#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
USH2A	7399	genome.wustl.edu	37	1	216172255	216172255	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr1:216172255C>T	ENST00000307340.3	-	34	7017	c.6631G>A	c.(6631-6633)Ggt>Agt	p.G2211S	USH2A_ENST00000366943.2_Missense_Mutation_p.G2211S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2211	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TATTTATTACCAGGTAAAACG	0.373										HNSCC(13;0.011)			ENSG00000042781																																					0													106.0	106.0	106.0					1																	216172255		2203	4300	6503	SO:0001583	missense	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6631G>A	1.37:g.216172255C>T	ENSP00000305941:p.Gly2211Ser		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.G2211S	ENST00000307340.3	37	c.6631	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241978	0.79912	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55930	0.49;0.49	5.22	5.22	0.72569	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.44902	D	0.000403	T	0.71409	0.3336	M	0.73962	2.25	0.52501	D	0.999955	D	0.89917	1.0	D	0.79108	0.992	T	0.65651	-0.6116	10	0.17832	T	0.49	.	18.9695	0.92709	0.0:1.0:0.0:0.0	.	2211	O75445	USH2A_HUMAN	S	2211	ENSP00000305941:G2211S;ENSP00000355910:G2211S	ENSP00000305941:G2211S	G	-	1	0	USH2A	214238878	1.000000	0.71417	0.971000	0.41717	0.492000	0.33523	4.492000	0.60334	2.707000	0.92482	0.591000	0.81541	GGT	-	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.373	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	86	86	132	0.00	0.00	C	NM_007123		216172255	-1	59	78	92	86	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	39.07	47.56	SNP	1.000	T	59	92
STARD9	57519	genome.wustl.edu	37	15	42979664	42979664	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr15:42979664C>T	ENST00000290607.7	+	23	5945	c.5888C>T	c.(5887-5889)gCc>gTc	p.A1963V		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1963					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GTGATGGTGGCCCAGGGTGGT	0.473													ENSG00000159433																																					0													38.0	45.0	43.0					15																	42979664		692	1590	2282	SO:0001583	missense	0			-	AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.5888C>T	15.37:g.42979664C>T	ENSP00000290607:p.Ala1963Val		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A1963V	ENST00000290607.7	37	c.5888	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774450	0.70107	.	.	ENSG00000159433	ENST00000290607	T	0.71461	-0.57	6.08	-2.67	0.06059	.	.	.	.	.	T	0.59004	0.2162	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.57075	-0.7873	7	0.87932	D	0	.	5.6572	0.17648	0.0:0.2084:0.4097:0.3819	.	.	.	.	V	1963	ENSP00000290607:A1963V	ENSP00000290607:A1963V	A	+	2	0	STARD9	40766956	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.006000	0.12833	-0.054000	0.13266	-0.136000	0.14681	GCC	-	STARD9	-	NULL		0.473	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	0	0	0	30	30	152	0.00	0.00	C			42979664	+1	8	33	37	94	tier1	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	17.78	25.98	SNP	0.000	T	8	37
PRDM9	56979	genome.wustl.edu	37	5	23523452	23523452	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr5:23523452G>T	ENST00000296682.3	+	9	1117	c.935G>T	c.(934-936)tGg>tTg	p.W312L		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	312	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GATAAATCCTGGGCCAACTGG	0.438										HNSCC(3;0.000094)			ENSG00000164256																																					0													126.0	121.0	123.0					5																	23523452		2203	4300	6503	SO:0001583	missense	0			-	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.935G>T	5.37:g.23523452G>T	ENSP00000296682:p.Trp312Leu		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.W312L	ENST00000296682.3	37	c.935	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	g	0.009	-1.799134	0.00617	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.38077	1.16	3.72	-7.29	0.01451	SET domain (2);	1.967040	0.02991	N	0.146808	T	0.11965	0.0291	N	0.03948	-0.315	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16867	-1.0388	10	0.09338	T	0.73	0.443	3.879	0.09069	0.4377:0.0:0.1567:0.4056	.	