNP	G	G	A	rs138065795	byFrequency	TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:101728256G>A	ENST00000261637.4	+	29	3789	c.3615G>A	c.(3613-3615)ctG>ctA	p.L1205L		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1205					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TGCTGAAACTGATCAGTATCT	0.378													ENSG00000120800																																					0													92.0	81.0	85.0					12																	101728256		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3615G>A	12.37:g.101728256G>A			Q9H3H4	Silent	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.L1205	ENST00000261637.4	37	c.3615	CCDS9081.1	12																																																																																			-	UTP20	-	superfamily_ARM-type_fold		0.378	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	0	0	0	40	40	84	0.00	0.00	G	NM_014503		101728256	+1	112	158	70	139	tier1	no_errors	ENST00000261637	ensembl	human	known	74_37	silent	61.54	52.67	SNP	0.872	A	112	70
TMPRSS3	64699	genome.wustl.edu	37	21	43815481	43815481	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr21:43815481G>A	ENST00000291532.3	-	2	1001	c.46C>T	c.(46-48)Cga>Tga	p.R16*	TMPRSS3_ENST00000380399.1_Nonsense_Mutation_p.R100*|TMPRSS3_ENST00000433957.2_Nonsense_Mutation_p.R16*|TMPRSS3_ENST00000398405.1_Nonsense_Mutation_p.R16*|TMPRSS3_ENST00000398397.3_Nonsense_Mutation_p.R16*	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	16					cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						AAAAGCGATCGGAATGAGAAG	0.512													ENSG00000160183																																					0													116.0	100.0	106.0					21																	43815481		2203	4300	6503	SO:0001587	stop_gained	0			-	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.46C>T	21.37:g.43815481G>A	ENSP00000291532:p.Arg16*		D3DSJ6|Q5USC7|Q6ZMC3	Nonsense_Mutation	SNP	pfam_Peptidase_S1,pfam_SRCR,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_LDrepeatLR_classA_rpt,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R100*	ENST00000291532.3	37	c.298	CCDS13686.1	21	.	.	.	.	.	.	.	.	.	.	G	44	10.942258	0.99492	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	.	.	.	5.39	1.77	0.24775	.	0.132141	0.36628	N	0.002499	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2435	0.48982	0.0:0.0:0.3538:0.6462	.	.	.	.	X	16;16;16;100;16	.	.	R	-	1	2	TMPRSS3	42688550	0.994000	0.37717	0.979000	0.43373	0.964000	0.63967	0.348000	0.20031	0.613000	0.30089	0.655000	0.94253	CGA	-	TMPRSS3	-	NULL		0.512	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS3	HGNC	protein_coding	OTTHUMT00000195347.1	0	0	1	30	30	110	0.00	0.90	G			43815481	-1	13	21	45	90	tier1	no_errors	ENST00000380399	ensembl	human	known	74_37	nonsense	22.41	18.75	SNP	0.970	A	13	45
HNRNPA1	3178	genome.wustl.edu	37	12	54676401	54676401	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:54676401T>A	ENST00000340913.6	+	6	681	c.628T>A	c.(628-630)Ttc>Atc	p.F210I	HNRNPA1_ENST00000330752.8_Missense_Mutation_p.F210I|CBX5_ENST00000209875.4_5'Flank|HNRNPA1_ENST00000547276.1_Intron|HNRNPA1_ENST00000546500.1_Missense_Mutation_p.F210I|RP11-968A15.8_ENST00000553061.1_RNA	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	210	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TGGAGGTGGTTTCGGTGGGAA	0.428													ENSG00000135486																									Colon(83;502 1289 8436 16406 24870)												0													106.0	103.0	104.0					12																	54676401		2203	4297	6500	SO:0001583	missense	0			-	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.628T>A	12.37:g.54676401T>A	ENSP00000341826:p.Phe210Ile		A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F210I	ENST00000340913.6	37	c.628	CCDS44909.1	12	.	.	.	.	.	.	.	.	.	.	T	15.30	2.792494	0.50102	.	.	ENSG00000135486	ENST00000546500;ENST00000547617;ENST00000552494;ENST00000340913;ENST00000330752;ENST00000552591;ENST00000551133;ENST00000548688;ENST00000550482	D;D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19;-2.19	3.1	3.1	0.35709	.	.	.	.	.	T	0.80088	0.4559	L	0.49513	1.565	0.80722	D	1	B;B;B;B;B;B	0.32893	0.389;0.277;0.277;0.277;0.277;0.389	B;B;B;B;B;B	0.23574	0.021;0.047;0.047;0.047;0.047;0.036	T	0.77107	-0.2710	9	0.31617	T	0.26	.	9.9246	0.41485	0.0:0.0:0.0:1.0	.	188;210;210;210;210;210	Q9BSM5;F8VRQ1;F8W6I7;F8VSB5;P09651-2;P09651	.;.;.;.;.;ROA1_HUMAN	I	210;210;210;210;210;210;210;229;81	ENSP00000448617:F210I;ENSP00000341826:F210I;ENSP00000333504:F210I;ENSP00000447782:F229I;ENSP00000446486:F81I	ENSP00000333504:F210I	F	+	1	0	HNRNPA1	52962668	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	5.023000	0.64084	1.670000	0.50864	0.240000	0.17902	TTC	-	HNRNPA1	-	NULL		0.428	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	HNRNPA1	HGNC	protein_coding	OTTHUMT00000405480.1	0	0	0	48	48	23	0.00	0.00	T	NM_031157		54676401	+1	25	14	44	12	tier1	no_errors	ENST00000340913	ensembl	human	known	74_37	missense	36.23	53.85	SNP	1.000	A	25	44
OR2T12	127064	genome.wustl.edu	37	1	248457939	248457939	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr1:248457939A>C	ENST00000317996.1	-	1	941	c.942T>G	c.(940-942)aaT>aaG	p.N314K		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TGTGGGCCTCATTTTGCTGGT	0.418													ENSG00000177201																																					0													165.0	164.0	165.0					1																	248457939		2203	4300	6503	SO:0001583	missense	0			-	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.942T>G	1.37:g.248457939A>C	ENSP00000324583:p.Asn314Lys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N314K	ENST00000317996.1	37	c.942	CCDS31110.1	1	.	.	.	.	.	.	.	.	.	.	-	1.921	-0.448349	0.04572	.	.	ENSG00000177201	ENST00000317996	T	0.00594	6.33	1.25	-2.49	0.06403	.	.	.	.	.	T	0.00328	0.0010	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41502	-0.9505	9	0.05721	T	0.95	.	3.8553	0.08973	0.6256:0.2093:0.165:0.0	.	314	Q8NG77	O2T12_HUMAN	K	314	ENSP00000324583:N314K	ENSP00000324583:N314K	N	-	3	2	OR2T12	246524562	0.006000	0.16342	0.003000	0.11579	0.098000	0.18820	1.804000	0.38873	-0.313000	0.08728	-1.522000	0.00932	AAT	-	OR2T12	-	NULL		0.418	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T12	HGNC	protein_coding	OTTHUMT00000097353.1	0	0	0	75	75	36	0.00	0.00	A	NM_001004692		248457939	-1	38	20	60	19	tier1	no_errors	ENST00000317996	ensembl	human	known	74_37	missense	38.78	51.28	SNP	0.000	C	38	60
PNN	5411	genome.wustl.edu	37	14	39651863	39651863	+	3'UTR	SNP	A	A	C			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr14:39651863A>C	ENST00000216832.4	+	0	3017				PNN_ENST00000557680.1_3'UTR	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein						cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		GGGAGGTAGAAAAGTATCTTT	0.343													ENSG00000100941																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.*796A>C	14.37:g.39651863A>C			B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	R	SNP	-	NULL	ENST00000216832.4	37	NULL	CCDS9671.1	14																																																																																			-	PNN	-	-		0.343	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNN	HGNC	protein_coding	OTTHUMT00000276776.2	0	0	0	23	23	114	0.00	0.00	A	NM_002687		39651863	+1	13	42	11	75	tier1	no_errors	ENST00000557680	ensembl	human	known	74_37	rna	54.17	35.90	SNP	0.996	C	13	11
