#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
MYH16	84176	genome.wustl.edu	37	7	98862800	98862800	+	IGR	SNP	T	T	C	rs570848712		TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr7:98862800T>C								MYH16 (7021 upstream) : ARPC1A (60720 downstream)																							CCCCAATGAGTTTAAGCAATC	0.498													ENSG00000002079																																					0																																										SO:0001628	intergenic_variant	0			-																													7.37:g.98862800T>C				R	SNP	-	NULL		37	NULL		7																																																																																			-	MYH16	-	-	0	0.498					MYH16	HGNC			0	0	1	187	187	101	0.00	0.98	T			98862800	+1	70	45	47	37	tier1	no_errors	ENST00000425880	ensembl	human	known	74_37	rna	59.83	54.88	SNP	1.000	C	70	47
KIAA1549	57670	genome.wustl.edu	37	7	138596018	138596018	+	Missense_Mutation	SNP	C	C	T	rs376801932		TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr7:138596018C>T	ENST00000422774.1	-	4	3067	c.3019G>A	c.(3019-3021)Gtt>Att	p.V1007I	KIAA1549_ENST00000242365.4_Missense_Mutation_p.V957I|KIAA1549_ENST00000440172.1_Missense_Mutation_p.V1007I			Q9HCM3	K1549_HUMAN	KIAA1549	1007						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GCCGTGTAAACGAAAGGACCG	0.388			O	BRAF	pilocytic astrocytoma								ENSG00000122778																									NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0								C	ILE/VAL,ILE/VAL	0,3728		0,0,1864	68.0	67.0	67.0		3019,3019	3.2	0.6	7		67	1,8205		0,1,4102	no	missense,missense	KIAA1549	NM_001164665.1,NM_020910.2	29,29	0,1,5966	TT,TC,CC		0.0122,0.0,0.0084	possibly-damaging,possibly-damaging	1007/1951,1007/1935	138596018	1,11933	1864	4103	5967	SO:0001583	missense	0			-		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3019G>A	7.37:g.138596018C>T	ENSP00000416040:p.Val1007Ile		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.V1007I	ENST00000422774.1	37	c.3019	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	C	8.976	0.974200	0.18736	0.0	1.22E-4	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.38722	1.12;1.14;1.13	5.23	3.17	0.36434	.	0.181870	0.35151	N	0.003402	T	0.29783	0.0744	N	0.24115	0.695	0.40342	D	0.979049	B;B	0.32526	0.257;0.374	B;B	0.32342	0.068;0.144	T	0.18681	-1.0329	10	0.72032	D	0.01	.	12.5313	0.56117	0.0:0.8771:0.0:0.1229	.	1007;1007	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	I	1007;957;1007	ENSP00000406661:V1007I;ENSP00000242365:V957I;ENSP00000416040:V1007I	ENSP00000242365:V957I	V	-	1	0	KIAA1549	138246558	0.179000	0.23135	0.571000	0.28486	0.201000	0.24016	0.673000	0.25203	0.705000	0.31890	0.655000	0.94253	GTT	-	KIAA1549	-	NULL		0.388	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	0	0	0	57	57	83	0.00	0.00	C			138596018	-1	24	59	14	35	tier1	no_errors	ENST00000422774	ensembl	human	known	74_37	missense	63.16	62.77	SNP	0.688	T	24	14
TIAL1	7073	genome.wustl.edu	37	10	121337184	121337184	+	Silent	SNP	C	C	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr10:121337184C>T	ENST00000436547.2	-	8	665	c.621G>A	c.(619-621)gtG>gtA	p.V207V	TIAL1_ENST00000369093.2_Silent_p.V224V|TIAL1_ENST00000463089.2_5'Flank|TIAL1_ENST00000369092.4_Silent_p.V84V	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	207	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		CTCCACAGTACACAGTACAAT	0.373													ENSG00000151923																																					0													144.0	131.0	135.0					10																	121337184		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.621G>A	10.37:g.121337184C>T			A8K3T0|A8K4L9	Silent	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.V224	ENST00000436547.2	37	c.672	CCDS7613.1	10																																																																																			-	TIAL1	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom		0.373	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAL1	HGNC	protein_coding	OTTHUMT00000050672.2	0	0	0	35	35	144	0.00	0.00	C	NM_022333, NM_003252		121337184	-1	5	28	21	66	tier1	no_errors	ENST00000369093	ensembl	human	known	74_37	silent	19.23	29.79	SNP	0.999	T	5	21
PNPLA3	80339	genome.wustl.edu	37	22	44333049	44333049	+	Silent	SNP	G	G	A	rs149395579	byFrequency	TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr22:44333049G>A	ENST00000216180.3	+	6	1049	c.876G>A	c.(874-876)ttG>ttA	p.L292L	PNPLA3_ENST00000423180.2_Silent_p.L288L	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	292					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				CGGCTGCCTTGGCTGTGAGGC	0.612													ENSG00000100344																																					0								G		2,4404	4.2+/-10.8	0,2,2201	104.0	83.0	90.0		876	1.6	0.0	22	dbSNP_134	90	0,8600		0,0,4300	no	coding-synonymous	PNPLA3	NM_025225.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		292/482	44333049	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.876G>A	22.37:g.44333049G>A			B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Silent	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.L292	ENST00000216180.3	37	c.876	CCDS14054.1	22																																																																																			rs149395579	PNPLA3	-	NULL		0.612	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNPLA3	HGNC	protein_coding	OTTHUMT00000318891.1	0	0	0	81	81	61	0.00	0.00	G	NM_025225		44333049	+1	32	18	27	17	tier1	no_errors	ENST00000216180	ensembl	human	known	74_37	silent	54.24	51.43	SNP	0.001	A	32	27
CD81	975	genome.wustl.edu	37	11	2407360	2407360	+	Intron	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr11:2407360G>A	ENST00000263645.5	+	2	322				CD81_ENST00000381036.3_Silent_p.L23L|CD81_ENST00000492627.1_Intron	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule						activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		gctgcagcttgacctgggttt	0.567													ENSG00000110651																																					0																																										SO:0001627	intron_variant	0			-		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.67-4282G>A	11.37:g.2407360G>A			P18582|Q5U0J6	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.L23	ENST00000263645.5	37	c.69	CCDS7734.1	11																																																																																			-	CD81	-	NULL		0.567	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD81	HGNC	protein_coding	OTTHUMT00000027357.4	0	0	0	93	93	64	0.00	0.00	G	NM_004356		2407360	+1	31	22	55	39	tier1	no_errors	ENST00000381036	ensembl	human	putative	74_37	silent	36.05	36.07	SNP	0.000	A	31	55
GRM6	2916	genome.wustl.edu	37	5	178413152	178413152	+	Silent	SNP	G	G	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr5:178413152G>T	ENST00000517717.1	-	9	2141	c.2103C>A	c.(2101-2103)acC>acA	p.T701T	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Silent_p.T701T			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	701					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TGAGGCTGAAGGTGATGACCA	0.617													ENSG00000113262																																					0													43.0	50.0	48.0					5																	178413152		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.2103C>A	5.37:g.178413152G>T				Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_6,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.T701	ENST00000517717.1	37	c.2103	CCDS4442.1	5																																																																																			-	GRM6	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3		0.617	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM6	HGNC	protein_coding	OTTHUMT00000253474.2	0	0	0	60	60	33	0.00	0.00	G			178413152	-1	58	26	35	19	tier1	no_errors	ENST00000231188	ensembl	human	known	74_37	silent	62.37	57.78	SNP	1.000	T	58	35
