#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PTCD1	26024	genome.wustl.edu	37	7	99022880	99022880	+	Silent	SNP	G	G	A	rs80070442	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr7:99022880G>A	ENST00000292478.4	-	6	1525	c.1275C>T	c.(1273-1275)gcC>gcT	p.A425A	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.A474A|PTCD1_ENST00000555673.1_Silent_p.A474A	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	425					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CTGCGGTGAGGGCTGCTGTGT	0.647													ENSG00000248919																																					0													101.0	100.0	101.0					7																	99022880		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1275C>T	7.37:g.99022880G>A			Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	pfam_Pentatricopeptide_repeat,pfam_F1F0-ATPsyn_F_prd,tigrfam_Pentatricopeptide_repeat	p.A474	ENST00000292478.4	37	c.1422	CCDS34691.1	7																																																																																			-	ATP5J2-PTCD1	-	NULL		0.647	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5J2-PTCD1	HGNC	protein_coding	OTTHUMT00000336391.1	0	0	0	22	22	47	0.00	0.00	G	NM_015545		99022880	-1	14	14	17	36	tier1	no_errors	ENST00000413834	ensembl	human	known	74_37	silent	45.16	28.00	SNP	0.000	A	14	17
TNFRSF9	3604	genome.wustl.edu	37	1	7995073	7995073	+	Splice_Site	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:7995073C>T	ENST00000377507.3	-	6	710	c.544G>A	c.(544-546)Gga>Aga	p.G182R		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	182					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCAGTTACCTGGCTCTCTC	0.537													ENSG00000049249																																					0													76.0	67.0	70.0					1																	7995073		2203	4300	6503	SO:0001630	splice_region_variant	0			-	L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.544+1G>A	1.37:g.7995073C>T				Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_9	p.G182R	ENST00000377507.3	37	c.544	CCDS92.1	1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081545	0.36758	.	.	ENSG00000049249	ENST00000377507	T	0.06687	3.27	4.59	2.63	0.31362	.	0.477271	0.21933	N	0.066988	T	0.06508	0.0167	L	0.38531	1.155	0.09310	N	1	B	0.18461	0.028	B	0.17433	0.018	T	0.37009	-0.9724	9	.	.	.	-7.2801	7.6105	0.28126	0.189:0.6287:0.1823:0.0	.	182	Q07011	TNR9_HUMAN	R	182	ENSP00000366729:G182R	.	G	-	1	0	TNFRSF9	7917660	0.001000	0.12720	0.001000	0.08648	0.399000	0.30720	0.600000	0.24104	0.619000	0.30197	0.455000	0.32223	GGA	-	TNFRSF9	-	NULL		0.537	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF9	HGNC	protein_coding	OTTHUMT00000003622.1	0	0	0	52	52	82	0.00	0.00	C		Missense_Mutation	7995073	-1	17	20	44	44	tier1	no_errors	ENST00000377507	ensembl	human	known	74_37	missense	27.87	31.25	SNP	0.003	T	17	44
C4orf33	132321	genome.wustl.edu	37	4	130030691	130030691	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr4:130030691C>T	ENST00000281146.5	+	5	1079	c.358C>T	c.(358-360)Ctc>Ttc	p.L120F	C4orf33_ENST00000425929.1_Missense_Mutation_p.L120F|C4orf33_ENST00000502887.1_Missense_Mutation_p.L120F	NM_173487.2	NP_775758.2	Q8N1A6	CD033_HUMAN	chromosome 4 open reading frame 33	120										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CAAAGCTTATCTCCCTTGGAG	0.358													ENSG00000151470																																					0													73.0	75.0	74.0					4																	130030691		2203	4300	6503	SO:0001583	missense	0			-	AK091022	CCDS3741.1	4q28.2	2008-02-05			ENSG00000151470	ENSG00000151470			27025	protein-coding gene	gene with protein product						12477932	Standard	NM_001099783		Approved	FLJ33703	uc010iod.3	Q8N1A6	OTTHUMG00000133347	ENST00000281146.5:c.358C>T	4.37:g.130030691C>T	ENSP00000281146:p.Leu120Phe		D3DNY2|Q6PJF3|Q8NBC5	Missense_Mutation	SNP	NULL	p.L120F	ENST00000281146.5	37	c.358	CCDS3741.1	4	.	.	.	.	.	.	.	.	.	.	C	19.73	3.881257	0.72294	.	.	ENSG00000151470	ENST00000281146;ENST00000502887;ENST00000425929	T;T;T	0.35789	1.29;1.29;1.29	5.61	3.86	0.44501	.	0.201130	0.44902	D	0.000403	T	0.51822	0.1697	M	0.73962	2.25	0.48696	D	0.999695	P;P	0.50369	0.934;0.934	P;P	0.53313	0.609;0.723	T	0.56667	-0.7941	10	0.66056	D	0.02	-42.7824	14.0962	0.65023	0.2735:0.7265:0.0:0.0	.	120;120	D6RIT3;Q8N1A6	.;CD033_HUMAN	F	120	ENSP00000281146:L120F;ENSP00000427406:L120F;ENSP00000401090:L120F	ENSP00000281146:L120F	L	+	1	0	C4orf33	130250141	0.372000	0.25064	0.799000	0.32177	0.936000	0.57629	0.344000	0.19962	0.689000	0.31550	0.655000	0.94253	CTC	-	C4orf33	-	NULL		0.358	C4orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf33	HGNC	protein_coding	OTTHUMT00000257177.2	0	0	0	45	45	121	0.00	0.00	C	NM_173487		130030691	+1	32	74	27	108	tier1	no_errors	ENST00000281146	ensembl	human	known	74_37	missense	54.24	40.66	SNP	0.981	T	32	27
GLUL	2752	genome.wustl.edu	37	1	182353691	182353691	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:182353691C>T	ENST00000331872.6	-	7	1511	c.971G>A	c.(970-972)cGc>cAc	p.R324H	GLUL_ENST00000417584.2_Missense_Mutation_p.R324H|GLUL_ENST00000311223.5_Missense_Mutation_p.R324H|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000339526.4_Missense_Mutation_p.R324H	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	324			R -> C (in CSGD; reduced glutamine synthetase activity). {ECO:0000269|PubMed:16267323}.		cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	CCGGGGAATGCGTATGCTGGC	0.552													ENSG00000135821																																					0													101.0	91.0	95.0					1																	182353691		2203	4300	6503	SO:0001583	missense	0			-	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.971G>A	1.37:g.182353691C>T	ENSP00000356537:p.Arg324His		Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	pfam_Gln_synth_cat_dom,pfam_Gln_synt_beta,superfamily_Gln_synt_beta	p.R324H	ENST00000331872.6	37	c.971	CCDS1344.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560314	0.86335	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	5.34	5.34	0.76211	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96664	0.8911	H	0.98351	4.21	0.80722	D	1	P	0.37466	0.596	B	0.34180	0.177	D	0.97664	1.0162	10	0.87932	D	0	-19.7213	17.5747	0.87946	0.0:1.0:0.0:0.0	.	324	P15104	GLNA_HUMAN	H	324	ENSP00000356537:R324H;ENSP00000307900:R324H;ENSP00000398320:R324H;ENSP00000344958:R324H	ENSP00000307900:R324H	R	-	2	0	GLUL	180620314	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.309000	0.78937	2.488000	0.83962	0.563000	0.77884	CGC	-	GLUL	-	pfam_Gln_synth_cat_dom		0.552	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	HGNC	protein_coding	OTTHUMT00000091043.1	0	0	0	32	32	29	0.00	0.00	C	NM_002065		182353691	-1	14	10	27	19	tier1	no_errors	ENST00000311223	ensembl	human	known	74_37	missense	34.15	34.48	SNP	1.000	T	14	27
