#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SRGAP1	57522	genome.wustl.edu	37	12	64377909	64377909	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:64377909C>T	ENST00000355086.3	+	2	774	c.250C>T	c.(250-252)Cat>Tat	p.H84Y	SRGAP1_ENST00000543397.1_Missense_Mutation_p.H44Y|SRGAP1_ENST00000357825.3_Missense_Mutation_p.H84Y	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	84	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.H84Y(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CACTAAGGATCATCAACAATA	0.353													ENSG00000196935																																					1	Substitution - Missense(1)	central_nervous_system(1)											85.0	80.0	82.0					12																	64377909		2203	4300	6503	SO:0001583	missense	0			-	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.250C>T	12.37:g.64377909C>T	ENSP00000347198:p.His84Tyr		Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.H84Y	ENST00000355086.3	37	c.250	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327844	0.81690	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.15718	2.4;2.4;2.4	5.03	5.03	0.67393	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.36234	U	0.002706	T	0.35189	0.0923	M	0.62723	1.935	0.80722	D	1	D;D;D	0.59767	0.985;0.986;0.986	P;P;P	0.57152	0.756;0.743;0.814	T	0.02844	-1.1103	9	.	.	.	.	18.7352	0.91751	0.0:1.0:0.0:0.0	.	84;44;84	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	Y	84;84;44	ENSP00000347198:H84Y;ENSP00000350480:H84Y;ENSP00000437948:H44Y	.	H	+	1	0	SRGAP1	62664176	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.755000	0.85180	2.494000	0.84150	0.650000	0.86243	CAT	-	SRGAP1	-	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom		0.353	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	0	0	1	23	23	98	0.00	1.01	C			64377909	+1	66	525	18	110	tier1	no_errors	ENST00000355086	ensembl	human	known	74_37	missense	78.57	82.68	SNP	1.000	T	66	18
POU1F1	5449	genome.wustl.edu	37	3	87322591	87322591	+	Intron	SNP	C	C	A	rs189221434	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr3:87322591C>A	ENST00000350375.2	-	2	267				POU1F1_ENST00000560656.1_Intron|POU1F1_ENST00000344265.3_Silent_p.S66S	NM_000306.2	NP_000297.1	P28069	PIT1_HUMAN	POU class 1 homeobox 1						B cell differentiation (GO:0030183)|cell fate specification (GO:0001708)|determination of adult lifespan (GO:0008340)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear transport (GO:0051169)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|somatotropin secreting cell development (GO:0060133)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(2)	18	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		ACGTTGTCACCGAGAAATGTG	0.393													ENSG00000064835																																					0													91.0	80.0	84.0					3																	87322591		2203	4300	6503	SO:0001627	intron_variant	0			-	D10216	CCDS2919.1, CCDS46873.1	3p11.2	2011-06-20	2007-07-13		ENSG00000064835	ENSG00000064835		"""Homeoboxes / POU class"""	9210	protein-coding gene	gene with protein product	"""growth hormone factor 1"""	173110	"""POU domain class 1, transcription factor 1"""	PIT1		1956794	Standard	NM_001122757		Approved	GHF-1, POU1F1a	uc010hoj.1	P28069	OTTHUMG00000158992	ENST00000350375.2:c.143-23G>T	3.37:g.87322591C>A			O75757|Q15132|Q15133|Q9UD34|Q9UEL3	Silent	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.S66	ENST00000350375.2	37	c.198	CCDS2919.1	3																																																																																			-	POU1F1	-	NULL		0.393	POU1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU1F1	HGNC	protein_coding	OTTHUMT00000352827.1	0	0	0	122	122	51	0.00	0.00	C	NM_000306		87322591	-1	28	27	68	61	tier1	no_errors	ENST00000344265	ensembl	human	known	74_37	silent	29.17	30.68	SNP	0.997	A	28	68
CACNB1	782	genome.wustl.edu	37	17	37351189	37351189	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr17:37351189C>G	ENST00000394303.3	-	2	326	c.119G>C	c.(118-120)cGg>cCg	p.R40P	CACNB1_ENST00000394310.3_Missense_Mutation_p.R40P|CACNB1_ENST00000344140.5_Missense_Mutation_p.R40P|CACNB1_ENST00000582877.1_5'UTR	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	40					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCATCTGACCGTTTGAATCG	0.562													ENSG00000067191																									Esophageal Squamous(5;100 366 38393 41452 45827)												0													206.0	134.0	158.0					17																	37351189		2203	4300	6503	SO:0001583	missense	0			-		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.119G>C	17.37:g.37351189C>G	ENSP00000377840:p.Arg40Pro		A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b1su	p.R40P	ENST00000394303.3	37	c.119	CCDS42311.1	17	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042210	0.93685	.	.	ENSG00000067191	ENST00000394303;ENST00000344140;ENST00000394310	T;T;T	0.79554	-1.28;-1.28;-1.27	5.79	5.79	0.91817	.	0.112694	0.64402	D	0.000010	D	0.87269	0.6135	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.998;0.999	D;D;D;D	0.91635	0.995;0.999;0.991;0.995	D	0.87116	0.2188	10	0.56958	D	0.05	-8.6998	16.9575	0.86263	0.0:1.0:0.0:0.0	.	40;40;40;40	Q6TME4;Q02641-2;Q02641-3;Q02641	.;.;.;CACB1_HUMAN	P	40	ENSP00000377840:R40P;ENSP00000345461:R40P;ENSP00000377847:R40P	ENSP00000345461:R40P	R	-	2	0	CACNB1	34604715	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.846000	0.75399	2.746000	0.94184	0.561000	0.74099	CGG	-	CACNB1	-	NULL		0.562	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB1	HGNC	protein_coding	OTTHUMT00000256945.3	0	0	0	85	85	133	0.00	0.00	C			37351189	-1	14	20	69	99	tier1	no_errors	ENST00000394303	ensembl	human	known	74_37	missense	16.87	16.81	SNP	1.000	G	14	69
