#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
YPEL5	51646	genome.wustl.edu	37	2	30381844	30381844	+	3'UTR	SNP	A	A	C			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:30381844A>C	ENST00000379520.3	+	0	1005				YPEL5_ENST00000402003.3_3'UTR|YPEL5_ENST00000495673.1_3'UTR|YPEL5_ENST00000402708.1_3'UTR|YPEL5_ENST00000261353.4_3'UTR|YPEL5_ENST00000379519.3_3'UTR	NM_001127401.1	NP_001120873.1	P62699	YPEL5_HUMAN	yippee-like 5 (Drosophila)											NS(1)|endometrium(1)|kidney(1)|lung(3)|prostate(1)	7	Acute lymphoblastic leukemia(172;0.155)					TCTAAGATGGAACctttcttt	0.348													ENSG00000119801																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF135161	CCDS1771.1	2p23	2004-06-28			ENSG00000119801	ENSG00000119801			18329	protein-coding gene	gene with protein product		609726					Standard	NM_016061		Approved	CGI-127	uc002rmz.4	P62699	OTTHUMG00000097839	ENST00000379520.3:c.*135A>C	2.37:g.30381844A>C			D6W568|Q65Z97|Q8R174|Q9D6M1|Q9UMX7|Q9Y3C9	R	SNP	-	NULL	ENST00000379520.3	37	NULL	CCDS1771.1	2																																																																																			-	YPEL5	-	-		0.348	YPEL5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YPEL5	HGNC	protein_coding	OTTHUMT00000215128.1	0	0	0	24	24	58	0.00	0.00	A	NM_016061		30381844	+1	6	13	20	41	tier1	no_errors	ENST00000495673	ensembl	human	known	74_37	rna	23.08	24.07	SNP	1.000	C	6	20
BRINP3	339479	genome.wustl.edu	37	1	190067649	190067649	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr1:190067649C>A	ENST00000367462.3	-	8	2031	c.1800G>T	c.(1798-1800)aaG>aaT	p.K600N	BRINP3_ENST00000534846.1_Missense_Mutation_p.K498N	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	600					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.K600N(1)									GTAGGTCCAACTTAGTCCGCT	0.468													ENSG00000162670																																					1	Substitution - Missense(1)	lung(1)											208.0	215.0	213.0					1																	190067649		2203	4300	6503	SO:0001583	missense	0			-	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1800G>T	1.37:g.190067649C>A	ENSP00000356432:p.Lys600Asn		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.K600N	ENST00000367462.3	37	c.1800	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	C	5.259	0.233219	0.09969	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.18810	2.45;2.19	5.61	2.71	0.32032	.	0.157466	0.56097	D	0.000035	T	0.10078	0.0247	N	0.16656	0.425	0.44570	D	0.997539	B;P	0.34522	0.081;0.455	B;B	0.29440	0.065;0.102	T	0.23976	-1.0173	10	0.15066	T	0.55	.	9.5676	0.39409	0.0:0.7735:0.0:0.2265	.	498;600	B7Z260;Q76B58	.;FAM5C_HUMAN	N	600;498	ENSP00000356432:K600N;ENSP00000438022:K498N	ENSP00000356432:K600N	K	-	3	2	FAM5C	188334272	0.208000	0.23494	0.875000	0.34327	0.993000	0.82548	-0.078000	0.11375	0.308000	0.22923	0.585000	0.79938	AAG	-	BRINP3	-	NULL		0.468	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1	0	0	1	47	47	138	0.00	0.72	C	NM_199051		190067649	-1	8	19	34	142	tier1	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	19.05	11.80	SNP	0.998	A	8	34
LCT	3938	genome.wustl.edu	37	2	136575110	136575110	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:136575110G>A	ENST00000264162.2	-	6	1518	c.1508C>T	c.(1507-1509)gCc>gTc	p.A503V	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	503	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	ATCCTGCAGGGCCTGAGGCAG	0.592													ENSG00000115850																																					0													90.0	78.0	82.0					2																	136575110		2203	4300	6503	SO:0001583	missense	0			-	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1508C>T	2.37:g.136575110G>A	ENSP00000264162:p.Ala503Val		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.A503V	ENST00000264162.2	37	c.1508	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258581	0.80246	.	.	ENSG00000115850	ENST00000264162	T	0.53423	0.62	5.64	4.76	0.60689	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.163053	0.53938	D	0.000052	T	0.66396	0.2785	M	0.74467	2.265	0.52501	D	0.99995	D	0.67145	0.996	D	0.63957	0.92	T	0.67177	-0.5736	10	0.33940	T	0.23	-12.05	16.9502	0.86243	0.0:0.1279:0.8721:0.0	.	503	P09848	LPH_HUMAN	V	503	ENSP00000264162:A503V	ENSP00000264162:A503V	A	-	2	0	LCT	136291580	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.436000	0.52856	1.507000	0.48752	0.561000	0.74099	GCC	-	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF		0.592	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	0	0	0	39	39	53	0.00	0.00	G	NM_002299		136575110	-1	10	9	56	44	tier1	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	15.15	16.98	SNP	1.000	A	10	56
UNC80	285175	genome.wustl.edu	37	2	210795724	210795724	+	Silent	SNP	C	C	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:210795724C>G	ENST00000439458.1	+	37	5822	c.5742C>G	c.(5740-5742)ctC>ctG	p.L1914L	UNC80_ENST00000272845.6_Silent_p.L1909L	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1914					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GCAAACTTCTCTTGAATATTG	0.358													ENSG00000144406																																					0													195.0	157.0	169.0					2																	210795724		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.5742C>G	2.37:g.210795724C>G			B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	NULL	p.L1914	ENST00000439458.1	37	c.5742	CCDS46504.1	2																																																																																			-	UNC80	-	NULL		0.358	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		0	0	0	37	37	94	0.00	0.00	C	NM_182587		210795724	+1	17	25	13	32	tier1	no_errors	ENST00000439458	ensembl	human	known	74_37	silent	56.67	43.86	SNP	1.000	G	17	13
ACCSL	390110	genome.wustl.edu	37	11	44074988	44074988	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr11:44074988C>A	ENST00000378832.1	+	8	1037	c.981C>A	c.(979-981)aaC>aaA	p.N327K		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	327					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						TGCTAATCAACCCTCAGAATC	0.443													ENSG00000205126																																					0													115.0	107.0	109.0					11																	44074988		1851	4089	5940	SO:0001583	missense	0			-		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.981C>A	11.37:g.44074988C>A	ENSP00000368109:p.Asn327Lys			Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.N327K	ENST00000378832.1	37	c.981	CCDS41636.1	11	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708130	0.30322	.	.	ENSG00000205126	ENST00000378832	D	0.91740	-2.9	4.45	-0.959	0.10343	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.96259	0.8780	H	0.97659	4.05	0.53005	D	0.999965	D	0.65815	0.995	D	0.71414	0.973	D	0.93035	0.6452	10	0.87932	D	0	-28.343	5.2389	0.15462	0.0:0.4691:0.1463:0.3846	.	327	Q4AC99	1A1L2_HUMAN	K	327	ENSP00000368109:N327K	ENSP00000368109:N327K	N	+	3	2	ACCSL	44031564	1.000000	0.71417	0.495000	0.27527	0.008000	0.06430	1.233000	0.32648	-0.045000	0.13468	-1.058000	0.02302	AAC	-	ACCSL	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.443	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCSL	HGNC	protein_coding	OTTHUMT00000389717.1	0	0	0	35	35	99	0.00	0.00	C	NM_001031854		44074988	+1	17	29	31	27	tier1	no_errors	ENST00000378832	ensembl	human	known	74_37	missense	35.42	51.79	SNP	1.000	A	17	31
OR5AR1	219493	genome.wustl.edu	37	11	56431448	56431448	+	Missense_Mutation	SNP	G	G	C	rs188426984		TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr11:56431448G>C	ENST00000302969.2	+	1	311	c.287G>C	c.(286-288)aGc>aCc	p.S96T		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						TCCTTCTCCAGCTGTGCCACC	0.512													ENSG00000172459																																					0													182.0	184.0	183.0					11																	56431448		2201	4296	6497	SO:0001583	missense	0			-	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.287G>C	11.37:g.56431448G>C	ENSP00000302639:p.Ser96Thr		Q6IF61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S96T	ENST00000302969.2	37	c.287	CCDS31535.1	11	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372673	0.24857	.	.	ENSG00000172459	ENST00000302969	T	0.03035	4.07	5.04	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000048	T	0.03011	0.0089	N	0.25992	0.78	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.39820	-0.9595	10	0.72032	D	0.01	.	6.204	0.20591	0.1625:0.1544:0.6831:0.0	.	96	Q8NGP9	O5AR1_HUMAN	T	96	ENSP00000302639:S96T	ENSP00000302639:S96T	S	+	2	0	OR5AR1	56188024	0.001000	0.12720	0.995000	0.50966	0.887000	0.51463	0.532000	0.23067	0.696000	0.31696	-0.254000	0.11334	AGC	-	OR5AR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.512	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AR1	HGNC	protein_coding	OTTHUMT00000334434.1	0	0	0	43	43	90	0.00	0.00	G	NM_001004730		56431448	+1	11	17	29	41	tier1	no_errors	ENST00000302969	ensembl	human	known	74_37	missense	27.50	29.31	SNP	0.048	C	11	29
MAML1	9794	genome.wustl.edu	37	5	179196021	179196021	+	Silent	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr5:179196021G>A	ENST00000292599.3	+	3	2165	c.1902G>A	c.(1900-1902)agG>agA	p.R634R	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGAAACAAAGGGAGCAGCAGC	0.522													ENSG00000161021																																					0													96.0	92.0	93.0					5																	179196021		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1902G>A	5.37:g.179196021G>A				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.R634	ENST00000292599.3	37	c.1902	CCDS34315.1	5																																																																																			-	MAML1	-	NULL		0.522	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000372316.2	0	0	0	27	27	136	0.00	0.00	G	NM_014757		179196021	+1	30	104	128	484	tier1	no_errors	ENST00000292599	ensembl	human	known	74_37	silent	18.99	17.69	SNP	1.000	A	30	128