312	Q9NQV7	PRDM9_HUMAN	L	312;106	ENSP00000296682:W312L	ENSP00000253473:W106L	W	+	2	0	PRDM9	23559209	0.155000	0.22806	0.006000	0.13384	0.099000	0.18886	0.634000	0.24614	-1.277000	0.02411	-0.212000	0.12691	TGG	-	PRDM9	-	pfscan_SET_dom		0.438	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	0	0	0	96	96	52	0.00	0.00	G	NM_020227		23523452	+1	94	30	102	44	tier1	no_errors	ENST00000296682	ensembl	human	known	74_37	missense	47.96	40.54	SNP	0.004	T	94	102
NSMAF	8439	genome.wustl.edu	37	8	59499075	59499075	+	Silent	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr8:59499075G>A	ENST00000038176.3	-	28	2600	c.2388C>T	c.(2386-2388)acC>acT	p.T796T	NSMAF_ENST00000427130.2_Silent_p.T827T	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	796					ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				GGTGCATTAAGGTGGCCGTTG	0.403													ENSG00000035681																																					0													199.0	172.0	181.0					8																	59499075		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.2388C>T	8.37:g.59499075G>A			B4DFB0|E9PCH0|Q8IW26	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,pfam_GRAM,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,smart_GRAM,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T827	ENST00000038176.3	37	c.2481	CCDS6173.1	8																																																																																			-	NSMAF	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.403	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMAF	HGNC	protein_coding	OTTHUMT00000378384.1	0	0	0	125	125	180	0.00	0.00	G	NM_003580		59499075	-1	85	78	140	72	tier1	no_errors	ENST00000427130	ensembl	human	known	74_37	silent	37.78	52.00	SNP	0.000	A	85	140
POU6F2	11281	genome.wustl.edu	37	7	39247149	39247149	+	Silent	SNP	C	C	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr7:39247149C>A	ENST00000403058.1	+	5	595	c.441C>A	c.(439-441)acC>acA	p.T147T	POU6F2_ENST00000518318.2_Silent_p.T147T|POU6F2_ENST00000559001.1_Silent_p.T139T|POU6F2_ENST00000517348.1_3'UTR	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	147					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						CGAATCTCACCAACATCCAAG	0.552													ENSG00000106536																																					0													50.0	48.0	48.0					7																	39247149		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.441C>A	7.37:g.39247149C>A			A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Lambda_D-bd_dom,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.T147	ENST00000403058.1	37	c.441	CCDS34620.2	7																																																																																			-	POU6F2	-	NULL		0.552	POU6F2-002	KNOWN	basic|CCDS	protein_coding	POU6F2	HGNC	protein_coding	OTTHUMT00000320146.3	0	0	0	38	38	85	0.00	0.00	C	NM_007252		39247149	+1	20	19	44	45	tier1	no_errors	ENST00000403058	ensembl	human	known	74_37	silent	31.25	29.69	SNP	1.000	A	20	44
GPC6	10082	genome.wustl.edu	37	13	94482415	94482415	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr13:94482415C>T	ENST00000377047.4	+	3	943	c.328C>T	c.(328-330)Cga>Tga	p.R110*	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	110					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGAATTTTTCCGAGAGCTCCT	0.388													ENSG00000183098																																					0													33.0	34.0	34.0					13																	94482415		2203	4298	6501	SO:0001587	stop_gained	0			-	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.328C>T	13.37:g.94482415C>T	ENSP00000366246:p.Arg110*		A8K279|Q96SG5|Q96SG8|Q9H1P4	Nonsense_Mutation	SNP	pfam_Glypican	p.R110*	ENST00000377047.4	37	c.328	CCDS9469.1	13	.	