#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PDPK2P	653650	genome.wustl.edu	37	16	2692244	2692244	+	lincRNA	SNP	C	C	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:2692244C>G	ENST00000565111.1	-	0	1144				PDPK2_ENST00000382326.1_RNA																							GAAAAAGAGCCTTCCCCAAGA	0.602													ENSG00000205918																																					0																																												0			-																													16.37:g.2692244C>G				R	SNP	-	NULL	ENST00000565111.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	10.36	1.329236	0.24167	.	.	ENSG00000205918	ENST00000382326	.	.	.	3.18	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.67325	0.2881	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	T	0.79245	-0.1883	5	0.87932	D	0	-11.1953	13.3911	0.60825	0.0:1.0:0.0:0.0	.	.	.	.	R	83	.	ENSP00000371763:G83R	G	-	1	0	AC141586.1	2632245	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	7.490000	0.81461	1.786000	0.52430	0.411000	0.27672	GGC	-	PDPK2	-	-		0.602	CTD-3126B10.4-001	KNOWN	basic	lincRNA	ENSG00000205918	Clone_based_vega_gene	lincRNA	OTTHUMT00000436114.1	0	0	0	52	52	89	0.00	0.00	C			2692244	-1	21	45	31	53	tier1	no_errors	ENST00000382326	ensembl	human	known	74_37	rna	40.38	45.92	SNP	1.000	G	21	31
HMCN2	256158	genome.wustl.edu	37	9	133263837	133263837	+	3'UTR	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:133263837C>A	ENST00000487727.2	+	0	527							Q8NDA2	HMCN2_HUMAN	hemicentin 2						response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										GACAGTGAGCCAGGTGGCTGG	0.577													ENSG00000148357																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000487727.2:c.*524C>A	9.37:g.133263837C>A			Q8N225|Q8TCI8	R	SNP	-	NULL	ENST00000487727.2	37	NULL		9																																																																																			-	HMCN2	-	-		0.577	HMCN2-006	KNOWN	mRNA_start_NF|basic	processed_transcript	HMCN2	HGNC	protein_coding	OTTHUMT00000054659.3	0	0	0	23	23	65	0.00	0.00	C	XM_175125		133263837	+1	14	26	28	31	tier1	no_errors	ENST00000487727	ensembl	human	known	74_37	rna	33.33	45.61	SNP	1.000	A	14	28
PHLPP2	23035	genome.wustl.edu	37	16	71748565	71748565	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:71748565G>A	ENST00000568954.1	-	2	512	c.134C>T	c.(133-135)aCa>aTa	p.T45I	PHLPP2_ENST00000360429.3_Missense_Mutation_p.T45I|PHLPP2_ENST00000356272.3_Missense_Mutation_p.T45I|PHLPP2_ENST00000567016.1_Missense_Mutation_p.T80I|PHLPP2_ENST00000393524.2_Missense_Mutation_p.T45I			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	45	Poly-Thr.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						GGTGGTGGTTGTAGTGGCAGT	0.478													ENSG00000040199																																					0													194.0	130.0	152.0					16																	71748565		2198	4300	6498	SO:0001583	missense	0			-	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.134C>T	16.37:g.71748565G>A	ENSP00000457991:p.Thr45Ile		A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom	p.T45I	ENST00000568954.1	37	c.134	CCDS32479.1	16	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337700	0.60963	.	.	ENSG00000040199	ENST00000360429;ENST00000356272;ENST00000393524;ENST00000538126	T;T;T	0.46063	1.34;1.41;0.88	5.58	5.58	0.84498	.	0.587434	0.18001	N	0.154911	T	0.25901	0.0631	N	0.08118	0	0.27897	N	0.939109	B;B	0.27380	0.096;0.177	B;B	0.26202	0.067;0.049	T	0.13469	-1.0508	10	0.31617	T	0.26	0.2957	15.0563	0.71915	0.0:0.0:1.0:0.0	.	45;45	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	I	45	ENSP00000353610:T45I;ENSP00000348611:T45I;ENSP00000377159:T45I	ENSP00000348611:T45I	T	-	2	0	PHLPP2	70306066	0.894000	0.30519	0.609000	0.28983	0.980000	0.70556	3.194000	0.51005	2.622000	0.88805	0.591000	0.81541	ACA	-	PHLPP2	-	NULL		0.478	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHLPP2	HGNC	protein_coding	OTTHUMT00000434139.1	0	0	0	28	28	128	0.00	0.00	G	NM_015020		71748565	-1	22	47	1	11	tier1	no_errors	ENST00000356272	ensembl	human	known	74_37	missense	95.65	81.03	SNP	0.688	A	22	1
KIAA1804	84451	genome.wustl.edu	37	1	233518139	233518139	+	Silent	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:233518139C>T	ENST00000366624.3	+	10	3054	c.2793C>T	c.(2791-2793)gtC>gtT	p.V931V	MLK4_ENST00000366622.1_Silent_p.V377V	NM_032435.2	NP_115811.2																					CAAGGGAGGTCTCACCCAAGA	0.587													ENSG00000143674																																					0													104.0	92.0	96.0					1																	233518139		2203	4300	6503	SO:0001819	synonymous_variant	0			-																												ENST00000366624.3:c.2793C>T	1.37:g.233518139C>T				Silent	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.V931	ENST00000366624.3	37	c.2793	CCDS1598.1	1																																																																																			-	MLK4	-	pirsf_MAPKKK9/10/11		0.587	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	Uniprot_gn	protein_coding	OTTHUMT00000092495.1	0	0	0	23	23	42	0.00	0.00	C			233518139	+1	14	25	19	27	tier1	no_errors	ENST00000366624	ensembl	human	known	74_37	silent	42.42	48.08	SNP	0.033	T	14	19
HMCN2	256158	genome.wustl.edu	37	9	133263827	133263827	+	3'UTR	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:133263827G>A	ENST00000487727.2	+	0	517							Q8NDA2	HMCN2_HUMAN	hemicentin 2						response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										CCAAGACAGAGACAGTGAGCC	0.582													ENSG00000148357																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000487727.2:c.*514G>A	9.37:g.133263827G>A			Q8N225|Q8TCI8	R	SNP	-	NULL	ENST00000487727.2	37	NULL		9																																																																																			-	HMCN2	-	-		0.582	HMCN2-006	KNOWN	mRNA_start_NF|basic	processed_transcript	HMCN2	HGNC	protein_coding	OTTHUMT00000054659.3	0	0	0	24	24	66	0.00	0.00	G	XM_175125		133263827	+1	12	25	29	34	tier1	no_errors	ENST00000487727	ensembl	human	known	74_37	rna	29.27	42.37	SNP	0.997	A	12	29
ASPH	444	genome.wustl.edu	37	8	62559366	62559366	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr8:62559366T>A	ENST00000379454.4	-	6	749	c.562A>T	c.(562-564)Atg>Ttg	p.M188L	ASPH_ENST00000445642.3_Missense_Mutation_p.M174L|ASPH_ENST00000517903.1_Missense_Mutation_p.M174L|ASPH_ENST00000541428.1_Missense_Mutation_p.M159L|ASPH_ENST00000518068.1_Intron|ASPH_ENST00000522835.1_Intron|ASPH_ENST00000517847.2_Missense_Mutation_p.M174L|ASPH_ENST00000522919.1_Start_Codon_SNP_p.M1L|ASPH_ENST00000356457.5_Missense_Mutation_p.M188L	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	188	Glu-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TCAGTCGCCATAAGAAACTCA	0.388													ENSG00000198363																																					0													383.0	384.0	384.0					8																	62559366		2203	4300	6503	SO:0001583	missense	0			-	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.562A>T	8.37:g.62559366T>A	ENSP00000368767:p.Met188Leu		A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.M188L	ENST00000379454.4	37	c.562	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	T	11.98	1.801344	0.31869	.	.	ENSG00000198363	ENST00000389213;ENST00000541428;ENST00000379454;ENST00000522919;ENST00000356457;ENST00000519234;ENST00000517903;ENST00000445642;ENST00000517847	T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.48	-7.43	0.01383	Aspartyl beta-hydroxylase/Triadin domain (1);	2.338930	0.01311	N	0.010611	T	0.22975	0.0555	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.08055	0.002;0.0;0.001;0.002;0.001;0.0;0.0;0.003	T	0.09885	-1.0654	10	0.17369	T	0.5	1.7494	2.6632	0.05032	0.0996:0.3606:0.2014:0.3385	.	188;174;174;159;188;188;174;188	B8Y0L3;B7ZM95;B7ZM96;F5H667;F8W7A9;Q12797-2;Q9H291;Q12797	.;.;.;.;.;.;.;ASPH_HUMAN	L	188;159;188;1;188;203;174;174;174	ENSP00000437864:M159L;ENSP00000368767:M188L;ENSP00000430516:M1L;ENSP00000348841:M188L;ENSP00000427823:M203L;ENSP00000430245:M174L;ENSP00000394013:M174L;ENSP00000429954:M174L	ENSP00000348841:M188L	M	-	1	0	ASPH	62721920	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.854000	0.04299	-1.443000	0.01953	-0.264000	0.10439	ATG	-	ASPH	-	pfam_Asp-B-hydro/Triadin_dom		0.388	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	0	0	0	50	50	105	0.00	0.00	T	NM_004318		62559366	-1	57	54	45	50	tier1	no_errors	ENST00000379454	ensembl	human	known	74_37	missense	55.88	51.92	SNP	0.000	A	57	45
