#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PPP1R1A	5502	genome.wustl.edu	37	12	54975830	54975830	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:54975830C>G	ENST00000257905.8	-	5	503	c.333G>C	c.(331-333)caG>caC	p.Q111H	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	111					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						GGCGGGACTCCTGGGTTTCTG	0.602													ENSG00000135447																																					0													68.0	70.0	69.0					12																	54975830		1917	4115	6032	SO:0001583	missense	0			-	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.333G>C	12.37:g.54975830C>G	ENSP00000257905:p.Gln111His		Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	pfam_PPI_1DARPP-32	p.Q111H	ENST00000257905.8	37	c.333	CCDS44912.1	12	.	.	.	.	.	.	.	.	.	.	C	16.74	3.208158	0.58343	.	.	ENSG00000135447	ENST00000257905	T	0.33216	1.42	5.28	4.39	0.52855	.	0.460512	0.19916	N	0.103199	T	0.43656	0.1257	L	0.55481	1.735	0.29944	N	0.820818	P	0.42123	0.771	P	0.57152	0.814	T	0.34900	-0.9810	10	0.32370	T	0.25	.	10.051	0.42216	0.0:0.9066:0.0:0.0934	.	111	Q13522	PPR1A_HUMAN	H	111	ENSP00000257905:Q111H	ENSP00000257905:Q111H	Q	-	3	2	PPP1R1A	53262097	0.991000	0.36638	1.000000	0.80357	0.633000	0.38033	0.290000	0.18975	1.366000	0.46076	0.655000	0.94253	CAG	-	PPP1R1A	-	pfam_PPI_1DARPP-32		0.602	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	HGNC	protein_coding	OTTHUMT00000406604.1	0	0	0	40	40	43	0.00	0.00	C	NM_006741		54975830	-1	255	269	40	50	tier1	no_errors	ENST00000257905	ensembl	human	known	74_37	missense	86.44	84.33	SNP	1.000	G	255	40
EDEM3	80267	genome.wustl.edu	37	1	184680917	184680917	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr1:184680917C>A	ENST00000318130.8	-	15	1897	c.1631G>T	c.(1630-1632)aGt>aTt	p.S544I	EDEM3_ENST00000367512.3_Missense_Mutation_p.S501I|EDEM3_ENST00000466392.1_5'Flank	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	544					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTCACGAATACTTTGAGCATA	0.373													ENSG00000116406																																					0													104.0	98.0	100.0					1																	184680917		2203	4300	6503	SO:0001583	missense	0			-	AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.1631G>T	1.37:g.184680917C>A	ENSP00000318147:p.Ser544Ile		B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,pfam_Protease-assoc_domain,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.S544I	ENST00000318130.8	37	c.1631	CCDS1363.2	1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823039	0.50739	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.72942	-0.7;-0.68	5.87	5.87	0.94306	.	0.091756	0.85682	D	0.000000	T	0.56187	0.1968	N	0.24115	0.695	0.46849	D	0.999227	B	0.17465	0.022	B	0.18561	0.022	T	0.50651	-0.8803	9	.	.	.	.	13.4064	0.60915	0.0:0.9285:0.0:0.0715	.	544	Q9BZQ6	EDEM3_HUMAN	I	544;501	ENSP00000318147:S544I;ENSP00000356482:S501I	.	S	-	2	0	EDEM3	182947540	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.298000	0.43602	2.779000	0.95612	0.655000	0.94253	AGT	-	EDEM3	-	NULL		0.373	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM3	HGNC	protein_coding	OTTHUMT00000085785.3	0	0	0	89	89	74	0.00	0.00	C	NM_025191		184680917	-1	20	10	80	52	tier1	no_errors	ENST00000318130	ensembl	human	known	74_37	missense	20.00	16.13	SNP	1.000	A	20	80
KCNH8	131096	genome.wustl.edu	37	3	19575241	19575241	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr3:19575241G>C	ENST00000328405.2	+	16	3240	c.2974G>C	c.(2974-2976)Gat>Cat	p.D992H		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	992	Ser-rich.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TCCAAGCCTTGATTATTCACC	0.483													ENSG00000183960																									NSCLC(124;1625 1765 8018 24930 42026)												0													187.0	185.0	186.0					3																	19575241		2203	4300	6503	SO:0001583	missense	0			-	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2974G>C	3.37:g.19575241G>C	ENSP00000328813:p.Asp992His		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tR-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.D992H	ENST00000328405.2	37	c.2974	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	9.990	1.230640	0.22542	.	.	ENSG00000183960	ENST00000328405	D	0.98585	-5.01	5.48	5.48	0.80851	.	0.588281	0.12229	U	0.487640	D	0.95332	0.8485	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.91041	0.4871	9	.	.	.	.	15.8905	0.79293	0.0:0.1448:0.8552:0.0	.	992	Q96L42	KCNH8_HUMAN	H	992	ENSP00000328813:D992H	.	D	+	1	0	KCNH8	19550245	0.270000	0.24152	0.215000	0.23724	0.968000	0.65278	3.213000	0.51153	2.558000	0.86282	0.655000	0.94253	GAT	-	KCNH8	-	NULL		0.483	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	0	0	0	49	49	92	0.00	0.00	G	NM_144633		19575241	+1	4	15	34	91	tier1	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	10.53	14.15	SNP	0.896	C	4	34
DUSP21	63904	genome.wustl.edu	37	X	44703772	44703772	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chrX:44703772G>A	ENST00000339042.4	+	1	524	c.394G>A	c.(394-396)Gcc>Acc	p.A132T		NM_022076.3	NP_071359.3	Q9H596	DUS21_HUMAN	dual specificity phosphatase 21	132	Tyrosine-protein phosphatase.				peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|skin(3)	19						GCTGCTGGACGCCCATACATG	0.557													ENSG00000189037																																					0													80.0	62.0	68.0					X																	44703772		2203	4300	6503	SO:0001583	missense	0			-	AF143321	CCDS14264.1	Xp11.4-p11.23	2011-06-09			ENSG00000189037	ENSG00000189037		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	20476	protein-coding gene	gene with protein product		300678				12408986	Standard	NM_022076		Approved		uc004dgd.3	Q9H596	OTTHUMG00000021401	ENST00000339042.4:c.394G>A	X.37:g.44703772G>A	ENSP00000343244:p.Ala132Thr		Q0VDA6|Q6IAJ6|Q6YDQ8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP_famB,prints_Atypical_DUSP	p.A132T	ENST00000339042.4	37	c.394	CCDS14264.1	X	.	