.	.	.	.	.	.	.	.	.	C	43	9.954422	0.99304	.	.	ENSG00000183098	ENST00000377047	.	.	.	5.53	4.67	0.58626	.	0.560121	0.16865	N	0.196374	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	13.6268	0.62170	0.2823:0.7177:0.0:0.0	.	.	.	.	X	110	.	ENSP00000366246:R110X	R	+	1	2	GPC6	93280416	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.944000	0.49034	1.447000	0.47661	0.650000	0.86243	CGA	-	GPC6	-	pfam_Glypican		0.388	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	0	0	0	90	90	94	0.00	0.00	C	NM_005708		94482415	+1	27	16	163	83	tier1	no_errors	ENST00000377047	ensembl	human	known	74_37	nonsense	14.21	16.16	SNP	1.000	T	27	163
TBC1D1	23216	genome.wustl.edu	37	4	37904015	37904015	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr4:37904015G>A	ENST00000261439.4	+	2	654	c.299G>A	c.(298-300)cGt>cAt	p.R100H	TBC1D1_ENST00000402522.1_Missense_Mutation_p.R100H|TBC1D1_ENST00000508802.1_Missense_Mutation_p.R100H	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	100					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						AAGCCTCAGCGTGTTCACAAA	0.483													ENSG00000065882																																					0													140.0	128.0	132.0					4																	37904015		2203	4300	6503	SO:0001583	missense	0			-	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.299G>A	4.37:g.37904015G>A	ENSP00000261439:p.Arg100His		B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.R100H	ENST00000261439.4	37	c.299	CCDS33972.1	4	.	.	.	.	.	.	.	.	.	.	G	0.653	-0.808765	0.02819	.	.	ENSG00000065882	ENST00000508802;ENST00000261439;ENST00000402522	T;T;T	0.16597	2.33;2.33;2.33	6.07	0.0851	0.14440	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	0.830495	0.10354	N	0.684731	T	0.03305	0.0096	N	0.00554	-1.385	0.18873	N	0.999987	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.41716	-0.9493	10	0.02654	T	1	-4.675	5.4583	0.16602	0.5033:0.0:0.3711:0.1256	.	100;100	E9PGH8;Q86TI0	.;TBCD1_HUMAN	H	100	ENSP00000423651:R100H;ENSP00000261439:R100H;ENSP00000383994:R100H	ENSP00000261439:R100H	R	+	2	0	TBC1D1	37580410	0.045000	0.20229	0.071000	0.20095	0.753000	0.42808	0.615000	0.24329	-0.169000	0.10834	-0.324000	0.08512	CGT	-	TBC1D1	-	smart_PTB/PI_dom		0.483	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	0	0	0	37	37	167	0.00	0.00	G	NM_015173		37904015	+1	60	51	77	63	tier1	no_errors	ENST00000261439	ensembl	human	known	74_37	missense	43.80	44.74	SNP	0.163	A	60	77
IMPG1	3617	genome.wustl.edu	37	6	76734971	76734971	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr6:76734971C>T	ENST00000369950.3	-	5	691	c.502G>A	c.(502-504)Gat>Aat	p.D168N	IMPG1_ENST00000369963.3_Missense_Mutation_p.D90N	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GATATTTCATCTTTTCTATTA	0.338													ENSG00000112706																									Pancreas(37;839 1141 2599 26037)												0													73.0	77.0	76.0					6																	76734971		2203	4299	6502	SO:0001583	missense	0			-	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.502G>A	6.37:g.76734971C>T	ENSP00000358966:p.Asp168Asn			Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.D168N	ENST00000369950.3	37	c.502	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	C	13.37	2.215967	0.39201	.	.	ENSG00000112706	ENST00000369950;ENST00000369963	T;T	0.78364	1.99;-1.17	5.15	5.15	0.70609	.	1.346180	0.05137	N	0.493531	T	0.71333	0.3327	M	0.70275	2.135	0.44880	D	0.997893	B	0.21753	0.06	B	0.19946	0.027	T	0.53711	-0.8400	9	.	.	.	.	16.7908	0.85589	0.0:1.0:0.0:0.0	.	168	Q17R60	IMPG1_HUMAN	N	168;90	ENSP00000358966:D168N;ENSP00000358980:D90N	.	D	-	1	0	IMPG1	76791691	1.000000	0.71417	1.000000	0.80357	0.522000	0.34438	2.906000	0.48735	2.555000	0.86185	0.650000	0.86243	GAT	-	IMPG1	-	NULL		0.338	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	0	0	0	31	31	72	0.00	0.00	C	NM_001563		76734971	-1	8	10	34	50	tier1	no_errors	ENST00000369950	ensembl	human	known	74_37	missense	19.05	16.39	SNP	1.000	T	8	34
