#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
FBN1	2200	genome.wustl.edu	37	15	48780437	48780437	+	Splice_Site	SNP	G	G	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr15:48780437G>A	ENST00000316623.5	-	27	3665	c.3210C>T	c.(3208-3210)gaC>gaT	p.D1070D		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1070	EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ATTCGTCAATGTCTGCACAAA	0.468													ENSG00000166147																																					0													61.0	55.0	57.0					15																	48780437		2198	4296	6494	SO:0001630	splice_region_variant	0			-	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.3209-1C>T	15.37:g.48780437G>A			B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.D1070	ENST00000316623.5	37	c.3210	CCDS32232.1	15																																																																																			-	FBN1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom		0.468	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	0	0	0	68	68	85	0.00	0.00	G		Silent	48780437	-1	24	46	32	60	tier1	no_errors	ENST00000316623	ensembl	human	known	74_37	silent	42.86	43.40	SNP	1.000	A	24	32
ADAM22	53616	genome.wustl.edu	37	7	87797524	87797524	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr7:87797524T>C	ENST00000265727.7	+	25	2343	c.2264T>C	c.(2263-2265)aTa>aCa	p.I755T	ADAM22_ENST00000398204.4_Missense_Mutation_p.I755T|ADAM22_ENST00000398209.3_Missense_Mutation_p.I755T|ADAM22_ENST00000398201.4_Missense_Mutation_p.I755T|ADAM22_ENST00000315984.7_Missense_Mutation_p.I755T			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	755					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			ATATTAGGAATAACTGCGTGG	0.353													ENSG00000008277																																					0													112.0	102.0	105.0					7																	87797524		1841	4090	5931	SO:0001583	missense	0			-	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.2264T>C	7.37:g.87797524T>C	ENSP00000265727:p.Ile755Thr		O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.I755T	ENST00000265727.7	37	c.2264	CCDS47637.1	7	.	.	.	.	.	.	.	.	.	.	T	13.74	2.328723	0.41197	.	.	ENSG00000008277	ENST00000398204;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203;ENST00000426930	T;T;T;T;T;T;T	0.48201	4.43;4.39;4.39;4.44;4.45;4.4;0.82	5.47	5.47	0.80525	.	0.145255	0.64402	D	0.000011	T	0.47507	0.1449	L	0.53249	1.67	0.45354	D	0.998349	P;P;B;P	0.42827	0.791;0.552;0.417;0.734	B;B;B;B	0.41764	0.366;0.199;0.098;0.302	T	0.49532	-0.8930	10	0.48119	T	0.1	.	14.8211	0.70074	0.0:0.0:0.0:1.0	.	807;755;755;755	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2	.;.;ADA22_HUMAN;.	T	755;755;755;755;755;722;113	ENSP00000381262:I755T;ENSP00000381260:I755T;ENSP00000265727:I755T;ENSP00000315900:I755T;ENSP00000381267:I755T;ENSP00000381261:I722T;ENSP00000396233:I113T	ENSP00000265727:I755T	I	+	2	0	ADAM22	87635460	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.692000	0.54727	2.198000	0.70561	0.533000	0.62120	ATA	-	ADAM22	-	NULL		0.353	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM22	HGNC	protein_coding	OTTHUMT00000268370.2	0	0	0	75	75	124	0.00	0.00	T	NM_021723		87797524	+1	18	72	31	103	tier1	no_errors	ENST00000265727	ensembl	human	known	74_37	missense	36.00	41.14	SNP	0.986	C	18	31
ING2	3622	genome.wustl.edu	37	4	184431587	184431587	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr4:184431587G>A	ENST00000302327.3	+	2	527	c.325G>A	c.(325-327)Gaa>Aaa	p.E109K	ING2_ENST00000434682.2_Missense_Mutation_p.E69K	NM_001564.2	NP_001555.1	Q9H160	ING2_HUMAN	inhibitor of growth family, member 2	109					chromatin modification (GO:0016568)|male germ-line stem cell asymmetric division (GO:0048133)|male meiosis I (GO:0007141)|negative regulation of cell proliferation (GO:0008285)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cellular senescence (GO:2000772)|regulation of growth (GO:0040008)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|seminiferous tubule development (GO:0072520)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleus (GO:0005634)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	7		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|all_hematologic(60;0.0207)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		ACAAATGCTCGAATTGGTGGA	0.398													ENSG00000168556																																					0													100.0	111.0	108.0					4																	184431587		2203	4300	6503	SO:0001583	missense	0			-	AB012853	CCDS3833.1	4q35.1	2013-01-28	2005-02-10	2005-02-11	ENSG00000168556	ENSG00000168556		"""Zinc fingers, PHD-type"""	6063	protein-coding gene	gene with protein product		604215	"""inhibitor of growth family, member 1-like"""	ING1L		10072587	Standard	XM_005262982		Approved	p33ING2	uc003ivs.1	Q9H160	OTTHUMG00000150502	ENST00000302327.3:c.325G>A	4.37:g.184431587G>A	ENSP00000307183:p.Glu109Lys		B6ZDS1|O95698	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E109K	ENST00000302327.3	37	c.325	CCDS3833.1	4	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346644	0.82022	.	.	ENSG00000168556	ENST00000302327;ENST00000412117;ENST00000434682	.	.	.	5.55	5.55	0.83447	Double Clp-N motif (1);Inhibitor of growth protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85318	0.5669	M	0.88450	2.955	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.79784	0.993;0.9	D	0.86653	0.1899	9	0.62326	D	0.03	-12.4342	19.6941	0.96016	0.0:0.0:1.0:0.0	.	69;109	B6ZDS1;Q9H160	.;ING2_HUMAN	K	109;69;69	.	ENSP00000307183:E109K	E	+	1	0	ING2	184668581	1.000000	0.71417	0.993000	0.49108	0.938000	0.57974	9.222000	0.95196	2.885000	0.99019	0.655000	0.94253	GAA	-	ING2	-	NULL		0.398	ING2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING2	HGNC	protein_coding	OTTHUMT00000318652.1	0	0	0	34	34	140	0.00	0.00	G	NM_001564		184431587	+1	11	54	23	102	tier1	no_errors	ENST00000302327	ensembl	human	known	74_37	missense	32.35	34.39	SNP	1.000	A	11	23
FDPS	2224	genome.wustl.edu	37	1	155288023	155288023	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:155288023C>G	ENST00000356657.6	+	6	787	c.625C>G	c.(625-627)Ctg>Gtg	p.L209V	RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368352.5_5'Flank|FDPS_ENST00000368356.4_Missense_Mutation_p.L209V|FDPS_ENST00000447866.1_Missense_Mutation_p.L143V|RUSC1_ENST00000368354.3_5'Flank	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	209					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	CTACCGCCTGCTGAAGCTCTA	0.537													ENSG00000160752																																					0													77.0	73.0	75.0					1																	155288023		2203	4300	6503	SO:0001583	missense	0			-	J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.625C>G	1.37:g.155288023C>G	ENSP00000349078:p.Leu209Val		D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.L209V	ENST00000356657.6	37	c.625	CCDS1110.1	1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523529	0.64747	.	.	ENSG00000160752	ENST00000447866;ENST00000368356;ENST00000356657	T;T;T	0.68765	-0.35;-0.35;-0.35	3.75	0.851	0.18989	Terpenoid synthase (2);	0.000000	0.30901	N	0.008642	T	0.66867	0.2833	M	0.85462	2.755	0.47183	D	0.999342	D	0.53619	0.961	P	0.54856	0.762	T	0.69591	-0.5104	10	0.72032	D	0.01	-14.4645	8.0541	0.30596	0.0:0.7418:0.0:0.2582	.	209	P14324	FPPS_HUMAN	V	143;209;209	ENSP00000391755:L143V;ENSP00000357340:L209V;ENSP00000349078:L209V	ENSP00000349078:L209V	L	+	1	2	FDPS	153554647	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	1.937000	0.40193	0.195000	0.20347	0.467000	0.42956	CTG	-	FDPS	-	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth		0.537	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FDPS	HGNC	protein_coding	OTTHUMT00000039053.1	0	0	0	64	64	33	0.00	0.00	C	NM_002004		155288023	+1	17	16	26	12	tier1	no_errors	ENST00000356657	ensembl	human	known	74_37	missense	39.53	57.14	SNP	1.000	G	17	26
KDM3A	55818	genome.wustl.edu	37	2	86693527	86693527	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr2:86693527C>T	ENST00000409556.1	+	11	1405	c.1040C>T	c.(1039-1041)tCt>tTt	p.S347F	KDM3A_ENST00000542128.1_Missense_Mutation_p.S295F|KDM3A_ENST00000312912.5_Missense_Mutation_p.S347F|KDM3A_ENST00000409064.1_Missense_Mutation_p.S347F			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	347					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						GAGGAAATTTCTTCCTGTCTA	0.388													ENSG00000115548																									NSCLC(96;1150 1523 6936 46253 49736)												0													97.0	119.0	112.0					2																	86693527		2197	4298	6495	SO:0001583	missense	0			-	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.1040C>T	2.37:g.86693527C>T	ENSP00000386660:p.Ser347Phe		D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S347F	ENST00000409556.1	37	c.1040	CCDS1990.1	2	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490963	0.64074	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.93	5.93	0.95920	.	0.191419	0.38217	N	0.001765	T	0.53238	0.1784	N	0.19112	0.55	0.34961	D	0.752236	B;B	0.29590	0.25;0.162	B;B	0.40228	0.323;0.172	T	0.64245	-0.6453	10	0.66056	D	0.02	.	17.5066	0.87747	0.0:1.0:0.0:0.0	.	295;347	F5H070;Q9Y4C1	.;KDM3A_HUMAN	F	347;347;347;347;295	ENSP00000386660:S347F;ENSP00000323659:S347F;ENSP00000386516:S347F;ENSP00000438324:S295F	ENSP00000323659:S347F	S	+	2	0	KDM3A	86547038	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.465000	0.60141	2.808000	0.96608	0.655000	0.94253	TCT	-	KDM3A	-	NULL		0.388	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	0	0	0	96	96	86	0.00	0.00	C	NM_018433		86693527	+1	54	83	31	57	tier1	no_errors	ENST00000312912	ensembl	human	known	74_37	missense	63.53	58.87	SNP	0.987	T	54	31
