#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SAR1A	56681	genome.wustl.edu	37	10	71921382	71921382	+	Silent	SNP	T	T	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr10:71921382T>C	ENST00000373242.2	-	4	367	c.171A>G	c.(169-171)ctA>ctG	p.L57L	SAR1A_ENST00000373236.1_Silent_p.L57L|SAR1A_ENST00000373241.4_Silent_p.L57L|SAR1A_ENST00000373238.1_Silent_p.L57L|SAR1A_ENST00000458634.2_Silent_p.L14L|SAR1A_ENST00000477464.1_5'UTR|SAR1A_ENST00000431664.2_Silent_p.L57L	NM_001142648.1	NP_001136120.1	Q9NR31	SAR1A_HUMAN	secretion associated, Ras related GTPase 1A	57					intracellular protein transport (GO:0006886)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TACTCGGATGTAGTGTTGGAA	0.398													ENSG00000079332																																					0													103.0	94.0	97.0					10																	71921382		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS7298.1	10q22.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000079332	ENSG00000079332			10534	protein-coding gene	gene with protein product		607691	"""SAR1a gene homolog (S. cerevisiae) 1"", ""SAR1a gene homolog 1 (S. cerevisiae)"", ""SAR1 homolog A (S. cerevisiae)"""	SARA1		10871277	Standard	NM_020150		Approved	SAR1, Sara	uc010qji.2	Q9NR31	OTTHUMG00000018400	ENST00000373242.2:c.171A>G	10.37:g.71921382T>C			B4DQ19	Silent	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gprotein_alpha_su,pfam_MIRO-like,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L57	ENST00000373242.2	37	c.171	CCDS7298.1	10																																																																																			-	SAR1A	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gprotein_alpha_su,pfam_MIRO-like,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.398	SAR1A-007	KNOWN	basic|appris_principal|CCDS	protein_coding	SAR1A	HGNC	protein_coding	OTTHUMT00000048500.2	0	0	0	55	55	79	0.00	0.00	T			71921382	-1	9	27	26	49	tier1	no_errors	ENST00000373238	ensembl	human	known	74_37	silent	25.71	35.06	SNP	0.893	C	9	26
JAK1	3716	genome.wustl.edu	37	1	65305469	65305469	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr1:65305469C>A	ENST00000342505.4	-	20	2907	c.2659G>T	c.(2659-2661)Ggg>Tgg	p.G887W	JAK1_ENST00000465376.1_5'Flank	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	887	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TCAACCTTCCCAAAGTGGCCC	0.552			Mis		ALL								ENSG00000162434																												Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													59.0	56.0	57.0					1																	65305469		1932	4145	6077	SO:0001583	missense	0			-	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2659G>T	1.37:g.65305469C>A	ENSP00000343204:p.Gly887Trp		Q59GQ2|Q9UD26	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_dom	p.G887W	ENST00000342505.4	37	c.2659	CCDS41346.1	1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553702	0.86231	.	.	ENSG00000162434	ENST00000342505	D	0.95137	-3.62	4.88	4.88	0.63580	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.98469	0.9490	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99771	1.1024	9	0.87932	D	0	-6.7415	18.2322	0.89937	0.0:1.0:0.0:0.0	.	887	P23458	JAK1_HUMAN	W	887	ENSP00000343204:G887W	ENSP00000343204:G887W	G	-	1	0	JAK1	65078057	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.273000	0.78527	2.527000	0.85204	0.563000	0.77884	GGG	-	JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.552	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	0	0	1	33	33	111	0.00	0.89	C	NM_002227		65305469	-1	16	57	7	14	tier1	no_errors	ENST00000342505	ensembl	human	known	74_37	missense	69.57	80.28	SNP	1.000	A	16	7
KRT77	374454	genome.wustl.edu	37	12	53086631	53086631	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:53086631C>T	ENST00000341809.3	-	6	1142	c.1114G>A	c.(1114-1116)Gga>Aga	p.G372R	KRT77_ENST00000537195.1_Missense_Mutation_p.G139R|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	372	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						AGGTCGTCTCCATGTCTCCCT	0.587													ENSG00000189182																																					0													182.0	128.0	146.0					12																	53086631		2202	4272	6474	SO:0001583	missense	0			-	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1114G>A	12.37:g.53086631C>T	ENSP00000342710:p.Gly372Arg		Q7RTS8	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.G372R	ENST00000341809.3	37	c.1114	CCDS8837.1	12	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524148	0.85600	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	T;T	0.76839	-0.78;-1.05	3.44	2.53	0.30540	Filament (1);	.	.	.	.	D	0.88437	0.6436	M	0.88377	2.95	0.39453	D	0.967431	D	0.76494	0.999	D	0.75020	0.985	D	0.90665	0.4593	9	0.72032	D	0.01	.	13.0875	0.59149	0.1617:0.8383:0.0:0.0	.	372	Q7Z794	K2C1B_HUMAN	R	372;139	ENSP00000342710:G372R;ENSP00000440803:G139R	ENSP00000342710:G372R	G	-	1	0	KRT77	51372898	0.998000	0.40836	0.128000	0.21923	0.469000	0.32828	4.767000	0.62286	1.009000	0.39289	0.456000	0.33151	GGA	-	KRT77	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_II		0.587	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	HGNC	protein_coding	OTTHUMT00000404111.1	0	0	0	34	34	57	0.00	0.00	C	NM_175078		53086631	-1	15	24	22	27	tier1	no_errors	ENST00000341809	ensembl	human	known	74_37	missense	40.54	47.06	SNP	0.999	T	15	22
TET2	54790	genome.wustl.edu	37	4	106196793	106196793	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:106196793G>A	ENST00000540549.1	+	11	5986	c.5126G>A	c.(5125-5127)tGt>tAt	p.C1709Y	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000513237.1_Missense_Mutation_p.C1730Y|TET2_ENST00000380013.4_Missense_Mutation_p.C1709Y			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1709					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TTCAGCAGTTGTACCATTAGA	0.428			"""Mis N, F"""		MDS								ENSG00000168769																												Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													140.0	115.0	122.0					4																	106196793		692	1591	2283	SO:0001583	missense	0			-	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5126G>A	4.37:g.106196793G>A	ENSP00000442788:p.Cys1709Tyr		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.C1709Y	ENST00000540549.1	37	c.5126	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	6.243	0.412933	0.11812	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.02787	4.17;4.16;4.17	5.16	3.38	0.38709	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.05960	0.0155	M	0.67953	2.075	0.80722	D	1	B;B	0.21688	0.059;0.059	B;B	0.26094	0.066;0.066	T	0.15983	-1.0418	9	0.40728	T	0.16	-5.1426	15.7582	0.78054	0.0:0.2314:0.7686:0.0	.	1730;1709	E7EQS8;Q6N021	.;TET2_HUMAN	Y	1709;1730;1709	ENSP00000442788:C1709Y;ENSP00000425443:C1730Y;ENSP00000369351:C1709Y	ENSP00000369351:C1709Y	C	+	2	0	TET2	106416242	1.000000	0.71417	0.009000	0.14445	0.274000	0.26718	5.729000	0.68538	0.515000	0.28320	0.467000	0.42956	TGT	-	TET2	-	NULL		0.428	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	0	0	0	35	35	153	0.00	0.00	G	NM_017628		106196793	+1	18	29	25	140	tier1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	41.86	17.16	SNP	1.000	A	18	25