GPR126	57211	genome.wustl.edu	37	6	142711416	142711416	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr6:142711416C>A	ENST00000230173.6	+	7	1720	c.1244C>A	c.(1243-1245)tCc>tAc	p.S415Y	GPR126_ENST00000367608.2_Missense_Mutation_p.S387Y|GPR126_ENST00000296932.8_Missense_Mutation_p.S387Y|GPR126_ENST00000367609.3_Missense_Mutation_p.S415Y	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	415					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		TATAGAATATCCGTAGTGATT	0.313													ENSG00000112414																																					0													96.0	94.0	95.0					6																	142711416		1838	4085	5923	SO:0001583	missense	0			-	AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.1244C>A	6.37:g.142711416C>A	ENSP00000230173:p.Ser415Tyr		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB_dom,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Pentaxin,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S415Y	ENST00000230173.6	37	c.1244	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	C	18.97	3.736411	0.69189	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.46	4.6	0.57074	.	0.211649	0.33753	N	0.004600	T	0.46619	0.1402	L	0.53249	1.67	0.33992	D	0.649249	P;P;P;P	0.51537	0.946;0.946;0.946;0.911	P;P;P;P	0.52627	0.704;0.704;0.704;0.51	T	0.56517	-0.7966	10	0.87932	D	0	.	11.914	0.52755	0.0:0.9195:0.0:0.0805	.	387;415;387;415	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	Y	415;387;387;415	ENSP00000230173:S415Y;ENSP00000356580:S387Y;ENSP00000296932:S387Y;ENSP00000356581:S415Y	ENSP00000230173:S415Y	S	+	2	0	GPR126	142753109	0.978000	0.34361	0.846000	0.33378	0.885000	0.51271	2.382000	0.44345	1.310000	0.45006	0.655000	0.94253	TCC	-	GPR126	-	NULL		0.313	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	0	0	0	41	41	93	0.00	0.00	C			142711416	+1	19	16	61	71	tier1	no_errors	ENST00000367609	ensembl	human	known	74_37	missense	23.75	18.39	SNP	0.965	A	19	61
TLR3	7098	genome.wustl.edu	37	4	186997801	186997801	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr4:186997801T>A	ENST00000296795.3	+	2	132	c.28T>A	c.(28-30)Ttt>Att	p.F10I		NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	10					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TTGTATCTACTTTTGGGGGGG	0.448													ENSG00000164342																																					0													103.0	98.0	99.0					4																	186997801		2203	4300	6503	SO:0001583	missense	0			-	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.28T>A	4.37:g.186997801T>A	ENSP00000296795:p.Phe10Ile		B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.F10I	ENST00000296795.3	37	c.28	CCDS3846.1	4	.	.	.	.	.	.	.	.	.	.	T	12.20	1.865987	0.32977	.	.	ENSG00000164342	ENST00000296795;ENST00000513189;ENST00000542020	T;T	0.30448	1.63;1.53	5.68	1.86	0.25419	.	0.937897	0.09156	N	0.840870	T	0.21674	0.0522	L	0.40543	1.245	0.18873	N	0.999989	B	0.20459	0.045	B	0.21546	0.035	T	0.34453	-0.9828	10	0.42905	T	0.14	.	0.8387	0.01145	0.247:0.1481:0.1304:0.4745	.	10	O15455	TLR3_HUMAN	I	10	ENSP00000296795:F10I;ENSP00000423386:F10I	ENSP00000296795:F10I	F	+	1	0	TLR3	187234795	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	1.002000	0.29796	0.477000	0.27464	-0.438000	0.05819	TTT	-	TLR3	-	NULL		0.448	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR3	HGNC	protein_coding	OTTHUMT00000360313.4	0	0	0	42	42	66	0.00	0.00	T			186997801	+1	39	49	56	63	tier1	no_errors	ENST00000296795	ensembl	human	known	74_37	missense	41.05	43.75	SNP	0.003	A	39	56