PSTPIP2	9050	genome.wustl.edu	37	18	43573597	43573597	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr18:43573597A>G	ENST00000409746.5	-	10	786	c.715T>C	c.(715-717)Tca>Cca	p.S239P	PSTPIP2_ENST00000589328.1_Missense_Mutation_p.S239P|PSTPIP2_ENST00000588801.1_Intron	NM_024430.3	NP_077748.3	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting protein 2	239						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	17						CATTGTTGTGACAGCTGATTC	0.403													ENSG00000152229																																					0													172.0	126.0	141.0					18																	43573597		2203	4300	6503	SO:0001583	missense	0			-		CCDS32820.2	18q12	2008-07-28			ENSG00000152229	ENSG00000152229			9581	protein-coding gene	gene with protein product						9804817	Standard	NM_024430		Approved		uc002lbp.4	Q9H939	OTTHUMG00000152674	ENST00000409746.5:c.715T>C	18.37:g.43573597A>G	ENSP00000387261:p.Ser239Pro			Missense_Mutation	SNP	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.S239P	ENST00000409746.5	37	c.715	CCDS32820.2	18	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471429	0.84533	.	.	ENSG00000152229	ENST00000409746;ENST00000360076	T	0.49720	0.77	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.73458	0.3589	M	0.89214	3.015	0.39027	D	0.959865	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.972	T	0.80872	-0.1188	10	0.87932	D	0	.	14.73	0.69374	1.0:0.0:0.0:0.0	.	239;239	Q9H939-2;Q9H939	.;PPIP2_HUMAN	P	239	ENSP00000387261:S239P	ENSP00000353189:S239P	S	-	1	0	PSTPIP2	41827595	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.698000	0.74608	2.124000	0.65301	0.460000	0.39030	TCA	-	PSTPIP2	-	NULL		0.403	PSTPIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSTPIP2	HGNC	protein_coding	OTTHUMT00000327522.1	0	0	0	38	38	63	0.00	0.00	A			43573597	-1	8	19	11	74	tier1	no_errors	ENST00000409746	ensembl	human	known	74_37	missense	42.11	20.43	SNP	1.000	G	8	11
MARK4	57787	genome.wustl.edu	37	19	45742155	45742155	+	lincRNA	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr19:45742155G>A	ENST00000590022.1	-	0	194																											GCGACAAGATGTTCCATTGGG	0.711													ENSG00000267045																																					0																																												0			-																													19.37:g.45742155G>A				R	SNP	-	NULL	ENST00000590022.1	37	NULL		19																																																																																			-	AC006126.4	-	-		0.711	AC006126.4-001	KNOWN	mRNA_end_NF|basic	lincRNA	ENSG00000267045	Clone_based_vega_gene	lincRNA	OTTHUMT00000457566.1	0	0	0	63	63	42	0.00	0.00	G			45742155	-1	9	8	28	17	tier1	no_errors	ENST00000590022	ensembl	human	known	74_37	rna	24.32	32.00	SNP	0.542	A	9	28
UNC79	57578	genome.wustl.edu	37	14	94004450	94004450	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr14:94004450G>C	ENST00000393151.2	+	12	1238	c.1238G>C	c.(1237-1239)aGt>aCt	p.S413T	UNC79_ENST00000256339.4_Missense_Mutation_p.S236T|UNC79_ENST00000555664.1_Missense_Mutation_p.S413T|UNC79_ENST00000553484.1_Missense_Mutation_p.S413T			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	413					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AATCATCACAGTAATGAAGTG	0.587													ENSG00000133958																																					0													65.0	61.0	62.0					14																	94004450		2203	4300	6503	SO:0001583	missense	0			-	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1238G>C	14.37:g.94004450G>C	ENSP00000376858:p.Ser413Thr		B5MDL6|Q6ZUT7	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.S413T	ENST00000393151.2	37	c.1238		14	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971156	0.74246	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.20780	0.0500	L	0.36672	1.1	0.53688	D	0.999975	P;B	0.36837	0.571;0.341	B;B	0.33454	0.164;0.117	T	0.01945	-1.1242	10	0.59425	D	0.04	-16.6381	19.9698	0.97280	0.0:0.0:1.0:0.0	.	413;413	C9JQL1;Q9P2D8	.;UNC79_HUMAN	T	236;413;413;413;413	ENSP00000256339:S236T;ENSP00000450868:S413T;ENSP00000451360:S413T;ENSP00000376858:S413T	ENSP00000256339:S236T	S	+	2	0	KIAA1409	93074203	1.000000	0.71417	0.986000	0.45419	0.982000	0.71751	6.314000	0.72848	2.786000	0.95864	0.561000	0.74099	AGT	-	UNC79	-	NULL		0.587	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	0	0	0	27	27	69	0.00	0.00	G	XM_028395		94004450	+1	11	23	15	33	tier1	no_errors	ENST00000553484	ensembl	human	known	74_37	missense	42.31	41.07	SNP	1.000	C	11	15
CREM	1390	genome.wustl.edu	37	10	35416094	35416094	+	5'Flank	SNP	G	G	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr10:35416094G>T	ENST00000395895.2	+	0	0				RP11-297A16.2_ENST00000450106.1_RNA|CREM_ENST00000354759.3_5'UTR|RP11-297A16.2_ENST00000450742.1_RNA|RP11-297A16.2_ENST00000457255.1_RNA|CREM_ENST00000374728.3_5'Flank|CREM_ENST00000374721.3_5'UTR|CREM_ENST00000474362.1_5'UTR|CREM_ENST00000345491.3_5'Flank|CREM_ENST00000469949.2_5'UTR|CREM_ENST00000489388.1_3'UTR|CREM_ENST00000460270.1_5'UTR|CREM_ENST00000489321.1_5'Flank|CREM_ENST00000429130.3_5'UTR|CREM_ENST00000374726.3_5'UTR			Q03060	CREM_HUMAN	cAMP responsive element modulator						cell differentiation (GO:0030154)|glycosphingolipid metabolic process (GO:0006687)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding protein binding (GO:0008140)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14						CAGTGACGAGGTCCGCTACGT	0.731													ENSG00000095794																																					0																																										SO:0001631	upstream_gene_variant	0			-		CCDS7180.1, CCDS7181.1, CCDS7182.1, CCDS7183.1, CCDS7184.1, CCDS7185.1, CCDS7186.1, CCDS7187.1, CCDS7188.1, CCDS31181.1, CCDS53519.1, CCDS53520.1, CCDS53517.1, CCDS53518.1, CCDS53521.1, CCDS58074.1, CCDS58075.1, CCDS58076.1	10p12.1-p11.1	2013-01-10			ENSG00000095794	ENSG00000095794		"""basic leucine zipper proteins"""	2352	protein-coding gene	gene with protein product		123812				1461747, 7916662	Standard	NM_182717		Approved	hCREM-2	uc001iyb.3	Q03060	OTTHUMG00000017953		10.37:g.35416094G>T	Exception_encountered		A8K014|A8K3J7|A8K6A1|A8MPQ2|B4DXC1|C9J785|C9JZ10|E9PAR4|E9PHM1|O75519|Q14501|Q14503|Q14504|Q14505|Q14506|Q15731|Q16114|Q16116|Q5T9H7|Q5W1A6|Q5W1A7|Q5W1A8|Q5W1A9|Q5W1B0|Q5W1B2|Q7Z2Q6|Q8IVD4|Q96AG7|Q9NZ98|Q9NZ99|Q9NZB9	R	SNP	-	NULL	ENST00000395895.2	37	NULL		10																																																																																			-	CREM	-	-		0.731	CREM-203	KNOWN	basic|appris_principal	protein_coding	CREM	HGNC	protein_coding		0	0	0	178	178	41	0.00	0.00	G	NM_001881		35416094	+1	28	17	101	44	tier1	no_errors	ENST00000461968	ensembl	human	known	74_37	rna	21.71	27.87	SNP	0.987	T	28	101
SHC4	399694	genome.wustl.edu	37	15	49176558	49176558	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr15:49176558C>T	ENST00000332408.4	-	4	1155	c.727G>A	c.(727-729)Gtt>Att	p.V243I		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	243	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		AGGAACTTAACTGGAGGCTTT	0.294													ENSG00000185634																																					0													81.0	82.0	82.0					15																	49176558		2196	4295	6491	SO:0001583	missense	0			-	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.727G>A	15.37:g.49176558C>T	ENSP00000329668:p.Val243Ile		Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_SH2,smart_PTB/PI_dom,smart_SH2,pfscan_PTB/PI_dom,pfscan_SH2,prints_PID_Shc-like,prints_SH2	p.V243I	ENST00000332408.4	37	c.727	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914868	0.52546	.	.	ENSG00000185634	ENST00000332408	T	0.13657	2.57	5.14	4.2	0.49525	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.283387	0.29529	N	0.011890	T	0.09818	0.0241	N	0.08118	0	0.80722	D	1	B	0.14012	0.009	B	0.29440	0.102	T	0.17048	-1.0382	10	0.51188	T	0.08	-15.7159	15.238	0.73447	0.0:0.8587:0.1413:0.0	.	243	Q6S5L8	SHC4_HUMAN	I	243	ENSP00000329668:V243I	ENSP00000329668:V243I	V	-	1	0	SHC4	46963850	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	1.818000	0.39012	1.354000	0.45846	0.655000	0.94253	GTT	-	SHC4	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.294	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	HGNC	protein_coding	OTTHUMT00000254371.1	0	0	0	41	41	72	0.00	0.00	C	NM_203349		49176558	-1	11	14	34	49	tier1	no_errors	ENST00000332408	ensembl	human	known	74_37	missense	24.44	22.22	SNP	1.000	T	11	34