B4GALNT1	2583	genome.wustl.edu	37	12	58025114	58025114	+	Silent	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58025114G>A	ENST00000341156.4	-	3	836	c.252C>T	c.(250-252)tcC>tcT	p.S84S	B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000449184.3_Silent_p.S84S|B4GALNT1_ENST00000418555.2_Intron|B4GALNT1_ENST00000550764.1_Silent_p.S84S|B4GALNT1_ENST00000552350.1_Silent_p.S84S	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	84					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CCCCCCCACTGGACTCACAAC	0.577													ENSG00000135454																																					0													64.0	74.0	70.0					12																	58025114		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.252C>T	12.37:g.58025114G>A			B4DE26|Q8N636	Silent	SNP	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.S84	ENST00000341156.4	37	c.252	CCDS8950.1	12																																																																																			-	B4GALNT1	-	pirsf_GM2_synthase		0.577	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	0	0	0	24	24	48	0.00	0.00	G	NM_001478		58025114	-1	57	108	310	706	tier1	no_errors	ENST00000341156	ensembl	human	known	74_37	silent	15.53	13.25	SNP	0.981	A	57	310
HTT	3064	genome.wustl.edu	37	4	3137957	3137957	+	Nonsense_Mutation	SNP	T	T	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr4:3137957T>G	ENST00000355072.5	+	21	2847	c.2702T>G	c.(2701-2703)tTa>tGa	p.L901*		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	901					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTAAAGCTTTTAAAACTGCAA	0.353													ENSG00000197386																																					0													124.0	112.0	116.0					4																	3137957		1836	4083	5919	SO:0001587	stop_gained	0			-	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.2702T>G	4.37:g.3137957T>G	ENSP00000347184:p.Leu901*		Q9UQB7	Nonsense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.L901*	ENST00000355072.5	37	c.2702	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	T	40	8.275135	0.98737	.	.	ENSG00000197386	ENST00000355072	.	.	.	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.9513	0.79840	0.0:0.0:0.0:1.0	.	.	.	.	X	901	.	ENSP00000347184:L901X	L	+	2	0	HTT	3107755	1.000000	0.71417	0.975000	0.42487	0.318000	0.28184	5.282000	0.65615	2.163000	0.67991	0.533000	0.62120	TTA	-	HTT	-	superfamily_ARM-type_fold		0.353	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	0	0	0	61	61	91	0.00	0.00	T	NM_002111		3137957	+1	4	18	30	76	tier1	no_errors	ENST00000355072	ensembl	human	known	74_37	nonsense	11.76	19.15	SNP	0.996	G	4	30
B4GALNT1	2583	genome.wustl.edu	37	12	58025075	58025075	+	Silent	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58025075G>T	ENST00000341156.4	-	3	875	c.291C>A	c.(289-291)gtC>gtA	p.V97V	B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000449184.3_Silent_p.V97V|B4GALNT1_ENST00000418555.2_Intron|B4GALNT1_ENST00000550764.1_Silent_p.V97V|B4GALNT1_ENST00000552350.1_Silent_p.V97V	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	97					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CAATAGCTCGGACTTGTTTCT	0.597													ENSG00000135454																																					0													108.0	118.0	114.0					12																	58025075		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.291C>A	12.37:g.58025075G>T			B4DE26|Q8N636	Silent	SNP	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.V97	ENST00000341156.4	37	c.291	CCDS8950.1	12																																																																																			-	B4GALNT1	-	pirsf_GM2_synthase		0.597	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	0	0	0	28	28	61	0.00	0.00	G	NM_001478		58025075	-1	65	128	321	819	tier1	no_errors	ENST00000341156	ensembl	human	known	74_37	silent	16.84	13.52	SNP	0.533	T	65	321
TMPRSS2	7113	genome.wustl.edu	37	21	42851103	42851103	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr21:42851103G>A	ENST00000332149.5	-	7	813	c.679C>T	c.(679-681)Cac>Tac	p.H227Y	TMPRSS2_ENST00000398585.3_Missense_Mutation_p.H264Y|TMPRSS2_ENST00000458356.1_Missense_Mutation_p.H227Y	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	227	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				GCATACCTGTGGTACAGTTTT	0.413			T	"""ERG, ETV1, ETV4, ETV5"""	prostate								ENSG00000184012																												Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	0													107.0	106.0	107.0					21																	42851103		2203	4300	6503	SO:0001583	missense	0			-	U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.679C>T	21.37:g.42851103G>A	ENSP00000330330:p.His227Tyr		A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_SRCR,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_LDrepeatLR_classA_rpt,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.H264Y	ENST00000332149.5	37	c.790	CCDS33564.1	21	.	