TRIM45	80263	genome.wustl.edu	37	1	117663697	117663697	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr1:117663697G>A	ENST00000256649.4	-	1	653	c.127C>T	c.(127-129)Cct>Tct	p.P43S	TRIM45_ENST00000369464.3_Missense_Mutation_p.P43S|TRIM45_ENST00000369461.3_Intron	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	43					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		TGCAAACAAGGCAAGAGCCTG	0.562													ENSG00000134253																																					0													59.0	63.0	61.0					1																	117663697		2203	4300	6503	SO:0001583	missense	0			-		CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.127C>T	1.37:g.117663697G>A	ENSP00000256649:p.Pro43Ser		Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_B-box,pfscan_Znf_RING	p.P43S	ENST00000256649.4	37	c.127	CCDS893.1	1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.868302	0.91587	.	.	ENSG00000134253	ENST00000256649;ENST00000369464	D;D	0.87029	-2.2;-2.2	5.26	5.26	0.73747	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.055984	0.64402	D	0.000001	D	0.90229	0.6945	L	0.59967	1.855	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.69307	0.933;0.963	D	0.89415	0.3706	10	0.46703	T	0.11	-12.6533	16.4044	0.83654	0.0:0.0:1.0:0.0	.	43;43	Q9H8W5-2;Q9H8W5	.;TRI45_HUMAN	S	43	ENSP00000256649:P43S;ENSP00000358476:P43S	ENSP00000256649:P43S	P	-	1	0	TRIM45	117465220	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.983000	0.88140	2.735000	0.93741	0.561000	0.74099	CCT	-	TRIM45	-	smart_Znf_RING,pfscan_Znf_RING		0.562	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM45	HGNC	protein_coding	OTTHUMT00000033503.1	0	0	0	28	28	59	0.00	0.00	G	NM_025188		117663697	-1	28	21	27	28	tier1	no_errors	ENST00000256649	ensembl	human	known	74_37	missense	50.91	42.86	SNP	1.000	A	28	27
C19orf45	374877	genome.wustl.edu	37	19	7573142	7573142	+	Silent	SNP	A	A	G			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr19:7573142A>G	ENST00000361664.2	+	9	1485	c.1344A>G	c.(1342-1344)tcA>tcG	p.S448S	CTD-2207O23.12_ENST00000599312.1_Intron	NM_198534.2	NP_940936.2	Q8NA69	CS045_HUMAN	chromosome 19 open reading frame 45	448										endometrium(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|stomach(1)	8						GCTTCTTCTCAACACAATACA	0.607													ENSG00000198723																																					0													58.0	57.0	57.0					19																	7573142		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC029824	CCDS12179.2	19p13.2	2008-02-05			ENSG00000198723	ENSG00000198723			24745	protein-coding gene	gene with protein product						12477932	Standard	NM_198534		Approved	FLJ35784	uc002mgm.2	Q8NA69	OTTHUMG00000157183	ENST00000361664.2:c.1344A>G	19.37:g.7573142A>G			Q8N115	Silent	SNP	NULL	p.S448	ENST00000361664.2	37	c.1344	CCDS12179.2	19																																																																																			-	C19orf45	-	NULL		0.607	C19orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf45	HGNC	protein_coding	OTTHUMT00000347808.1	0	0	0	47	47	85	0.00	0.00	A	NM_198534		7573142	+1	41	35	69	45	tier1	no_errors	ENST00000361664	ensembl	human	known	74_37	silent	37.27	43.75	SNP	0.022	G	41	69
DLGAP1	9229	genome.wustl.edu	37	18	3814090	3814090	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr18:3814090G>C	ENST00000315677.3	-	5	1736	c.1141C>G	c.(1141-1143)Cag>Gag	p.Q381E	DLGAP1_ENST00000515196.2_Missense_Mutation_p.Q381E|DLGAP1_ENST00000581699.1_Missense_Mutation_p.Q87E|DLGAP1_ENST00000400149.3_Missense_Mutation_p.Q89E|DLGAP1_ENST00000581527.1_Missense_Mutation_p.Q381E|DLGAP1_ENST00000400147.2_Missense_Mutation_p.Q79E|DLGAP1_ENST00000478161.1_5'UTR|DLGAP1_ENST00000400155.1_Missense_Mutation_p.Q87E|DLGAP1_ENST00000400150.3_Missense_Mutation_p.Q87E|DLGAP1_ENST00000400145.2_Missense_Mutation_p.Q79E|DLGAP1_ENST00000584874.1_Missense_Mutation_p.Q381E|snoU13_ENST00000459060.1_RNA|DLGAP1_ENST00000539435.1_Missense_Mutation_p.Q79E|DLGAP1_ENST00000534970.1_Missense_Mutation_p.Q93E	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	381					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				AGGGATGGCTGAGTAGCCTTG	0.507													ENSG00000170579																																					