AP3B2	8120	genome.wustl.edu	37	15	83357916	83357916	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr15:83357916G>T	ENST00000261722.3	-	3	465	c.258C>A	c.(256-258)aaC>aaA	p.N86K	AP3B2_ENST00000561455.1_5'UTR|AP3B2_ENST00000535359.1_Missense_Mutation_p.N86K|AP3B2_ENST00000535348.1_Missense_Mutation_p.N86K|AP3B2_ENST00000542200.1_Missense_Mutation_p.N86K|RP11-752G15.3_ENST00000560650.1_RNA	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	86					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			TCACCTCTATGTTCTTACAGG	0.567													ENSG00000103723																																					0													65.0	66.0	66.0					15																	83357916		2013	4172	6185	SO:0001583	missense	0			-	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.258C>A	15.37:g.83357916G>T	ENSP00000261722:p.Asn86Lys		A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,pirsf_AP3_beta	p.N86K	ENST00000261722.3	37	c.258	CCDS45331.1	15	.	.	.	.	.	.	.	.	.	.	G	29.6	5.023458	0.93462	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359;ENST00000541693;ENST00000542200;ENST00000535513	T;T;T;T;T	0.25250	2.5;1.81;2.5;2.5;2.5	5.96	5.05	0.67936	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60843	0.2300	M	0.92459	3.31	0.80722	D	1	P;D;D;D	0.76494	0.893;0.999;0.988;0.971	B;D;P;P	0.83275	0.394;0.996;0.893;0.838	T	0.71882	-0.4458	10	0.66056	D	0.02	-38.4332	15.1267	0.72489	0.0675:0.0:0.9325:0.0	.	86;86;86;86	F5H0E6;B7ZKR7;B7ZKS0;Q13367	.;.;.;AP3B2_HUMAN	K	86;86;86;42;86;86	ENSP00000261722:N86K;ENSP00000438721:N86K;ENSP00000440984:N86K;ENSP00000441961:N42K;ENSP00000440719:N86K	ENSP00000261722:N86K	N	-	3	2	AP3B2	81154970	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.103000	0.57783	1.524000	0.49035	0.655000	0.94253	AAC	-	AP3B2	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta		0.567	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B2	HGNC	protein_coding	OTTHUMT00000397463.1	0	0	1	50	50	86	0.00	1.14	G			83357916	-1	6	24	20	55	tier1	no_errors	ENST00000261722	ensembl	human	known	74_37	missense	23.08	30.00	SNP	1.000	T	6	20
CAPN8	388743	genome.wustl.edu	37	1	223805977	223805977	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr1:223805977G>C	ENST00000366873.2	-	10	1218	c.1142C>G	c.(1141-1143)tCc>tGc	p.S381C	CAPN8_ENST00000366872.5_Intron			A6NHC0	CAN8_HUMAN	calpain 8	0					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						TTCAACCTAGGAGGAGCCTAC	0.517													ENSG00000203697																																					0																																										SO:0001583	missense	0			-		CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366873.2:c.1142C>G	1.37:g.223805977G>C	ENSP00000355838:p.Ser381Cys		B2RXL2	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.S381C	ENST00000366873.2	37	c.1142		1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918773	0.52546	.	.	ENSG00000203697	ENST00000366873	D	0.88741	-2.42	5.61	3.71	0.42584	.	.	.	.	.	D	0.90971	0.7161	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.89944	0.4075	6	0.87932	D	0	.	9.2641	0.37630	0.1708:0.0:0.8292:0.0	.	.	.	.	C	381	ENSP00000355838:S381C	ENSP00000355838:S381C	S	-	2	0	CAPN8	221872600	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	0.934000	0.28910	0.693000	0.31634	0.655000	0.94253	TCC	-	CAPN8	-	prints_Calpain_cysteine_protease		0.517	CAPN8-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CAPN8	HGNC	protein_coding	OTTHUMT00000171394.3	0	0	0	55	55	50	0.00	0.00	G	NM_001143962		223805977	-1	11	21	92	93	tier1	no_errors	ENST00000366873	ensembl	human	novel	74_37	missense	10.68	18.42	SNP	1.000	C	11	92
RGS17	26575	genome.wustl.edu	37	6	153365122	153365122	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr6:153365122C>T	ENST00000367225.2	-	1	56	c.32G>A	c.(31-33)gGa>gAa	p.G11E	RGS17_ENST00000206262.1_Missense_Mutation_p.G11E			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	11					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		GGCAGGTGTTCCTTCATTTTG	0.448													ENSG00000091844																									Esophageal Squamous(78;500 1236 6775 24364 49058)												0													164.0	165.0	165.0					6																	153365122		2203	4300	6503	SO:0001583	missense	0			-	AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.32G>A	6.37:g.153365122C>T	ENSP00000356194:p.Gly11Glu		Q5TF49|Q8TD61|Q9UJS8	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.G11E	ENST00000367225.2	37	c.32	CCDS5244.1	6	.	.	.	.	.	.	.	.	.	.	C	5.871	0.344821	0.11126	.	.	ENSG00000091844	ENST00000367225;ENST00000206262	T;T	0.39056	1.1;1.1	5.15	2.24	0.28232	.	0.858989	0.10390	N	0.680549	T	0.05593	0.0147	N	0.04148	-0.265	0.43942	D	0.996602	B	0.02656	0.0	B	0.06405	0.002	T	0.44967	-0.9293	10	0.02654	T	1	1.3009	8.1217	0.30976	0.0:0.6679:0.0:0.3321	.	11	Q9UGC6	RGS17_HUMAN	E	11	ENSP00000356194:G11E;ENSP00000206262:G11E	ENSP00000206262:G11E	G	-	2	0	RGS17	153406815	1.000000	0.71417	0.997000	0.53966	0.860000	0.49131	2.446000	0.44908	0.142000	0.18901	0.305000	0.20034	GGA	-	RGS17	-	NULL		0.448	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS17	HGNC	protein_coding	OTTHUMT00000042773.2	0	0	0	64	64	58	0.00	0.00	C			153365122	-1	10	11	53	48	tier1	no_errors	ENST00000206262	ensembl	human	known	74_37	missense	15.87	18.64	SNP	1.000	T	10	53
DPH1	1801	genome.wustl.edu	37	17	1939349	1939349	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr17:1939349G>T	ENST00000263083.6	+	4	424	c.379G>T	c.(379-381)Gct>Tct	p.A127S	DPH1_ENST00000570477.1_Missense_Mutation_p.A47S|DPH1_ENST00000576891.2_3'UTR	NM_001383.3	NP_001374.3	Q9BZG8	DPH1_HUMAN	diphthamide biosynthesis 1	127					cell proliferation (GO:0008283)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	17						GGCCCTGGGAGCTGACTTCTT	0.637													ENSG00000108963																																					0													101.0	113.0	109.0					17																	1939349		2175	4254	6429	SO:0001583	missense	0			-	S81752	CCDS42228.1	17p13.3	2013-05-02	2013-05-02	2005-06-03	ENSG00000108963	ENSG00000108963			3003	protein-coding gene	gene with protein product	"""ovarian tumor suppressor candidate 1"""	603527	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 1 (S. cerevisiae)"", ""DPH-like 1 (S. cerevisiae)"", ""DPH1 homolog (S. cerevisiae)"""	DPH2L, DPH2L1		8603384, 15485916, 22869748	Standard	NM_001383		Approved	OVCA1	uc002fts.3	Q9BZG8	OTTHUMG00000177724	ENST00000263083.6:c.379G>T	17.37:g.1939349G>T	ENSP00000263083:p.Ala127Ser		D3DTI3|Q16439|Q4VBA2|Q9BTW7|Q9UCY0	Missense_Mutation	SNP	pfam_DPH1/DPH2,pirsf_DPH1_eu/DPH2_arc,tigrfam_DPH1/DPH2	p.A127S	ENST00000263083.6	37	c.379	CCDS42228.1	17	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497865	0.64186	.	.	ENSG00000108963	ENST00000263083	T	0.51071	0.72	5.25	4.27	0.50696	.	0.113243	0.64402	D	0.000013	T	0.58090	0.2098	M	0.66439	2.03	0.43857	D	0.996452	P;B;B	0.36125	0.538;0.395;0.066	P;B;B	0.46718	0.525;0.283;0.264	T	0.62849	-0.6767	10	0.72032	D	0.01	-0.3105	14.6913	0.69087	0.0:0.1459:0.8541:0.0	.	137;137;127	E7ENH3;B4DNK0;Q9BZG8	.;.;DPH1_HUMAN	S	127	ENSP00000263083:A127S	ENSP00000263083:A127S	A	+	1	0	DPH1	1886099	1.000000	0.71417	0.802000	0.32245	0.900000	0.52787	9.711000	0.98735	1.201000	0.43203	0.455000	0.32223	GCT	-	DPH1	-	pfam_DPH1/DPH2,pirsf_DPH1_eu/DPH2_arc,tigrfam_DPH1/DPH2		0.637	DPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPH1	HGNC	protein_coding	OTTHUMT00000438660.1	0	0	0	102	102	37	0.00	0.00	G	NM_001383		1939349	+1	41	30	56	36	tier1	no_errors	ENST00000263083	ensembl	human	known	74_37	missense	41.84	45.45	SNP	0.998	T	41	56
