#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
VWA8	23078	genome.wustl.edu	37	13	42273392	42273392	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr13:42273392T>C	ENST00000379310.3	-	29	3447	c.3379A>G	c.(3379-3381)Act>Gct	p.T1127A		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1127						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										ACATAGAGAGTATTTTGCTCA	0.373													ENSG00000102763																																					0													77.0	74.0	75.0					13																	42273392		1841	4090	5931	SO:0001583	missense	0			-	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3379A>G	13.37:g.42273392T>C	ENSP00000368612:p.Thr1127Ala		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.T1127A	ENST00000379310.3	37	c.3379	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	T	0.061	-1.224201	0.01530	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.09538	2.97	5.5	3.09	0.35607	.	0.471642	0.22627	N	0.057627	T	0.08179	0.0204	L	0.50333	1.59	0.26384	N	0.97669	B	0.02656	0.0	B	0.01281	0.0	T	0.41161	-0.9524	10	0.11182	T	0.66	.	4.4746	0.11729	0.1355:0.234:0.0:0.6304	.	1127	A3KMH1	K0564_HUMAN	A	1031;1127	ENSP00000368612:T1127A	ENSP00000251030:T1031A	T	-	1	0	KIAA0564	41171392	0.003000	0.15002	0.123000	0.21794	0.062000	0.15995	0.123000	0.15708	0.484000	0.27630	0.477000	0.44152	ACT	-	VWA8	-	NULL		0.373	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2	0	0	0	21	21	115	0.00	0.00	T	NM_015058		42273392	-1	15	15	65	115	tier1	no_errors	ENST00000379310	ensembl	human	known	74_37	missense	18.75	11.54	SNP	0.418	C	15	65
ISY1	57461	genome.wustl.edu	37	3	128864635	128864635	+	Missense_Mutation	SNP	C	C	G	rs368170673		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr3:128864635C>G	ENST00000393295.3	-	6	586	c.269G>C	c.(268-270)cGg>cCg	p.R90P	ISY1_ENST00000471497.1_5'UTR|ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.R90P|ISY1_ENST00000393292.3_Missense_Mutation_p.R90P|ISY1_ENST00000273541.8_Missense_Mutation_p.R90P	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	90					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						CTCCTTTATCCGGACCTCCCA	0.478													ENSG00000261796																																					0													117.0	119.0	118.0					3																	128864635		1961	4157	6118	SO:0001583	missense	0			-		CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.269G>C	3.37:g.128864635C>G	ENSP00000376973:p.Arg90Pro		Q96IL2|Q9BT05	Missense_Mutation	SNP	pfam_Isy1	p.R90P	ENST00000393295.3	37	c.269	CCDS43149.1	3	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414475	0.83449	.	.	ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541;ENST00000496163;ENST00000393292	T	0.37584	1.19	5.31	4.43	0.53597	.	0.054844	0.85682	D	0.000000	T	0.65760	0.2722	M	0.91510	3.215	0.80722	D	1	D;D;D	0.76494	0.995;0.976;0.999	D;P;D	0.77004	0.952;0.894;0.989	T	0.73180	-0.4064	10	0.87932	D	0	.	11.8615	0.52469	0.0:0.9147:0.0:0.0853	.	90;90;90	Q9ULR0-2;Q9ULR0;Q9ULR0-1	.;ISY1_HUMAN;.	P	90;90;90;28;90	ENSP00000273541:R90P	ENSP00000273541:R90P	R	-	2	0	ISY1	130347325	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.542000	0.67218	1.241000	0.43820	0.591000	0.81541	CGG	-	ISY1-RAB43	-	pfam_Isy1		0.478	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISY1-RAB43	HGNC	protein_coding	OTTHUMT00000267856.1	0	0	0	48	48	121	0.00	0.00	C	NM_020701		128864635	-1	13	31	73	113	tier1	no_errors	ENST00000418265	ensembl	human	known	74_37	missense	15.12	21.53	SNP	1.000	G	13	73