TMEM132D	121256	genome.wustl.edu	37	12	129558577	129558577	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:129558577G>T	ENST00000422113.2	-	9	3469	c.3143C>A	c.(3142-3144)aCc>aAc	p.T1048N	TMEM132D_ENST00000389441.4_Missense_Mutation_p.T586N	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	1048					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GGTGAAGGTGGTAAATTTTAC	0.502													ENSG00000151952																																					0													135.0	138.0	137.0					12																	129558577		2203	4300	6503	SO:0001583	missense	0			-	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.3143C>A	12.37:g.129558577G>T	ENSP00000408581:p.Thr1048Asn		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.T1048N	ENST00000422113.2	37	c.3143	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905965	0.52333	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.16196	2.36;3.19	4.16	3.24	0.37175	.	0.084351	0.49305	D	0.000146	T	0.44117	0.1278	M	0.86502	2.82	0.45567	D	0.998519	D;D	0.71674	0.97;0.998	P;D	0.66084	0.676;0.941	T	0.52275	-0.8597	9	.	.	.	-36.5755	13.8755	0.63651	0.0:0.1544:0.8456:0.0	.	1048;586	Q14C87;Q14C87-2	T132D_HUMAN;.	N	586;1048	ENSP00000374092:T586N;ENSP00000408581:T1048N	.	T	-	2	0	TMEM132D	128124530	1.000000	0.71417	0.004000	0.12327	0.325000	0.28411	6.384000	0.73177	0.819000	0.34492	0.563000	0.77884	ACC	-	TMEM132D	-	NULL		0.502	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	0	0	0	58	58	143	0.00	0.00	G	NM_133448		129558577	-1	34	44	32	51	tier1	no_errors	ENST00000422113	ensembl	human	known	74_37	missense	51.52	46.32	SNP	1.000	T	34	32
OR2M4	26245	genome.wustl.edu	37	1	248402501	248402501	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr1:248402501T>A	ENST00000306687.1	+	1	271	c.271T>A	c.(271-273)Tct>Act	p.S91T		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	91					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TGGGAAGAAATCTATCTCTCT	0.473													ENSG00000171180																																					0													161.0	141.0	148.0					1																	248402501		2203	4300	6503	SO:0001583	missense	0			-	X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.271T>A	1.37:g.248402501T>A	ENSP00000306688:p.Ser91Thr		Q15611|Q8NG82	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S91T	ENST00000306687.1	37	c.271	CCDS31108.1	1	.	.	.	.	.	.	.	.	.	.	t	2.522	-0.310571	0.05458	.	.	ENSG00000171180	ENST00000306687	T	0.00569	6.52	3.49	-2.85	0.05734	GPCR, rhodopsin-like superfamily (1);	0.935394	0.08790	N	0.893410	T	0.00271	0.0008	N	0.16016	0.355	0.09310	N	1	B	0.17268	0.021	B	0.16289	0.015	T	0.39418	-0.9615	10	0.15499	T	0.54	.	0.4756	0.00539	0.2388:0.1988:0.1348:0.4276	.	91	Q96R27	OR2M4_HUMAN	T	91	ENSP00000306688:S91T	ENSP00000306688:S91T	S	+	1	0	OR2M4	246469124	0.000000	0.05858	0.001000	0.08648	0.259000	0.26198	-0.146000	0.10250	-0.247000	0.09597	0.443000	0.29094	TCT	-	OR2M4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.473	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	HGNC	protein_coding	OTTHUMT00000097352.1	0	0	0	76	76	100	0.00	0.00	T	NM_017504		248402501	+1	45	33	56	43	tier1	no_errors	ENST00000306687	ensembl	human	known	74_37	missense	44.55	43.42	SNP	0.004	A	45	56
HSPD1	3329	genome.wustl.edu	37	2	198358123	198358123	+	Missense_Mutation	SNP	T	T	C	rs149003485		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr2:198358123T>C	ENST00000388968.3	-	7	1061	c.794A>G	c.(793-795)aAt>aGt	p.N265S	HSPD1_ENST00000345042.2_Missense_Mutation_p.N265S	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	265					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			ACGGTGAGCATTGGCAATTTC	0.393													ENSG00000144381																																					0								T	SER/ASN,SER/ASN	1,4405	2.1+/-5.4	0,1,2202	106.0	106.0	106.0		794,794	5.3	1.0	2	dbSNP_134	106	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	HSPD1	NM_002156.4,NM_199440.1	46,46	0,2,6501	CC,CT,TT		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	265/574,265/574	198358123	2,13004	2203	4300	6503	SO:0001583	missense	0			-	M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.794A>G	2.37:g.198358123T>C	ENSP00000373620:p.Asn265Ser		B2R5M6|B7Z712|Q38L19|Q9UCR6	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,superfamily_Cpn60/TCP-1,prints_Chaprnin_Cpn60,prints_Chaperone_TCP-1,tigrfam_Chaprnin_Cpn60	p.N265S	ENST00000388968.3	37	c.794	CCDS33357.1	2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106296	0.77096	2.27E-4	1.16E-4	ENSG00000144381	ENST00000388968;ENST00000345042;ENST00000536745	T;T	0.77620	-1.11;-1.11	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.78168	0.4241	L	0.41906	1.305	0.80722	D	1	P;P;P	0.45715	0.675;0.675;0.865	P;P;B	0.51516	0.672;0.555;0.279	T	0.76005	-0.3117	10	0.30078	T	0.28	-24.1621	15.5821	0.76452	0.0:0.0:0.0:1.0	.	256;265;265	B7Z597;B3GQS7;P10809	.;.;CH60_HUMAN	S	265;265;121	ENSP00000373620:N265S;ENSP00000340019:N265S	ENSP00000340019:N265S	N	-	2	0	HSPD1	198066368	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.941000	0.87700	2.139000	0.66308	0.477000	0.44152	AAT	rs149003485	HSPD1	-	pfam_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,superfamily_Cpn60/TCP-1,tigrfam_Chaprnin_Cpn60		0.393	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPD1	HGNC	protein_coding	OTTHUMT00000335324.2	0	0	0	30	30	21	0.00	0.00	T	NM_002156		198358123	-1	7	5	33	16	tier1	no_errors	ENST00000345042	ensembl	human	known	74_37	missense	17.50	23.81	SNP	1.000	C	7	33
RERE	473	genome.wustl.edu	37	1	8421513	8421513	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr1:8421513C>T	ENST00000337907.3	-	19	2688	c.2054G>A	c.(2053-2055)gGa>gAa	p.G685E	RERE_ENST00000377464.1_Missense_Mutation_p.G417E|RERE_ENST00000476556.1_Missense_Mutation_p.G131E|RERE_ENST00000400908.2_Missense_Mutation_p.G685E|RERE_ENST00000400907.2_Intron	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	685					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TGAACTCTCTCCCTCACCTTC	0.602													ENSG00000142599																																					0													112.0	101.0	105.0					1																	8421513		2195	4294	6489	SO:0001583	missense	0			-	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.2054G>A	1.37:g.8421513C>T	ENSP00000338629:p.Gly685Glu		O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.G685E	ENST00000337907.3	37	c.2054	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275205	0.80580	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T;T	0.05025	3.51;3.51;3.51;3.51	5.6	5.6	0.85130	.	.	.	.	.	T	0.21509	0.0518	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.08027	-1.0742	9	0.07990	T	0.79	-22.1638	18.5905	0.91210	0.0:1.0:0.0:0.0	.	417;685	B1AKN3;Q9P2R6	.;RERE_HUMAN	E	685;417;131;685	ENSP00000338629:G685E;ENSP00000366684:G417E;ENSP00000422246:G131E;ENSP00000383700:G685E	ENSP00000338629:G685E	G	-	2	0	RERE	8344100	1.000000	0.71417	0.980000	0.43619	0.691000	0.40173	5.842000	0.69417	2.653000	0.90120	0.561000	0.74099	GGA	-	RERE	-	pfam_Atrophin-like		0.602	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	0	0	0	28	28	80	0.00	0.00	C			8421513	-1	21	22	22	24	tier1	no_errors	ENST00000337907	ensembl	human	known	74_37	missense	48.84	47.83	SNP	1.000	T	21	22