LAYN	143903	genome.wustl.edu	37	11	111420356	111420356	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr11:111420356G>T	ENST00000375615.3	+	4	606	c.421G>T	c.(421-423)Gat>Tat	p.D141Y	LAYN_ENST00000528924.1_Intron|LAYN_ENST00000533265.1_Missense_Mutation_p.D133Y|LAYN_ENST00000436913.2_Intron|LAYN_ENST00000525126.1_Missense_Mutation_p.D141Y|LAYN_ENST00000375614.2_Missense_Mutation_p.D133Y	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	141	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	CTGGTATGTGGATGAGCCATC	0.552													ENSG00000204381																									Ovarian(17;551 586 12136 22082 22900)												0													72.0	64.0	67.0					11																	111420356		2201	4297	6498	SO:0001583	missense	0			-		CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.421G>T	11.37:g.111420356G>T	ENSP00000364765:p.Asp141Tyr		A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.D141Y	ENST00000375615.3	37	c.421	CCDS58178.1	11	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663288	0.88251	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000525126;ENST00000533265;ENST00000541011	T;T;T;T	0.30448	3.1;1.53;1.53;3.1	5.66	5.66	0.87406	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.59004	0.2162	M	0.76328	2.33	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.997	T	0.60505	-0.7250	10	0.66056	D	0.02	-23.7131	19.3539	0.94402	0.0:0.0:1.0:0.0	.	133;141;141;133	E9PMI0;Q6UX15;E9PQU7;Q6UX15-2	.;LAYN_HUMAN;.;.	Y	133;141;141;133;96	ENSP00000364764:D133Y;ENSP00000364765:D141Y;ENSP00000434328:D141Y;ENSP00000434972:D133Y	ENSP00000364764:D133Y	D	+	1	0	LAYN	110925566	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	9.455000	0.97625	2.659000	0.90383	0.563000	0.77884	GAT	-	LAYN	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.552	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	HGNC	protein_coding	OTTHUMT00000391187.1	0	0	0	18	18	49	0.00	0.00	G	NM_178834		111420356	+1	6	14	16	62	tier1	no_errors	ENST00000375615	ensembl	human	known	74_37	missense	27.27	18.42	SNP	1.000	T	6	16
MROH2B	133558	genome.wustl.edu	37	5	41042208	41042208	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:41042208C>T	ENST00000399564.4	-	19	2389	c.1939G>A	c.(1939-1941)Ggg>Agg	p.G647R	MROH2B_ENST00000506092.2_Missense_Mutation_p.G202R	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	647																	CTTTGATCCCCCAGTTGGTTG	0.428													ENSG00000171495																																					0													53.0	49.0	50.0					5																	41042208		1831	4086	5917	SO:0001583	missense	0			-		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1939G>A	5.37:g.41042208C>T	ENSP00000382476:p.Gly647Arg		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G647R	ENST00000399564.4	37	c.1939	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752217	0.69533	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.01369	4.97;5.21	5.79	5.79	0.91817	Armadillo-type fold (1);	0.000000	0.52532	D	0.000078	T	0.05777	0.0151	L	0.51422	1.61	0.39581	D	0.969437	D	0.89917	1.0	D	0.97110	1.0	T	0.58081	-0.7699	10	0.22109	T	0.4	.	15.5371	0.76013	0.0:1.0:0.0:0.0	.	647	Q7Z745	HTRB2_HUMAN	R	202;352;647	ENSP00000441504:G202R;ENSP00000382476:G647R	ENSP00000296803:G352R	G	-	1	0	HEATR7B2	41077965	0.744000	0.28250	0.743000	0.31040	0.756000	0.42949	3.761000	0.55242	2.746000	0.94184	0.460000	0.39030	GGG	-	MROH2B	-	superfamily_ARM-type_fold		0.428	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	0	0	0	49	49	109	0.00	0.00	C	NM_173489		41042208	-1	28	49	30	56	tier1	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	48.28	46.23	SNP	0.869	T	28	30
TMCO6	55374	genome.wustl.edu	37	5	140021484	140021484	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:140021484G>T	ENST00000394671.3	+	4	445	c.344G>T	c.(343-345)gGg>gTg	p.G115V	TMCO6_ENST00000511410.1_3'UTR|TMCO6_ENST00000252100.6_Missense_Mutation_p.G115V|TMCO6_ENST00000537378.1_Intron|NDUFA2_ENST00000510680.1_Intron	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	115					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCTGGTCGGGCTCCTGACC	0.637													ENSG00000113119																																					0													34.0	39.0	37.0					5																	140021484		2050	4181	6231	SO:0001583	missense	0			-	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.344G>T	5.37:g.140021484G>T	ENSP00000378166:p.Gly115Val		Q9BUU0|Q9P198	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.G115V	ENST00000394671.3	37	c.344	CCDS4233.2	5	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989905	0.74589	.	.	ENSG00000113119	ENST00000394671;ENST00000252100	T;T	0.30182	1.54;1.54	5.4	5.4	0.78164	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	U	0.000019	T	0.45538	0.1347	L	0.47716	1.5	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.61722	0.893;0.893	T	0.33828	-0.9853	10	0.59425	D	0.04	-14.4106	14.3916	0.66983	0.0:0.1478:0.8522:0.0	.	115;115	Q96DC7-2;Q96DC7	.;TMCO6_HUMAN	V	115	ENSP00000378166:G115V;ENSP00000252100:G115V	ENSP00000252100:G115V	G	+	2	0	TMCO6	140001668	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	7.276000	0.78559	2.542000	0.85734	0.563000	0.77884	GGG	-	TMCO6	-	superfamily_ARM-type_fold,smart_Armadillo		0.637	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	HGNC	protein_coding	OTTHUMT00000251666.2	0	0	0	18	18	12	0.00	0.00	G	NM_018502		140021484	+1	12	14	9	19	tier1	no_errors	ENST00000252100	ensembl	human	known	74_37	missense	57.14	42.42	SNP	1.000	T	12	9
ZNF644	84146	genome.wustl.edu	37	1	91406009	91406009	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:91406009G>C	ENST00000370440.1	-	3	1119	c.902C>G	c.(901-903)aCt>aGt	p.T301S	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.T301S|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	301					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGTATAACGAGTTATCTTGCT	0.328													ENSG00000122482																																					0													91.0	88.0	89.0					1																	91406009		2203	4299	6502	SO:0001583	missense	0			-	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.902C>G	1.37:g.91406009G>C	ENSP00000359469:p.Thr301Ser		A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T301S	ENST00000370440.1	37	c.902	CCDS731.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.88|11.88	1.770608|1.770608	0.31320|0.31320	.|.	.|.	ENSG00000122482|ENSG00000122482	ENST00000541557|ENST00000370440;ENST00000337393	.|T;T	.|0.00591	.|6.35;6.35	5.58|5.58	4.66|4.66	0.58398|0.58398	.|.	.|0.164580	.|0.56097	.|D	.|0.000039	T|T	0.00271|0.00271	0.0008|0.0008	L|L	0.29908|0.29908	0.895|0.895	0.42862|0.42862	D|D	0.994115|0.994115	.|P	.|0.34800	.|0.469	.|B	.|0.32211	.|0.142	T|T	0.79072|0.79072	-0.1953|-0.1953	6|10	0.87932|0.27785	D|T	0|0.31	-11.9515|-11.9515	14.7234|14.7234	0.69326|0.69326	0.0703:0.0:0.9297:0.0|0.0703:0.0:0.9297:0.0	.|.	.|301	.|Q9H582	.|ZN644_HUMAN	K|S	300|301	.|ENSP00000359469:T301S;ENSP00000337008:T301S	ENSP00000442287:N300K|ENSP00000337008:T301S	N|T	-|-	3|2	2|0	ZNF644|ZNF644	91178597|91178597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.987000|3.987000	0.56944|0.56944	2.636000|2.636000	0.89361|0.89361	0.655000|0.655000	0.94253|0.94253	AAC|ACT	-	ZNF644	-	NULL		0.328	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	0	0	1	25	25	138	0.00	0.72	G	NM_032186		91406009	-1	29	36	22	44	tier1	no_errors	ENST00000337393	ensembl	human	known	74_37	missense	56.86	45.00	SNP	1.000	C	29	22
TTLL2	83887	genome.wustl.edu	37	6	167754600	167754600	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr6:167754600G>C	ENST00000239587.5	+	3	1300	c.1212G>C	c.(1210-1212)aaG>aaC	p.K404N		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	404	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGTTGGTGAAGAGAAAACTTG	0.398													ENSG00000120440																																					0													125.0	131.0	129.0					6																	167754600		2203	4300	6503	SO:0001583	missense	0			-	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.1212G>C	6.37:g.167754600G>C	ENSP00000239587:p.Lys404Asn		B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.K404N	ENST00000239587.5	37	c.1212	CCDS5301.1	6	.	.	.	.	.	.	.	.	.	.	G	14.41	2.525947	0.44969	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.07114	3.22	3.85	2.97	0.34412	.	0.000000	0.64402	D	0.000002	T	0.29556	0.0737	H	0.98238	4.18	0.37008	D	0.895616	D	0.89917	1.0	D	0.97110	1.0	T	0.39099	-0.9630	10	0.87932	D	0	.	7.855	0.29476	0.2074:0.0:0.7926:0.0	.	404	Q9BWV7	TTLL2_HUMAN	N	404;331	ENSP00000239587:K404N	ENSP00000239587:K404N	K	+	3	2	TTLL2	167674590	1.000000	0.71417	0.786000	0.31890	0.546000	0.35178	1.747000	0.38298	0.956000	0.37904	0.491000	0.48974	AAG	-	TTLL2	-	pfam_TTL/TTLL_fam		0.398	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL2	HGNC	protein_coding	OTTHUMT00000043127.3	0	0	0	29	29	97	0.00	0.00	G	NM_031949		167754600	+1	17	44	23	75	tier1	no_errors	ENST00000239587	ensembl	human	known	74_37	missense	42.50	36.97	SNP	1.000	C	17	23
