#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
MYO3A	53904	genome.wustl.edu	37	10	26310463	26310463	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr10:26310463C>T	ENST00000265944.5	+	8	783	c.617C>T	c.(616-618)aCt>aTt	p.T206I	MYO3A_ENST00000543632.1_Missense_Mutation_p.T206I|MYO3A_ENST00000376302.1_Missense_Mutation_p.T206I	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	206	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TTGGATACCACTTATGACGCC	0.443													ENSG00000095777																																					0													196.0	166.0	176.0					10																	26310463		2203	4300	6503	SO:0001583	missense	0			-	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.617C>T	10.37:g.26310463C>T	ENSP00000265944:p.Thr206Ile		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.T206I	ENST00000265944.5	37	c.617	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555042	0.86231	.	.	ENSG00000095777	ENST00000265944;ENST00000376302;ENST00000543632	T;T;T	0.66099	-0.19;-0.19;-0.19	6.03	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.187775	0.56097	D	0.000032	T	0.56062	0.1960	N	0.16266	0.395	0.53688	D	0.99997	P;P;P;B	0.46064	0.551;0.606;0.872;0.431	B;B;P;B	0.48524	0.178;0.272;0.58;0.234	T	0.62062	-0.6933	10	0.72032	D	0.01	.	16.1309	0.81436	0.1341:0.8659:0.0:0.0	.	206;206;206;206	F5H0U9;Q0VD65;Q8NEV4;Q4G0X2	.;.;MYO3A_HUMAN;.	I	206	ENSP00000265944:T206I;ENSP00000365479:T206I;ENSP00000445909:T206I	ENSP00000265944:T206I	T	+	2	0	MYO3A	26350469	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	4.023000	0.57211	2.861000	0.98227	0.655000	0.94253	ACT	-	MYO3A	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.443	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	0	0	0	43	43	136	0.00	0.00	C	NM_017433		26310463	+1	32	51	18	91	tier1	no_errors	ENST00000265944	ensembl	human	known	74_37	missense	64.00	35.92	SNP	1.000	T	32	18
DNAH3	55567	genome.wustl.edu	37	16	21108691	21108691	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr16:21108691C>G	ENST00000261383.3	-	18	2649	c.2650G>C	c.(2650-2652)Gag>Cag	p.E884Q	DNAH3_ENST00000415178.1_Missense_Mutation_p.E884Q	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	884	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		ATCCATTCCTCTGACTTGATG	0.478													ENSG00000158486																																					0													219.0	174.0	189.0					16																	21108691		2201	4300	6501	SO:0001583	missense	0			-	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.2650G>C	16.37:g.21108691C>G	ENSP00000261383:p.Glu884Gln		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.E884Q	ENST00000261383.3	37	c.2650	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	13.25	2.179988	0.38511	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.61510	0.1;0.1	5.26	5.26	0.73747	Dynein heavy chain, domain-2 (1);	0.064020	0.64402	D	0.000008	T	0.56292	0.1975	L	0.52011	1.625	0.58432	D	0.999999	P	0.41232	0.743	B	0.40506	0.331	T	0.56263	-0.8008	10	0.36615	T	0.2	.	18.824	0.92109	0.0:1.0:0.0:0.0	.	884	Q8TD57	DYH3_HUMAN	Q	884	ENSP00000261383:E884Q;ENSP00000394245:E884Q	ENSP00000261383:E884Q	E	-	1	0	DNAH3	21016192	0.999000	0.42202	0.959000	0.39883	0.185000	0.23345	4.572000	0.60886	2.627000	0.88993	0.650000	0.86243	GAG	-	DH3	-	pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase		0.478	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH3	HGNC	protein_coding	OTTHUMT00000207361.1	0	0	0	37	37	97	0.00	0.00	C	NM_017539		21108691	-1	14	34	24	57	tier1	no_errors	ENST00000261383	ensembl	human	known	74_37	missense	36.84	37.36	SNP	0.999	G	14	24