STARD4	134429	genome.wustl.edu	37	5	110836598	110836598	+	Intron	SNP	T	T	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr5:110836598T>G	ENST00000296632.3	-	5	532				STARD4_ENST00000511569.1_5'UTR|STARD4_ENST00000509887.1_3'UTR|STARD4_ENST00000512160.1_Intron|STARD4_ENST00000502322.1_3'UTR	NM_139164.1	NP_631903.1	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain containing 4						lipid transport (GO:0006869)		lipid binding (GO:0008289)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	12		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)		GATTACAGAGTCAGAGTTGAA	0.313													ENSG00000164211																																					0																																										SO:0001627	intron_variant	0			-	AF480299	CCDS4104.1	5q22	2011-09-12	2007-08-16		ENSG00000164211	ENSG00000164211		"""StAR-related lipid transfer (START) domain containing"""	18058	protein-coding gene	gene with protein product		607049	"""START domain containing 4, sterol regulated"""			12011452	Standard	NM_139164		Approved		uc003kph.1	Q96DR4	OTTHUMG00000128793	ENST00000296632.3:c.397+101A>C	5.37:g.110836598T>G			Q86TN9	R	SNP	-	NULL	ENST00000296632.3	37	NULL	CCDS4104.1	5																																																																																			-	STARD4	-	-		0.313	STARD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD4	HGNC	protein_coding	OTTHUMT00000250720.1	0	0	0	14	14	88	0.00	0.00	T	NM_139164		110836598	-1	8	24	15	84	tier1	no_errors	ENST00000510346	ensembl	human	known	74_37	rna	34.78	22.22	SNP	0.000	G	8	15
UHRF1BP1L	23074	genome.wustl.edu	37	12	100451839	100451839	+	Silent	SNP	T	T	C			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:100451839T>C	ENST00000279907.7	-	14	3428	c.3216A>G	c.(3214-3216)ccA>ccG	p.P1072P	UHRF1BP1L_ENST00000545232.2_Silent_p.P722P	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1072										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GTGTTCTAACTGGGGGGGTCT	0.368													ENSG00000111647																																					0													69.0	75.0	73.0					12																	100451839		2201	4298	6499	SO:0001819	synonymous_variant	0			-		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3216A>G	12.37:g.100451839T>C			A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Silent	SNP	NULL	p.P1072	ENST00000279907.7	37	c.3216	CCDS31882.1	12																																																																																			-	UHRF1BP1L	-	NULL		0.368	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	0	0	0	27	27	93	0.00	0.00	T	NM_001006947		100451839	-1	107	71	55	168	tier1	no_errors	ENST00000279907	ensembl	human	known	74_37	silent	66.05	29.58	SNP	0.841	C	107	55
DNAI2	64446	genome.wustl.edu	37	17	72308191	72308191	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr17:72308191G>A	ENST00000311014.6	+	12	1611	c.1544G>A	c.(1543-1545)cGg>cAg	p.R515Q	RP11-647F2.2_ENST00000585167.1_RNA|DNAI2_ENST00000582036.1_Missense_Mutation_p.R503Q|DNAI2_ENST00000446837.2_Missense_Mutation_p.R515Q|DNAI2_ENST00000307504.5_Missense_Mutation_p.R372Q|DNAI2_ENST00000579490.1_Missense_Mutation_p.R572Q			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	515					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GCCAGGCACCGGGAGATGCGG	0.652									Kartagener syndrome				ENSG00000171595																																					0													54.0	49.0	51.0					17																	72308191		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1544G>A	17.37:g.72308191G>A	ENSP00000308312:p.Arg515Gln		C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.R515Q	ENST00000311014.6	37	c.1544	CCDS11697.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.261468	0.95368	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	T;T;T	0.34275	1.37;1.37;1.37	4.62	3.65	0.41850	.	0.111156	0.64402	D	0.000012	T	0.50718	0.1632	M	0.81682	2.555	0.54753	D	0.999983	D	0.61697	0.99	P	0.51657	0.676	T	0.58880	-0.7558	10	0.72032	D	0.01	-10.8387	12.4895	0.55891	0.0815:0.0:0.9185:0.0	.	515	Q9GZS0	DNAI2_HUMAN	Q	515;372;515	ENSP00000308312:R515Q;ENSP00000302929:R372Q;ENSP00000400252:R515Q	ENSP00000302929:R372Q	R	+	2	0	DNAI2	69819786	1.000000	0.71417	0.766000	0.31476	0.980000	0.70556	6.461000	0.73522	0.965000	0.38133	0.485000	0.47835	CGG	-	DI2	-	NULL		0.652	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DI2	HGNC	protein_coding	OTTHUMT00000442537.1	0	0	0	24	24	41	0.00	0.00	G	NM_023036		72308191	+1	7	4	24	26	tier1	no_errors	ENST00000311014	ensembl	human	known	74_37	missense	22.58	13.33	SNP	0.998	A	7	24
UTP20	27340	genome.wustl.edu	37	12	101715333	101715333	+	Silent	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:101715333G>A	ENST00000261637.4	+	25	3141	c.2967G>A	c.(2965-2967)gtG>gtA	p.V989V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	989					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AAGAGATAGTGCATTTTAGCA	0.368													ENSG00000120800																																					0													129.0	124.0	126.0					12																	101715333		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.2967G>A	12.37:g.101715333G>A			Q9H3H4	Silent	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.V989	ENST00000261637.4	37	c.2967	CCDS9081.1	12																																																																																			-	UTP20	-	pfam_DRIM,superfamily_ARM-type_fold		0.368	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	0	0	0	42	42	73	0.00	0.00	G	NM_014503		101715333	+1	165	214	105	156	tier1	no_errors	ENST00000261637	ensembl	human	known	74_37	silent	61.11	57.84	SNP	0.997	A	165	105
SULF1	23213	genome.wustl.edu	37	8	70533469	70533469	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr8:70533469G>A	ENST00000260128.4	+	14	2294	c.1577G>A	c.(1576-1578)aGa>aAa	p.R526K	SULF1_ENST00000458141.2_Missense_Mutation_p.R526K|SULF1_ENST00000402687.4_Missense_Mutation_p.R526K|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Missense_Mutation_p.R526K	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	526					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CAATTCTTGAGAAACCAGGGG	0.502													ENSG00000137573																																					0													50.0	52.0	51.0					8																	70533469		2203	4300	6503	SO:0001583	missense	0			-	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1577G>A	8.37:g.70533469G>A	ENSP00000260128:p.Arg526Lys		Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.R526K	ENST00000260128.4	37	c.1577	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	G	8.901	0.956427	0.18507	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.98747	-5.11;-5.11;-5.11;-5.11	5.75	5.75	0.90469	Alkaline-phosphatase-like, core domain (1);	0.155036	0.56097	D	0.000033	D	0.97046	0.9035	L	0.57536	1.79	0.32664	N	0.517703	B	0.17038	0.02	B	0.14023	0.01	D	0.93121	0.6525	10	0.05620	T	0.96	.	19.9417	0.97165	0.0:0.0:1.0:0.0	.	526	Q8IWU6	SULF1_HUMAN	K	526	ENSP00000403040:R526K;ENSP00000260128:R526K;ENSP00000385704:R526K;ENSP00000390315:R526K	ENSP00000260128:R526K	R	+	2	0	SULF1	70696023	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.241000	0.78201	2.720000	0.93068	0.655000	0.94253	AGA	-	SULF1	-	superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase		0.502	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	0	0	0	29	29	129	0.00	0.00	G	NM_015170		70533469	+1	6	20	18	84	tier1	no_errors	ENST00000260128	ensembl	human	known	74_37	missense	25.00	19.23	SNP	1.000	A	6	18