TGM4	7047	genome.wustl.edu	37	3	44943114	44943114	+	Silent	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr3:44943114C>A	ENST00000296125.4	+	7	824	c.756C>A	c.(754-756)atC>atA	p.I252I	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	252					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GTGCCCCGATCCTGCAGCAGT	0.567													ENSG00000163810																																					0													122.0	112.0	115.0					3																	44943114		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.756C>A	3.37:g.44943114C>A			Q16707|Q96QN4	Silent	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.I252	ENST00000296125.4	37	c.756	CCDS2723.1	3																																																																																			-	TGM4	-	NULL		0.567	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM4	HGNC	protein_coding	OTTHUMT00000256755.2	0	0	0	17	17	93	0.00	0.00	C	NM_003241		44943114	+1	14	37	12	36	tier1	no_errors	ENST00000296125	ensembl	human	known	74_37	silent	53.85	50.68	SNP	1.000	A	14	12
PRMT2	3275	genome.wustl.edu	37	21	48083355	48083355	+	Silent	SNP	A	A	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr21:48083355A>T	ENST00000397637.1	+	10	2112	c.1158A>T	c.(1156-1158)ggA>ggT	p.G386G	PRMT2_ENST00000458387.2_Nonsense_Mutation_p.R239*|PRMT2_ENST00000440086.1_Silent_p.G284G|PRMT2_ENST00000397638.2_Silent_p.G386G|PRMT2_ENST00000355680.3_Silent_p.G386G|PRMT2_ENST00000451211.2_Intron|PRMT2_ENST00000291705.6_Intron			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	386	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		TCCATACAGGAGACGTGGTCA	0.572													ENSG00000160310																																					0													186.0	146.0	159.0					21																	48083355		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.1158A>T	21.37:g.48083355A>T			B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Nonsense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tR_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.R239*	ENST00000397637.1	37	c.715	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	.	18.48	3.632505	0.67015	.	.	ENSG00000160310	ENST00000458387	.	.	.	5.29	-2.21	0.06973	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.0315	1.4573	0.02388	0.4684:0.1365:0.2627:0.1325	.	.	.	.	X	239	.	.	R	+	1	2	PRMT2	46907783	1.000000	0.71417	0.881000	0.34555	0.058000	0.15608	0.667000	0.25112	-0.174000	0.10743	-0.316000	0.08728	AGA	-	PRMT2	-	NULL		0.572	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	HGNC	protein_coding	OTTHUMT00000207401.1	0	0	0	27	27	48	0.00	0.00	A	NM_001535		48083355	+1	12	12	11	40	tier1	no_errors	ENST00000458387	ensembl	human	known	74_37	nonsense	52.17	23.08	SNP	0.998	T	12	11
FREM2	341640	genome.wustl.edu	37	13	39263770	39263770	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr13:39263770G>C	ENST00000280481.7	+	1	2505	c.2289G>C	c.(2287-2289)ttG>ttC	p.L763F		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	763					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CCTTGGTCTTGACTGACAACC	0.532													ENSG00000150893																																					0													83.0	88.0	86.0					13																	39263770		2203	4300	6503	SO:0001583	missense	0			-	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2289G>C	13.37:g.39263770G>C	ENSP00000280481:p.Leu763Phe		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.L763F	ENST00000280481.7	37	c.2289	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	8.747	0.920371	0.17982	.	.	ENSG00000150893	ENST00000280481	T	0.39406	1.08	5.8	3.05	0.35203	.	0.072531	0.56097	N	0.000030	T	0.32675	0.0837	L	0.58428	1.81	0.54753	D	0.999988	B	0.21309	0.054	B	0.23852	0.049	T	0.08086	-1.0739	10	0.09084	T	0.74	.	6.7643	0.23558	0.0665:0.233:0.5812:0.1193	.	763	Q5SZK8	FREM2_HUMAN	F	763	ENSP00000280481:L763F	ENSP00000280481:L763F	L	+	3	2	FREM2	38161770	0.997000	0.39634	0.972000	0.41901	0.859000	0.49053	0.397000	0.20883	0.335000	0.23614	0.655000	0.94253	TTG	-	FREM2	-	NULL		0.532	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	0	0	0	16	16	100	0.00	0.00	G	NM_207361		39263770	+1	5	15	22	98	tier1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	18.52	13.27	SNP	1.000	C	5	22
ZNF462	58499	genome.wustl.edu	37	9	109690005	109690005	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:109690005C>T	ENST00000277225.5	+	3	4101	c.3812C>T	c.(3811-3813)tCa>tTa	p.S1271L	ZNF462_ENST00000441147.2_Missense_Mutation_p.S116L|ZNF462_ENST00000457913.1_Missense_Mutation_p.S1271L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1271					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						AGGCAGTGCTCATATACCTCC	0.522													ENSG00000148143																																					0													196.0	200.0	198.0					9																	109690005		2203	4300	6503	SO:0001583	missense	0			-	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3812C>T	9.37:g.109690005C>T	ENSP00000277225:p.Ser1271Leu		Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1271L	ENST00000277225.5	37	c.3812	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722652	0.89298	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.06687	3.27;3.69;3.83;3.83	5.35	5.35	0.76521	Zinc finger, C2H2-like (1);	0.250639	0.41500	D	0.000864	T	0.14917	0.0360	L	0.27053	0.805	0.80722	D	1	P;D	0.56287	0.804;0.975	B;P	0.59761	0.307;0.863	T	0.04537	-1.0944	10	0.33940	T	0.23	.	15.6579	0.77158	0.0:0.8532:0.1468:0.0	.	1271;1271	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	L	1271;1271;154;116	ENSP00000277225:S1271L;ENSP00000414570:S1271L;ENSP00000363818:S154L;ENSP00000397306:S116L	ENSP00000277225:S1271L	S	+	2	0	ZNF462	108729826	0.982000	0.34865	0.919000	0.36401	0.943000	0.58893	5.811000	0.69187	2.505000	0.84491	0.555000	0.69702	TCA	-	ZNF462	-	smart_Znf_C2H2-like		0.522	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	0	0	0	19	19	60	0.00	0.00	C	NM_021224		109690005	+1	16	42	15	55	tier1	no_errors	ENST00000457913	ensembl	human	known	74_37	missense	51.61	43.30	SNP	0.945	T	16	15
OTOGL	283310	genome.wustl.edu	37	12	80663926	80663926	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr12:80663926C>T	ENST00000547103.1	+	22	2489	c.2483C>T	c.(2482-2484)cCc>cTc	p.P828L	OTOGL_ENST00000458043.2_Missense_Mutation_p.P828L			Q3ZCN5	OTOGL_HUMAN	otogelin-like	828					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTAGCAACGCCCTCTGCTGGT	0.383											OREG0011204|OREG0022007	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model	ENSG00000165899																																					0													100.0	97.0	98.0					12																	80663926		1928	4135	6063	SO:0001583	missense	0			-	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.2483C>T	12.37:g.80663926C>T	ENSP00000447211:p.Pro828Leu	1200	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.P828L	ENST00000547103.1	37	c.2483		12	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129502	0.56721	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.17528	2.28;2.27	5.22	5.22	0.72569	.	.	.	.	.	T	0.15305	0.0369	N	0.16307	0.4	0.45648	D	0.99857	.	.	.	.	.	.	T	0.09596	-1.0667	7	0.31617	T	0.26	.	12.1148	0.53860	0.0:0.9161:0.0:0.0839	.	.	.	.	L	828	ENSP00000447211:P828L;ENSP00000400895:P828L	ENSP00000400895:P828L	P	+	2	0	OTOGL	79188057	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	2.305000	0.43664	2.588000	0.87417	0.650000	0.86243	CCC	-	OTOGL	-	smart_VWC_out		0.383	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	0	0	0	44	44	105	0.00	0.00	C	NM_173591		80663926	+1	29	36	34	55	tier1	no_errors	ENST00000458043	ensembl	human	known	74_37	missense	46.03	39.56	SNP	1.000	T	29	34
DICER1	23405	genome.wustl.edu	37	14	95584038	95584038	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr14:95584038T>C	ENST00000526495.1	-	11	1721	c.1430A>G	c.(1429-1431)aAt>aGt	p.N477S	DICER1_ENST00000527414.1_Missense_Mutation_p.N477S|DICER1_ENST00000343455.3_Missense_Mutation_p.N477S|DICER1_ENST00000541352.1_Missense_Mutation_p.N477S|DICER1_ENST00000393063.1_Missense_Mutation_p.N477S			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	477	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AGTTATGAAATTGCTACTGAT	0.363			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome				ENSG00000100697																											yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													172.0	150.0	157.0					14																	95584038		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	-	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1430A>G	14.37:g.95584038T>C	ENSP00000437256:p.Asn477Ser		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ_dom,pfam_Dicer_dimerisation_dom,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_P-loop_NTPase,superfamily_PAZ_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ_dom,smart_RNase_III_dom,smart_dsR-bd_dom,pfscan_PAZ_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsR-bd_dom,pfscan_RNase_III_dom	p.N477S	ENST00000526495.1	37	c.1430	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	T	18.78	3.697429	0.68386	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.8	5.17	5.17	0.71159	Helicase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.47229	0.1434	N	0.04132	-0.27	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.44019	-0.9355	10	0.07644	T	0.81	-31.9186	15.3439	0.74320	0.0:0.0:0.0:1.0	.	477	Q9UPY3	DICER_HUMAN	S	477	ENSP00000343745:N477S;ENSP00000437256:N477S;ENSP00000376783:N477S;ENSP00000435681:N477S;ENSP00000444719:N477S	ENSP00000343745:N477S	N	-	2	0	DICER1	94653791	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.965000	0.87945	2.078000	0.62432	0.528000	0.53228	AAT	-	DICER1	-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.363	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1	0	0	0	30	30	93	0.00	0.00	T			95584038	-1	22	29	28	44	tier1	no_errors	ENST00000343455	ensembl	human	known	74_37	missense	44.00	39.73	SNP	1.000	C	22	28