ZNF76	7629	genome.wustl.edu	37	6	35255451	35255451	+	Silent	SNP	C	C	T	rs376706823		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr6:35255451C>T	ENST00000373953.3	+	5	527	c.261C>T	c.(259-261)gcC>gcT	p.A87A	ZNF76_ENST00000440666.2_Silent_p.A61A|ZNF76_ENST00000339411.5_Silent_p.A87A	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	87	3 X 12 AA approximate repeats.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CCCTGGAAGCCGTCCAACTGG	0.587													ENSG00000065029																									Esophageal Squamous(52;92 1039 20612 23956 34676)												0								C		0,4406		0,0,2203	98.0	87.0	91.0		261	-4.9	0.9	6		91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF76	NM_003427.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		87/571	35255451	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.261C>T	6.37:g.35255451C>T			Q9BQB2	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A87	ENST00000373953.3	37	c.261	CCDS4801.1	6																																																																																			-	ZNF76	-	NULL		0.587	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF76	HGNC	protein_coding	OTTHUMT00000040279.2	0	0	0	13	13	71	0.00	0.00	C	NM_003427		35255451	+1	5	28	11	52	tier1	no_errors	ENST00000373953	ensembl	human	known	74_37	silent	31.25	35.00	SNP	0.896	T	5	11
CENPE	1062	genome.wustl.edu	37	4	104061060	104061060	+	Silent	SNP	G	G	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr4:104061060G>A	ENST00000265148.3	-	38	6179	c.6090C>T	c.(6088-6090)agC>agT	p.S2030S	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2030					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTCTTCAAGGCTTTCATGAA	0.363													ENSG00000138778																																					0													146.0	139.0	141.0					4																	104061060		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6090C>T	4.37:g.104061060G>A			A6NKY9|A8K2U7|Q4LE75	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S2030	ENST00000265148.3	37	c.6090	CCDS34042.1	4																																																																																			-	CENPE	-	NULL		0.363	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		0	0	0	79	79	97	0.00	0.00	G			104061060	-1	43	44	96	66	tier1	no_errors	ENST00000265148	ensembl	human	known	74_37	silent	30.94	40.00	SNP	0.019	A	43	96
STARD13	90627	genome.wustl.edu	37	13	33684840	33684840	+	Missense_Mutation	SNP	C	C	T	rs368225953		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr13:33684840C>T	ENST00000336934.5	-	11	2928	c.2812G>A	c.(2812-2814)Gat>Aat	p.D938N	STARD13_ENST00000399365.3_Missense_Mutation_p.D820N|STARD13_ENST00000255486.4_Missense_Mutation_p.D930N	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	938	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		AAAGCAAGATCTGTATTGTCC	0.448													ENSG00000133121																																					0								C	ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	156.0	146.0	149.0		2788,2812,2458	5.5	0.9	13		149	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	STARD13	NM_178007.2,NM_178006.3,NM_052851.2	23,23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	930/1106,938/1114,820/996	33684840	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2812G>A	13.37:g.33684840C>T	ENSP00000338785:p.Asp938Asn		A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.D938N	ENST00000336934.5	37	c.2812	CCDS9348.1	13	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216430	0.79352	0.0	1.16E-4	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934	T;T;T	0.80480	-1.38;-1.38;-1.38	5.49	5.49	0.81192	Lipid-binding START (3);START-like domain (1);	0.290468	0.42420	D	0.000701	T	0.80292	0.4596	L	0.41573	1.285	0.80722	D	1	P;B;B	0.34757	0.467;0.168;0.01	B;B;B	0.41202	0.302;0.35;0.04	T	0.80946	-0.1155	10	0.87932	D	0	.	19.7343	0.96195	0.0:1.0:0.0:0.0	.	