NPAP1	23742	genome.wustl.edu	37	15	24922764	24922764	+	Missense_Mutation	SNP	T	T	C	rs374388831		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr15:24922764T>C	ENST00000329468.2	+	1	2224	c.1750T>C	c.(1750-1752)Tct>Cct	p.S584P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	584					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TACTGCCCCATCTCAGGTTGT	0.488													ENSG00000185823																																					0													102.0	98.0	99.0					15																	24922764		2203	4300	6503	SO:0001583	missense	0			-	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1750T>C	15.37:g.24922764T>C	ENSP00000333735:p.Ser584Pro			Missense_Mutation	SNP	NULL	p.S584P	ENST00000329468.2	37	c.1750	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	12.17	1.858223	0.32791	.	.	ENSG00000185823	ENST00000329468	T	0.10668	2.85	1.68	-0.696	0.11287	.	0.387908	0.19188	N	0.120482	T	0.07548	0.0190	L	0.46157	1.445	0.09310	N	1	B	0.24768	0.111	B	0.15052	0.012	T	0.25293	-1.0136	10	0.37606	T	0.19	.	4.1393	0.10186	0.0:0.444:0.0:0.556	.	584	Q9NZP6	CO002_HUMAN	P	584	ENSP00000333735:S584P	ENSP00000333735:S584P	S	+	1	0	C15orf2	22473857	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	-0.017000	0.12590	-0.212000	0.10109	0.172000	0.16884	TCT	-	NPAP1	-	NULL		0.488	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	0	0	0	36	36	122	0.00	0.00	T	NM_018958		24922764	+1	8	14	32	107	tier1	no_errors	ENST00000329468	ensembl	human	known	74_37	missense	20.00	11.57	SNP	0.000	C	8	32
PRR12	57479	genome.wustl.edu	37	19	50100901	50100901	+	Silent	SNP	G	G	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr19:50100901G>A	ENST00000418929.2	+	4	3321	c.3309G>A	c.(3307-3309)gcG>gcA	p.A1103A		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		AGTTCGAGGCGGACGAGGACA	0.672													ENSG00000126464																																					0													11.0	16.0	14.0					19																	50100901		2086	4190	6276	SO:0001819	synonymous_variant	0			-	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.3309G>A	19.37:g.50100901G>A			E9PB06|Q8N4J6	Silent	SNP	NULL	p.A1103	ENST00000418929.2	37	c.3309	CCDS46143.1	19																																																																																			-	PRR12	-	NULL		0.672	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR12	HGNC	protein_coding	OTTHUMT00000465915.1	0	0	0	10	10	16	0.00	0.00	G	NM_020719		50100901	+1	4	15	10	11	tier1	no_errors	ENST00000418929	ensembl	human	novel	74_37	silent	28.57	55.56	SNP	0.240	A	4	10
VTCN1	79679	genome.wustl.edu	37	1	117690386	117690386	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:117690386C>T	ENST00000369458.3	-	5	821	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	VTCN1_ENST00000359008.4_Missense_Mutation_p.R251Q|VTCN1_ENST00000328189.3_Missense_Mutation_p.R132Q|VTCN1_ENST00000539893.1_Missense_Mutation_p.R153Q	NM_024626.3	NP_078902.2			V-set domain containing T cell activation inhibitor 1											large_intestine(7)|lung(4)|upper_aerodigestive_tract(1)	12	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		TAGGTGACTCCGCCTTTTGAT	0.458													ENSG00000134258																																					0													121.0	113.0	116.0					1																	117690386		2203	4300	6503	SO:0001583	missense	0			-	BX648021	CCDS894.1, CCDS58019.1, CCDS58020.1	1p12	2013-01-29			ENSG00000134258	ENSG00000134258		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28873	protein-coding gene	gene with protein product	"""B7 family member, H4"", ""B7 superfamily member 1"""	608162				12818165, 12818166	Standard	NM_024626		Approved	B7-H4, FLJ22418, B7S1, B7X, B7H4	uc001ehb.3	Q7Z7D3	OTTHUMG00000012118	ENST00000369458.3:c.743G>A	1.37:g.117690386C>T	ENSP00000358470:p.Arg248Gln			Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.R251Q	ENST00000369458.3	37	c.752	CCDS894.1	1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332110	0.41297	.	.	ENSG00000134258	ENST00000369458;ENST00000359008;ENST00000328189;ENST00000539893	T;T;T;T	0.23348	3.42;3.4;1.91;3.63	5.49	2.65	0.31530	.	0.236214	0.29767	N	0.011241	T	0.03136	0.0092	N	0.11560	0.145	0.27286	N	0.957971	B;B	0.18461	0.028;0.002	B;B	0.08055	0.003;0.001	T	0.42378	-0.9455	10	0.23891	T	0.37	-14.2247	4.1884	0.10409	0.15:0.5359:0.0:0.3141	.	132;248	Q7Z7D3-2;Q7Z7D3	.;VTCN1_HUMAN	Q	248;251;132;153	ENSP00000358470:R248Q;ENSP00000351899:R251Q;ENSP00000328168:R132Q;ENSP00000444724:R153Q	ENSP00000328168:R132Q	R	-	2	0	VTCN1	117491909	0.827000	0.29292	0.983000	0.44433	0.993000	0.82548	0.337000	0.19841	0.453000	0.26858	0.655000	0.94253	CGG	-	VTCN1	-	NULL		0.458	VTCN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VTCN1	HGNC	protein_coding	OTTHUMT00000033500.2	0	0	0	90	90	99	0.00	0.00	C	NM_024626		117690386	-1	12	40	35	52	tier1	no_errors	ENST00000359008	ensembl	human	known	74_37	missense	25.53	43.01	SNP	0.962	T	12	35
CHTOP	26097	genome.wustl.edu	37	1	153615716	153615716	+	Silent	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:153615716C>T	ENST00000368694.3	+	5	729	c.417C>T	c.(415-417)ctC>ctT	p.L139L	CHTOP_ENST00000368687.1_Silent_p.L114L|CHTOP_ENST00000368686.1_3'UTR|CHTOP_ENST00000403433.1_Intron|CHTOP_ENST00000495554.1_Intron|CHTOP_ENST00000368690.3_Intron	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	139	Arg/Gly-rich.				mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						AAAACCTGCTCCGAGGTGGAC	0.532													ENSG00000160679																																					0													121.0	120.0	121.0					1																	153615716		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.417C>T	1.37:g.153615716C>T			D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Silent	SNP	NULL	p.L139	ENST00000368694.3	37	c.417	CCDS1048.1	1																																																																																			-	CHTOP	-	NULL		0.532	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHTOP	HGNC	protein_coding	OTTHUMT00000089967.1	0	0	0	65	65	95	0.00	0.00	C	NM_015607		153615716	+1	19	40	42	74	tier1	no_errors	ENST00000368694	ensembl	human	known	74_37	silent	30.65	35.09	SNP	1.000	T	19	42
RGSL1	353299	genome.wustl.edu	37	1	182458326	182458326	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:182458326T>A	ENST00000294854.8	+	8	1726	c.1706T>A	c.(1705-1707)gTg>gAg	p.V569E	RGSL1_ENST00000542961.1_Missense_Mutation_p.V604E	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	569					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						ACATCTCCAGTGTTTCTAACA	0.408													ENSG00000121446																									Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)												0													71.0	63.0	66.0					1																	182458326		692	1591	2283	SO:0001583	missense	0			-	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.1706T>A	1.37:g.182458326T>A	ENSP00000457748:p.Val569Glu		A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam	p.V569E	ENST00000294854.8	37	c.1706	CCDS58049.1	1																																																																																			-	RGSL1	-	NULL		0.408	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	RGSL1	HGNC	protein_coding	OTTHUMT00000320710.3	0	0	0	37	37	75	0.00	0.00	T	NM_181572		182458326	+1	11	33	24	102	tier1	no_errors	ENST00000294854	ensembl	human	known	74_37	missense	31.43	24.44	SNP	0.981	A	11	24
OR2T33	391195	genome.wustl.edu	37	1	248436695	248436695	+	Missense_Mutation	SNP	C	C	T	rs71642437		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:248436695C>T	ENST00000318021.2	-	1	443	c.422G>A	c.(421-423)aGg>aAg	p.R141K		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CATGGTCATCCTCAGGCACAG	0.582													ENSG00000177212																																					0													128.0	122.0	124.0					1																	248436695		2203	4300	6503	SO:0001583	missense	0			-		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.422G>A	1.37:g.248436695C>T	ENSP00000324687:p.Arg141Lys		B2RNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R141K	ENST00000318021.2	37	c.422	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	5.681	0.310225	0.10733	.	.	ENSG00000177212	ENST00000318021	T	0.00115	8.71	2.52	-4.01	0.04045	GPCR, rhodopsin-like superfamily (1);	1.546670	0.04758	U	0.425746	T	0.00073	0.0002	N	0.12502	0.225	0.09310	N	1	B	0.14012	0.009	B	0.17979	0.02	T	0.12319	-1.0552	10	0.45353	T	0.12	.	2.7156	0.05186	0.1395:0.1381:0.1396:0.5828	.	141	Q8NG76	O2T33_HUMAN	K	141	ENSP00000324687:R141K	ENSP00000324687:R141K	R	-	2	0	OR2T33	246503318	0.000000	0.05858	0.000000	0.03702	0.133000	0.20885	-4.625000	0.00207	-0.865000	0.04073	0.494000	0.49563	AGG	rs71642437	OR2T33	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.582	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	HGNC	protein_coding	OTTHUMT00000097354.1	0	0	0	259	259	126	0.00	0.00	C	NM_001004695		248436695	-1	42	28	161	122	tier1	no_errors	ENST00000318021	ensembl	human	known	74_37	missense	20.69	18.67	SNP	0.000	T	42	161
TECPR2	9895	genome.wustl.edu	37	14	102898417	102898417	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr14:102898417G>C	ENST00000359520.7	+	8	1595	c.1369G>C	c.(1369-1371)Gtc>Ctc	p.V457L	TECPR2_ENST00000558678.1_Missense_Mutation_p.V457L	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	457					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						CCAGGAGCTTGTCGTGAAGCC	0.552													ENSG00000196663																																					0													16.0	16.0	16.0					14																	102898417		2000	3937	5937	SO:0001583	missense	0			-	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1369G>C	14.37:g.102898417G>C	ENSP00000352510:p.Val457Leu		A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_RCC1/BLIP-II,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.V457L	ENST00000359520.7	37	c.1369	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234123	0.39498	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.21191	2.02	5.39	1.73	0.24493	.	0.346810	0.29328	N	0.012473	T	0.18383	0.0441	L	0.53249	1.67	0.09310	N	1	B;B	0.21905	0.062;0.062	B;B	0.21917	0.037;0.037	T	0.17561	-1.0365	10	0.52906	T	0.07	.	7.0423	0.25027	0.5334:0.0:0.4666:0.0	.	457;457	A5PKY3;O15040	.;TCPR2_HUMAN	L	457	ENSP00000352510:V457L	ENSP00000352510:V457L	V	+	1	0	TECPR2	101968170	0.511000	0.26179	0.010000	0.14722	0.982000	0.71751	0.749000	0.26320	0.632000	0.30432	0.650000	0.86243	GTC	-	TECPR2	-	NULL		0.552	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2	0	0	0	48	48	16	0.00	0.00	G	NM_014844		102898417	+1	5	3	36	23	tier1	no_errors	ENST00000359520	ensembl	human	known	74_37	missense	12.20	11.54	SNP	0.040	C	5	36
LOC653786	653786	genome.wustl.edu	37	16	22580493	22580493	+	RNA	SNP	A	A	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr16:22580493A>T	ENST00000550753.1	+	0	2121					NR_003676.2																						CAGCTGGATTAACTAAGGCAG	0.443													ENSG00000257838																																					0																																												0			-																													16.37:g.22580493A>T				R	SNP	-	NULL	ENST00000550753.1	37	NULL		16																																																																																			-	RP11-368J21.3	-	-		0.443	RP11-368J21.3-001	KNOWN	basic	processed_transcript	LOC653786	Clone_based_vega_gene	pseudogene	OTTHUMT00000409041.1	0	0	0	89	89	107	0.00	0.00	A			22580493	+1	10	19	45	81	tier1	no_errors	ENST00000550753	ensembl	human	known	74_37	rna	18.18	18.81	SNP	1.000	T	10	45