ETV3L	440695	genome.wustl.edu	37	1	157062675	157062675	+	Silent	SNP	T	T	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr1:157062675T>C	ENST00000454449.2	-	5	1136	c.852A>G	c.(850-852)ccA>ccG	p.P284P		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	284	Pro-rich.				cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GAGGAAGCCCTGGAAAATGCC	0.627													ENSG00000253831																																					0													28.0	31.0	30.0					1																	157062675		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.852A>G	1.37:g.157062675T>C				Silent	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.P284	ENST00000454449.2	37	c.852	CCDS30893.1	1																																																																																			-	ETV3L	-	NULL		0.627	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3L	HGNC	protein_coding	OTTHUMT00000099024.2	0	0	0	25	25	64	0.00	0.00	T	NM_001004341		157062675	-1	19	24	17	25	tier1	no_errors	ENST00000454449	ensembl	human	known	74_37	silent	52.78	48.98	SNP	0.003	C	19	17
SLX4	84464	genome.wustl.edu	37	16	3641103	3641103	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:3641103C>T	ENST00000294008.3	-	12	3176	c.2536G>A	c.(2536-2538)Gtg>Atg	p.V846M		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	846	Glu-rich.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GCTTCATTCACGTTTTCTTGA	0.483								Direct reversal of damage					ENSG00000188827																																					0													156.0	157.0	156.0					16																	3641103		2197	4300	6497	SO:0001583	missense	0			-	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2536G>A	16.37:g.3641103C>T	ENSP00000294008:p.Val846Met		Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.V846M	ENST00000294008.3	37	c.2536	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	8.241	0.806912	0.16467	.	.	ENSG00000188827	ENST00000294008	T	0.01725	4.67	5.57	2.59	0.31030	.	0.094472	0.44483	N	0.000448	T	0.02807	0.0084	L	0.52126	1.63	0.24605	N	0.993758	D	0.69078	0.997	P	0.45913	0.497	T	0.42137	-0.9469	10	0.49607	T	0.09	.	10.1114	0.42565	0.0:0.7828:0.0:0.2172	.	846	Q8IY92	SLX4_HUMAN	M	846	ENSP00000294008:V846M	ENSP00000294008:V846M	V	-	1	0	SLX4	3581104	0.945000	0.32115	0.527000	0.27925	0.154000	0.21943	1.596000	0.36718	0.727000	0.32360	-0.224000	0.12420	GTG	-	SLX4	-	NULL		0.483	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	0	0	0	65	65	97	0.00	0.00	C	NM_032444		3641103	-1	44	26	62	59	tier1	no_errors	ENST00000294008	ensembl	human	known	74_37	missense	41.51	30.23	SNP	0.462	T	44	62
GOLGA6C	653641	genome.wustl.edu	37	15	75562507	75562507	+	Silent	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:75562507C>T	ENST00000300576.5	+	18	2049	c.2049C>T	c.(2047-2049)atC>atT	p.I683I	RN7SL489P_ENST00000486185.2_RNA	NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C	683						Golgi apparatus (GO:0005794)				ovary(1)	1						TACAGCAGATCGTGCAGCTGT	0.592													ENSG00000167195																																					0													45.0	58.0	54.0					15																	75562507		656	1575	2231	SO:0001819	synonymous_variant	0			-		CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.2049C>T	15.37:g.75562507C>T				Silent	SNP	NULL	p.I683	ENST00000300576.5	37	c.2049	CCDS58388.1	15																																																																																			-	GOLGA6C	-	NULL		0.592	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6C	HGNC	protein_coding	OTTHUMT00000419797.1	0	0	0	141	141	27	0.00	0.00	C	NM_001164404		75562507	+1	67	14	117	45	tier1	no_errors	ENST00000300576	ensembl	human	known	74_37	silent	36.41	23.73	SNP	1.000	T	67	117
STAT2	6773	genome.wustl.edu	37	12	56749495	56749495	+	Silent	SNP	T	T	C	rs112826194	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr12:56749495T>C	ENST00000314128.4	-	4	401	c.378A>G	c.(376-378)caA>caG	p.Q126Q	STAT2_ENST00000418572.2_Silent_p.Q122Q|STAT2_ENST00000557235.1_Silent_p.Q122Q			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	126					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						TCCTCACCAATTGGGCCCTCT	0.473													ENSG00000170581																																					0								T	,	8,4398	14.3+/-33.2	0,8,2195	126.0	131.0	129.0		378,366	-0.1	0.0	12	dbSNP_132	129	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	STAT2	NM_005419.3,NM_198332.1	,	0,9,6494	CC,CT,TT		0.0116,0.1816,0.0692	,	126/852,122/848	56749495	9,12997	2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.378A>G	12.37:g.56749495T>C			B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Silent	SNP	pfam_STAT_TF_D-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_D-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.Q126	ENST00000314128.4	37	c.378	CCDS8917.1	12																																																																																			rs112826194	STAT2	-	superfamily_STAT_TF_prot_interaction		0.473	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	HGNC	protein_coding	OTTHUMT00000410277.1	0	0	0	34	34	146	0.00	0.00	T	NM_005419		56749495	-1	16	70	1	13	tier1	no_errors	ENST00000314128	ensembl	human	known	74_37	silent	94.12	84.34	SNP	0.144	C	16	1
NRCAM	4897	genome.wustl.edu	37	7	107788355	107788355	+	3'UTR	SNP	A	A	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr7:107788355A>T	ENST00000379028.3	-	0	6385				NRCAM_ENST00000522550.2_5'UTR|NRCAM_ENST00000413765.2_3'UTR|NRCAM_ENST00000351718.4_3'UTR			Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TTCTCCCAAAATATTGGCAAA	0.348													ENSG00000091129																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000379028.3:c.*2000T>A	7.37:g.107788355A>T			A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	R	SNP	-	NULL	ENST00000379028.3	37	NULL	CCDS47686.1	7																																																																																			-	NRCAM	-	-		0.348	NRCAM-202	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding		0	0	0	58	58	140	0.00	0.00	A	NM_001037132		107788355	-1	24	60	31	73	tier1	no_errors	ENST00000522550	ensembl	human	known	74_37	rna	43.64	45.11	SNP	0.000	T	24	31
SREBF2	6721	genome.wustl.edu	37	22	42276780	42276780	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr22:42276780C>A	ENST00000361204.4	+	10	1988	c.1822C>A	c.(1822-1824)Ctg>Atg	p.L608M		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	608					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GGGCCGGGCACTGCCCACCTC	0.587													ENSG00000198911																																					0													48.0	53.0	51.0					22																	42276780		2203	4300	6503	SO:0001583	missense	0			-	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1822C>A	22.37:g.42276780C>A	ENSP00000354476:p.Leu608Met		Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L608M	ENST00000361204.4	37	c.1822	CCDS14023.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.14|19.14	3.769467|3.769467	0.69992|0.69992	.|.	.|.	ENSG00000198911|ENSG00000198911	ENST00000361204;ENST00000457567|ENST00000444813	T|.	0.29655|.	1.56|.	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65322|0.65322	0.2680|0.2680	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	D|.	0.53312|.	0.959|.	P|.	0.47744|.	0.556|.	T|T	0.68697|0.68697	-0.5340|-0.5340	10|6	0.51188|0.87932	T|D	0.08|0	-12.7337|-12.7337	11.654|11.654	0.51306|0.51306	0.0:0.918:0.0:0.082|0.0:0.918:0.0:0.082	.|.	608|.	Q12772|.	SRBP2_HUMAN|.	M|N	608|641	ENSP00000354476:L608M|.	ENSP00000354476:L608M|ENSP00000395728:T641N	L|T	+|+	1|2	2|0	SREBF2|SREBF2	40606726|40606726	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.862000|0.862000	0.49288|0.49288	4.935000|4.935000	0.63498|0.63498	2.292000|2.292000	0.77174|0.77174	0.478000|0.478000	0.44815|0.44815	CTG|ACT	-	SREBF2	-	NULL		0.587	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	HGNC	protein_coding	OTTHUMT00000321956.1	0	0	0	61	61	24	0.00	0.00	C	NM_004599		42276780	+1	19	13	49	19	tier1	no_errors	ENST00000361204	ensembl	human	known	74_37	missense	27.94	40.62	SNP	0.999	A	19	49