RASAL2	9462	genome.wustl.edu	37	1	178063820	178063820	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr1:178063820C>T	ENST00000367649.3	+	1	545	c.193C>T	c.(193-195)Cgg>Tgg	p.R65W	RASAL2-AS1_ENST00000421505.1_lincRNA|RASAL2_ENST00000448150.3_Missense_Mutation_p.R47W			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	0	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						GAGCTGGGTCCGGGTGTACGG	0.577													ENSG00000075391																																					0													46.0	38.0	41.0					1																	178063820		2203	4300	6503	SO:0001583	missense	0			-	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000367649.3:c.193C>T	1.37:g.178063820C>T	ENSP00000356621:p.Arg65Trp		F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.R65W	ENST00000367649.3	37	c.193	CCDS1321.2	1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344018	0.61073	.	.	ENSG00000075391	ENST00000448150;ENST00000367649	T;T	0.21543	2.03;2.0	4.53	4.53	0.55603	.	0.133249	0.32015	N	0.006717	T	0.26521	0.0648	L	0.36672	1.1	0.46521	D	0.999089	D	0.58620	0.983	P	0.51016	0.656	T	0.02156	-1.1204	10	0.62326	D	0.03	.	14.5484	0.68050	0.0:1.0:0.0:0.0	.	65	F8W755	.	W	47;65	ENSP00000407768:R47W;ENSP00000356621:R65W	ENSP00000356621:R65W	R	+	1	2	RASAL2	176330443	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.253000	0.58791	2.224000	0.72417	0.491000	0.48974	CGG	-	RASAL2	-	smart_Pleckstrin_homology		0.577	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000352415.1	0	0	0	34	34	72	0.00	0.00	C	NM_170692		178063820	+1	13	41	13	60	tier1	no_errors	ENST00000367649	ensembl	human	known	74_37	missense	50.00	40.59	SNP	1.000	T	13	13
TMEM132D	121256	genome.wustl.edu	37	12	129694177	129694177	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr12:129694177G>A	ENST00000422113.2	-	5	1657	c.1331C>T	c.(1330-1332)aCg>aTg	p.T444M	RP11-669N7.3_ENST00000542578.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	444					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CGTCTTCCCCGTGAGGATGGC	0.592													ENSG00000151952																																					0													93.0	74.0	80.0					12																	129694177		2203	4300	6503	SO:0001583	missense	0			-	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1331C>T	12.37:g.129694177G>A	ENSP00000408581:p.Thr444Met		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.T444M	ENST00000422113.2	37	c.1331	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499800	0.85176	.	.	ENSG00000151952	ENST00000422113	T	0.17691	2.26	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000002	T	0.47820	0.1466	M	0.88640	2.97	0.58432	D	0.999999	D	0.89917	1.0	D	0.74674	0.984	T	0.54873	-0.8228	9	.	.	.	-23.1339	14.6727	0.68956	0.0:0.0:0.8542:0.1458	.	444	Q14C87	T132D_HUMAN	M	444	ENSP00000408581:T444M	.	T	-	2	0	TMEM132D	128260130	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.321000	0.79088	2.446000	0.82766	0.655000	0.94253	ACG	-	TMEM132D	-	NULL		0.592	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	0	0	0	49	49	59	0.00	0.00	G	NM_133448		129694177	-1	17	24	26	42	tier1	no_errors	ENST00000422113	ensembl	human	known	74_37	missense	39.53	36.36	SNP	1.000	A	17	26