EGF	1950	genome.wustl.edu	37	4	110897337	110897337	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897337G>C	ENST00000265171.5	+	13	2444	c.1999G>C	c.(1999-2001)Gaa>Caa	p.E667Q	EGF_ENST00000503392.1_Missense_Mutation_p.E667Q|EGF_ENST00000509793.1_Missense_Mutation_p.E625Q	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	667					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GTCTGTGATTGAAATGGCCAA	0.448													ENSG00000138798																																					0													126.0	107.0	113.0					4																	110897337		2203	4300	6503	SO:0001583	missense	0			-	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1999G>C	4.37:g.110897337G>C	ENSP00000265171:p.Glu667Gln		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.E667Q	ENST00000265171.5	37	c.1999	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	29.8	5.041147	0.93685	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.95885	-3.84;-3.84;-3.84	5.77	5.77	0.91146	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.98018	0.9347	M	0.85373	2.75	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.996;1.0	D	0.98183	1.0458	10	0.62326	D	0.03	.	19.9915	0.97366	0.0:0.0:1.0:0.0	.	667;625;667	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	Q	625;667;667	ENSP00000424316:E625Q;ENSP00000265171:E667Q;ENSP00000421384:E667Q	ENSP00000265171:E667Q	E	+	1	0	EGF	111116786	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.302000	0.89953	2.723000	0.93209	0.655000	0.94253	GAA	-	EGF	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.448	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	0	0	0	54	54	143	0.00	0.00	G			110897337	+1	14	60	48	143	tier1	no_errors	ENST00000265171	ensembl	human	known	74_37	missense	22.58	29.56	SNP	1.000	C	14	48
TET2	54790	genome.wustl.edu	37	4	106196802	106196802	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:106196802G>A	ENST00000540549.1	+	11	5995	c.5135G>A	c.(5134-5136)aGa>aAa	p.R1712K	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000513237.1_Missense_Mutation_p.R1733K|TET2_ENST00000380013.4_Missense_Mutation_p.R1712K			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1712					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TGTACCATTAGACCAAATGTA	0.433			"""Mis N, F"""		MDS								ENSG00000168769																												Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													127.0	105.0	112.0					4																	106196802		692	1591	2283	SO:0001583	missense	0			-	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5135G>A	4.37:g.106196802G>A	ENSP00000442788:p.Arg1712Lys		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.R1712K	ENST00000540549.1	37	c.5135	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	6.914	0.538352	0.13250	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.02709	4.2;4.19;4.2	5.16	2.47	0.30058	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.01592	0.0051	N	0.11201	0.11	0.80722	D	1	B;B	0.13594	0.003;0.008	B;B	0.16289	0.015;0.011	T	0.50224	-0.8853	9	0.09084	T	0.74	-7.0319	8.3984	0.32570	0.2474:0.0:0.7526:0.0	.	1733;1712	E7EQS8;Q6N021	.;TET2_HUMAN	K	1712;1733;1712	ENSP00000442788:R1712K;ENSP00000425443:R1733K;ENSP00000369351:R1712K	ENSP00000369351:R1712K	R	+	2	0	TET2	106416251	1.000000	0.71417	0.001000	0.08648	0.328000	0.28507	3.873000	0.56093	0.185000	0.20105	0.467000	0.42956	AGA	-	TET2	-	NULL		0.433	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	0	0	1	35	35	147	0.00	0.67	G	NM_017628		106196802	+1	16	31	24	139	tier1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	40.00	18.13	SNP	0.993	A	16	24
PDGFC	56034	genome.wustl.edu	37	4	157892061	157892061	+	5'UTR	SNP	T	T	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:157892061T>A	ENST00000502773.1	-	0	485				PDGFC_ENST00000422544.2_5'Flank|PDGFC_ENST00000541126.1_5'UTR	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		CTCATTTGGCTGACTGGGGTG	0.607											OREG0016375	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000145431																																					0													40.0	43.0	42.0					4																	157892061		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-	AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.-6A>T	4.37:g.157892061T>A		1789	B4DU34|B9EGR8|Q4W5M9|Q9UL22	R	SNP	-	NULL	ENST00000502773.1	37	NULL	CCDS3795.1	4																																																																																			-	PDGFC	-	-		0.607	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFC	HGNC	protein_coding	OTTHUMT00000366123.1	0	0	0	28	28	47	0.00	0.00	T			157892061	-1	7	8	13	13	tier1	no_errors	ENST00000513664	ensembl	human	known	74_37	rna	35.00	38.10	SNP	1.000	A	7	13
PRRC2A	7916	genome.wustl.edu	37	6	31604303	31604303	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:31604303C>T	ENST00000376033.2	+	27	6086	c.5852C>T	c.(5851-5853)cCa>cTa	p.P1951L	PRRC2A_ENST00000376007.4_Missense_Mutation_p.P1951L	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1951	3 X 50 AA type C repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CAGGATCTGCCATCCCCTTCG	0.512													ENSG00000204469																																					0													145.0	164.0	157.0					6																	31604303		1510	2709	4219	SO:0001583	missense	0			-	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.5852C>T	6.37:g.31604303C>T	ENSP00000365201:p.Pro1951Leu		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.P1951L	ENST00000376033.2	37	c.5852	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707209	0.30322	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01572	4.76;4.76	5.35	5.35	0.76521	.	0.000000	0.51477	D	0.000096	T	0.01800	0.0057	L	0.36672	1.1	0.51767	D	0.999934	D	0.54207	0.965	P	0.48598	0.583	T	0.63681	-0.6582	10	0.87932	D	0	-7.0082	16.1031	0.81201	0.0:1.0:0.0:0.0	.	1951	P48634	PRC2A_HUMAN	L	1943;1932;1951;1951;1176	ENSP00000365175:P1951L;ENSP00000365201:P1951L	ENSP00000365175:P1951L	P	+	2	0	PRRC2A	31712282	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.840000	0.39230	2.784000	0.95788	0.551000	0.68910	CCA	-	PRRC2A	-	NULL		0.512	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	0	0	0	73	73	87	0.00	0.00	C	NM_080686		31604303	+1	16	24	28	55	tier1	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	36.36	30.38	SNP	1.000	T	16	28
ANPEP	290	genome.wustl.edu	37	15	90349396	90349396	+	Missense_Mutation	SNP	C	C	T	rs145360414	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr15:90349396C>T	ENST00000300060.6	-	2	732	c.419G>A	c.(418-420)cGt>cAt	p.R140H		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	140	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TCCCACACCACGCAGGACCAC	0.617													ENSG00000166825																									NSCLC(30;827 977 2459 19669 26125)												0								C	HIS/ARG	2,4398	4.2+/-10.8	0,2,2198	79.0	68.0	72.0		419	2.1	0.1	15	dbSNP_134	72	0,8598		0,0,4299	no	missense	ANPEP	NM_001150.2	29	0,2,6497	TT,TC,CC		0.0,0.0455,0.0154	benign	140/968	90349396	2,12996	2200	4299	6499	SO:0001583	missense	0			-	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.419G>A	15.37:g.90349396C>T	ENSP00000300060:p.Arg140His		Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.R140H	ENST00000300060.6	37	c.419	CCDS10356.1	15	.	.	.	.	.	.	.	.	.	.	C	8.150	0.787103	0.16189	4.55E-4	0.0	ENSG00000166825	ENST00000300060	T	0.02737	4.18	5.07	2.09	0.27110	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.705140	0.02757	N	0.118153	T	0.04363	0.0120	L	0.50919	1.6	0.09310	N	1	B	0.22909	0.077	B	0.22386	0.039	T	0.40776	-0.9545	10	0.42905	T	0.14	.	4.5329	0.12013	0.0:0.5844:0.187:0.2287	.	140	P15144	AMPN_HUMAN	H	140	ENSP00000300060:R140H	ENSP00000300060:R140H	R	-	2	0	ANPEP	88150400	0.000000	0.05858	0.115000	0.21578	0.159000	0.22180	-0.669000	0.05262	1.113000	0.41760	0.563000	0.77884	CGT	rs145360414	ANPEP	-	pfam_Peptidase_M1_N		0.617	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANPEP	HGNC	protein_coding	OTTHUMT00000313425.1	0	0	0	38	38	25	0.00	0.00	C			90349396	-1	12	11	25	10	tier1	no_errors	ENST00000300060	ensembl	human	known	74_37	missense	32.43	52.38	SNP	0.042	T	12	25