MSC-AS1	100132891	genome.wustl.edu	37	8	72744891	72744891	+	Intron	SNP	A	A	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr8:72744891A>G	ENST00000521467.1	+	1	49				AC104012.1_ENST00000390739.2_RNA																lung(1)	1						taatggcaaaaacctcagtaa	0.378													ENSG00000264576																																					0																																										SO:0001627	intron_variant	0			-																												ENST00000521467.1:c.-91+4441A>G	8.37:g.72744891A>G				R	SNP	-	NULL	ENST00000521467.1	37	NULL		8																																																																																			-	AC104012.1	-	-		0.378	RP11-383H13.1-006	PUTATIVE	basic|appris_candidate	protein_coding	ENSG00000264576	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000379051.1	0	0	0	31	31	56	0.00	0.00	A			72744891	-1	22	22	21	15	tier1	no_errors	ENST00000390739	ensembl	human	novel	74_37	rna	51.16	59.46	SNP	0.003	G	22	21
CHRDL2	25884	genome.wustl.edu	37	11	74414359	74414359	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr11:74414359T>C	ENST00000376332.3	-	8	1433	c.937A>G	c.(937-939)Att>Gtt	p.I313V	CHRDL2_ENST00000534159.1_5'UTR|CHRDL2_ENST00000263671.5_Missense_Mutation_p.I313V	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	313	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					CCTGGGCAAATCTTGCAGCAC	0.637													ENSG00000054938																																					0													49.0	43.0	45.0					11																	74414359		2200	4293	6493	SO:0001583	missense	0			-	AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.937A>G	11.37:g.74414359T>C	ENSP00000365510:p.Ile313Val		A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Missense_Mutation	SNP	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	p.I313V	ENST00000376332.3	37	c.937		11	.	.	.	.	.	.	.	.	.	.	T	2.379	-0.342549	0.05243	.	.	ENSG00000054938	ENST00000263671;ENST00000376332;ENST00000376323;ENST00000393519	T;T	0.62498	0.02;0.02	5.75	4.62	0.57501	von Willebrand factor, type C (4);	0.164300	0.53938	N	0.000054	T	0.40145	0.1105	N	0.17312	0.475	0.40337	D	0.978998	B;B	0.26845	0.153;0.161	B;B	0.27262	0.078;0.075	T	0.23547	-1.0185	10	0.06099	T	0.92	-3.5298	9.8464	0.41030	0.0:0.0809:0.0:0.9191	.	313;313	Q6WN34;Q6WN34-2	CRDL2_HUMAN;.	V	313;313;199;197	ENSP00000263671:I313V;ENSP00000365510:I313V	ENSP00000263671:I313V	I	-	1	0	CHRDL2	74092007	1.000000	0.71417	0.993000	0.49108	0.149000	0.21700	1.171000	0.31896	1.003000	0.39130	0.459000	0.35465	ATT	-	CHRDL2	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C		0.637	CHRDL2-002	KNOWN	basic	protein_coding	CHRDL2	HGNC	protein_coding	OTTHUMT00000385391.1	0	0	0	43	43	57	0.00	0.00	T			74414359	-1	28	23	32	26	tier1	no_errors	ENST00000263671	ensembl	human	known	74_37	missense	46.67	46.94	SNP	1.000	C	28	32
GSAP	54103	genome.wustl.edu	37	7	76941178	76941178	+	Missense_Mutation	SNP	T	T	A	rs201644766		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr7:76941178T>A	ENST00000257626.7	-	30	2531	c.2453A>T	c.(2452-2454)gAt>gTt	p.D818V	GSAP_ENST00000441833.2_Missense_Mutation_p.D139V|GSAP_ENST00000440473.1_5'Flank	NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	818					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										GGACTCTATATCTGTCAGAAT	0.408													ENSG00000186088																																					0													77.0	76.0	76.0					7																	76941178		1856	4097	5953	SO:0001583	missense	0			-		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.2453A>T	7.37:g.76941178T>A	ENSP00000257626:p.Asp818Val		A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	NULL	p.D818V	ENST00000257626.7	37	c.2453	CCDS34672.2	7	.	.	.	.	.	.	.	.	.	.	T	12.14	1.848722	0.32699	.	.	ENSG00000186088	ENST00000257626;ENST00000441833	T	0.21543	2.0	5.11	1.2	0.21068	.	0.449553	0.27105	N	0.020907	T	0.15176	0.0366	L	0.47716	1.5	0.19300	N	0.999978	P	0.37276	0.589	B	0.35813	0.211	T	0.13469	-1.0508	10	0.62326	D	0.03	.	4.3857	0.11316	0.0:0.1776:0.1691:0.6533	.	818	A4D1B5	GSAP_HUMAN	V	818;139	ENSP00000257626:D818V	ENSP00000257626:D818V	D	-	2	0	PION	76779114	0.643000	0.27269	0.017000	0.16124	0.992000	0.81027	0.951000	0.29135	0.117000	0.18138	0.454000	0.30748	GAT	-	GSAP	-	NULL		0.408	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSAP	HGNC	protein_coding	OTTHUMT00000318672.2	0	0	0	10	10	140	0.00	0.00	T	NM_017439		76941178	-1	4	78	13	54	tier1	no_errors	ENST00000257626	ensembl	human	known	74_37	missense	23.53	59.09	SNP	0.048	A	4	13
EPB41L4A	64097	genome.wustl.edu	37	5	111576464	111576464	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:111576464G>T	ENST00000261486.5	-	10	1115	c.839C>A	c.(838-840)gCt>gAt	p.A280D	RP11-526F3.1_ENST00000504004.1_RNA	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	280	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		GTGCTTGCAAGCAGTTTTACT	0.348													ENSG00000129595																																					0													72.0	68.0	70.0					5																	111576464		1815	4093	5908	SO:0001583	missense	0			-	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.839C>A	5.37:g.111576464G>T	ENSP00000261486:p.Ala280Asp		A4FUI6	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.A280D	ENST00000261486.5	37	c.839	CCDS43350.1	5	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426703	0.62733	.	.	ENSG00000129595	ENST00000261486	D	0.87729	-2.29	5.76	4.88	0.63580	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.267779	0.36591	N	0.002512	D	0.86830	0.6027	M	0.79805	2.47	0.35088	D	0.76402	P	0.43542	0.81	B	0.37650	0.255	D	0.92475	0.5988	10	0.87932	D	0	.	14.0608	0.64800	0.0751:0.0:0.9249:0.0	.	280	Q9HCS5	E41LA_HUMAN	D	280	ENSP00000261486:A280D	ENSP00000261486:A280D	A	-	2	0	EPB41L4A	111604363	0.950000	0.32346	1.000000	0.80357	0.986000	0.74619	3.569000	0.53827	2.720000	0.93068	0.655000	0.94253	GCT	-	EPB41L4A	-	pfam_FERM_PH-like_C,pfscan_FERM_domain		0.348	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370969.1	0	0	0	20	20	84	0.00	0.00	G			111576464	-1	10	29	33	38	tier1	no_errors	ENST00000261486	ensembl	human	known	74_37	missense	23.26	43.28	SNP	0.996	T	10	33
PTCHD1	139411	genome.wustl.edu	37	X	23397790	23397790	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chrX:23397790A>G	ENST00000379361.4	+	2	1294	c.434A>G	c.(433-435)gAt>gGt	p.D145G		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	145					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CTGAATAATGATAAGACTTGC	0.448													ENSG00000165186																																					0													85.0	76.0	79.0					X																	23397790		2203	4300	6503	SO:0001583	missense	0			-	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.434A>G	X.37:g.23397790A>G	ENSP00000368666:p.Asp145Gly		B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.D145G	ENST00000379361.4	37	c.434	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	A	11.32	1.604104	0.28534	.	.	ENSG00000165186	ENST00000379361	D	0.86366	-2.11	5.06	5.06	0.68205	.	0.175286	0.51477	D	0.000088	T	0.73528	0.3598	N	0.17082	0.46	0.39163	D	0.96244	B;B	0.29862	0.259;0.05	B;B	0.23716	0.041;0.048	T	0.71849	-0.4468	10	0.02654	T	1	.	14.135	0.65281	1.0:0.0:0.0:0.0	.	40;145	Q96NR3-3;Q96NR3	.;PTHD1_HUMAN	G	145	ENSP00000368666:D145G	ENSP00000368666:D145G	D	+	2	0	PTCHD1	23307711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.579000	0.74036	1.983000	0.57843	0.486000	0.48141	GAT	-	PTCHD1	-	pfam_Patched		0.448	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	0	0	0	44	44	74	0.00	0.00	A	NM_173495		23397790	+1	26	27	90	113	tier1	no_errors	ENST00000379361	ensembl	human	known	74_37	missense	22.41	19.29	SNP	1.000	G	26	90
SARDH	1757	genome.wustl.edu	37	9	136594926	136594926	+	Silent	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr9:136594926G>A	ENST00000371872.4	-	6	1133	c.876C>T	c.(874-876)caC>caT	p.H292H	SARDH_ENST00000298628.5_Silent_p.H292H|SARDH_ENST00000422262.2_Silent_p.H124H|SARDH_ENST00000439388.1_Silent_p.H292H|SARDH_ENST00000371867.1_Silent_p.H203H	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	292					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CATAGGCATGGTGCATGGCCA	0.632													ENSG00000123453																																					0													102.0	84.0	90.0					9																	136594926		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.876C>T	9.37:g.136594926G>A			B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.H292	ENST00000371872.4	37	c.876	CCDS6978.1	9																																																																																			-	SARDH	-	pfam_FAD-dep_OxRdtase		0.632	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1	0	0	0	12	12	41	0.00	0.00	G			136594926	-1	5	17	11	20	tier1	no_errors	ENST00000371872	ensembl	human	known	74_37	silent	31.25	45.95	SNP	0.999	A	5	11
KRT16P6	353194	genome.wustl.edu	37	17	16722165	16722165	+	RNA	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:16722165G>T	ENST00000602730.1	+	0	6486				AC022596.6_ENST00000417510.1_RNA																							AGGAGAGGCTGTGAAGACAGA	0.592													ENSG00000226145																																					0																																												0			-																													17.37:g.16722165G>T				R	SNP	-	NULL	ENST00000602730.1	37	NULL		17																																																																																			-	AC022596.6	-	-		0.592	RP11-219A15.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226145	Clone_based_vega_gene	processed_transcript	OTTHUMT00000468034.1	0	0	0	128	128	153	0.00	0.00	G			16722165	-1	151	125	180	237	tier1	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	45.48	34.44	SNP	0.211	T	151	180