.	.	.	.	.	.	.	.	.	G	4.689	0.128180	0.08981	.	.	ENSG00000184012	ENST00000332149;ENST00000398585;ENST00000458356;ENST00000454499;ENST00000424093	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	5.22	4.25	0.50352	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.241217	0.35838	N	0.002953	T	0.41696	0.1170	L	0.37750	1.13	0.30371	N	0.78288	B;B	0.23990	0.095;0.016	B;B	0.20384	0.017;0.029	T	0.29610	-1.0006	10	0.13853	T	0.58	.	9.3564	0.38168	0.0:0.0:0.7315:0.2685	.	264;227	F8WES1;O15393	.;TMPS2_HUMAN	Y	227;264;227;227;187	ENSP00000330330:H227Y;ENSP00000381588:H264Y;ENSP00000391216:H227Y;ENSP00000389006:H227Y;ENSP00000397846:H187Y	ENSP00000330330:H227Y	H	-	1	0	TMPRSS2	41772973	1.000000	0.71417	0.992000	0.48379	0.228000	0.25075	2.291000	0.43540	2.443000	0.82685	0.549000	0.68633	CAC	-	TMPRSS2	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel		0.413	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS2	HGNC	protein_coding	OTTHUMT00000195189.1	0	0	0	63	63	99	0.00	0.00	G			42851103	-1	96	147	56	101	tier1	no_errors	ENST00000398585	ensembl	human	known	74_37	missense	62.75	59.27	SNP	0.999	A	96	56
KRT86	3892	genome.wustl.edu	37	12	52648120	52648120	+	Intron	SNP	G	G	C			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:52648120G>C	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCTAGGTCTGATTTGCGCAG	0.562													ENSG00000135477																																					0																																										SO:0001627	intron_variant	0			-	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+4908G>C	12.37:g.52648120G>C			P78387	R	SNP	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			-	KRT121P	-	-		0.562	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	HGNC	protein_coding		0	0	0	82	82	63	0.00	0.00	G	NM_002284		52648120	-1	60	98	106	141	tier1	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	36.14	41.00	SNP	0.195	C	60	106
NBPF6	653149	genome.wustl.edu	37	1	108926235	108926235	+	Intron	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:108926235C>T	ENST00000444143.2	+	1	183				NBPF6_ENST00000294652.8_Intron|NBPF5P_ENST00000357046.4_RNA			Q5VWK0	NBPF6_HUMAN	neuroblastoma breakpoint family, member 6							cytoplasm (GO:0005737)				endometrium(2)	2						TTGGCTTCCTCGGTAGGCTCC	0.453													ENSG00000243967																																					0																																										SO:0001627	intron_variant	0			-		CCDS44184.1	1p13.3	2013-01-17				ENSG00000186086		"""neuroblastoma breakpoint family"""	31988	protein-coding gene	gene with protein product		613996				16079250	Standard	NM_001143987		Approved		uc009wep.3	Q5VWK0	OTTHUMG00000039830	ENST00000444143.2:c.-36+7632C>T	1.37:g.108926235C>T			A4QN25	R	SNP	-	NULL	ENST00000444143.2	37	NULL	CCDS44184.1	1																																																																																			-	NBPF5P	-	-		0.453	NBPF6-203	KNOWN	basic|CCDS	protein_coding	NBPF5P	HGNC	protein_coding	OTTHUMT00000276886.3	0	0	0	66	66	66	0.00	0.00	C	XM_926213		108926235	+1	14	7	64	43	tier1	no_errors	ENST00000357046	ensembl	human	known	74_37	rna	17.95	14.00	SNP	0.003	T	14	64
SRGAP1	57522	genome.wustl.edu	37	12	64377912	64377912	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:64377912C>T	ENST00000355086.3	+	2	777	c.253C>T	c.(253-255)Caa>Taa	p.Q85*	SRGAP1_ENST00000543397.1_Nonsense_Mutation_p.Q45*|SRGAP1_ENST00000357825.3_Nonsense_Mutation_p.Q85*	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	85	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TAAGGATCATCAACAATACAA	0.353													ENSG00000196935																																					0													82.0	78.0	79.0					12																	64377912		2203	4300	6503	SO:0001587	stop_gained	0			-	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.253C>T	12.37:g.64377912C>T	ENSP00000347198:p.Gln85*		Q9H8A3|Q9P2P2	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.Q85*	ENST00000355086.3	37	c.253	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	C	50	16.726747	0.99870	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	.	.	.	5.16	5.16	0.70880	.	0.000000	0.33792	U	0.004556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0307	0.92955	0.0:1.0:0.0:0.0	.	.	.	.	X	85;85;45	.	.	Q	+	1	0	SRGAP1	62664179	1.000000	0.71417	0.993000	0.49108	0.785000	0.44390	7.737000	0.84957	2.566000	0.86566	0.650000	0.86243	CAA	-	SRGAP1	-	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom		0.353	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	0	0	0	22	22	95	0.00	0.00	C			64377912	+1	64	517	18	107	tier1	no_errors	ENST00000355086	ensembl	human	known	74_37	nonsense	78.05	82.85	SNP	1.000	T	64	18