SEZ6L	23544	genome.wustl.edu	37	22	26747191	26747191	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr22:26747191C>T	ENST00000248933.6	+	12	2676	c.2581C>T	c.(2581-2583)Cgc>Tgc	p.R861C	SEZ6L_ENST00000402979.1_Missense_Mutation_p.R634C|SEZ6L_ENST00000403121.1_Missense_Mutation_p.R634C|SEZ6L_ENST00000360929.3_Intron|SEZ6L_ENST00000529632.2_Missense_Mutation_p.R861C|SEZ6L_ENST00000404234.3_Missense_Mutation_p.R861C|SEZ6L_ENST00000343706.4_Missense_Mutation_p.R861C|SEZ6L_ENST00000411842.2_Missense_Mutation_p.R58C			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	861	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CTGGACGTCTCGCCTGCCCCA	0.532													ENSG00000100095																																					0													112.0	97.0	102.0					22																	26747191		2203	4300	6503	SO:0001583	missense	0			-	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2581C>T	22.37:g.26747191C>T	ENSP00000248933:p.Arg861Cys		A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R861C	ENST00000248933.6	37	c.2581	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	c	19.37	3.815475	0.70912	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979;ENST00000411842	T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	4.54	4.54	0.55810	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.51477	D	0.000083	T	0.75384	0.3842	M	0.79258	2.445	0.52099	D	0.999941	D;D;D;D;D;D	0.71674	0.989;0.991;0.995;0.998;0.98;0.991	P;P;P;P;P;P	0.62382	0.807;0.81;0.901;0.785;0.81;0.81	T	0.78841	-0.2045	10	0.87932	D	0	.	11.711	0.51625	0.1765:0.8235:0.0:0.0	.	861;861;634;861;861;861	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	C	861;861;861;861;634;634;58	ENSP00000384772:R861C;ENSP00000437037:R861C;ENSP00000248933:R861C;ENSP00000342661:R861C;ENSP00000384838:R634C;ENSP00000384733:R634C;ENSP00000397274:R58C	ENSP00000248933:R861C	R	+	1	0	SEZ6L	25077191	0.776000	0.28616	0.967000	0.41034	0.985000	0.73830	1.406000	0.34646	2.381000	0.81170	0.539000	0.68188	CGC	-	SEZ6L	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.532	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	HGNC	protein_coding	OTTHUMT00000320359.3	1	1	0	99	99	103	1.00	0.00	C			26747191	+1	43	24	66	50	tier1	no_errors	ENST00000248933	ensembl	human	known	74_37	missense	39.45	32.43	SNP	0.956	T	43	66
ASCC3	10973	genome.wustl.edu	37	6	101247339	101247339	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr6:101247339T>C	ENST00000369162.2	-	7	1581	c.1237A>G	c.(1237-1239)Atg>Gtg	p.M413V	ASCC3_ENST00000522650.1_Missense_Mutation_p.M413V	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	413					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GATGTTTTCATGGCTTCAGCC	0.368													ENSG00000112249																																					0													118.0	118.0	118.0					6																	101247339		2203	4300	6503	SO:0001583	missense	0			-	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.1237A>G	6.37:g.101247339T>C	ENSP00000358159:p.Met413Val		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M413V	ENST00000369162.2	37	c.1237	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	T	12.51	1.960315	0.34565	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	T;T	0.55930	0.56;0.49	5.31	4.13	0.48395	.	0.156377	0.56097	D	0.000032	T	0.20210	0.0486	N	0.22421	0.69	0.80722	D	1	B;B	0.15473	0.013;0.001	B;B	0.15484	0.013;0.005	T	0.04216	-1.0968	10	0.26408	T	0.33	.	12.1038	0.53801	0.0:0.0:0.1491:0.8509	.	413;413	E7EW23;Q8N3C0	.;HELC1_HUMAN	V	413	ENSP00000358159:M413V;ENSP00000430769:M413V	ENSP00000358159:M413V	M	-	1	0	ASCC3	101354060	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.622000	0.61240	0.843000	0.35070	0.377000	0.23210	ATG	-	ASCC3	-	superfamily_P-loop_NTPase		0.368	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2	0	0	0	47	47	54	0.00	0.00	T	NM_006828		101247339	-1	16	25	28	32	tier1	no_errors	ENST00000369162	ensembl	human	known	74_37	missense	36.36	43.86	SNP	1.000	C	16	28
LOC105372038	105372038	genome.wustl.edu	37	18	24918656	24918656	+	lincRNA	SNP	A	A	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr18:24918656A>G	ENST00000584546.1	-	0	457																											GTCTCTCTAGAGCCTGCCAAG	0.517													ENSG00000264151																																					0																																												0			-																													18.37:g.24918656A>G				R	SNP	-	NULL	ENST00000584546.1	37	NULL		18																																																																																			-	RP11-739N10.1	-	-		0.517	RP11-739N10.1-001	KNOWN	basic	lincRNA	ENSG00000264151	Clone_based_vega_gene	lincRNA	OTTHUMT00000447183.1	0	0	0	19	19	61	0.00	0.00	A			24918656	-1	9	14	10	46	tier1	no_errors	ENST00000580699	ensembl	human	known	74_37	rna	47.37	23.33	SNP	0.001	G	9	10
ZDHHC15	158866	genome.wustl.edu	37	X	74641738	74641738	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chrX:74641738C>G	ENST00000373367.3	-	9	1054	c.824G>C	c.(823-825)gGa>gCa	p.G275A	ZDHHC15_ENST00000373361.3_3'UTR|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.G266A	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	275					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						CTTCTTATCTCCAAACACCTG	0.448													ENSG00000102383																																					0													117.0	103.0	108.0					X																	74641738		2203	4300	6503	SO:0001583	missense	0			-	AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.824G>C	X.37:g.74641738C>G	ENSP00000362465:p.Gly275Ala		B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.G275A	ENST00000373367.3	37	c.824	CCDS14430.1	X	.	.	.	.	.	.	.	.	.	.	c	25.4	4.631510	0.87660	.	.	ENSG00000102383	ENST00000373367;ENST00000541184	T;T	0.60548	0.18;0.4	5.44	5.44	0.79542	.	0.106577	0.64402	D	0.000003	T	0.81969	0.4935	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.86288	0.1672	10	0.62326	D	0.03	-16.0683	17.2382	0.87005	0.0:1.0:0.0:0.0	.	266;275	B3KVG7;Q96MV8	.;ZDH15_HUMAN	A	275;266	ENSP00000362465:G275A;ENSP00000445420:G266A	ENSP00000362465:G275A	G	-	2	0	ZDHHC15	74558463	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.317000	0.79018	2.282000	0.76494	0.597000	0.82753	GGA	-	ZDHHC15	-	NULL		0.448	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC15	HGNC	protein_coding	OTTHUMT00000057283.1	0	0	0	31	31	67	0.00	0.00	C	NM_144969		74641738	-1	6	37	23	38	tier1	no_errors	ENST00000373367	ensembl	human	known	74_37	missense	20.69	49.33	SNP	1.000	G	6	23
ACTA2	59	genome.wustl.edu	37	10	90694720	90694720	+	IGR	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr10:90694720C>T	ENST00000458208.1	-	0	1756				ACTA2-AS1_ENST00000437930.4_RNA|STAMBPL1_ENST00000371927.3_Intron	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta						glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		ACATATCCATCCTAATTGCCA	0.463											OREG0020356	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000180139																																					0																																										SO:0001628	intergenic_variant	0			-	X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700		10.37:g.90694720C>T		1276	B2R8A4|P03996|P04108|Q6FI19	R	SNP	-	NULL	ENST00000458208.1	37	NULL	CCDS7392.1	10																																																																																			-	ACTA2-AS1	-	-		0.463	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2-AS1	HGNC	protein_coding	OTTHUMT00000049264.1	0	0	0	68	68	70	0.00	0.00	C	NM_001613		90694720	+1	32	25	23	46	tier1	no_errors	ENST00000437930	ensembl	human	known	74_37	rna	58.18	35.21	SNP	0.000	T	32	23
MAML1	9794	genome.wustl.edu	37	5	179196072	179196072	+	Silent	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr5:179196072G>A	ENST00000292599.3	+	3	2216	c.1953G>A	c.(1951-1953)caG>caA	p.Q651Q	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGAGGCAACAGCACCTTCTCG	0.502													ENSG00000161021																																					0													72.0	67.0	69.0					5																	179196072		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1953G>A	5.37:g.179196072G>A				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q651	ENST00000292599.3	37	c.1953	CCDS34315.1	5																																																																																			-	MAML1	-	NULL		0.502	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000372316.2	0	0	0	20	20	93	0.00	0.00	G	NM_014757		179196072	+1	22	77	102	394	tier1	no_errors	ENST00000292599	ensembl	human	known	74_37	silent	17.74	16.31	SNP	1.000	A	22	102
OSBPL8	114882	genome.wustl.edu	37	12	76844722	76844722	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:76844722C>G	ENST00000261183.3	-	4	605	c.126G>C	c.(124-126)aaG>aaC	p.K42N	OSBPL8_ENST00000393250.4_5'UTR|OSBPL8_ENST00000393249.2_5'UTR	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	42					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						GCTGACTCATCTTTCCTGGTG	0.428													ENSG00000091039																																					0													160.0	140.0	147.0					12																	76844722		2203	4300	6503	SO:0001583	missense	0			-	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.126G>C	12.37:g.76844722C>G	ENSP00000261183:p.Lys42Asn		A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K42N	ENST00000261183.3	37	c.126	CCDS31862.1	12	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005458	0.74932	.	.	ENSG00000091039	ENST00000261183;ENST00000446075;ENST00000438913;ENST00000547540;ENST00000548341;ENST00000551927;ENST00000547544	T;T;T	0.12255	2.7;2.7;2.7	5.66	3.83	0.44106	.	0.270493	0.36972	N	0.002304	T	0.19525	0.0469	N	0.19112	0.55	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.01725	-1.1287	10	0.59425	D	0.04	-6.9996	9.7585	0.40517	0.0:0.7711:0.0:0.2289	.	42	Q9BZF1	OSBL8_HUMAN	N	42;27;42;42;29;42;39	ENSP00000261183:K42N;ENSP00000450238:K42N;ENSP00000446886:K29N	ENSP00000261183:K42N	K	-	3	2	OSBPL8	75368853	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.250000	0.32850	0.738000	0.32606	-0.136000	0.14681	AAG	-	OSBPL8	-	NULL		0.428	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL8	HGNC	protein_coding	OTTHUMT00000406357.1	0	0	0	63	63	87	0.00	0.00	C	NM_020841		76844722	-1	193	193	63	52	tier1	no_errors	ENST00000261183	ensembl	human	known	74_37	missense	75.10	78.46	SNP	1.000	G	193	63
WEE2	494551	genome.wustl.edu	37	7	141427061	141427061	+	Intron	SNP	T	T	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr7:141427061T>G	ENST00000397541.2	+	10	1798				WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|RNU1-82P_ENST00000390851.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)						female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					TTTTTCCCAATAGTGAAGCTT	0.438													ENSG00000228775																																					0													98.0	96.0	97.0					7																	141427061		1871	4103	5974	SO:0001627	intron_variant	0			-	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.1393-43T>G	7.37:g.141427061T>G				R	SNP	-	NULL	ENST00000397541.2	37	NULL	CCDS43660.1	7																																																																																			-	WEE2-AS1	-	-		0.438	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WEE2-AS1	HGNC	protein_coding	OTTHUMT00000349091.1	0	0	0	85	85	149	0.00	0.00	T	NM_001105558		141427061	-1	19	52	19	38	tier1	no_errors	ENST00000478332	ensembl	human	known	74_37	rna	50.00	57.78	SNP	0.000	G	19	19