GSTA4	2941	genome.wustl.edu	37	6	52849261	52849261	+	Splice_Site	SNP	C	C	A			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr6:52849261C>A	ENST00000370959.1	-	5	532		c.e5+1		GSTA4_ENST00000486559.1_Splice_Site|GSTA4_ENST00000541324.1_Splice_Site|GSTA4_ENST00000370960.1_Splice_Site			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4						glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				Glutathione(DB00143)	CTGCCACCTACCTTTTCAAAC	0.418													ENSG00000170899																																					0													108.0	96.0	100.0					6																	52849261		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""			9480897	Standard	NM_001512		Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.414+1G>T	6.37:g.52849261C>A			B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	Splice_Site	SNP	-	e4+1	ENST00000370959.1	37	c.414+1	CCDS4948.1	6	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284616	0.80803	.	.	ENSG00000170899	ENST00000370963;ENST00000541324;ENST00000370960;ENST00000370959;ENST00000457564	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3562	0.90358	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GSTA4	52957220	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.088000	0.71371	2.507000	0.84556	0.557000	0.71058	.	-	GSTA4	-	-		0.418	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTA4	HGNC	protein_coding	OTTHUMT00000040946.1	0	0	0	208	208	173	0.00	0.00	C	NM_001512	Intron	52849261	-1	90	99	20	27	tier1	no_errors	ENST00000370959	ensembl	human	known	74_37	splice_site	81.82	78.57	SNP	1.000	A	90	20
F5	2153	genome.wustl.edu	37	1	169510957	169510957	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr1:169510957T>C	ENST00000367797.3	-	13	3572	c.3371A>G	c.(3370-3372)gAg>gGg	p.E1124G	F5_ENST00000367796.3_Missense_Mutation_p.E1129G	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1124	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	ATAGTGTTCCTCTGGGGGCAC	0.478													ENSG00000198734																																					0													151.0	155.0	154.0					1																	169510957		2203	4300	6503	SO:0001583	missense	0			-	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3371A>G	1.37:g.169510957T>C	ENSP00000356771:p.Glu1124Gly		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.E1124G	ENST00000367797.3	37	c.3371	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	T	10.84	1.462770	0.26248	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.22539	1.95;1.95	4.93	2.45	0.29901	.	0.694656	0.13436	N	0.388075	T	0.09335	0.0230	M	0.68952	2.095	0.25285	N	0.989405	B	0.12630	0.006	B	0.09377	0.004	T	0.07616	-1.0763	9	0.49607	T	0.09	-7.8335	6.5337	0.22341	0.0:0.0888:0.1556:0.7555	.	1124	P12259	FA5_HUMAN	G	1124;1129	ENSP00000356771:E1124G;ENSP00000356770:E1129G	ENSP00000356770:E1129G	E	-	2	0	F5	167777581	0.001000	0.12720	0.186000	0.23195	0.557000	0.35523	0.681000	0.25320	0.850000	0.35239	0.446000	0.29264	GAG	-	F5	-	NULL		0.478	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	0	0	0	105	105	124	0.00	0.00	T	NM_000130		169510957	-1	44	37	65	86	tier1	no_errors	ENST00000367797	ensembl	human	known	74_37	missense	40.37	30.08	SNP	0.277	C	44	65
SPPL2C	162540	genome.wustl.edu	37	17	43924079	43924079	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr17:43924079G>A	ENST00000329196.5	+	1	1824	c.1807G>A	c.(1807-1809)Ggc>Agc	p.G603S	MAPT-AS1_ENST00000579244.1_RNA|MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579599.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	603						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										TAGCTCCGAGGGCTGGAGTGA	0.572													ENSG00000185294																																					0													119.0	101.0	107.0					17																	43924079		2203	4300	6503	SO:0001583	missense	0			-		CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.1807G>A	17.37:g.43924079G>A	ENSP00000332488:p.Gly603Ser		Q8TC67|Q8WVZ6	Missense_Mutation	SNP	pfam_Peptidase_A22B_SPP,pfam_Protease-assoc_domain,smart_Preselin/SPP	p.G603S	ENST00000329196.5	37	c.1807	CCDS32673.1	17	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874324	0.51695	.	