SMCHD1	23347	genome.wustl.edu	37	18	2795948	2795948	+	Splice_Site	SNP	T	T	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr18:2795948T>A	ENST00000320876.6	+	46	6059	c.5721T>A	c.(5719-5721)gaT>gaA	p.D1907E	RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1907					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TCTTTACAGATCTTCTTCAGC	0.368													ENSG00000101596																																					0													45.0	39.0	41.0					18																	2795948		1873	4092	5965	SO:0001630	splice_region_variant	0			-	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.5720-1T>A	18.37:g.2795948T>A			O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.D1907E	ENST00000320876.6	37	c.5721	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	T	5.134	0.210272	0.09757	.	.	ENSG00000101596	ENST00000320876	T	0.21361	2.01	5.42	-3.03	0.05429	.	.	.	.	.	T	0.11537	0.0281	L	0.39633	1.23	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25117	-1.0141	9	0.24483	T	0.36	.	1.5981	0.02668	0.1122:0.2046:0.2581:0.4252	.	1907	A6NHR9	SMHD1_HUMAN	E	1907	ENSP00000326603:D1907E	ENSP00000326603:D1907E	D	+	3	2	SMCHD1	2785948	0.993000	0.37304	0.967000	0.41034	0.902000	0.53008	0.011000	0.13264	-0.723000	0.04915	-1.417000	0.01113	GAT	-	SMCHD1	-	NULL		0.368	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	0	0	0	42	42	82	0.00	0.00	T		Missense_Mutation	2795948	+1	8	20	16	78	tier1	no_errors	ENST00000320876	ensembl	human	known	74_37	missense	33.33	20.41	SNP	0.995	A	8	16
SIPA1L2	57568	genome.wustl.edu	37	1	232607223	232607223	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:232607223C>T	ENST00000366630.1	-	7	2495	c.2137G>A	c.(2137-2139)Gag>Aag	p.E713K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E713K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	713	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCCCCAGGCTCCTGGAAGACG	0.413													ENSG00000116991																																					0													137.0	143.0	141.0					1																	232607223		2123	4272	6395	SO:0001583	missense	0			-	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.2137G>A	1.37:g.232607223C>T	ENSP00000355589:p.Glu713Lys		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.E713K	ENST00000366630.1	37	c.2137	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.878050	0.97055	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	D;D	0.97352	-4.35;-4.35	5.98	5.98	0.97165	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.98966	0.9648	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99069	1.0833	10	0.66056	D	0.02	-43.8212	20.4561	0.99145	0.0:1.0:0.0:0.0	.	713	Q9P2F8	SI1L2_HUMAN	K	713	ENSP00000355589:E713K;ENSP00000262861:E713K	ENSP00000262861:E713K	E	-	1	0	SIPA1L2	230673846	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.843000	0.97960	0.650000	0.86243	GAG	-	SIPA1L2	-	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom		0.413	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	0	0	0	82	82	113	0.00	0.00	C	XM_045839		232607223	-1	17	20	52	105	tier1	no_errors	ENST00000262861	ensembl	human	known	74_37	missense	24.64	16.00	SNP	1.000	T	17	52
RFTN2	130132	genome.wustl.edu	37	2	198540166	198540166	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr2:198540166C>T	ENST00000295049.4	-	1	553	c.17G>A	c.(16-18)aGa>aAa	p.R6K		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	6					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TTCTAGCTTTCTAAGTCCGCA	0.413													ENSG00000162944																																					0													118.0	129.0	125.0					2																	198540166		2203	4300	6503	SO:0001583	missense	0			-	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.17G>A	2.37:g.198540166C>T	ENSP00000295049:p.Arg6Lys		Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	NULL	p.R6K	ENST00000295049.4	37	c.17	CCDS2323.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.347010	0.95807	.	.	ENSG00000162944	ENST00000295049;ENST00000429081	T;T	0.35605	1.3;1.3	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.56891	0.2016	M	0.64997	1.995	0.58432	D	0.999993	D	0.71674	0.998	D	0.77557	0.99	T	0.44050	-0.9353	10	0.18710	T	0.47	-32.0444	18.3002	0.90160	0.0:1.0:0.0:0.0	.	6	Q52LD8	RFTN2_HUMAN	K	6	ENSP00000295049:R6K;ENSP00000398128:R6K	ENSP00000295049:R6K	R	-	2	0	RFTN2	198248411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.127000	0.77210	2.747000	0.94245	0.585000	0.79938	AGA	-	RFTN2	-	NULL		0.413	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFTN2	HGNC	protein_coding	OTTHUMT00000256106.2	0	0	0	19	19	84	0.00	0.00	C	NM_144629		198540166	-1	6	12	8	82	tier1	no_errors	ENST00000295049	ensembl	human	known	74_37	missense	42.86	12.63	SNP	1.000	T	6	8
IRS1	3667	genome.wustl.edu	37	2	227662435	227662435	+	Silent	SNP	G	G	A	rs376825507		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr2:227662435G>A	ENST00000305123.5	-	1	2040	c.1020C>T	c.(1018-1020)gcC>gcT	p.A340A	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	340	Ser-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CGTCCACCGAGGCTGGGCGGG	0.721											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000169047																																					0								G		2,4392		0,2,2195	50.0	55.0	53.0		1020	-1.3	0.9	2		53	4,8566		0,4,4281	no	coding-synonymous	IRS1	NM_005544.2		0,6,6476	AA,AG,GG		0.0467,0.0455,0.0463		340/1243	227662435	6,12958	2197	4285	6482	SO:0001819	synonymous_variant	0			-		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1020C>T	2.37:g.227662435G>A		2321		Silent	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.A340	ENST00000305123.5	37	c.1020	CCDS2463.1	2																																																																																			-	IRS1	-	NULL		0.721	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	HGNC	protein_coding	OTTHUMT00000256886.3	0	0	0	73	73	9	0.00	0.00	G	NM_005544		227662435	-1	15	5	61	21	tier1	no_errors	ENST00000305123	ensembl	human	known	74_37	silent	19.74	19.23	SNP	0.951	A	15	61