PAPD5	64282	genome.wustl.edu	37	16	50264686	50264686	+	3'UTR	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr16:50264686G>A	ENST00000436909.3	+	0	3579				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR	NM_001040284.2|NM_001040285.2	NP_001035374.2|NP_001035375.2	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TGTTGAGTTTGAAACTCAGTT	0.308													ENSG00000121274																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000436909.3:c.*1447G>A	16.37:g.50264686G>A			B4DV38|Q9NW67|Q9Y6C0	R	SNP	-	NULL	ENST00000436909.3	37	NULL	CCDS54006.1	16																																																																																			-	PAPD5	-	-		0.308	PAPD5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423149.2	0	0	0	66	66	80	0.00	0.00	G	NM_022447		50264686	+1	13	14	47	53	tier1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	21.67	20.90	SNP	1.000	A	13	47
PLEKHA7	144100	genome.wustl.edu	37	11	16805332	16805332	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr11:16805332C>G	ENST00000531066.1	-	25	3606	c.3565G>C	c.(3565-3567)Gat>Cat	p.D1189H				Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	0					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						TCTTCGGGATCTAGCTCCACG	0.612													ENSG00000166689																																					0																																										SO:0001583	missense	0			-	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000531066.1:c.3565G>C	11.37:g.16805332C>G	ENSP00000435389:p.Asp1189His		B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_WW_dom	p.D1189H	ENST00000531066.1	37	c.3565		11	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890860	0.91889	.	.	ENSG00000166689	ENST00000531066	T	0.08720	3.06	5.31	5.31	0.75309	.	.	.	.	.	T	0.23014	0.0556	.	.	.	0.80722	D	1	D	0.54397	0.966	P	0.53988	0.739	T	0.00157	-1.1977	8	0.87932	D	0	.	19.1626	0.93539	0.0:1.0:0.0:0.0	.	1189	E9PKC0	.	H	1189	ENSP00000435389:D1189H	ENSP00000435389:D1189H	D	-	1	0	PLEKHA7	16761908	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.296000	0.78790	2.768000	0.95171	0.561000	0.74099	GAT	-	PLEKHA7	-	NULL		0.612	PLEKHA7-002	PUTATIVE	not_organism_supported|basic|appris_candidate_longest|exp_conf	protein_coding	PLEKHA7	HGNC	protein_coding	OTTHUMT00000387236.1	0	0	0	110	110	34	0.00	0.00	C	NM_175058		16805332	-1	19	8	38	26	tier1	no_errors	ENST00000531066	ensembl	human	putative	74_37	missense	33.33	23.53	SNP	1.000	G	19	38
KIT	3815	genome.wustl.edu	37	4	55599285	55599285	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr4:55599285G>A	ENST00000288135.5	+	17	2508	c.2411G>A	c.(2410-2412)cGg>cAg	p.R804Q		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	804	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> W (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACTCATGGTCGGATCACAAAG	0.373		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors				ENSG00000157404																											yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													125.0	125.0	125.0					4																	55599285		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	-	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2411G>A	4.37:g.55599285G>A	ENSP00000288135:p.Arg804Gln		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R804Q	ENST00000288135.5	37	c.2411	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.142808	0.94560	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.89123	-2.47;-2.47	5.62	4.78	0.61160	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45867	D	0.000327	D	0.89210	0.6650	N	0.16201	0.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.91076	0.4896	10	0.72032	D	0.01	.	14.4845	0.67606	0.0706:0.0:0.9294:0.0	.	800;804	P10721-2;P10721	.;KIT_HUMAN	Q	804;800	ENSP00000288135:R804Q;ENSP00000390987:R800Q	ENSP00000288135:R804Q	R	+	2	0	KIT	55294042	1.000000	0.71417	0.955000	0.39395	0.990000	0.78478	7.901000	0.87382	1.392000	0.46585	0.585000	0.79938	CGG	-	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.373	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	0	0	0	98	98	88	0.00	0.00	G			55599285	+1	35	43	22	25	tier1	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	61.40	63.24	SNP	1.000	A	35	22
DNAJB8	165721	genome.wustl.edu	37	3	128182759	128182759	+	5'UTR	SNP	T	T	G			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr3:128182759T>G	ENST00000469083.1	-	0	1887				DNAJB8_ENST00000319153.3_5'UTR|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8						chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		CGGGGTAAGCTCCACAAAGGC	0.587													ENSG00000242049																																					0																																										SO:0001623	5_prime_UTR_variant	0			-		CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.-671A>C	3.37:g.128182759T>G			B3KWV7	R	SNP	-	NULL	ENST00000469083.1	37	NULL	CCDS3048.1	3																																																																																			-	DJB8-AS1	-	-		0.587	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DJB8-AS1	HGNC	protein_coding	OTTHUMT00000356933.1	0	0	0	41	41	71	0.00	0.00	T	NM_153330		128182759	+1	16	21	17	30	tier1	no_errors	ENST00000471626	ensembl	human	known	74_37	rna	48.48	41.18	SNP	0.000	G	16	17
SCN5A	6331	genome.wustl.edu	37	3	38601865	38601865	+	Missense_Mutation	SNP	C	C	T	rs199473605		TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr3:38601865C>T	ENST00000333535.4	-	23	4167	c.4018G>A	c.(4018-4020)Gtc>Atc	p.V1340I	SCN5A_ENST00000425664.1_Missense_Mutation_p.V1340I|SCN5A_ENST00000449557.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000450102.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000443581.1_Missense_Mutation_p.V1339I|SCN5A_ENST00000414099.2_Missense_Mutation_p.V1340I|SCN5A_ENST00000451551.2_Missense_Mutation_p.V1286I|SCN5A_ENST00000423572.2_Missense_Mutation_p.V1339I|SCN5A_ENST00000413689.1_Missense_Mutation_p.V1340I|SCN5A_ENST00000455624.2_Missense_Mutation_p.V1339I			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1340					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	ATGAGGCAGACGAGGAGGACG	0.577													ENSG00000183873																																					0													112.0	106.0	108.0					3																	38601865		2203	4300	6503	SO:0001583	missense	0			-	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4018G>A	3.37:g.38601865C>T	ENSP00000328968:p.Val1340Ile		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.V1340I	ENST00000333535.4	37	c.4018	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994698	0.93167	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96	4.25	4.25	0.50352	Ion transport (1);	0.133960	0.49916	D	0.000126	D	0.98865	0.9616	M	0.80616	2.505	0.54753	D	0.999989	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.998	D;D;D;D;D;D;P	0.87578	0.977;0.995;0.984;0.991;0.996;0.998;0.859	D	0.99758	1.1020	10	0.87932	D	0	.	17.2234	0.86963	0.0:1.0:0.0:0.0	.	1286;1339;1340;1340;1340;1339;1340	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	I	1340;1339;1340;1286;1339;1340;1340;1339;1286;1286	ENSP00000398962:V1340I;ENSP00000398266:V1339I;ENSP00000410257:V1340I;ENSP00000388797:V1286I;ENSP00000397915:V1339I;ENSP00000416634:V1340I;ENSP00000328968:V1340I;ENSP00000399524:V1339I;ENSP00000403355:V1286I;ENSP00000413996:V1286I	ENSP00000328968:V1340I	V	-	1	0	SCN5A	38576869	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.848000	0.69458	2.355000	0.79922	0.655000	0.94253	GTC	rs199473605	SCN5A	-	pfam_Ion_trans_dom		0.577	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	0	0	0	56	56	39	0.00	0.00	C	NM_198056		38601865	-1	10	6	34	17	tier1	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	22.73	26.09	SNP	1.000	T	10	34