KRCC1	51315	genome.wustl.edu	37	2	88327569	88327569	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:88327569C>A	ENST00000347055.3	-	4	907	c.514G>T	c.(514-516)Gag>Tag	p.E172*		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	172	Lys-rich.									cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7						CGCTCCTCCTCTGATTTTTCT	0.428													ENSG00000172086																																					0													120.0	121.0	120.0					2																	88327569		2203	4300	6503	SO:0001587	stop_gained	0			-	AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086			28039	protein-coding gene	gene with protein product						12477932	Standard	XM_005264360		Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.514G>T	2.37:g.88327569C>A	ENSP00000340083:p.Glu172*		Q3B7J7	Nonsense_Mutation	SNP	NULL	p.E172*	ENST00000347055.3	37	c.514	CCDS2000.1	2	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292809	0.60086	.	.	ENSG00000172086	ENST00000347055	.	.	.	5.61	-2.39	0.06602	.	0.828207	0.10740	N	0.639625	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-17.5492	11.1046	0.48194	0.0:0.3505:0.0:0.6495	.	.	.	.	X	172	.	ENSP00000340083:E172X	E	-	1	0	KRCC1	88108684	0.006000	0.16342	0.003000	0.11579	0.200000	0.23975	-0.106000	0.10890	-0.316000	0.08690	-0.355000	0.07637	GAG	-	KRCC1	-	NULL		0.428	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRCC1	HGNC	protein_coding	OTTHUMT00000252664.1	0	0	0	48	48	120	0.00	0.00	C	NM_016618		88327569	-1	5	14	52	72	tier1	no_errors	ENST00000347055	ensembl	human	known	74_37	nonsense	8.77	16.28	SNP	0.001	A	5	52
AGO4	192670	genome.wustl.edu	37	1	36316471	36316471	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr1:36316471C>A	ENST00000373210.3	+	17	2539	c.2294C>A	c.(2293-2295)tCa>tAa	p.S765*	AGO4_ENST00000488778.1_3'UTR	NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	765	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										AGCCGTCCCTCACATTACCAG	0.408													ENSG00000134698																																					0													106.0	93.0	98.0					1																	36316471		2203	4300	6503	SO:0001587	stop_gained	0			-	AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.2294C>A	1.37:g.36316471C>A	ENSP00000362306:p.Ser765*		A7MD27	Nonsense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.S765*	ENST00000373210.3	37	c.2294	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.014058	0.98610	.	.	ENSG00000134698	ENST00000373210	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-9.0679	18.7904	0.91971	0.0:1.0:0.0:0.0	.	.	.	.	X	765	.	ENSP00000362306:S765X	S	+	2	0	EIF2C4	36089058	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.814000	0.86154	2.417000	0.82017	0.591000	0.81541	TCA	-	AGO4	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi		0.408	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO4	HGNC	protein_coding	OTTHUMT00000012213.3	0	0	1	53	53	84	0.00	1.18	C	NM_017629		36316471	+1	4	12	37	48	tier1	no_errors	ENST00000373210	ensembl	human	known	74_37	nonsense	9.76	20.00	SNP	1.000	A	4	37
XIRP2	129446	genome.wustl.edu	37	2	167760312	167760312	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:167760312T>C	ENST00000409728.1	+	2	409	c.320T>C	c.(319-321)aTt>aCt	p.I107T	XIRP2_ENST00000295237.9_Missense_Mutation_p.I107T|XIRP2_ENST00000420519.1_Missense_Mutation_p.I107T|XIRP2_ENST00000409195.1_Missense_Mutation_p.I107T|XIRP2_ENST00000409756.2_Missense_Mutation_p.I107T|XIRP2_ENST00000409043.1_Missense_Mutation_p.I107T	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CGGCGCAGGATTGAACGCTTT	0.512													ENSG00000163092																																					0													123.0	125.0	124.0					2																	167760312		2025	4164	6189	SO:0001583	missense	0			-	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.320T>C	2.37:g.167760312T>C	ENSP00000386619:p.Ile107Thr		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.I107T	ENST00000409728.1	37	c.320	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	T	13.97	2.395624	0.42512	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	D;D;T;D;D;T	0.86164	-2.07;-2.08;3.3;-2.07;-2.08;3.3	5.12	3.95	0.45737	.	.	.	.	.	T	0.78817	0.4343	.	.	.	0.27938	N	0.937636	B;B	0.30709	0.291;0.291	B;B	0.29598	0.104;0.104	T	0.66854	-0.5818	8	0.30078	T	0.28	-5.1548	7.6888	0.28557	0.0:0.0972:0.0:0.9028	.	107;107	A4UGR9-4;A4UGR9-6	.;.	T	107	ENSP00000386454:I107T;ENSP00000386619:I107T;ENSP00000386840:I107T;ENSP00000386724:I107T;ENSP00000415541:I107T;ENSP00000295237:I107T	ENSP00000295237:I107T	I	+	2	0	XIRP2	167468558	0.996000	0.38824	0.771000	0.31576	0.384000	0.30261	3.854000	0.55949	0.796000	0.33947	0.533000	0.62120	ATT	-	XIRP2	-	NULL		0.512	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	0	0	0	68	68	85	0.00	0.00	T	NM_152381		167760312	+1	7	21	35	61	tier1	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	16.67	25.61	SNP	0.942	C	7	35
NABP2	79035	genome.wustl.edu	37	12	56618715	56618715	+	Silent	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:56618715G>A	ENST00000380198.2	+	1	573	c.75G>A	c.(73-75)gaG>gaA	p.E25E	NABP2_ENST00000267023.4_Silent_p.E25E|RNF41_ENST00000552656.1_5'Flank|NABP2_ENST00000341463.5_Silent_p.E25E			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	25					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)										TTGTGCTGGAGACAGGTGTCT	0.572											OREG0021922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000139579																																					0													113.0	102.0	106.0					12																	56618715		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.75G>A	12.37:g.56618715G>A		1016	A6NDF8|Q6XYC8	Silent	SNP	pfam_-bd_OB_tR,superfamily_-bd_OB-fold	p.E25	ENST00000380198.2	37	c.75	CCDS8911.1	12																																																																																			-	BP2	-	superfamily_-bd_OB-fold		0.572	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BP2	HGNC	protein_coding	OTTHUMT00000326610.1	0	0	0	38	38	67	0.00	0.00	G	NM_024068		56618715	+1	30	39	22	55	tier1	no_errors	ENST00000267023	ensembl	human	known	74_37	silent	57.69	41.49	SNP	1.000	A	30	22
LRRFIP1	9208	genome.wustl.edu	37	2	238667417	238667417	+	Intron	SNP	C	C	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:238667417C>G	ENST00000392000.4	+	10	864				LRRFIP1_ENST00000308482.9_Missense_Mutation_p.R424G|LRRFIP1_ENST00000289175.6_Intron|LRRFIP1_ENST00000244815.5_Intron	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1						innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		AAGGAGTGAACGGGATGATCT	0.383													ENSG00000124831																																					0													153.0	145.0	147.0					2																	238667417		1568	3582	5150	SO:0001627	intron_variant	0			-	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.748-1290C>G	2.37:g.238667417C>G			E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_Prefoldin	p.R424G	ENST00000392000.4	37	c.1270	CCDS46552.1	2	.	.	.	.	.	.	.	.	.	.	C	19.07	3.756057	0.69648	.	.	ENSG00000124831	ENST00000308482;ENST00000391999	T	0.41758	0.99	5.62	5.62	0.85841	.	.	.	.	.	T	0.66147	0.2760	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62709	-0.6797	9	0.38643	T	0.18	.	19.0125	0.92879	0.0:1.0:0.0:0.0	.	424	E9PGZ2	.	G	424;414	ENSP00000310109:R424G	ENSP00000310109:R424G	R	+	1	2	LRRFIP1	238332156	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.837000	0.48191	2.804000	0.96469	0.655000	0.94253	CGG	-	LRRFIP1	-	pfam_Leu-rich_rep_flightless-int_pr,superfamily_Prefoldin		0.383	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	HGNC	protein_coding	OTTHUMT00000317198.1	0	0	0	46	46	117	0.00	0.00	C	NM_004735		238667417	+1	15	32	25	105	tier1	no_errors	ENST00000308482	ensembl	human	putative	74_37	missense	37.50	23.36	SNP	1.000	G	15	25
MAML1	9794	genome.wustl.edu	37	5	179195930	179195930	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr5:179195930G>A	ENST00000292599.3	+	3	2074	c.1811G>A	c.(1810-1812)aGc>aAc	p.S604N	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCGTGGCCAGCTCCCACAAC	0.587													ENSG00000161021																																					0													111.0	123.0	119.0					5																	179195930		2203	4300	6503	SO:0001583	missense	0			-	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1811G>A	5.37:g.179195930G>A	ENSP00000292599:p.Ser604Asn			Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.S604N	ENST00000292599.3	37	c.1811	CCDS34315.1	5	.	.	.	.	.	.	.	.	.	.	G	12.94	2.087865	0.36855	.	.	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.49432	0.78	4.59	0.554	0.17241	.	0.442996	0.23754	N	0.044888	T	0.30448	0.0765	L	0.37561	1.115	0.26025	N	0.981812	B;B	0.19445	0.022;0.036	B;B	0.15052	0.004;0.012	T	0.16276	-1.0408	10	0.18710	T	0.47	-10.2703	7.6947	0.28587	0.1317:0.2568:0.6115:0.0	.	641;604	Q59GH4;Q92585	.;MAML1_HUMAN	N	604;641	ENSP00000292599:S604N	ENSP00000292599:S604N	S	+	2	0	MAML1	179128536	1.000000	0.71417	0.967000	0.41034	0.967000	0.64934	1.478000	0.35442	0.342000	0.23796	-0.467000	0.05162	AGC	-	MAML1	-	NULL		0.587	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000372316.2	0	0	0	38	38	105	0.00	0.00	G	NM_014757		179195930	+1	55	83	179	364	tier1	no_errors	ENST00000292599	ensembl	human	known	74_37	missense	23.50	18.44	SNP	0.998	A	55	179
TAF1L	138474	genome.wustl.edu	37	9	32634701	32634701	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr9:32634701G>T	ENST00000242310.4	-	1	966	c.877C>A	c.(877-879)Cag>Aag	p.Q293K	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	293					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCCTGGATCTGCTCTTCCTGT	0.512													ENSG00000122728																																					0													178.0	162.0	167.0					9																	32634701		2203	4300	6503	SO:0001583	missense	0			-	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.877C>A	9.37:g.32634701G>T	ENSP00000418379:p.Gln293Lys		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.Q293K	ENST00000242310.4	37	c.877	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	10.16	1.275179	0.23307	.	.	ENSG00000122728	ENST00000242310	T	0.06933	3.24	1.04	1.04	0.20106	.	0.270901	0.37437	N	0.002090	T	0.03053	0.0090	N	0.08118	0	0.27553	N	0.95044	B	0.09022	0.002	B	0.10450	0.005	T	0.46148	-0.9212	10	0.05959	T	0.93	.	7.4859	0.27432	0.0:0.0:1.0:0.0	.	293	Q8IZX4	TAF1L_HUMAN	K	293	ENSP00000418379:Q293K	ENSP00000418379:Q293K	Q	-	1	0	TAF1L	32624701	0.998000	0.40836	0.996000	0.52242	0.848000	0.48234	2.392000	0.44433	0.507000	0.28148	0.195000	0.17529	CAG	-	TAF1L	-	pirsf_TAF1_animal		0.512	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	0	0	0	82	82	104	0.00	0.00	G			32634701	-1	14	6	49	31	tier1	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	22.22	16.22	SNP	1.000	T	14	49