EMX1	2016	genome.wustl.edu	37	2	73160999	73160999	+	Silent	SNP	G	G	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr2:73160999G>A	ENST00000258106.6	+	3	1167	c.789G>A	c.(787-789)aaG>aaA	p.K263K	EMX1_ENST00000394111.5_3'UTR	NM_004097.2	NP_004088.2	Q04741	EMX1_HUMAN	empty spiracles homeobox 1	230					brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|in utero embryonic development (GO:0001701)|neuron projection extension (GO:1990138)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.K263K(1)		cervix(1)|large_intestine(2)|lung(3)	6						AGCAGAAGAAGAAGGGCTCCC	0.582													ENSG00000135638																																					1	Substitution - coding silent(1)	lung(1)											72.0	83.0	79.0					2																	73160999		2123	4243	6366	SO:0001819	synonymous_variant	0			-	X68879	CCDS1921.2	2p13.2	2011-06-20	2007-02-15		ENSG00000135638	ENSG00000135638		"""Homeoboxes / ANTP class : NKL subclass"""	3340	protein-coding gene	gene with protein product		600034	"""empty spiracles homolog 1 (Drosophila)"""			7959790	Standard	XM_005264203		Approved		uc002sin.1	Q04741	OTTHUMG00000129778	ENST00000258106.6:c.789G>A	2.37:g.73160999G>A			Q0D2P0|Q53T30|Q86XB0	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.K263	ENST00000258106.6	37	c.789	CCDS1921.2	2																																																																																			-	EMX1	-	NULL		0.582	EMX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMX1	HGNC	protein_coding	OTTHUMT00000251994.3	0	0	0	54	54	102	0.00	0.00	G			73160999	+1	5	15	26	50	tier1	no_errors	ENST00000258106	ensembl	human	known	74_37	silent	16.13	23.08	SNP	1.000	A	5	26
PFKP	5214	genome.wustl.edu	37	10	3146134	3146134	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr10:3146134G>C	ENST00000381125.4	+	5	694	c.618G>C	c.(616-618)caG>caC	p.Q206H	PFKP_ENST00000381075.2_Missense_Mutation_p.Q198H	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	206	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		CCACGGCCCAGAGGTAAAGCG	0.617													ENSG00000067057																																					0													47.0	39.0	42.0					10																	3146134		2202	4300	6502	SO:0001583	missense	0			-	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.618G>C	10.37:g.3146134G>C	ENSP00000370517:p.Gln206His		B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.Q206H	ENST00000381125.4	37	c.618	CCDS7059.1	10	.	.	.	.	.	.	.	.	.	.	G	6.918	0.538994	0.13250	.	.	ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000407806	T;T;T	0.77877	-1.13;-1.13;-1.13	4.64	4.64	0.57946	Phosphofructokinase domain (2);	0.052190	0.85682	D	0.000000	T	0.75391	0.3843	L	0.28776	0.89	0.80722	D	1	D;D	0.63046	0.99;0.992	P;P	0.59056	0.851;0.795	T	0.69837	-0.5037	10	0.15499	T	0.54	.	11.1955	0.48711	0.1352:0.0:0.8648:0.0	.	198;206	Q5VSR7;Q01813	.;K6PP_HUMAN	H	206;195;198;168	ENSP00000370517:Q206H;ENSP00000370465:Q198H;ENSP00000385880:Q168H	ENSP00000370465:Q198H	Q	+	3	2	PFKP	3136134	1.000000	0.71417	1.000000	0.80357	0.129000	0.20672	2.887000	0.48586	2.293000	0.77203	0.650000	0.86243	CAG	-	PFKP	-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk		0.617	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKP	HGNC	protein_coding	OTTHUMT00000046454.1	0	0	0	29	29	46	0.00	0.00	G	NM_002627		3146134	+1	11	6	9	26	tier1	no_errors	ENST00000381125	ensembl	human	known	74_37	missense	55.00	18.75	SNP	1.000	C	11	9
MYOM2	9172	genome.wustl.edu	37	8	2044184	2044184	+	Silent	SNP	C	C	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr8:2044184C>A	ENST00000262113.4	+	18	2364	c.2223C>A	c.(2221-2223)ccC>ccA	p.P741P	MYOM2_ENST00000523438.1_Silent_p.P166P	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	741	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GTGGCTCGCCCATCCTGGGCT	0.557													ENSG00000036448																																					0													97.0	85.0	89.0					8																	2044184		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2223C>A	8.37:g.2044184C>A			Q7Z3Y2	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P741	ENST00000262113.4	37	c.2223	CCDS5957.1	8																																																																																			-	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.557	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	0	0	0	64	64	101	0.00	0.00	C	NM_003970		2044184	+1	26	39	32	59	tier1	no_errors	ENST00000262113	ensembl	human	known	74_37	silent	44.83	39.80	SNP	0.325	A	26	32
MAGED1	9500	genome.wustl.edu	37	X	51639866	51639866	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chrX:51639866T>A	ENST00000375722.1	+	4	1367	c.1115T>A	c.(1114-1116)cTg>cAg	p.L372Q	MAGED1_ENST00000375772.3_Missense_Mutation_p.L372Q|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Missense_Mutation_p.L428Q|MAGED1_ENST00000326587.7_Missense_Mutation_p.L372Q			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	372	22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.|Pro-rich.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CCGAATCCACTGGCCTGGCAG	0.617										Multiple Myeloma(10;0.10)			ENSG00000179222																																					0													29.0	28.0	28.0					X																	51639866		2203	4300	6503	SO:0001583	missense	0			-	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1115T>A	X.37:g.51639866T>A	ENSP00000364874:p.Leu372Gln		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.L428Q	ENST00000375722.1	37	c.1283	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	T	14.75	2.627268	0.46944	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	3.84	2.69	0.31865	.	0.594559	0.12737	N	0.443390	T	0.39784	0.1091	N	0.08118	0	0.09310	N	1	D;D	0.71674	0.998;0.996	P;P	0.59703	0.862;0.731	T	0.21042	-1.0257	10	0.08837	T	0.75	.	6.1004	0.20043	0.0:0.1311:0.0:0.8689	.	428;372	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	Q	372;372;372;428	ENSP00000364927:L372Q;ENSP00000364874:L372Q;ENSP00000325333:L372Q;ENSP00000364847:L428Q	ENSP00000325333:L372Q	L	+	2	0	MAGED1	51656606	0.952000	0.32445	0.904000	0.35570	0.917000	0.54804	2.034000	0.41145	1.498000	0.48600	0.235000	0.17854	CTG	-	MAGED1	-	NULL		0.617	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	0	0	0	116	116	64	0.00	0.00	T	NM_001005332		51639866	+1	37	26	214	165	tier1	no_errors	ENST00000375695	ensembl	human	known	74_37	missense	14.74	13.61	SNP	0.102	A	37	214
OR7A5	26659	genome.wustl.edu	37	19	14939050	14939050	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr19:14939050C>A	ENST00000322301.3	-	2	91	c.4G>T	c.(4-6)Gaa>Taa	p.E2*	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Nonsense_Mutation_p.E2*			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	2					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TTTCCTGGTTCCATTTGATTG	0.393													ENSG00000188269																																					0													33.0	33.0	33.0					19																	14939050		2152	4245	6397	SO:0001587	stop_gained	0			-	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.4G>T	19.37:g.14939050C>A	ENSP00000316955:p.Glu2*		B2R682|Q6IFP1|Q96R96	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E2*	ENST00000322301.3	37	c.4	CCDS12318.1	19	.	.	.	.	.	.	.	.	.	.	c	17.83	3.485900	0.63962	.	.	ENSG00000188269	ENST00000322301	.	.	.	3.13	3.13	0.36017	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	12.2501	0.54593	0.0:1.0:0.0:0.0	.	.	.	.	X	2	.	ENSP00000316955:E2X	E	-	1	0	OR7A5	14800050	0.035000	0.19736	0.210000	0.23637	0.250000	0.25880	0.418000	0.21230	1.807000	0.52817	0.134000	0.15878	GAA	-	OR7A5	-	NULL		0.393	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A5	HGNC	protein_coding	OTTHUMT00000466518.1	0	0	0	101	101	82	0.00	0.00	C	NM_017506		14939050	-1	50	52	62	59	tier1	no_errors	ENST00000322301	ensembl	human	known	74_37	nonsense	44.64	46.85	SNP	0.810	A	50	62
FGFR1	2260	genome.wustl.edu	37	8	38285564	38285564	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr8:38285564G>A	ENST00000447712.2	-	5	1437	c.496C>T	c.(496-498)Cat>Tat	p.H166Y	FGFR1_ENST00000356207.5_Missense_Mutation_p.H77Y|FGFR1_ENST00000341462.5_Missense_Mutation_p.H167Y|RP11-350N15.4_ENST00000528407.1_RNA|FGFR1_ENST00000532791.1_Missense_Mutation_p.H166Y|FGFR1_ENST00000397108.4_Missense_Mutation_p.H164Y|FGFR1_ENST00000425967.3_Missense_Mutation_p.H197Y|FGFR1_ENST00000326324.6_Missense_Mutation_p.H75Y|FGFR1_ENST00000335922.5_Missense_Mutation_p.H158Y|FGFR1_ENST00000397091.5_Missense_Mutation_p.H164Y|FGFR1_ENST00000397113.2_Missense_Mutation_p.H164Y|FGFR1_ENST00000397103.1_Missense_Mutation_p.H75Y	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	166	Heparin-binding.|Ig-like C2-type 2.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GGCACTGCATGCAATTTCTTT	0.532		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""						ENSG00000077782																									Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	0													103.0	102.0	102.0					8																	38285564		1946	4148	6094	SO:0001583	missense	0			-	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.496C>T	8.37:g.38285564G>A	ENSP00000400162:p.His166Tyr		A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.H197Y	ENST00000447712.2	37	c.589	CCDS6107.2	8	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142946	0.57044	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000356207;ENST00000335922;ENST00000326324;ENST00000397103;ENST00000397108;ENST00000326296;ENST00000533668;ENST00000525001;ENST00000526742;ENST00000529552;ENST00000530568	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-0.96;-1.49;-1.49;-1.49;-0.94	5.56	5.56	0.83823	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84951	0.5586	L	0.31476	0.935	0.80722	D	1	D;P;P;P;P;D;D;P;P;D;P;P	0.89917	1.0;0.708;0.712;0.712;0.889;0.999;0.999;0.756;0.708;0.977;0.95;0.712	D;P;P;P;P;D;D;P;P;P;B;P	0.91635	0.999;0.48;0.55;0.55;0.531;0.997;0.998;0.678;0.48;0.538;0.409;0.55	D	0.83868	0.0272	10	0.37606	T	0.19	.	19.5308	0.95228	0.0:0.0:1.0:0.0	.	77;77;164;197;75;75;77;166;158;77;75;166	B5A959;P11362-3;P11362-7;P11362-21;B5A958;P11362-14;P11362-4;P11362;P11362-20;P11362-16;P11362-18;P11362-2	.;.;.;.;.;.;.;FGFR1_HUMAN;.;.;.;.	Y	164;197;166;167;166;166;164;77;158;75;75;164;167;6;166;75;77;75	ENSP00000380280:H164Y;ENSP00000393312:H197Y;ENSP00000400162:H166Y;ENSP00000340636:H167Y;ENSP00000432972:H166Y;ENSP00000380302:H164Y;ENSP00000348537:H77Y;ENSP00000337247:H158Y;ENSP00000327229:H75Y;ENSP00000380292:H75Y;ENSP00000380297:H164Y;ENSP00000434869:H6Y;ENSP00000434712:H166Y;ENSP00000433569:H75Y;ENSP00000435283:H77Y;ENSP00000434473:H75Y	ENSP00000311337:H166Y	H	-	1	0	FGFR1	38404721	1.000000	0.71417	0.980000	0.43619	0.616000	0.37450	5.636000	0.67848	2.630000	0.89119	0.563000	0.77884	CAT	-	FGFR1	-	pirsf_FGF_rcpt_fam,smart_Ig_sub,pfscan_Ig-like_dom		0.532	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	HGNC	protein_coding		0	0	1	142	142	56	0.00	1.75	G			38285564	-1	50	17	77	40	tier1	no_errors	ENST00000425967	ensembl	human	known	74_37	missense	39.37	29.82	SNP	1.000	A	50	77