REV3L	5980	genome.wustl.edu	37	6	111688371	111688371	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr6:111688371C>G	ENST00000358835.3	-	15	7074	c.6620G>C	c.(6619-6621)aGa>aCa	p.R2207T	REV3L_ENST00000435970.1_Missense_Mutation_p.R2129T|REV3L_ENST00000368805.1_Missense_Mutation_p.R2207T|REV3L_ENST00000368802.3_Missense_Mutation_p.R2207T			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2207					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CAGAAGTTTTCTCTGTATGAT	0.403								DNA polymerases (catalytic subunits)					ENSG00000009413																																					0													98.0	97.0	97.0					6																	111688371		2203	4300	6503	SO:0001583	missense	0			-	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6620G>C	6.37:g.111688371C>G	ENSP00000351697:p.Arg2207Thr		O43214|Q5TC33	Missense_Mutation	SNP	pfam_D-dir_D_pol_B_multi_dom,pfam_D-dir_D_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_D-dir_D_pol_B,prints_D-dir_D_pol_B	p.R2207T	ENST00000358835.3	37	c.6620	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168248	0.57476	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.01629	4.82;4.82;4.82;4.72	5.46	3.69	0.42338	Ribonuclease H-like (1);	0.074533	0.64402	D	0.000013	T	0.00845	0.0028	L	0.51422	1.61	0.30096	N	0.807859	D	0.53312	0.959	B	0.43225	0.412	T	0.55192	-0.8179	10	0.29301	T	0.29	-6.533	7.8331	0.29355	0.1317:0.7289:0.0:0.1395	.	2207	O60673	DPOLZ_HUMAN	T	2207;2207;2207;2129;280	ENSP00000357792:R2207T;ENSP00000357795:R2207T;ENSP00000351697:R2207T;ENSP00000402003:R2129T	ENSP00000351697:R2207T	R	-	2	0	REV3L	111795064	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.260000	0.43267	0.790000	0.33803	0.655000	0.94253	AGA	-	REV3L	-	superfamily_RNaseH-like_dom		0.403	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	0	0	0	54	54	125	0.00	0.00	C	NM_002912		111688371	-1	437	692	85	167	tier1	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	83.56	80.28	SNP	1.000	G	437	85
SULF1	23213	genome.wustl.edu	37	8	70533412	70533412	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr8:70533412G>A	ENST00000260128.4	+	14	2237	c.1520G>A	c.(1519-1521)aGg>aAg	p.R507K	SULF1_ENST00000458141.2_Missense_Mutation_p.R507K|SULF1_ENST00000402687.4_Missense_Mutation_p.R507K|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Missense_Mutation_p.R507K	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	507					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TGCAGTTGTAGGGAGTCTGGT	0.532													ENSG00000137573																																					0													70.0	68.0	69.0					8																	70533412		2203	4300	6503	SO:0001583	missense	0			-	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.1520G>A	8.37:g.70533412G>A	ENSP00000260128:p.Arg507Lys		Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.R507K	ENST00000260128.4	37	c.1520	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	G	4.310	0.056760	0.08339	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08	5.85	2.84	0.33178	Alkaline-phosphatase-like, core domain (1);	0.289314	0.43110	D	0.000609	D	0.95758	0.8620	N	0.22421	0.69	0.09310	N	1	B	0.22003	0.063	B	0.30105	0.111	T	0.81621	-0.0850	10	0.06236	T	0.91	.	18.4808	0.90811	0.0:0.2558:0.7442:0.0	.	507	Q8IWU6	SULF1_HUMAN	K	507	ENSP00000403040:R507K;ENSP00000260128:R507K;ENSP00000385704:R507K;ENSP00000390315:R507K	ENSP00000260128:R507K	R	+	2	0	SULF1	70695966	0.956000	0.32656	0.002000	0.10522	0.300000	0.27592	1.832000	0.39151	0.787000	0.33731	0.655000	0.94253	AGG	-	SULF1	-	superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase		0.532	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	0	0	0	33	33	91	0.00	0.00	G	NM_015170		70533412	+1	7	16	26	75	tier1	no_errors	ENST00000260128	ensembl	human	known	74_37	missense	21.21	17.58	SNP	0.076	A	7	26
RNF213	57674	genome.wustl.edu	37	17	78268762	78268762	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr17:78268762A>T	ENST00000582970.1	+	9	1858	c.1715A>T	c.(1714-1716)cAg>cTg	p.Q572L	RNF213_ENST00000456466.1_Missense_Mutation_p.Q572L|RNF213_ENST00000319921.4_Missense_Mutation_p.Q572L|RNF213_ENST00000508628.2_Missense_Mutation_p.Q621L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	572					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TATGAAGGACAGGCACAGCTG	0.537													ENSG00000173821																																					0													74.0	75.0	74.0					17																	78268762		2203	4300	6503	SO:0001583	missense	0			-	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1715A>T	17.37:g.78268762A>T	ENSP00000464087:p.Gln572Leu		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.Q572L	ENST00000582970.1	37	c.1715	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	a	9.838	1.190219	0.21954	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	5.17	-4.11	0.03928	.	4.101390	0.00890	N	0.002229	T	0.25644	0.0624	N	0.08118	0	0.09310	N	1	B;B	0.29805	0.257;0.068	B;B	0.29077	0.098;0.048	T	0.27331	-1.0077	9	0.48119	T	0.1	0.2153	11.5064	0.50468	0.5535:0.0:0.4465:0.0	.	572;572	Q9HCF4;Q9HCF4-2	ALO17_HUMAN;.	L	572;621;572;572	.	ENSP00000324392:Q572L	Q	+	2	0	RNF213	75883357	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.440000	0.06888	-0.981000	0.03520	-0.477000	0.04895	CAG	-	RNF213	-	NULL		0.537	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	0	0	0	47	47	75	0.00	0.00	A	NM_020914		78268762	+1	10	10	39	58	tier1	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	20.41	14.71	SNP	0.000	T	10	39
MUC5AC	4586	genome.wustl.edu	37	11	1214194	1214194	+	3'UTR	SNP	T	T	C			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr11:1214194T>C	ENST00000358378.6	+	0	1178							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		CCAAATGCGGTTCCCCCCAGA	0.572													ENSG00000215182																																					0													11.0	10.0	10.0					11																	1214194		856	1976	2832	SO:0001624	3_prime_UTR_variant	0			-	AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*1175T>C	11.37:g.1214194T>C			O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	R	SNP	-	NULL	ENST00000358378.6	37	NULL		11																																																																																			-	MUC5AC	-	-		0.572	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	HGNC	protein_coding	OTTHUMT00000396096.2	0	0	0	46	46	166	0.00	0.00	T	XM_001130382		1214194	+1	18	45	19	40	tier1	no_errors	ENST00000358378	ensembl	human	putative	74_37	rna	48.65	52.94	SNP	0.016	C	18	19
DNAH14	127602	genome.wustl.edu	37	1	225539569	225539569	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr1:225539569delA	ENST00000445597.2	+	50	8829	c.8829delA	c.(8827-8829)acafs	p.T2943fs	DNAH14_ENST00000430092.1_Frame_Shift_Del_p.T3746fs|DNAH14_ENST00000439375.2_Frame_Shift_Del_p.T3746fs			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2943					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AGGAAAATACAAAACCACCAG	0.338													ENSG00000185842																																					0													83.0	71.0	75.0					1																	225539569		692	1591	2283	SO:0001589	frameshift_variant	0				U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8829delA	1.37:g.225539569delA	ENSP00000409472:p.Thr2943fs		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Frame_Shift_Del	DEL	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.K3747fs	ENST00000445597.2	37	c.11238		1																																																																																				DH14	-	pfam_Dynein_heavy_dom		0.338	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DH14	HGNC	protein_coding	OTTHUMT00000331217.3	0	0	0	11	11	164	0.00	0.00	A	XM_059166		225539569	+1	8	36	15	76	tier1	no_errors	ENST00000430092	ensembl	human	known	74_37	frame_shift_del	34.78	32.14	DEL	0.000	-	8	15