VSIG10L	147645	genome.wustl.edu	37	19	51845231	51845231	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:51845231G>A	ENST00000335624.4	-	2	70	c.71C>T	c.(70-72)gCc>gTc	p.A24V	CTD-2616J11.16_ENST00000601148.1_RNA|CTD-2616J11.16_ENST00000594311.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	24						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						TCCAGAAGAGGCTCTGAGGGT	0.567													ENSG00000186806																																					0													96.0	104.0	101.0					19																	51845231		692	1591	2283	SO:0001583	missense	0			-		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.71C>T	19.37:g.51845231G>A	ENSP00000335623:p.Ala24Val			Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A24V	ENST00000335624.4	37	c.71	CCDS54300.1	19	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752745	0.49362	.	.	ENSG00000186806	ENST00000335624;ENST00000542561	T	0.29142	1.58	2.88	1.84	0.25277	.	.	.	.	.	T	0.13114	0.0318	N	0.08118	0	0.09310	N	1	B	0.33694	0.421	B	0.25291	0.059	T	0.14172	-1.0482	9	0.59425	D	0.04	.	6.0454	0.19758	0.1453:0.0:0.8547:0.0	.	24	Q86VR7	VS10L_HUMAN	V	24	ENSP00000335623:A24V	ENSP00000335623:A24V	A	-	2	0	VSIG10L	56537043	0.148000	0.22702	0.003000	0.11579	0.058000	0.15608	1.237000	0.32695	0.778000	0.33520	-0.216000	0.12614	GCC	-	VSIG10L	-	NULL		0.567	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	HGNC	protein_coding	OTTHUMT00000464535.1	0	0	0	21	21	88	0.00	0.00	G	NM_001163922		51845231	-1	12	29	13	42	tier1	no_errors	ENST00000335624	ensembl	human	novel	74_37	missense	48.00	40.85	SNP	0.015	A	12	13
PLBD1	79887	genome.wustl.edu	37	12	14656854	14656854	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:14656854G>T	ENST00000240617.5	-	11	2166	c.1514C>A	c.(1513-1515)tCc>tAc	p.S505Y		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	505					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						TATGGCATAGGATGTGTACTG	0.468													ENSG00000121316																																					0													125.0	109.0	114.0					12																	14656854		2203	4300	6503	SO:0001583	missense	0			-	BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.1514C>A	12.37:g.14656854G>T	ENSP00000240617:p.Ser505Tyr		A8K4E9|Q9BVV3|Q9H625	Missense_Mutation	SNP	pfam_PLipase_B-like	p.S505Y	ENST00000240617.5	37	c.1514	CCDS31751.1	12	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623812	0.66901	.	.	ENSG00000121316	ENST00000240617	T	0.17213	2.29	5.87	4.98	0.66077	.	0.098892	0.64402	D	0.000001	T	0.39172	0.1068	M	0.65498	2.005	0.32654	N	0.519048	D	0.56521	0.976	D	0.63703	0.917	T	0.55829	-0.8079	10	0.87932	D	0	-15.9511	15.8279	0.78727	0.0:0.1349:0.8651:0.0	.	505	Q6P4A8	PLBL1_HUMAN	Y	505	ENSP00000240617:S505Y	ENSP00000240617:S505Y	S	-	2	0	PLBD1	14548121	1.000000	0.71417	0.990000	0.47175	0.380000	0.30137	9.434000	0.97515	1.616000	0.50265	-0.165000	0.13383	TCC	-	PLBD1	-	pfam_PLipase_B-like		0.468	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	HGNC	protein_coding	OTTHUMT00000401203.1	0	0	0	35	35	118	0.00	0.00	G	NM_024829		14656854	-1	10	19	40	88	tier1	no_errors	ENST00000240617	ensembl	human	known	74_37	missense	20.00	17.76	SNP	1.000	T	10	40
EGF	1950	genome.wustl.edu	37	4	110897208	110897208	+	Missense_Mutation	SNP	G	G	A	rs567044142		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897208G>A	ENST00000265171.5	+	13	2315	c.1870G>A	c.(1870-1872)Gaa>Aaa	p.E624K	EGF_ENST00000503392.1_Missense_Mutation_p.E624K|EGF_ENST00000509793.1_Missense_Mutation_p.E582K	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	624					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	TCCACGAATTGAAAGTTCTTC	0.383													ENSG00000138798																																					0													185.0	200.0	195.0					4																	110897208		2203	4300	6503	SO:0001583	missense	0			-	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1870G>A	4.37:g.110897208G>A	ENSP00000265171:p.Glu624Lys		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.E624K	ENST00000265171.5	37	c.1870	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	34	5.400318	0.96030	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.93604	-3.25;-3.25;-3.25	5.66	5.66	0.87406	Six-bladed beta-propeller, TolB-like (1);	0.047963	0.85682	D	0.000000	D	0.97393	0.9147	M	0.90082	3.085	0.58432	D	0.999998	D;P;D	0.76494	0.998;0.941;0.999	D;P;D	0.74023	0.96;0.738;0.982	D	0.97417	1.0006	10	0.56958	D	0.05	.	19.756	0.96291	0.0:0.0:1.0:0.0	.	624;582;624	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	K	582;624;624	ENSP00000424316:E582K;ENSP00000265171:E624K;ENSP00000421384:E624K	ENSP00000265171:E624K	E	+	1	0	EGF	111116657	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.302000	0.89953	2.665000	0.90641	0.655000	0.94253	GAA	-	EGF	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.383	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	0	0	1	74	74	141	0.00	0.70	G			110897208	+1	28	57	59	162	tier1	no_errors	ENST00000265171	ensembl	human	known	74_37	missense	32.18	25.91	SNP	1.000	A	28	59
FSIP2	401024	genome.wustl.edu	37	2	186671383	186671383	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr2:186671383G>A	ENST00000424728.1	+	17	17350	c.17350G>A	c.(17350-17352)Gct>Act	p.A5784T	FSIP2_ENST00000343098.5_Missense_Mutation_p.A5873T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5784										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AATTTTTCCCGCTAAGTTTTT	0.333													ENSG00000188738																																					0													72.0	68.0	69.0					2																	186671383		1804	4072	5876	SO:0001583	missense	0			-	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17350G>A	2.37:g.186671383G>A	ENSP00000401306:p.Ala5784Thr		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.A5873T	ENST00000424728.1	37	c.17617		2	.	.	.	.	.	.	.	.	.	.	G	11.81	1.748834	0.30955	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.62364	0.03;0.04	5.06	2.27	0.28462	.	.	.	.	.	T	0.50667	0.1629	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.44817	-0.9303	7	0.51188	T	0.08	.	4.4373	0.11557	0.1844:0.0:0.6388:0.1768	.	.	.	.	T	5873;5784	ENSP00000344403:A5873T;ENSP00000401306:A5784T	ENSP00000344403:A5873T	A	+	1	0	FSIP2	186379628	0.151000	0.22747	0.096000	0.21009	0.298000	0.27526	0.723000	0.25939	0.299000	0.22661	-0.194000	0.12790	GCT	-	FSIP2	-	NULL		0.333	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	0	0	0	74	74	134	0.00	0.00	G	NM_173651		186671383	+1	22	57	50	90	tier1	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	30.56	38.78	SNP	0.143	A	22	50