903;938;930	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	N	820;930;938	ENSP00000382300:D820N;ENSP00000255486:D930N;ENSP00000338785:D938N	ENSP00000255486:D930N	D	-	1	0	STARD13	32582840	1.000000	0.71417	0.862000	0.33874	0.910000	0.53928	7.681000	0.84073	2.728000	0.93425	0.561000	0.74099	GAT	-	STARD13	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom		0.448	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13	HGNC	protein_coding	OTTHUMT00000276118.2	0	0	0	31	31	77	0.00	0.00	C	NM_001243466		33684840	-1	19	18	45	53	tier1	no_errors	ENST00000336934	ensembl	human	known	74_37	missense	29.69	25.35	SNP	1.000	T	19	45
OR2T8	343172	genome.wustl.edu	37	1	248084815	248084815	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:248084815T>C	ENST00000319968.4	+	1	496	c.496T>C	c.(496-498)Tat>Cat	p.Y166H		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGCTTCCCATATTGCGGTGC	0.567													ENSG00000177462																																					0													45.0	34.0	37.0					1																	248084815		2198	4273	6471	SO:0001583	missense	0			-		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.496T>C	1.37:g.248084815T>C	ENSP00000326225:p.Tyr166His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y166H	ENST00000319968.4	37	c.496	CCDS31100.1	1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.983559	0.53827	.	.	ENSG00000177462	ENST00000319968	T	0.00099	8.73	3.56	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.516040	0.14172	U	0.336646	T	0.00468	0.0015	M	0.83223	2.63	0.09310	N	1	D	0.63880	0.993	D	0.68192	0.956	T	0.44314	-0.9336	10	0.87932	D	0	.	11.2197	0.48846	0.0:0.0:0.0:1.0	.	166	A6NH00	OR2T8_HUMAN	H	166	ENSP00000326225:Y166H	ENSP00000326225:Y166H	Y	+	1	0	OR2T8	246151438	0.000000	0.05858	0.003000	0.11579	0.056000	0.15407	0.803000	0.27083	1.481000	0.48307	0.332000	0.21555	TAT	-	OR2T8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.567	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	0	0	0	8	8	15	0.00	0.00	T	NM_001005522		248084815	+1	8	2	16	11	tier1	no_errors	ENST00000319968	ensembl	human	known	74_37	missense	33.33	15.38	SNP	0.124	C	8	16
TMEM252	169693	genome.wustl.edu	37	9	71155617	71155617	+	Silent	SNP	C	C	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr9:71155617C>A	ENST00000377311.3	-	1	166	c.114G>T	c.(112-114)ggG>ggT	p.G38G	RP11-274B18.2_ENST00000432148.1_lincRNA|RP11-274B18.4_ENST00000413269.3_lincRNA	NM_153237.1	NP_694969.1	Q8N6L7	TM252_HUMAN	transmembrane protein 252	38						integral component of membrane (GO:0016021)											CAATCAGGCTCCCCTGACAGT	0.537													ENSG00000181778																																					0													64.0	61.0	62.0					9																	71155617		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC029780	CCDS35040.1	9q21.13	2012-07-19	2012-07-19	2012-07-19	ENSG00000181778	ENSG00000181778			28537	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 71"""	C9orf71		12477932	Standard	NM_153237		Approved	MGC34760	uc004agt.3	Q8N6L7	OTTHUMG00000019967	ENST00000377311.3:c.114G>T	9.37:g.71155617C>A				Silent	SNP	NULL	p.G38	ENST00000377311.3	37	c.114	CCDS35040.1	9																																																																																			-	TMEM252	-	NULL		0.537	TMEM252-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM252	HGNC	protein_coding	OTTHUMT00000052551.1	0	0	0	23	23	94	0.00	0.00	C	NM_153237		71155617	-1	10	29	27	73	tier1	no_errors	ENST00000377311	ensembl	human	known	74_37	silent	27.03	28.16	SNP	0.000	A	10	27