EIF1	10209	genome.wustl.edu	37	17	39845149	39845162	+	5'UTR	DEL	GAGCCGCCGCCGAG	GAGCCGCCGCCGAG	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	GAGCCGCCGCCGAG	GAGCCGCCGCCGAG	GAGCCGCCGCCGAG	-	GAGCCGCCGCCGAG	GAGCCGCCGCCGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:39845149_39845162delGAGCCGCCGCCGAG	ENST00000469257.1	+	0	5_18				EIF1_ENST00000591776.1_5'UTR|EIF1_ENST00000310837.4_3'UTR|JUP_ENST00000540235.1_Intron			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1						dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CCCAGTCACTGAGCCGCCGCCGAGGATTCAGCAG	0.706													ENSG00000173812																									Pancreas(176;1692 2837 16734 17588)												0																																										SO:0001623	5_prime_UTR_variant	0				AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.-129GAGCCGCCGCCGAG>-	17.37:g.39845149_39845162delGAGCCGCCGCCGAG			Q9UNQ9	R	DEL	-	NULL	ENST00000469257.1	37	NULL	CCDS11403.1	17																																																																																				EIF1	-	-		0.706	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1	HGNC	protein_coding	OTTHUMT00000257390.1	0	0	0	27	27	27	0.00	0.00	GAGCCGCCGCCGAG	NM_005801		39845162	+1	4	4	14	14	tier1	no_errors	ENST00000310837	ensembl	human	known	74_37	rna	22.22	22.22	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	4	14
MEFV	4210	genome.wustl.edu	37	16	3299599	3299599	+	Silent	SNP	C	C	T	rs11466022	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:3299599C>T	ENST00000219596.1	-	3	1131	c.1092G>A	c.(1090-1092)ccG>ccA	p.P364P	MEFV_ENST00000339854.4_Silent_p.P184P|MEFV_ENST00000536379.1_Silent_p.P153P|MEFV_ENST00000541159.1_Silent_p.P153P	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	364					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TTAGGCTTCCCGGGCTCTTCC	0.647													ENSG00000103313																																					0													37.0	35.0	36.0					16																	3299599		2197	4300	6497	SO:0001819	synonymous_variant	0			GMAF=0.0005	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1092G>A	16.37:g.3299599C>T			D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_DEATH-like_dom,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.P364	ENST00000219596.1	37	c.1092	CCDS10498.1	16																																																																																			rs11466022	MEFV	-	NULL		0.647	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	HGNC	protein_coding	OTTHUMT00000251464.1	0	0	0	38	38	11	0.00	0.00	C	NM_000243		3299599	-1	31	5	27	7	tier1	no_errors	ENST00000219596	ensembl	human	known	74_37	silent	53.45	41.67	SNP	0.000	T	31	27
WRAP53	55135	genome.wustl.edu	37	17	7592932	7592932	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr17:7592932G>C	ENST00000316024.5	+	3	2903	c.555G>C	c.(553-555)ttG>ttC	p.L185F	WRAP53_ENST00000457584.2_Missense_Mutation_p.L185F|TP53_ENST00000269305.4_5'Flank|TP53_ENST00000420246.2_5'Flank|WRAP53_ENST00000534050.1_Missense_Mutation_p.L152F|TP53_ENST00000445888.2_5'Flank|WRAP53_ENST00000396463.2_Missense_Mutation_p.L185F|TP53_ENST00000455263.2_5'Flank|WRAP53_ENST00000431639.2_Missense_Mutation_p.L185F			Q9BUR4	WAP53_HUMAN	WD repeat containing, antisense to TP53	185					positive regulation of telomerase activity (GO:0051973)|telomere formation via telomerase (GO:0032203)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(2)	18						CCTGCATCTTGACCAATAGTG	0.517													ENSG00000141499																																					0													104.0	93.0	97.0					17																	7592932		2203	4300	6503	SO:0001583	missense	0			-	AK001247, DQ431240	CCDS11119.1	17p13.1	2014-09-17	2009-02-16	2009-02-16	ENSG00000141499	ENSG00000141499		"""WD repeat domain containing"""	25522	protein-coding gene	gene with protein product	"""telomerase cajal body protein 1"", ""WD-encoding RNA antisense to p53"""	612661	"""WD repeat domain 79"""	WDR79		19179534, 19250907, 19571673, 19342896, 20494116, 21441950	Standard	NM_018081		Approved	FLJ10385, TCAB1	uc010vuh.2	Q9BUR4	OTTHUMG00000134323	ENST00000316024.5:c.555G>C	17.37:g.7592932G>C	ENSP00000324203:p.Leu185Phe		B3KPR9|D3DTQ4|Q08ET9|Q9NW09	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L185F	ENST00000316024.5	37	c.555	CCDS11119.1	17	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021801	0.75275	.	.	ENSG00000141499	ENST00000431639;ENST00000316024;ENST00000457584;ENST00000396463;ENST00000534050	T;T;T;T;T	0.67171	0.1;0.1;0.1;0.1;-0.25	5.0	3.97	0.46021	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000010	D	0.82861	0.5129	M	0.88241	2.94	0.40299	D	0.978581	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.86048	0.1524	10	0.62326	D	0.03	-7.9239	12.5379	0.56152	0.0:0.1693:0.8307:0.0	.	152;185	E9PMG4;Q9BUR4	.;WAP53_HUMAN	F	185;185;185;185;152	ENSP00000397219:L185F;ENSP00000324203:L185F;ENSP00000411061:L185F;ENSP00000379727:L185F;ENSP00000434999:L152F	ENSP00000324203:L185F	L	+	3	2	WRAP53	7533657	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.423000	0.44705	2.330000	0.79161	0.655000	0.94253	TTG	-	WRAP53	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat		0.517	WRAP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP53	HGNC	protein_coding	OTTHUMT00000259385.2	0	0	0	33	33	85	0.00	0.00	G	NM_018081		7592932	+1	41	84	2	3	tier1	no_errors	ENST00000316024	ensembl	human	known	74_37	missense	95.35	96.55	SNP	1.000	C	41	2
VPS16	64601	genome.wustl.edu	37	20	2841110	2841110	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr20:2841110C>T	ENST00000380445.3	+	5	457	c.385C>T	c.(385-387)Cgg>Tgg	p.R129W	VPS16_ENST00000380469.3_Missense_Mutation_p.R129W|VPS16_ENST00000380443.3_5'Flank	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	129					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						GCTCCAGAACCGGGTTCTGGA	0.597													ENSG00000215305																																					0													76.0	74.0	75.0					20																	2841110		2203	4300	6503	SO:0001583	missense	0			-	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.385C>T	20.37:g.2841110C>T	ENSP00000369810:p.Arg129Trp		Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	pfam_Vps16_N,pfam_Vps16_C,pirsf_VPS16	p.R129W	ENST00000380445.3	37	c.385	CCDS13036.1	20	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229040	0.79688	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000453689;ENST00000417508	T;T	0.44881	0.91;0.91	5.95	5.95	0.96441	Vps16, N-terminal (1);	0.166737	0.53938	D	0.000042	T	0.56587	0.1995	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.998	P;P	0.60609	0.877;0.865	T	0.55547	-0.8124	10	0.72032	D	0.01	-25.9441	17.8727	0.88815	0.0:1.0:0.0:0.0	.	129;129	Q9H269-2;Q9H269	.;VPS16_HUMAN	W	129;129;11;11	ENSP00000369810:R129W;ENSP00000369836:R129W	ENSP00000369810:R129W	R	+	1	2	VPS16	2789110	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	3.503000	0.53340	2.826000	0.97356	0.563000	0.77884	CGG	-	VPS16	-	pfam_Vps16_N,pirsf_VPS16		0.597	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	HGNC	protein_coding	OTTHUMT00000077658.2	0	0	0	41	41	62	0.00	0.00	C	NM_022575		2841110	+1	4	8	36	95	tier1	no_errors	ENST00000380445	ensembl	human	known	74_37	missense	10.00	7.77	SNP	1.000	T	4	36
ADAMTS14	140766	genome.wustl.edu	37	10	72517795	72517795	+	Silent	SNP	C	C	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:72517795C>T	ENST00000373207.1	+	20	3015	c.3015C>T	c.(3013-3015)tgC>tgT	p.C1005C	ADAMTS14_ENST00000373208.1_Silent_p.C1008C	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1005	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TCGGGCATTGCGAGGGGGATA	0.667													ENSG00000138316																																					0													46.0	43.0	44.0					10																	72517795		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3015C>T	10.37:g.72517795C>T			Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.C1008	ENST00000373207.1	37	c.3024	CCDS7306.1	10																																																																																			-	ADAMTS14	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.667	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	0	0	0	18	18	7	0.00	0.00	C	NM_080722		72517795	+1	3	0	9	9	tier1	no_errors	ENST00000373208	ensembl	human	known	74_37	silent	25.00	0.00	SNP	0.392	T	3	9