PKHD1L1	93035	genome.wustl.edu	37	8	110412352	110412352	+	Missense_Mutation	SNP	C	C	A	rs374182485		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr8:110412352C>A	ENST00000378402.5	+	13	1164	c.1060C>A	c.(1060-1062)Cgt>Agt	p.R354S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	354	IPT/TIG 3.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCGTCCAATACGTTTGGAAGA	0.423										HNSCC(38;0.096)			ENSG00000205038																																					0													185.0	183.0	183.0					8																	110412352		1865	4093	5958	SO:0001583	missense	0			-	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1060C>A	8.37:g.110412352C>A	ENSP00000367655:p.Arg354Ser		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.R354S	ENST00000378402.5	37	c.1060	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	2.228	-0.376769	0.05000	.	.	ENSG00000205038	ENST00000378402	D	0.84589	-1.87	5.3	5.3	0.74995	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);	0.360688	0.25169	N	0.032606	T	0.69269	0.3092	N	0.03608	-0.345	0.24278	N	0.99522	B	0.13594	0.008	B	0.14023	0.01	T	0.50320	-0.8842	10	0.16420	T	0.52	.	16.4525	0.83996	0.0:1.0:0.0:0.0	.	354	Q86WI1	PKHL1_HUMAN	S	354	ENSP00000367655:R354S	ENSP00000367655:R354S	R	+	1	0	PKHD1L1	110481528	0.002000	0.14202	0.411000	0.26484	0.002000	0.02628	1.567000	0.36407	2.457000	0.83068	0.563000	0.77884	CGT	-	PKHD1L1	-	superfamily_Ig_E-set,smart_IPT,smart_PA14		0.423	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	0	0	0	106	106	111	0.00	0.00	C	NM_177531		110412352	+1	39	33	42	61	tier1	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	48.15	34.38	SNP	0.888	A	39	42
OR10Z1	128368	genome.wustl.edu	37	1	158577164	158577164	+	Silent	SNP	A	A	G			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:158577164A>G	ENST00000361284.1	+	1	936	c.936A>G	c.(934-936)aaA>aaG	p.K312K		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TGCTGGGTAAAGGATGAAGGT	0.488													ENSG00000198967																																					0													94.0	95.0	95.0					1																	158577164		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.936A>G	1.37:g.158577164A>G			Q5VYL0|Q6IFR7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K312	ENST00000361284.1	37	c.936	CCDS30901.1	1																																																																																			-	OR10Z1	-	NULL		0.488	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	0	0	0	46	46	107	0.00	0.00	A	NM_001004478		158577164	+1	17	63	18	78	tier1	no_errors	ENST00000361284	ensembl	human	known	74_37	silent	48.57	44.68	SNP	0.009	G	17	18
TLR9	54106	genome.wustl.edu	37	3	52255778	52255778	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr3:52255778C>T	ENST00000360658.2	-	2	3187	c.2554G>A	c.(2554-2556)Gcc>Acc	p.A852T	TLR9_ENST00000494383.1_Missense_Mutation_p.G1005D|TLR9_ENST00000597542.1_Missense_Mutation_p.A876T	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	852					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	GGAAGCCAGGCCAGGCACAGG	0.642													ENSG00000239732																																					0													55.0	55.0	55.0					3																	52255778		2203	4300	6503	SO:0001583	missense	0			-	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2554G>A	3.37:g.52255778C>T	ENSP00000353874:p.Ala852Thr		B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_TIR_dom,pfscan_TIR_dom	p.A876T	ENST00000360658.2	37	c.2626	CCDS2848.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.26|14.26	2.481511|2.481511	0.44147|0.44147	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.34072|.	1.38|.	4.97|4.97	3.09|3.09	0.35607|0.35607	.|.	0.000000|.	0.37483|.	N|.	0.002069|.	T|T	0.65565|0.65565	0.2703|0.2703	M|M	0.77103|0.77103	2.36|2.36	0.40781|0.40781	D|D	0.983171|0.983171	B;B|.	0.28667|.	0.053;0.219|.	B;B|.	0.23275|.	0.033;0.045|.	T|T	0.65549|0.65549	-0.6141|-0.6141	10|5	0.52906|.	T|.	0.07|.	.|.	7.6588|7.6588	0.28392|0.28392	0.1621:0.7487:0.0:0.0892|0.1621:0.7487:0.0:0.0892	.|.	949;852|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	T|D	852|1005	ENSP00000353874:A852T|.	ENSP00000353874:A852T|.	A|G	-|-	1|2	0|0	TLR9|RP11-330H6.5	52230818|52230818	0.015000|0.015000	0.18098|0.18098	0.931000|0.931000	0.37212|0.37212	0.846000|0.846000	0.48090|0.48090	0.206000|0.206000	0.17375|0.17375	1.085000|1.085000	0.41206|0.41206	0.561000|0.561000	0.74099|0.74099	GCC|GGC	-	TLR9	-	NULL		0.642	TLR9-001	KNOWN	basic|CCDS	protein_coding	TLR9	HGNC	protein_coding	OTTHUMT00000350203.1	0	0	0	71	71	25	0.00	0.00	C			52255778	-1	10	9	65	32	tier1	no_errors	ENST00000597542	ensembl	human	known	74_37	missense	13.16	21.95	SNP	0.998	T	10	65
WDR81	124997	genome.wustl.edu	37	17	1630298	1630298	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr17:1630298C>T	ENST00000409644.1	+	1	2045	c.2045C>T	c.(2044-2046)tCc>tTc	p.S682F	WDR81_ENST00000437219.2_Intron|WDR81_ENST00000309182.5_Intron|WDR81_ENST00000446363.1_Intron|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000419248.1_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	682					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CTGGGCTCCTCCAGTCAAGCG	0.607													ENSG00000167716																																					0													12.0	14.0	14.0					17																	1630298		691	1588	2279	SO:0001583	missense	0			-	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.2045C>T	17.37:g.1630298C>T	ENSP00000386609:p.Ser682Phe		B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S682F	ENST00000409644.1	37	c.2045	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	C	2.791	-0.251404	0.05867	.	.	ENSG00000167716	ENST00000409644	T	0.56444	0.46	5.5	4.5	0.54988	.	.	.	.	.	T	0.52158	0.1717	.	.	.	0.29534	N	0.85255	.	.	.	.	.	.	T	0.50180	-0.8858	6	0.37606	T	0.19	.	11.6034	0.51017	0.0:0.8056:0.1247:0.0697	.	.	.	.	F	682	ENSP00000386609:S682F	ENSP00000386609:S682F	S	+	2	0	WDR81	1577048	0.044000	0.20184	0.251000	0.24312	0.026000	0.11368	0.643000	0.24750	2.580000	0.87095	0.561000	0.74099	TCC	-	WDR81	-	NULL		0.607	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2	0	0	0	59	59	68	0.00	0.00	C	NM_152348		1630298	+1	40	47	37	34	tier1	no_errors	ENST00000409644	ensembl	human	known	74_37	missense	51.95	58.02	SNP	0.134	T	40	37
OR2T4	127074	genome.wustl.edu	37	1	248525837	248525837	+	Missense_Mutation	SNP	C	C	A	rs375159583		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:248525837C>A	ENST00000366475.1	+	1	955	c.955C>A	c.(955-957)Cct>Act	p.P319T		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	319						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGTGGTGAACCCTTTAATCTA	0.458													ENSG00000196944																																					0													140.0	139.0	139.0					1																	248525837		2203	4300	6503	SO:0001583	missense	0			-	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.955C>A	1.37:g.248525837C>A	ENSP00000355431:p.Pro319Thr		Q6IEZ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P319T	ENST00000366475.1	37	c.955	CCDS31113.1	1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675482	0.29783	.	.	ENSG00000196944	ENST00000366475	T	0.63913	-0.07	2.87	1.92	0.25849	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000279	T	0.79131	0.4394	M	0.91038	3.17	0.36512	D	0.869679	D	0.60160	0.987	P	0.62813	0.907	D	0.83903	0.0291	10	0.87932	D	0	.	10.5129	0.44872	0.196:0.804:0.0:0.0	.	319	Q8NH00	OR2T4_HUMAN	T	319	ENSP00000355431:P319T	ENSP00000355431:P319T	P	+	1	0	OR2T4	246592460	0.916000	0.31088	0.875000	0.34327	0.057000	0.15508	3.115000	0.50391	0.381000	0.24851	0.485000	0.47835	CCT	-	OR2T4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.458	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T4	HGNC	protein_coding	OTTHUMT00000097349.2	0	0	0	244	244	44	0.00	0.00	C	NM_001004696		248525837	+1	31	6	165	52	tier1	no_errors	ENST00000366475	ensembl	human	known	74_37	missense	15.82	10.34	SNP	0.996	A	31	165
IARS	3376	genome.wustl.edu	37	9	95013076	95013076	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr9:95013076T>C	ENST00000375643.3	-	23	2614	c.2348A>G	c.(2347-2349)aAt>aGt	p.N783S	IARS_ENST00000443024.2_Missense_Mutation_p.N783S|IARS_ENST00000447699.2_Missense_Mutation_p.N673S|IARS_ENST00000375629.3_5'UTR	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	783					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	CACCTTTAGATTCTGGTACAT	0.438													ENSG00000196305																																					0													141.0	108.0	119.0					9																	95013076		2203	4300	6503	SO:0001583	missense	0			-	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.2348A>G	9.37:g.95013076T>C	ENSP00000364794:p.Asn783Ser		A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	pfam_aa-tR-synth_Ia,pfam_V/L/I-tR-synth_anticodon-bd,pfam_Methionyl/Leucyl_tR_Synth,superfamily_Val/Leu/Ile-tR-synth_edit,superfamily_tRsynth_1a_anticodon-bd,prints_Ile-tR-ligase,tigrfam_Ile-tR-ligase	p.N783S	ENST00000375643.3	37	c.2348	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	T	18.04	3.535383	0.64972	.	.	ENSG00000196305	ENST00000375643;ENST00000451588;ENST00000443024;ENST00000447699;ENST00000375660;ENST00000436450;ENST00000449893	T;T;T	0.13901	2.55;2.55;2.55	5.52	5.52	0.82312	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.041243	0.85682	D	0.000000	T	0.23688	0.0573	M	0.70108	2.13	0.80722	D	1	B;P	0.36837	0.11;0.571	B;B	0.42163	0.196;0.378	T	0.01245	-1.1407	10	0.41790	T	0.15	-28.2057	15.3206	0.74117	0.0:0.0:0.0:1.0	.	783;628	P41252;Q6P0M4	SYIC_HUMAN;.	S	783;15;783;673;783;15;15	ENSP00000364794:N783S;ENSP00000406448:N783S;ENSP00000415020:N673S	ENSP00000364794:N783S	N	-	2	0	IARS	94052897	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.580000	0.82523	2.111000	0.64477	0.533000	0.62120	AAT	-	IARS	-	pfam_V/L/I-tR-synth_anticodon-bd,superfamily_tRsynth_1a_anticodon-bd,tigrfam_Ile-tR-ligase		0.438	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2	0	0	0	58	58	120	0.00	0.00	T	NM_002161		95013076	-1	21	65	28	65	tier1	no_errors	ENST00000375643	ensembl	human	known	74_37	missense	42.86	50.00	SNP	1.000	C	21	28