.	ENSG00000185294	ENST00000329196	T	0.10192	2.9	4.68	2.69	0.31865	.	0.154448	0.30302	N	0.009925	T	0.07458	0.0188	L	0.29908	0.895	0.30555	N	0.765105	B	0.27882	0.192	B	0.23150	0.044	T	0.09335	-1.0679	10	0.62326	D	0.03	-41.243	7.1956	0.25851	0.2007:0.0:0.7993:0.0	.	603	Q8IUH8	IMP5_HUMAN	S	603	ENSP00000332488:G603S	ENSP00000332488:G603S	G	+	1	0	AC217771.1	41279859	1.000000	0.71417	0.999000	0.59377	0.245000	0.25701	4.109000	0.57824	0.684000	0.31448	0.655000	0.94253	GGC	-	SPPL2C	-	NULL		0.572	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2C	HGNC	protein_coding	OTTHUMT00000441156.1	0	0	0	32	32	71	0.00	0.00	G	NM_175882		43924079	+1	7	31	21	66	tier1	no_errors	ENST00000329196	ensembl	human	known	74_37	missense	25.00	31.63	SNP	1.000	A	7	21
CCDC7	79741	genome.wustl.edu	37	10	33140795	33140795	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr10:33140795C>T	ENST00000375030.2	+	21	2180	c.1562C>T	c.(1561-1563)aCa>aTa	p.T521I	C10orf68_ENST00000375025.4_Missense_Mutation_p.T626I|C10orf68_ENST00000375028.3_Missense_Mutation_p.T566I			Q9H943	CJ068_HUMAN		562										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						ATTTATAGAACATATAGGGCT	0.343													ENSG00000150076																																					0													135.0	147.0	143.0					10																	33140795		2203	4299	6502	SO:0001583	missense	0			-																												ENST00000375030.2:c.1562C>T	10.37:g.33140795C>T	ENSP00000364170:p.Thr521Ile		B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	NULL	p.T626I	ENST00000375030.2	37	c.1877		10	.	.	.	.	.	.	.	.	.	.	.	7.400	0.632497	0.14322	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.28895	1.61;1.6;1.59;1.59	3.17	-2.98	0.05513	.	.	.	.	.	T	0.17746	0.0426	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.25667	0.012;0.131;0.131;0.021	B;B;B;B	0.22601	0.007;0.027;0.04;0.016	T	0.29792	-1.0000	9	0.66056	D	0.02	.	0.6371	0.00804	0.1743:0.2598:0.1723:0.3936	.	543;562;566;521	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	I	562;521;566;626;538	ENSP00000303710:T562I;ENSP00000364170:T521I;ENSP00000364168:T566I;ENSP00000364165:T626I	ENSP00000303710:T562I	T	+	2	0	C10orf68	33180801	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.859000	0.01657	-0.673000	0.05259	-0.143000	0.13931	ACA	-	C10orf68	-	NULL		0.343	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	0	0	1	43	43	154	0.00	0.64	C			33140795	+1	6	23	44	132	tier1	no_errors	ENST00000375025	ensembl	human	known	74_37	missense	12.00	14.84	SNP	0.000	T	6	44
FAM134A	79137	genome.wustl.edu	37	2	220045810	220045810	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr2:220045810G>T	ENST00000430297.2	+	6	803	c.667G>T	c.(667-669)Gtg>Ttg	p.V223L	CNPPD1_ENST00000409789.1_5'Flank	NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	223						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGGCCCCTGGTGGTTTATCA	0.522													ENSG00000144567																																					0													133.0	128.0	130.0					2																	220045810		2203	4300	6503	SO:0001583	missense	0			-	AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.667G>T	2.37:g.220045810G>T	ENSP00000395249:p.Val223Leu		Q6P1P5|Q9H0K7	Missense_Mutation	SNP	pfam_Reticulon	p.V223L	ENST00000430297.2	37	c.667	CCDS2434.1	2	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980531	0.92982	.	.	