MCCC1	56922	genome.wustl.edu	37	3	182759436	182759436	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr3:182759436T>C	ENST00000265594.4	-	11	1332	c.1186A>G	c.(1186-1188)Atg>Gtg	p.M396V	MCCC1_ENST00000492597.1_Missense_Mutation_p.M287V|MCCC1_ENST00000539926.1_Missense_Mutation_p.M261V	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	396	Biotin carboxylation.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	GCCACAGGCATGAAGTTATTG	0.478													ENSG00000078070																																					0													148.0	146.0	147.0					3																	182759436		2203	4300	6503	SO:0001583	missense	0			-	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1186A>G	3.37:g.182759436T>C	ENSP00000265594:p.Met396Val		Q59ES4|Q9H959|Q9NS97	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_DUF201-type,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.M396V	ENST00000265594.4	37	c.1186	CCDS3241.1	3	.	.	.	.	.	.	.	.	.	.	T	6.745	0.506308	0.12883	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616;ENST00000539926;ENST00000476176;ENST00000448585	T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44	5.45	2.93	0.34026	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.086756	0.85682	D	0.000000	T	0.75347	0.3837	L	0.55834	1.745	0.46317	D	0.998989	B;B;B	0.22604	0.064;0.071;0.072	B;B;B	0.29353	0.078;0.078;0.101	T	0.72204	-0.4361	10	0.59425	D	0.04	.	8.6266	0.33892	0.1188:0.0:0.2481:0.633	.	349;287;396	E9PG35;E9PHF7;Q96RQ3	.;.;MCCA_HUMAN	V	396;287;246;261;349;349	ENSP00000265594:M396V;ENSP00000419898:M287V;ENSP00000441253:M261V;ENSP00000420433:M349V	ENSP00000265594:M396V	M	-	1	0	MCCC1	184242130	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	1.629000	0.37071	0.889000	0.36185	-0.429000	0.05907	ATG	-	MCCC1	-	pfam_Biotin_COase_C,superfamily_Rudment_hybrid_motif,smart_Biotin_COase_C,pfscan_Biotin_carboxylation_dom		0.478	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC1	HGNC	protein_coding	OTTHUMT00000350775.1	0	0	0	139	139	77	0.00	0.00	T	NM_020166		182759436	-1	45	38	52	31	tier1	no_errors	ENST00000265594	ensembl	human	known	74_37	missense	46.39	55.07	SNP	1.000	C	45	52
CAMTA1	23261	genome.wustl.edu	37	1	6885151	6885151	+	Splice_Site	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr1:6885151G>A	ENST00000303635.7	+	3	322		c.e3-1		CAMTA1_ENST00000473578.1_Splice_Site|CAMTA1_ENST00000557126.1_Splice_Site|CAMTA1_ENST00000476163.1_Splice_Site|CAMTA1_ENST00000467404.2_Splice_Site|CAMTA1_ENST00000439411.2_Splice_Site	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTTCTTTGTAGATGATCATGG	0.328			T	WWTR1	epitheliod hemangioendothelioma								ENSG00000171735																												Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													53.0	57.0	55.0					1																	6885151		2203	4299	6502	SO:0001630	splice_region_variant	0			-	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.116-1G>A	1.37:g.6885151G>A			A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Splice_Site	SNP	-	e3-1	ENST00000303635.7	37	c.116-1	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168702	0.78339	.	.	ENSG00000171735	ENST00000303635;ENST00000473578;ENST00000557126;ENST00000467404;ENST00000439411	.	.	.	6.05	6.05	0.98169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5894	0.95501	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAMTA1	6807738	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.516000	0.81772	2.878000	0.98634	0.650000	0.86243	.	-	CAMTA1	-	-		0.328	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	0	0	0	44	44	58	0.00	0.00	G	NM_015215	Intron	6885151	+1	25	34	18	34	tier1	no_errors	ENST00000303635	ensembl	human	known	74_37	splice_site	58.14	49.28	SNP	1.000	A	25	18
TMCC2	9911	genome.wustl.edu	37	1	205225428	205225428	+	Intron	SNP	G	G	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr1:205225428G>T	ENST00000358024.3	+	3	1136				TMCC2_ENST00000330675.7_Intron|TMCC2_ENST00000329800.7_5'UTR|TMCC2_ENST00000545499.1_Intron|TMCC2_ENST00000495538.1_Intron	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2							integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TGGCCAGCCGGTGACACTGCT	0.552											OREG0014148	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000133069																																					0																																										SO:0001627	intron_variant	0			-	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.748-12650G>T	1.37:g.205225428G>T		2150	A2RRH3|B7Z1P7|Q6ZN09	R	SNP	-	NULL	ENST00000358024.3	37	NULL	CCDS30984.1	1																																																																																			-	TMCC2	-	-		0.552	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMCC2	HGNC	protein_coding	OTTHUMT00000090383.1	0	0	0	33	33	23	0.00	0.00	G	NM_014858		205225428	+1	8	4	46	27	tier1	no_errors	ENST00000468846	ensembl	human	known	74_37	rna	14.81	12.90	SNP	0.000	T	8	46
DSG3	1830	genome.wustl.edu	37	18	29040795	29040795	+	Splice_Site	SNP	G	G	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr18:29040795G>T	ENST00000257189.4	+	7	767		c.e7-1			NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3						apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TCCAAAATTAGCAAGCTAGCA	0.323													ENSG00000134757																																					0													53.0	51.0	52.0					18																	29040795		2203	4300	6503	SO:0001630	splice_region_variant	0			-	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.685-1G>T	18.37:g.29040795G>T			A8K2V2	Splice_Site	SNP	-	e7-1	ENST00000257189.4	37	c.685-1	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	12.99	2.101998	0.37048	.	.	ENSG00000134757	ENST00000257189	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0065	0.92852	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DSG3	27294793	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	6.321000	0.72881	2.651000	0.90000	0.585000	0.79938	.	-	DSG3	-	-		0.323	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1	0	0	0	66	66	47	0.00	0.00	G	NM_001944	Intron	29040795	+1	42	35	39	42	tier1	no_errors	ENST00000257189	ensembl	human	known	74_37	splice_site	51.85	45.45	SNP	1.000	T	42	39
CDCA2	157313	genome.wustl.edu	37	8	25364178	25364178	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr8:25364178T>C	ENST00000330560.3	+	15	2473	c.1996T>C	c.(1996-1998)Tcc>Ccc	p.S666P	CDCA2_ENST00000521098.2_3'UTR|CDCA2_ENST00000380665.3_Missense_Mutation_p.S651P	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	666					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		TATAAAAAGTTCCTCATCGCT	0.313													ENSG00000184661																																					0													65.0	69.0	68.0					8																	25364178		2203	4300	6503	SO:0001583	missense	0			-	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.1996T>C	8.37:g.25364178T>C	ENSP00000328228:p.Ser666Pro		Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.S666P	ENST00000330560.3	37	c.1996	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	T	14.77	2.634992	0.47049	.	.	ENSG00000184661	ENST00000330560;ENST00000380665;ENST00000434814	T;T	0.46063	0.88;0.88	5.18	-0.0718	0.13742	.	0.636597	0.15004	N	0.285978	T	0.27765	0.0683	L	0.48642	1.525	0.09310	N	1	B;B	0.21452	0.056;0.056	B;B	0.23150	0.044;0.044	T	0.21415	-1.0246	10	0.40728	T	0.16	-2.0523	0.4334	0.00475	0.1757:0.2223:0.205:0.397	.	651;666	E9PEI0;Q69YH5	.;CDCA2_HUMAN	P	666;651;65	ENSP00000328228:S666P;ENSP00000370040:S651P	ENSP00000328228:S666P	S	+	1	0	CDCA2	25420095	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	-0.334000	0.07883	0.107000	0.17824	0.528000	0.53228	TCC	-	CDCA2	-	NULL		0.313	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	0	0	0	53	53	35	0.00	0.00	T	NM_152562		25364178	+1	20	30	24	30	tier1	no_errors	ENST00000330560	ensembl	human	known	74_37	missense	45.45	50.00	SNP	0.000	C	20	24
PAPD5	64282	genome.wustl.edu	37	16	50264680	50264680	+	3'UTR	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr16:50264680G>A	ENST00000436909.3	+	0	3573				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR	NM_001040284.2|NM_001040285.2	NP_001035374.2|NP_001035375.2	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		ATTACCTGTTGAGTTTGAAAC	0.303													ENSG00000121274																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000436909.3:c.*1441G>A	16.37:g.50264680G>A			B4DV38|Q9NW67|Q9Y6C0	R	SNP	-	NULL	ENST00000436909.3	37	NULL	CCDS54006.1	16																																																																																			-	PAPD5	-	-		0.303	PAPD5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423149.2	0	0	0	63	63	82	0.00	0.00	G	NM_022447		50264680	+1	17	15	48	54	tier1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	26.15	21.74	SNP	0.994	A	17	48