ESRP1	54845	genome.wustl.edu	37	8	95658450	95658450	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr8:95658450delA	ENST00000433389.2	+	4	620	c.430delA	c.(430-432)aagfs	p.K145fs	ESRP1_ENST00000454170.2_Frame_Shift_Del_p.K145fs|ESRP1_ENST00000358397.5_Frame_Shift_Del_p.K145fs|ESRP1_ENST00000423620.2_Frame_Shift_Del_p.K145fs	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	145					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						AAAAGAATTCAAGAAATGTTG	0.353													ENSG00000104413																																					0													159.0	150.0	153.0					8																	95658450		1869	4096	5965	SO:0001589	frameshift_variant	0				AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.430delA	8.37:g.95658450delA	ENSP00000405738:p.Lys145fs		A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Frame_Shift_Del	DEL	superfamily_RNaseH-like_dom,smart_RRM_dom,pfscan_RRM_dom	p.K144fs	ENST00000433389.2	37	c.430	CCDS47897.1	8																																																																																				ESRP1	-	superfamily_RNaseH-like_dom		0.353	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	0	0	0	71	71	129	0.00	0.00	A	NM_017697		95658450	+1	41	19	53	69	tier1	no_errors	ENST00000433389	ensembl	human	known	74_37	frame_shift_del	43.62	21.59	DEL	1.000	-	41	53
PIM1	5292	genome.wustl.edu	37	6	37139016	37139025	+	Frame_Shift_Del	DEL	TCCTGGAGAG	TCCTGGAGAG	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	TCCTGGAGAG	TCCTGGAGAG	TCCTGGAGAG	-	TCCTGGAGAG	TCCTGGAGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr6:37139016_37139025delTCCTGGAGAG	ENST00000373509.5	+	4	729_738	c.356_365delTCCTGGAGAG	c.(355-366)atcctggagaggfs	p.ILER119fs		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	210					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	TTCGTCCTGATCCTGGAGAGGCCCGAGCCG	0.614			T	BCL6	NHL								ENSG00000137193																												Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	0																																										SO:0001589	frameshift_variant	0					CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.356_365delTCCTGGAGAG	6.37:g.37139016_37139025delTCCTGGAGAG	ENSP00000362608:p.Ile119fs		Q38RT9|Q5T7H7|Q96RG3	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I119fs	ENST00000373509.5	37	c.356_365	CCDS4830.1	6																																																																																				PIM1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.614	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM1	HGNC	protein_coding	OTTHUMT00000043903.1	0	0	0	94	94	94	0.00	0.00	TCCTGGAGAG			37139025	+1	10	10	67	67	tier1	no_errors	ENST00000373509	ensembl	human	known	74_37	frame_shift_del	12.99	12.99	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.944:1.000	-	10	67
VPS45	11311	genome.wustl.edu	37	1	150082514	150082514	+	Intron	DEL	A	A	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:150082514delA	ENST00000369130.3	+	14	2039				VPS45_ENST00000484306.1_3'UTR|VPS45_ENST00000535106.1_Intron|VPS45_ENST00000369128.5_Intron	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)						blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCCTCCACCAAAAAAAAAAG	0.303													ENSG00000136631																																					0																																										SO:0001627	intron_variant	0				U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.1494-97A>-	1.37:g.150082514delA			D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	R	DEL	-	NULL	ENST00000369130.3	37	NULL	CCDS944.1	1																																																																																				VPS45	-	-		0.303	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS45	HGNC	protein_coding	OTTHUMT00000034964.1	0	0	0	18	18	47	0.00	0.00	A	NM_007259		150082514	+1	5	6	31	45	tier1	no_errors	ENST00000484306	ensembl	human	known	74_37	rna	13.89	11.76	DEL	0.965	-	5	31