PLEKHA8P1	51054	genome.wustl.edu	37	12	45567092	45567092	+	RNA	SNP	C	C	T	rs145353585	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr12:45567092C>T	ENST00000256692.5	-	0	1593					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ACGGTTAACGCGGCCACAAAA	0.502													ENSG00000134297																																					0								C		1,4405	2.1+/-5.4	0,1,2202	103.0	97.0	99.0			-0.7	0.0	12	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	intergenic				0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154			45567092	2,13004	2203	4300	6503			0			-	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567092C>T				R	SNP	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			rs145353585	PLEKHA8P1	-	-		0.502	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	HGNC	pseudogene	OTTHUMT00000404814.1	0	0	0	78	78	66	0.00	0.00	C	NR_037144		45567092	-1	13	10	83	41	tier1	no_errors	ENST00000256692	ensembl	human	known	74_37	rna	13.54	19.61	SNP	0.989	T	13	83
CXorf30	645090	genome.wustl.edu	37	X	36337408	36337408	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chrX:36337408C>T	ENST00000378657.4	+	11	1415	c.767C>T	c.(766-768)cCg>cTg	p.P256L		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	256										breast(1)|lung(2)|stomach(1)	4						TTTAGTTCTCCGAGTGAAATA	0.353													ENSG00000205081																																					0													192.0	145.0	159.0					X																	36337408		692	1591	2283	SO:0001583	missense	0			-		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.767C>T	X.37:g.36337408C>T	ENSP00000367926:p.Pro256Leu			Missense_Mutation	SNP	NULL	p.P256L	ENST00000378657.4	37	c.767	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	C	2.598	-0.293616	0.05568	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.21734	1.99;2.0	4.32	-1.17	0.09648	.	3.775070	0.00822	N	0.001597	T	0.08313	0.0207	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26608	-1.0098	10	0.25751	T	0.34	4.4714	8.3663	0.32389	0.0:0.309:0.0:0.691	.	256	A6PW82	CX030_HUMAN	L	541;256	ENSP00000367922:P541L;ENSP00000367926:P256L	ENSP00000367922:P541L	P	+	2	0	CXorf30	36247329	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.270000	0.18607	-0.394000	0.07727	-1.163000	0.01768	CCG	-	CXorf30	-	NULL		0.353	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding		0	0	0	31	31	42	0.00	0.00	C	NP_001092313		36337408	+1	22	27	18	10	tier1	no_errors	ENST00000378657	ensembl	human	known	74_37	missense	55.00	71.05	SNP	0.000	T	22	18
OPCML	4978	genome.wustl.edu	37	11	132307146	132307146	+	Missense_Mutation	SNP	C	C	T	rs372641813		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr11:132307146C>T	ENST00000331898.7	-	4	1212	c.634G>A	c.(634-636)Gat>Aat	p.D212N	OPCML_ENST00000524381.1_Missense_Mutation_p.D205N|OPCML_ENST00000541867.1_Missense_Mutation_p.D212N|OPCML_ENST00000374778.4_Missense_Mutation_p.D171N|OPCML_ENST00000529038.1_5'UTR	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	212	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TTCCGCACATCGGGCGCAGCG	0.537													ENSG00000183715																																					0								C	ASN/ASP,ASN/ASP	0,4402		0,0,2201	128.0	114.0	119.0		613,634	5.9	0.8	11		119	1,8593		0,1,4296	no	missense,missense	OPCML	NM_001012393.1,NM_002545.3	23,23	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	205/339,212/346	132307146	1,12995	2201	4297	6498	SO:0001583	missense	0			-	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.634G>A	11.37:g.132307146C>T	ENSP00000330862:p.Asp212Asn		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D212N	ENST00000331898.7	37	c.634	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558459	0.86231	0.0	1.16E-4	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.58940	0.32;0.3;1.14;1.14	5.95	5.95	0.96441	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.79816	0.4511	M	0.83118	2.625	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.998;0.996	T	0.80754	-0.1241	10	0.66056	D	0.02	-20.0948	19.9958	0.97383	0.0:1.0:0.0:0.0	.	212;205;211;212	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	N	212;205;171;179;212	ENSP00000330862:D212N;ENSP00000434750:D205N;ENSP00000363910:D171N;ENSP00000445496:D212N	ENSP00000330862:D212N	D	-	1	0	OPCML	131812356	1.000000	0.71417	0.803000	0.32268	0.233000	0.25261	7.487000	0.81328	2.825000	0.97269	0.655000	0.94253	GAT	-	OPCML	-	smart_Ig_sub,pfscan_Ig-like_dom		0.537	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	0	0	0	47	47	64	0.00	0.00	C	NM_001012393		132307146	-1	25	19	28	24	tier1	no_errors	ENST00000541867	ensembl	human	known	74_37	missense	47.17	44.19	SNP	1.000	T	25	28
PCDHA2	56146	genome.wustl.edu	37	5	140176057	140176057	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr5:140176057C>T	ENST00000526136.1	+	1	1508	c.1508C>T	c.(1507-1509)gCg>gTg	p.A503V	PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.A503V|PCDHA2_ENST00000520672.2_Missense_Mutation_p.A503V	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	503	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A503V(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGAGCGCGCGTTGTCGAGC	0.677													ENSG00000204969																																					2	Substitution - Missense(2)	kidney(2)											57.0	59.0	58.0					5																	140176057		2203	4299	6502	SO:0001583	missense	0			-	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1508C>T	5.37:g.140176057C>T	ENSP00000431748:p.Ala503Val		O75287|Q9BTV3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A503V	ENST00000526136.1	37	c.1508	CCDS54914.1	5	.	.	.	.	.	.	.	.	.	.	c	16.98	3.272519	0.59649	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.54071	0.66;0.59;0.63	3.88	1.98	0.26296	Cadherin (4);Cadherin-like (1);	0.970408	0.08372	U	0.955891	T	0.51856	0.1699	N	0.20610	0.595	0.09310	N	1	P;P;P	0.52692	0.955;0.869;0.955	P;P;P	0.56398	0.461;0.797;0.461	T	0.46303	-0.9201	10	0.66056	D	0.02	.	9.4268	0.38586	0.0:0.8211:0.0:0.1789	.	503;503;503	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	V	503	ENSP00000430584:A503V;ENSP00000367372:A503V;ENSP00000431748:A503V	ENSP00000367372:A503V	A	+	2	0	PCDHA2	140156241	0.000000	0.05858	0.963000	0.40424	0.959000	0.62525	0.232000	0.17891	0.219000	0.20840	0.644000	0.83932	GCG	-	PCDHA2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.677	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	0	0	0	163	163	1	0.00	0.00	C	NM_018905		140176057	+1	41	5	105	15	tier1	no_errors	ENST00000526136	ensembl	human	known	74_37	missense	27.52	25.00	SNP	0.132	T	41	105