TET2	54790	genome.wustl.edu	37	4	106158294	106158294	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr4:106158294G>T	ENST00000540549.1	+	3	4055	c.3195G>T	c.(3193-3195)ttG>ttT	p.L1065F	TET2_ENST00000413648.2_Missense_Mutation_p.L1065F|TET2_ENST00000305737.2_Missense_Mutation_p.L1065F|TET2_ENST00000513237.1_Missense_Mutation_p.L1086F|TET2_ENST00000545826.1_Missense_Mutation_p.L1065F|TET2_ENST00000380013.4_Missense_Mutation_p.L1065F|TET2_ENST00000394764.1_Missense_Mutation_p.L1065F			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1065					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TCACAGTTTTGACTAGACAAA	0.433			"""Mis N, F"""		MDS								ENSG00000168769																												Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													80.0	78.0	79.0					4																	106158294		2203	4300	6503	SO:0001583	missense	0			-	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.3195G>T	4.37:g.106158294G>T	ENSP00000442788:p.Leu1065Phe		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.L1065F	ENST00000540549.1	37	c.3195	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132814	0.37630	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	T;T;T;T;T;T;T	0.21932	1.98;1.98;2.5;1.98;1.98;1.98;1.98	5.14	1.44	0.22558	.	1.334490	0.05696	N	0.593216	T	0.40570	0.1122	L	0.49778	1.585	0.21184	N	0.999763	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.981;0.981;0.996	T	0.23190	-1.0195	10	0.72032	D	0.01	.	8.5495	0.33442	0.6877:0.0:0.3123:0.0	.	1086;1065;1065	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	F	1065;1065;1065;1086;1065;1065;1065	ENSP00000306705:L1065F;ENSP00000442788:L1065F;ENSP00000442867:L1065F;ENSP00000425443:L1086F;ENSP00000369351:L1065F;ENSP00000378245:L1065F;ENSP00000391448:L1065F	ENSP00000265149:L1065F	L	+	3	2	TET2	106377743	0.022000	0.18835	0.012000	0.15200	0.944000	0.59088	-0.287000	0.08388	0.022000	0.15160	-0.302000	0.09304	TTG	-	TET2	-	NULL		0.433	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	0	0	0	19	19	84	0.00	0.00	G	NM_017628		106158294	+1	7	20	10	74	tier1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	41.18	21.28	SNP	0.233	T	7	10
NXF4	55999	genome.wustl.edu	37	X	101820660	101820660	+	RNA	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chrX:101820660C>T	ENST00000360035.2	+	0	1262					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						TGGACAGTATCATCCGGGAAT	0.478													ENSG00000196970																																					0																																												0			-	AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101820660C>T				R	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			-	NXF4	-	-		0.478	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	0	0	0	44	44	43	0.00	0.00	C			101820660	+1	79	77	63	39	tier1	no_errors	ENST00000360035	ensembl	human	known	74_37	rna	55.63	66.38	SNP	0.929	T	79	63
SNX17	9784	genome.wustl.edu	37	2	27599243	27599243	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:27599243C>T	ENST00000233575.2	+	13	1468	c.1246C>T	c.(1246-1248)Cca>Tca	p.P416S	SNX17_ENST00000543024.1_Missense_Mutation_p.P202S|SNX17_ENST00000542478.1_Missense_Mutation_p.P202S|ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000537606.1_Missense_Mutation_p.P391S	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	416	FERM-like.|PTB-like F3 module.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTGAAGTCCCCACCACTGCT	0.602													ENSG00000115234																																					0													82.0	83.0	83.0					2																	27599243		2203	4300	6503	SO:0001583	missense	0			-	D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.1246C>T	2.37:g.27599243C>T	ENSP00000233575:p.Pro416Ser		B4DQM7|Q53HN7|Q6IAS3	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,superfamily_FERM_central,smart_Phox,pfscan_Phox,pfscan_Ras-assoc	p.P416S	ENST00000233575.2	37	c.1246	CCDS1750.1	2	.	.	.	.	.	.	.	.	.	.	C	9.114	1.007174	0.19199	.	.	ENSG00000115234	ENST00000233575;ENST00000543024;ENST00000537606;ENST00000542478	T;T;T;T	0.26518	2.15;1.73;1.73;1.73	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.33962	0.0881	L	0.27053	0.805	0.80722	D	1	D;D;D;B	0.89917	1.0;1.0;1.0;0.001	D;D;D;B	0.79108	0.992;0.992;0.992;0.001	T	0.01688	-1.1295	10	0.02654	T	1	-8.7064	17.8169	0.88637	0.0:1.0:0.0:0.0	.	391;404;396;416	B4DQM7;B4DTB8;B4DQ37;Q15036	.;.;.;SNX17_HUMAN	S	416;202;391;202	ENSP00000233575:P416S;ENSP00000441779:P202S;ENSP00000439208:P391S;ENSP00000442567:P202S	ENSP00000233575:P416S	P	+	1	0	SNX17	27452747	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.343000	0.65976	2.797000	0.96272	0.561000	0.74099	CCA	-	SNX17	-	NULL		0.602	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	HGNC	protein_coding	OTTHUMT00000215024.1	0	0	0	32	32	40	0.00	0.00	C	NM_014748		27599243	+1	6	11	22	35	tier1	no_errors	ENST00000233575	ensembl	human	known	74_37	missense	21.43	23.91	SNP	1.000	T	6	22
RPL36A	6173	genome.wustl.edu	37	X	100646802	100646802	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chrX:100646802C>T	ENST00000553110.3	+	3	253	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	RPL36A_ENST00000471855.1_5'UTR|RPL36A_ENST00000427805.2_Missense_Mutation_p.R93W|RPL36A-HNRNPH2_ENST00000409170.3_Silent_p.S67S			P83881	RL36A_HUMAN	ribosomal protein L36a	57					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			liver(4)|lung(1)|prostate(1)	6						GCCGATTTTCCGGAAAAAGGT	0.413													ENSG00000241343																																					0													190.0	156.0	167.0					X																	100646802		2203	4300	6503	SO:0001583	missense	0			-	BC001781	CCDS14483.1, CCDS14483.2	Xq22.1	2011-04-06	2002-01-15	2002-01-18	ENSG00000241343	ENSG00000241343		"""L ribosomal proteins"""	10359	protein-coding gene	gene with protein product		300902	"""ribosomal protein L44"""	RPL44		3461443	Standard	NM_021029		Approved	L36A		P83881	OTTHUMG00000022027	ENST00000553110.3:c.169C>T	X.37:g.100646802C>T	ENSP00000446503:p.Arg57Trp		P09896|P10661|Q08ES5|Q5J9I6	Missense_Mutation	SNP	pfam_Ribosomal_L44e,superfamily_Ribosomal_zn-bd	p.R93W	ENST00000553110.3	37	c.277		X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.04|15.04	2.715346|2.715346	0.48622|0.48622	.|.	.|.	ENSG00000241343|ENSG00000241343;ENSG00000241343;ENSG00000257529	ENST00000392994|ENST00000427805;ENST00000553110;ENST00000409338	.|T;T;T	.|0.47177	.|0.85;0.85;0.85	5.85|5.85	1.79|1.79	0.24919|0.24919	.|Ribosomal protein, zinc-binding domain (1);	.|0.000000	.|0.56097	.|U	.|0.000031	T|T	0.53530|0.53530	0.1802|0.1802	M|M	0.86953|0.86953	2.85|2.85	0.33858|0.33858	D|D	0.63341|0.63341	.|B;B	.|0.13594	.|0.001;0.008	.|B;B	.|0.15870	.|0.001;0.014	T|T	0.63287|0.63287	-0.6671|-0.6671	5|10	.|0.48119	.|T	.|0.1	-18.2697|-18.2697	15.1464|15.1464	0.72657|0.72657	0.6132:0.3868:0.0:0.0|0.6132:0.3868:0.0:0.0	.|.	.|57;57	.|P83881;B2REA7	.|RL36A_HUMAN;.	L|W	75|93;57;68	.|ENSP00000404375:R93W;ENSP00000446503:R57W;ENSP00000386974:R68W	.|ENSP00000386974:R68W	P|R	+|+	2|1	0|2	RPL36A|RPL36A;RP1-164F3.9	100533458|100533458	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.979000|0.979000	0.70002|0.70002	1.239000|1.239000	0.32719|0.32719	0.187000|0.187000	0.20147|0.20147	0.468000|0.468000	0.43344|0.43344	CCG|CGG	-	RPL36A	-	pfam_Ribosomal_L44e,superfamily_Ribosomal_zn-bd		0.413	RPL36A-201	KNOWN	basic|appris_principal	protein_coding	RPL36A	HGNC	protein_coding		0	0	0	24	24	82	0.00	0.00	C	NM_021029		100646802	+1	16	23	9	28	tier1	no_errors	ENST00000427805	ensembl	human	known	74_37	missense	64.00	45.10	SNP	0.999	T	16	9
IRAK1	3654	genome.wustl.edu	37	X	153276177	153276177	+	3'UTR	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chrX:153276177C>T	ENST00000369980.3	-	0	3439				IRAK1_ENST00000477274.1_5'UTR|IRAK1_ENST00000393682.1_3'UTR|IRAK1_ENST00000369974.2_3'UTR	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1						activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AAAATGTTTCCCTTCCCTGTC	0.512													ENSG00000184216																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.*1133G>A	X.37:g.153276177C>T			D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	R	SNP	-	NULL	ENST00000369980.3	37	NULL	CCDS14740.1	X																																																																																			-	IRAK1	-	-		0.512	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK1	HGNC	protein_coding	OTTHUMT00000061143.3	0	0	0	12	12	14	0.00	0.00	C			153276177	-1	11	27	49	150	tier1	no_errors	ENST00000477274	ensembl	human	known	74_37	rna	18.33	15.25	SNP	0.000	T	11	49
EMCN	51705	genome.wustl.edu	37	4	101368702	101368702	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr4:101368702T>C	ENST00000296420.4	-	5	581	c.403A>G	c.(403-405)Aca>Gca	p.T135A	EMCN_ENST00000511970.1_Intron|EMCN_ENST00000305864.3_Missense_Mutation_p.T135A|EMCN_ENST00000502327.1_5'UTR	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	135	Thr-rich.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		GGTATTTCTGTTGTTTTAATT	0.308													ENSG00000164035																																					0													88.0	95.0	93.0					4																	101368702		2201	4299	6500	SO:0001583	missense	0			-	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.403A>G	4.37:g.101368702T>C	ENSP00000296420:p.Thr135Ala		A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Missense_Mutation	SNP	pfam_Endomucin	p.T135A	ENST00000296420.4	37	c.403	CCDS3655.1	4	.	.	.	.	.	.	.	.	.	.	t	12.66	2.005652	0.35415	.	.	ENSG00000164035	ENST00000296420;ENST00000305864;ENST00000506300;ENST00000502569	.	.	.	4.43	1.89	0.25635	.	0.399441	0.18491	N	0.139621	T	0.17195	0.0413	N	0.24115	0.695	0.09310	N	1	P;B	0.40909	0.732;0.35	B;B	0.38264	0.269;0.187	T	0.10613	-1.0622	9	0.62326	D	0.03	-4.8823	4.3427	0.11117	0.0:0.104:0.2035:0.6925	.	135;135	Q9ULC0-2;Q9ULC0	.;MUCEN_HUMAN	A	135;135;62;135	.	ENSP00000296420:T135A	T	-	1	0	EMCN	101587725	0.039000	0.19947	0.001000	0.08648	0.013000	0.08279	-0.269000	0.08596	0.422000	0.26005	0.533000	0.62120	ACA	-	EMCN	-	pfam_Endomucin		0.308	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMCN	HGNC	protein_coding	OTTHUMT00000253699.2	0	0	0	40	40	58	0.00	0.00	T	NM_016242		101368702	-1	8	16	20	24	tier1	no_errors	ENST00000296420	ensembl	human	known	74_37	missense	28.57	40.00	SNP	0.001	C	8	20
ST6GALNAC3	256435	genome.wustl.edu	37	1	76877795	76877795	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr1:76877795A>G	ENST00000328299.3	+	3	464	c.316A>G	c.(316-318)Aga>Gga	p.R106G	ST6GALNAC3_ENST00000464140.1_3'UTR	NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	106					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						CTGCATTTGGAGAATGAACAA	0.468													ENSG00000184005																																					0													124.0	110.0	115.0					1																	76877795		2203	4300	6503	SO:0001583	missense	0			-		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.316A>G	1.37:g.76877795A>G	ENSP00000329214:p.Arg106Gly		Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	pfam_Glyco_trans_29	p.R106G	ENST00000328299.3	37	c.316	CCDS672.1	1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.281915	0.80692	.	.	ENSG00000184005	ENST00000394994;ENST00000328299;ENST00000394993;ENST00000415813	T	0.68624	-0.34	6.17	6.17	0.99709	.	0.106967	0.64402	D	0.000002	D	0.84469	0.5479	M	0.93241	3.395	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.88532	0.3103	10	0.87932	D	0	-8.5966	16.0034	0.80327	1.0:0.0:0.0:0.0	.	41;106;106	B4DM98;Q8NDV1;Q8NDV1-2	.;SIA7C_HUMAN;.	G	106;106;105;40	ENSP00000329214:R106G	ENSP00000329214:R106G	R	+	1	2	ST6GALNAC3	76650383	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.392000	0.59659	2.371000	0.80710	0.533000	0.62120	AGA	-	ST6GALC3	-	pfam_Glyco_trans_29		0.468	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALC3	HGNC	protein_coding	OTTHUMT00000026501.1	0	0	0	51	51	121	0.00	0.00	A	NM_152996		76877795	+1	35	39	44	74	tier1	no_errors	ENST00000328299	ensembl	human	known	74_37	missense	44.30	34.51	SNP	1.000	G	35	44