MYH1	4619	genome.wustl.edu	37	17	10404621	10404621	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr17:10404621G>T	ENST00000226207.5	-	27	3638	c.3544C>A	c.(3544-3546)Ctg>Atg	p.L1182M	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1182					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GCCTCCTCCAGGTCCCTGCGC	0.597													ENSG00000109061																																					0													84.0	89.0	88.0					17																	10404621		2203	4300	6503	SO:0001583	missense	0			-		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3544C>A	17.37:g.10404621G>T	ENSP00000226207:p.Leu1182Met		Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1182M	ENST00000226207.5	37	c.3544	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783963	0.90282	.	.	ENSG00000109061	ENST00000226207	D	0.90844	-2.74	5.51	5.51	0.81932	Myosin tail (1);	0.000000	0.35525	U	0.003154	D	0.95758	0.8620	M	0.90542	3.125	0.80722	D	1	D	0.55385	0.971	P	0.59546	0.859	D	0.95149	0.8271	10	0.44086	T	0.13	.	19.7865	0.96442	0.0:0.0:1.0:0.0	.	1182	P12882	MYH1_HUMAN	M	1182	ENSP00000226207:L1182M	ENSP00000226207:L1182M	L	-	1	2	MYH1	10345346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.572000	0.74005	2.751000	0.94390	0.650000	0.86243	CTG	-	MYH1	-	pfam_Myosin_tail		0.597	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	0	0	0	65	65	14	0.00	0.00	G	NM_005963		10404621	-1	55	3	97	7	tier1	no_errors	ENST00000226207	ensembl	human	known	74_37	missense	36.18	30.00	SNP	1.000	T	55	97
MIEF2	125170	genome.wustl.edu	37	17	18167708	18167708	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr17:18167708A>G	ENST00000323019.4	+	4	1206	c.995A>G	c.(994-996)cAg>cGg	p.Q332R	MIEF2_ENST00000395706.2_Missense_Mutation_p.Q343R|MIEF2_ENST00000395704.4_3'UTR	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	332					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											CTCTGGCTGCAGGACCTGTAT	0.677													ENSG00000177427																																					0													41.0	48.0	46.0					17																	18167708		2202	4297	6499	SO:0001583	missense	0			-	BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.995A>G	17.37:g.18167708A>G	ENSP00000323591:p.Gln332Arg		J3KPT3|Q6ZRD4|Q96N07	Missense_Mutation	SNP	NULL	p.Q332R	ENST00000323019.4	37	c.995	CCDS11193.1	17	.	.	.	.	.	.	.	.	.	.	A	7.159	0.585239	0.13749	.	.	ENSG00000177427	ENST00000323019;ENST00000395706	T;T	0.08193	3.12;3.12	5.45	5.45	0.79879	.	0.177118	0.49916	D	0.000121	T	0.17195	0.0413	L	0.52759	1.655	0.48087	D	0.999582	D	0.54772	0.968	P	0.52909	0.713	T	0.00398	-1.1764	10	0.48119	T	0.1	-27.4493	15.5101	0.75772	1.0:0.0:0.0:0.0	.	332	Q96C03	MID49_HUMAN	R	332;343	ENSP00000323591:Q332R;ENSP00000379057:Q343R	ENSP00000323591:Q332R	Q	+	2	0	SMCR7	18108433	1.000000	0.71417	0.997000	0.53966	0.586000	0.36452	3.394000	0.52551	2.073000	0.62155	0.379000	0.24179	CAG	-	MIEF2	-	NULL		0.677	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF2	HGNC	protein_coding	OTTHUMT00000132060.2	0	0	0	19	19	16	0.00	0.00	A	NM_139162		18167708	+1	13	2	26	9	tier1	no_errors	ENST00000323019	ensembl	human	known	74_37	missense	33.33	18.18	SNP	1.000	G	13	26