POTEC	388468	genome.wustl.edu	37	18	14542900	14542900	+	Silent	SNP	A	A	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr18:14542900A>G	ENST00000358970.5	-	1	245	c.246T>C	c.(244-246)acT>acC	p.T82T	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	82										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						GGTCTCCAGAAGTGCCCACGT	0.582													ENSG00000183206																																					0													42.0	49.0	47.0					18																	14542900		692	1591	2283	SO:0001819	synonymous_variant	0			-	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.246T>C	18.37:g.14542900A>G				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T82	ENST00000358970.5	37	c.246	CCDS45835.1	18																																																																																			-	POTEC	-	NULL		0.582	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	0	0	0	435	435	49	0.00	0.00	A	XM_496269		14542900	-1	398	38	314	50	tier1	no_errors	ENST00000358970	ensembl	human	known	74_37	silent	55.82	43.18	SNP	0.015	G	398	314
TAF6L	10629	genome.wustl.edu	37	11	62545600	62545600	+	Splice_Site	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr11:62545600G>A	ENST00000294168.3	+	4	586	c.385G>A	c.(385-387)Gtt>Att	p.V129I	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	129					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						AGCTGTCAGAGGTGGCTGCCG	0.602													ENSG00000162227																																					0													52.0	48.0	49.0					11																	62545600		2201	4299	6500	SO:0001630	splice_region_variant	0			-	BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.385+1G>A	11.37:g.62545600G>A			B2RAT0|Q96HA6	Missense_Mutation	SNP	pfam_TAF_TATA-bd,pfam_DUF1546,superfamily_Histone-fold,smart_TAF_TATA-bd	p.V129I	ENST00000294168.3	37	c.385	CCDS8035.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.145363	0.94603	.	.	ENSG00000162227	ENST00000294168;ENST00000529509	T;T	0.47528	0.84;0.92	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	T	0.56790	0.2009	L	0.50333	1.59	0.80722	D	1	D;D	0.63880	0.982;0.993	P;P	0.55923	0.479;0.787	T	0.53070	-0.8490	10	0.40728	T	0.16	-0.4222	15.3007	0.73949	0.0:0.0:1.0:0.0	.	129;129	B4DVM4;Q9Y6J9	.;TAF6L_HUMAN	I	129	ENSP00000294168:V129I;ENSP00000434662:V129I	ENSP00000294168:V129I	V	+	1	0	TAF6L	62302176	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.661000	0.91125	2.687000	0.91594	0.462000	0.41574	GTT	-	TAF6L	-	NULL		0.602	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6L	HGNC	protein_coding	OTTHUMT00000395352.1	0	0	0	71	71	68	0.00	0.00	G	NM_006473	Missense_Mutation	62545600	+1	16	16	75	60	tier1	no_errors	ENST00000294168	ensembl	human	known	74_37	missense	17.58	21.05	SNP	1.000	A	16	75
EPB41L1	2036	genome.wustl.edu	37	20	34797668	34797668	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr20:34797668C>T	ENST00000338074.2	+	15	2088	c.1927C>T	c.(1927-1929)Ctc>Ttc	p.L643F	EPB41L1_ENST00000479336.1_3'UTR|EPB41L1_ENST00000441639.1_Missense_Mutation_p.L569F|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000202028.5_Missense_Mutation_p.L569F|EPB41L1_ENST00000373941.1_Missense_Mutation_p.L643F|EPB41L1_ENST00000373950.2_Missense_Mutation_p.L534F	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	643					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CCTGCCTGAGCTCGACCGGGA	0.612													ENSG00000088367																																					0													62.0	54.0	57.0					20																	34797668		2203	4300	6503	SO:0001583	missense	0			-	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1927C>T	20.37:g.34797668C>T	ENSP00000337168:p.Leu643Phe		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB_dom,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.L643F	ENST00000338074.2	37	c.1927	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791357	0.70452	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000344237;ENST00000338074;ENST00000373941	D;D;D;D;D	0.91237	-2.81;-2.73;-2.81;-2.68;-2.68	5.87	4.92	0.64577	.	0.057628	0.64402	D	0.000002	D	0.92257	0.7544	L	0.36672	1.1	0.40977	D	0.984744	D;D;D;D;D;D	0.89917	0.999;1.0;0.997;0.992;0.997;0.992	D;D;D;D;P;P	0.85130	0.946;0.997;0.927;0.914;0.852;0.876	D	0.92095	0.5683	10	0.56958	D	0.05	-7.9001	13.8848	0.63702	0.0:0.9272:0.0:0.0728	.	643;932;643;534;534;569	B7Z653;E9PCJ3;Q9H4G0;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;.;E41L1_HUMAN;.;.;.	F	569;534;643;534;569;932;643;643	ENSP00000202028:L569F;ENSP00000363061:L534F;ENSP00000399214:L569F;ENSP00000337168:L643F;ENSP00000363052:L643F	ENSP00000202028:L569F	L	+	1	0	EPB41L1	34261082	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.638000	0.46562	2.941000	0.99782	0.655000	0.94253	CTC	-	EPB41L1	-	pirsf_Band_41_protein		0.612	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	0	0	0	28	28	54	0.00	0.00	C	NM_012156		34797668	+1	9	11	26	54	tier1	no_errors	ENST00000338074	ensembl	human	known	74_37	missense	25.71	16.92	SNP	1.000	T	9	26