NABP2	79035	genome.wustl.edu	37	12	56618713	56618713	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:56618713G>A	ENST00000380198.2	+	1	571	c.73G>A	c.(73-75)Gag>Aag	p.E25K	NABP2_ENST00000267023.4_Missense_Mutation_p.E25K|RNF41_ENST00000552656.1_5'Flank|NABP2_ENST00000341463.5_Missense_Mutation_p.E25K			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	25					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)										CATTGTGCTGGAGACAGGTGT	0.572											OREG0021922	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000139579																																					0													115.0	104.0	108.0					12																	56618713		2203	4300	6503	SO:0001583	missense	0			-	BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.73G>A	12.37:g.56618713G>A	ENSP00000369545:p.Glu25Lys	1016	A6NDF8|Q6XYC8	Missense_Mutation	SNP	pfam_-bd_OB_tR,superfamily_-bd_OB-fold	p.E25K	ENST00000380198.2	37	c.73	CCDS8911.1	12	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012345	0.93346	.	.	ENSG00000139579	ENST00000447747;ENST00000399713;ENST00000267023;ENST00000380198;ENST00000341463	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	4.27	4.27	0.50696	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.64402	D	0.000002	T	0.48466	0.1501	M	0.79011	2.435	0.53688	D	0.999972	P;P;P	0.48640	0.913;0.654;0.642	P;P;P	0.58172	0.834;0.604;0.673	T	0.54899	-0.8224	10	0.72032	D	0.01	.	16.0037	0.80327	0.0:0.0:1.0:0.0	.	25;25;25	C9JT95;C9JMP5;Q9BQ15	.;.;SOSB1_HUMAN	K	25	ENSP00000413902:E25K;ENSP00000408616:E25K;ENSP00000267023:E25K;ENSP00000369545:E25K;ENSP00000368862:E25K	ENSP00000267023:E25K	E	+	1	0	OBFC2B	54904980	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.075000	0.89502	2.381000	0.81170	0.557000	0.71058	GAG	-	BP2	-	superfamily_-bd_OB-fold		0.572	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BP2	HGNC	protein_coding	OTTHUMT00000326610.1	0	0	0	38	38	67	0.00	0.00	G	NM_024068		56618713	+1	32	39	23	57	tier1	no_errors	ENST00000267023	ensembl	human	known	74_37	missense	58.18	40.62	SNP	1.000	A	32	23
MMP27	64066	genome.wustl.edu	37	11	102573792	102573792	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr11:102573792T>A	ENST00000260229.4	-	3	490	c.399A>T	c.(397-399)gaA>gaT	p.E133D		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	133					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CTTCTAAACCTTCTTGGATAG	0.383													ENSG00000137675																																					0													112.0	104.0	106.0					11																	102573792		2203	4299	6502	SO:0001583	missense	0			-	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.399A>T	11.37:g.102573792T>A	ENSP00000260229:p.Glu133Asp		Q6UWK6	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.E133D	ENST00000260229.4	37	c.399	CCDS8319.1	11	.	.	.	.	.	.	.	.	.	.	T	9.095	1.002604	0.19121	.	.	ENSG00000137675	ENST00000260229	T	0.22134	1.97	5.0	-1.88	0.07713	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.296561	0.28683	N	0.014486	T	0.07593	0.0191	N	0.10945	0.07	0.21579	N	0.999634	B	0.06786	0.001	B	0.11329	0.006	T	0.16630	-1.0396	10	0.66056	D	0.02	.	0.5138	0.00600	0.3436:0.2833:0.1741:0.1989	.	133	Q9H306	MMP27_HUMAN	D	133	ENSP00000260229:E133D	ENSP00000260229:E133D	E	-	3	2	MMP27	102079002	0.965000	0.33210	0.060000	0.19600	0.083000	0.17756	0.062000	0.14389	-0.210000	0.10140	-0.490000	0.04691	GAA	-	MMP27	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A		0.383	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	HGNC	protein_coding	OTTHUMT00000398128.1	0	0	0	35	35	125	0.00	0.00	T	NM_022122		102573792	-1	9	17	18	95	tier1	no_errors	ENST00000260229	ensembl	human	known	74_37	missense	33.33	15.18	SNP	0.410	A	9	18
KRT78	196374	genome.wustl.edu	37	12	53237971	53237971	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:53237971T>A	ENST00000304620.4	-	6	1016	c.953A>T	c.(952-954)cAt>cTt	p.H318L	KRT78_ENST00000359499.4_Missense_Mutation_p.H208L	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	318	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						CCTGTCCCCATGAAGCTGGGC	0.512													ENSG00000170423																																					0													167.0	151.0	156.0					12																	53237971		2203	4300	6503	SO:0001583	missense	0			-	AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.953A>T	12.37:g.53237971T>A	ENSP00000306261:p.His318Leu		A8K4D6|Q5HYM7|Q7RTT2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.H318L	ENST00000304620.4	37	c.953	CCDS8840.1	12	.	.	.	.	.	.	.	.	.	.	T	16.02	3.004554	0.54254	.	.	ENSG00000170423	ENST00000359499;ENST00000304620;ENST00000539860	D;D	0.89123	-2.47;-2.47	4.65	2.26	0.28386	Filament (1);	0.257284	0.20449	N	0.092137	D	0.92974	0.7764	H	0.96398	3.815	0.09310	N	1	P	0.50528	0.936	P	0.50082	0.63	D	0.86822	0.2005	10	0.87932	D	0	.	6.4542	0.21920	0.0:0.2204:0.0:0.7796	.	318	Q8N1N4	K2C78_HUMAN	L	208;318;89	ENSP00000352479:H208L;ENSP00000306261:H318L	ENSP00000306261:H318L	H	-	2	0	KRT78	51524238	0.959000	0.32827	0.002000	0.10522	0.006000	0.05464	2.747000	0.47475	0.370000	0.24538	0.456000	0.33151	CAT	-	KRT78	-	pfam_IF,prints_Keratin_II		0.512	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT78	HGNC	protein_coding	OTTHUMT00000406380.1	0	0	0	51	51	82	0.00	0.00	T	NM_173352		53237971	-1	9	18	37	59	tier1	no_errors	ENST00000304620	ensembl	human	known	74_37	missense	19.57	23.38	SNP	0.024	A	9	37
TKTL2	84076	genome.wustl.edu	37	4	164393216	164393216	+	Silent	SNP	G	G	T	rs201861103		TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr4:164393216G>T	ENST00000280605.3	-	1	1831	c.1671C>A	c.(1669-1671)ggC>ggA	p.G557G		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	557						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TAACTCGGCCGCCTGTGGCTT	0.507													ENSG00000151005																																					0													107.0	101.0	103.0					4																	164393216		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.1671C>A	4.37:g.164393216G>T			A4FVB4|Q8NCT0|Q96M82	Silent	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.G557	ENST00000280605.3	37	c.1671	CCDS3805.1	4																																																																																			-	TKTL2	-	pfam_Transketolase_C,superfamily_Transketo_C/Pyr-ferredox_oxred		0.507	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL2	HGNC	protein_coding	OTTHUMT00000365207.1	0	0	0	55	55	111	0.00	0.00	G	NM_032136		164393216	-1	38	48	39	60	tier1	no_errors	ENST00000280605	ensembl	human	known	74_37	silent	49.35	44.44	SNP	0.470	T	38	39
OSBPL8	114882	genome.wustl.edu	37	12	76844700	76844700	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:76844700C>G	ENST00000261183.3	-	4	627	c.148G>C	c.(148-150)Gaa>Caa	p.E50Q	OSBPL8_ENST00000393250.4_Missense_Mutation_p.E8Q|OSBPL8_ENST00000393249.2_Missense_Mutation_p.E8Q	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	50					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						GGATAAGCTTCTTTTCCTTGG	0.433													ENSG00000091039																																					0													166.0	142.0	150.0					12																	76844700		2203	4300	6503	SO:0001583	missense	0			-	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.148G>C	12.37:g.76844700C>G	ENSP00000261183:p.Glu50Gln		A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E50Q	ENST00000261183.3	37	c.148	CCDS31862.1	12	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918727	0.92249	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250;ENST00000438913;ENST00000547540;ENST00000548341;ENST00000553139;ENST00000549570;ENST00000551927;ENST00000547544	T;T;T;T;T;T	0.50277	1.4;2.79;1.4;2.79;2.79;0.75	5.7	5.7	0.88788	.	0.352683	0.32231	N	0.006382	T	0.32376	0.0827	N	0.19112	0.55	0.34370	D	0.691953	P	0.41673	0.759	B	0.32289	0.143	T	0.45789	-0.9237	10	0.37606	T	0.19	-12.4206	18.3908	0.90483	0.0:1.0:0.0:0.0	.	50	Q9BZF1	OSBL8_HUMAN	Q	8;50;35;8;50;50;37;8;8;50;47	ENSP00000376939:E8Q;ENSP00000261183:E50Q;ENSP00000376940:E8Q;ENSP00000450238:E50Q;ENSP00000446886:E37Q;ENSP00000449618:E8Q	ENSP00000261183:E50Q	E	-	1	0	OSBPL8	75368831	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	3.324000	0.52022	2.675000	0.91044	0.655000	0.94253	GAA	-	OSBPL8	-	NULL		0.433	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL8	HGNC	protein_coding	OTTHUMT00000406357.1	0	0	0	61	61	96	0.00	0.00	C	NM_020841		76844700	-1	221	208	72	58	tier1	no_errors	ENST00000261183	ensembl	human	known	74_37	missense	75.43	78.20	SNP	1.000	G	221	72
AGO4	192670	genome.wustl.edu	37	1	36316629	36316629	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr1:36316629C>A	ENST00000373210.3	+	17	2697	c.2452C>A	c.(2452-2454)Cat>Aat	p.H818N	AGO4_ENST00000488778.1_3'UTR	NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	818	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										GGCAAGGTATCATCTGGTGGA	0.413													ENSG00000134698																																					0													69.0	63.0	65.0					1																	36316629		2203	4300	6503	SO:0001583	missense	0			-	AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.2452C>A	1.37:g.36316629C>A	ENSP00000362306:p.His818Asn		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.H818N	ENST00000373210.3	37	c.2452	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539731	0.85917	.	.	ENSG00000134698	ENST00000373210	T	0.26518	1.73	5.4	5.4	0.78164	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.56031	0.1958	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.60752	-0.7201	10	0.72032	D	0.01	-18.0048	19.1712	0.93578	0.0:1.0:0.0:0.0	.	818	Q9HCK5	AGO4_HUMAN	N	818	ENSP00000362306:H818N	ENSP00000362306:H818N	H	+	1	0	EIF2C4	36089216	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.526000	0.85167	0.591000	0.81541	CAT	-	AGO4	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi		0.413	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO4	HGNC	protein_coding	OTTHUMT00000012213.3	0	0	0	38	38	93	0.00	0.00	C	NM_017629		36316629	+1	5	14	32	93	tier1	no_errors	ENST00000373210	ensembl	human	known	74_37	missense	13.51	13.08	SNP	1.000	A	5	32