TPM3	7170	genome.wustl.edu	37	1	154144674	154144674	+	Intron	DEL	A	A	-			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:154144674delA	ENST00000368530.2	-	5	759				TPM3_ENST00000330188.9_Intron|TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000302206.5_Intron|TPM3_ENST00000368531.2_Intron|TPM3_ENST00000368533.3_Intron|TPM3_ENST00000341485.5_Intron|TPM3_ENST00000323144.7_Intron|TPM3_ENST00000271850.7_Intron|TPM3_ENST00000341372.3_Intron|TPM3_ENST00000328159.4_Intron	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					CAGCAAAACGAAAAAAAAAAA	0.438			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""								ENSG00000143549																												Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0																																										SO:0001627	intron_variant	0				BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.566+709T>-	1.37:g.154144674delA			D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	R	DEL	-	NULL	ENST00000368530.2	37	NULL	CCDS41403.1	1																																																																																				TPM3	-	-		0.438	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	HGNC	protein_coding	OTTHUMT00000087271.2	0	0	0	22	22	56	0.00	0.00	A	NM_152263		154144674	-1	5	6	51	60	tier1	no_errors	ENST00000469717	ensembl	human	known	74_37	rna	8.93	9.09	DEL	0.000	-	5	51
AZU1	566	genome.wustl.edu	37	19	831755	831755	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr19:831755C>T	ENST00000233997.2	+	5	655	c.634C>T	c.(634-636)Cac>Tac	p.H212Y		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	212	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCCTGGCCCACGGCGTGGC	0.692													ENSG00000172232																																					0													17.0	20.0	19.0					19																	831755		2197	4291	6488	SO:0001583	missense	0			-	X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.634C>T	19.37:g.831755C>T	ENSP00000233997:p.His212Tyr		P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.H212Y	ENST00000233997.2	37	c.634	CCDS12044.1	19	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786812	0.31593	.	.	ENSG00000172232	ENST00000233997	D	0.88431	-2.38	1.87	-0.307	0.12777	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.78483	0.4290	N	0.13043	0.29	0.09310	N	1	D	0.58620	0.983	P	0.46110	0.504	T	0.69636	-0.5092	9	0.52906	T	0.07	.	3.909	0.09194	0.0:0.5796:0.0:0.4204	.	212	P20160	CAP7_HUMAN	Y	212	ENSP00000233997:H212Y	ENSP00000233997:H212Y	H	+	1	0	AZU1	782755	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.236000	0.17967	-0.021000	0.14009	0.561000	0.74099	CAC	-	AZU1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.692	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZU1	HGNC	protein_coding	OTTHUMT00000457472.2	0	0	0	38	38	9	0.00	0.00	C	NM_001700		831755	+1	22	0	67	6	tier1	no_errors	ENST00000233997	ensembl	human	known	74_37	missense	24.72	0.00	SNP	0.000	T	22	67
NEUROG2	63973	genome.wustl.edu	37	4	113436358	113436358	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr4:113436358G>A	ENST00000313341.3	-	2	600	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	RP11-402J6.1_ENST00000504009.1_RNA|RP11-402J6.1_ENST00000506057.1_RNA	NM_024019.3	NP_076924.1	Q9H2A3	NGN2_HUMAN	neurogenin 2	92					axon guidance (GO:0007411)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(6)|skin(2)	12		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00168)		GCCCGCGCCCGGGAAGGGCGC	0.726													ENSG00000178403																																					0													14.0	16.0	15.0					4																	113436358		2163	4236	6399	SO:0001583	missense	0			-	AF303002	CCDS3698.1	4q25	2013-05-21			ENSG00000178403	ENSG00000178403		"""Basic helix-loop-helix proteins"""	13805	protein-coding gene	gene with protein product		606624					Standard	NM_024019		Approved	Atoh4, Math4A, ngn-2, bHLHa8, NGN2	uc003ias.3	Q9H2A3	OTTHUMG00000132907	ENST00000313341.3:c.274C>T	4.37:g.113436358G>A	ENSP00000317333:p.Arg92Trp		Q8N416	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R92W	ENST00000313341.3	37	c.274	CCDS3698.1	4	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292469	0.23564	.	