ENSG00000144567	ENST00000458520;ENST00000430297;ENST00000452022;ENST00000443518	T;T;T	0.41758	0.99;1.06;0.99	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.48040	0.1478	L	0.45698	1.435	0.80722	D	1	P;P	0.48230	0.907;0.711	P;P	0.50405	0.64;0.507	T	0.24083	-1.0170	10	0.19147	T	0.46	-17.3832	19.0001	0.92830	0.0:0.0:1.0:0.0	.	16;223	E7EUL4;Q8NC44	.;F134A_HUMAN	L	16;223;16;16	ENSP00000403898:V16L;ENSP00000395249:V223L;ENSP00000391284:V16L	ENSP00000395249:V223L	V	+	1	0	FAM134A	219754054	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.857000	0.99534	2.476000	0.83614	0.655000	0.94253	GTG	-	FAM134A	-	pfam_Reticulon		0.522	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM134A	HGNC	protein_coding	OTTHUMT00000336147.2	0	0	0	85	85	124	0.00	0.00	G	NM_024293		220045810	+1	30	50	38	74	tier1	no_errors	ENST00000430297	ensembl	human	known	74_37	missense	44.12	40.32	SNP	1.000	T	30	38
MIR200A	406983	genome.wustl.edu	37	1	1103249	1103249	+	lincRNA	SNP	C	C	T			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr1:1103249C>T	ENST00000606993.1	+	0	0				MIR200A_ENST00000384875.1_RNA|MIR429_ENST00000362106.1_RNA|MIR200B_ENST00000384997.1_RNA																							CCTCCCGGGCCCCTGTGAGCA	0.662													ENSG00000207607																																					0													22.0	25.0	24.0					1																	1103249		1556	3569	5125			0			-																													1.37:g.1103249C>T				R	SNP	-	NULL	ENST00000606993.1	37	NULL		1																																																																																			-	MIR200A	-	-		0.662	RP11-465B22.8-001	KNOWN	basic	lincRNA	MIR200A	HGNC	lincRNA	OTTHUMT00000470776.1	0	0	0	111	111	44	0.00	0.00	C			1103249	+1	60	20	9	2	tier1	no_errors	ENST00000384875	ensembl	human	known	74_37	rna	86.96	90.91	SNP	1.000	T	60	9
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	rs28934578	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	30	30	47	0.00	0.00	C	NM_000546		7578406	-1	17	31	2	8	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	89.47	79.49	SNP	1.000	T	17	2
FAM196B	100131897	genome.wustl.edu	37	5	169309787	169309787	+	Silent	SNP	A	A	G			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr5:169309787A>G	ENST00000377365.3	-	2	2497	c.1116T>C	c.(1114-1116)aaT>aaC	p.N372N	DOCK2_ENST00000520908.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000540750.1_Intron|DOCK2_ENST00000256935.8_Intron|DOCK2_ENST00000523351.1_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	372										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						TTCCTGGACAATTTGGAAACT	0.478													ENSG00000204767																																					0													106.0	90.0	95.0					5																	169309787		692	1591	2283	SO:0001819	synonymous_variant	0			-		CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.1116T>C	5.37:g.169309787A>G				Silent	SNP	NULL	p.N372	ENST00000377365.3	37	c.1116	CCDS47336.1	5																																																																																			-	FAM196B	-	NULL		0.478	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196B	HGNC	protein_coding	OTTHUMT00000371629.1	0	0	0	55	55	70	0.00	0.00	A	NM_001129891		169309787	-1	7	7	61	79	tier1	no_errors	ENST00000377365	ensembl	human	known	74_37	silent	10.29	8.14	SNP	0.000	G	7	61