CRX	1406	genome.wustl.edu	37	19	48339521	48339521	+	Missense_Mutation	SNP	G	G	A	rs61748436		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:48339521G>A	ENST00000221996.7	+	3	328	c.122G>A	c.(121-123)cGg>cAg	p.R41Q	TPRX2P_ENST00000535362.1_Intron|CRX_ENST00000539067.1_Missense_Mutation_p.R41Q	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	41			R -> Q (in RP). {ECO:0000269|PubMed:9427255, ECO:0000269|PubMed:9792858}.|R -> W (in CORD2; exhibits reduced DNA binding, transcriptional synergy and interaction with NRL). {ECO:0000269|PubMed:9427255}.		circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		AAGCAGCGGCGGGAGCGCACC	0.652													ENSG00000105392																									Pancreas(57;461 1196 22201 40716 47188)												0			GRCh37	CM970396	CRX	M	rs61748436						53.0	62.0	59.0					19																	48339521		2203	4300	6503	SO:0001583	missense	0			-	AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.122G>A	19.37:g.48339521G>A	ENSP00000221996:p.Arg41Gln		Q0QD45	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Otx_TF_C,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R41Q	ENST00000221996.7	37	c.122	CCDS12706.1	19	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368074	0.61513	.	.	ENSG00000105392	ENST00000221996;ENST00000539067	D;D	0.97066	-4.23;-4.23	3.67	3.67	0.42095	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.98239	0.9417	M	0.84511	2.7	0.80722	A	1	D	0.71674	0.998	D	0.76575	0.988	D	0.99921	1.1255	9	0.59425	D	0.04	-18.357	12.8982	0.58111	0.0:0.0:1.0:0.0	rs61748436	41	O43186	CRX_HUMAN	Q	41	ENSP00000221996:R41Q;ENSP00000445565:R41Q	ENSP00000221996:R41Q	R	+	2	0	CRX	53031333	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	8.973000	0.93428	1.883000	0.54544	0.205000	0.17691	CGG	rs61748436	CRX	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.652	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRX	HGNC	protein_coding	OTTHUMT00000409812.4	0	0	0	38	38	46	0.00	0.00	G	NM_000554		48339521	+1	6	12	26	21	tier1	no_errors	ENST00000221996	ensembl	human	known	74_37	missense	18.75	36.36	SNP	1.000	A	6	26
OCSTAMP	128506	genome.wustl.edu	37	20	45170491	45170491	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr20:45170491G>A	ENST00000279028.2	-	3	1136	c.1123C>T	c.(1123-1125)Cac>Tac	p.H375Y		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	375					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						TAGGAGCTGTGGACGGAGAGG	0.677													ENSG00000149635																																					0													9.0	11.0	10.0					20																	45170491		687	1587	2274	SO:0001583	missense	0			-	AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1123C>T	20.37:g.45170491G>A	ENSP00000279028:p.His375Tyr			Missense_Mutation	SNP	pfam_DC_STAMP-like	p.H375Y	ENST00000279028.2	37	c.1123	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652381	0.47362	.	.	ENSG00000149635	ENST00000279028	T	0.30182	1.54	4.95	2.92	0.33932	Dendritic cell-specific transmembrane protein-like (1);	0.418104	0.25236	N	0.032123	T	0.20251	0.0487	L	0.27053	0.805	0.09310	N	1	D	0.57257	0.979	P	0.49192	0.602	T	0.07693	-1.0759	10	0.11182	T	0.66	-11.5243	3.3519	0.07155	0.084:0.1437:0.4391:0.3332	.	375	Q9BR26	CT123_HUMAN	Y	375	ENSP00000279028:H375Y	ENSP00000279028:H375Y	H	-	1	0	C20orf123	44603898	0.027000	0.19231	0.005000	0.12908	0.002000	0.02628	1.275000	0.33144	0.606000	0.29965	0.655000	0.94253	CAC	-	OCSTAMP	-	pfam_DC_STAMP-like		0.677	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	0	0	0	23	23	43	0.00	0.00	G	XM_496476		45170491	-1	4	7	20	38	tier1	no_errors	ENST00000279028	ensembl	human	known	74_37	missense	16.67	15.56	SNP	0.002	A	4	20
FAM221A	340277	genome.wustl.edu	37	7	23737906	23737906	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr7:23737906A>C	ENST00000344962.4	+	5	822	c.733A>C	c.(733-735)Acg>Ccg	p.T245P	FAM221A_ENST00000409192.3_Intron|FAM221A_ENST00000409653.1_Missense_Mutation_p.T187P|FAM221A_ENST00000409994.3_Intron	NM_199136.3	NP_954587.2	A4D161	F221A_HUMAN	family with sequence similarity 221, member A	245																	TTCTCCAGAAACGTTAACAGA	0.358													ENSG00000188732																																					0													119.0	120.0	120.0					7																	23737906		2203	4299	6502	SO:0001583	missense	0			-		CCDS5385.1, CCDS47561.1, CCDS47562.1, CCDS75570.1	7p15.3	2012-04-02	2012-04-02	2012-04-02	ENSG00000188732	ENSG00000188732			27977	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 46"""	C7orf46		12477932	Standard	XR_242080		Approved	FLJ45875, MGC72075, DKFZp686F0810	uc003swo.4	A4D161	OTTHUMG00000128463	ENST00000344962.4:c.733A>C	7.37:g.23737906A>C	ENSP00000342576:p.Thr245Pro		Q05CG4|Q4G0Q7|Q6P519	Missense_Mutation	SNP	NULL	p.T245P	ENST00000344962.4	37	c.733	CCDS5385.1	7	.	.	.	.	.	.	.	.	.	.	A	3.672	-0.067351	0.07273	.	.	ENSG00000188732	ENST00000344962;ENST00000409653	T;T	0.14640	2.49;2.49	5.66	3.27	0.37495	.	0.677862	0.14992	N	0.286632	T	0.09818	0.0241	L	0.33485	1.01	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.35251	-0.9796	10	0.23891	T	0.37	-0.6925	7.352	0.26697	0.5496:0.3712:0.0792:0.0	.	245	A4D161	CG046_HUMAN	P	245;187	ENSP00000342576:T245P;ENSP00000386900:T187P	ENSP00000342576:T245P	T	+	1	0	C7orf46	23704431	0.021000	0.18746	0.566000	0.28421	0.129000	0.20672	2.068000	0.41471	0.500000	0.27991	-0.250000	0.11733	ACG	-	FAM221A	-	NULL		0.358	FAM221A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM221A	HGNC	protein_coding	OTTHUMT00000250261.1	0	0	0	40	40	120	0.00	0.00	A	NM_199136		23737906	+1	17	37	35	65	tier1	no_errors	ENST00000344962	ensembl	human	known	74_37	missense	32.69	36.27	SNP	0.092	C	17	35
TET2	54790	genome.wustl.edu	37	4	106197126	106197126	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:106197126G>C	ENST00000540549.1	+	11	6319	c.5459G>C	c.(5458-5460)aGt>aCt	p.S1820T	TET2_ENST00000545826.1_3'UTR|TET2_ENST00000513237.1_Missense_Mutation_p.S1841T|TET2_ENST00000380013.4_Missense_Mutation_p.S1820T			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1820					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CACAAATTAAGTGATGCTAAT	0.483			"""Mis N, F"""		MDS								ENSG00000168769																												Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													49.0	45.0	46.0					4																	106197126		692	1591	2283	SO:0001583	missense	0			-	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5459G>C	4.37:g.106197126G>C	ENSP00000442788:p.Ser1820Thr		B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.S1820T	ENST00000540549.1	37	c.5459	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.679821	0.00751	.	.	ENSG00000168769	ENST00000540549;ENST00000513237;ENST00000380013	T;T;T	0.02050	4.49;4.48;4.49	5.33	-3.88	0.04205	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	.	.	.	.	T	0.00784	0.0026	N	0.02011	-0.69	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.11329	0.001;0.006	T	0.46303	-0.9201	9	0.07325	T	0.83	.	4.5271	0.11986	0.2578:0.4717:0.1794:0.0912	.	1841;1820	E7EQS8;Q6N021	.;TET2_HUMAN	T	1820;1841;1820	ENSP00000442788:S1820T;ENSP00000425443:S1841T;ENSP00000369351:S1820T	ENSP00000369351:S1820T	S	+	2	0	TET2	106416575	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.092000	0.11129	-0.803000	0.04415	-0.218000	0.12543	AGT	-	TET2	-	NULL		0.483	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	0	0	0	13	13	114	0.00	0.00	G	NM_017628		106197126	+1	9	42	15	81	tier1	no_errors	ENST00000380013	ensembl	human	known	74_37	missense	36.00	33.87	SNP	0.000	C	9	15