.	ENSG00000178403	ENST00000313341	D	0.92048	-2.96	3.5	1.64	0.23874	.	0.177647	0.26560	U	0.023694	D	0.90872	0.7132	N	0.24115	0.695	0.47698	D	0.999499	D	0.89917	1.0	D	0.67231	0.95	D	0.88760	0.3256	10	0.72032	D	0.01	-10.2651	9.3501	0.38133	0.0:0.0:0.5039:0.4961	.	92	Q9H2A3	NGN2_HUMAN	W	92	ENSP00000317333:R92W	ENSP00000317333:R92W	R	-	1	2	NEUROG2	113655807	0.985000	0.35326	0.018000	0.16275	0.023000	0.10783	3.720000	0.54933	0.144000	0.18951	0.313000	0.20887	CGG	-	NEUROG2	-	NULL		0.726	NEUROG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROG2	HGNC	protein_coding	OTTHUMT00000256414.1	0	0	0	33	33	5	0.00	0.00	G	NM_024019		113436358	-1	24	0	43	2	tier1	no_errors	ENST00000313341	ensembl	human	known	74_37	missense	35.82	0.00	SNP	0.709	A	24	43
CABLES1	91768	genome.wustl.edu	37	18	20716015	20716023	+	In_Frame_Del	DEL	GGCGCCGGC	GGCGCCGGC	-	rs201595073|rs139352344	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	GGCGCCGGC	GGCGCCGGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr18:20716015_20716023delGGCGCCGGC	ENST00000256925.7	+	1	289_297	c.289_297delGGCGCCGGC	c.(289-297)ggcgccggcdel	p.GAG97del	AC105247.1_ENST00000411067.1_RNA|CABLES1_ENST00000400473.2_Intron	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	97	Ala-rich.|Interacts with TDRD7. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ggccaagccgggcgccggcggcgcctgcg	0.785													ENSG00000134508		1123	0.224241	0.2602	0.17	5008	,	,		3844	0.244		0.2048	False		,,,				2504	0.2137																0																																										SO:0001651	inframe_deletion	0				BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.289_297delGGCGCCGGC	18.37:g.20716015_20716023delGGCGCCGGC	ENSP00000256925:p.Gly97_Gly99del		B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	In_Frame_Del	DEL	pfam_Cyclin_N,superfamily_Cyclin-like,pirsf_Cdk5/c-Abl_linker_Cables	p.GGA99in_frame_del	ENST00000256925.7	37	c.289_297	CCDS42417.1	18																																																																																				CABLES1	-	pirsf_Cdk5/c-Abl_linker_Cables		0.785	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CABLES1	HGNC	protein_coding	OTTHUMT00000445198.2	0	0	0	0	0	0	0.00	0.00	GGCGCCGGC	NM_138375		20716023	+1	0	0	1	1	tier1	no_errors	ENST00000256925	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.983:0.981:0.990:0.998:0.999:0.997:0.999:0.999:0.997	-	0	1
SCN11A	11280	genome.wustl.edu	37	3	38948802	38948811	+	Intron	DEL	TGTGTGTGTG	TGTGTGTGTG	-	rs141158768		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	TGTGTGTGTG	TGTGTGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr3:38948802_38948811delTGTGTGTGTG	ENST00000302328.3	-	10	1672				SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000456224.3_Intron|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000444237.2_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ccAACATATAtgtgtgtgtgtgtgtgtgtg	0.367													ENSG00000215941																																					0																																										SO:0001627	intron_variant	0				AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+628CACACACACA>-	3.37:g.38948812_38948821delTGTGTGTGTG			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	R	DEL	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																				AC116038.1	-	-		0.367	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000109746.4	0	0	0	0	0	0	0.00	0.00	TGTGTGTGTG	NM_014139		38948811	+1	0	0	0	0	tier1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.000:0.001:0.005:0.007:0.015:0.028:0.021:0.020:0.022:0.022	-	0	0