OR2F2	135948	genome.wustl.edu	37	7	143632973	143632973	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr7:143632973G>C	ENST00000408955.2	+	1	715	c.648G>C	c.(646-648)ttG>ttC	p.L216F		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					TGGTTCTGTTGTCCTACATCC	0.527													ENSG00000221910																																					0													202.0	179.0	187.0					7																	143632973		2203	4300	6503	SO:0001583	missense	0			-		CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.648G>C	7.37:g.143632973G>C	ENSP00000386222:p.Leu216Phe		A4D2G0|Q6IFP8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L216F	ENST00000408955.2	37	c.648	CCDS43666.1	7	.	.	.	.	.	.	.	.	.	.	G	0.205	-1.041187	0.02013	.	.	ENSG00000221910	ENST00000408955	T	0.36340	1.26	3.49	1.52	0.23074	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40728	N	0.001034	T	0.15912	0.0383	N	0.04880	-0.145	0.09310	N	1	B	0.16166	0.016	B	0.28784	0.094	T	0.20306	-1.0279	10	0.26408	T	0.33	-6.6393	5.1721	0.15116	0.1271:0.417:0.4559:0.0	.	216	O95006	OR2F2_HUMAN	F	216	ENSP00000386222:L216F	ENSP00000386222:L216F	L	+	3	2	OR2F2	143263906	0.000000	0.05858	0.945000	0.38365	0.622000	0.37654	-0.638000	0.05452	0.230000	0.21059	0.491000	0.48974	TTG	-	OR2F2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.527	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F2	HGNC	protein_coding	OTTHUMT00000349570.1	0	0	0	111	111	40	0.00	0.00	G			143632973	+1	21	16	43	35	tier1	no_errors	ENST00000408955	ensembl	human	known	74_37	missense	32.81	31.37	SNP	0.019	C	21	43
C19orf44	84167	genome.wustl.edu	37	19	16620577	16620586	+	Frame_Shift_Del	DEL	GAAAACTCTC	GAAAACTCTC	-			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	GAAAACTCTC	GAAAACTCTC	GAAAACTCTC	-	GAAAACTCTC	GAAAACTCTC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr19:16620577_16620586delGAAAACTCTC	ENST00000221671.3	+	5	1573_1582	c.1417_1426delGAAAACTCTC	c.(1417-1428)gaaaactctccafs	p.ENSP473fs	CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000594035.1_Frame_Shift_Del_p.ENSP473fs	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	473										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						GGAGGATTTTGAAAACTCTCCAAGTCTGAC	0.519													ENSG00000105072																																					0																																										SO:0001589	frameshift_variant	0				AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1417_1426delGAAAACTCTC	19.37:g.16620577_16620586delGAAAACTCTC	ENSP00000221671:p.Glu473fs		Q8N6Y7	Frame_Shift_Del	DEL	NULL	p.E473fs	ENST00000221671.3	37	c.1417_1426	CCDS12345.1	19																																																																																				C19orf44	-	NULL		0.519	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf44	HGNC	protein_coding	OTTHUMT00000461218.1	0	0	0	86	86	86	0.00	0.00	GAAAACTCTC	NM_032207		16620586	+1	13	13	42	42	tier1	no_errors	ENST00000221671	ensembl	human	known	74_37	frame_shift_del	23.64	23.64	DEL	0.852:0.769:0.114:0.003:0.000:0.000:0.003:0.003:0.000:0.000	-	13	42
GRAP2	9402	genome.wustl.edu	37	22	40364152	40364153	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr22:40364152_40364153insC	ENST00000344138.4	+	6	829_830	c.566_567insC	c.(565-570)caccccfs	p.HP189fs	GRAP2_ENST00000399090.2_Frame_Shift_Ins_p.HP76fs|GRAP2_ENST00000543252.1_Frame_Shift_Ins_p.HP149fs|GRAP2_ENST00000407075.3_Frame_Shift_Ins_p.HP189fs|GRAP2_ENST00000544756.1_Frame_Shift_Ins_p.HP117fs|GRAP2_ENST00000540310.1_Frame_Shift_Ins_p.HP123fs	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	189					cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CTGTCGGATCACCCCCCGACCC	0.663													ENSG00000100351																																					0																																										SO:0001589	frameshift_variant	0				AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.572dupC	22.37:g.40364158_40364158dupC	ENSP00000339186:p.His189fs		B7Z8I3|O43726|Q9NRB7	Frame_Shift_Ins	INS	pfam_SH3_domain,pfam_SH2,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.T192fs	ENST00000344138.4	37	c.566_567	CCDS13999.1	22																																																																																				GRAP2	-	NULL		0.663	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP2	HGNC	protein_coding	OTTHUMT00000321295.1	0	0	0	83	83	31	0.00	0.00	-	NM_004810		40364153	+1	33	26	46	31	tier1	no_errors	ENST00000344138	ensembl	human	known	74_37	frame_shift_ins	41.77	45.61	INS	0.872:0.397	C	33	46
ACTA2	59	genome.wustl.edu	37	10	90708478	90708481	+	Intron	DEL	AGAT	AGAT	-			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	AGAT	AGAT	AGAT	-	AGAT	AGAT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr10:90708478_90708481delAGAT	ENST00000458208.1	-	2	604				STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000224784.6_Intron|ACTA2_ENST00000480297.1_Intron	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta						glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		GGGCAGAAAGAGATAGACAATCTG	0.387													ENSG00000107796																																					0																																										SO:0001627	intron_variant	0				X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.129+77ATCT>-	10.37:g.90708478_90708481delAGAT			B2R8A4|P03996|P04108|Q6FI19	R	DEL	-	NULL	ENST00000458208.1	37	NULL	CCDS7392.1	10																																																																																				ACTA2	-	-		0.387	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	HGNC	protein_coding	OTTHUMT00000049264.1	0	0	0	59	59	85	0.00	0.00	AGAT	NM_001613		90708481	-1	27	34	22	25	tier1	no_errors	ENST00000482085	ensembl	human	known	74_37	rna	55.10	57.63	DEL	0.000:0.000:0.001:0.000	-	27	22
ATRX	546	genome.wustl.edu	37	X	76939418	76939418	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chrX:76939418G>A	ENST00000373344.5	-	9	1544	c.1330C>T	c.(1330-1332)Cga>Tga	p.R444*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.R406*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	444					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCTCCTTTTCGTGCTTTTGTT	0.358			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											146.0	136.0	140.0					X																	76939418		2203	4296	6499	SO:0001587	stop_gained	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1330C>T	X.37:g.76939418G>A	ENSP00000362441:p.Arg444*		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R444*	ENST00000373344.5	37	c.1330	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	g	35	5.516759	0.96402	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	4.36	-0.278	0.12894	.	1.104670	0.07014	N	0.825688	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-0.0892	3.2237	0.06724	0.0903:0.212:0.1704:0.5272	.	.	.	.	X	444;406;400	.	ENSP00000362441:R444X	R	-	1	2	ATRX	76826074	0.030000	0.19436	0.817000	0.32601	0.946000	0.59487	1.207000	0.32333	-0.310000	0.08766	-0.330000	0.08379	CGA	-	ATRX	-	NULL		0.358	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	47	47	46	0.00	0.00	G	NM_000489		76939418	-1	47	71	4	4	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	92.16	94.67	SNP	0.000	A	47	4
DAGLB	221955	genome.wustl.edu	37	7	6487537	6487537	+	5'UTR	SNP	G	G	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr7:6487537G>C	ENST00000297056.6	-	0	106				KDELR2_ENST00000463747.1_Intron|DAGLB_ENST00000436575.1_Intron|DAGLB_ENST00000428902.2_5'UTR|DAGLB_ENST00000479922.2_5'UTR|DAGLB_ENST00000421761.2_5'UTR|DAGLB_ENST00000425398.2_5'UTR	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta						arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GAACAAACCAGCACCCTCCGG	0.677													ENSG00000164535																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.-64C>G	7.37:g.6487537G>C			A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	R	SNP	-	NULL	ENST00000297056.6	37	NULL	CCDS5350.1	7																																																																																			-	DAGLB	-	-		0.677	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLB	HGNC	protein_coding	OTTHUMT00000246840.2	0	0	0	33	33	16	0.00	0.00	G	NM_139179		6487537	-1	16	16	4	6	tier1	no_errors	ENST00000479922	ensembl	human	known	74_37	rna	80.00	72.73	SNP	0.000	C	16	4