.	.	.	.	.	.	.	.	.	g	18.05	3.537326	0.65085	.	.	ENSG00000189037	ENST00000339042;ENST00000537377	D	0.92495	-3.05	4.21	4.21	0.49690	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.95300	0.8475	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.64410	0.925	D	0.95656	0.8711	10	0.87932	D	0	.	13.4772	0.61316	0.0:0.0:1.0:0.0	.	132	Q9H596	DUS21_HUMAN	T	132;131	ENSP00000343244:A132T	ENSP00000343244:A132T	A	+	1	0	DUSP21	44588716	1.000000	0.71417	0.059000	0.19551	0.015000	0.08874	9.492000	0.97957	2.348000	0.79779	0.597000	0.82753	GCC	-	DUSP21	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat		0.557	DUSP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP21	HGNC	protein_coding	OTTHUMT00000056323.1	0	0	0	21	21	21	0.00	0.00	G	NM_022076		44703772	+1	6	7	14	12	tier1	no_errors	ENST00000339042	ensembl	human	known	74_37	missense	30.00	36.84	SNP	1.000	A	6	14
SLC4A8	9498	genome.wustl.edu	37	12	51857442	51857442	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:51857442C>G	ENST00000453097.2	+	11	1510	c.1293C>G	c.(1291-1293)caC>caG	p.H431Q	SLC4A8_ENST00000535225.2_Missense_Mutation_p.H378Q|SLC4A8_ENST00000514353.3_Missense_Mutation_p.H378Q|SLC4A8_ENST00000358657.3_Missense_Mutation_p.H458Q|SLC4A8_ENST00000394856.1_Missense_Mutation_p.H378Q	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		ATGTTTGCCACATAGAACAGG	0.463													ENSG00000050438																																					0													116.0	117.0	116.0					12																	51857442		2203	4300	6503	SO:0001583	missense	0			-	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1293C>G	12.37:g.51857442C>G	ENSP00000405812:p.His431Gln			Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.H431Q	ENST00000453097.2	37	c.1293	CCDS44890.1	12	.	.	.	.	.	.	.	.	.	.	C	8.249	0.808491	0.16467	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.76186	-0.36;-1.0;-1.0;-0.38;-0.38	5.42	3.58	0.41010	.	0.297548	0.39210	N	0.001439	T	0.57388	0.2050	L	0.44542	1.39	0.40242	D	0.977978	P;B;B;B;B;B	0.35363	0.497;0.003;0.01;0.001;0.0;0.0	B;B;B;B;B;B	0.28553	0.091;0.004;0.008;0.002;0.004;0.006	T	0.52946	-0.8507	10	0.13470	T	0.59	.	7.4986	0.27505	0.0:0.6927:0.0:0.3073	.	378;458;378;431;431;431	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	Q	378;458;431;378;431;378;378	ENSP00000441520:H378Q;ENSP00000351483:H458Q;ENSP00000405812:H431Q;ENSP00000378325:H378Q;ENSP00000442561:H378Q	ENSP00000315789:H431Q	H	+	3	2	SLC4A8	50143709	0.513000	0.26194	1.000000	0.80357	0.977000	0.68977	0.345000	0.19979	1.451000	0.47736	0.655000	0.94253	CAC	-	SLC4A8	-	tigrfam_HCO3_transpt_euk		0.463	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	HGNC	protein_coding	OTTHUMT00000404356.1	0	0	0	51	51	102	0.00	0.00	C	NM_004858		51857442	+1	118	195	334	598	tier1	no_errors	ENST00000453097	ensembl	human	known	74_37	missense	26.11	24.59	SNP	0.984	G	118	334
R3HDM2	22864	genome.wustl.edu	37	12	57693914	57693914	+	Silent	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:57693914G>A	ENST00000347140.3	-	5	648	c.258C>T	c.(256-258)tcC>tcT	p.S86S	R3HDM2_ENST00000358907.2_Silent_p.S86S|R3HDM2_ENST00000402412.1_Silent_p.S86S|R3HDM2_ENST00000403821.2_Silent_p.S86S			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	86						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						ATGGGGTGGAGGACTCCTCAC	0.393													ENSG00000179912																																					0													58.0	53.0	55.0					12																	57693914		692	1591	2283	SO:0001819	synonymous_variant	0			-	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.258C>T	12.37:g.57693914G>A			Q2M1T9|Q3ZCT5	Silent	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.S86	ENST00000347140.3	37	c.258	CCDS8937.2	12																																																																																			-	R3HDM2	-	NULL		0.393	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	HGNC	protein_coding	OTTHUMT00000326570.2	0	0	0	34	34	78	0.00	0.00	G	NM_014925		57693914	-1	29	32	37	79	tier1	no_errors	ENST00000347140	ensembl	human	known	74_37	silent	43.94	28.83	SNP	0.998	A	29	37
OR52E6	390078	genome.wustl.edu	37	11	5863176	5863176	+	5'Flank	SNP	T	T	C			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:5863176T>C	ENST00000329322.5	-	0	0				OR52E6_ENST00000379946.2_Splice_Site_p.K3E|TRIM5_ENST00000380027.1_Intron	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AATTATTGACTTTCCATTAGT	0.373													ENSG00000205409																																					0													24.0	22.0	22.0					11																	5863176		2059	4239	6298	SO:0001631	upstream_gene_variant	0			-	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3			11.37:g.5863176T>C	Exception_encountered		Q6IFF8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K3E	ENST00000329322.5	37	c.7	CCDS53597.1	11	.	.	.	.	.	.	.	.	.	.	T	0.157	-1.085077	0.01888	.	.	ENSG00000205409	ENST00000379946	T	0.00004	9.81	3.37	2.19	0.27852	.	2.413010	0.02138	N	0.056918	T	0.00039	0.0001	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.07028	-1.0794	6	.	.	.	.	6.5849	0.22614	0.0:0.0:0.2475:0.7525	.	.	.	.	E	3	ENSP00000369279:K3E	.	K	-	1	0	OR52E6	5819752	0.000000	0.05858	0.016000	0.15963	0.029000	0.11900	0.011000	0.13264	0.449000	0.26747	-0.485000	0.04761	AAA	-	OR52E6	-	NULL		0.373	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E6	HGNC	protein_coding	OTTHUMT00000401144.1	0	0	0	42	42	75	0.00	0.00	T	NM_001005167		5863176	-1	9	8	32	51	tier1	no_errors	ENST00000379946	ensembl	human	known	74_37	missense	21.95	13.56	SNP	0.034	C	9	32