MAOA	4128	genome.wustl.edu	37	X	43602982	43602982	+	Intron	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chrX:43602982C>T	ENST00000338702.3	+	13	1385				MAOA_ENST00000542639.1_Intron	NM_000240.3	NP_000231.1	P21397	AOFA_HUMAN	monoamine oxidase A						cellular biogenic amine metabolic process (GO:0006576)|dopamine catabolic process (GO:0042420)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	primary amine oxidase activity (GO:0008131)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	18					Almotriptan(DB00918)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Minaprine(DB00805)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Naratriptan(DB00952)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sertraline(DB01104)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)|Zonisamide(DB00909)	CAGTGATTGGCTCATTTACCC	0.483													ENSG00000189221																																					0																																										SO:0001627	intron_variant	0			-		CCDS14260.1, CCDS59163.1	Xp11.4-p11.3	2008-02-05			ENSG00000189221	ENSG00000189221	1.4.3.4		6833	protein-coding gene	gene with protein product		309850					Standard	NM_000240		Approved		uc004dfy.4	P21397	OTTHUMG00000021387	ENST00000338702.3:c.1263-59C>T	X.37:g.43602982C>T			B4DF46|Q16426	R	SNP	-	NULL	ENST00000338702.3	37	NULL	CCDS14260.1	X																																																																																			-	MAOA	-	-		0.483	MAOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOA	HGNC	protein_coding	OTTHUMT00000056300.1	0	0	0	14	14	82	0.00	0.00	C	NM_000240		43602982	+1	5	35	6	62	tier1	no_errors	ENST00000490604	ensembl	human	known	74_37	rna	45.45	36.08	SNP	0.001	T	5	6
EGF	1950	genome.wustl.edu	37	4	110897311	110897311	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897311G>A	ENST00000265171.5	+	13	2418	c.1973G>A	c.(1972-1974)tGg>tAg	p.W658*	EGF_ENST00000503392.1_Nonsense_Mutation_p.W658*|EGF_ENST00000509793.1_Nonsense_Mutation_p.W616*	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	658					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	AAGTTGTACTGGTGCGATGCC	0.493													ENSG00000138798																																					0													145.0	129.0	135.0					4																	110897311		2203	4300	6503	SO:0001587	stop_gained	0			-	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1973G>A	4.37:g.110897311G>A	ENSP00000265171:p.Trp658*		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Nonsense_Mutation	SNP	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.W658*	ENST00000265171.5	37	c.1973	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	40	8.147415	0.98678	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9915	0.97366	0.0:0.0:1.0:0.0	.	.	.	.	X	616;658;658	.	ENSP00000265171:W658X	W	+	2	0	EGF	111116760	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	8.302000	0.89953	2.723000	0.93209	0.655000	0.94253	TGG	-	EGF	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.493	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	0	0	0	63	63	146	0.00	0.00	G			110897311	+1	16	62	57	150	tier1	no_errors	ENST00000265171	ensembl	human	known	74_37	nonsense	21.92	29.25	SNP	1.000	A	16	57
ZBED4	9889	genome.wustl.edu	37	22	50279664	50279664	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr22:50279664A>G	ENST00000216268.5	+	2	2831	c.2354A>G	c.(2353-2355)cAg>cGg	p.Q785R		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	785						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		AACAGCATTCAGAAGCAGCTG	0.642													ENSG00000100426																																					0													34.0	33.0	33.0					22																	50279664		2203	4300	6503	SO:0001583	missense	0			-	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2354A>G	22.37:g.50279664A>G	ENSP00000216268:p.Gln785Arg		B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	pfam_Znf_BED_prd,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.Q785R	ENST00000216268.5	37	c.2354	CCDS33677.1	22	.	.	.	.	.	.	.	.	.	.	A	5.513	0.279699	0.10458	.	.	ENSG00000100426	ENST00000216268	T	0.21932	1.98	5.57	2.25	0.28309	Ribonuclease H-like (1);	0.194552	0.44688	N	0.000439	T	0.17280	0.0415	L	0.53729	1.69	0.40891	D	0.984078	B	0.06786	0.001	B	0.04013	0.001	T	0.11203	-1.0597	10	0.16896	T	0.51	-11.8791	8.75	0.34609	0.7752:0.0:0.2248:0.0	.	785	O75132	ZBED4_HUMAN	R	785	ENSP00000216268:Q785R	ENSP00000216268:Q785R	Q	+	2	0	ZBED4	48665668	1.000000	0.71417	0.526000	0.27913	0.706000	0.40770	3.786000	0.55431	0.078000	0.16900	0.533000	0.62120	CAG	-	ZBED4	-	superfamily_RNaseH-like_dom		0.642	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED4	HGNC	protein_coding	OTTHUMT00000317408.2	0	0	0	28	28	35	0.00	0.00	A	NM_014838		50279664	+1	12	8	24	15	tier1	no_errors	ENST00000216268	ensembl	human	known	74_37	missense	33.33	34.78	SNP	0.998	G	12	24
TDRD12	91646	genome.wustl.edu	37	19	33281462	33281462	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:33281462C>T	ENST00000444215.2	+	12	1467	c.1147C>T	c.(1147-1149)Cct>Tct	p.P383S	TDRD12_ENST00000421545.2_Missense_Mutation_p.P383S			Q587J7	TDR12_HUMAN	tudor domain containing 12	383					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					AAATCCTGATCCTTTGAGAGC	0.328													ENSG00000173809																																					0													135.0	111.0	118.0					19																	33281462		692	1591	2283	SO:0001583	missense	0			-	AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.1147C>T	19.37:g.33281462C>T	ENSP00000416248:p.Pro383Ser			Missense_Mutation	SNP	pfam_Tudor,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase	p.P383S	ENST00000444215.2	37	c.1147		19	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901702	0.72754	.	.	ENSG00000173809	ENST00000444215;ENST00000421545	T	0.26810	1.71	5.47	5.47	0.80525	.	0.000000	0.56097	D	0.000034	T	0.41696	0.1170	L	0.34521	1.04	0.36910	D	0.890832	D;D	0.89917	1.0;0.964	D;P	0.83275	0.996;0.466	T	0.46978	-0.9152	10	0.87932	D	0	-13.0856	16.2372	0.82381	0.0:1.0:0.0:0.0	.	383;383	E9PAY0;Q587J7	.;TDR12_HUMAN	S	383	ENSP00000416248:P383S	ENSP00000390621:P383S	P	+	1	0	TDRD12	37973302	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.441000	0.44864	2.566000	0.86566	0.563000	0.77884	CCT	-	TDRD12	-	NULL		0.328	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1	0	0	0	16	16	113	0.00	0.00	C	NM_001015890		33281462	+1	6	34	13	69	tier1	no_errors	ENST00000444215	ensembl	human	known	74_37	missense	31.58	33.01	SNP	1.000	T	6	13