RCOR1	23186	genome.wustl.edu	37	14	103173719	103173719	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr14:103173719A>G	ENST00000570597.1	+	5	521	c.521A>G	c.(520-522)aAt>aGt	p.N174S	RCOR1_ENST00000262241.6_Missense_Mutation_p.N177S			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	174	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interaction with HDAC1.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						CATAAACATAATATCGAAAAG	0.358													ENSG00000089902																																					0													135.0	134.0	134.0					14																	103173719		2203	4300	6503	SO:0001583	missense	0			-	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.521A>G	14.37:g.103173719A>G	ENSP00000459789:p.Asn174Ser		Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom,prints_Antifreeze_1	p.N177S	ENST00000570597.1	37	c.530		14	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386572	0.82902	.	.	ENSG00000089902	ENST00000262241	.	.	.	4.98	4.98	0.66077	ELM2 domain (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.76314	0.3970	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.78360	-0.2234	9	0.54805	T	0.06	-29.9048	14.9728	0.71246	1.0:0.0:0.0:0.0	.	174	Q9UKL0	RCOR1_HUMAN	S	174	.	ENSP00000262241:N174S	N	+	2	0	RCOR1	102243472	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.255000	0.95524	2.007000	0.58848	0.533000	0.62120	AAT	-	RCOR1	-	superfamily_Homeodomain-like,pfscan_ELM2_dom		0.358	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	RCOR1	HGNC	protein_coding		0	0	0	60	60	108	0.00	0.00	A	NM_015156		103173719	+1	10	25	32	129	tier1	no_errors	ENST00000262241	ensembl	human	known	74_37	missense	23.81	16.23	SNP	1.000	G	10	32
KRT86	3892	genome.wustl.edu	37	12	52647544	52647544	+	Intron	SNP	G	G	A			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:52647544G>A	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGAGAACGCGGATCTCCTGCA	0.542													ENSG00000135477																																					0																																										SO:0001627	intron_variant	0			-	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+4332G>A	12.37:g.52647544G>A			P78387	R	SNP	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			-	KRT121P	-	-		0.542	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	HGNC	protein_coding		0	0	0	45	45	73	0.00	0.00	G	NM_002284		52647544	-1	52	128	59	144	tier1	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	46.85	47.06	SNP	0.182	A	52	59
B4GALNT1	2583	genome.wustl.edu	37	12	58024808	58024808	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58024808G>C	ENST00000341156.4	-	4	1029	c.445C>G	c.(445-447)Cta>Gta	p.L149V	B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000449184.3_Missense_Mutation_p.L149V|B4GALNT1_ENST00000418555.2_Missense_Mutation_p.L94V|B4GALNT1_ENST00000550764.1_Missense_Mutation_p.L149V|B4GALNT1_ENST00000552350.1_Missense_Mutation_p.L149V	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	149					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			ACACCCTGTAGGGGGTACTGG	0.647													ENSG00000135454																																					0													41.0	43.0	42.0					12																	58024808		2203	4300	6503	SO:0001583	missense	0			-	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.445C>G	12.37:g.58024808G>C	ENSP00000341562:p.Leu149Val		B4DE26|Q8N636	Missense_Mutation	SNP	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.L149V	ENST00000341156.4	37	c.445	CCDS8950.1	12	.	.	.	.	.	.	.	.	.	.	.	2.007	-0.428109	0.04701	.	.	ENSG00000135454	ENST00000341156;ENST00000418555;ENST00000550764;ENST00000552350;ENST00000548888	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	4.76	3.86	0.44501	.	0.135630	0.48286	D	0.000186	T	0.14960	0.0361	N	0.16567	0.415	0.32800	D	0.500028	P;P;B;B	0.46859	0.885;0.817;0.2;0.001	P;B;B;B	0.48189	0.57;0.23;0.051;0.003	T	0.13791	-1.0496	10	0.08179	T	0.78	-0.6081	3.8168	0.08818	0.0901:0.16:0.585:0.1649	.	149;94;149;149	B4DSP5;B4DE26;Q8N636;Q00973	.;.;.;B4GN1_HUMAN	V	149;94;149;149;149	ENSP00000341562:L149V;ENSP00000401601:L94V;ENSP00000450303:L149V;ENSP00000448500:L149V;ENSP00000447945:L149V	ENSP00000341562:L149V	L	-	1	2	B4GALNT1	56311075	0.983000	0.35010	0.999000	0.59377	0.919000	0.55068	2.005000	0.40864	1.194000	0.43101	0.609000	0.83330	CTA	-	B4GALNT1	-	pirsf_GM2_synthase		0.647	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	0	0	0	20	20	38	0.00	0.00	G	NM_001478		58024808	-1	66	139	260	514	tier1	no_errors	ENST00000341156	ensembl	human	known	74_37	missense	20.18	21.29	SNP	0.988	C	66	260
B4GALNT1	2583	genome.wustl.edu	37	12	58025099	58025099	+	Silent	SNP	G	G	T			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr12:58025099G>T	ENST00000341156.4	-	3	851	c.267C>A	c.(265-267)ctC>ctA	p.L89L	B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000449184.3_Silent_p.L89L|B4GALNT1_ENST00000418555.2_Intron|B4GALNT1_ENST00000550764.1_Silent_p.L89L|B4GALNT1_ENST00000552350.1_Silent_p.L89L	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	89					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AGGGGAGGGGGAGGCCCCCCC	0.592													ENSG00000135454																																					0													79.0	90.0	86.0					12																	58025099		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.267C>A	12.37:g.58025099G>T			B4DE26|Q8N636	Silent	SNP	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.L89	ENST00000341156.4	37	c.267	CCDS8950.1	12																																																																																			-	B4GALNT1	-	pirsf_GM2_synthase		0.592	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	0	0	1	24	24	50	0.00	1.96	G	NM_001478		58025099	-1	58	117	312	765	tier1	no_errors	ENST00000341156	ensembl	human	known	74_37	silent	15.63	13.25	SNP	0.000	T	58	312