ZNF518A	9849	genome.wustl.edu	37	10	97923283	97923283	+	RNA	DEL	A	A	-			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr10:97923283delA	ENST00000534948.1	+	0	8059							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		GTTTTCAAAGAATTTATCTTG	0.274													ENSG00000177853																																					0																																												0				AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97923283delA			A0PJI5|O15044|Q32MP4	R	DEL	-	NULL	ENST00000534948.1	37	NULL		10																																																																																				ZNF518A	-	-		0.274	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	HGNC	processed_transcript		0	0	0	39	39	97	0.00	0.00	A	NM_014803		97923283	+1	18	26	33	56	tier1	no_errors	ENST00000534948	ensembl	human	known	74_37	rna	35.29	31.71	DEL	0.000	-	18	33
HCAR3	8843	genome.wustl.edu	37	12	123200742	123200742	+	Silent	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr12:123200742G>A	ENST00000528880.2	-	1	697	c.543C>T	c.(541-543)agC>agT	p.S181S	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	181					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	TATGGCAGATGCTGAAGCTGA	0.532													ENSG00000255398																																					0													87.0	87.0	87.0					12																	123200742		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.543C>T	12.37:g.123200742G>A			A8K4G5|B2R830|E9PI97|Q8NGE4	Silent	SNP	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S181	ENST00000528880.2	37	c.543	CCDS53842.1	12																																																																																			-	HCAR3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.532	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR3	HGNC	protein_coding	OTTHUMT00000387549.2	0	0	0	49	49	36	0.00	0.00	G	NM_006018		123200742	-1	27	13	13	5	tier1	no_errors	ENST00000528880	ensembl	human	known	74_37	silent	67.50	72.22	SNP	1.000	A	27	13
MAGI1	9223	genome.wustl.edu	37	3	65479204	65479204	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr3:65479204T>C	ENST00000497477.2	-	3	532	c.533A>G	c.(532-534)gAa>gGa	p.E178G	MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000330909.8_Missense_Mutation_p.E178G|MAGI1_ENST00000483466.1_Missense_Mutation_p.E178G|MAGI1_ENST00000402939.2_Missense_Mutation_p.E178G			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	178	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GGTGCCGACTTCCAGAAGAGT	0.498													ENSG00000151276																																					0													86.0	80.0	82.0					3																	65479204		2203	4300	6503	SO:0001583	missense	0			-	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.533A>G	3.37:g.65479204T>C	ENSP00000424369:p.Glu178Gly		A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.E178G	ENST00000497477.2	37	c.533		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.3|28.3	4.904646|4.904646	0.92035|0.92035	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477|ENST00000460329	T;T;T;T;T|.	0.71934|.	-0.61;-0.61;-0.61;-0.61;-0.61|.	5.9|5.9	5.9|5.9	0.94986|0.94986	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88880|0.88880	0.6557|0.6557	H|H	0.97806|0.97806	4.08|4.08	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.999;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	0.997;1.0;0.973;0.999;0.999;1.0|.	D|D	0.92912|0.92912	0.6348|0.6348	10|5	0.51188|.	T|.	0.08|.	-24.998|-24.998	16.307|16.307	0.82852|0.82852	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	178;178;178;178;178;178|.	Q96QZ7-6;Q96QZ7;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5|.	.;MAGI1_HUMAN;.;.;.;.|.	G|E	178;178;74;53;178;178|59	ENSP00000385450:E178G;ENSP00000331157:E178G;ENSP00000418177:E53G;ENSP00000420323:E178G;ENSP00000424369:E178G|.	ENSP00000331157:E178G|.	E|K	-|-	2|1	0|0	MAGI1|MAGI1	65454244|65454244	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	8.040000|8.040000	0.89188|0.89188	2.249000|2.249000	0.74217|0.74217	0.528000|0.528000	0.53228|0.53228	GAA|AAG	-	MAGI1	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like		0.498	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349132.2	0	0	0	51	51	96	0.00	0.00	T	NM_004742		65479204	-1	19	5	63	54	tier1	no_errors	ENST00000402939	ensembl	human	known	74_37	missense	23.17	8.47	SNP	1.000	C	19	63
HMMR	3161	genome.wustl.edu	37	5	162918134	162918134	+	Silent	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr5:162918134C>T	ENST00000358715.3	+	18	2175	c.2139C>T	c.(2137-2139)taC>taT	p.Y713Y	HMMR_ENST00000393915.4_Silent_p.Y714Y|HMMR_ENST00000432118.2_Silent_p.Y627Y|HMMR_ENST00000353866.3_Silent_p.Y698Y|RP11-80G7.1_ENST00000514724.2_RNA|RP11-80G7.1_ENST00000521666.1_RNA			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	713					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	CAAACTGTTACCGAGCTCCTA	0.318													ENSG00000072571																																					0													112.0	125.0	121.0					5																	162918134		2203	4298	6501	SO:0001819	synonymous_variant	0			-	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.2139C>T	5.37:g.162918134C>T			A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Silent	SNP	NULL	p.Y714	ENST00000358715.3	37	c.2142	CCDS4362.1	5																																																																																			-	HMMR	-	NULL		0.318	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HMMR	HGNC	protein_coding	OTTHUMT00000252752.1	0	0	0	61	61	118	0.00	0.00	C	NM_012484		162918134	+1	10	5	111	116	tier1	no_errors	ENST00000393915	ensembl	human	known	74_37	silent	8.26	4.13	SNP	0.032	T	10	111
REV3L	5980	genome.wustl.edu	37	6	111688530	111688530	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr6:111688530G>T	ENST00000358835.3	-	15	6915	c.6461C>A	c.(6460-6462)tCa>tAa	p.S2154*	REV3L_ENST00000435970.1_Nonsense_Mutation_p.S2076*|REV3L_ENST00000368805.1_Nonsense_Mutation_p.S2154*|REV3L_ENST00000368802.3_Nonsense_Mutation_p.S2154*			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2154					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AAAAGCCAATGAAGGCAGCTC	0.423								DNA polymerases (catalytic subunits)					ENSG00000009413																																					0													85.0	85.0	85.0					6																	111688530		2203	4300	6503	SO:0001587	stop_gained	0			-	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6461C>A	6.37:g.111688530G>T	ENSP00000351697:p.Ser2154*		O43214|Q5TC33	Nonsense_Mutation	SNP	pfam_D-dir_D_pol_B_multi_dom,pfam_D-dir_D_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_D-dir_D_pol_B,prints_D-dir_D_pol_B	p.S2154*	ENST00000358835.3	37	c.6461	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475756	0.44044	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	.	.	.	5.73	5.73	0.89815	.	0.742304	0.13085	N	0.415004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.9226	8.2469	0.31693	0.078:0.0:0.7258:0.1962	.	.	.	.	X	2154;2154;2154;2076;227	.	ENSP00000351697:S2154X	S	-	2	0	REV3L	111795223	0.986000	0.35501	0.134000	0.22075	0.278000	0.26855	2.529000	0.45632	2.854000	0.98071	0.655000	0.94253	TCA	-	REV3L	-	superfamily_RNaseH-like_dom		0.423	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	0	0	0	52	52	113	0.00	0.00	G	NM_002912		111688530	-1	12	14	83	145	tier1	no_errors	ENST00000358835	ensembl	human	known	74_37	nonsense	12.63	8.81	SNP	0.085	T	12	83