MET	4233	genome.wustl.edu	37	7	116340270	116340270	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr7:116340270G>A	ENST00000318493.6	+	2	1319	c.1132G>A	c.(1132-1134)Gtc>Atc	p.V378I	MET_ENST00000397752.3_Missense_Mutation_p.V378I|MET_ENST00000436117.2_Missense_Mutation_p.V378I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CAACAAGATCGTCAACAAAAA	0.433			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)				ENSG00000105976																												Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													104.0	96.0	99.0					7																	116340270		1925	4140	6065	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1132G>A	7.37:g.116340270G>A	ENSP00000317272:p.Val378Ile		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.V378I	ENST00000318493.6	37	c.1132	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715979	0.30413	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.04406	3.63;3.63;3.63	6.04	6.04	0.98038	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.217393	0.48286	D	0.000198	T	0.14960	0.0361	L	0.56396	1.775	0.80722	D	1	P;B;D;B;B;B;B;B;P;B;B;D;D	0.61697	0.916;0.43;0.987;0.032;0.032;0.032;0.057;0.057;0.945;0.276;0.032;0.99;0.99	B;B;P;B;B;B;B;B;P;B;B;P;P	0.54460	0.298;0.116;0.713;0.021;0.021;0.016;0.031;0.031;0.476;0.104;0.025;0.753;0.753	T	0.00173	-1.1957	10	0.35671	T	0.21	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	378;378;378;378;378;378;378;378;378;378;378;378;378	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	I	378	ENSP00000380860:V378I;ENSP00000317272:V378I;ENSP00000410980:V378I	ENSP00000317272:V378I	V	+	1	0	MET	116127506	1.000000	0.71417	0.992000	0.48379	0.974000	0.67602	6.696000	0.74598	2.873000	0.98535	0.563000	0.77884	GTC	-	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.433	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	0	0	0	31	31	101	0.00	0.00	G			116340270	+1	14	12	28	95	tier1	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	33.33	11.11	SNP	1.000	A	14	28
EGF	1950	genome.wustl.edu	37	4	110897298	110897298	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr4:110897298G>A	ENST00000265171.5	+	13	2405	c.1960G>A	c.(1960-1962)Gac>Aac	p.D654N	EGF_ENST00000503392.1_Missense_Mutation_p.D654N|EGF_ENST00000509793.1_Missense_Mutation_p.D612N	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	654					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CTTCTTAACTGACAAGTTGTA	0.478													ENSG00000138798																																					0													148.0	136.0	140.0					4																	110897298		2203	4300	6503	SO:0001583	missense	0			-	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1960G>A	4.37:g.110897298G>A	ENSP00000265171:p.Asp654Asn		B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.D654N	ENST00000265171.5	37	c.1960	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726547	0.69074	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.93426	-3.22;-3.22;-3.22	5.77	5.77	0.91146	Six-bladed beta-propeller, TolB-like (1);	0.138414	0.64402	D	0.000005	D	0.92945	0.7755	L	0.39020	1.185	0.44956	D	0.997973	P;P;P	0.49307	0.65;0.513;0.922	P;B;P	0.54060	0.465;0.261;0.741	D	0.92066	0.5660	10	0.39692	T	0.17	.	15.1628	0.72798	0.0692:0.0:0.9308:0.0	.	654;612;654	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	N	612;654;654	ENSP00000424316:D612N;ENSP00000265171:D654N;ENSP00000421384:D654N	ENSP00000265171:D654N	D	+	1	0	EGF	111116747	0.999000	0.42202	0.979000	0.43373	0.993000	0.82548	2.813000	0.48002	2.723000	0.93209	0.655000	0.94253	GAC	-	EGF	-	pirsf_Pro-epidermal_GF,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.478	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	0	0	0	65	65	146	0.00	0.00	G			110897298	+1	18	62	55	154	tier1	no_errors	ENST00000265171	ensembl	human	known	74_37	missense	24.66	28.70	SNP	0.992	A	18	55
MDGA2	161357	genome.wustl.edu	37	14	47324254	47324254	+	Silent	SNP	A	A	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr14:47324254A>C	ENST00000399232.2	-	15	3013	c.2649T>G	c.(2647-2649)gtT>gtG	p.V883V	MDGA2_ENST00000357362.3_Silent_p.V654V|MDGA2_ENST00000439988.3_Silent_p.V952V|MDGA2_ENST00000399222.3_Silent_p.V85V|MDGA2_ENST00000426342.1_Silent_p.V654V	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	883	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						GGTATATATTAACATGAGCCT	0.328													ENSG00000272781																																					0													140.0	129.0	132.0					14																	47324254		1824	4075	5899	SO:0001819	synonymous_variant	0			-	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2649T>G	14.37:g.47324254A>C			F6W3S7|J3KPX6	Silent	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.V952	ENST00000399232.2	37	c.2856		14																																																																																			-	MDGA2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom		0.328	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	0	0	0	40	40	108	0.00	0.00	A	NM_182830		47324254	-1	22	54	37	55	tier1	no_errors	ENST00000439988	ensembl	human	known	74_37	silent	36.67	49.54	SNP	0.999	C	22	37
DCAF8L2	347442	genome.wustl.edu	37	X	27766328	27766328	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chrX:27766328C>T	ENST00000451261.2	+	5	1715	c.1316C>T	c.(1315-1317)gCc>gTc	p.A439V		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	439								p.A406V(1)		central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						GAGCTGCTAGCCAGCTACAAT	0.443													ENSG00000189186																																					1	Substitution - Missense(1)	skin(1)											156.0	105.0	120.0					X																	27766328		692	1591	2283	SO:0001583	missense	0			-		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1316C>T	X.37:g.27766328C>T	ENSP00000462745:p.Ala439Val		B2RXH9|J3KT06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A439V	ENST00000451261.2	37	c.1316	CCDS59162.1	X																																																																																			-	DCAF8L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.443	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	0	0	0	44	44	66	0.00	0.00	C	XM_293354		27766328	+1	10	23	50	45	tier1	no_errors	ENST00000451261	ensembl	human	known	74_37	missense	16.67	33.82	SNP	1.000	T	10	50
FAT2	2196	genome.wustl.edu	37	5	150920164	150920164	+	Silent	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr5:150920164G>C	ENST00000261800.5	-	10	9015	c.9003C>G	c.(9001-9003)gtC>gtG	p.V3001V		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3001	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGACGTCCAGGACAAAGATCT	0.547													ENSG00000086570																																					0													98.0	82.0	87.0					5																	150920164		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9003C>G	5.37:g.150920164G>C			O75091|Q9NSR7	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V3001	ENST00000261800.5	37	c.9003	CCDS4317.1	5																																																																																			-	FAT2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.547	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	0	0	1	43	43	82	0.00	1.18	G	NM_001447		150920164	-1	7	14	30	69	tier1	no_errors	ENST00000261800	ensembl	human	known	74_37	silent	18.92	16.87	SNP	0.860	C	7	30