SEH1L	81929	genome.wustl.edu	37	18	12986927	12986929	+	3'UTR	DEL	TCC	TCC	-			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	TCC	TCC	TCC	-	TCC	TCC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr18:12986927_12986929delTCC	ENST00000262124.11	+	0	2886_2888				RP11-773H22.4_ENST00000588211.1_RNA|SEH1L_ENST00000399892.2_In_Frame_Del_p.P385del	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)						attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						CCCAGCTCCTtcctcctcctcct	0.522													ENSG00000085415																																					0																																										SO:0001624	3_prime_UTR_variant	0				BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.*1678TCC>-	18.37:g.12986936_12986938delTCC			A8K5B1|Q8NFU6|Q96MH3|Q9C069	In_Frame_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P383in_frame_del	ENST00000262124.11	37	c.1137_1139	CCDS45832.1	18																																																																																				SEH1L	-	NULL		0.522	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEH1L	HGNC	protein_coding	OTTHUMT00000458254.1	0	0	0	25	25	59	0.00	0.00	TCC	NM_031216		12986929	+1	4	4	25	50	tier1	no_errors	ENST00000399892	ensembl	human	known	74_37	in_frame_del	13.79	7.41	DEL	0.997:1.000:1.000	-	4	25
TMED10	10972	genome.wustl.edu	37	14	75601711	75601712	+	Splice_Site	INS	-	-	A	rs200389497	byFrequency	TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr14:75601711_75601712insA	ENST00000303575.4	-	5	590		c.e5-2		RP11-950C14.7_ENST00000556236.1_RNA|TMED10_ENST00000557670.1_Splice_Site	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)						beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		TTGTTGACTCTAAAAAAAAACA	0.426													ENSG00000170348																																					0																																										SO:0001630	splice_region_variant	0				AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.539-2->T	14.37:g.75601720_75601720dupA			B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Splice_Site	INS	-	e5-2	ENST00000303575.4	37	c.539-3_539-2	CCDS9840.1	14																																																																																				TMED10	-	-		0.426	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1	0	0	1	38	38	70	0.00	1.41	-	NM_006827	Intron	75601712	-1	3	4	27	80	tier1	no_errors	ENST00000303575	ensembl	human	known	74_37	splice_site_ins	10.00	4.76	INS	1.000:0.961	A	3	27
TTLL5	23093	genome.wustl.edu	37	14	76420882	76420882	+	3'UTR	DEL	T	T	-			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr14:76420882delT	ENST00000298832.9	+	0	4144					NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTCCATAGTATTTTTTTTTTT	0.463													ENSG00000119685																																					0																																										SO:0001624	3_prime_UTR_variant	0				AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.*93T>-	14.37:g.76420882delT			B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	R	DEL	-	NULL	ENST00000298832.9	37	NULL	CCDS32124.1	14																																																																																				TTLL5	-	-		0.463	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	0	0	1	25	25	45	0.00	2.17	T	NM_015072		76420882	+1	4	11	33	55	tier1	no_errors	ENST00000554972	ensembl	human	known	74_37	rna	10.81	16.67	DEL	0.005	-	4	33