IL17RA	23765	genome.wustl.edu	37	22	17579665	17579665	+	Splice_Site	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr22:17579665C>T	ENST00000319363.6	+	4	444	c.311C>T	c.(310-312)gCc>gTc	p.A104V	IL17RA_ENST00000477874.1_3'UTR	NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	104					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TCTCCTGCAGCCAGCATCCTG	0.498													ENSG00000177663																																					0													126.0	93.0	104.0					22																	17579665		2203	4300	6503	SO:0001630	splice_region_variant	0			-	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.311-1C>T	22.37:g.17579665C>T			O43844|Q20WK1	Missense_Mutation	SNP	pfam_SEFIR	p.A104V	ENST00000319363.6	37	c.311	CCDS13739.1	22	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971790	0.74246	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.25250	1.81	5.97	4.93	0.64822	.	0.171616	0.38326	N	0.001735	T	0.43612	0.1255	M	0.64997	1.995	0.39081	D	0.960909	D;D	0.89917	1.0;0.999	P;P	0.61070	0.883;0.77	T	0.26430	-1.0103	9	.	.	.	.	14.3761	0.66879	0.0:0.8155:0.1845:0.0	.	104;104	D3YTB4;Q96F46	.;I17RA_HUMAN	V	104	ENSP00000320936:A104V	.	A	+	2	0	IL17RA	15959665	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	1.799000	0.38824	2.837000	0.97791	0.655000	0.94253	GCC	-	IL17RA	-	NULL		0.498	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RA	HGNC	protein_coding	OTTHUMT00000315820.1	0	0	0	37	37	41	0.00	0.00	C	NM_014339	Missense_Mutation	17579665	+1	9	7	47	49	tier1	no_errors	ENST00000319363	ensembl	human	known	74_37	missense	16.07	12.50	SNP	1.000	T	9	47
E2F7	144455	genome.wustl.edu	37	12	77458410	77458410	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:77458410C>G	ENST00000322886.7	-	2	241	c.6G>C	c.(4-6)gaG>gaC	p.E2D	E2F7_ENST00000416496.2_Missense_Mutation_p.E2D	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	2					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AACAATTTACCTCCATCTGTA	0.343													ENSG00000165891																																					0													124.0	117.0	119.0					12																	77458410		2203	4300	6503	SO:0001583	missense	0			-	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.6G>C	12.37:g.77458410C>G	ENSP00000323246:p.Glu2Asp		A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	pfam_E2F_TDP	p.E2D	ENST00000322886.7	37	c.6	CCDS9016.1	12	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780506	0.70222	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669;ENST00000547316	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	5.11	3.2	0.36748	.	0.145132	0.64402	N	0.000009	D	0.88858	0.6551	L	0.56769	1.78	0.47621	D	0.999476	D;B	0.89917	1.0;0.058	D;B	0.83275	0.996;0.026	D	0.88362	0.2988	10	0.87932	D	0	-19.1147	8.0955	0.30826	0.1581:0.7562:0.0:0.0858	.	2;2	F8VSE7;Q96AV8	.;E2F7_HUMAN	D	2	ENSP00000323246:E2D;ENSP00000393639:E2D;ENSP00000448245:E2D;ENSP00000449033:E2D	ENSP00000323246:E2D	E	-	3	2	E2F7	75982541	0.999000	0.42202	1.000000	0.80357	0.989000	0.77384	0.798000	0.27014	1.339000	0.45563	0.561000	0.74099	GAG	-	E2F7	-	NULL		0.343	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	HGNC	protein_coding	OTTHUMT00000406716.1	0	0	0	35	35	125	0.00	0.00	C	XM_084871		77458410	-1	80	151	37	83	tier1	no_errors	ENST00000322886	ensembl	human	known	74_37	missense	68.38	64.53	SNP	1.000	G	80	37
CTTN	2017	genome.wustl.edu	37	11	70255965	70255965	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:70255965C>T	ENST00000301843.8	+	5	396	c.190C>T	c.(190-192)Caa>Taa	p.Q64*	CTTN_ENST00000376561.3_Nonsense_Mutation_p.Q64*|CTTN_ENST00000346329.3_Nonsense_Mutation_p.Q64*|CTTN_ENST00000527622.1_3'UTR	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	64					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GAATGTCTTTCAAGAGCATCA	0.428													ENSG00000085733																																					0													216.0	214.0	214.0					11																	70255965		2200	4294	6494	SO:0001587	stop_gained	0			-	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.190C>T	11.37:g.70255965C>T	ENSP00000301843:p.Gln64*		Q8N707|Q96H99	Nonsense_Mutation	SNP	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.Q64*	ENST00000301843.8	37	c.190	CCDS41680.1	11	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117914	0.56505	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561	.	.	.	5.12	4.2	0.49525	.	0.241097	0.41938	D	0.000792	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-23.1195	13.7335	0.62804	0.0:0.9254:0.0:0.0746	.	.	.	.	X	64	.	ENSP00000301843:Q64X	Q	+	1	0	CTTN	69933613	0.919000	0.31177	0.958000	0.39756	0.005000	0.04900	2.270000	0.43355	1.141000	0.42275	0.563000	0.77884	CAA	-	CTTN	-	NULL		0.428	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	HGNC	protein_coding	OTTHUMT00000259233.2	0	0	0	37	37	104	0.00	0.00	C	NM_138565		70255965	+1	15	32	79	138	tier1	no_errors	ENST00000301843	ensembl	human	known	74_37	nonsense	15.96	18.82	SNP	0.996	T	15	79
GRIA1	2890	genome.wustl.edu	37	5	153065889	153065889	+	Splice_Site	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr5:153065889G>A	ENST00000285900.5	+	8	1477	c.1134G>A	c.(1132-1134)aaG>aaA	p.K378K	GRIA1_ENST00000448073.4_Splice_Site_p.K388K|GRIA1_ENST00000340592.5_Splice_Site_p.K378K|GRIA1_ENST00000521843.2_Splice_Site_p.K309K|GRIA1_ENST00000518783.1_Splice_Site_p.K388K|GRIA1_ENST00000518142.1_Splice_Site_p.K298K	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	378					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GCATCCGAAAGGTAAGGTCCC	0.507													ENSG00000155511																																					0													89.0	81.0	84.0					5																	153065889		2203	4300	6503	SO:0001630	splice_region_variant	0			-		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1134+1G>A	5.37:g.153065889G>A			B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K388	ENST00000285900.5	37	c.1164	CCDS4322.1	5																																																																																			-	GRIA1	-	superfamily_Peripla_BP_I		0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	0	0	0	25	25	73	0.00	0.00	G		Silent	153065889	+1	8	13	30	61	tier1	no_errors	ENST00000448073	ensembl	human	known	74_37	silent	21.05	17.57	SNP	1.000	A	8	30