0													165.0	152.0	157.0					18																	3814090		2203	4300	6503	SO:0001583	missense	0			-	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1141C>G	18.37:g.3814090G>C	ENSP00000316377:p.Gln381Glu		A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	pfam_GKAP	p.Q381E	ENST00000315677.3	37	c.1141	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833092	0.71258	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	D;D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.95645	0.8584	M	0.79693	2.465	0.80722	D	1	D;D;D;B;D;D;D;D;D	0.71674	0.982;0.982;0.997;0.122;0.997;0.992;0.99;0.993;0.998	D;D;D;B;D;P;D;P;D	0.72982	0.952;0.952;0.935;0.077;0.935;0.907;0.979;0.9;0.971	D	0.94774	0.7947	10	0.51188	T	0.08	-24.8443	20.422	0.99049	0.0:0.0:1.0:0.0	.	381;93;67;87;79;381;79;381;79	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;Q6IS01;O14490-3;O14490;O14490-2	.;.;.;.;.;.;.;DLGP1_HUMAN;.	E	381;79;87;89;87;93;79;79;381	ENSP00000316377:Q381E;ENSP00000383011:Q79E;ENSP00000383014:Q87E;ENSP00000383013:Q89E;ENSP00000383019:Q87E;ENSP00000437817:Q93E;ENSP00000446312:Q79E;ENSP00000383010:Q79E;ENSP00000445973:Q381E	ENSP00000316377:Q381E	Q	-	1	0	DLGAP1	3804090	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.751000	0.98889	2.832000	0.97577	0.655000	0.94253	CAG	-	DLGAP1	-	NULL		0.507	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	0	0	0	32	32	110	0.00	0.00	G			3814090	-1	25	44	25	64	tier1	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	50.00	40.74	SNP	1.000	C	25	25
SCN9A	6335	genome.wustl.edu	37	2	167144952	167144952	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr2:167144952C>G	ENST00000409435.1	-	9	1308	c.1309G>C	c.(1309-1311)Gct>Cct	p.A437P	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.A438P|SCN9A_ENST00000409672.1_Missense_Mutation_p.A437P|SCN9A_ENST00000375387.4_Missense_Mutation_p.A438P			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	437					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGTACCTCAGCTTCTTCTTGC	0.388													ENSG00000169432																																					0													129.0	136.0	134.0					2																	167144952		1836	4092	5928	SO:0001583	missense	0			-	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1309G>C	2.37:g.167144952C>G	ENSP00000386330:p.Ala437Pro		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.A438P	ENST00000409435.1	37	c.1312	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350225	0.82132	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;T;T	0.96619	-4.05;-4.06;-4.06;-4.07;-0.4;-0.4	5.74	4.86	0.63082	.	0.305004	0.28436	N	0.015349	D	0.97548	0.9197	M	0.80508	2.5	0.50039	D	0.999844	P;D;P	0.56968	0.954;0.978;0.954	P;P;P	0.59825	0.786;0.864;0.786	D	0.97532	1.0080	10	0.56958	D	0.05	.	15.1606	0.72782	0.0:0.9311:0.0:0.0689	.	437;437;438	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	P	437;438;438;437;302;302	ENSP00000386306:A437P;ENSP00000364536:A438P;ENSP00000304748:A438P;ENSP00000386330:A437P;ENSP00000413212:A302P;ENSP00000393141:A302P	ENSP00000304748:A438P	A	-	1	0	SCN9A	166853198	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.710000	0.68392	2.712000	0.92718	0.650000	0.86243	GCT	-	SCN9A	-	NULL		0.388	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	0	0	0	62	62	89	0.00	0.00	C	NM_002977		167144952	-1	69	27	99	86	tier1	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	41.07	23.89	SNP	1.000	G	69	99