FKBP5	2289	genome.wustl.edu	37	6	35668845	35668845	+	Intron	SNP	A	A	G			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr6:35668845A>G	ENST00000536438.1	-	2	297				AL157823.1_ENST00000411131.1_RNA	NM_001145775.1	NP_001139247.1	Q13451	FKBP5_HUMAN	FK506 binding protein 5						chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(3)|urinary_tract(2)	17						gtatatcccaaatattgcagg	0.224													ENSG00000223063																																					0																																										SO:0001627	intron_variant	0			-	U42031	CCDS4808.1, CCDS54996.1	6p21.31	2013-01-10	2001-11-28		ENSG00000096060	ENSG00000096060		"""Tetratricopeptide (TTC) repeat domain containing"""	3721	protein-coding gene	gene with protein product		602623	"""FK506-binding protein 5"""			9001212	Standard	NM_004117		Approved	FKBP51, FKBP54, PPIase, P54, Ptg-10	uc003okx.2	Q13451	OTTHUMG00000014576	ENST00000536438.1:c.18+19259T>C	6.37:g.35668845A>G			F5H7R1|Q59EB8|Q5TGM6	R	SNP	-	NULL	ENST00000536438.1	37	NULL	CCDS4808.1	6																																																																																			-	AL157823.1	-	-		0.224	FKBP5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000223063	Clone_based_ensembl_gene	protein_coding		0	0	0	108	108	10	0.00	0.00	A			35668845	-1	55	3	69	7	tier1	no_errors	ENST00000411131	ensembl	human	novel	74_37	rna	44.35	30.00	SNP	0.066	G	55	69
LAMA1	284217	genome.wustl.edu	37	18	7026019	7026019	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr18:7026019G>T	ENST00000389658.3	-	17	2454	c.2361C>A	c.(2359-2361)gaC>gaA	p.D787E		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	787	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGGGCTGGCAGTCCCCAGGTG	0.637													ENSG00000101680																																					0													47.0	38.0	41.0					18																	7026019		2203	4300	6503	SO:0001583	missense	0			-	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2361C>A	18.37:g.7026019G>T	ENSP00000374309:p.Asp787Glu			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.D787E	ENST00000389658.3	37	c.2361	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191603	0.78902	.	.	ENSG00000101680	ENST00000389658	T	0.61158	0.13	5.35	2.61	0.31194	EGF-like, laminin (4);	0.151803	0.41001	U	0.000971	T	0.74023	0.3662	M	0.89287	3.02	0.43039	D	0.99462	D	0.62365	0.991	D	0.64776	0.929	T	0.72704	-0.4213	10	0.49607	T	0.09	.	8.2121	0.31490	0.3104:0.0:0.6896:0.0	.	787	P25391	LAMA1_HUMAN	E	787	ENSP00000374309:D787E	ENSP00000374309:D787E	D	-	3	2	LAMA1	7016019	1.000000	0.71417	0.995000	0.50966	0.907000	0.53573	4.652000	0.61454	0.248000	0.21435	0.563000	0.77884	GAC	-	LAMA1	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin		0.637	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	0	0	0	48	48	19	0.00	0.00	G	NM_005559		7026019	-1	10	4	22	8	tier1	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	31.25	33.33	SNP	1.000	T	10	22
MTMR14	64419	genome.wustl.edu	37	3	9743521	9743521	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr3:9743521C>T	ENST00000296003.4	+	19	1939	c.1817C>T	c.(1816-1818)tCa>tTa	p.S606L	MTMR14_ENST00000420925.1_Missense_Mutation_p.S248L|CPNE9_ENST00000383831.3_5'Flank|CPNE9_ENST00000383832.3_5'Flank|MTMR14_ENST00000351233.5_Missense_Mutation_p.S494L|MTMR14_ENST00000353332.5_Missense_Mutation_p.S554L	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	606					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					GAGGTGCGCTCAGCCTTCTTG	0.612													ENSG00000163719																																					0													45.0	51.0	49.0					3																	9743521		1970	4149	6119	SO:0001583	missense	0			-	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1817C>T	3.37:g.9743521C>T	ENSP00000296003:p.Ser606Leu		Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	NULL	p.S606L	ENST00000296003.4	37	c.1817	CCDS43043.1	3	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697056	0.68386	.	.	ENSG00000163719	ENST00000353332;ENST00000420925;ENST00000296003;ENST00000351233	D	0.97404	-4.37	5.4	4.52	0.55395	.	0.174796	0.51477	D	0.000096	D	0.95281	0.8469	L	0.48642	1.525	0.27264	N	0.958555	B;B;P;B	0.40083	0.1;0.001;0.702;0.376	B;B;B;B	0.39904	0.054;0.005;0.313;0.115	D	0.90463	0.4447	10	0.52906	T	0.07	-5.3031	16.2775	0.82651	0.0:0.8675:0.1325:0.0	.	248;494;554;606	C9JSR1;Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;.;MTMRE_HUMAN	L	554;248;606;494	ENSP00000401993:S248L	ENSP00000296003:S606L	S	+	2	0	MTMR14	9718521	0.999000	0.42202	0.999000	0.59377	0.989000	0.77384	4.502000	0.60400	1.252000	0.44001	0.561000	0.74099	TCA	-	MTMR14	-	NULL		0.612	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR14	HGNC	protein_coding	OTTHUMT00000338435.1	0	0	0	91	91	12	0.00	0.00	C	NM_022485		9743521	+1	20	2	80	8	tier1	no_errors	ENST00000296003	ensembl	human	known	74_37	missense	19.80	20.00	SNP	0.979	T	20	80
OSCAR	126014	genome.wustl.edu	37	19	54598510	54598510	+	3'UTR	SNP	G	G	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr19:54598510G>A	ENST00000284648.6	-	0	1479				OSCAR_ENST00000356532.3_Silent_p.R260R|OSCAR_ENST00000358375.4_Silent_p.R256R|OSCAR_ENST00000351806.4_Silent_p.R245R|OSCAR_ENST00000359649.4_3'UTR|OSCAR_ENST00000391761.1_3'UTR			Q8IYS5	OSCAR_HUMAN	osteoclast associated, immunoglobulin-like receptor							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|skin(1)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)					CAGCAGGAGCGCGGTTCTGAC	0.667													ENSG00000170909																																					0													22.0	25.0	24.0					19																	54598510		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	AK130199	CCDS12873.1, CCDS12874.1, CCDS12875.1, CCDS12876.1, CCDS62789.1, CCDS74444.1	19q13.42	2013-01-29			ENSG00000170909	ENSG00000170909		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29960	protein-coding gene	gene with protein product		606862				11805147	Standard	NM_206818		Approved		uc002qda.3	Q8IYS5	OTTHUMG00000064966	ENST00000284648.6:c.*433C>T	19.37:g.54598510G>A			B7WNS2|Q5GRG5|Q8N763|Q8NHL4|Q8WXQ0|Q8WXQ1|Q8WXQ2	Silent	SNP	smart_Ig_sub	p.R260	ENST00000284648.6	37	c.780		19																																																																																			-	OSCAR	-	NULL		0.667	OSCAR-001	NOVEL	basic	protein_coding	OSCAR	HGNC	protein_coding	OTTHUMT00000139493.4	0	0	0	97	97	18	0.00	0.00	G	NM_133169		54598510	-1	14	6	34	7	tier1	no_errors	ENST00000356532	ensembl	human	known	74_37	silent	29.17	46.15	SNP	0.000	A	14	34
PANK1	53354	genome.wustl.edu	37	10	91398993	91398993	+	Intron	SNP	G	G	C			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr10:91398993G>C	ENST00000307534.4	-	1	859				PANK1_ENST00000488482.1_Intron|PANK1_ENST00000342512.3_Intron|PANK1_ENST00000371774.2_Missense_Mutation_p.L8V|PANK1_ENST00000322191.6_Intron	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1						coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						aaaggcaaaagagcatgcttg	0.473													ENSG00000152782																																					0																																										SO:0001627	intron_variant	0			-	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.703+5363C>G	10.37:g.91398993G>C			A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.L8V	ENST00000307534.4	37	c.22	CCDS31244.1	10	.	.	.	.	.	.	.	.	.	.	G	0.063	-1.218293	0.01542	.	.	ENSG00000152782	ENST00000371774	D	0.99552	-6.15	0.468	0.468	0.16732	.	.	.	.	.	D	0.97049	0.9036	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.95284	0.8389	7	0.13108	T	0.6	.	.	.	.	.	8	Q8TE04-4	.	V	8	ENSP00000360839:L8V	ENSP00000360839:L8V	L	-	1	0	PANK1	91388973	0.021000	0.18746	0.012000	0.15200	0.011000	0.07611	0.504000	0.22626	0.488000	0.27723	0.491000	0.48974	CTT	-	PANK1	-	NULL		0.473	PANK1-201	KNOWN	basic|CCDS	protein_coding	PANK1	HGNC	protein_coding		0	0	0	13	13	40	0.00	0.00	G			91398993	-1	10	11	4	9	tier1	no_errors	ENST00000371774	ensembl	human	known	74_37	missense	71.43	55.00	SNP	0.014	C	10	4