TRIM16	10626	genome.wustl.edu	37	17	15554817	15554817	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr17:15554817G>A	ENST00000578237.1	-	6	962	c.107C>T	c.(106-108)tCa>tTa	p.S36L	TRIM16_ENST00000416464.2_Intron|RP11-640I15.1_ENST00000584540.1_RNA|TRIM16_ENST00000336708.7_Missense_Mutation_p.S36L|RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.S36L|TRIM16_ENST00000581224.1_Intron			O95361	TRI16_HUMAN	tripartite motif containing 16	36					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TGGGCTGGCTGACCCAGAATC	0.642													ENSG00000221926																																					0													74.0	79.0	77.0					17																	15554817		2203	4300	6503	SO:0001583	missense	0			-	AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.107C>T	17.37:g.15554817G>A	ENSP00000463188:p.Ser36Leu		Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,prints_Butyrophylin	p.S36L	ENST00000578237.1	37	c.107	CCDS11171.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	7.419|7.419	0.636415|0.636415	0.14386|0.14386	.|.	.|.	ENSG00000251537|ENSG00000221926	ENST00000455584|ENST00000336708	.|T	.|0.64618	.|-0.11	0.137|0.137	0.137|0.137	0.14787|0.14787	.|.	.|7.084450	.|0.01642	.|U	.|0.024100	.|T	.|0.66005	.|0.2746	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	1|1	.|B;P	.|0.48350	.|0.437;0.909	.|B;P	.|0.48704	.|0.098;0.587	.|T	.|0.53092	.|-0.8487	.|9	.|0.62326	.|D	.|0.03	.|.	.|.	.|.	.|.	.|.	.|36;50	.|O95361;Q59EB2	.|TRI16_HUMAN;.	X|L	51|36	.|ENSP00000338989:S36L	.|ENSP00000338989:S36L	Q|S	-|-	1|2	0|0	RP11-385D13.1|TRIM16	15495542|15495542	0.008000|0.008000	0.16893|0.16893	0.052000|0.052000	0.19188|0.19188	0.072000|0.072000	0.16883|0.16883	0.310000|0.310000	0.19356|0.19356	0.291000|0.291000	0.22468|0.22468	0.297000|0.297000	0.19635|0.19635	CAG|TCA	-	TRIM16	-	NULL		0.642	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM16	HGNC	protein_coding	OTTHUMT00000130700.2	0	0	0	29	29	39	0.00	0.00	G	NM_006470		15554817	-1	9	19	63	93	tier1	no_errors	ENST00000336708	ensembl	human	known	74_37	missense	12.50	16.96	SNP	0.049	A	9	63
RNF183	138065	genome.wustl.edu	37	9	116059948	116059948	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr9:116059948C>T	ENST00000478815.1	-	1	2097	c.517G>A	c.(517-519)Gtc>Atc	p.V173I	RNF183_ENST00000297894.5_Missense_Mutation_p.V173I|RNF183_ENST00000441031.3_Missense_Mutation_p.V173I|RNF183_ENST00000416588.2_Missense_Mutation_p.V173I|RNF183_ENST00000478493.1_5'Flank			Q96D59	RN183_HUMAN	ring finger protein 183	173						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			lung(1)|prostate(1)|skin(1)	3						AACAGAGTGACACTGAGGATG	0.522													ENSG00000165188																																					0													91.0	97.0	95.0					9																	116059948		2104	4213	6317	SO:0001583	missense	0			-		CCDS43866.1	9q32	2007-04-24			ENSG00000165188	ENSG00000165188		"""RING-type (C3HC4) zinc fingers"""	28721	protein-coding gene	gene with protein product						12477932	Standard	NM_145051		Approved	MGC4734	uc004bgz.3	Q96D59	OTTHUMG00000020520	ENST00000478815.1:c.517G>A	9.37:g.116059948C>T	ENSP00000419454:p.Val173Ile			Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.V173I	ENST00000478815.1	37	c.517	CCDS43866.1	9	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744958	0.30865	.	.	ENSG00000165188	ENST00000441031;ENST00000416588;ENST00000478815;ENST00000297894	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.09	3.26	0.37387	.	0.544492	0.17776	N	0.162409	T	0.12817	0.0311	L	0.29908	0.895	0.20307	N	0.999916	B	0.09022	0.002	B	0.06405	0.002	T	0.34129	-0.9841	10	0.08179	T	0.78	-16.8988	9.4541	0.38745	0.0:0.8277:0.0:0.1722	.	173	Q96D59	RN183_HUMAN	I	173	ENSP00000417176:V173I;ENSP00000420740:V173I;ENSP00000419454:V173I;ENSP00000417943:V173I	ENSP00000417943:V173I	V	-	1	0	RNF183	115099769	0.109000	0.22037	0.017000	0.16124	0.531000	0.34715	1.595000	0.36708	0.737000	0.32582	-0.258000	0.10820	GTC	-	RNF183	-	NULL		0.522	RNF183-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF183	HGNC	protein_coding	OTTHUMT00000356360.1	0	0	0	33	33	85	0.00	0.00	C	NM_145051		116059948	-1	19	29	30	86	tier1	no_errors	ENST00000297894	ensembl	human	known	74_37	missense	38.78	25.22	SNP	0.261	T	19	30
SIRT3	23410	genome.wustl.edu	37	11	233415	233415	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr11:233415G>A	ENST00000382743.4	-	2	503	c.401C>T	c.(400-402)gCc>gTc	p.A134V	SIRT3_ENST00000529382.1_5'UTR|SIRT3_ENST00000525319.1_Missense_Mutation_p.A53V|SIRT3_ENST00000524564.1_Intron|SIRT3_ENST00000528702.1_5'UTR|SIRT3_ENST00000532956.1_Missense_Mutation_p.A134V	NM_001017524.2|NM_012239.5	NP_001017524.1|NP_036371.1	Q9NTG7	SIR3_HUMAN	sirtuin 3	134	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				aerobic respiration (GO:0009060)|peptidyl-lysine deacetylation (GO:0034983)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)	membrane (GO:0016020)|mitochondrion (GO:0005739)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|zinc ion binding (GO:0008270)			endometrium(1)|lung(5)|urinary_tract(1)	7		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.66e-27)|Epithelial(43;2.02e-26)|OV - Ovarian serous cystadenocarcinoma(40;2.9e-21)|BRCA - Breast invasive adenocarcinoma(625;3.88e-05)|Lung(200;0.111)|LUSC - Lung squamous cell carcinoma(625;0.129)		GCAGGCTCTGGCCCGAATCAG	0.572													ENSG00000142082																																					0													85.0	74.0	78.0					11																	233415		2203	4300	6503	SO:0001583	missense	0			-	AF083108	CCDS7691.1, CCDS53590.1	11p15.5	2010-06-25	2010-06-25		ENSG00000142082	ENSG00000142082			14931	protein-coding gene	gene with protein product		604481	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 3"", ""sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)"""			10381378, 18215119	Standard	NM_012239		Approved	SIR2L3	uc001lok.4	Q9NTG7	OTTHUMG00000119074	ENST00000382743.4:c.401C>T	11.37:g.233415G>A	ENSP00000372191:p.Ala134Val		B7Z5U6|Q9Y6E8	Missense_Mutation	SNP	pfam_Sirtuin,pirsf_D-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom	p.A134V	ENST00000382743.4	37	c.401	CCDS7691.1	11	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081520	0.36758	.	.	ENSG00000142082	ENST00000382743;ENST00000525319;ENST00000532956	T;T;T	0.23552	2.2;1.9;2.2	4.38	2.47	0.30058	.	1.100240	0.07141	N	0.847264	T	0.24586	0.0596	M	0.62723	1.935	0.09310	N	0.999997	P;B;B;B	0.34864	0.473;0.42;0.184;0.039	B;B;B;B	0.28011	0.085;0.014;0.008;0.003	T	0.24404	-1.0161	10	0.51188	T	0.08	-1.7959	5.9599	0.19293	0.0937:0.0:0.4339:0.4723	.	134;134;53;134	E9PM75;B7Z7G4;E9PK80;Q9NTG7	.;.;.;SIRT3_HUMAN	V	134;53;134	ENSP00000372191:A134V;ENSP00000435464:A53V;ENSP00000433077:A134V	ENSP00000372191:A134V	A	-	2	0	SIRT3	223415	0.053000	0.20554	0.003000	0.11579	0.983000	0.72400	2.437000	0.44828	0.464000	0.27142	0.555000	0.69702	GCC	-	SIRT3	-	pirsf_D-dep_deAcase_SIR2_class_I,pfscan_Ssirtuin_cat_dom		0.572	SIRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT3	HGNC	protein_coding	OTTHUMT00000239288.3	0	0	0	18	18	59	0.00	0.00	G			233415	-1	9	9	18	37	tier1	no_errors	ENST00000382743	ensembl	human	known	74_37	missense	33.33	19.57	SNP	0.000	A	9	18
Z97352.1	0	genome.wustl.edu	37	6	130068891	130068891	+	RNA	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr6:130068891G>A	ENST00000390707.1	+	0	10																											CAttaggttggtgcaaaagta	0.373													ENSG00000211996																																					0																																												0			-																													6.37:g.130068891G>A				R	SNP	-	NULL	ENST00000390707.1	37	NULL		6																																																																																			-	Z97352.1	-	-		0.373	Z97352.1-201	NOVEL	basic	miRNA	ENSG00000211996	Clone_based_ensembl_gene	miRNA		0	0	0	38	38	63	0.00	0.00	G			130068891	+1	6	16	16	45	tier1	no_errors	ENST00000390707	ensembl	human	novel	74_37	rna	27.27	26.23	SNP	0.085	A	6	16