HLA-DRB1	3123	genome.wustl.edu	37	6	32548628	32548628	+	Missense_Mutation	SNP	G	G	A	rs34624872	byFrequency	TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr6:32548628G>A	ENST00000360004.5	-	4	763	c.658C>T	c.(658-660)Cgg>Tgg	p.R220W		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	220	Beta-2.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GATTCAGACCGTGCTCCTGAG	0.483										Multiple Myeloma(14;0.17)			ENSG00000196126																																					0													77.0	86.0	83.0					6																	32548628		1511	2709	4220	SO:0001583	missense	0			-	AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.658C>T	6.37:g.32548628G>A	ENSP00000353099:p.Arg220Trp		P01914|Q9MYF5	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R220W	ENST00000360004.5	37	c.658	CCDS47409.1	6	.	.	.	.	.	.	.	.	.	.	.	12.70	2.016010	0.35606	.	.	ENSG00000196126	ENST00000360004	T	0.00635	6.06	3.98	3.98	0.46160	Immunoglobulin-like fold (3);	0.849923	0.10912	N	0.620484	T	0.00580	0.0019	L	0.56769	1.78	0.24665	N	0.993446	B;B;D	0.71674	0.007;0.007;0.998	B;B;P	0.47430	0.0;0.001;0.547	T	0.53995	-0.8359	10	0.66056	D	0.02	.	10.0825	0.42399	0.0:0.2056:0.7944:0.0	rs34624872	220;220;220	P04229;Q29974;P01911	2B11_HUMAN;2B1G_HUMAN;2B1F_HUMAN	W	220	ENSP00000353099:R220W	ENSP00000353099:R220W	R	-	1	2	HLA-DRB1	32656606	0.013000	0.17824	0.747000	0.31113	0.149000	0.21700	1.804000	0.38873	1.943000	0.56356	0.453000	0.30009	CGG	rs34624872	HLA-DRB1	-	NULL		0.483	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	1	1	0	133	133	49	0.75	0.00	G	NM_002124		32548628	-1	9	0	35	9	tier1	no_errors	ENST00000360004	ensembl	human	known	74_37	missense	20.45	0.00	SNP	0.988	A	9	35
CES1P1	51716	genome.wustl.edu	37	16	55803899	55803899	+	RNA	SNP	G	G	A			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr16:55803899G>A	ENST00000571348.1	+	0	474					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										CACGGAGGGGGGCTGATGGTG	0.572													ENSG00000228695																																					0																																												0			-	AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55803899G>A			A2RRL8|B9ZVS2	R	SNP	-	NULL	ENST00000571348.1	37	NULL		16																																																																																			-	CES1P1	-	-		0.572	CES1P1-003	KNOWN	basic	processed_transcript	CES1P1	HGNC	pseudogene	OTTHUMT00000440035.1	0	0	0	14	14	0	0.00	0.00	G	NR_003276		55803899	+1	4	0	11	0	tier1	no_errors	ENST00000571348	ensembl	human	known	74_37	rna	26.67	0.00	SNP	0.860	A	4	11
AC023490.2	0	genome.wustl.edu	37	22	20378616	20378628	+	lincRNA	DEL	GGGATCCGGGGGT	GGGATCCGGGGGT	-			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	GGGATCCGGGGGT	GGGATCCGGGGGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr22:20378616_20378628delGGGATCCGGGGGT	ENST00000426653.1	+	0	666_678				AC023490.1_ENST00000438669.1_lincRNA																							ggaagggggcgggatccgggggtggggtgaggt	0.704													ENSG00000235704																																					0																																												0																																22.37:g.20378616_20378628delGGGATCCGGGGGT				R	DEL	-	NULL	ENST00000426653.1	37	NULL		22																																																																																				AC023490.2	-	-		0.704	AC023490.2-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000235704	Clone_based_vega_gene	lincRNA	OTTHUMT00000322210.1	0	0	0	0	0	0	0.00	0.00	GGGATCCGGGGGT			20378628	+1	0	0	0	0	tier1	no_errors	ENST00000426653	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.009:0.014:0.006:0.004:0.011:0.028:0.217:0.219:0.178:0.177:0.193:0.194:0.213	-	0	0