TP53	7157	genome.wustl.edu	37	17	7578191	7578191	+	Missense_Mutation	SNP	A	A	C	rs530941076		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr17:7578191A>C	ENST00000269305.4	-	6	847	c.658T>G	c.(658-660)Tat>Gat	p.Y220D	TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.Y220D|TP53_ENST00000413465.2_Missense_Mutation_p.Y220D|TP53_ENST00000420246.2_Missense_Mutation_p.Y220D|TP53_ENST00000445888.2_Missense_Mutation_p.Y220D|TP53_ENST00000359597.4_Missense_Mutation_p.Y220D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220N(12)|p.?(11)|p.Y220H(8)|p.0?(8)|p.Y220D(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.S215fs*27(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCGGCTCATAGGGCACCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Substitution - Missense(22)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(1)	breast(10)|biliary_tract(6)|endometrium(5)|oesophagus(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(3)|skin(3)|stomach(2)|central_nervous_system(2)|urinary_tract(2)|lung(2)|liver(2)|ovary(1)											105.0	96.0	99.0					17																	7578191		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.658T>G	17.37:g.7578191A>C	ENSP00000269305:p.Tyr220Asp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y220D	ENST00000269305.4	37	c.658	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	23.0	4.367056	0.82463	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99836	-7.05;-7.05;-7.05;-7.05;-7.05;-7.05;-7.05;-7.05	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999;0.998;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.996;0.992;1.0;0.998;0.995;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	1.0:0.0:0.0:0.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	D	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220D;ENSP00000352610:Y220D;ENSP00000269305:Y220D;ENSP00000398846:Y220D;ENSP00000391127:Y220D;ENSP00000391478:Y220D;ENSP00000425104:Y88D;ENSP00000423862:Y127D	ENSP00000269305:Y220D	Y	-	1	0	TP53	7518916	1.000000	0.71417	0.614000	0.29051	0.991000	0.79684	9.287000	0.95975	2.128000	0.65567	0.460000	0.39030	TAT	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	69	69	97	0.00	0.00	A	NM_000546		7578191	-1	46	97	13	21	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	77.97	82.20	SNP	0.998	C	46	13
CLDN15	24146	genome.wustl.edu	37	7	100877561	100877561	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr7:100877561G>C	ENST00000401528.1	-	3	1505	c.380C>G	c.(379-381)gCc>gGc	p.A127G	CLDN15_ENST00000308344.5_Missense_Mutation_p.A127G|CLDN15_ENST00000433422.1_5'Flank	NM_001185080.1	NP_001172009.1	P56746	CLD15_HUMAN	claudin 15	127					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|ion transport (GO:0006811)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	10	Lung NSC(181;0.168)|all_lung(186;0.215)					CCAGTTACCGGCCAGAATGTG	0.622													ENSG00000106404																																					0													49.0	57.0	55.0					7																	100877561		2202	4299	6501	SO:0001583	missense	0			-	AJ245738	CCDS5717.1	7q22	2008-07-18			ENSG00000106404	ENSG00000106404		"""Claudins"""	2036	protein-coding gene	gene with protein product		615778					Standard	NM_014343		Approved		uc003uyg.2	P56746	OTTHUMG00000150512	ENST00000401528.1:c.380C>G	7.37:g.100877561G>C	ENSP00000385300:p.Ala127Gly		B3KPB5	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin15	p.A127G	ENST00000401528.1	37	c.380	CCDS5717.1	7	.	.	.	.	.	.	.	.	.	.	G	6.468	0.454447	0.12283	.	.	ENSG00000106404	ENST00000308344;ENST00000401528;ENST00000412417	D;D;D	0.90324	-2.65;-2.65;-2.65	5.48	3.62	0.41486	.	0.457774	0.23731	N	0.045140	D	0.85410	0.5690	L	0.31207	0.915	0.23010	N	0.998433	B	0.15473	0.013	B	0.26969	0.075	T	0.72833	-0.4173	10	0.34782	T	0.22	.	13.613	0.62091	0.0:0.4561:0.5438:0.0	.	127	P56746	CLD15_HUMAN	G	127;127;104	ENSP00000308870:A127G;ENSP00000385300:A127G;ENSP00000390230:A104G	ENSP00000308870:A127G	A	-	2	0	CLDN15	100664281	0.007000	0.16637	0.527000	0.27925	0.001000	0.01503	1.488000	0.35551	0.633000	0.30452	-0.305000	0.09177	GCC	-	CLDN15	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin		0.622	CLDN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN15	HGNC	protein_coding	OTTHUMT00000318698.1	0	0	0	72	72	46	0.00	0.00	G	NM_014343		100877561	-1	20	16	17	29	tier1	no_errors	ENST00000308344	ensembl	human	known	74_37	missense	54.05	35.56	SNP	0.680	C	20	17
SLC22A14	9389	genome.wustl.edu	37	3	38354512	38354512	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr3:38354512T>C	ENST00000273173.4	+	5	1058	c.967T>C	c.(967-969)Tgg>Cgg	p.W323R	SLC22A14_ENST00000448498.1_Missense_Mutation_p.W323R	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	323					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		GTCCCCGCGGTGGCTGATGAT	0.592													ENSG00000144671																																					0													53.0	52.0	52.0					3																	38354512		2200	4296	6496	SO:0001583	missense	0			-	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.967T>C	3.37:g.38354512T>C	ENSP00000273173:p.Trp323Arg		A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.W323R	ENST00000273173.4	37	c.967	CCDS2677.1	3	.	.	.	.	.	.	.	.	.	.	T	19.01	3.743231	0.69418	.	.	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.78126	-1.15;-1.15	4.14	4.14	0.48551	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.88883	0.6558	M	0.90705	3.14	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	D	0.90495	0.4470	10	0.87932	D	0	.	11.1683	0.48556	0.0:0.0:0.0:1.0	.	323	Q9Y267	S22AE_HUMAN	R	323	ENSP00000396283:W323R;ENSP00000273173:W323R	ENSP00000273173:W323R	W	+	1	0	SLC22A14	38329516	0.998000	0.40836	0.939000	0.37840	0.041000	0.13682	2.705000	0.47127	1.792000	0.52537	0.482000	0.46254	TGG	-	SLC22A14	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.592	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A14	HGNC	protein_coding	OTTHUMT00000253742.3	0	0	0	58	58	56	0.00	0.00	T	NM_004803		38354512	+1	28	30	31	40	tier1	no_errors	ENST00000273173	ensembl	human	known	74_37	missense	47.46	42.86	SNP	0.996	C	28	31
DCAF8	50717	genome.wustl.edu	37	1	160187406	160187406	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:160187406G>C	ENST00000368073.3	-	14	2204	c.1770C>G	c.(1768-1770)gaC>gaG	p.D590E	DCAF8_ENST00000368074.1_Missense_Mutation_p.D590E|DCAF8_ENST00000556710.1_Missense_Mutation_p.D744E|DCAF8_ENST00000608310.1_Missense_Mutation_p.D744E|DCAF8_ENST00000326837.2_Missense_Mutation_p.D590E			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	590					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						ACTGCACCCGGTCAGGGCCCT	0.647													ENSG00000132716																																					0													56.0	56.0	56.0					1																	160187406		2203	4300	6503	SO:0001583	missense	0			-	AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.1770C>G	1.37:g.160187406G>C	ENSP00000357052:p.Asp590Glu		D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Missense_Mutation	SNP	pfam_Pex19,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D744E	ENST00000368073.3	37	c.2232	CCDS1200.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142350	0.77888	.	.	ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000132716;ENSG00000258465	ENST00000368073;ENST00000326837;ENST00000368074;ENST00000555195;ENST00000540855;ENST00000556710	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.07;-0.07	5.23	4.32	0.51571	.	0.000000	0.64402	U	0.000015	T	0.66877	0.2834	L	0.58428	1.81	0.58432	D	0.999997	D;D	0.61697	0.99;0.984	D;D	0.75484	0.986;0.952	T	0.66540	-0.5898	10	0.30854	T	0.27	-7.0088	8.9913	0.36026	0.1691:0.0:0.8309:0.0	.	744;590	G3V3G9;Q5TAQ9	.;DCAF8_HUMAN	E	590;590;590;744;571;744	ENSP00000357052:D590E;ENSP00000318227:D590E;ENSP00000357053:D590E;ENSP00000451989:D744E;ENSP00000451235:D744E	ENSP00000318227:D590E	D	-	3	2	RP11-574F21.3;DCAF8	158454030	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.104000	0.50306	1.441000	0.47550	0.655000	0.94253	GAC	-	DCAF8	-	NULL		0.647	DCAF8-001	KNOWN	basic|CCDS	protein_coding	DCAF8	HGNC	protein_coding	OTTHUMT00000077402.2	0	0	0	33	33	36	0.00	0.00	G	NM_015726		160187406	-1	28	13	15	27	tier1	no_errors	ENST00000608310	ensembl	human	known	74_37	missense	65.12	32.50	SNP	1.000	C	28	15
PPP1R13B	23368	genome.wustl.edu	37	14	104201334	104201334	+	3'UTR	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr14:104201334C>T	ENST00000202556.9	-	0	3712				PPP1R13B_ENST00000423488.2_3'UTR|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B						intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				GAAAGGGCCTCACCTGGAAAC	0.433													ENSG00000088808																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.*157G>A	14.37:g.104201334C>T			B2RMX5|O94870	R	SNP	-	NULL	ENST00000202556.9	37	NULL	CCDS41997.1	14																																																																																			-	PPP1R13B	-	-		0.433	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R13B	HGNC	protein_coding	OTTHUMT00000414591.1	0	0	0	75	75	140	0.00	0.00	C	NM_015316		104201334	-1	20	70	35	76	tier1	no_errors	ENST00000555391	ensembl	human	known	74_37	rna	36.36	47.95	SNP	0.992	T	20	35