C22orf34	348645	genome.wustl.edu	37	22	50017970	50017970	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr22:50017970G>T	ENST00000444628.1	-	4	1562	c.491C>A	c.(490-492)cCc>cAc	p.P164H	C22orf34_ENST00000400023.1_Intron|C22orf34_ENST00000405854.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	138										pancreas(1)	1						TGATGCTCGGGGTGCTGACCT	0.647													ENSG00000188511																																					0																																										SO:0001583	missense	0			-	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.491C>A	22.37:g.50017970G>T	ENSP00000395549:p.Pro164His		Q147Y0|Q5R3D1|Q6ZTN8	Missense_Mutation	SNP	NULL	p.P164H	ENST00000444628.1	37	c.491		22	.	.	.	.	.	.	.	.	.	.	G	9.693	1.152473	0.21371	.	.	ENSG00000188511	ENST00000444628	.	.	.	0.463	-0.927	0.10451	.	.	.	.	.	T	0.23289	0.0563	.	.	.	0.21675	N	0.999594	.	.	.	.	.	.	T	0.27640	-1.0068	4	.	.	.	.	4.3979	0.11372	0.3276:0.0:0.6724:0.0	.	.	.	.	H	164	.	.	P	-	2	0	C22orf34	48403974	0.998000	0.40836	0.002000	0.10522	0.367000	0.29736	1.345000	0.33953	-0.359000	0.08150	0.121000	0.15741	CCC	-	C22orf34	-	NULL		0.647	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	C22orf34	HGNC	protein_coding		0	0	0	56	56	6	0.00	0.00	G	NR_026997		50017970	-1	26	1	40	3	tier1	no_errors	ENST00000444628	ensembl	human	known	74_37	missense	38.81	25.00	SNP	0.994	T	26	40
CYP4F2	8529	genome.wustl.edu	37	19	16008315	16008315	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr19:16008315G>A	ENST00000221700.6	-	2	202	c.107C>T	c.(106-108)gCc>gTc	p.A36V	CYP4F2_ENST00000011989.7_5'UTR	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GTAGGTCCAGGCCAGGACATG	0.647													ENSG00000186115																																					0													78.0	77.0	78.0					19																	16008315		2203	4300	6503	SO:0001583	missense	0			-	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.107C>T	19.37:g.16008315G>A	ENSP00000221700:p.Ala36Val			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.A36V	ENST00000221700.6	37	c.107	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	g	13.91	2.377030	0.42105	.	.	ENSG00000186115	ENST00000221700	D	0.91464	-2.85	2.99	2.99	0.34606	.	0.664063	0.12414	U	0.471052	D	0.88213	0.6376	M	0.69823	2.125	0.58432	D	0.999999	B	0.10296	0.003	B	0.13407	0.009	T	0.82713	-0.0321	10	0.23891	T	0.37	.	9.6204	0.39719	0.0:0.0:1.0:0.0	.	36	P78329	CP4F2_HUMAN	V	36	ENSP00000221700:A36V	ENSP00000221700:A36V	A	-	2	0	CYP4F2	15869315	0.001000	0.12720	0.243000	0.24186	0.583000	0.36354	0.624000	0.24462	1.655000	0.50712	0.479000	0.44913	GCC	-	CYP4F2	-	NULL		0.647	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	HGNC	protein_coding	OTTHUMT00000460372.3	0	0	0	55	55	2	0.00	0.00	G	NM_001082		16008315	-1	16	0	66	8	tier1	no_errors	ENST00000221700	ensembl	human	known	74_37	missense	19.51	0.00	SNP	0.791	A	16	66
DNM1P47	100216544	genome.wustl.edu	37	15	102294619	102294619	+	RNA	SNP	C	C	T	rs368844070	byFrequency	TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:102294619C>T	ENST00000561463.1	+	0	2665									DNM1 pseudogene 47																		GCAGGCACAGCGGTGCGACGA	0.597													ENSG00000259660	.|||	2	0.000399361	0.0008	0.0	5008	,	,		50050	0.001		0.0	False		,,,				2504	0.0																0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294619C>T				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.597	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	26	26	1	0.00	0.00	C	NG_009149		102294619	+1	6	0	36	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	14.29	0.00	SNP	1.000	T	6	36
CYTIP	9595	genome.wustl.edu	37	2	158298116	158298121	+	Intron	DEL	ACACAC	ACACAC	-	rs199974176|rs147795088|rs112695012|rs35513959|rs57074495|rs201904015		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	ACACAC	ACACAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr2:158298116_158298121delACACAC	ENST00000264192.3	-	1	296				CYTIP_ENST00000540637.1_Intron|CYTIP_ENST00000497432.1_Intron|AC019201.1_ENST00000401235.1_RNA	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein						regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						atatgcacatacacacacacacacac	0.403													ENSG00000216054																																					0																																										SO:0001627	intron_variant	0				L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.174+2237GTGTGT>-	2.37:g.158298122_158298127delACACAC			B4DWH9|Q15630|Q8NE32	R	DEL	-	NULL	ENST00000264192.3	37	NULL	CCDS2204.1	2																																																																																				AC019201.1	-	-		0.403	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216054	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000254926.1	0	0	0	0	0	0	0.00	0.00	ACACAC	NM_004288		158298121	+1	0	0	0	0	tier1	no_errors	ENST00000401235	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.006:0.012:0.018:0.024:0.029:0.033	-	0	0
LOC441666	441666	genome.wustl.edu	37	10	42832502	42832503	+	RNA	INS	-	-	TATCA	rs368679059		TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr10:42832502_42832503insTATCA	ENST00000609841.1	-	0	1400_1401					NR_024380.1																						CCCCTATCAATTATGTTTAGTA	0.366													ENSG00000215146																																					0																																												0																																10.37:g.42832502_42832503insTATCA				R	INS	-	NULL	ENST00000609841.1	37	NULL		10																																																																																				RP11-313J2.1	-	-		0.366	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	0	0	0	4	4	4	0.00	0.00	-			42832503	-1	0	0	3	3	tier1	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.995:0.996	TATCA	0	3
LOC644794	644794	genome.wustl.edu	37	7	66369212	66369213	+	lincRNA	INS	-	-	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr7:66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC	ENST00000610177.1	+	0	1369_1370																											TGCCTCGTGGCGGCCTTCCCCG	0.738													ENSG00000273142																																					0																																												0																																7.37:g.66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC				R	INS	-	NULL	ENST00000610177.1	37	NULL		7																																																																																				RP11-458F8.4	-	-		0.738	RP11-458F8.4-001	KNOWN	basic	lincRNA	LOC644794	Clone_based_vega_gene	lincRNA	OTTHUMT00000472525.1	0	0	0	1	1	1	0.00	0.00	-			66369213	+1	0	0	2	2	tier1	no_errors	ENST00000610177	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.293:0.454	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC	0	2
LRFN3	79414	genome.wustl.edu	37	19	36431082	36431087	+	In_Frame_Del	DEL	ACTGCA	ACTGCA	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	ACTGCA	ACTGCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr19:36431082_36431087delACTGCA	ENST00000588831.1	+	3	1809_1814	c.755_760delACTGCA	c.(754-762)cactgcaac>cac	p.CN253del	LRFN3_ENST00000246529.3_In_Frame_Del_p.CN253del			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	253	LRRCT.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AACCCCCTGCACTGCAACTGCGAGCT	0.738													ENSG00000126243																																					0																																										SO:0001651	inframe_deletion	0				BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.755_760delACTGCA	19.37:g.36431082_36431087delACTGCA	ENSP00000466989:p.Cys253_Asn254del		Q6UY10	In_Frame_Del	DEL	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.NC254in_frame_del	ENST00000588831.1	37	c.755_760	CCDS12483.1	19																																																																																				LRFN3	-	smart_Cys-rich_flank_reg_C		0.738	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN3	HGNC	protein_coding	OTTHUMT00000457403.2	0	0	0	2	2	2	0.00	0.00	ACTGCA	NM_024509		36431087	+1	0	0	7	7	tier1	no_errors	ENST00000246529	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	1.000:1.000:1.000:1.000:1.000:1.000	-	0	7
MT-ND1	4535	genome.wustl.edu	37	M	1056	1056	+	5'Flank	SNP	A	A	G			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chrM:1056A>G	ENST00000361390.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TGAACACACAATAGCTAAGAC	0.423													ENSG00000211459																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1056A>G	Exception_encountered		C0JKH6|Q37523	R	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	MT-RNR1	-	-		0.423	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		0	0	0	19	19	0	0.00	0.00	A	YP_003024026		1056	+1	5	0	3	0	tier1	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	62.50	0.00	SNP	NULL	G	5	3