HES3	390992	genome.wustl.edu	37	1	6305511	6305511	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr1:6305511G>T	ENST00000377898.3	+	4	570	c.505G>T	c.(505-507)Ggg>Tgg	p.G169W		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	169	Pro-rich.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		CGAGAGTCCCGGGCTGGGCCT	0.697													ENSG00000173673																																					0													7.0	9.0	8.0					1																	6305511		1657	3748	5405	SO:0001583	missense	0			-		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.505G>T	1.37:g.6305511G>T	ENSP00000367130:p.Gly169Trp		Q5TGS0	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G169W	ENST00000377898.3	37	c.505	CCDS41238.1	1	.	.	.	.	.	.	.	.	.	.	G	15.85	2.955231	0.53293	.	.	ENSG00000173673	ENST00000377898	T	0.32753	1.44	2.9	1.95	0.26073	.	2.454950	0.02007	N	0.046722	T	0.39937	0.1097	N	0.19112	0.55	0.09310	N	1	D	0.76494	0.999	D	0.73708	0.981	T	0.30621	-0.9972	10	0.66056	D	0.02	-6.1494	5.1074	0.14790	0.1755:0.0:0.8245:0.0	.	169	Q5TGS1	HES3_HUMAN	W	169	ENSP00000367130:G169W	ENSP00000367130:G169W	G	+	1	0	HES3	6228098	0.250000	0.23951	0.008000	0.14137	0.326000	0.28443	1.472000	0.35376	0.766000	0.33244	0.289000	0.19496	GGG	-	HES3	-	NULL		0.697	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HES3	HGNC	protein_coding	OTTHUMT00000003716.3	0	0	0	80	80	3	0.00	0.00	G	NM_001024598		6305511	+1	4	0	29	2	tier1	no_errors	ENST00000377898	ensembl	human	known	74_37	missense	12.12	0.00	SNP	0.007	T	4	29
SDHAP1	255812	genome.wustl.edu	37	3	195687221	195687221	+	RNA	SNP	A	A	G	rs62282781		TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr3:195687221A>G	ENST00000427841.1	-	0	2325					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		gctggagcccaggaggtggag	0.522													ENSG00000185485																									Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			-	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195687221A>G				R	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			rs62282781	SDHAP1	-	-		0.522	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	0	0	0	14	14	3	0.00	0.00	A			195687221	-1	5	0	8	6	tier1	no_errors	ENST00000427149	ensembl	human	known	74_37	rna	38.46	0.00	SNP	0.009	G	5	8
TELO2	9894	genome.wustl.edu	37	16	1550652	1550652	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48J-01A-21D-A307-09	TCGA-DX-A48J-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c31d841a-1b54-4e64-bde0-e458668a7f88	130d56bf-7533-4fbc-bea1-bc8973a3b123	g.chr16:1550652G>T	ENST00000262319.6	+	9	1512	c.1233G>T	c.(1231-1233)gaG>gaT	p.E411D		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	411					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				TCGTGGCAGAGGTCGTTAGTG	0.697													ENSG00000100726																																					0													38.0	42.0	40.0					16																	1550652		2198	4299	6497	SO:0001583	missense	0			-	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1233G>T	16.37:g.1550652G>T	ENSP00000262319:p.Glu411Asp		D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	pfam_Telomere_length_regulation_dom,superfamily_ARM-type_fold	p.E411D	ENST00000262319.6	37	c.1233	CCDS32363.1	16	.	.	.	.	.	.	.	.	.	.	g	13.97	2.397211	0.42512	.	.	ENSG00000100726	ENST00000437914;ENST00000262319	D	0.84944	-1.92	4.79	-0.243	0.13035	.	0.047821	0.85682	N	0.000000	D	0.90373	0.6987	M	0.84326	2.69	0.43959	D	0.996638	D	0.89917	1.0	D	0.91635	0.999	D	0.86844	0.2019	10	0.44086	T	0.13	-28.9035	8.9679	0.35887	0.441:0.0:0.559:0.0	.	411	Q9Y4R8	TELO2_HUMAN	D	25;411	ENSP00000262319:E411D	ENSP00000262319:E411D	E	+	3	2	TELO2	1490653	1.000000	0.71417	0.193000	0.23327	0.007000	0.05969	1.465000	0.35299	-0.306000	0.08818	0.651000	0.88453	GAG	-	TELO2	-	NULL		0.697	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TELO2	HGNC	protein_coding	OTTHUMT00000103602.2	0	0	0	32	32	25	0.00	0.00	G	NM_016111		1550652	+1	4	2	22	34	tier1	no_errors	ENST00000262319	ensembl	human	known	74_37	missense	15.38	5.56	SNP	0.755	T	4	22