PRX	57716	genome.wustl.edu	37	19	40913828	40913828	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr19:40913828delC	ENST00000324001.7	-	4	282	c.12delG	c.(10-12)aggfs	p.R4fs	PRX_ENST00000291825.7_Frame_Shift_Del_p.R4fs|PRX_ENST00000599513.1_5'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	4					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CACTCCGGCTCCTGGCCTCCA	0.627													ENSG00000105227																																					0													60.0	50.0	54.0					19																	40913828		2203	4300	6503	SO:0001589	frameshift_variant	0				AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.12delG	19.37:g.40913828delC	ENSP00000326018:p.Arg4fs		Q9BXL9|Q9HCF2	Frame_Shift_Del	DEL	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S5fs	ENST00000324001.7	37	c.12	CCDS33028.1	19																																																																																				PRX	-	NULL		0.627	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	0	0	0	49	49	12	0.00	0.00	C	NM_020956		40913828	-1	2	0	13	5	tier1	no_errors	ENST00000324001	ensembl	human	known	74_37	frame_shift_del	13.33	0.00	DEL	1.000	-	2	13
FAM57A	79850	genome.wustl.edu	37	17	636266	636267	+	Intron	INS	-	-	GGGCC	rs141977343|rs3830920	byFrequency	TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr17:636266_636267insGGGCC	ENST00000308278.8	+	2	358				FAM57A_ENST00000572018.1_Intron|FAM57A_ENST00000301324.8_Intron	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		GTCAGGCCGAAGGGCCGGGCCG	0.762													ENSG00000167695		2438	0.486821	0.3351	0.5173	5008	,	,		10677	0.6022		0.4692	False		,,,				2504	0.5695																0																																										SO:0001627	intron_variant	0				AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.123-71->GGGCC	17.37:g.636272_636276dupGGGCC			A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Frame_Shift_Ins	INS	NULL	p.P131fs	ENST00000308278.8	37	c.379_380	CCDS10996.1	17																																																																																				FAM57A	-	NULL		0.762	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57A	HGNC	protein_coding	OTTHUMT00000437155.2	0	0	0	0	0	0	0.00	0.00	-	NM_024792		636267	+1	0	0	0	0	tier1	no_errors	ENST00000574327	ensembl	human	known	74_37	frame_shift_ins	0.00	0.00	INS	0.000:0.000	GGGCC	0	0
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664016	+	RNA	INS	-	-	G	rs202030378|rs372212945	byFrequency	TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr7:72664015_72664016insG	ENST00000425256.1	-	0	884_885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCCA	0.505													ENSG00000214544	GGGGG|GGGG|GGGGG|deletion	3786	0.75599	0.7247	0.8242	5008	,	,		6539	0.7212		0.8101	False		,,,				2504	0.7301																0																																												0				AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664019dupG				R	INS	-	NULL	ENST00000425256.1	37	NULL		7																																																																																				GTF2IRD2P1	-	-		0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1	0	0	0	17	17	1	0.00	0.00	-	NR_002164		72664016	-1	3	0	7	2	tier1	no_errors	ENST00000425256	ensembl	human	known	74_37	rna	30.00	0.00	INS	0.912:0.964	G	3	7
KRTAP10-1	386677	genome.wustl.edu	37	21	45959750	45959750	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr21:45959750C>G	ENST00000400375.1	-	1	328	c.284G>C	c.(283-285)tGc>tCc	p.C95S	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	95	24 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						ggcctgctggcagggggagga	0.657													ENSG00000215455																																					0													40.0	46.0	44.0					21																	45959750		2189	4278	6467	SO:0001583	missense	0			-	AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.284G>C	21.37:g.45959750C>G	ENSP00000383226:p.Cys95Ser		Q0VAR0|Q0VAR1	Missense_Mutation	SNP	NULL	p.C95S	ENST00000400375.1	37	c.284	CCDS42954.1	21	.	.	.	.	.	.	.	.	.	.	c	3.093	-0.186562	0.06340	.	.	ENSG00000215455	ENST00000400375;ENST00000545982	T	0.02395	4.31	3.46	2.47	0.30058	.	.	.	.	.	T	0.16599	0.0399	M	0.89715	3.055	0.27619	N	0.948415	D	0.76494	0.999	D	0.67231	0.95	T	0.01537	-1.1330	9	0.87932	D	0	.	11.2345	0.48931	0.1829:0.8171:0.0:0.0	.	95	P60331	KR101_HUMAN	S	95	ENSP00000383226:C95S	ENSP00000383226:C95S	C	-	2	0	KRTAP10-1	44784178	1.000000	0.71417	0.990000	0.47175	0.109000	0.19521	0.807000	0.27140	1.946000	0.56461	0.491000	0.48974	TGC	-	KRTAP10-1	-	NULL		0.657	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-1	HGNC	protein_coding	OTTHUMT00000128030.1	0	0	0	181	181	0	0.00	0.00	C			45959750	-1	43	0	114	2	tier1	no_errors	ENST00000400375	ensembl	human	known	74_37	missense	27.39	0.00	SNP	0.996	G	43	114
SGSM1	129049	genome.wustl.edu	37	22	25251313	25251313	+	Silent	SNP	C	C	T			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr22:25251313C>T	ENST00000400359.4	+	7	592	c.585C>T	c.(583-585)ccC>ccT	p.P195P	SGSM1_ENST00000400358.4_Silent_p.P195P	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	195						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GGACCGATCCCTCGGCTGACG	0.632													ENSG00000167037																																					0													31.0	34.0	33.0					22																	25251313		2084	4213	6297	SO:0001819	synonymous_variant	0			-	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.585C>T	22.37:g.25251313C>T			A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Silent	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.P195	ENST00000400359.4	37	c.585	CCDS46674.1	22																																																																																			-	SGSM1	-	NULL		0.632	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	0	0	0	40	40	55	0.00	0.00	C	XM_059318		25251313	+1	6	3	19	40	tier1	no_errors	ENST00000400359	ensembl	human	known	74_37	silent	24.00	6.98	SNP	0.987	T	6	19
PRKCI	5584	genome.wustl.edu	37	3	169988342	169988342	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A3UD-01A-11D-A307-09	TCGA-DX-A3UD-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a46b055d-5534-4c00-85b6-a15ba4d62613	c788ed6d-2b8e-49ef-bef0-c44ee15b4d4c	g.chr3:169988342T>A	ENST00000295797.4	+	6	889	c.584T>A	c.(583-585)tTg>tAg	p.L195*		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	195	Regulatory domain.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	CGGCATTCTTTGCCACAGGTA	0.408													ENSG00000163558																																					0													89.0	81.0	84.0					3																	169988342		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.584T>A	3.37:g.169988342T>A	ENSP00000295797:p.Leu195*		D3DNQ4|Q8WW06	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_PKC_zeta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.L195*	ENST00000295797.4	37	c.584	CCDS3212.2	3	.	.	.	.	.	.	.	.	.	.	T	35	5.594106	0.96602	.	.	ENSG00000163558	ENST00000295797	.	.	.	5.41	5.41	0.78517	.	0.175903	0.46145	D	0.000314	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7199	0.77700	0.0:0.0:0.0:1.0	.	.	.	.	X	195	.	.	L	+	2	0	PRKCI	171471036	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	7.264000	0.78432	2.175000	0.68902	0.482000	0.46254	TTG	-	PRKCI	-	pirsf_PKC_zeta		0.408	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCI	HGNC	protein_coding	OTTHUMT00000316866.3	0	0	0	19	19	36	0.00	0.00	T	NM_002740		169988342	+1	3	3	11	28	tier1	no_errors	ENST00000295797	ensembl	human	known	74_37	nonsense	21.43	9.68	SNP	1.000	A	3	11