PDXDC1	23042	genome.wustl.edu	37	16	15221350	15221350	+	Intron	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr16:15221350G>T	ENST00000535621.2	+	17	1587				RP11-1186N24.5_ENST00000605794.1_RNA|PKD1P6_ENST00000424133.2_RNA			Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATCCAGAAGAGAAAGAGGATG	0.647													ENSG00000250251																																					0																																										SO:0001627	intron_variant	0			-	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-11386G>T	16.37:g.15221350G>T			B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	R	SNP	-	NULL	ENST00000535621.2	37	NULL		16																																																																																			-	PKD1P6	-	-		0.647	PDXDC1-016	PUTATIVE	basic	protein_coding	PKD1P6	HGNC	protein_coding	OTTHUMT00000422421.1	0	0	0	77	77	0	0.00	0.00	G	NM_015027		15221350	-1	59	0	69	0	tier1	no_errors	ENST00000424133	ensembl	human	known	74_37	rna	46.09	0.00	SNP	0.912	T	59	69
TCTA	6988	genome.wustl.edu	37	3	49450616	49450616	+	Intron	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr3:49450616G>T	ENST00000273590.3	+	2	490				RHOA_ENST00000454011.2_5'Flank|RHOA_ENST00000265538.3_5'Flank|RHOA_ENST00000418115.1_5'Flank|RHOA_ENST00000422781.1_5'Flank|TCTA_ENST00000493381.1_Intron	NM_022171.2	NP_071503.1	P57738	TCTA_HUMAN	T-cell leukemia translocation altered							integral component of membrane (GO:0016021)				large_intestine(4)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGACAGAGAGGGGAGTTCTCA	0.532													ENSG00000145022																																					0													60.0	47.0	51.0					3																	49450616		692	1591	2283	SO:0001627	intron_variant	0			-		CCDS2796.1	3p21	2012-02-27	2012-02-27		ENSG00000145022	ENSG00000145022			11692	protein-coding gene	gene with protein product		600690	"""T-cell leukemia translocation altered gene"""			7728759	Standard	NM_022171		Approved		uc003cwv.4	P57738	OTTHUMG00000156846	ENST00000273590.3:c.269+73G>T	3.37:g.49450616G>T			B2R4I4|Q6I9U4|Q9BSB0	R	SNP	-	NULL	ENST00000273590.3	37	NULL	CCDS2796.1	3																																																																																			-	TCTA	-	-		0.532	TCTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTA	HGNC	protein_coding	OTTHUMT00000346210.1	0	0	0	30	30	73	0.00	0.00	G	NM_022171		49450616	+1	4	2	33	84	tier1	no_errors	ENST00000482193	ensembl	human	known	74_37	rna	10.81	2.33	SNP	0.001	T	4	33
ONECUT1	3175	genome.wustl.edu	37	15	53081692	53081692	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:53081692A>C	ENST00000305901.5	-	1	517	c.390T>G	c.(388-390)caT>caG	p.H130Q	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	130	Poly-His.				B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		ggtggtggtgatggtggtggt	0.642													ENSG00000169856																																					0													52.0	47.0	49.0					15																	53081692		2194	4293	6487	SO:0001583	missense	0			-	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.390T>G	15.37:g.53081692A>C	ENSP00000302630:p.His130Gln		B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.H130Q	ENST00000305901.5	37	c.390	CCDS10150.1	15	.	.	.	.	.	.	.	.	.	.	A	11.24	1.579621	0.28180	.	.	ENSG00000169856	ENST00000305901	T	0.50548	0.74	3.92	-5.47	0.02600	.	0.126884	0.50627	D	0.000119	T	0.51991	0.1707	L	0.51422	1.61	0.80722	D	1	P	0.44006	0.824	P	0.60886	0.88	T	0.56007	-0.8050	10	0.25106	T	0.35	-9.6666	13.5628	0.61799	0.348:0.0:0.652:0.0	.	130	Q9UBC0	HNF6_HUMAN	Q	130	ENSP00000302630:H130Q	ENSP00000302630:H130Q	H	-	3	2	ONECUT1	50868984	0.982000	0.34865	0.829000	0.32907	0.965000	0.64279	0.174000	0.16743	-1.047000	0.03242	0.352000	0.21897	CAT	-	ONECUT1	-	NULL		0.642	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT1	HGNC	protein_coding	OTTHUMT00000254849.2	0	0	0	45	45	21	0.00	0.00	A			53081692	-1	7	2	44	24	tier1	no_errors	ENST00000305901	ensembl	human	known	74_37	missense	13.73	7.69	SNP	0.913	C	7	44
KDELR3	11015	genome.wustl.edu	37	22	38870538	38870538	+	Silent	SNP	G	G	T			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr22:38870538G>T	ENST00000216014.4	+	2	274	c.102G>T	c.(100-102)ggG>ggT	p.G34G	KDELR3_ENST00000471268.1_3'UTR|KDELR3_ENST00000409006.3_Silent_p.G34G	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	34					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					GCATCTCTGGGAAGAGCCAGA	0.562													ENSG00000100196																									Ovarian(11;103 529 24120 28493 32980)												0													176.0	134.0	148.0					22																	38870538		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.102G>T	22.37:g.38870538G>T			A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Silent	SNP	pfam_ER_ret_rcpt,superfamily_Cyt_c_oxidase_su2_TM_dom,prints_ER_ret_rcpt	p.G34	ENST00000216014.4	37	c.102	CCDS13972.1	22																																																																																			-	KDELR3	-	pfam_ER_ret_rcpt,prints_ER_ret_rcpt		0.562	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR3	HGNC	protein_coding	OTTHUMT00000331474.1	0	0	0	36	36	71	0.00	0.00	G			38870538	+1	4	2	43	79	tier1	no_errors	ENST00000409006	ensembl	human	known	74_37	silent	8.51	2.47	SNP	1.000	T	4	43
FAM193B	54540	genome.wustl.edu	37	5	176952043	176952043	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr5:176952043delT	ENST00000514747.1	-	6	1487	c.1439delA	c.(1438-1440)aacfs	p.N480fs	FAM193B_ENST00000443375.2_Frame_Shift_Del_p.N447fs|FAM193B_ENST00000508298.1_5'Flank|FAM193B_ENST00000329540.5_Frame_Shift_Del_p.N106fs	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	560						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						TTTGACAGTGTTTTTGATCTC	0.597													ENSG00000146067																																					0													91.0	95.0	94.0					5																	176952043		2028	4195	6223	SO:0001589	frameshift_variant	0					CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.1439delA	5.37:g.176952043delT	ENSP00000422131:p.Asn480fs		E9PET5|Q9NW00	Frame_Shift_Del	DEL	NULL	p.N447fs	ENST00000514747.1	37	c.1340	CCDS54954.1	5																																																																																				FAM193B	-	NULL		0.597	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM193B	HGNC	protein_coding	OTTHUMT00000373121.1	0	0	0	15	15	44	0.00	0.00	T	NM_019057		176952043	-1	2	2	15	42	tier1	no_errors	ENST00000443375	ensembl	human	known	74_37	frame_shift_del	11.76	4.55	DEL	1.000	-	2	15
ONECUT1	3175	genome.wustl.edu	37	15	53081679	53081693	+	In_Frame_Del	DEL	GGTGGTGGTGGTGAT	GGTGGTGGTGGTGAT	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	GGTGGTGGTGGTGAT	GGTGGTGGTGGTGAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr15:53081679_53081693delGGTGGTGGTGGTGAT	ENST00000305901.5	-	1	516_530	c.389_403delATCACCACCACCACC	c.(388-405)catcaccaccaccacccg>ccg	p.HHHHH130del	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	130	Poly-His.				B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		tggtggtgcgggtggtggtggtgatggtggtggtg	0.628													ENSG00000169856																																					0										47,4215		18,11,2102						4.2	1.0			45	58,8196		24,10,4093	no	coding	ONECUT1	NM_004498.1		42,21,6195	A1A1,A1R,RR		0.7027,1.1028,0.8389				105,12411				SO:0001651	inframe_deletion	0				U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.389_403delATCACCACCACCACC	15.37:g.53081679_53081693delGGTGGTGGTGGTGAT	ENSP00000302630:p.His130_His134del		B2RTV4|Q99744|Q9UMR6	In_Frame_Del	DEL	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.HHHHH130in_frame_del	ENST00000305901.5	37	c.403_389	CCDS10150.1	15																																																																																				ONECUT1	-	NULL		0.628	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT1	HGNC	protein_coding	OTTHUMT00000254849.2	0	0	0	18	18	18	0.00	0.00	GGTGGTGGTGGTGAT			53081693	-1	2	2	27	27	tier1	no_errors	ENST00000305901	ensembl	human	known	74_37	in_frame_del	6.90	6.90	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.997:1.000:1.000:1.000:1.000:1.000:0.913:1.000	-	2	27
GNAI2	2771	genome.wustl.edu	37	3	50296406	50296406	+	3'UTR	DEL	C	C	-			TCGA-DX-A3UC-01A-11D-A307-09	TCGA-DX-A3UC-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	165d4951-6e01-49de-b97d-8037f6767a3b	c782c030-10d3-460e-bcbd-154a26efae01	g.chr3:50296406delC	ENST00000313601.6	+	0	2083				GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000266027.5_3'UTR|GNAI2_ENST00000536647.1_3'UTR|U73166.2_ENST00000439898.1_lincRNA	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2						activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GACCAGCAAGCCCCCCCCCAG	0.483													ENSG00000114353																																					0																																										SO:0001624	3_prime_UTR_variant	0				X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.*631C>-	3.37:g.50296406delC			B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	R	DEL	-	NULL	ENST00000313601.6	37	NULL	CCDS2813.1	3																																																																																				GI2	-	-		0.483	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GI2	HGNC	protein_coding	OTTHUMT00000346688.1	0	0	0	11	11	54	0.00	0.00	C	NM_002070		50296406	+1	3	3	23	56	tier1	no_errors	ENST00000491100	ensembl	human	known	74_37	rna	11.54	5.08	DEL	0.001	-	3	23