DLGAP1	9229	genome.wustl.edu	37	18	3879315	3879315	+	Missense_Mutation	SNP	G	G	A	rs572784569		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr18:3879315G>A	ENST00000315677.3	-	4	1349	c.754C>T	c.(754-756)Cgg>Tgg	p.R252W	DLGAP1_ENST00000515196.2_Missense_Mutation_p.R252W|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R252W|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000584874.1_Missense_Mutation_p.R252W	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	252					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TTGTTGCTCCGGGAGGCCTTC	0.657													ENSG00000170579	G|||	1	0.000199681	0.0	0.0	5008	,	,		16926	0.0		0.0	False		,,,				2504	0.001																0													61.0	60.0	60.0					18																	3879315		2203	4300	6503	SO:0001583	missense	0			-	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.754C>T	18.37:g.3879315G>A	ENSP00000316377:p.Arg252Trp		A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	pfam_GKAP	p.R252W	ENST00000315677.3	37	c.754	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633677	0.67130	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.30714	1.52;1.52	5.51	3.52	0.40303	.	0.000000	0.85682	D	0.000000	T	0.50973	0.1647	M	0.64997	1.995	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.987;0.999;0.982	T	0.55483	-0.8134	10	0.87932	D	0	-21.5295	12.9962	0.58648	0.0:0.0:0.5897:0.4102	.	252;252;252	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	W	252	ENSP00000316377:R252W;ENSP00000445973:R252W	ENSP00000316377:R252W	R	-	1	2	DLGAP1	3869315	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	1.903000	0.39858	1.314000	0.45095	0.655000	0.94253	CGG	-	DLGAP1	-	NULL		0.657	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	0	0	0	49	49	23	0.00	0.00	G			3879315	-1	7	6	30	23	tier1	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	18.92	20.69	SNP	1.000	A	7	30
PPP1R1A	5502	genome.wustl.edu	37	12	54975829	54975829	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:54975829C>T	ENST00000257905.8	-	5	504	c.334G>A	c.(334-336)Gag>Aag	p.E112K	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	112					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						GGGCGGGACTCCTGGGTTTCT	0.602													ENSG00000135447																																					0													68.0	70.0	69.0					12																	54975829		1916	4113	6029	SO:0001583	missense	0			-	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.334G>A	12.37:g.54975829C>T	ENSP00000257905:p.Glu112Lys		Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	pfam_PPI_1DARPP-32	p.E112K	ENST00000257905.8	37	c.334	CCDS44912.1	12	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697115	0.68386	.	.	ENSG00000135447	ENST00000257905	T	0.32023	1.47	5.28	4.32	0.51571	.	0.320500	0.26948	N	0.021681	T	0.39091	0.1065	L	0.55481	1.735	0.30318	N	0.787903	P	0.48162	0.906	P	0.51777	0.679	T	0.35425	-0.9789	10	0.54805	T	0.06	.	11.3674	0.49679	0.0:0.817:0.183:0.0	.	112	Q13522	PPR1A_HUMAN	K	112	ENSP00000257905:E112K	ENSP00000257905:E112K	E	-	1	0	PPP1R1A	53262096	0.998000	0.40836	1.000000	0.80357	0.649000	0.38597	0.874000	0.28065	2.629000	0.89072	0.655000	0.94253	GAG	-	PPP1R1A	-	pfam_PPI_1DARPP-32		0.602	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	HGNC	protein_coding	OTTHUMT00000406604.1	0	0	0	40	40	42	0.00	0.00	C	NM_006741		54975829	-1	251	267	39	48	tier1	no_errors	ENST00000257905	ensembl	human	known	74_37	missense	86.55	84.23	SNP	1.000	T	251	39
EPHA5	2044	genome.wustl.edu	37	4	66356412	66356412	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr4:66356412C>T	ENST00000273854.3	-	5	1685	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	EPHA5_ENST00000511294.1_Missense_Mutation_p.R362Q|EPHA5_ENST00000354839.4_Missense_Mutation_p.R362Q|EPHA5_ENST00000432638.2_Intron	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	362	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GATGGCATTCCGAGGAGCAGA	0.398										TSP Lung(17;0.13)			ENSG00000145242																																					0													45.0	44.0	44.0					4																	66356412		2203	4300	6503	SO:0001583	missense	0			-	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1085G>A	4.37:g.66356412C>T	ENSP00000273854:p.Arg362Gln		Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R362Q	ENST00000273854.3	37	c.1085	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	C	14.15	2.450707	0.43531	.	.	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;T	0.57273	0.41;0.41;0.41	5.86	5.86	0.93980	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000052	T	0.68155	0.2970	L	0.53780	1.695	0.53688	D	0.999976	D;P;D;P	0.76494	0.999;0.659;0.998;0.568	D;B;D;B	0.67382	0.951;0.153;0.918;0.024	T	0.60352	-0.7280	10	0.26408	T	0.33	.	20.1859	0.98214	0.0:1.0:0.0:0.0	.	362;362;362;362	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	Q	362	ENSP00000273854:R362Q;ENSP00000346899:R362Q;ENSP00000427638:R362Q	ENSP00000273854:R362Q	R	-	2	0	EPHA5	66039007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.058000	0.57463	2.777000	0.95525	0.591000	0.81541	CGG	-	EPHA5	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Fibronectin_type3,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3		0.398	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	0	0	0	52	52	79	0.00	0.00	C	NM_004439		66356412	-1	10	18	21	41	tier1	no_errors	ENST00000273854	ensembl	human	known	74_37	missense	32.26	30.51	SNP	1.000	T	10	21