GNRH2	2797	genome.wustl.edu	37	20	3026346	3026350	+	Frame_Shift_Del	DEL	GCCCC	GCCCC	-	rs377041343|rs67749149		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	GCCCC	GCCCC	GCCCC	-	GCCCC	GCCCC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr20:3026346_3026350delGCCCC	ENST00000245983.2	+	4	378_382	c.327_331delGCCCC	c.(325-333)gagccccgcfs	p.PR110fs	GNRH2_ENST00000359987.1_Frame_Shift_Del_p.PR102fs|GNRH2_ENST00000380346.2_Frame_Shift_Del_p.PR102fs|MRPS26_ENST00000380325.3_5'Flank|GNRH2_ENST00000359100.2_Frame_Shift_Del_p.PR103fs|GNRH2_ENST00000380347.2_Frame_Shift_Del_p.PR103fs	NM_001501.1	NP_001492.1	O43555	GON2_HUMAN	gonadotropin-releasing hormone 2	110					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			ovary(1)|upper_aerodigestive_tract(1)	2						CAGCCCGAGAGCCCCGCCCCGCCCC	0.634													ENSG00000125787																																					0									,,	4,204,4048		0,0,4,15,174,1935					,,	-2.0	0.0		dbSNP_130	50	46,851,7353		2,8,34,78,687,3316	no	codingComplex,codingComplex,codingComplex	GNRH2	NM_178332.1,NM_178331.1,NM_001501.1	,,	2,8,38,93,861,5251	A1A1,A1A2,A1R,A2A2,A2R,RR		10.8727,4.8872,8.8358	,,	,,		50,1055,11401				SO:0001589	frameshift_variant	0				AF036329	CCDS13040.1, CCDS13041.1, CCDS13042.1	20p13	2013-02-26			ENSG00000125787	ENSG00000125787		"""Endogenous ligands"""	4420	protein-coding gene	gene with protein product		602352				9419371, 12447356	Standard	NM_178331		Approved		uc002whr.1	O43555	OTTHUMG00000031723	ENST00000245983.2:c.327_331delGCCCC	20.37:g.3026356_3026360delGCCCC	ENSP00000245983:p.Pro110fs		Q14C68|Q14C69|Q9BYN9|Q9BYP0	Frame_Shift_Del	DEL	pfam_GnRH	p.A113fs	ENST00000245983.2	37	c.327_331	CCDS13040.1	20																																																																																				GNRH2	-	NULL		0.634	GNRH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNRH2	HGNC	protein_coding	OTTHUMT00000077694.2	0	0	0	34	34	34	0.00	0.00	GCCCC	NM_001501		3026350	+1	7	7	23	23	tier1	no_errors	ENST00000245983	ensembl	human	known	74_37	frame_shift_del	23.33	23.33	DEL	0.024:0.007:0.002:0.001:0.000	-	7	23
ENPP5	59084	genome.wustl.edu	37	6	46129094	46129094	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr6:46129094G>C	ENST00000371383.2	-	5	1663	c.1403C>G	c.(1402-1404)gCt>gGt	p.A468G	ENPP5_ENST00000230565.3_Missense_Mutation_p.A468G					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						AGCTATTTCAGCATGCATATC	0.328													ENSG00000112796																																					0													45.0	43.0	44.0					6																	46129094		2203	4299	6502	SO:0001583	missense	0			-	AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.1403C>G	6.37:g.46129094G>C	ENSP00000360436:p.Ala468Gly			Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.A468G	ENST00000371383.2	37	c.1403	CCDS4915.1	6	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480524	0.26598	.	.	ENSG00000112796	ENST00000371383;ENST00000230565	T;T	0.74315	-0.83;-0.83	5.81	2.03	0.26663	.	2.478390	0.01605	N	0.022228	T	0.48519	0.1504	L	0.50333	1.59	0.23616	N	0.997283	B	0.06786	0.001	B	0.04013	0.001	T	0.10359	-1.0633	10	0.31617	T	0.26	-3.2242	6.6069	0.22729	0.1533:0.2759:0.5707:0.0	.	468	Q9UJA9	ENPP5_HUMAN	G	468	ENSP00000360436:A468G;ENSP00000230565:A468G	ENSP00000230565:A468G	A	-	2	0	ENPP5	46237053	0.610000	0.26983	0.995000	0.50966	0.918000	0.54935	1.053000	0.30442	0.095000	0.17434	-0.933000	0.02702	GCT	-	ENPP5	-	NULL		0.328	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	HGNC	protein_coding	OTTHUMT00000040779.2	0	0	0	45	45	118	0.00	0.00	G			46129094	-1	4	12	21	153	tier1	no_errors	ENST00000230565	ensembl	human	known	74_37	missense	16.00	7.27	SNP	0.988	C	4	21
ZFHX2	85446	genome.wustl.edu	37	14	23994340	23994340	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr14:23994340delT	ENST00000419474.3	-	9	5166	c.4811delA	c.(4810-4812)gagfs	p.E1604fs	RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1604					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GGTCTGGAACTCTGTGAACTT	0.592													ENSG00000136367																																					0																																										SO:0001589	frameshift_variant	0				AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.4811delA	14.37:g.23994340delT	ENSP00000413418:p.Glu1604fs		Q9UPU6	Frame_Shift_Del	DEL	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E1604fs	ENST00000419474.3	37	c.4811	CCDS55907.1	14																																																																																				ZFHX2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.592	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	0	0	0	35	35	60	0.00	0.00	T	NM_014894		23994340	-1	4	6	28	97	tier1	no_errors	ENST00000419474	ensembl	human	known	74_37	frame_shift_del	12.50	5.83	DEL	1.000	-	4	28