GPR56	9289	genome.wustl.edu	37	16	57691386	57691386	+	Silent	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr16:57691386C>T	ENST00000388812.4	+	10	1709	c.1269C>T	c.(1267-1269)gcC>gcT	p.A423A	GPR56_ENST00000562631.1_Silent_p.A423A|GPR56_ENST00000567835.1_Silent_p.A423A|GPR56_ENST00000562558.1_Silent_p.A423A|GPR56_ENST00000568909.1_Silent_p.A423A|GPR56_ENST00000456916.1_Silent_p.A423A|GPR56_ENST00000540164.2_Silent_p.A423A|GPR56_ENST00000568908.1_Silent_p.A423A|GPR56_ENST00000379696.3_Silent_p.A423A|GPR56_ENST00000538815.1_Silent_p.A423A|GPR56_ENST00000379694.4_Silent_p.A253A|GPR56_ENST00000544297.1_Silent_p.A248A|GPR56_ENST00000388813.5_Silent_p.A423A			Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56	423					angiogenesis (GO:0001525)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cerebral cortex radial glia guided migration (GO:0021801)|G-protein coupled receptor signaling pathway (GO:0007186)|layer formation in cerebral cortex (GO:0021819)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell adhesion (GO:0045785)|positive regulation of Rho protein signal transduction (GO:0035025)|protein kinase C signaling (GO:0070528)|Rho protein signal transduction (GO:0007266)|vascular endothelial growth factor production (GO:0010573)	extracellular vesicular exosome (GO:0070062)|glial limiting end-foot (GO:0097451)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	15						TCACCATTGCCGCCTACCTCT	0.647													ENSG00000205336																																					0													155.0	139.0	144.0					16																	57691386		2198	4300	6498	SO:0001819	synonymous_variant	0			-	AJ011001	CCDS32460.1, CCDS32461.1, CCDS73893.1	16q13	2014-08-08				ENSG00000205336		"""-"", ""GPCR / Class B : Orphans"""	4512	protein-coding gene	gene with protein product		604110				10049584, 10100861	Standard	XM_005256237		Approved	TM7LN4, TM7XN1	uc002emb.2	Q9Y653		ENST00000388812.4:c.1269C>T	16.37:g.57691386C>T			A6NIT7|A6NJV9|B0M0K4|B4DR54|O95966|Q6ZMP1|Q8NGB3|Q96HB4	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_orphan_rcpt_GPR56,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.A423	ENST00000388812.4	37	c.1269	CCDS32460.1	16																																																																																			-	GPR56	-	pfam_GPCR_2_secretin-like,prints_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.647	GPR56-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR56	HGNC	protein_coding	OTTHUMT00000433436.3	0	0	0	79	79	69	0.00	0.00	C			57691386	+1	25	6	156	65	tier1	no_errors	ENST00000379696	ensembl	human	known	74_37	silent	13.81	8.45	SNP	0.951	T	25	156
SERPINA11	256394	genome.wustl.edu	37	14	94909524	94909524	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr14:94909524C>T	ENST00000334708.3	-	4	1020	c.956G>A	c.(955-957)gGa>gAa	p.G319E	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	319					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		GTTATATGTTCCAGAAATTGA	0.443													ENSG00000186910																																					0													91.0	88.0	89.0					14																	94909524		2203	4300	6503	SO:0001583	missense	0			-	BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.956G>A	14.37:g.94909524C>T	ENSP00000335024:p.Gly319Glu		B2RV07	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.G319E	ENST00000334708.3	37	c.956	CCDS32149.1	14	.	.	.	.	.	.	.	.	.	.	C	9.375	1.071626	0.20147	.	.	ENSG00000186910	ENST00000334708	D	0.83163	-1.69	6.04	0.512	0.16994	Serpin domain (3);	0.360393	0.22871	N	0.054634	T	0.71863	0.3390	L	0.31926	0.97	0.09310	N	0.999999	P	0.35982	0.531	B	0.39935	0.314	T	0.59616	-0.7421	10	0.21014	T	0.42	.	8.1166	0.30946	0.1103:0.379:0.4474:0.0633	.	319	Q86U17	SPA11_HUMAN	E	319	ENSP00000335024:G319E	ENSP00000335024:G319E	G	-	2	0	SERPINA11	93979277	0.348000	0.24861	0.006000	0.13384	0.114000	0.19823	0.883000	0.28200	0.379000	0.24794	0.563000	0.77884	GGA	-	SERPI11	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.443	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPI11	HGNC	protein_coding	OTTHUMT00000413091.1	0	0	0	68	68	149	0.00	0.00	C	NM_001080451		94909524	-1	11	4	39	50	tier1	no_errors	ENST00000334708	ensembl	human	known	74_37	missense	22.00	7.41	SNP	0.034	T	11	39
SERPINA11	256394	genome.wustl.edu	37	14	94909527	94909527	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr14:94909527G>A	ENST00000334708.3	-	4	1017	c.953C>T	c.(952-954)tCt>tTt	p.S318F	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	318					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		ATATGTTCCAGAAATTGAAAA	0.438													ENSG00000186910																																					0													86.0	84.0	85.0					14																	94909527		2203	4300	6503	SO:0001583	missense	0			-	BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.953C>T	14.37:g.94909527G>A	ENSP00000335024:p.Ser318Phe		B2RV07	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S318F	ENST00000334708.3	37	c.953	CCDS32149.1	14	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055481	0.36277	.	.	ENSG00000186910	ENST00000334708	D	0.89196	-2.48	6.04	5.14	0.70334	Serpin domain (3);	0.474610	0.19928	N	0.102934	D	0.95274	0.8467	H	0.94847	3.59	0.27043	N	0.963957	D	0.71674	0.998	D	0.74674	0.984	D	0.90200	0.4256	10	0.87932	D	0	.	8.5153	0.33242	0.0685:0.0:0.6536:0.2779	.	318	Q86U17	SPA11_HUMAN	F	318	ENSP00000335024:S318F	ENSP00000335024:S318F	S	-	2	0	SERPINA11	93979280	1.000000	0.71417	0.030000	0.17652	0.117000	0.20001	3.534000	0.53568	1.531000	0.49152	0.563000	0.77884	TCT	-	SERPI11	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.438	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPI11	HGNC	protein_coding	OTTHUMT00000413091.1	0	0	1	66	66	148	0.00	0.67	G	NM_001080451		94909527	-1	8	4	35	49	tier1	no_errors	ENST00000334708	ensembl	human	known	74_37	missense	18.60	7.55	SNP	0.710	A	8	35
FAT1	2195	genome.wustl.edu	37	4	187629538	187629538	+	Missense_Mutation	SNP	C	C	A	rs3733413	byFrequency	TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr4:187629538C>A	ENST00000441802.2	-	2	1653	c.1444G>T	c.(1444-1446)Gtc>Ttc	p.V482F		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	482	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.			V -> I (in Ref. 1; CAA60685). {ECO:0000305}.	actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGGCTCATGACAGTAGTACCA	0.468										HNSCC(5;0.00058)			ENSG00000083857																									Colon(197;1040 2055 4143 4984 49344)												0													153.0	147.0	149.0					4																	187629538		2042	4182	6224	SO:0001583	missense	0			-	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1444G>T	4.37:g.187629538C>A	ENSP00000406229:p.Val482Phe			Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.V482F	ENST00000441802.2	37	c.1444	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	13.52	2.260970	0.39995	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509647	T;T	0.62364	0.27;0.03	5.45	2.77	0.32553	Cadherin (4);Cadherin-like (1);	0.114202	0.64402	D	0.000016	T	0.79482	0.4453	M	0.89658	3.05	0.09310	P	0.9999999874831	D	0.59767	0.986	D	0.66351	0.943	D	0.85914	0.1442	9	0.62326	D	0.03	.	11.1193	0.48279	0.0:0.7968:0.0:0.2032	.	482	Q14517	FAT1_HUMAN	F	482	ENSP00000406229:V482F;ENSP00000423736:V482F	ENSP00000260147:V482F	V	-	1	0	FAT1	187866532	0.998000	0.40836	0.329000	0.25429	0.320000	0.28249	3.947000	0.56652	0.872000	0.35775	-0.258000	0.10820	GTC	-	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.468	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	0	0	0	12	12	57	0.00	0.00	C	NM_005245		187629538	-1	6	33	3	16	tier1	no_errors	ENST00000441802	ensembl	human	known	74_37	missense	31.58	34.38	SNP	0.970	A	6	3