FBXW10	10517	genome.wustl.edu	37	17	18668118	18668118	+	Silent	SNP	T	T	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:18668118T>G	ENST00000395665.4	+	8	1718	c.1497T>G	c.(1495-1497)acT>acG	p.T499T	FBXW10_ENST00000395667.1_Silent_p.T499T|FBXW10_ENST00000301938.4_Silent_p.T499T|FBXW10_ENST00000308799.4_Silent_p.T528T			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	499										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GGACTATCACTTGCATGGACT	0.468													ENSG00000171931																																					0													58.0	59.0	58.0					17																	18668118		2201	4279	6480	SO:0001819	synonymous_variant	0			-	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1497T>G	17.37:g.18668118T>G			C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T528	ENST00000395665.4	37	c.1584	CCDS11199.3	17																																																																																			-	FBXW10	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.468	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	HGNC	protein_coding	OTTHUMT00000313531.2	0	0	0	64	64	52	0.00	0.00	T	NM_031456		18668118	+1	7	7	45	14	tier1	no_errors	ENST00000308799	ensembl	human	known	74_37	silent	13.46	31.82	SNP	0.998	G	7	45
KIF26A	26153	genome.wustl.edu	37	14	104638087	104638087	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr14:104638087G>T	ENST00000423312.2	+	6	1141	c.1141G>T	c.(1141-1143)Gca>Tca	p.A381S	KIF26A_ENST00000315264.7_Missense_Mutation_p.A242S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	381	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GATCTGGCCCGCACAGGGGGC	0.682													ENSG00000066735																																					0													9.0	13.0	12.0					14																	104638087		1930	4120	6050	SO:0001583	missense	0			-	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1141G>T	14.37:g.104638087G>T	ENSP00000388241:p.Ala381Ser		Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.A381S	ENST00000423312.2	37	c.1141	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	G	5.199	0.222295	0.09863	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.41758	0.99;0.99	3.77	-2.85	0.05734	Kinesin, motor domain (3);	.	.	.	.	T	0.13670	0.0331	N	0.02539	-0.55	0.20196	N	0.99993	B	0.10296	0.003	B	0.09377	0.004	T	0.35400	-0.9790	9	0.06099	T	0.92	.	8.9911	0.36024	0.0919:0.0:0.1858:0.7222	.	381	Q9ULI4	KI26A_HUMAN	S	381;242	ENSP00000388241:A381S;ENSP00000325452:A242S	ENSP00000325452:A242S	A	+	1	0	KIF26A	103707840	0.993000	0.37304	0.004000	0.12327	0.653000	0.38743	2.564000	0.45931	-0.338000	0.08413	0.462000	0.41574	GCA	-	KIF26A	-	superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.682	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	0	0	0	51	51	6	0.00	0.00	G			104638087	+1	12	2	58	10	tier1	no_errors	ENST00000423312	ensembl	human	known	74_37	missense	17.14	16.67	SNP	0.327	T	12	58
ZNF229	7772	genome.wustl.edu	37	19	44934383	44934383	+	Silent	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr19:44934383C>T	ENST00000588931.1	-	6	1006	c.573G>A	c.(571-573)gcG>gcA	p.A191A	ZNF229_ENST00000591289.1_Intron|ZNF229_ENST00000291187.4_Silent_p.A185A|CTC-512J12.4_ENST00000588655.1_RNA	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				GGTTCACAAACGCTTTTGCCC	0.428													ENSG00000167383																																					0													100.0	95.0	97.0					19																	44934383		1857	4096	5953	SO:0001819	synonymous_variant	0			-	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.573G>A	19.37:g.44934383C>T			B2RWN3|Q59FV2|Q86WL9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A191	ENST00000588931.1	37	c.573	CCDS42574.1	19																																																																																			-	ZNF229	-	NULL		0.428	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	HGNC	protein_coding	OTTHUMT00000460833.1	0	0	0	46	46	75	0.00	0.00	C	NM_014518		44934383	-1	6	18	46	63	tier1	no_errors	ENST00000588931	ensembl	human	known	74_37	silent	11.54	21.95	SNP	0.000	T	6	46
SLC6A13	6540	genome.wustl.edu	37	12	352956	352956	+	Missense_Mutation	SNP	C	C	T	rs147275386	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr12:352956C>T	ENST00000343164.4	-	3	278	c.226G>A	c.(226-228)Gtc>Atc	p.V76I	SLC6A13_ENST00000445055.2_Intron	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	76					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			AAGAGGAAGACGAGGTAGGGG	0.527													ENSG00000010379	C|||	2	0.000399361	0.0	0.0	5008	,	,		22796	0.0		0.001	False		,,,				2504	0.001																0								C	,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	96.0	88.0	91.0		,226	5.0	1.0	12	dbSNP_134	91	0,8600		0,0,4300	no	intron,missense	SLC6A13	NM_001190997.2,NM_016615.4	,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,benign	,76/603	352956	1,13005	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.226G>A	12.37:g.352956C>T	ENSP00000339260:p.Val76Ile		B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT2	p.V76I	ENST00000343164.4	37	c.226	CCDS8502.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	5.365	0.252624	0.10185	2.27E-4	0.0	ENSG00000010379	ENST00000313154;ENST00000343164	T	0.72282	-0.64	6.17	4.97	0.65823	.	0.088257	0.85682	N	0.000000	T	0.31857	0.0810	N	0.00382	-1.575	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.005	T	0.46076	-0.9217	10	0.02654	T	1	.	12.2354	0.54512	0.0:0.0665:0.0:0.9335	.	55;76	B4DJS3;Q9NSD5	.;S6A13_HUMAN	I	55;76	ENSP00000339260:V76I	ENSP00000318097:V55I	V	-	1	0	SLC6A13	223217	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.886000	0.63149	1.146000	0.42352	-0.290000	0.09829	GTC	rs147275386	SLC6A13	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport		0.527	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A13	HGNC	protein_coding	OTTHUMT00000397801.1	0	0	0	87	87	71	0.00	0.00	C	NM_016615		352956	-1	5	18	53	42	tier1	no_errors	ENST00000343164	ensembl	human	known	74_37	missense	8.62	30.00	SNP	1.000	T	5	53