ZNF971P	100419895	genome.wustl.edu	37	16	34682224	34682224	+	RNA	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr16:34682224C>A	ENST00000568619.1	-	0	255																											AAATCAAAGGCTTTTTCACAT	0.383													ENSG00000214581																																					0																																												0			-																													16.37:g.34682224C>A				R	SNP	-	NULL	ENST00000568619.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	c	1.309	-0.602687	0.03744	.	.	ENSG00000214581	ENST00000398617	.	.	.	0.253	0.253	0.15551	.	.	.	.	.	T	0.37865	0.1019	.	.	.	.	.	.	.	.	.	.	.	.	T	0.45352	-0.9267	3	.	.	.	.	6.4222	0.21750	0.0:0.9998:0.0:2.0E-4	.	.	.	.	N	11	.	.	K	-	3	2	AC018558.1	34539725	0.000000	0.05858	0.010000	0.14722	0.010000	0.07245	-1.052000	0.03503	0.383000	0.24910	0.388000	0.25769	AAG	-	RP11-80F22.10	-	-		0.383	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	0	0	0	77	77	101	0.00	0.00	C			34682224	-1	23	24	69	64	tier1	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	25.00	27.27	SNP	0.136	A	23	69
CAPN8	388743	genome.wustl.edu	37	1	223716526	223716526	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:223716526G>T	ENST00000366872.5	-	19	1965	c.1966C>A	c.(1966-1968)Cta>Ata	p.L656I				A6NHC0	CAN8_HUMAN	calpain 8	678					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						AGGCTGAATAGTTCTAAAACA	0.488													ENSG00000203697																																					0													111.0	103.0	105.0					1																	223716526		692	1591	2283	SO:0001583	missense	0			-		CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1966C>A	1.37:g.223716526G>T	ENSP00000355837:p.Leu656Ile		B2RXL2	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L656I	ENST00000366872.5	37	c.1966		1	.	.	.	.	.	.	.	.	.	.	G	0.333	-0.954780	0.02285	.	.	ENSG00000203697	ENST00000430824;ENST00000366872	D;D	0.94497	-3.44;-3.44	4.8	1.57	0.23409	EF-hand-like domain (1);	0.233246	0.37261	N	0.002162	T	0.82047	0.4952	N	0.05441	-0.05	0.23751	N	0.996943	B	0.09022	0.002	B	0.06405	0.002	T	0.67389	-0.5683	10	0.09590	T	0.72	.	4.1826	0.10383	0.2189:0.0:0.4242:0.3568	.	678	A6NHC0	CAN8_HUMAN	I	131;656	ENSP00000390294:L131I;ENSP00000355837:L656I	ENSP00000355837:L656I	L	-	1	2	CAPN8	221783149	0.151000	0.22747	0.744000	0.31058	0.016000	0.09150	-0.458000	0.06737	0.120000	0.18254	-0.143000	0.13931	CTA	-	CAPN8	-	NULL		0.488	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	HGNC	protein_coding		0	0	1	57	57	90	0.00	1.10	G	NM_001143962		223716526	-1	24	13	40	67	tier1	no_errors	ENST00000366872	ensembl	human	known	74_37	missense	37.50	16.25	SNP	0.998	T	24	40
ZNF391	346157	genome.wustl.edu	37	6	27368642	27368642	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr6:27368642T>C	ENST00000244576.4	+	3	1038	c.493T>C	c.(493-495)Tat>Cat	p.Y165H		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						AGAGAAACCTTATGAATGCAA	0.393													ENSG00000124613																																					0													84.0	91.0	89.0					6																	27368642		2198	4298	6496	SO:0001583	missense	0			-	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.493T>C	6.37:g.27368642T>C	ENSP00000244576:p.Tyr165His		B4DH77	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y165H	ENST00000244576.4	37	c.493	CCDS43429.1	6	.	.	.	.	.	.	.	.	.	.	T	20.8	4.045665	0.75846	.	.	ENSG00000124613	ENST00000244576	T	0.21734	1.99	4.01	4.01	0.46588	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19765	0.0475	L	0.28400	0.85	0.25604	N	0.986567	D	0.89917	1.0	D	0.97110	1.0	T	0.06734	-1.0810	9	0.66056	D	0.02	.	10.8976	0.47031	0.0:0.0:0.0:1.0	.	165	Q9UJN7	ZN391_HUMAN	H	165	ENSP00000244576:Y165H	ENSP00000244576:Y165H	Y	+	1	0	ZNF391	27476621	0.305000	0.24481	0.990000	0.47175	0.986000	0.74619	3.892000	0.56235	1.440000	0.47531	0.460000	0.39030	TAT	-	ZNF391	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF391	HGNC	protein_coding	OTTHUMT00000040145.2	0	0	0	25	25	61	0.00	0.00	T	NM_001076781		27368642	+1	9	12	20	34	tier1	no_errors	ENST00000244576	ensembl	human	known	74_37	missense	31.03	26.09	SNP	0.906	C	9	20
TLR2	7097	genome.wustl.edu	37	4	154626356	154626356	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr4:154626356T>C	ENST00000260010.6	+	1	3705	c.2297T>C	c.(2296-2298)aTg>aCg	p.M766T		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	766	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	GAGTGGCCCATGGACGAGGCT	0.478													ENSG00000137462																																					0													68.0	72.0	71.0					4																	154626356		2201	4300	6501	SO:0001583	missense	0			-	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.2297T>C	4.37:g.154626356T>C	ENSP00000260010:p.Met766Thr		B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.M766T	ENST00000260010.6	37	c.2297	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	T	3.005	-0.205078	0.06180	.	.	ENSG00000137462	ENST00000260010	T	0.20598	2.06	5.63	-6.7	0.01766	Toll/interleukin-1 receptor homology (TIR) domain (4);	2.979670	0.01204	N	0.007661	T	0.04003	0.0112	N	0.00446	-1.495	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28038	-1.0056	10	0.12766	T	0.61	.	1.6857	0.02841	0.1572:0.2618:0.3076:0.2733	.	766	O60603	TLR2_HUMAN	T	766	ENSP00000260010:M766T	ENSP00000260010:M766T	M	+	2	0	TLR2	154845806	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.133000	0.01308	-1.122000	0.02945	-1.064000	0.02280	ATG	-	TLR2	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom		0.478	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	HGNC	protein_coding	OTTHUMT00000365205.1	0	0	0	43	43	123	0.00	0.00	T			154626356	+1	18	47	18	76	tier1	no_errors	ENST00000260010	ensembl	human	known	74_37	missense	50.00	38.21	SNP	0.000	C	18	18
MAP2K7	5609	genome.wustl.edu	37	19	7976147	7976147	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr19:7976147G>A	ENST00000397979.3	+	8	922	c.868G>A	c.(868-870)Gac>Aac	p.D290N	MAP2K7_ENST00000397981.3_Missense_Mutation_p.D290N|CTD-3193O13.13_ENST00000595655.1_RNA|MAP2K7_ENST00000545011.1_Missense_Mutation_p.D332N|MAP2K7_ENST00000397983.3_Missense_Mutation_p.D306N	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	290	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						CGAGCGCATTGACCCCCCAGA	0.701													ENSG00000076984																																					0													33.0	38.0	36.0					19																	7976147		1872	4089	5961	SO:0001583	missense	0			-	AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.868G>A	19.37:g.7976147G>A	ENSP00000381066:p.Asp290Asn		B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D332N	ENST00000397979.3	37	c.994	CCDS42491.1	19	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453583	0.63290	.	.	ENSG00000076984	ENST00000397981;ENST00000397983;ENST00000545011;ENST00000425613;ENST00000397979	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.67	4.57	0.56435	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.38188	0.1031	N	0.04787	-0.16	0.58432	D	0.999997	B;P	0.36144	0.198;0.539	B;B	0.29942	0.049;0.109	T	0.43228	-0.9404	10	0.42905	T	0.14	-11.1265	14.1594	0.65436	0.0:0.1511:0.8489:0.0	.	290;290	O14733-4;O14733	.;MP2K7_HUMAN	N	290;306;332;306;290	ENSP00000381068:D290N;ENSP00000381070:D306N;ENSP00000443946:D332N;ENSP00000381066:D290N	ENSP00000381066:D290N	D	+	1	0	MAP2K7	7882147	1.000000	0.71417	0.869000	0.34112	0.868000	0.49771	7.566000	0.82347	2.836000	0.97738	0.655000	0.94253	GAC	-	MAP2K7	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.701	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	MAP2K7	HGNC	protein_coding	OTTHUMT00000267980.1	0	0	0	22	22	34	0.00	0.00	G			7976147	+1	9	10	33	48	tier1	no_errors	ENST00000545011	ensembl	human	known	74_37	missense	21.43	17.24	SNP	0.999	A	9	33