RHAG	6005	genome.wustl.edu	37	6	49604429	49604429	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:49604429G>A	ENST00000371175.4	-	1	123	c.97C>T	c.(97-99)Ctc>Ttc	p.L33F	RHAG_ENST00000229810.7_Missense_Mutation_p.L33F	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	33					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					AGCTGCTCGAGAACAGTCTGG	0.393													ENSG00000112077																									Ovarian(176;476 2003 7720 43408 44749)												0													196.0	185.0	189.0					6																	49604429		2203	4300	6503	SO:0001583	missense	0			-		CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.97C>T	6.37:g.49604429G>A	ENSP00000360217:p.Leu33Phe		B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.L33F	ENST00000371175.4	37	c.97	CCDS4927.1	6	.	.	.	.	.	.	.	.	.	.	G	5.143	0.211964	0.09757	.	.	ENSG00000112077	ENST00000371175;ENST00000229810;ENST00000418071;ENST00000539403	T;T	0.26373	1.74;1.74	5.32	-10.6	0.00265	Ammonium transporter AmtB-like (1);	5.215190	0.00166	N	0.000000	T	0.05456	0.0144	L	0.39245	1.2	0.09310	N	1	B;B;B	0.20261	0.043;0.001;0.043	B;B;B	0.32022	0.038;0.009;0.139	T	0.17198	-1.0377	10	0.54805	T	0.06	13.3027	1.0411	0.01559	0.1995:0.1106:0.3261:0.3639	.	33;33;33	O43515;Q9UHG9;Q02094	.;.;RHAG_HUMAN	F	33	ENSP00000360217:L33F;ENSP00000229810:L33F	ENSP00000229810:L33F	L	-	1	0	RHAG	49712388	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.511000	0.00446	-3.726000	0.00115	-0.218000	0.12543	CTC	-	RHAG	-	pfam_NH4_transpt_AmtB-like_dom		0.393	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHAG	HGNC	protein_coding	OTTHUMT00000043806.1	0	0	0	40	40	121	0.00	0.00	G			49604429	-1	17	48	21	35	tier1	no_errors	ENST00000371175	ensembl	human	known	74_37	missense	44.74	57.83	SNP	0.000	A	17	21
RAI1	10743	genome.wustl.edu	37	17	17682037	17682037	+	Intron	SNP	T	T	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr17:17682037T>C	ENST00000353383.1	+	3	453				RP1-253P7.1_ENST00000583598.1_RNA|SMCR5_ENST00000543475.1_RNA	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1						circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		AGCAGAGGCCTGCGATTCTCC	0.572													ENSG00000226746																																					0																																										SO:0001627	intron_variant	0			-	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.-16-14210T>C	17.37:g.17682037T>C			Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	R	SNP	-	NULL	ENST00000353383.1	37	NULL	CCDS11188.1	17	.	.	.	.	.	.	.	.	.	.	T	12.24	1.877312	0.33162	.	.	ENSG00000226746	ENST00000543475	.	.	.	4.02	-0.648	0.11464	.	.	.	.	.	T	0.28995	0.0720	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.09377	0.004	T	0.28459	-1.0043	7	0.87932	D	0	.	6.977	0.24681	0.0:0.4337:0.0:0.5663	.	119	Q8TEV8	SMCR5_HUMAN	G	119	.	ENSP00000438627:R119G	R	-	1	2	SMCR5	17622762	0.000000	0.05858	0.000000	0.03702	0.484000	0.33280	-0.005000	0.12855	-0.046000	0.13446	0.459000	0.35465	AGG	-	SMCR5	-	-		0.572	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR5	HGNC	protein_coding	OTTHUMT00000131775.1	0	0	0	64	64	97	0.00	0.00	T	NM_030665		17682037	-1	7	25	24	53	tier1	no_errors	ENST00000543475	ensembl	human	known	74_37	rna	22.58	32.05	SNP	0.000	C	7	24
OR1L6	392390	genome.wustl.edu	37	9	125512914	125512914	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr9:125512914C>T	ENST00000373684.1	+	1	896	c.896C>T	c.(895-897)cCc>cTc	p.P299L	OR1L6_ENST00000304720.2_Missense_Mutation_p.P263L			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						TATTTTAGGCCCCTGTCCATG	0.507													ENSG00000171459																																					0													106.0	90.0	96.0					9																	125512914		2203	4300	6503	SO:0001583	missense	0			-		CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.896C>T	9.37:g.125512914C>T	ENSP00000362788:p.Pro299Leu		Q6IFM8|Q96R80	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P299L	ENST00000373684.1	37	c.896		9	.	.	.	.	.	.	.	.	.	.	C	16.17	3.047569	0.55110	.	.	ENSG00000171459	ENST00000373684;ENST00000304720	T;T	0.00279	8.33;8.33	4.32	4.32	0.51571	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000044	T	0.00906	0.0030	M	0.90650	3.135	0.39774	D	0.972202	D	0.89917	1.0	D	0.97110	1.0	T	0.64761	-0.6331	10	0.72032	D	0.01	-35.1133	16.0696	0.80914	0.0:1.0:0.0:0.0	.	299	Q8NGR2	OR1L6_HUMAN	L	299;263	ENSP00000362788:P299L;ENSP00000304235:P263L	ENSP00000304235:P263L	P	+	2	0	OR1L6	124552735	0.873000	0.30073	0.998000	0.56505	0.993000	0.82548	2.294000	0.43567	2.392000	0.81423	0.655000	0.94253	CCC	-	OR1L6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.507	OR1L6-201	KNOWN	basic	protein_coding	OR1L6	HGNC	protein_coding		0	0	0	59	59	80	0.00	0.00	C			125512914	+1	22	27	63	85	tier1	no_errors	ENST00000373684	ensembl	human	known	74_37	missense	25.88	24.11	SNP	0.589	T	22	63
CRACR2A	84766	genome.wustl.edu	37	12	3768815	3768815	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr12:3768815A>C	ENST00000252322.1	-	8	1145	c.677T>G	c.(676-678)aTt>aGt	p.I226S	EFCAB4B_ENST00000444507.1_Missense_Mutation_p.I226S|EFCAB4B_ENST00000440314.2_Missense_Mutation_p.I226S	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		226					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			ATAAGCAGCAATTTTCCTACA	0.483													ENSG00000130038																																					0													154.0	133.0	140.0					12																	3768815		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000252322.1:c.677T>G	12.37:g.3768815A>C	ENSP00000252322:p.Ile226Ser		B4E1X0|B9EK63	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_EF_hand_dom,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_hand_dom,tigrfam_Small_GTP-bd_dom	p.I226S	ENST00000252322.1	37	c.677	CCDS8522.1	12	.	.	.	.	.	.	.	.	.	.	A	15.93	2.978614	0.53720	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.21361	2.01;2.65;2.66	4.86	3.7	0.42460	.	0.169109	0.52532	D	0.000066	T	0.33731	0.0873	L	0.48362	1.52	0.39417	D	0.966845	P;D;D	0.76494	0.852;0.988;0.999	B;P;D	0.83275	0.177;0.852;0.996	T	0.07770	-1.0755	10	0.18276	T	0.48	-6.5727	10.2851	0.43562	0.8339:0.1661:0.0:0.0	.	226;226;226	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	S	226	ENSP00000409382:I226S;ENSP00000412496:I226S;ENSP00000252322:I226S	ENSP00000252322:I226S	I	-	2	0	EFCAB4B	3639076	1.000000	0.71417	0.981000	0.43875	0.882000	0.50991	5.206000	0.65192	0.800000	0.34041	0.533000	0.62120	ATT	-	EFCAB4B	-	NULL		0.483	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	HGNC	protein_coding	OTTHUMT00000398673.1	0	0	0	39	39	83	0.00	0.00	A			3768815	-1	24	24	18	28	tier1	no_errors	ENST00000440314	ensembl	human	known	74_37	missense	57.14	46.15	SNP	0.992	C	24	18
AMER1	139285	genome.wustl.edu	37	X	63410105	63410105	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chrX:63410105G>A	ENST00000330258.3	-	2	3334	c.3062C>T	c.(3061-3063)gCt>gTt	p.A1021V	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	1021	Pro-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TGAGGGACGAGCTAGTTGAGG	0.572													ENSG00000184675																																					67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											53.0	60.0	57.0					X																	63410105		2122	4215	6337	SO:0001583	missense	0			-	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.3062C>T	X.37:g.63410105G>A	ENSP00000329117:p.Ala1021Val		A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.A1021V	ENST00000330258.3	37	c.3062	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	G	7.983	0.751674	0.15778	.	.	ENSG00000184675	ENST00000330258	T	0.43688	0.94	4.93	3.16	0.36331	.	.	.	.	.	T	0.25382	0.0617	N	0.24115	0.695	0.54753	D	0.999987	B	0.12013	0.005	B	0.12837	0.008	T	0.05131	-1.0904	8	.	.	.	-1.2796	8.1759	0.31281	0.2017:0.0:0.7983:0.0	.	1021	Q5JTC6	F123B_HUMAN	V	1021	ENSP00000329117:A1021V	.	A	-	2	0	FAM123B	63326830	0.014000	0.17966	0.951000	0.38953	0.210000	0.24377	0.610000	0.24253	1.221000	0.43506	0.529000	0.55759	GCT	-	AMER1	-	NULL		0.572	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER1	HGNC	protein_coding	OTTHUMT00000316584.1	0	0	0	75	75	132	0.00	0.00	G	NM_152424		63410105	-1	30	41	8	8	tier1	no_errors	ENST00000330258	ensembl	human	known	74_37	missense	78.95	83.67	SNP	0.852	A	30	8