ACADVL	37	genome.wustl.edu	37	17	7123240	7123241	+	5'UTR	INS	-	-	GGGCGTGCAGGACGC	rs77051465|rs550196368|rs3835013|rs6145976|rs139223575|rs421019	byFrequency	TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr17:7123240_7123241insGGGCGTGCAGGACGC	ENST00000356839.5	+	0	116_117				DLG4_ENST00000485100.1_5'Flank|ACADVL_ENST00000350303.5_5'UTR|DLG4_ENST00000399506.2_5'Flank|DLG4_ENST00000399510.2_5'Flank|ACADVL_ENST00000543245.2_Intron|DLG4_ENST00000302955.6_5'Flank	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						CGCCAGGACGTGGGCGTGCAGG	0.713													ENSG00000072778		2343	0.467851	0.2988	0.4769	5008	,	,		14818	0.4712		0.5736	False		,,,				2504	0.5777																0									,,	1193,2759		290,613,1073					,,	-1.0	0.0		dbSNP_130	8	4084,3646		1352,1380,1133	no	utr-5,utr-5,utr-5	ACADVL,DLG4	NM_001365.3,NM_001033859.1,NM_000018.2	,,	1642,1993,2206	A1A1,A1R,RR		47.1669,30.1872,45.1721	,,	,,		5277,6405				SO:0001623	5_prime_UTR_variant	0				BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.-63->GGGCGTGCAGGACGC	17.37:g.7123240_7123241insGGGCGTGCAGGACGC			B4DEB6|F5H2A9|O76056|Q8WUL0	R	INS	-	NULL	ENST00000356839.5	37	NULL	CCDS11090.1	17																																																																																				ACADVL	-	-		0.713	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	HGNC	protein_coding	OTTHUMT00000220001.5	0	0	0	5	5	5	0.00	0.00	-	NM_000018		7123241	+1	1	1	8	8	tier1	no_errors	ENST00000577857	ensembl	human	known	74_37	rna	11.11	11.11	INS	0.000:0.000	GGGCGTGCAGGACGC	1	8
PRKRIR	5612	genome.wustl.edu	37	11	76062929	76062929	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr11:76062929A>G	ENST00000260045.3	-	5	1370	c.1265T>C	c.(1264-1266)aTc>aCc	p.I422T	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	422					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						AGAATGGCAGATTTCCTTCAG	0.373													ENSG00000137492																																					0													28.0	30.0	30.0					11																	76062929		2189	4275	6464	SO:0001583	missense	0			-	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1265T>C	11.37:g.76062929A>G	ENSP00000260045:p.Ile422Thr		A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	pfam_Znf_C2CH,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_Znf_C2CH,pfscan_Znf_C2CH	p.I422T	ENST00000260045.3	37	c.1265	CCDS8243.1	11	.	.	.	.	.	.	.	.	.	.	A	3.800	-0.041815	0.07452	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	T;T	0.23147	1.92;1.92	4.99	4.99	0.66335	Ribonuclease H-like (1);	0.337329	0.37715	N	0.001968	T	0.17619	0.0423	N	0.19112	0.55	0.39328	D	0.965365	B	0.17465	0.022	B	0.11329	0.006	T	0.07328	-1.0778	10	0.21540	T	0.41	.	15.1171	0.72410	1.0:0.0:0.0:0.0	.	422	O43422	P52K_HUMAN	T	247;422	ENSP00000436249:I247T;ENSP00000260045:I422T	ENSP00000260045:I422T	I	-	2	0	PRKRIR	75740577	0.608000	0.26966	1.000000	0.80357	0.993000	0.82548	2.926000	0.48892	2.043000	0.60533	0.524000	0.50904	ATC	-	PRKRIR	-	superfamily_RNaseH-like_dom		0.373	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRIR	HGNC	protein_coding	OTTHUMT00000383188.1	0	0	0	35	35	5	0.00	0.00	A	NM_004705		76062929	-1	9	1	27	3	tier1	no_errors	ENST00000260045	ensembl	human	known	74_37	missense	25.00	25.00	SNP	0.993	G	9	27
PTMA	5757	genome.wustl.edu	37	2	232577616	232577616	+	3'UTR	SNP	A	A	G			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr2:232577616A>G	ENST00000341369.7	+	0	582				PTMA_ENST00000409115.3_3'UTR|PTMA_ENST00000409321.1_3'UTR|PTMA_ENST00000466801.1_3'UTR|PTMA_ENST00000409683.1_3'UTR	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha						transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TGACCTATTCACCCTCCACTT	0.527													ENSG00000187514																																					0													7.0	9.0	9.0					2																	232577616		687	1587	2274	SO:0001624	3_prime_UTR_variant	0			-		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.*55A>G	2.37:g.232577616A>G			Q15249|Q15592	R	SNP	-	NULL	ENST00000341369.7	37	NULL	CCDS42833.1	2																																																																																			-	PTMA	-	-		0.527	PTMA-002	KNOWN	basic|CCDS	protein_coding	PTMA	HGNC	protein_coding	OTTHUMT00000332553.1	0	0	0	17	17	6	0.00	0.00	A			232577616	+1	5	1	10	7	tier1	no_errors	ENST00000466801	ensembl	human	known	74_37	rna	31.25	12.50	SNP	1.000	G	5	10
AMZ1	155185	genome.wustl.edu	37	7	2740235	2740235	+	Silent	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr7:2740235G>A	ENST00000312371.4	+	2	518	c.150G>A	c.(148-150)ccG>ccA	p.P50P	AMZ1_ENST00000407112.1_Silent_p.P50P	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	50							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CCTACAACCCGCAGAGGACGC	0.662													ENSG00000174945																																					0													111.0	119.0	116.0					7																	2740235		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.150G>A	7.37:g.2740235G>A			B3KRS0|Q8TF51	Silent	SNP	pfam_Pept_M54_archaemetzincn	p.P50	ENST00000312371.4	37	c.150	CCDS34589.1	7																																																																																			-	AMZ1	-	NULL		0.662	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	HGNC	protein_coding	OTTHUMT00000325244.1	0	0	0	51	51	3	0.00	0.00	G	NM_133463		2740235	+1	15	0	46	4	tier1	no_errors	ENST00000312371	ensembl	human	known	74_37	silent	24.59	0.00	SNP	0.019	A	15	46
CT47B1	643311	genome.wustl.edu	37	X	120009417	120009417	+	Silent	SNP	G	G	A			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chrX:120009417G>A	ENST00000371311.3	-	1	362	c.108C>T	c.(106-108)ggC>ggT	p.G36G		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	36										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GGCCGGAGTCGCCGCCCTCCT	0.736													ENSG00000236446																																					0													3.0	4.0	4.0					X																	120009417		563	1379	1942	SO:0001819	synonymous_variant	0			-		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.108C>T	X.37:g.120009417G>A			A6NM97	Silent	SNP	NULL	p.G36	ENST00000371311.3	37	c.108	CCDS48161.1	X																																																																																			-	CT47B1	-	NULL		0.736	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CT47B1	HGNC	protein_coding	OTTHUMT00000058121.1	0	0	0	34	34	0	0.00	0.00	G	NM_001145718		120009417	-1	49	0	11	0	tier1	no_errors	ENST00000371311	ensembl	human	known	74_37	silent	81.67	0.00	SNP	0.000	A	49	11