TEX37	200523	genome.wustl.edu	37	2	88828633	88828633	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr2:88828633C>T	ENST00000303254.3	+	4	326	c.184C>T	c.(184-186)Ccc>Tcc	p.P62S		NM_152670.2	NP_689883.1	Q96LM6	TEX37_HUMAN	testis expressed 37	62						nucleus (GO:0005634)											TAACCCCAACCCCAAGCTAAC	0.532													ENSG00000172073																																					0													94.0	89.0	91.0					2																	88828633		2203	4300	6503	SO:0001583	missense	0			-	AK058098	CCDS2003.1	2p11.2	2014-01-28	2012-09-14	2012-09-14	ENSG00000172073	ENSG00000172073			26341	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 21kDa"""		"""chromosome 2 open reading frame 51"""	C2orf51		17091336	Standard	NM_152670		Approved	FLJ25369, TSC21	uc002stb.2	Q96LM6	OTTHUMG00000130332	ENST00000303254.3:c.184C>T	2.37:g.88828633C>T	ENSP00000307142:p.Pro62Ser			Missense_Mutation	SNP	NULL	p.P62S	ENST00000303254.3	37	c.184	CCDS2003.1	2	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839903	0.51057	.	.	ENSG00000172073	ENST00000303254	T	0.59224	0.28	4.61	3.73	0.42828	.	0.000000	0.47852	D	0.000205	T	0.61590	0.2359	L	0.36672	1.1	0.35693	D	0.815038	D	0.69078	0.997	D	0.69307	0.963	T	0.68969	-0.5269	10	0.87932	D	0	-23.0829	7.9692	0.30117	0.0:0.8915:0.0:0.1085	.	62	Q96LM6	TSC21_HUMAN	S	62	ENSP00000307142:P62S	ENSP00000307142:P62S	P	+	1	0	C2orf51	88609748	0.927000	0.31430	1.000000	0.80357	0.380000	0.30137	1.788000	0.38714	2.561000	0.86390	0.462000	0.41574	CCC	-	TEX37	-	NULL		0.532	TEX37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX37	HGNC	protein_coding	OTTHUMT00000252682.1	0	0	0	38	38	131	0.00	0.00	C	NM_152670		88828633	+1	16	35	29	87	tier1	no_errors	ENST00000303254	ensembl	human	known	74_37	missense	34.78	28.69	SNP	0.987	T	16	29
SLC25A36	55186	genome.wustl.edu	37	3	140695202	140695207	+	In_Frame_Del	DEL	TCGTGG	TCGTGG	-	rs142389196		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	TCGTGG	TCGTGG	TCGTGG	-	TCGTGG	TCGTGG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr3:140695202_140695207delTCGTGG	ENST00000324194.6	+	7	1011_1016	c.843_848delTCGTGG	c.(841-849)tatcgtggt>tat	p.RG282del	SLC25A36_ENST00000453248.2_In_Frame_Del_p.RG256del|SLC25A36_ENST00000446041.2_In_Frame_Del_p.RG281del			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	282					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						GGTCTCTTTATCGTGGTCTGACAACT	0.408													ENSG00000114120																																					0																																										SO:0001651	inframe_deletion	0				AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.843_848delTCGTGG	3.37:g.140695202_140695207delTCGTGG	ENSP00000320688:p.Arg282_Gly283del		A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	In_Frame_Del	DEL	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Mit_uncoupling	p.RG282in_frame_del	ENST00000324194.6	37	c.843_848	CCDS46927.1	3																																																																																				SLC25A36	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.408	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A36	HGNC	protein_coding	OTTHUMT00000359929.1	0	0	0	90	90	90	0.00	0.00	TCGTGG	NM_018155		140695207	+1	22	22	35	35	tier1	no_errors	ENST00000324194	ensembl	human	known	74_37	in_frame_del	38.60	38.60	DEL	1.000:1.000:1.000:0.993:1.000:1.000	-	22	35
MYH7	4625	genome.wustl.edu	37	14	23884643	23884645	+	In_Frame_Del	DEL	CCT	CCT	-	rs149509691		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	CCT	CCT	CCT	-	CCT	CCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr14:23884643_23884645delCCT	ENST00000355349.3	-	36	5390_5392	c.5228_5230delAGG	c.(5227-5232)gaggca>gca	p.E1743del	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1743					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCCTGCACTGCCTCCTCCACTTC	0.586													ENSG00000092054																																					0																																										SO:0001651	inframe_deletion	0				M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5228_5230delAGG	14.37:g.23884646_23884648delCCT	ENSP00000347507:p.Glu1743del		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	In_Frame_Del	DEL	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1743in_frame_del	ENST00000355349.3	37	c.5230_5228	CCDS9601.1	14																																																																																				MYH7	-	pfam_Myosin_tail		0.586	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	0	0	0	55	55	97	0.00	0.00	CCT	NM_000257		23884645	-1	14	17	45	62	tier1	no_errors	ENST00000355349	ensembl	human	known	74_37	in_frame_del	23.73	21.52	DEL	1.000:0.995:1.000	-	14	45
RBM8A	9939	genome.wustl.edu	37	1	145508402	145508415	+	Intron	DEL	CTCACTCTATTCCT	CTCACTCTATTCCT	-	rs587653214		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	CTCACTCTATTCCT	CTCACTCTATTCCT	CTCACTCTATTCCT	-	CTCACTCTATTCCT	CTCACTCTATTCCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr1:145508402_145508415delCTCACTCTATTCCT	ENST00000330165.8	+	4	274				RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000447686.2_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000596355.1_RNA|RBM8A_ENST00000369307.3_Intron|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGAGTCCGCACTCACTCTATTCCTGTGAGCCTGC	0.453													ENSG00000234222																																					0																																										SO:0001627	intron_variant	0				AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.206-60CTCACTCTATTCCT>-	1.37:g.145508402_145508415delCTCACTCTATTCCT			B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	Splice_Site	DEL	-	NULL	ENST00000330165.8	37	c.NULL	CCDS916.1	1																																																																																				RP11-315I20.1	-	-		0.453	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000234222	Clone_based_vega_gene	protein_coding	OTTHUMT00000038503.2	0	0	0	108	108	108	0.00	0.00	CTCACTCTATTCCT	NM_005105		145508415	-1	9	9	81	81	tier1	no_errors	ENST00000596355	ensembl	human	known	74_37	splice_site_del	10.00	10.00	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-	9	81