ADAMTS18	170692	genome.wustl.edu	37	16	77325207	77325207	+	Missense_Mutation	SNP	C	C	A	rs199845592		TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr16:77325207C>A	ENST00000282849.5	-	21	3776	c.3358G>T	c.(3358-3360)Gtg>Ttg	p.V1120L	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1120					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ATGTTGTACACTGGATGGGCT	0.493													ENSG00000140873																																					0													120.0	115.0	117.0					16																	77325207		2198	4300	6498	SO:0001583	missense	0			-	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3358G>T	16.37:g.77325207C>A	ENSP00000282849:p.Val1120Leu		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V1120L	ENST00000282849.5	37	c.3358	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	C	2.907	-0.226178	0.06022	.	.	ENSG00000140873	ENST00000282849	T	0.59638	0.25	3.87	1.87	0.25490	.	1.323900	0.04706	N	0.416803	T	0.31513	0.0799	N	0.05510	-0.035	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18681	-1.0329	10	0.11485	T	0.65	.	1.4102	0.02290	0.1794:0.4647:0.1531:0.2029	.	1120	Q8TE60	ATS18_HUMAN	L	1120	ENSP00000282849:V1120L	ENSP00000282849:V1120L	V	-	1	0	ADAMTS18	75882708	0.000000	0.05858	0.094000	0.20943	0.061000	0.15899	0.427000	0.21379	0.249000	0.21456	0.467000	0.42956	GTG	rs199845592	ADAMTS18	-	superfamily_Thrombospondin_1_rpt		0.493	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	0	0	0	50	50	91	0.00	0.00	C			77325207	-1	10	15	35	40	tier1	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	22.22	27.27	SNP	0.001	A	10	35
SNX17	9784	genome.wustl.edu	37	2	27599044	27599044	+	Silent	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:27599044C>T	ENST00000233575.2	+	12	1398	c.1176C>T	c.(1174-1176)atC>atT	p.I392I	SNX17_ENST00000543024.1_Silent_p.I178I|SNX17_ENST00000542478.1_Silent_p.I178I|ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000537606.1_Silent_p.I367I	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	392	FERM-like.|PTB-like F3 module.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGGCAGTATCAGGAAGGTAG	0.517													ENSG00000115234																																					0													131.0	123.0	126.0					2																	27599044		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.1176C>T	2.37:g.27599044C>T			B4DQM7|Q53HN7|Q6IAS3	Silent	SNP	pfam_Phox,superfamily_Phox,superfamily_FERM_central,smart_Phox,pfscan_Phox,pfscan_Ras-assoc	p.I392	ENST00000233575.2	37	c.1176	CCDS1750.1	2																																																																																			-	SNX17	-	NULL		0.517	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	HGNC	protein_coding	OTTHUMT00000215024.1	0	0	0	28	28	80	0.00	0.00	C	NM_014748		27599044	+1	8	18	27	84	tier1	no_errors	ENST00000233575	ensembl	human	known	74_37	silent	22.86	17.65	SNP	1.000	T	8	27
CAMTA1	23261	genome.wustl.edu	37	1	7723936	7723936	+	Silent	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr1:7723936C>T	ENST00000303635.7	+	9	1536	c.1329C>T	c.(1327-1329)gcC>gcT	p.A443A	CAMTA1_ENST00000439411.2_Silent_p.A443A	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	443					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ACAAGTTCGCCTTTCCCACCA	0.652			T	WWTR1	epitheliod hemangioendothelioma								ENSG00000171735																												Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													80.0	79.0	79.0					1																	7723936		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1329C>T	1.37:g.7723936C>T			A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.A443	ENST00000303635.7	37	c.1329	CCDS30576.1	1																																																																																			-	CAMTA1	-	NULL		0.652	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	0	0	0	58	58	24	0.00	0.00	C	NM_015215		7723936	+1	14	4	42	14	tier1	no_errors	ENST00000303635	ensembl	human	known	74_37	silent	25.00	22.22	SNP	1.000	T	14	42
GTF3C1	2975	genome.wustl.edu	37	16	27509985	27509985	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr16:27509985G>A	ENST00000356183.4	-	13	2146	c.2131C>T	c.(2131-2133)Cgc>Tgc	p.R711C	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R711C	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	711					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						ATCCGGAAGCGGACCTGCTCG	0.587													ENSG00000077235																																					0													191.0	170.0	177.0					16																	27509985		2197	4300	6497	SO:0001583	missense	0			-	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.2131C>T	16.37:g.27509985G>A	ENSP00000348510:p.Arg711Cys		B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.R711C	ENST00000356183.4	37	c.2131	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	G	28.9	4.964200	0.92791	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.28255	1.62	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.58438	0.2122	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.62572	-0.6826	10	0.87932	D	0	-22.4169	18.584	0.91182	0.0:0.0:1.0:0.0	.	711;711	Q12789;Q12789-3	TF3C1_HUMAN;.	C	711;709	ENSP00000348510:R711C	ENSP00000348510:R711C	R	-	1	0	GTF3C1	27417486	1.000000	0.71417	0.931000	0.37212	0.995000	0.86356	9.281000	0.95811	2.478000	0.83669	0.563000	0.77884	CGC	-	GTF3C1	-	NULL		0.587	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	0	0	0	49	49	92	0.00	0.00	G	NM_001520		27509985	-1	6	12	40	45	tier1	no_errors	ENST00000356183	ensembl	human	known	74_37	missense	13.04	21.05	SNP	0.999	A	6	40
MTMR12	54545	genome.wustl.edu	37	5	32248179	32248179	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr5:32248179A>T	ENST00000382142.3	-	10	1120	c.950T>A	c.(949-951)cTg>cAg	p.L317Q	MTMR12_ENST00000264934.5_Missense_Mutation_p.L317Q|MTMR12_ENST00000280285.5_Missense_Mutation_p.L317Q	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	317	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						GTTGCTTGACAGGTCTTCCGT	0.373													ENSG00000150712																																					0													129.0	122.0	124.0					5																	32248179		2203	4300	6503	SO:0001583	missense	0			-	AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.950T>A	5.37:g.32248179A>T	ENSP00000371577:p.Leu317Gln		Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	pfam_Myotubularin_assoc	p.L317Q	ENST00000382142.3	37	c.950	CCDS34138.1	5	.	.	.	.	.	.	.	.	.	.	A	18.07	3.540928	0.65085	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	D;D;D	0.90620	-2.7;-2.7;-2.7	5.46	4.31	0.51392	Myotubularin phosphatase domain (1);	3.019940	0.01217	N	0.007990	D	0.95837	0.8645	M	0.78637	2.42	0.47698	D	0.999492	P;D;D	0.89917	0.731;1.0;1.0	P;D;D	0.91635	0.549;0.999;0.998	D	0.83663	0.0162	10	0.66056	D	0.02	.	10.9236	0.47180	0.9261:0.0:0.0739:0.0	.	317;317;317	Q9C0I1-3;Q9C0I1-2;Q9C0I1	.;.;MTMRC_HUMAN	Q	317	ENSP00000280285:L317Q;ENSP00000371577:L317Q;ENSP00000264934:L317Q	ENSP00000264934:L317Q	L	-	2	0	MTMR12	32283936	0.997000	0.39634	0.429000	0.26710	0.979000	0.70002	3.939000	0.56591	1.023000	0.39654	0.533000	0.62120	CTG	-	MTMR12	-	NULL		0.373	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	HGNC	protein_coding	OTTHUMT00000366579.1	0	0	0	38	38	101	0.00	0.00	A	NM_019061		32248179	-1	34	91	24	66	tier1	no_errors	ENST00000382142	ensembl	human	known	74_37	missense	58.62	57.96	SNP	0.781	T	34	24
BCR	613	genome.wustl.edu	37	22	23626245	23626245	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr22:23626245G>T	ENST00000305877.8	+	9	2948	c.2197G>T	c.(2197-2199)Gac>Tac	p.D733Y	BCR_ENST00000359540.3_Missense_Mutation_p.D733Y	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	733	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.			D -> E (in Ref. 4; CAA26441). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CCTGTTCACCGACCTGCTTCT	0.637			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								ENSG00000186716																												Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													42.0	37.0	39.0					22																	23626245		2203	4300	6503	SO:0001583	missense	0			-		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2197G>T	22.37:g.23626245G>T	ENSP00000303507:p.Asp733Tyr		P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_dom,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RhoGAP_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.D733Y	ENST00000305877.8	37	c.2197	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790092	0.50102	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149;ENST00000427791	T;T;T	0.37411	1.2;1.2;2.61	5.64	4.63	0.57726	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.63674	0.2531	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.70916	-0.4742	10	0.87932	D	0	.	13.9834	0.64319	0.0727:0.0:0.9273:0.0	.	322;398;351;733;733	B4E065;Q12843;Q12844;P11274-2;P11274	.;.;.;.;BCR_HUMAN	Y	733;733;398;217	ENSP00000303507:D733Y;ENSP00000352535:D733Y;ENSP00000396531:D217Y	ENSP00000303507:D733Y	D	+	1	0	BCR	21956245	1.000000	0.71417	0.892000	0.35008	0.037000	0.13140	7.742000	0.85008	1.546000	0.49388	-0.136000	0.14681	GAC	-	BCR	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.637	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	0	0	0	68	68	33	0.00	0.00	G	NM_004327		23626245	+1	33	11	43	23	tier1	no_errors	ENST00000305877	ensembl	human	known	74_37	missense	43.42	32.35	SNP	0.997	T	33	43
PPFIBP2	8495	genome.wustl.edu	37	11	7670079	7670079	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr11:7670079delG	ENST00000299492.4	+	19	2234	c.1846delG	c.(1846-1848)gtgfs	p.V616fs	PPFIBP2_ENST00000533792.1_Frame_Shift_Del_p.V458fs|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_Frame_Shift_Del_p.V504fs|PPFIBP2_ENST00000530181.1_Frame_Shift_Del_p.V473fs	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	616	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TGTTTTAGCAGTGAAAGCCAT	0.428													ENSG00000166387																																					0													167.0	172.0	170.0					11																	7670079		2201	4296	6497	SO:0001589	frameshift_variant	0				AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1846delG	11.37:g.7670079delG	ENSP00000299492:p.Val616fs		B7Z433|E9PK77|O75337|Q8WW26	Frame_Shift_Del	DEL	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_D-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.V616fs	ENST00000299492.4	37	c.1846	CCDS31419.1	11																																																																																				PPFIBP2	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.428	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	0	0	0	15	15	129	0.00	0.00	G	NM_003621		7670079	+1	8	17	12	100	tier1	no_errors	ENST00000299492	ensembl	human	known	74_37	frame_shift_del	40.00	14.53	DEL	0.985	-	8	12