KCNJ6	3763	genome.wustl.edu	37	21	39086687	39086687	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr21:39086687G>A	ENST00000609713.1	-	3	1362	c.773C>T	c.(772-774)aCg>aTg	p.T258M	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Missense_Mutation_p.T258M	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	258					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	GTTGATATCCGTCTGGTTCAA	0.502													ENSG00000157542																									Pancreas(48;379 1118 2936 19024 28214)												0													115.0	117.0	117.0					21																	39086687		1913	4142	6055	SO:0001583	missense	0			-	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.773C>T	21.37:g.39086687G>A	ENSP00000477437:p.Thr258Met		Q3MJ74|Q53WW6	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.2	p.T258M	ENST00000609713.1	37	c.773	CCDS42927.1	21	.	.	.	.	.	.	.	.	.	.	G	16.65	3.182122	0.57800	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.91577	-2.87;-2.87	6.17	6.17	0.99709	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.95620	0.8576	M	0.79475	2.455	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.94231	0.7476	10	0.46703	T	0.11	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	258	P48051	IRK6_HUMAN	M	258	ENSP00000383330:T258M;ENSP00000288309:T258M	ENSP00000288309:T258M	T	-	2	0	KCNJ6	38008557	1.000000	0.71417	0.973000	0.42090	0.708000	0.40852	8.062000	0.89475	2.941000	0.99782	0.655000	0.94253	ACG	-	KCNJ6	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir		0.502	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ6	HGNC	protein_coding	OTTHUMT00000194828.2	0	0	0	71	71	99	0.00	0.00	G	NM_002240		39086687	-1	7	20	55	66	tier1	no_errors	ENST00000288309	ensembl	human	known	74_37	missense	11.29	23.26	SNP	1.000	A	7	55
SLC9C2	284525	genome.wustl.edu	37	1	173486699	173486699	+	Missense_Mutation	SNP	C	C	T	rs147401558		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr1:173486699C>T	ENST00000367714.3	-	23	3306	c.2884G>A	c.(2884-2886)Gtc>Atc	p.V962I	SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	962					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										TCACAGATGACGGTATATTCA	0.363													ENSG00000162753	C|||	1	0.000199681	0.0	0.0014	5008	,	,		19328	0.0		0.0	False		,,,				2504	0.0																0													106.0	109.0	108.0					1																	173486699		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.2884G>A	1.37:g.173486699C>T	ENSP00000356687:p.Val962Ile		Q86UF3	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.V962I	ENST00000367714.3	37	c.2884	CCDS1308.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.461	1.093038	0.20471	.	.	ENSG00000162753	ENST00000367714	D	0.93426	-3.22	5.0	4.09	0.47781	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.401961	0.20797	N	0.085505	T	0.76485	0.3994	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.70799	-0.4774	10	0.22706	T	0.39	-10.2394	9.9671	0.41732	0.0:0.9048:0.0:0.0952	.	962	Q5TAH2	S9A11_HUMAN	I	962	ENSP00000356687:V962I	ENSP00000356687:V962I	V	-	1	0	SLC9A11	171753322	0.965000	0.33210	0.769000	0.31535	0.025000	0.11179	2.568000	0.45965	1.237000	0.43756	-0.133000	0.14855	GTC	rs147401558	SLC9C2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom		0.363	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	HGNC	protein_coding	OTTHUMT00000084205.1	0	0	1	47	47	83	0.00	1.19	C	NM_178527		173486699	-1	12	8	38	51	tier1	no_errors	ENST00000367714	ensembl	human	known	74_37	missense	24.00	13.56	SNP	0.905	T	12	38
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	63	63	94	0.00	0.00	G	NM_000546		7578212	-1	12	16	42	79	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	22.22	16.84	SNP	0.893	A	12	42
MUC17	140453	genome.wustl.edu	37	7	100682909	100682909	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr7:100682909G>T	ENST00000306151.4	+	3	8276	c.8212G>T	c.(8212-8214)Ggt>Tgt	p.G2738C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2738	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTGCTGAAGGTACCAGCAT	0.507													ENSG00000169876																																					0													259.0	257.0	258.0					7																	100682909		2203	4300	6503	SO:0001583	missense	0			-	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8212G>T	7.37:g.100682909G>T	ENSP00000302716:p.Gly2738Cys		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.G2738C	ENST00000306151.4	37	c.8212	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	4.985	0.182942	0.09495	.	.	ENSG00000169876	ENST00000306151	T	0.02236	4.38	0.861	-1.51	0.08664	.	.	.	.	.	T	0.04679	0.0127	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.72982	0.979	T	0.38499	-0.9658	9	0.56958	D	0.05	.	5.3744	0.16156	0.3982:0.0:0.6018:0.0	.	2738	Q685J3	MUC17_HUMAN	C	2738	ENSP00000302716:G2738C	ENSP00000302716:G2738C	G	+	1	0	MUC17	100469629	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	0.077000	0.14738	-0.600000	0.05790	0.134000	0.15878	GGT	-	MUC17	-	NULL		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	0	0	0	196	196	18	0.00	0.00	G	NM_001040105		100682909	+1	19	3	148	16	tier1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	11.38	15.79	SNP	0.000	T	19	148