RP11-782C8.4	0	genome.wustl.edu	37	1	143156621	143156621	+	lincRNA	SNP	C	C	T	rs61786125	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:143156621C>T	ENST00000424474.2	+	0	379				RP11-782C8.2_ENST00000412204.2_lincRNA|RP11-782C8.1_ENST00000438000.1_lincRNA																							AGCCTCTGCACCTCTGTCTTC	0.473													ENSG00000230850																																					0																																												0			-																													1.37:g.143156621C>T				R	SNP	-	NULL	ENST00000424474.2	37	NULL		1																																																																																			rs61786125	RP11-782C8.1	-	-		0.473	RP11-782C8.4-001	KNOWN	not_best_in_genome_evidence|basic|exp_conf	lincRNA	ENSG00000230850	Clone_based_vega_gene	lincRNA	OTTHUMT00000037573.2	0	0	0	11	11	2	0.00	0.00	C			143156621	+1	4	0	5	0	tier1	no_errors	ENST00000454861	ensembl	human	known	74_37	rna	44.44	0.00	SNP	0.997	T	4	5
FAM138C	654835	genome.wustl.edu	37	9	35199	35199	+	lincRNA	SNP	A	A	G	rs9408059		TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr9:35199A>G	ENST00000449442.2	-	0	403									family with sequence similarity 138, member C																		tgggaggctgaggtgggagga	0.438													ENSG00000218839																																					0																																												0			-			9p24.3	2013-01-30			ENSG00000218839	ENSG00000218839		"""Long non-coding RNAs"""	32333	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026822		Approved	F379	uc003zfv.3		OTTHUMG00000019422		9.37:g.35199A>G				R	SNP	-	NULL	ENST00000449442.2	37	NULL		9	.	.	.	.	.	.	.	.	.	.	A	1.738	-0.492428	0.04322	.	.	ENSG00000218839	ENST00000449442;ENST00000305248	.	.	.	0.185	-0.371	0.12525	.	.	.	.	.	T	0.33990	0.0882	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31752	-0.9932	4	0.52906	T	0.07	.	.	.	.	.	.	.	.	P	28	.	ENSP00000303458:S28P	S	-	1	0	FAM138C	25199	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.686000	0.05161	-0.785000	0.04522	-0.782000	0.03352	TCA	-	FAM138C	-	-		0.438	FAM138C-001	KNOWN	basic	lincRNA	FAM138C	HGNC	lincRNA	OTTHUMT00000051450.2	0	0	0	15	15	0	0.00	0.00	A	NR_026822		35199	-1	4	0	7	0	tier1	no_errors	ENST00000305248	ensembl	human	known	74_37	rna	36.36	0.00	SNP	0.000	G	4	7
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGT	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr1:153233991_153233992insCTCTGGCGGCGT	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGT	c.(565-570)tactct>taCTCTGGCGGCGTctct	p.190_191insGGVS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	190					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743													ENSG00000203782																																					0																																										SO:0001652	inframe_insertion	0				M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	Exception_encountered	1.37:g.153233991_153233992insCTCTGGCGGCGT	ENSP00000357731:p.Ser190_Gly191insGlyGlyValSer		Q5T869|Q5XKF8	In_Frame_Ins	INS	NULL	p.193in_frame_insVSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																				LOR	-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	HGNC	protein_coding	OTTHUMT00000039107.1	0	0	0	1	1	1	0.00	0.00	-	NM_000427		153233992	+1	0	0	0	0	tier1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.014:0.200	CTCTGGCGGCGT	0	0
AP3B1	8546	genome.wustl.edu	37	5	77411983	77412004	+	Frame_Shift_Del	DEL	CTTCCTCAGATTCAGAATAAAA	CTTCCTCAGATTCAGAATAAAA	-	rs370684531|rs377485358|rs113301033	byFrequency	TCGA-DX-A2J4-01A-32D-A21Q-09	TCGA-DX-A2J4-10A-01D-A21Q-09	CTTCCTCAGATTCAGAATAAAA	CTTCCTCAGATTCAGAATAAAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	968929b0-6bfb-4a2c-bd4d-570bfcdb8a6a	7beaaff7-e241-4851-8dba-fd0b302c53cf	g.chr5:77411983_77412004delCTTCCTCAGATTCAGAATAAAA	ENST00000255194.6	-	18	2198_2219	c.2023_2044delTTTTATTCTGAATCTGAGGAAG	c.(2023-2046)ttttattctgaatctgaggaagagfs	p.FYSESEEE675fs	AP3B1_ENST00000519295.1_Frame_Shift_Del_p.FYSESEEE626fs	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	675					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GAGTCCTCCTCTTCCTCAGATTCAGAATAAAACTTCTTAGCA	0.329									Hermansky-Pudlak syndrome				ENSG00000132842																																					0																																										SO:0001589	frameshift_variant	0	Familial Cancer Database	HPS, HPS1-8		U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2023_2044delTTTTATTCTGAATCTGAGGAAG	5.37:g.77411983_77412004delCTTCCTCAGATTCAGAATAAAA	ENSP00000255194:p.Phe675fs		E5RJ68|O00580|Q7Z393|Q9HD66	Frame_Shift_Del	DEL	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta	p.F675fs	ENST00000255194.6	37	c.2044_2023	CCDS4041.1	5																																																																																				AP3B1	-	pirsf_AP3_beta		0.329	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	0	0	0	77	77	77	0.00	0.00	CTTCCTCAGATTCAGAATAAAA			77412004	-1	2	2	84	84	tier1	no_errors	ENST00000255194	ensembl	human	known	74_37	frame_shift_del	2.33	2.33	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.980:1.000:1.000:0.994:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000	-	2	84