PYCR1	5831	genome.wustl.edu	37	17	79894067	79894067	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr17:79894067C>T	ENST00000329875.8	-	2	134	c.70G>A	c.(70-72)Gtc>Atc	p.V24I	PYCR1_ENST00000577756.1_Missense_Mutation_p.V24I|PYCR1_ENST00000337943.5_Missense_Mutation_p.V24I|PYCR1_ENST00000403172.4_Missense_Mutation_p.V24I|PYCR1_ENST00000402252.2_Missense_Mutation_p.V51I	NM_001282280.1|NM_001282281.1|NM_006907.2	NP_001269209.1|NP_001269210.1|NP_008838.2	P32322	P5CR1_HUMAN	pyrroline-5-carboxylate reductase 1	24					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to oxidative stress (GO:0034599)|L-proline biosynthetic process (GO:0055129)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|proline biosynthetic process (GO:0006561)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|pyrroline-5-carboxylate reductase activity (GO:0004735)			endometrium(2)|kidney(1)|lung(1)|prostate(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		L-Proline(DB00172)	GCAGCCAAGACGCCTGAGGGG	0.507													ENSG00000183010																																					0													94.0	90.0	91.0					17																	79894067		2203	4300	6503	SO:0001583	missense	0			-		CCDS11794.1, CCDS11795.1, CCDS62365.1, CCDS62366.1	17q25.3	2013-09-23			ENSG00000183010	ENSG00000183010	1.5.1.2		9721	protein-coding gene	gene with protein product		179035				1730675	Standard	XM_005256381		Approved	P5C	uc002kcr.1	P32322	OTTHUMG00000178436	ENST00000329875.8:c.70G>A	17.37:g.79894067C>T	ENSP00000328858:p.Val24Ile		A6NFM2|B4DMU0|Q6FHI4|Q96DI6|Q9HBQ4	Missense_Mutation	SNP	pfam_G3P_DH_D-dep_N,superfamily_6-PGluconate_DH_C-like,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase	p.V24I	ENST00000329875.8	37	c.70	CCDS11795.1	17	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392175	0.25118	.	.	ENSG00000183010	ENST00000337943;ENST00000329875;ENST00000403172;ENST00000402252;ENST00000405481	T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06	4.25	-6.83	0.01693	NAD(P)-binding domain (1);	0.389040	0.25932	N	0.027364	T	0.40522	0.1120	L	0.31371	0.925	0.23950	N	0.996372	B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.0;0.0	B;B;B;B;B;B	0.18561	0.002;0.001;0.022;0.001;0.0;0.001	T	0.36504	-0.9745	10	0.10111	T	0.7	-4.8113	14.7019	0.69162	0.0:0.6743:0.0:0.3257	.	51;24;24;24;24;24	B4DMU0;E7D7X9;Q9HBQ4;P32322;E7D7Y0;A6NFM2	.;.;.;P5CR1_HUMAN;.;.	I	24;24;24;51;24	ENSP00000336579:V24I;ENSP00000328858:V24I;ENSP00000385483:V24I;ENSP00000384949:V51I;ENSP00000386002:V24I	ENSP00000328858:V24I	V	-	1	0	PYCR1	77487358	0.000000	0.05858	0.004000	0.12327	0.147000	0.21601	-0.463000	0.06696	-1.240000	0.02529	-1.267000	0.01435	GTC	-	PYCR1	-	pfam_G3P_DH_D-dep_N,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase		0.507	PYCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYCR1	HGNC	protein_coding	OTTHUMT00000441953.1	0	0	0	49	49	72	0.00	0.00	C			79894067	-1	13	4	60	56	tier1	no_errors	ENST00000329875	ensembl	human	known	74_37	missense	17.81	6.67	SNP	0.039	T	13	60
FAM118A	55007	genome.wustl.edu	37	22	45719209	45719209	+	Silent	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr22:45719209G>A	ENST00000216214.3	+	4	1035	c.201G>A	c.(199-201)gaG>gaA	p.E67E	FAM118A_ENST00000441876.2_Silent_p.E67E|FAM118A_ENST00000405673.1_Silent_p.E67E	NM_001104595.1	NP_001098065.1	Q9NWS6	F118A_HUMAN	family with sequence similarity 118, member A	67						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		AGCAGCTGGAGGTGCTGCACC	0.632													ENSG00000100376																																					0													58.0	57.0	57.0					22																	45719209		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC013696	CCDS14065.1	22q13.3	2006-04-26	2006-04-26	2006-04-26	ENSG00000100376	ENSG00000100376			1313	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 8"""	C22orf8		12477932	Standard	NM_001104595		Approved	FLJ20635, bK268H5.C22.4	uc003bga.4	Q9NWS6	OTTHUMG00000151338	ENST00000216214.3:c.201G>A	22.37:g.45719209G>A			B3KWG4|B4DY02|Q5TII5|Q96CY3	Silent	SNP	superfamily_RNaseH-like_dom	p.E67	ENST00000216214.3	37	c.201	CCDS14065.1	22																																																																																			-	FAM118A	-	NULL		0.632	FAM118A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM118A	HGNC	protein_coding	OTTHUMT00000322260.1	0	0	0	19	19	32	0.00	0.00	G	NM_017911		45719209	+1	5	4	15	38	tier1	no_errors	ENST00000216214	ensembl	human	known	74_37	silent	25.00	9.52	SNP	1.000	A	5	15
SLC19A1	6573	genome.wustl.edu	37	21	46951687	46951687	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr21:46951687A>T	ENST00000311124.4	-	3	717	c.565T>A	c.(565-567)Tcg>Acg	p.S189T	SLC19A1_ENST00000485649.2_Missense_Mutation_p.S149T|SLC19A1_ENST00000567670.1_Missense_Mutation_p.S189T|SLC19A1_ENST00000380010.4_Missense_Mutation_p.S189T	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	189					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	AAGGCCAGCGAGATGTAGTTG	0.662													ENSG00000173638																																					0													75.0	56.0	62.0					21																	46951687		2201	4295	6496	SO:0001583	missense	0			-	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.565T>A	21.37:g.46951687A>T	ENSP00000308895:p.Ser189Thr		B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.S189T	ENST00000311124.4	37	c.565	CCDS13725.1	21	.	.	.	.	.	.	.	.	.	.	A	15.94	2.979726	0.53827	.	.	ENSG00000173638	ENST00000311124;ENST00000380010;ENST00000485649	D;D;D	0.89196	-2.48;-2.48;-2.48	4.78	2.21	0.28008	Major facilitator superfamily domain, general substrate transporter (1);	0.120243	0.64402	N	0.000019	D	0.90280	0.6960	L	0.49571	1.57	0.54753	D	0.999986	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.77004	0.989;0.984;0.984;0.984	D	0.85486	0.1182	10	0.22109	T	0.4	-25.0419	8.9947	0.36045	0.7047:0.0:0.0:0.2953	.	149;211;189;189	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	T	189;189;149	ENSP00000308895:S189T;ENSP00000369347:S189T;ENSP00000441772:S149T	ENSP00000308895:S189T	S	-	1	0	SLC19A1	45776115	1.000000	0.71417	0.759000	0.31340	0.961000	0.63080	6.623000	0.74238	0.230000	0.21059	0.254000	0.18369	TCG	-	SLC19A1	-	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier		0.662	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1	0	0	1	45	45	22	0.00	4.35	A			46951687	-1	18	13	30	51	tier1	no_errors	ENST00000311124	ensembl	human	known	74_37	missense	36.73	20.31	SNP	1.000	T	18	30
CELP	1057	genome.wustl.edu	37	9	135962585	135962586	+	RNA	INS	-	-	GCCCCATCCCCGCTACGGGTGACTCTGAGGCC	rs641386|rs372789499|rs143200085	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr9:135962585_135962586insGCCCCATCCCCGCTACGGGTGACTCTGAGGCC	ENST00000411440.2	+	0	1092_1093					NR_001275.2				carboxyl ester lipase pseudogene																		ACACTGAGGCTGCCCCTGTGTC	0.629													ENSG00000170827																																					0																																												0				L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962585_135962586insGCCCCATCCCCGCTACGGGTGACTCTGAGGCC				R	INS	-	NULL	ENST00000411440.2	37	NULL		9																																																																																				CELP	-	-		0.629	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	0	0	0	9	9	9	0.00	0.00	-	NM_001808		135962586	+1	1	1	5	5	tier1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	16.67	16.67	INS	0.130:0.000	GCCCCATCCCCGCTACGGGTGACTCTGAGGCC	1	5