DCAF8	50717	genome.wustl.edu	37	1	160187383	160187383	+	Silent	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:160187383C>T	ENST00000368073.3	-	14	2227	c.1793G>A	c.(1792-1794)tGa>tAa	p.*598*	DCAF8_ENST00000368074.1_Silent_p.*598*|DCAF8_ENST00000556710.1_Silent_p.*752*|DCAF8_ENST00000608310.1_Silent_p.*752*|DCAF8_ENST00000326837.2_Silent_p.*598*			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	0					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						TATGAGGCCTCAAGATGGCAT	0.622													ENSG00000132716																																					0													48.0	47.0	48.0					1																	160187383		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.1793G>A	1.37:g.160187383C>T			D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Silent	SNP	pfam_Pex19,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.*752	ENST00000368073.3	37	c.2255	CCDS1200.1	1																																																																																			-	DCAF8	-	NULL		0.622	DCAF8-001	KNOWN	basic|CCDS	protein_coding	DCAF8	HGNC	protein_coding	OTTHUMT00000077402.2	0	0	0	27	27	36	0.00	0.00	C	NM_015726		160187383	-1	22	11	13	31	tier1	no_errors	ENST00000608310	ensembl	human	known	74_37	silent	59.46	26.19	SNP	1.000	T	22	13
C16orf91	283951	genome.wustl.edu	37	16	1479302	1479302	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr16:1479302T>C	ENST00000310355.1	-	1	43	c.44A>G	c.(43-45)gAa>gGa	p.E15G				Q4G0I0	CSMT1_HUMAN	chromosome 16 open reading frame 91	0						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11						CAGCAGCCTTTCCTGGGACCT	0.607													ENSG00000174109																																					0													110.0	117.0	115.0					16																	1479302		2199	4300	6499	SO:0001583	missense	0			-	BC023590	CCDS61789.1	16p13.3	2012-10-10			ENSG00000174109	ENSG00000174109			27558	protein-coding gene	gene with protein product	"""cattle cerebrum and skeletal muscle-specific protein 1 family member"""						Standard	NM_001272051		Approved	gs103, CCSMST1	uc002clr.4	Q4G0I0		ENST00000310355.1:c.44A>G	16.37:g.1479302T>C	ENSP00000311390:p.Glu15Gly		Q96RZ0	Missense_Mutation	SNP	prints_CCSMST1	p.E15G	ENST00000310355.1	37	c.44	CCDS32360.1	16	.	.	.	.	.	.	.	.	.	.	t	7.082	0.570470	0.13560	.	.	ENSG00000174109	ENST00000310355	.	.	.	0.588	-1.18	0.09617	.	.	.	.	.	T	0.36771	0.0979	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39292	-0.9621	4	0.87932	D	0	.	.	.	.	.	.	.	.	G	15	.	ENSP00000311390:E15G	E	-	2	0	C16orf91	1419303	0.000000	0.05858	0.011000	0.14972	0.126000	0.20510	-1.352000	0.02619	-0.520000	0.06435	0.255000	0.18592	GAA	-	C16orf91	-	NULL		0.607	C16orf91-201	KNOWN	basic|CCDS	protein_coding	C16orf91	HGNC	protein_coding		0	0	0	270	270	58	0.00	0.00	T	NM_001010878		1479302	-1	19	4	93	25	tier1	no_errors	ENST00000310355	ensembl	human	known	74_37	missense	16.96	13.79	SNP	0.230	C	19	93
KNTC1	9735	genome.wustl.edu	37	12	123042022	123042022	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr12:123042022T>C	ENST00000333479.7	+	17	1541	c.1364T>C	c.(1363-1365)gTa>gCa	p.V455A	KNTC1_ENST00000450485.2_Missense_Mutation_p.V418A	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	455					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CAACAACTTGTAGACGACGCT	0.378													ENSG00000184445																																					0													127.0	116.0	120.0					12																	123042022		1886	4121	6007	SO:0001583	missense	0			-		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1364T>C	12.37:g.123042022T>C	ENSP00000328236:p.Val455Ala		A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.V455A	ENST00000333479.7	37	c.1364	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	T	12.08	1.831590	0.32329	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.27256	1.68;2.2	5.74	5.74	0.90152	.	0.062767	0.64402	D	0.000005	T	0.27454	0.0674	M	0.67953	2.075	0.80722	D	1	P;P	0.42871	0.792;0.7	B;B	0.35182	0.197;0.193	T	0.11966	-1.0566	10	0.72032	D	0.01	-17.4381	13.3475	0.60582	0.0:0.0:0.1311:0.8689	.	418;455	E7ES84;P50748	.;KNTC1_HUMAN	A	418;455	ENSP00000397992:V418A;ENSP00000328236:V455A	ENSP00000328236:V455A	V	+	2	0	KNTC1	121607975	1.000000	0.71417	0.042000	0.18584	0.087000	0.18053	5.450000	0.66626	2.317000	0.78254	0.460000	0.39030	GTA	-	KNTC1	-	NULL		0.378	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	0	0	0	95	95	86	0.00	0.00	T			123042022	+1	8	16	68	113	tier1	no_errors	ENST00000333479	ensembl	human	known	74_37	missense	10.39	12.40	SNP	0.997	C	8	68
TRIM42	287015	genome.wustl.edu	37	3	140401655	140401655	+	Silent	SNP	C	C	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr3:140401655C>A	ENST00000286349.3	+	2	884	c.693C>A	c.(691-693)cgC>cgA	p.R231R		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	231						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCTTTGACCGCTCCTCCGGGC	0.617													ENSG00000155890																																					0													74.0	73.0	73.0					3																	140401655		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.693C>A	3.37:g.140401655C>A			A1L4B4|Q8N832|Q8NDL3	Silent	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.R231	ENST00000286349.3	37	c.693	CCDS3113.1	3																																																																																			-	TRIM42	-	NULL		0.617	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	0	0	0	79	79	31	0.00	0.00	C	NM_152616		140401655	+1	12	5	101	27	tier1	no_errors	ENST00000286349	ensembl	human	known	74_37	silent	10.62	15.62	SNP	0.290	A	12	101
PTPRU	10076	genome.wustl.edu	37	1	29602257	29602257	+	Missense_Mutation	SNP	C	C	T	rs574283151	byFrequency	TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:29602257C>T	ENST00000345512.3	+	8	1571	c.1442C>T	c.(1441-1443)aCg>aTg	p.T481M	PTPRU_ENST00000460170.2_Missense_Mutation_p.T481M|PTPRU_ENST00000373779.3_Missense_Mutation_p.T481M|PTPRU_ENST00000323874.8_Missense_Mutation_p.T481M|PTPRU_ENST00000428026.2_Missense_Mutation_p.T481M|PTPRU_ENST00000356870.3_Missense_Mutation_p.T481M	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	481	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ACTTTCCAGACGGATGAGGAT	0.522													ENSG00000060656	C|||	2	0.000399361	0.0	0.0029	5008	,	,		18828	0.0		0.0	False		,,,				2504	0.0																0													68.0	57.0	61.0					1																	29602257		2203	4300	6503	SO:0001583	missense	0			-	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1442C>T	1.37:g.29602257C>T	ENSP00000334941:p.Thr481Met		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.T481M	ENST00000345512.3	37	c.1442	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.948211	0.92593	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.4	5.4	0.78164	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80221	0.4583	M	0.77486	2.375	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.998	T	0.80171	-0.1493	9	.	.	.	.	18.5309	0.90992	0.0:1.0:0.0:0.0	.	481;481;481;481;481	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	M	481	ENSP00000334941:T481M;ENSP00000362884:T481M;ENSP00000349333:T481M;ENSP00000314987:T481M;ENSP00000392332:T481M;ENSP00000432906:T481M	.	T	+	2	0	PTPRU	29474844	1.000000	0.71417	0.962000	0.40283	0.962000	0.63368	7.776000	0.85560	2.695000	0.91970	0.643000	0.83706	ACG	-	PTPRU	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.522	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	0	0	0	33	33	136	0.00	0.00	C			29602257	+1	16	78	9	22	tier1	no_errors	ENST00000345512	ensembl	human	known	74_37	missense	64.00	78.00	SNP	1.000	T	16	9
LRRC40	55631	genome.wustl.edu	37	1	70611568	70611568	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:70611568T>C	ENST00000370952.3	-	15	1803	c.1724A>G	c.(1723-1725)aAt>aGt	p.N575S		NM_017768.4	NP_060238.3	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	575						membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(2)	27						TCGGAATGGATTTCCATCCAG	0.328													ENSG00000066557																																					0													72.0	69.0	70.0					1																	70611568		2203	4300	6503	SO:0001583	missense	0			-		CCDS646.1	1p31.1	2008-02-05			ENSG00000066557	ENSG00000066557			26004	protein-coding gene	gene with protein product						12477932	Standard	NM_017768		Approved	FLJ20331	uc001der.2	Q9H9A6	OTTHUMG00000009348	ENST00000370952.3:c.1724A>G	1.37:g.70611568T>C	ENSP00000359990:p.Asn575Ser		Q9BTR7|Q9NSK1|Q9NXC1	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.N575S	ENST00000370952.3	37	c.1724	CCDS646.1	1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394981	0.83011	.	.	ENSG00000066557	ENST00000370952	T	0.72505	-0.66	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.84088	0.5395	M	0.90019	3.08	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.88007	0.2760	10	0.87932	D	0	.	14.6161	0.68549	0.0:0.0:0.0:1.0	.	575	Q9H9A6	LRC40_HUMAN	S	575	ENSP00000359990:N575S	ENSP00000359990:N575S	N	-	2	0	LRRC40	70384156	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.457000	0.73505	1.919000	0.55581	0.533000	0.62120	AAT	-	LRRC40	-	NULL		0.328	LRRC40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC40	HGNC	protein_coding	OTTHUMT00000025914.1	0	0	0	73	73	99	0.00	0.00	T	NM_017768		70611568	-1	7	16	27	51	tier1	no_errors	ENST00000370952	ensembl	human	known	74_37	missense	20.59	23.88	SNP	1.000	C	7	27
PPP6R1	22870	genome.wustl.edu	37	19	55753603	55753604	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	-	-	-	CC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr19:55753603_55753604insCC	ENST00000412770.2	-	7	1341_1342	c.775_776insGG	c.(775-777)gagfs	p.E259fs	PPP6R1_ENST00000587283.1_Frame_Shift_Ins_p.E259fs	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	259	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)	p.E259*(1)		breast(1)	1						CTGGCTCTGCTCCCCCTCGAAC	0.653													ENSG00000105063																																					1	Substitution - Nonsense(1)	lung(1)																																								SO:0001589	frameshift_variant	0				AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.774_775dupGG	19.37:g.55753606_55753607dupCC	ENSP00000414202:p.Glu259fs		Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Frame_Shift_Ins	INS	pfam_SAPS,superfamily_ARM-type_fold	p.E259fs	ENST00000412770.2	37	c.776_775	CCDS46186.1	19																																																																																				PPP6R1	-	pfam_SAPS,superfamily_ARM-type_fold		0.653	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP6R1	HGNC	protein_coding	OTTHUMT00000452663.1	0	0	0	46	46	38	0.00	0.00	-	NM_014931		55753604	-1	12	11	35	18	tier1	no_errors	ENST00000412770	ensembl	human	known	74_37	frame_shift_ins	25.53	37.93	INS	1.000:1.000	CC	12	35