TMEM14B	81853	genome.wustl.edu	37	6	10756863	10756864	+	3'UTR	INS	-	-	A	rs57806113|rs398065562		TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr6:10756863_10756864insA	ENST00000379542.5	+	0	624_625				TMEM14B_ENST00000491103.1_3'UTR|TMEM14B_ENST00000379530.3_3'UTR|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000473276.1_3'UTR|TMEM14B_ENST00000467317.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000481240.1_Intron	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				ACATTTTACCTAAAAAAAAAAA	0.366													ENSG00000137210																																					0																																										SO:0001624	3_prime_UTR_variant	0				AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.*113->A	6.37:g.10756874_10756874dupA			Q5THN7|Q5THN8|Q96IX7|Q9BVN8	R	INS	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																				TMEM14B	-	-		0.366	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	0	0	0	24	24	48	0.00	0.00	-	NM_030969		10756864	+1	4	5	13	46	tier1	no_errors	ENST00000486421	ensembl	human	known	74_37	rna	23.53	9.80	INS	0.029:0.005	A	4	13
KRT10	3858	genome.wustl.edu	37	17	38975103	38975104	+	In_Frame_Ins	INS	-	-	GCT			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr17:38975103_38975104insGCT	ENST00000269576.5	-	7	1692_1693	c.1683_1684insAGC	c.(1681-1686)agctcc>agcAGCtcc	p.561_562SS>SSS	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	561	Gly-rich.|Ser-rich.|Tail.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				CCTCCGCTGGAgctgccgccgc	0.683													ENSG00000186395																																					0																																										SO:0001652	inframe_insertion	0				J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1681_1683dupAGC	17.37:g.38975104_38975106dupGCT	ENSP00000269576:p.Ser562_Ser563dup		Q14664|Q8N175	In_Frame_Ins	INS	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.563in_frame_insS	ENST00000269576.5	37	c.1684_1683	CCDS11377.1	17																																																																																				KRT10	-	NULL		0.683	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	HGNC	protein_coding	OTTHUMT00000257875.1	0	0	0	29	29	8	0.00	0.00	-	NM_000421		38975104	-1	4	0	22	9	tier1	no_errors	ENST00000269576	ensembl	human	known	74_37	in_frame_ins	15.38	0.00	INS	0.124:0.323	GCT	4	22
PRR34	55267	genome.wustl.edu	37	22	46449708	46449708	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr22:46449708G>C	ENST00000396008.2	-	1	316	c.266C>G	c.(265-267)gCc>gGc	p.A89G	C22orf26_ENST00000333761.1_Missense_Mutation_p.A89G|RP6-109B7.2_ENST00000439423.1_lincRNA|RP6-109B7.3_ENST00000451166.1_RNA|RP6-109B7.3_ENST00000416202.1_RNA|RP6-109B7.3_ENST00000445441.1_RNA|RP6-109B7.5_ENST00000608644.1_RNA|FLJ27365_ENST00000381051.2_5'Flank			Q9NV39	PRR34_HUMAN		89													Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		CCGAGCTCGGGCAGCAGGGTG	0.746													ENSG00000182257																																					0													3.0	4.0	4.0					22																	46449708		1674	3579	5253	SO:0001583	missense	0			-																												ENST00000396008.2:c.266C>G	22.37:g.46449708G>C	ENSP00000379329:p.Ala89Gly		B0QZ24	Missense_Mutation	SNP	NULL	p.A89G	ENST00000396008.2	37	c.266	CCDS14071.1	22	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033869	0.54896	.	.	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.38722	1.12;1.12	3.25	3.25	0.37280	.	.	.	.	.	T	0.42063	0.1186	N	0.08118	0	0.25091	N	0.990854	D	0.76494	0.999	D	0.79108	0.992	T	0.27706	-1.0066	9	0.87932	D	0	.	10.2769	0.43515	0.0:0.0:1.0:0.0	.	89	Q9NV39	CV026_HUMAN	G	89	ENSP00000379329:A89G;ENSP00000327764:A89G	ENSP00000327764:A89G	A	-	2	0	C22orf26	44828372	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.742000	0.55097	2.119000	0.64992	0.650000	0.86243	GCC	-	C22orf26	-	NULL		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf26	HGNC	protein_coding	OTTHUMT00000317994.1	0	0	0	8	8	0	0.00	0.00	G			46449708	-1	8	1	4	0	tier1	no_errors	ENST00000333761	ensembl	human	known	74_37	missense	66.67	100.00	SNP	1.000	C	8	4
HCN2	610	genome.wustl.edu	37	19	616057	616057	+	Silent	SNP	G	G	C	rs201222040	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:616057G>C	ENST00000251287.2	+	8	2306	c.2253G>C	c.(2251-2253)gcG>gcC	p.A751A	AC005559.2_ENST00000591847.1_RNA	NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	751	Pro-rich.				cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGCTGGCGCTCGGCTCGC	0.851													ENSG00000099822	G|||	1035	0.206669	0.1634	0.1571	5008	,	,		3853	0.25		0.2356	False		,,,				2504	0.226				Melanoma(145;1175 2427 8056 36306)												0													1.0	1.0	1.0					19																	616057		152	300	452	SO:0001819	synonymous_variant	0			-	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.2253G>C	19.37:g.616057G>C			O60742|O60743|O75267|Q9UBS2	Silent	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.A751	ENST00000251287.2	37	c.2253	CCDS12035.1	19																																																																																			rs201222040	HCN2	-	NULL		0.851	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	HGNC	protein_coding	OTTHUMT00000452100.1	0	0	0	8	8	0	0.00	0.00	G	NM_001194		616057	+1	7	0	7	0	tier1	no_errors	ENST00000251287	ensembl	human	known	74_37	silent	50.00	0.00	SNP	0.061	C	7	7
SLC39A3	29985	genome.wustl.edu	37	19	2737421	2737421	+	Intron	DEL	T	T	-	rs567070163	byFrequency	TCGA-DX-A3UA-01A-12D-A307-09	TCGA-DX-A3UA-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a853679a-0be7-4f37-900c-f8f028f590aa	224f10b3-a507-435c-bc6c-3fdd6dfb5a46	g.chr19:2737421delT	ENST00000269740.4	-	2	208				SLC39A3_ENST00000545664.1_Intron|SLC39A3_ENST00000455372.2_Intron|SLC39A3_ENST00000590875.1_5'UTR|AC006538.4_ENST00000586572.1_Intron	NM_144564.4	NP_653165.2	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter), member 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttcttttttcttttttttttt	0.488													ENSG00000141873																																					0																																										SO:0001627	intron_variant	0				AF052125	CCDS12093.1, CCDS45909.1	19p13.3	2013-05-22			ENSG00000141873	ENSG00000141873		"""Solute carriers"""	17128	protein-coding gene	gene with protein product		612168				10681536	Standard	NM_144564		Approved	ZIP3	uc002lwg.3	Q9BRY0		ENST00000269740.4:c.122-44A>-	19.37:g.2737421delT			B3KMJ3|Q8WUG1	R	DEL	-	NULL	ENST00000269740.4	37	NULL	CCDS12093.1	19																																																																																				SLC39A3	-	-		0.488	SLC39A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A3	HGNC	protein_coding	OTTHUMT00000451354.2	0	0	0	16	16	13	0.00	0.00	T			2737421	-1	5	2	15	30	tier1	no_errors	ENST00000590875	ensembl	human	known	74_37	rna	25.00	6.25	DEL	0.018	-	5	15