EP400	57634	genome.wustl.edu	37	12	132547141	132547141	+	Silent	SNP	G	G	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr12:132547141G>A	ENST00000333577.4	+	48	8446	c.8337G>A	c.(8335-8337)caG>caA	p.Q2779Q	EP400_ENST00000332482.4_Silent_p.Q2706Q|EP400_ENST00000389562.2_Silent_p.Q2742Q|EP400_ENST00000330386.6_Silent_p.Q2662Q|EP400_ENST00000389561.2_Silent_p.Q2743Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2779	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2742Q(2)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacagcagcagcagc	0.597													ENSG00000183495																																					2	Substitution - coding silent(2)	kidney(2)											52.0	42.0	46.0					12																	132547141		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8337G>A	12.37:g.132547141G>A			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_D-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_D-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2779	ENST00000333577.4	37	c.8337		12																																																																																			-	EP400	-	NULL		0.597	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		0	0	0	22	22	5	0.00	0.00	G	NM_015409		132547141	+1	4	0	26	3	tier1	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	13.33	0.00	SNP	0.737	A	4	26
DUOXA2	405753	genome.wustl.edu	37	15	45409411	45409411	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr15:45409411C>T	ENST00000323030.5	+	5	962	c.677C>T	c.(676-678)tCc>tTc	p.S226F	DUOX2_ENST00000389039.6_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	226					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		GCCTTGGCCTCCATCTCTAGC	0.692													ENSG00000140274																																					0													19.0	21.0	20.0					15																	45409411		2053	4193	6246	SO:0001583	missense	0			-	BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.677C>T	15.37:g.45409411C>T	ENSP00000319705:p.Ser226Phe		B2RPI9|H0YNQ6	Missense_Mutation	SNP	pfam_Dual_oxidase_maturation_fac	p.S226F	ENST00000323030.5	37	c.677	CCDS10118.2	15	.	.	.	.	.	.	.	.	.	.	c	11.53	1.666706	0.29604	.	.	ENSG00000140274	ENST00000323030;ENST00000350243	T	0.56103	0.48	4.9	4.9	0.64082	.	0.364671	0.29537	N	0.011864	T	0.60805	0.2297	L	0.52011	1.625	0.41562	D	0.988635	D	0.53462	0.96	P	0.54965	0.765	T	0.61163	-0.7118	10	0.41790	T	0.15	-15.5902	15.57	0.76326	0.0:1.0:0.0:0.0	.	226	Q1HG44	DOXA2_HUMAN	F	226;181	ENSP00000319705:S226F	ENSP00000319705:S226F	S	+	2	0	DUOXA2	43196703	0.377000	0.25106	1.000000	0.80357	0.225000	0.24961	3.046000	0.49846	2.276000	0.75962	0.506000	0.49869	TCC	-	DUOXA2	-	pfam_Dual_oxidase_maturation_fac		0.692	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUOXA2	HGNC	protein_coding	OTTHUMT00000254142.1	0	0	0	25	25	2	0.00	0.00	C	NM_207581		45409411	+1	7	0	17	2	tier1	no_errors	ENST00000323030	ensembl	human	known	74_37	missense	29.17	0.00	SNP	0.995	T	7	17
HCN2	610	genome.wustl.edu	37	19	613914	613914	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr19:613914C>A	ENST00000251287.2	+	7	1941	c.1888C>A	c.(1888-1890)Ctc>Atc	p.L630I	AC005559.2_ENST00000591847.1_RNA	NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	630					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTACTGCCGCCTCTATTCGCT	0.687													ENSG00000099822																									Melanoma(145;1175 2427 8056 36306)												0													39.0	37.0	38.0					19																	613914		2199	4297	6496	SO:0001583	missense	0			-	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.1888C>A	19.37:g.613914C>A	ENSP00000251287:p.Leu630Ile		O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.L630I	ENST00000251287.2	37	c.1888	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	18.58	3.653895	0.67472	.	.	ENSG00000099822	ENST00000251287	D	0.97529	-4.42	3.83	3.83	0.44106	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	.	.	.	.	D	0.98071	0.9364	M	0.73753	2.245	0.80722	D	1	P	0.41910	0.764	P	0.62435	0.902	D	0.99305	1.0902	9	0.72032	D	0.01	.	15.1504	0.72692	0.0:1.0:0.0:0.0	.	630	Q9UL51	HCN2_HUMAN	I	630	ENSP00000251287:L630I	ENSP00000251287:L630I	L	+	1	0	HCN2	564914	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	5.494000	0.66905	1.876000	0.54355	0.425000	0.28330	CTC	-	HCN2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG		0.687	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	HGNC	protein_coding	OTTHUMT00000452100.1	0	0	0	48	48	0	0.00	0.00	C	NM_001194		613914	+1	4	0	46	2	tier1	no_errors	ENST00000251287	ensembl	human	known	74_37	missense	8.00	0.00	SNP	1.000	A	4	46
HOXA9	3205	genome.wustl.edu	37	7	27204839	27204839	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr7:27204839C>A	ENST00000343483.6	-	1	310	c.238G>T	c.(238-240)Gct>Tct	p.A80S	HOXA9_ENST00000497089.1_Intron|RP1-170O19.20_ENST00000470747.4_Intron|RP1-170O19.20_ENST00000465941.1_Intron|HOXA9_ENST00000396345.1_Missense_Mutation_p.A80S	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9	80				Missing (in Ref. 1; AAB40867). {ECO:0000305}.	endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						TACACCGCAGCGGGTACAGCG	0.711			T	"""NUP98, MSI2"""	AML*								ENSG00000078399																												Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	0													9.0	11.0	11.0					7																	27204839		2162	4237	6399	SO:0001583	missense	0			-		CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.238G>T	7.37:g.27204839C>A	ENSP00000343619:p.Ala80Ser		O43369|O43429|Q99820	Missense_Mutation	SNP	pfam_Hox9_activation_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Homeobox_Hox9,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.A80S	ENST00000343483.6	37	c.238	CCDS5409.1	7	.	.	.	.	.	.	.	.	.	.	C	0.450	-0.894079	0.02491	.	.	ENSG00000078399	ENST00000343483;ENST00000396345	D	0.93019	-3.15	5.37	3.57	0.40892	Hox9, N-terminal activation domain (1);	0.166457	0.28865	N	0.013895	D	0.83418	0.5250	N	0.16602	0.42	0.40567	D	0.981269	B	0.09022	0.002	B	0.15052	0.012	T	0.72830	-0.4174	10	0.02654	T	1	.	9.2544	0.37575	0.0:0.7788:0.0:0.2212	.	80	P31269	HXA9_HUMAN	S	80	ENSP00000343619:A80S	ENSP00000343619:A80S	A	-	1	0	HOXA9	27171364	0.779000	0.28652	0.922000	0.36590	0.517000	0.34286	1.075000	0.30716	0.653000	0.30826	-0.291000	0.09656	GCT	-	HOXA9	-	pfam_Hox9_activation_N,pirsf_Homeobox_Hox9		0.711	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA9	HGNC	protein_coding	OTTHUMT00000358706.2	0	0	0	27	27	0	0.00	0.00	C			27204839	-1	3	0	11	3	tier1	no_errors	ENST00000343483	ensembl	human	known	74_37	missense	21.43	0.00	SNP	1.000	A	3	11