METTL21B	25895	genome.wustl.edu	37	12	58164954	58164954	+	5'Flank	DEL	G	G	-			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:58164954delG	ENST00000300209.8	+	0	0				METTL1_ENST00000257848.7_Frame_Shift_Del_p.P66fs|RP11-571M6.15_ENST00000471530.1_5'Flank|METTL21B_ENST00000333012.5_5'Flank|METTL21B_ENST00000551420.1_5'Flank|METTL1_ENST00000548681.1_5'UTR|METTL1_ENST00000324871.7_Frame_Shift_Del_p.P66fs|METTL21B_ENST00000548256.1_5'Flank	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						CTTATCCTTTGGGTCATCGTG	0.498													ENSG00000037897																																					0													128.0	102.0	110.0					12																	58164954		2203	4300	6503	SO:0001631	upstream_gene_variant	0				AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58164954delG	Exception_encountered		Q9H749|Q9Y3W2	Frame_Shift_Del	DEL	pfam_tR_(Gua-N-7)_MeTrfase,tigrfam_tR_(Gua-N-7)_MeTrfase	p.P66fs	ENST00000300209.8	37	c.197	CCDS8957.1	12																																																																																				METTL1	-	pfam_tR_(Gua-N-7)_MeTrfase		0.498	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL1	HGNC	protein_coding	OTTHUMT00000409268.1	0	0	0	106	106	44	0.00	0.00	G	NM_015433		58164954	-1	29	9	157	54	tier1	no_errors	ENST00000324871	ensembl	human	known	74_37	frame_shift_del	15.59	14.29	DEL	1.000	-	29	157
LRTM2	654429	genome.wustl.edu	37	12	1943689	1943689	+	Silent	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:1943689G>A	ENST00000543818.1	+	5	1757	c.915G>A	c.(913-915)agG>agA	p.R305R	CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000588077.1_Intron|CACNA2D4_ENST00000382722.5_Intron|LRTM2_ENST00000299194.1_Silent_p.R305R|CACNA2D4_ENST00000586184.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000587995.1_Intron|LRTM2_ENST00000535041.1_Silent_p.R305R	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	305						integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			CGAGCGTGAGGCGAGCCATGG	0.677													ENSG00000166159																																					0													40.0	38.0	39.0					12																	1943689		2180	4248	6428	SO:0001819	synonymous_variant	0			-	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.915G>A	12.37:g.1943689G>A			A7E2U6	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R305	ENST00000543818.1	37	c.915	CCDS31726.1	12	.	.	.	.	.	.	.	.	.	.	G	2.295	-0.361601	0.05103	.	.	ENSG00000166159	ENST00000424079	.	.	.	5.44	-0.503	0.12000	.	.	.	.	.	T	0.67767	0.2928	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68784	-0.5317	5	0.66056	D	0.02	.	10.6057	0.45392	0.0:0.4395:0.2996:0.2609	.	.	.	.	T	62	.	ENSP00000394967:A62T	A	+	1	0	LRTM2	1813950	1.000000	0.71417	0.980000	0.43619	0.068000	0.16541	0.726000	0.25984	0.003000	0.14656	-0.175000	0.13238	GCG	-	LRTM2	-	NULL		0.677	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1	0	0	0	40	40	14	0.00	0.00	G			1943689	+1	29	2	31	5	tier1	no_errors	ENST00000299194	ensembl	human	known	74_37	silent	48.33	28.57	SNP	0.996	A	29	31
KRT8	3856	genome.wustl.edu	37	12	53292604	53292604	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr12:53292604G>T	ENST00000552551.1	-	7	1493	c.1061C>A	c.(1060-1062)tCc>tAc	p.S354Y	KRT8_ENST00000546897.1_Missense_Mutation_p.S354Y|KRT8_ENST00000552150.1_Missense_Mutation_p.S382Y|KRT8_ENST00000293308.6_Missense_Mutation_p.S354Y			P05787	K2C8_HUMAN	keratin 8	354	Coil 2.|Necessary for interaction with PNN.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTCCAGCTCGGACAACTTGGC	0.642													ENSG00000170421																																					0													53.0	53.0	53.0					12																	53292604		2203	4300	6503	SO:0001583	missense	0			-	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.1061C>A	12.37:g.53292604G>T	ENSP00000447566:p.Ser354Tyr		A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.S354Y	ENST00000552551.1	37	c.1061	CCDS8841.1	12	.	.	.	.	.	.	.	.	.	.	G	7.824	0.718488	0.15372	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000546897;ENST00000552150	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	3.85	-0.795	0.10915	Filament (1);	0.861931	0.10292	N	0.692201	D	0.83667	0.5304	M	0.84082	2.675	0.09310	N	1	B;B	0.32526	0.323;0.374	B;P	0.45037	0.272;0.467	T	0.78909	-0.2018	10	0.72032	D	0.01	.	12.7756	0.57445	0.0:0.0:0.392:0.608	.	382;354	F8VXB4;P05787	.;K2C8_HUMAN	Y	354;354;354;382	ENSP00000447566:S354Y;ENSP00000293308:S354Y;ENSP00000447402:S354Y;ENSP00000449404:S382Y	ENSP00000293308:S354Y	S	-	2	0	KRT8	51578871	0.000000	0.05858	0.286000	0.24833	0.001000	0.01503	0.358000	0.20216	0.029000	0.15352	-1.431000	0.01090	TCC	-	KRT8	-	pfam_IF,prints_Keratin_II,prints_Keratin_I		0.642	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT8	HGNC	protein_coding	OTTHUMT00000406385.1	0	0	0	55	55	6	0.00	0.00	G	NM_002273		53292604	-1	14	3	42	2	tier1	no_errors	ENST00000293308	ensembl	human	known	74_37	missense	25.00	60.00	SNP	0.035	T	14	42
SPECC1	92521	genome.wustl.edu	37	17	20000011	20000011	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr17:20000011G>A	ENST00000261503.5	+	2	98	c.47G>A	c.(46-48)gGc>gAc	p.G16D	SPECC1_ENST00000395529.3_Missense_Mutation_p.G16D|SPECC1_ENST00000395527.4_Missense_Mutation_p.G16D|SPECC1_ENST00000472876.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	16					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AGAGCAGGGGGCCACGGCCCA	0.577													ENSG00000128487																																					0													68.0	77.0	74.0					17																	20000011		2203	4300	6503	SO:0001583	missense	0			-	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.47G>A	17.37:g.20000011G>A	ENSP00000261503:p.Gly16Asp		B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.G16D	ENST00000261503.5	37	c.47	CCDS32590.1	17	.	.	.	.	.	.	.	.	.	.	G	5.235	0.228755	0.09916	.	.	ENSG00000128487	ENST00000395530;ENST00000413167;ENST00000261503;ENST00000395529	T;T	0.63417	-0.04;2.95	4.95	2.76	0.32466	.	0.231809	0.36972	N	0.002312	T	0.46367	0.1389	N	0.19112	0.55	0.80722	D	1	B;B	0.19200	0.034;0.02	B;B	0.21708	0.036;0.016	T	0.46261	-0.9204	10	0.52906	T	0.07	-1.5994	11.9381	0.52884	0.0:0.3338:0.6662:0.0	.	16;16	Q5M775-2;Q5M775	.;CYTSB_HUMAN	D	16	ENSP00000261503:G16D;ENSP00000378900:G16D	ENSP00000261503:G16D	G	+	2	0	SPECC1	19940603	1.000000	0.71417	0.922000	0.36590	0.044000	0.14063	1.291000	0.33330	1.185000	0.42971	0.563000	0.77884	GGC	-	SPECC1	-	NULL		0.577	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1	HGNC	protein_coding	OTTHUMT00000441206.1	0	0	0	50	50	13	0.00	0.00	G	NM_152904		20000011	+1	24	8	43	9	tier1	no_errors	ENST00000261503	ensembl	human	known	74_37	missense	35.82	47.06	SNP	0.925	A	24	43
PAPPA2	60676	genome.wustl.edu	37	1	176525573	176525573	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr1:176525573C>A	ENST00000367662.3	+	2	1279	c.115C>A	c.(115-117)Cac>Aac	p.H39N	PAPPA2_ENST00000367661.3_Missense_Mutation_p.H39N	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	39					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TGAGAGGGAACACCTGAATCA	0.542													ENSG00000116183																																					0													92.0	92.0	92.0					1																	176525573		2010	4188	6198	SO:0001583	missense	0			-	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.115C>A	1.37:g.176525573C>A	ENSP00000356634:p.His39Asn		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.H39N	ENST00000367662.3	37	c.115	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.499355	0.26861	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.32023	4.74;1.47	4.82	2.89	0.33648	.	0.478571	0.18015	U	0.154422	T	0.28896	0.0717	M	0.65975	2.015	0.09310	N	1	B;B	0.29432	0.067;0.244	B;B	0.27500	0.012;0.08	T	0.28933	-1.0028	10	0.72032	D	0.01	-1.1232	5.8938	0.18927	0.1886:0.7113:0.0:0.1001	.	39;39	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	N	39	ENSP00000356634:H39N;ENSP00000356633:H39N	ENSP00000356633:H39N	H	+	1	0	PAPPA2	174792196	0.006000	0.16342	0.042000	0.18584	0.969000	0.65631	0.561000	0.23515	0.427000	0.26145	0.561000	0.74099	CAC	-	PAPPA2	-	NULL		0.542	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	0	0	0	67	67	113	0.00	0.00	C			176525573	+1	13	14	86	133	tier1	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	13.13	9.52	SNP	0.045	A	13	86
COX20	116228	genome.wustl.edu	37	1	245005524	245005524	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr1:245005524G>C	ENST00000411948.2	+	3	578	c.185G>C	c.(184-186)gGa>gCa	p.G62A	HNRNPU-AS1_ENST00000475997.1_RNA|COX20_ENST00000498262.1_3'UTR|COX20_ENST00000366528.3_Missense_Mutation_p.G74A	NM_198076.4	NP_932342.1	Q5RI15	COX20_HUMAN	COX20 cytochrome C oxidase assembly factor	62						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											TGTGATGTTGGAGTAGGAGGG	0.303													ENSG00000203667																																					0													161.0	148.0	152.0					1																	245005524		2203	4300	6503	SO:0001583	missense	0			-	BC062419	CCDS31080.1	1q44	2013-05-24	2013-05-23	2012-02-24	ENSG00000203667	ENSG00000203667		"""Mitochondrial respiratory chain complex assembly factors"""	26970	protein-coding gene	gene with protein product		614698	"""family with sequence similarity 36, member A"", ""COX20 Cox2 chaperone homolog (S. cerevisiae)"""	FAM36A		22356826, 23125284	Standard	NM_198076		Approved	FLJ43269	uc001iar.3	Q5RI15	OTTHUMG00000040401	ENST00000411948.2:c.185G>C	1.37:g.245005524G>C	ENSP00000406327:p.Gly62Ala		Q8WV86	Missense_Mutation	SNP	pfam_Cox20/FAM36A,prints_FAM36A	p.G62A	ENST00000411948.2	37	c.185	CCDS31080.1	1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632430	0.46944	.	.	ENSG00000203667	ENST00000411948;ENST00000366528	.	.	.	5.86	3.85	0.44370	.	0.218255	0.46442	N	0.000281	T	0.37293	0.0998	N	0.05078	-0.115	0.44485	D	0.997428	B	0.09022	0.002	B	0.12837	0.008	T	0.11991	-1.0565	9	0.19590	T	0.45	-13.8475	17.8466	0.88732	0.0:0.3386:0.6613:0.0	.	62	Q5RI15	FA36A_HUMAN	A	62;74	.	ENSP00000355486:G74A	G	+	2	0	FAM36A	243072147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.672000	0.37523	1.465000	0.48006	0.585000	0.79938	GGA	-	COX20	-	pfam_Cox20/FAM36A,prints_FAM36A		0.303	COX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX20	HGNC	protein_coding	OTTHUMT00000097174.1	0	0	0	45	45	111	0.00	0.00	G	NM_198076		245005524	+1	4	9	27	83	tier1	no_errors	ENST00000411948	ensembl	human	known	74_37	missense	12.90	9.78	SNP	1.000	C	4	27