GLIS1	148979	genome.wustl.edu	37	1	54059922	54059922	+	Silent	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:54059922C>T	ENST00000312233.2	-	3	1220	c.654G>A	c.(652-654)aaG>aaA	p.K218K		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						CGATGTGGCTCTTCTCGATGT	0.672													ENSG00000174332																																					0													85.0	63.0	71.0					1																	54059922		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.654G>A	1.37:g.54059922C>T				Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K218	ENST00000312233.2	37	c.654	CCDS582.1	1																																																																																			-	GLIS1	-	smart_Znf_C2H2-like		0.672	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS1	HGNC	protein_coding	OTTHUMT00000022109.1	0	0	0	56	56	11	0.00	0.00	C	NM_147193		54059922	-1	29	4	14	2	tier1	no_errors	ENST00000312233	ensembl	human	known	74_37	silent	67.44	66.67	SNP	1.000	T	29	14
NPDC1	56654	genome.wustl.edu	37	9	139935042	139935042	+	Missense_Mutation	SNP	C	C	T	rs557720412		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr9:139935042C>T	ENST00000371601.4	-	6	845	c.632G>A	c.(631-633)cGt>cAt	p.R211H	NPDC1_ENST00000371600.3_Missense_Mutation_p.R289H|NPDC1_ENST00000488145.1_5'Flank|RP11-229P13.20_ENST00000457302.2_lincRNA	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1	211						integral component of membrane (GO:0016021)				NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		GCGGATCTCACGCTGCAGCCT	0.692													ENSG00000107281	c|||	1	0.000199681	0.0	0.0	5008	,	,		9781	0.0		0.0	False		,,,				2504	0.001																0													23.0	28.0	26.0					9																	139935042		2176	4284	6460	SO:0001583	missense	0			-	AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.632G>A	9.37:g.139935042C>T	ENSP00000360660:p.Arg211His		Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	Missense_Mutation	SNP	pfam_NPDC1	p.R289H	ENST00000371601.4	37	c.866	CCDS7024.1	9	.	.	.	.	.	.	.	.	.	.	c	16.48	3.134971	0.56828	.	.	ENSG00000107281	ENST00000371600;ENST00000371601	.	.	.	3.23	2.18	0.27775	.	0.248486	0.23340	U	0.049250	T	0.49133	0.1539	L	0.52573	1.65	0.26498	N	0.974824	D;D;D;D	0.76494	0.993;0.993;0.999;0.993	P;P;D;P	0.64042	0.772;0.772;0.921;0.772	T	0.24693	-1.0153	9	0.72032	D	0.01	-19.7394	6.1716	0.20421	0.0:0.7668:0.0:0.2332	.	211;211;289;211	Q8WXX4;Q9NQX5;Q5SPY9;Q8NCE1	.;NPDC1_HUMAN;.;.	H	289;211	.	ENSP00000360659:R289H	R	-	2	0	NPDC1	139054863	0.000000	0.05858	0.993000	0.49108	0.628000	0.37860	0.076000	0.14712	1.628000	0.50416	0.472000	0.43445	CGT	-	NPDC1	-	pfam_NPDC1		0.692	NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPDC1	HGNC	protein_coding	OTTHUMT00000055182.1	0	0	0	31	31	9	0.00	0.00	C	NM_015392		139935042	-1	20	9	21	5	tier1	no_errors	ENST00000371600	ensembl	human	known	74_37	missense	48.78	64.29	SNP	0.808	T	20	21
OXSM	54995	genome.wustl.edu	37	3	25832990	25832990	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr3:25832990T>C	ENST00000280701.3	+	2	578	c.479T>C	c.(478-480)gTt>gCt	p.V160A	OXSM_ENST00000449808.1_Intron|OXSM_ENST00000420173.2_Missense_Mutation_p.V160A|NGLY1_ENST00000417874.2_5'Flank	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	160					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CTTGAAGTTGTTTCTGAAACT	0.433													ENSG00000151093																																					0													99.0	102.0	101.0					3																	25832990		2203	4300	6503	SO:0001583	missense	0			-	BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.479T>C	3.37:g.25832990T>C	ENSP00000280701:p.Val160Ala			Missense_Mutation	SNP	pfam_Ketoacyl_synth_N,pfam_Ketoacyl_synth_C,pfam_Thiolase_N,superfamily_Thiolase-like,smart_PKS_Beta-ketoAc_synthase_dom,tigrfam_3-oxoacyl-ACP_synth-2	p.V160A	ENST00000280701.3	37	c.479	CCDS2643.1	3	.	.	.	.	.	.	.	.	.	.	T	24.8	4.571202	0.86542	.	.	ENSG00000151093	ENST00000452098;ENST00000280701;ENST00000420173;ENST00000428266	.	.	.	6.16	6.16	0.99307	Beta-ketoacyl synthase, N-terminal (1);Thiolase-like, subgroup (1);Thiolase-like (1);	0.370022	0.31404	N	0.007714	T	0.61726	0.2370	N	0.26042	0.785	0.46849	D	0.99922	B;P	0.38711	0.293;0.643	B;P	0.51806	0.121;0.68	T	0.64863	-0.6307	9	0.87932	D	0	-15.7176	16.8061	0.85666	0.0:0.0:0.0:1.0	.	160;160	Q9NWU1-2;Q9NWU1	.;OXSM_HUMAN	A	160	.	ENSP00000280701:V160A	V	+	2	0	OXSM	25807994	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.959000	0.87885	2.367000	0.80283	0.528000	0.53228	GTT	-	OXSM	-	pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,smart_PKS_Beta-ketoAc_synthase_dom,tigrfam_3-oxoacyl-ACP_synth-2		0.433	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXSM	HGNC	protein_coding	OTTHUMT00000252876.2	0	0	0	55	55	101	0.00	0.00	T	NM_017897		25832990	+1	5	9	36	100	tier1	no_errors	ENST00000280701	ensembl	human	known	74_37	missense	12.20	8.18	SNP	1.000	C	5	36
CKAP2L	150468	genome.wustl.edu	37	2	113513773	113513773	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr2:113513773C>A	ENST00000302450.6	-	4	1253	c.1175G>T	c.(1174-1176)aGc>aTc	p.S392I	CKAP2L_ENST00000481732.1_5'Flank|CKAP2L_ENST00000541405.1_Missense_Mutation_p.S227I	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	392						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						GCTAGGGGTGCTTGGAATGGC	0.403													ENSG00000169607																																					0													185.0	180.0	182.0					2																	113513773		2203	4300	6503	SO:0001583	missense	0			-	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1175G>T	2.37:g.113513773C>A	ENSP00000305204:p.Ser392Ile		A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	NULL	p.S392I	ENST00000302450.6	37	c.1175	CCDS2100.1	2	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672793	0.29693	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.12672	2.66;3.32	4.42	2.43	0.29744	.	0.160631	0.40728	N	0.001033	T	0.18676	0.0448	M	0.68317	2.08	0.30785	N	0.741569	P	0.44044	0.825	P	0.48063	0.565	T	0.09796	-1.0658	10	0.87932	D	0	-0.5724	4.4865	0.11792	0.2109:0.664:0.0:0.1251	.	392	Q8IYA6	CKP2L_HUMAN	I	227;392	ENSP00000438763:S227I;ENSP00000305204:S392I	ENSP00000305204:S392I	S	-	2	0	CKAP2L	113230244	0.999000	0.42202	0.998000	0.56505	0.400000	0.30750	0.595000	0.24029	0.674000	0.31244	0.585000	0.79938	AGC	-	CKAP2L	-	NULL		0.403	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP2L	HGNC	protein_coding	OTTHUMT00000254082.2	0	0	0	116	116	87	0.00	0.00	C	NM_152515		113513773	-1	8	9	90	101	tier1	no_errors	ENST00000302450	ensembl	human	known	74_37	missense	8.16	8.11	SNP	0.999	A	8	90
FOXO4	4303	genome.wustl.edu	37	X	70320988	70320988	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chrX:70320988G>T	ENST00000374259.3	+	2	1240	c.908G>T	c.(907-909)gGt>gTt	p.G303V	FOXO4_ENST00000341558.3_Missense_Mutation_p.G248V	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	303					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					CTCAATGAAGGTCTAGAGCTG	0.572											OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000184481																																					0													46.0	50.0	48.0					X																	70320988		2112	4196	6308	SO:0001583	missense	0			-		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.908G>T	X.37:g.70320988G>T	ENSP00000363377:p.Gly303Val	1121	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G303V	ENST00000374259.3	37	c.908	CCDS43969.1	X	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577420	0.28180	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	D;D	0.95447	-3.46;-3.71	4.94	1.29	0.21616	.	0.467157	0.23530	N	0.047196	D	0.86674	0.5989	N	0.08118	0	0.41268	D	0.98682	B;B	0.19445	0.036;0.011	B;B	0.25140	0.058;0.018	T	0.73783	-0.3874	10	0.22109	T	0.4	-17.7582	7.613	0.28142	0.7389:0.0:0.2611:0.0	.	248;303	P98177-2;P98177	.;FOXO4_HUMAN	V	303;248	ENSP00000363377:G303V;ENSP00000342209:G248V	ENSP00000342209:G248V	G	+	2	0	FOXO4	70237713	1.000000	0.71417	0.995000	0.50966	0.927000	0.56198	3.438000	0.52871	-0.015000	0.14150	-0.415000	0.06103	GGT	-	FOXO4	-	NULL		0.572	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO4	HGNC	protein_coding	OTTHUMT00000057115.1	0	0	0	82	82	91	0.00	0.00	G	NM_005938		70320988	+1	8	8	49	115	tier1	no_errors	ENST00000374259	ensembl	human	known	74_37	missense	13.79	6.50	SNP	1.000	T	8	49
ADAMTSL2	9719	genome.wustl.edu	37	9	136402660	136402660	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr9:136402660T>A	ENST00000354484.4	+	3	781	c.224T>A	c.(223-225)cTg>cAg	p.L75Q	ADAMTSL2_ENST00000393061.3_Missense_Mutation_p.L184Q|ADAMTSL2_ENST00000393060.1_Missense_Mutation_p.L75Q	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	75	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		CGGCACTGCCTGCAGCAGAGG	0.692													ENSG00000197859																																					0													30.0	35.0	34.0					9																	136402660		2203	4298	6501	SO:0001583	missense	0			-	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.224T>A	9.37:g.136402660T>A	ENSP00000346478:p.Leu75Gln		B1B0D5|O60345	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS	p.L184Q	ENST00000354484.4	37	c.551	CCDS6976.1	9	.	.	.	.	.	.	.	.	.	.	T	22.7	4.328583	0.81690	.	.	ENSG00000197859	ENST00000354484;ENST00000393061;ENST00000393060	T;T;T	0.51817	0.69;0.69;0.69	4.84	4.84	0.62591	.	0.000000	0.53938	U	0.000056	T	0.63943	0.2554	L	0.58669	1.825	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.63690	-0.6580	10	0.40728	T	0.16	.	14.4	0.67037	0.0:0.0:0.0:1.0	.	75	Q86TH1	ATL2_HUMAN	Q	75;184;75	ENSP00000346478:L75Q;ENSP00000376781:L184Q;ENSP00000376780:L75Q	ENSP00000346478:L75Q	L	+	2	0	ADAMTSL2	135392481	1.000000	0.71417	0.997000	0.53966	0.725000	0.41563	7.640000	0.83355	1.808000	0.52836	0.402000	0.26972	CTG	-	ADAMTSL2	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.692	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL2	HGNC	protein_coding	OTTHUMT00000254619.1	0	0	0	149	149	4	0.00	0.00	T	NM_014694		136402660	+1	13	0	114	2	tier1	no_errors	ENST00000393061	ensembl	human	known	74_37	missense	10.24	0.00	SNP	1.000	A	13	114
LOC101927209	101927209	genome.wustl.edu	37	1	142715153	142715153	+	lincRNA	SNP	G	G	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr1:142715153G>T	ENST00000610091.1	-	0	505																											TTCTTATATTGTTTCTCTTTC	0.299													ENSG00000203849																																					0																																												0			-																													1.37:g.142715153G>T				R	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	RP11-417J8.6	-	-		0.299	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	0	0	0	158	158	0	0.00	0.00	G			142715153	-1	46	0	116	0	tier1	no_errors	ENST00000610091	ensembl	human	known	74_37	rna	28.40	0.00	SNP	0.176	T	46	116