LINC00273	649159	genome.wustl.edu	37	16	33961400	33961400	+	lincRNA	SNP	G	G	T	rs113037697		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr16:33961400G>T	ENST00000539813.1	-	0	1103				AC136932.1_ENST00000385251.1_RNA	NR_038368.1				long intergenic non-protein coding RNA 273											lung(1)	1						GACCCGCTCCGCTGCGAGCCG	0.746													ENSG00000256642																																					0																																												0			-	AY587847		16p11.2	2013-06-03	2011-08-11	2011-08-11	ENSG00000256642	ENSG00000256642		"""Long non-coding RNAs"""	38595	other	unknown	"""non-protein coding RNA 273-1"""		"""non-protein coding RNA 273"""	NCRNA00273			Standard	NR_038368		Approved	TOP, NCRNA00273-1	uc021thl.1		OTTHUMG00000176379		16.37:g.33961400G>T				R	SNP	-	NULL	ENST00000539813.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	N	0.883	-0.728117	0.03135	.	.	ENSG00000256642	ENST00000539813	.	.	.	.	.	.	.	.	.	.	.	T	0.17619	0.0423	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.19484	-1.0304	2	.	.	.	.	.	.	.	.	.	.	.	R	347	.	.	S	-	3	2	AC136932.2	33868901	0.001000	0.12720	0.003000	0.11579	0.003000	0.03518	-1.633000	0.02022	-1.729000	0.01364	-1.721000	0.00707	AGC	rs113037697	LINC00273	-	-		0.746	LINC00273-001	KNOWN	basic	lincRNA	LINC00273	HGNC	lincRNA	OTTHUMT00000431840.1	0	0	0	17	17	0	0.00	0.00	G	NR_038368		33961400	-1	8	1	16	2	tier1	no_errors	ENST00000539813	ensembl	human	known	74_37	rna	33.33	33.33	SNP	0.003	T	8	16
POTEB2	100287399	genome.wustl.edu	37	15	21071460	21071460	+	Missense_Mutation	SNP	C	C	T	rs546964009	byFrequency	TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr15:21071460C>T	ENST00000454856.4	-	1	183	c.151G>A	c.(151-153)Gac>Aac	p.D51N		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	51																	ATAAAGGAGTCGTCATGGTCT	0.597													ENSG00000230031	C|||	2123	0.423922	0.4236	0.3804	5008	,	,		19650	0.4633		0.4155	False		,,,				2504	0.4233																0													1.0	1.0	1.0					15																	21071460		36	159	195	SO:0001583	missense	0			-		CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.151G>A	15.37:g.21071460C>T	ENSP00000456953:p.Asp51Asn			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D51N	ENST00000454856.4	37	c.151	CCDS59248.1	15																																																																																			-	POTEB2	-	NULL		0.597	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB2	HGNC	protein_coding	OTTHUMT00000471435.1	0	0	0	9	9	3	0.00	0.00	C			21071460	-1	4	0	7	3	tier1	no_errors	ENST00000454856	ensembl	human	known	74_37	missense	36.36	0.00	SNP	0.034	T	4	7
NPIPB5	100132247	genome.wustl.edu	37	16	22503208	22503208	+	Intron	SNP	A	A	T			TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr16:22503208A>T	ENST00000415654.1	+	15	2061				SMG1P1_ENST00000431681.1_RNA	NR_002555.2		A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5							integral component of membrane (GO:0016021)											TTTTttttttaaattttgctt	0.299													ENSG00000237296																																					0																																										SO:0001627	intron_variant	0			-		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000415654.1:c.2061+61A>T	16.37:g.22503208A>T			B4DK13	R	SNP	-	NULL	ENST00000415654.1	37	NULL		16																																																																																			-	SMG1P1	-	-		0.299	NPIPB5-016	KNOWN	mRNA_end_NF|basic	processed_transcript	SMG1P1	HGNC	protein_coding	OTTHUMT00000402477.1	0	0	0	65	65	0	0.00	0.00	A	NM_001135865		22503208	+1	7	0	75	0	tier1	no_errors	ENST00000431681	ensembl	human	known	74_37	rna	8.33	0.00	SNP	0.087	T	7	75
TRAF3IP2-AS1	643749	genome.wustl.edu	37	6	111812290	111812291	+	RNA	INS	-	-	TGCGAAATT	rs71021845|rs72259911	byFrequency	TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr6:111812290_111812291insTGCGAAATT	ENST00000532226.1	+	0	275_276				TRAF3IP2-AS1_ENST00000456352.2_RNA|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2-AS1_ENST00000440395.1_RNA|TRAF3IP2-AS1_ENST00000420651.2_RNA|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2-AS1_ENST00000449449.2_RNA|TRAF3IP2-AS1_ENST00000440001.2_RNA|TRAF3IP2-AS1_ENST00000525151.1_RNA|TRAF3IP2-AS1_ENST00000438298.2_RNA					TRAF3IP2 antisense RNA 1																		tatgagccaccatgccctgcGA	0.525													ENSG00000231889		217	0.0433307	0.0492	0.0663	5008	,	,		13683	0.0		0.0656	False		,,,				2504	0.0409																0																																												0						6q21	2012-10-12	2012-08-15		ENSG00000231889	ENSG00000231889		"""Long non-coding RNAs"""	40005	non-coding RNA	RNA, long non-coding			"""TRAF3IP2 antisense RNA 2 (non-protein coding)"", ""chromosome 6 open reading frame 3"", ""non-protein coding RNA 248"", ""TRAF3IP2 antisense RNA 1 (non-protein coding)"""	TRAF3IP2-AS2, C6orf3, NCRNA00248			Standard	NR_034108		Approved	C6UAS	uc021zdt.1		OTTHUMG00000015378		6.37:g.111812290_111812291insTGCGAAATT				R	INS	-	NULL	ENST00000532226.1	37	NULL		6																																																																																				TRAF3IP2-AS1	-	-		0.525	TRAF3IP2-AS1-007	KNOWN	basic	antisense	TRAF3IP2-AS1	HGNC	antisense	OTTHUMT00000382628.1	0	0	0	0	0	0	0.00	0.00	-	NR_034108		111812291	+1	0	0	0	0	tier1	no_errors	ENST00000532226	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.045:0.046	TGCGAAATT	0	0
TOX2	84969	genome.wustl.edu	37	20	42694484	42694484	+	Missense_Mutation	SNP	C	C	T	rs142650311		TCGA-DX-A23Y-01A-11D-A27P-09	TCGA-DX-A23Y-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4936d96-0bcc-45f5-8c25-88095c8c18cc	21bc6cb1-b5ea-4cc1-9c9e-4f9885cee5d0	g.chr20:42694484C>T	ENST00000358131.5	+	6	1247	c.1039C>T	c.(1039-1041)Cgc>Tgc	p.R347C	TOX2_ENST00000423191.2_Missense_Mutation_p.R323C|TOX2_ENST00000372999.1_Missense_Mutation_p.R323C|TOX2_ENST00000341197.4_Missense_Mutation_p.R365C|TOX2_ENST00000435864.2_3'UTR	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	347					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			GCAGGCCTTCCGCAGTGGGGC	0.692													ENSG00000124191	C|||	1	0.000199681	0.0	0.0	5008	,	,		12073	0.0		0.0	False		,,,				2504	0.001																0								C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	8,4398	12.9+/-30.5	0,8,2195	55.0	59.0	58.0		967,1093,1039,967	4.2	1.0	20	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense,missense	TOX2	NM_001098796.1,NM_001098797.1,NM_001098798.1,NM_032883.2	180,180,180,180	0,9,6494	TT,TC,CC		0.0116,0.1816,0.0692	probably-damaging,probably-damaging,probably-damaging,probably-damaging	323/465,365/507,347/489,323/465	42694484	9,12997	2203	4300	6503	SO:0001583	missense	0			-	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1039C>T	20.37:g.42694484C>T	ENSP00000350849:p.Arg347Cys		A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R365C	ENST00000358131.5	37	c.1093	CCDS42875.1	20	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900546	0.72754	0.001816	1.16E-4	ENSG00000124191	ENST00000341197;ENST00000423191;ENST00000372999;ENST00000358131;ENST00000435864	T;T;T;T;T	0.17213	2.69;2.7;2.7;2.29;2.46	5.11	4.17	0.49024	.	0.426017	0.27518	N	0.019018	T	0.33118	0.0852	L	0.48642	1.525	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.99;0.997;0.993;0.993	T	0.02512	-1.1148	10	0.51188	T	0.08	.	12.1878	0.54250	0.0:0.9163:0.0:0.0837	.	243;365;347;323	B4DQV8;G3XAC7;Q96NM4;E1P5X0	.;.;TOX2_HUMAN;.	C	365;323;323;347;243	ENSP00000344724:R365C;ENSP00000390278:R323C;ENSP00000362090:R323C;ENSP00000350849:R347C;ENSP00000396777:R243C	ENSP00000344724:R365C	R	+	1	0	TOX2	42127898	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	4.547000	0.60712	1.273000	0.44346	0.655000	0.94253	CGC	rs142650311	TOX2	-	NULL		0.692	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2	0	0	0	42	42	2	0.00	0.00	C			42694484	+1	19	2	37	0	tier1	no_errors	ENST00000341197	ensembl	human	known	74_37	missense	33.93	100.00	SNP	1.000	T	19	37