GIMAP8	155038	genome.wustl.edu	37	7	150174547	150174547	+	Silent	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr7:150174547C>T	ENST00000307271.3	+	5	2251	c.1677C>T	c.(1675-1677)taC>taT	p.Y559Y		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	559	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TTACGAAATACGCGATTATGC	0.473													ENSG00000171115																																					0													90.0	91.0	91.0					7																	150174547		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1677C>T	7.37:g.150174547C>T				Silent	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.Y559	ENST00000307271.3	37	c.1677	CCDS34777.1	7																																																																																			-	GIMAP8	-	pfam_AIG1,superfamily_P-loop_NTPase		0.473	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	0	0	0	32	32	125	0.00	0.00	C	NM_175571		150174547	+1	5	20	19	89	tier1	no_errors	ENST00000307271	ensembl	human	known	74_37	silent	20.83	18.35	SNP	0.009	T	5	19
RARA	5914	genome.wustl.edu	37	17	38499264	38499264	+	Intron	SNP	A	A	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:38499264A>G	ENST00000254066.5	+	3	633				RARA_ENST00000394086.3_Intron|RARA_ENST00000425707.3_Intron|RARA_ENST00000394089.2_Intron|RARA_ENST00000394081.3_Intron|CTD-2267D19.2_ENST00000581080.1_RNA	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha						apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TTGCTGGACAATTGAACCCTC	0.542			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL								ENSG00000265666																												Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	0													75.0	70.0	72.0					17																	38499264		692	1591	2283	SO:0001627	intron_variant	0			-	X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.179-5304A>G	17.37:g.38499264A>G			B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	R	SNP	-	NULL	ENST00000254066.5	37	NULL	CCDS11366.1	17																																																																																			-	CTD-2267D19.2	-	-		0.542	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929693	Clone_based_vega_gene	protein_coding	OTTHUMT00000257136.2	0	0	0	47	47	98	0.00	0.00	A			38499264	-1	14	10	44	71	tier1	no_errors	ENST00000581080	ensembl	human	known	74_37	rna	24.14	12.05	SNP	0.000	G	14	44
KCNH4	23415	genome.wustl.edu	37	17	40321679	40321679	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr17:40321679A>G	ENST00000264661.3	-	9	1738	c.1406T>C	c.(1405-1407)gTg>gCg	p.V469A	KCNH4_ENST00000607371.1_Missense_Mutation_p.V469A	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	469					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCCGAACACCACAGCGTGCAT	0.647													ENSG00000089558																									NSCLC(117;707 1703 2300 21308 31858)												0													69.0	56.0	61.0					17																	40321679		2203	4300	6503	SO:0001583	missense	0			-	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1406T>C	17.37:g.40321679A>G	ENSP00000264661:p.Val469Ala			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.V469A	ENST00000264661.3	37	c.1406	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	A	13.32	2.201400	0.38905	.	.	ENSG00000089558	ENST00000264661	D	0.98531	-4.98	4.36	4.36	0.52297	Ion transport (1);	0.000000	0.33253	N	0.005112	D	0.94994	0.8380	N	0.16903	0.455	0.54753	D	0.999981	B	0.18166	0.026	B	0.30943	0.122	D	0.92550	0.6049	10	0.25751	T	0.34	.	13.7185	0.62712	1.0:0.0:0.0:0.0	.	469	Q9UQ05	KCNH4_HUMAN	A	469	ENSP00000264661:V469A	ENSP00000264661:V469A	V	-	2	0	KCNH4	37575205	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.097000	0.94193	1.828000	0.53243	0.379000	0.24179	GTG	-	KCNH4	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_ELK		0.647	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	HGNC	protein_coding	OTTHUMT00000449791.2	0	0	0	66	66	12	0.00	0.00	A	NM_012285		40321679	-1	11	2	53	5	tier1	no_errors	ENST00000264661	ensembl	human	known	74_37	missense	17.19	28.57	SNP	1.000	G	11	53
SLC31A2	1318	genome.wustl.edu	37	9	115923901	115923901	+	Silent	SNP	C	C	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr9:115923901C>T	ENST00000259392.3	+	3	319	c.186C>T	c.(184-186)atC>atT	p.I62I		NM_001860.2	NP_001851.1	O15432	COPT2_HUMAN	solute carrier family 31 (copper transporter), member 2	62					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|regulation of copper ion transmembrane transport (GO:1902311)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	7					Carboplatin(DB00958)|Cisplatin(DB00515)	CAACCTCCATCAGCCAGCAGA	0.557													ENSG00000136867																																					0													117.0	120.0	119.0					9																	115923901		2129	4239	6368	SO:0001819	synonymous_variant	0			-		CCDS6788.1	9q32	2013-07-17	2013-07-17		ENSG00000136867	ENSG00000136867		"""Solute carriers"""	11017	protein-coding gene	gene with protein product	"""copper transporter 2"""	603088		COPT2		9207117	Standard	NM_001860		Approved	hCTR2, CTR2	uc004bgq.3	O15432	OTTHUMG00000021037	ENST00000259392.3:c.186C>T	9.37:g.115923901C>T				Silent	SNP	pfam_Cop_transporter	p.I62	ENST00000259392.3	37	c.186	CCDS6788.1	9																																																																																			-	SLC31A2	-	pfam_Cop_transporter		0.557	SLC31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC31A2	HGNC	protein_coding	OTTHUMT00000055509.2	0	0	1	33	33	36	0.00	2.70	C	NM_001860		115923901	+1	643	685	33	26	tier1	no_errors	ENST00000259392	ensembl	human	known	74_37	silent	94.98	96.34	SNP	0.030	T	643	33
LOC101927209	101927209	genome.wustl.edu	37	1	142634555	142634555	+	lincRNA	SNP	A	A	G	rs4362000	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr1:142634555A>G	ENST00000610091.1	-	0	5979				RP11-417J8.3_ENST00000426408.1_lincRNA																							agaagcttagagatgcaggaa	0.597													ENSG00000203849																																					0																																												0			-																													1.37:g.142634555A>G				R	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			rs4362000	RP11-417J8.6	-	-		0.597	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	0	0	0	8	8	0	0.00	0.00	A			142634555	-1	4	0	5	0	tier1	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	44.44	0.00	SNP	0.054	G	4	5