MAML3	55534	genome.wustl.edu	37	4	140811064	140811066	+	In_Frame_Del	DEL	TGC	TGC	-	rs58015886|rs370122702		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr4:140811064_140811066delTGC	ENST00000509479.2	-	2	2380_2382	c.1524_1526delGCA	c.(1522-1527)cagcaa>caa	p.508_509QQ>Q	MAML3_ENST00000398940.1_Splice_Site_p.A37del|MAML3_ENST00000327122.5_In_Frame_Del_p.352_353QQ>Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					TGAGtgctgttgctgctgctgct	0.512													ENSG00000196782																																					0																																										SO:0001651	inframe_deletion	0				AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1524_1526delGCA	4.37:g.140811073_140811075delTGC	ENSP00000421180:p.Gln510del			Frame_Shift_Del	DEL	NULL	p.Q37fs	ENST00000509479.2	37	c.110_109	CCDS54805.1	4																																																																																				MAML3	-	NULL		0.512	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	0	0	0	68	68	1	0.00	0.00	TGC			140811066	-1	8	0	49	1	tier1	no_errors	ENST00000398940	ensembl	human	known	74_37	frame_shift_del	14.04	0.00	DEL	1.000:1.000	-	8	49
SIAH2	6478	genome.wustl.edu	37	3	150480449	150480451	+	In_Frame_Del	DEL	CCG	CCG	-	rs569310827		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	CCG	CCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr3:150480449_150480451delCCG	ENST00000312960.3	-	1	713_715	c.186_188delCGG	c.(184-189)ggcggg>ggg	p.62_63GG>G	SIAH2-AS1_ENST00000461943.1_RNA|SIAH2_ENST00000472885.1_Intron	NM_005067.5	NP_005058.3	O43255	SIAH2_HUMAN	siah E3 ubiquitin protein ligase 2	62					axon guidance (GO:0007411)|cell cycle (GO:0007049)|cellular protein catabolic process (GO:0044257)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|regulation of protein ubiquitination (GO:0031396)|regulation of RNA biosynthetic process (GO:2001141)|small GTPase mediated signal transduction (GO:0007264)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)	16			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			cgggccggccccgccgccgccgc	0.764													ENSG00000181788																																					0										31,18,2859		4,0,23,4,10,1413						1.9	1.0			6	73,0,6195		12,0,49,0,0,3073	no	codingComplex	SIAH2	NM_005067.5		16,0,72,4,10,4486	A1A1,A1A2,A1R,A2A2,A2R,RR		1.1646,1.685,1.3296				104,18,9054				SO:0001651	inframe_deletion	0				U76248	CCDS3152.1	3q25	2012-02-23	2012-02-23		ENSG00000181788	ENSG00000181788	6.3.2.1		10858	protein-coding gene	gene with protein product		602213	"""seven in absentia (Drosophila) homolog 2"", ""seven in absentia homolog 2 (Drosophila)"""			9334332	Standard	NM_005067		Approved		uc003eyi.3	O43255	OTTHUMG00000159847	ENST00000312960.3:c.186_188delCGG	3.37:g.150480458_150480460delCCG	ENSP00000322457:p.Gly63del		O43270	In_Frame_Del	DEL	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like,pfscan_Znf_RING,pfscan_Znf_SIAH	p.G63in_frame_del	ENST00000312960.3	37	c.188_186	CCDS3152.1	3																																																																																				SIAH2	-	NULL		0.764	SIAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAH2	HGNC	protein_coding	OTTHUMT00000357697.1	0	0	0	18	18	4	0.00	0.00	CCG	NM_005067		150480451	-1	2	0	15	3	tier1	no_errors	ENST00000312960	ensembl	human	known	74_37	in_frame_del	11.76	0.00	DEL	1.000:1.000:0.993	-	2	15
SLC2A6	11182	genome.wustl.edu	37	9	136340690	136340690	+	Silent	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr9:136340690C>T	ENST00000371899.4	-	5	683	c.606G>A	c.(604-606)gcG>gcA	p.A202A	SLC2A6_ENST00000485978.1_5'UTR|SLC2A6_ENST00000371897.4_Silent_p.A202A	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	202					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		TGAGCACAGGCGCCTCCCCGG	0.711													ENSG00000160326																																					0													13.0	15.0	14.0					9																	136340690		2189	4290	6479	SO:0001819	synonymous_variant	0			-	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.606G>A	9.37:g.136340690C>T			A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.A202	ENST00000371899.4	37	c.606	CCDS6975.1	9																																																																																			-	SLC2A6	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.711	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A6	HGNC	protein_coding	OTTHUMT00000054909.1	0	0	0	31	31	3	0.00	0.00	C	NM_017585		136340690	-1	7	0	21	0	tier1	no_errors	ENST00000371899	ensembl	human	known	74_37	silent	25.00	0.00	SNP	0.998	T	7	21
SOX1	6656	genome.wustl.edu	37	13	112722436	112722441	+	In_Frame_Del	DEL	TGGGCG	TGGGCG	-	rs554658976	byFrequency	TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	TGGGCG	TGGGCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr13:112722436_112722441delTGGGCG	ENST00000330949.1	+	1	524_529	c.464_469delTGGGCG	c.(463-471)atgggcgtg>atg	p.GV160del		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	160					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		gcTGTGGCCATGGGCGTGGGCGTGGG	0.786													ENSG00000182968		537	0.107228	0.1195	0.0692	5008	,	,		2991	0.0794		0.0895	False		,,,				2504	0.1646																0										29,551		13,3,274						-1.0	1.0			2	50,1202		20,10,596	no	coding	SOX1	NM_005986.2		33,13,870	A1A1,A1R,RR		3.9936,5.0,4.3122				79,1753				SO:0001651	inframe_deletion	0					CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.464_469delTGGGCG	13.37:g.112722442_112722447delTGGGCG	ENSP00000330218:p.Gly160_Val161del		Q5W0Q1	In_Frame_Del	DEL	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.VG159in_frame_del	ENST00000330949.1	37	c.464_469	CCDS9523.1	13																																																																																				SOX1	-	pfam_TF_SOX		0.786	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX1	HGNC	protein_coding	OTTHUMT00000045817.3	0	0	0	1	1	1	0.00	0.00	TGGGCG	NM_005986		112722441	+1	0	0	0	0	tier1	no_errors	ENST00000330949	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.985:0.996:1.000:1.000:0.975:0.961	-	0	0
C14orf180	400258	genome.wustl.edu	37	14	105055119	105055127	+	Stop_Codon_Del	DEL	GACGGGCAG	GACGGGCAG	-	rs111285011|rs569942489|rs11278058	byFrequency	TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	GACGGGCAG	GACGGGCAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr14:105055119_105055127delGACGGGCAG	ENST00000557649.1	+	0	818_826				C14orf180_ENST00000331952.2_In_Frame_Del_p.TGR153del|RP11-614O9.1_ENST00000556073.1_RNA|C14orf180_ENST00000410013.1_Stop_Codon_Del			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		CTGCGGCTCTgacgggcaggacgggcagg	0.718													ENSG00000184601		3012	0.601438	0.8079	0.6095	5008	,	,		14598	0.6954		0.4235	False		,,,				2504	0.4029																0										1070,740		494,82,329						3.0	0.1		dbSNP_132	3	1279,3127		502,275,1426	no	coding	C14orf180	NM_001008404.1		996,357,1755	A1A1,A1R,RR		29.0286,40.884,37.7896				2349,3867				SO:0001567	stop_retained_variant	0					CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	Exception_encountered	14.37:g.105055128_105055136delGACGGGCAG				Frame_Shift_Del	DEL	NULL	p.*161fs	ENST00000557649.1	37	c.482_483	CCDS32166.1	14																																																																																				C14orf180	-	NULL		0.718	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C14orf180	HGNC	protein_coding	OTTHUMT00000410580.1	0	0	0	2	2	2	0.00	0.00	GACGGGCAG	NM_001008404		105055127	+1	2	2	0	0	tier1	no_errors	ENST00000410013	ensembl	human	known	74_37	frame_shift_del	100.00	100.00	DEL	0.046:0.035	-	2	0
MGAM	8972	genome.wustl.edu	37	7	141781869	141781869	+	Intron	SNP	C	C	T			TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr7:141781869C>T	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Silent_p.T2010T	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTGGCTTCACCTTCAATGACA	0.488													ENSG00000257335																																					0																																										SO:0001627	intron_variant	0			-	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-12551C>T	7.37:g.141781869C>T			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.T2010	ENST00000549489.2	37	c.6030	CCDS47727.1	7																																																																																			-	MGAM	-	superfamily_Gal_mutarotase_SF_dom		0.488	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	0	0	0	92	92	60	0.00	0.00	C			141781869	+1	7	2	71	58	tier1	no_errors	ENST00000475668	ensembl	human	putative	74_37	silent	8.97	3.33	SNP	1.000	T	7	71
TGFBR2	7048	genome.wustl.edu	37	3	30691872	30691872	+	Frame_Shift_Del	DEL	A	A	-	rs79375991		TCGA-DX-A3UF-01A-11D-A307-09	TCGA-DX-A3UF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	99ba1406-c89a-4509-927c-fc73304b5297	f6892671-6102-40e1-9d38-656a40b10c76	g.chr3:30691872delA	ENST00000295754.5	+	3	756	c.374delA	c.(373-375)gaafs	p.E125fs	TGFBR2_ENST00000359013.4_Frame_Shift_Del_p.E150fs	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	125					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.?(1)|p.P129fs*3(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						ATTATGAAGGAAAAAAAAAAG	0.423													ENSG00000163513																																					2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|skin(1)											89.0	92.0	91.0					3																	30691872		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.374delA	3.37:g.30691872delA	ENSP00000295754:p.Glu125fs		B4DTV5|Q15580|Q6DKT6|Q99474	Frame_Shift_Del	DEL	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.K153fs	ENST00000295754.5	37	c.449	CCDS2648.1	3																																																																																				TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,prints_TGFB_receptor		0.423	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	0	0	0	77	77	50	0.00	0.00	A			30691872	+1	7	3	53	63	tier1	no_errors	ENST00000359013	ensembl	human	known	74_37	frame_shift_del	11.67	4.55	DEL	1.000	-	7	53