TDG	6996	genome.wustl.edu	37	12	104378945	104378954	+	Intron	DEL	ACACACACAC	ACACACACAC	-	rs2722186|rs527868730	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	ACACACACAC	ACACACACAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr12:104378945_104378954delACACACACAC	ENST00000392872.3	+	8	1198				AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000542036.1_Intron|TDG_ENST00000544861.1_Intron|TDG_ENST00000266775.9_Intron	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		ATAGacacatacacacacacacacacacac	0.329								Base excision repair (BER), DNA glycosylases					ENSG00000215976																																					0																																										SO:0001627	intron_variant	0				U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.964+247ACACACACAC>-	12.37:g.104378955_104378964delACACACACAC			Q8IUZ6|Q8IZM3	R	DEL	-	NULL	ENST00000392872.3	37	NULL	CCDS9095.1	12																																																																																				AC078819.1	-	-		0.329	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215976	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000399673.2	0	0	0	0	0	0	0.00	0.00	ACACACACAC			104378954	+1	0	0	0	0	tier1	no_errors	ENST00000401157	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.022:0.023:0.025:0.026:0.026:0.026:0.026:0.025:0.024:0.023	-	0	0
LINC00266-1	140849	genome.wustl.edu	37	20	62934863	62934864	+	RNA	INS	-	-	TT	rs370163240|rs4057443		TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr20:62934863_62934864insTT	ENST00000279067.3	+	0	879_880					NR_040415.1				long intergenic non-protein coding RNA 266-1																		GTAATTTTAACTGTGATTTATT	0.332													ENSG00000149656																																					0																																												0				BC118988		20q13.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000149656	ENSG00000149656		"""Long non-coding RNAs"""	16202	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 69"", ""non-protein coding RNA 266"", ""non-protein coding RNA 266-1"""	C20orf69, NCRNA00266, NCRNA00266-1			Standard	NR_040415		Approved	bA476I15.3	uc002yio.1		OTTHUMG00000033036		20.37:g.62934863_62934864insTT				R	INS	-	NULL	ENST00000279067.3	37	NULL		20																																																																																				LINC00266-1	-	-		0.332	LINC00266-1-001	KNOWN	basic	processed_transcript	LINC00266-1	HGNC	processed_transcript	OTTHUMT00000080304.2	0	0	0	20	20	0	0.00	0.00	-			62934864	+1	8	0	37	0	tier1	no_errors	ENST00000279067	ensembl	human	known	74_37	rna	17.78	0.00	INS	0.448:0.498	TT	8	37
ARHGAP29	9411	genome.wustl.edu	37	1	94643143	94643144	+	Intron	INS	-	-	T	rs563927860	byFrequency	TCGA-DX-A3UB-01A-11D-A307-09	TCGA-DX-A3UB-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66b644e8-b86a-4f11-8e3f-63a9d913f618	db5413dc-7f80-4fbc-a345-6a5d8ed16ad0	g.chr1:94643143_94643144insT	ENST00000260526.6	-	22	3088				ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29						positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CAGCAAACATATTTTTTTTTTA	0.376													ENSG00000137962																																					0																																										SO:0001627	intron_variant	0					CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2905+23->A	1.37:g.94643153_94643153dupT			O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	R	INS	-	NULL	ENST00000260526.6	37	NULL	CCDS748.1	1																																																																																				ARHGAP29	-	-		0.376	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	0	0	0	26	26	34	0.00	0.00	-	NM_004815		94643144	-1	5	2	41	51	tier1	no_errors	ENST00000482481	ensembl	human	known	74_37	rna	10.87	3.77	INS	0.000:0.000	T	5	41