LAMC3	10319	genome.wustl.edu	37	9	133901823	133901823	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr9:133901823G>T	ENST00000361069.4	+	2	658	c.525G>T	c.(523-525)gaG>gaT	p.E175D	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	175	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GCCGGCCCGAGGGCCAGTACC	0.672													ENSG00000050555																																					0													33.0	38.0	36.0					9																	133901823		2203	4298	6501	SO:0001583	missense	0			-	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.525G>T	9.37:g.133901823G>T	ENSP00000354360:p.Glu175Asp		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E175D	ENST00000361069.4	37	c.525	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	G	8.447	0.852171	0.17034	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.74947	-0.89	5.93	4.06	0.47325	Laminin, N-terminal (3);	0.377733	0.30151	N	0.010290	T	0.50326	0.1609	N	0.13098	0.295	0.30535	N	0.767011	B	0.12013	0.005	B	0.20184	0.028	T	0.42599	-0.9442	10	0.06891	T	0.86	.	6.1204	0.20150	0.071:0.1342:0.6558:0.1391	.	175	Q9Y6N6	LAMC3_HUMAN	D	175	ENSP00000354360:E175D	ENSP00000325873:E175D	E	+	3	2	LAMC3	132891644	0.252000	0.23972	1.000000	0.80357	0.009000	0.06853	0.291000	0.18994	0.813000	0.34350	-0.150000	0.13652	GAG	-	LAMC3	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N		0.672	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	0	0	0	43	43	2	0.00	0.00	G	NM_006059		133901823	+1	4	0	36	7	tier1	no_errors	ENST00000361069	ensembl	human	known	74_37	missense	10.00	0.00	SNP	0.946	T	4	36
PDXDC1	23042	genome.wustl.edu	37	16	15198400	15198401	+	Intron	INS	-	-	G	rs372111052|rs543842154|rs62039523	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr16:15198400_15198401insG	ENST00000535621.2	+	17	1587				RP11-1186N24.5_ENST00000605794.1_RNA|NPIPP1_ENST00000534799.2_RNA|RP11-72I8.1_ENST00000569858.1_RNA			Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGCAGACACTCGGAGGTGTCTT	0.545													ENSG00000188599																																					0																																										SO:0001627	intron_variant	0				AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-34335->G	16.37:g.15198402_15198402dupG			B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	R	INS	-	NULL	ENST00000535621.2	37	NULL		16																																																																																				NPIPP1	-	-		0.545	PDXDC1-016	PUTATIVE	basic	protein_coding	NPIPP1	HGNC	protein_coding	OTTHUMT00000422421.1	0	0	0	28	28	0	0.00	0.00	-	NM_015027		15198401	-1	9	0	45	0	tier1	no_errors	ENST00000534799	ensembl	human	known	74_37	rna	16.67	0.00	INS	0.017:0.018	G	9	45
PSG1	5669	genome.wustl.edu	37	19	43383883	43383883	+	5'Flank	SNP	C	C	T			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr19:43383883C>T	ENST00000436291.2	-	0	0				PSG1_ENST00000312439.6_5'Flank|PSG1_ENST00000403380.3_5'Flank|PSG1_ENST00000595356.1_5'Flank|PSG1_ENST00000595124.1_5'Flank|PSG1_ENST00000244296.2_5'Flank|PSG1_ENST00000601073.1_5'UTR	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				TGGGCAGGGTCAGGCCCAGGA	0.552													ENSG00000231924																																					0																																										SO:0001631	upstream_gene_variant	0			-		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123		19.37:g.43383883C>T	Exception_encountered		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	R	SNP	-	NULL	ENST00000436291.2	37	NULL	CCDS54275.1	19																																																																																			-	PSG1	-	-		0.552	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	0	0	0	35	35	0	0.00	0.00	C			43383883	-1	5	1	47	7	tier1	no_errors	ENST00000601073	ensembl	human	known	74_37	rna	9.62	12.50	SNP	0.003	T	5	47
RPL23AP82	284942	genome.wustl.edu	37	22	51237643	51237643	+	RNA	SNP	C	C	G			TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr22:51237643C>G	ENST00000480246.1	+	0	893					NR_026982.1																						TAAttagaatcaaatctataa	0.269													ENSG00000184319																																					0																																												0			-																													22.37:g.51237643C>G				R	SNP	-	NULL	ENST00000480246.1	37	NULL		22																																																																																			-	AC002055.4	-	-		0.269	AC002055.4-006	KNOWN	basic	processed_transcript	RPL23AP82	Clone_based_vega_gene	pseudogene	OTTHUMT00000316621.1	0	0	0	19	19	0	0.00	0.00	C			51237643	+1	8	0	11	0	tier1	no_errors	ENST00000462238	ensembl	human	known	74_37	rna	42.11	0.00	SNP	0.999	G	8	11
SLC12A2	6558	genome.wustl.edu	37	5	127419938	127419955	+	In_Frame_Del	DEL	GCGGCGGCGGCGGCGGCA	GCGGCGGCGGCGGCGGCA	-	rs181849063|rs560532409	byFrequency	TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	GCGGCGGCGGCGGCGGCA	GCGGCGGCGGCGGCGGCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr5:127419938_127419955delGCGGCGGCGGCGGCGGCA	ENST00000262461.2	+	1	481_498	c.292_309delGCGGCGGCGGCGGCGGCA	c.(292-309)gcggcggcggcggcggcadel	p.AAAAAA98del	CTC-228N24.3_ENST00000501702.2_lincRNA|SLC12A2_ENST00000343225.4_In_Frame_Del_p.AAAAAA98del	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	98	Ala-rich.				ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TGCTgcggcggcggcggcggcggcggcagcggcggcgg	0.771													ENSG00000064651																																					0										17,429		8,1,214						1.7	0.7			1	60,1308		28,4,652	no	coding	SLC12A2	NM_001046.2		36,5,866	A1A1,A1R,RR		4.386,3.8117,4.2448				77,1737				SO:0001651	inframe_deletion	0					CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.292_309delGCGGCGGCGGCGGCGGCA	5.37:g.127419938_127419955delGCGGCGGCGGCGGCGGCA	ENSP00000262461:p.Ala98_Ala103del		Q8N713|Q8WWH7	In_Frame_Del	DEL	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt1,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.AAAAAA101in_frame_del	ENST00000262461.2	37	c.292_309	CCDS4144.1	5																																																																																				SLC12A2	-	NULL		0.771	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	HGNC	protein_coding	OTTHUMT00000250972.1	0	0	0	0	0	0	0.00	0.00	GCGGCGGCGGCGGCGGCA	NM_001046		127419955	+1	0	0	2	2	tier1	no_errors	ENST00000262461	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.986:0.660:0.322:0.982:0.990:0.982:0.984:0.993:0.986:0.997:0.991:0.966:0.942:0.693:0.010:0.018:0.020:0.019	-	0	2
ANKRD30BP2	149992	genome.wustl.edu	37	21	14418386	14418386	+	RNA	SNP	A	A	T	rs201367790		TCGA-DX-A48K-01A-11D-A307-09	TCGA-DX-A48K-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ce6266b-1a84-4c5d-9e07-96b3e9957e4a	f0526221-b66f-4ead-ab8f-d5ce68caab49	g.chr21:14418386A>T	ENST00000507941.1	+	0	998				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		CCAGTGAGACATGAGTCTTTT	0.368													ENSG00000224309																																					0																																												0			-	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14418386A>T				R	SNP	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			rs201367790	ANKRD30BP2	-	-		0.368	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	HGNC	pseudogene	OTTHUMT00000372094.1	0	0	0	23	23	20	0.00	0.00	A	NR_026916		14418386	+1	6	2	31	25	tier1	no_errors	ENST00000507941	ensembl	human	known	74_37	rna	16.22	7.41	SNP	0.003	T	6	31