KRTAP5-5	439915	genome.wustl.edu	37	11	1651227	1651228	+	Frame_Shift_Ins	INS	-	-	GAGGC	rs71454096	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:1651227_1651228insGAGGC	ENST00000399676.2	+	1	195_196	c.157_158insGAGGC	c.(157-159)gcgfs	p.A53fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctccggctgtgcgggctgtggg	0.683													ENSG00000185940																																					0																																										SO:0001589	frameshift_variant	0				AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651227_1651228insGAGGC	ENSP00000382584:p.Ala53fs		A8MWN2	Frame_Shift_Ins	INS	NULL	p.A53fs	ENST00000399676.2	37	c.157_158	CCDS41592.1	11																																																																																				KRTAP5-5	-	NULL		0.683	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	0	0	0	0	0	0	0.00	0.00	-			1651228	+1	0	0	3	3	tier1	no_errors	ENST00000399676	ensembl	human	known	74_37	frame_shift_ins	0.00	0.00	INS	0.083:0.113	GAGGC	0	3
KRTAP5-5	439915	genome.wustl.edu	37	11	1651229	1651230	+	Frame_Shift_Ins	INS	-	-	TGGCTCC	rs553119014	byFrequency	TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr11:1651229_1651230insTGGCTCC	ENST00000399676.2	+	1	197_198	c.159_160insTGGCTCC	c.(160-162)ggcfs	p.G54fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	54						keratin filament (GO:0045095)		p.A53A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtgcgggctgtggggg	0.683													ENSG00000185940																																					1	Substitution - coding silent(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0				AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651229_1651230insTGGCTCC	ENSP00000382584:p.Gly54fs		A8MWN2	Frame_Shift_Ins	INS	NULL	p.G53fs	ENST00000399676.2	37	c.159_160	CCDS41592.1	11																																																																																				KRTAP5-5	-	NULL		0.683	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	0	0	0	0	0	0	0.00	0.00	-			1651230	+1	0	0	3	3	tier1	no_errors	ENST00000399676	ensembl	human	known	74_37	frame_shift_ins	0.00	0.00	INS	0.325:0.996	TGGCTCC	0	3
MT-ND2	4536	genome.wustl.edu	37	M	1884	1884	+	5'Flank	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chrM:1884G>A	ENST00000361453.3	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TAACTTTGCAAGGAGAGCCAA	0.403													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1884G>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	R	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.403	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		0	0	0	22	22	0	0.00	0.00	G	YP_003024027		1884	+1	25	0	13	0	tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	65.79	0.00	SNP	NULL	A	25	13
MT-ND5	4540	genome.wustl.edu	37	M	12508	12508	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chrM:12508G>A	ENST00000361567.2	+	1	172	c.172G>A	c.(172-174)Gac>Aac	p.D58N	MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	58					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCATGTGCCTAGACCAAGAAG	0.398													ENSG00000198786																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.172G>A	M.37:g.12508G>A	ENSP00000354813:p.Asp58Asn		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_DH_UbQ/plastoQ_OxRdtase,pfam_DH_DH_su5_C,pfam_DH_UbQ_OxRdtase_chain5/L_N,tigrfam_DHpl_OxRdtase_5	p.D58N	ENST00000361567.2	37	c.172		MT																																																																																			-	MT-ND5	-	tigrfam_DHpl_OxRdtase_5		0.398	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		0	0	0	54	54	0	0.00	0.00	G	YP_003024036		12508	+1	30	0	21	0	tier1	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	58.82	0.00	SNP	NULL	A	30	21
C10orf131	100127889	genome.wustl.edu	37	10	97684071	97684071	+	Splice_Site	SNP	A	A	T			TCGA-DX-A2J1-01A-11D-A21Q-09	TCGA-DX-A2J1-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3278541c-2838-4fda-a6fe-cacf4452baae	c9668713-33ae-4fe6-9a86-f669778a8f53	g.chr10:97684071A>T	ENST00000423344.2	+	5	270	c.74A>T	c.(73-75)gAt>gTt	p.D25V	ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|RP11-248J23.7_ENST00000491114.1_3'UTR|ENTPD1-AS1_ENST00000416301.1_RNA	NM_001130446.2	NP_001123918.2	A6NCD4	CJ131_HUMAN	chromosome 10 open reading frame 131	21										endometrium(1)|kidney(1)	2						TTCCTGATAGATTTAGATGCA	0.269													ENSG00000173088																																					0													67.0	61.0	63.0					10																	97684071		692	1585	2277	SO:0001630	splice_region_variant	0			-		CCDS58090.1	10q24.1	2012-05-30			ENSG00000173088	ENSG00000173088			31667	protein-coding gene	gene with protein product							Standard	NM_001130446		Approved	bA690P14.3	uc010qoo.2	A6NCD4	OTTHUMG00000018824	ENST00000423344.2:c.74-1A>T	10.37:g.97684071A>T			B1AMZ2|B4DG41	Missense_Mutation	SNP	NULL	p.D25V	ENST00000423344.2	37	c.74	CCDS58090.1	10	.	.	.	.	.	.	.	.	.	.	A	17.44	3.390239	0.62066	.	.	ENSG00000173088	ENST00000371202;ENST00000423344	.	.	.	3.29	-0.659	0.11424	.	0.849158	0.09837	N	0.749431	T	0.36276	0.0961	L	0.57536	1.79	0.18873	N	0.999988	P	0.51147	0.942	P	0.49085	0.6	T	0.21793	-1.0235	8	.	.	.	.	3.121	0.06391	0.5176:0.223:0.2593:0.0	.	25	B4DG41	.	V	21;25	.	.	D	+	2	0	C10orf131	97674061	0.952000	0.32445	0.188000	0.23233	0.877000	0.50540	0.219000	0.17641	-0.219000	0.10003	0.472000	0.43445	GAT	-	C10orf131	-	NULL		0.269	C10orf131-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf131	HGNC	protein_coding	OTTHUMT00000468148.1	0	0	0	69	69	77	0.00	0.00	A	NM_001098847	Missense_Mutation	97684071	+1	7	3	57	55	tier1	no_errors	ENST00000423344	ensembl	human	known	74_37	missense	10.94	5.17	SNP	0.113	T	7	57