EGR1	1958	genome.wustl.edu	37	5	137801710	137801710	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr5:137801710A>C	ENST00000239938.4	+	1	532	c.260A>C	c.(259-261)aAc>aCc	p.N87T		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	87					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			agcaCCTTCAACCCTCAGGCG	0.706													ENSG00000120738																																					0													12.0	11.0	11.0					5																	137801710		2129	4186	6315	SO:0001583	missense	0			-	M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.260A>C	5.37:g.137801710A>C	ENSP00000239938:p.Asn87Thr			Missense_Mutation	SNP	pfam_DUF3432,pfam_DUF3446,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N87T	ENST00000239938.4	37	c.260	CCDS4206.1	5	.	.	.	.	.	.	.	.	.	.	A	10.71	1.427928	0.25726	.	.	ENSG00000120738	ENST00000535792;ENST00000411801;ENST00000239938	T	0.08282	3.11	5.16	5.16	0.70880	.	0.191643	0.37715	N	0.001970	T	0.05823	0.0152	L	0.36672	1.1	0.26020	N	0.981888	P;B	0.39480	0.675;0.16	B;B	0.28553	0.091;0.066	T	0.38090	-0.9677	10	0.20519	T	0.43	-29.4828	11.3074	0.49342	1.0:0.0:0.0:0.0	.	87;87	B4DNX4;P18146	.;EGR1_HUMAN	T	87	ENSP00000239938:N87T	ENSP00000239938:N87T	N	+	2	0	EGR1	137829609	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	4.137000	0.58010	2.171000	0.68590	0.459000	0.35465	AAC	-	EGR1	-	NULL		0.706	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR1	HGNC	protein_coding	OTTHUMT00000251274.1	0	0	0	45	45	7	0.00	0.00	A	NM_001964		137801710	+1	14	0	60	8	tier1	no_errors	ENST00000239938	ensembl	human	known	74_37	missense	18.92	0.00	SNP	0.997	C	14	60
ATXN3	4287	genome.wustl.edu	37	14	92537357	92537358	+	In_Frame_Ins	INS	-	-	CTGCTGCTGCTGCTGCTG			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr14:92537357_92537358insCTGCTGCTGCTGCTGCTG	ENST00000532032.1	-	10	921_922	c.912_913insCAGCAGCAGCAGCAGCAG	c.(910-915)cagcag>cagCAGCAGCAGCAGCAGCAGcag	p.304_305QQ>QQQQQQQQ	ATXN3_ENST00000502250.1_In_Frame_Ins_p.125_126QQ>QQQQQQQQ|ATXN3_ENST00000429774.2_In_Frame_Ins_p.297_298QQ>QQQQQQQQ|ATXN3_ENST00000340660.6_In_Frame_Ins_p.249_250QQ>QQQQQQQQ|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000545170.1_In_Frame_Ins_p.313_314QQ>QQQQQQQQ|ATXN3_ENST00000393287.5_In_Frame_Ins_p.304_305QQ>QQQQQQQQ|ATXN3_ENST00000503767.1_In_Frame_Ins_p.289_290QQ>QQQQQQQQ			P54252	ATX3_HUMAN	ataxin 3	304	Poly-Gln.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		AGGTCCCCctgctgctgctgct	0.446													ENSG00000066427																									Esophageal Squamous(190;752 2094 29897 44875 49530)												0																																										SO:0001652	inframe_insertion	0				U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.895_912dupCAGCAGCAGCAGCAGCAG	14.37:g.92537357_92537358insCTGCTGCTGCTGCTGCTG	ENSP00000437157:p.Gln299_Gln304dup		A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	In_Frame_Ins	INS	pfam_Josephin,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Josephin,pfscan_Ubiquitin-int_motif,prints_Josephin	p.314in_frame_insQQQQQQ	ENST00000532032.1	37	c.940_939		14																																																																																				ATXN3	-	NULL		0.446	ATXN3-015	KNOWN	basic	protein_coding	ATXN3	HGNC	protein_coding	OTTHUMT00000388065.1	0	0	0	3	3	3	0.00	0.00	-	NM_004993		92537358	-1	0	0	2	2	tier1	no_errors	ENST00000545170	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.831:0.984	CTGCTGCTGCTGCTGCTG	0	2
FAM230B	642633	genome.wustl.edu	37	22	21538275	21538275	+	RNA	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr22:21538275C>T	ENST00000451257.1	+	0	1261									family with sequence similarity 230, member B (non-protein coding)																		CCAACGAGGACGCCGCCCAGG	0.716													ENSG00000215498																																					0																																												0			-	BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538275C>T				R	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			-	FAM230B	-	-		0.716	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	0	0	0	18	18	0	0.00	0.00	C	NR_108107		21538275	+1	5	0	22	0	tier1	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	18.52	0.00	SNP	0.000	T	5	22
KIF26A	26153	genome.wustl.edu	37	14	104640551	104640551	+	Silent	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr14:104640551C>T	ENST00000423312.2	+	11	2097	c.2097C>T	c.(2095-2097)atC>atT	p.I699I	KIF26A_ENST00000315264.7_Silent_p.I560I	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	699	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CCACCATGATCGCCCACGTGT	0.677													ENSG00000066735																																					0													16.0	23.0	21.0					14																	104640551		2169	4250	6419	SO:0001819	synonymous_variant	0			-	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2097C>T	14.37:g.104640551C>T			Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.I699	ENST00000423312.2	37	c.2097	CCDS45171.1	14																																																																																			-	KIF26A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom		0.677	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	0	0	0	75	75	0	0.00	0.00	C			104640551	+1	33	0	56	5	tier1	no_errors	ENST00000423312	ensembl	human	known	74_37	silent	37.08	0.00	SNP	0.834	T	33	56
ARID1B	57492	genome.wustl.edu	37	6	157099426	157099427	+	In_Frame_Ins	INS	-	-	CAGCAG	rs78253128	byFrequency	TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr6:157099426_157099427insCAGCAG	ENST00000350026.5	+	1	364_365	c.363_364insCAGCAG	c.(364-366)cag>CAGCAGcag	p.122_122Q>QQQ	ARID1B_ENST00000275248.4_In_Frame_Ins_p.64_64Q>QQQ|MIR4466_ENST00000606121.1_RNA|RP11-230C9.2_ENST00000603191.1_lincRNA|ARID1B_ENST00000346085.5_In_Frame_Ins_p.122_122Q>QQQ|RP11-230C9.3_ENST00000604792.1_RNA|ARID1B_ENST00000367148.1_In_Frame_Ins_p.122_122Q>QQQ	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	122	Gln-rich.|Poly-Gln.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		agcagcagcaacagcagcagca	0.644													ENSG00000049618																																					0																																										SO:0001652	inframe_insertion	0				AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.376_381dupCAGCAG	6.37:g.157099427_157099432dupCAGCAG	ENSP00000055163:p.GlnGln130dup		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	In_Frame_Ins	INS	pfam_DUF3518,pfam_ARID/BRIGHT_D-bd,superfamily_ARID/BRIGHT_D-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd	p.125in_frame_insQQ	ENST00000350026.5	37	c.363_364	CCDS5251.2	6																																																																																				ARID1B	-	NULL		0.644	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	0	0	0	0	0	0	0.00	0.00	-	NM_020732		157099427	+1	2	2	3	3	tier1	no_errors	ENST00000367148	ensembl	human	known	74_37	in_frame_ins	40.00	40.00	INS	0.847:0.974	CAGCAG	2	3
TMC6	11322	genome.wustl.edu	37	17	76113990	76113990	+	Silent	SNP	C	C	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr17:76113990C>T	ENST00000590602.1	-	16	2073	c.1914G>A	c.(1912-1914)gcG>gcA	p.A638A	TMC6_ENST00000592076.1_Intron|TMC6_ENST00000591436.1_Silent_p.A217A|TMC6_ENST00000322933.4_Silent_p.A217A|TMC6_ENST00000322914.3_Silent_p.A638A|TMC6_ENST00000392467.3_Silent_p.A638A|TMC6_ENST00000306591.7_Intron			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	638					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GCCGGCGCGGCGCCTGGCAGT	0.682													ENSG00000141524																																					0													26.0	24.0	25.0					17																	76113990		2199	4295	6494	SO:0001819	synonymous_variant	0			-	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.1914G>A	17.37:g.76113990C>T			O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Silent	SNP	pfam_TMC	p.A638	ENST00000590602.1	37	c.1914	CCDS32748.1	17																																																																																			-	TMC6	-	pfam_TMC		0.682	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMC6	HGNC	protein_coding	OTTHUMT00000437146.1	0	0	0	22	22	2	0.00	0.00	C			76113990	-1	14	3	15	1	tier1	no_errors	ENST00000322914	ensembl	human	known	74_37	silent	46.67	75.00	SNP	0.558	T	14	15
ASAP2	8853	genome.wustl.edu	37	2	9496213	9496213	+	Silent	SNP	G	G	A			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:9496213G>A	ENST00000281419.3	+	13	1489	c.1149G>A	c.(1147-1149)caG>caA	p.Q383Q	ASAP2_ENST00000315273.4_Silent_p.Q383Q	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	383	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AAGATGAACAGGAATGTCAAA	0.423													ENSG00000151693																																					0													200.0	189.0	193.0					2																	9496213		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1149G>A	2.37:g.9496213G>A			D6W4Y8	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.Q383	ENST00000281419.3	37	c.1149	CCDS1661.1	2																																																																																			-	ASAP2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.423	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	0	0	0	63	63	147	0.00	0.00	G	NM_003887		9496213	+1	12	3	48	89	tier1	no_errors	ENST00000281419	ensembl	human	known	74_37	silent	20.00	3.26	SNP	1.000	A	12	48
CWC22	57703	genome.wustl.edu	37	2	180819049	180819049	+	Silent	SNP	G	G	T			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr2:180819049G>T	ENST00000410053.3	-	16	1871	c.1572C>A	c.(1570-1572)tcC>tcA	p.S524S	CWC22_ENST00000295749.6_Silent_p.S524S	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	524	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						TACCTTCAAAGGATTCCATGT	0.308													ENSG00000163510																																					0													109.0	100.0	102.0					2																	180819049		1836	4081	5917	SO:0001819	synonymous_variant	0			-		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.1572C>A	2.37:g.180819049G>T			Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Silent	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.S524	ENST00000410053.3	37	c.1572	CCDS46465.1	2																																																																																			-	CWC22	-	pfam_Initiation_fac_eIF4g_MI,smart_Initiation_fac_eIF4g_MI		0.308	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	HGNC	protein_coding	OTTHUMT00000334537.1	0	0	0	40	40	124	0.00	0.00	G	NM_020943		180819049	-1	4	2	27	71	tier1	no_errors	ENST00000295749	ensembl	human	known	74_37	silent	12.90	2.70	SNP	0.886	T	4	27
SLC26A7	115111	genome.wustl.edu	37	8	92407428	92407428	+	3'UTR	SNP	C	C	G			TCGA-DX-A3LY-01B-11D-A27P-09	TCGA-DX-A3LY-10B-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	df4366c4-170f-4233-b577-a8ea277b069c	f1611d3f-a7d1-42ab-b07c-27d0ce090948	g.chr8:92407428C>G	ENST00000276609.3	+	0	2313				SLC26A7_ENST00000523719.1_3'UTR|SLC26A7_ENST00000520249.1_3'UTR	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CTACAGATGACCTCTGCTACA	0.393													ENSG00000147606																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.*103C>G	8.37:g.92407428C>G				R	SNP	-	NULL	ENST00000276609.3	37	NULL	CCDS6254.1	8																																																																																			-	SLC26A7	-	-		0.393	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC26A7	HGNC	protein_coding	OTTHUMT00000377011.1	0	0	0	40	40	102	0.00	0.00	C			92407428	+1	6	2	28	65	tier1	no_errors	ENST00000520249	ensembl	human	known	74_37	rna	17.65	2.99	SNP	0.001	G	6	28