ZBTB8B	728116	genome.wustl.edu	37	1	32936253	32936253	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr1:32936253C>A	ENST00000609129.1	+	2	106	c.28C>A	c.(28-30)Ctt>Att	p.L10I	RP1-27O5.3_ENST00000480336.1_Missense_Mutation_p.L10I	NM_001145720.1	NP_001139192.1	Q8NAP8	ZBT8B_HUMAN	zinc finger and BTB domain containing 8B	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)	1						TTATGCCAAGCTTTTGGGGGA	0.458													ENSG00000254553																																					0													61.0	58.0	59.0					1																	32936253		692	1591	2283	SO:0001583	missense	0			-	AL442095	CCDS44104.1	1p35.1	2013-01-08			ENSG00000215897	ENSG00000273274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	37057	protein-coding gene	gene with protein product							Standard	NM_001145720		Approved	RP1-27O5.1, DKFZp547H154, ZNF916B	uc001bvl.4	Q8NAP8	OTTHUMG00000167087	ENST00000609129.1:c.28C>A	1.37:g.32936253C>A	ENSP00000476499:p.Leu10Ile		Q15DG5|Q5VXR5|Q69YT7	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L10I	ENST00000609129.1	37	c.28	CCDS44104.1	1	.	.	.	.	.	.	.	.	.	.	C	30	5.055263	0.93793	.	.	ENSG00000215897	ENST00000415091	T	0.73575	-0.76	5.72	5.72	0.89469	BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.82632	0.5079	L	0.48986	1.54	0.58432	D	0.999997	D	0.63880	0.993	D	0.68483	0.958	T	0.78091	-0.2339	10	0.28530	T	0.3	.	19.2446	0.93896	0.0:1.0:0.0:0.0	.	10	Q8NAP8	ZBT8B_HUMAN	I	10	ENSP00000400836:L10I	ENSP00000435749:L10I	L	+	1	0	ZBTB8B	32708840	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.702000	0.68332	2.876000	0.98609	0.650000	0.86243	CTT	-	RP1-27O5.3	-	superfamily_BTB/POZ_fold		0.458	ZBTB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254553	Clone_based_vega_gene	protein_coding	OTTHUMT00000392986.2	0	0	0	47	47	104	0.00	0.00	C	NM_001145720		32936253	+1	46	50	19	10	tier1	no_errors	ENST00000480336	ensembl	human	known	74_37	missense	70.77	83.33	SNP	1.000	A	46	19
PKDREJ	10343	genome.wustl.edu	37	22	46655314	46655314	+	Silent	SNP	G	G	A	rs150338973		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr22:46655314G>A	ENST00000253255.5	-	1	3905	c.3906C>T	c.(3904-3906)aaC>aaT	p.N1302N		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1302	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ATCGACCCTCGTTGTTGTGCC	0.453													ENSG00000130943	G|||	1	0.000199681	0.0008	0.0	5008	,	,		21037	0.0		0.0	False		,,,				2504	0.0																0								G		8,4398	14.3+/-33.2	0,8,2195	125.0	116.0	119.0		3906	-7.6	0.6	22	dbSNP_134	119	0,8600		0,0,4300	no	coding-synonymous	PKDREJ	NM_006071.1		0,8,6495	AA,AG,GG		0.0,0.1816,0.0615		1302/2254	46655314	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.3906C>T	22.37:g.46655314G>A			B1AJY3|O95850	Silent	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,prints_PKD_2	p.N1302	ENST00000253255.5	37	c.3906	CCDS14073.1	22																																																																																			rs150338973	PKDREJ	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.453	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	0	0	1	41	41	148	0.00	0.67	G	NM_006071		46655314	-1	20	21	111	141	tier1	no_errors	ENST00000253255	ensembl	human	known	74_37	silent	15.27	12.96	SNP	0.003	A	20	111
CDHR4	389118	genome.wustl.edu	37	3	49830600	49830600	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr3:49830600C>T	ENST00000412678.2	-	13	1776	c.1768G>A	c.(1768-1770)Gtg>Atg	p.V590M	CDHR4_ENST00000462108.1_5'Flank	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	590	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						CTACCTCCCACGATGCTATAG	0.572													ENSG00000187492																																					0													64.0	61.0	62.0					3																	49830600		692	1591	2283	SO:0001583	missense	0			-		CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.1768G>A	3.37:g.49830600C>T	ENSP00000391409:p.Val590Met		Q6UXT0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V590M	ENST00000412678.2	37	c.1768	CCDS46829.1	3	.	.	.	.	.	.	.	.	.	.	C	9.101	1.004151	0.19199	.	.	ENSG00000187492	ENST00000412678	T	0.22134	1.97	5.78	3.01	0.34805	Cadherin-like (1);	.	.	.	.	T	0.09069	0.0224	N	0.17082	0.46	0.80722	D	1	P	0.52842	0.956	B	0.32090	0.14	T	0.21042	-1.0257	9	0.32370	T	0.25	.	9.2583	0.37597	0.0:0.7699:0.0:0.2301	.	590	A6H8M9	CDHR4_HUMAN	M	590	ENSP00000391409:V590M	ENSP00000391409:V590M	V	-	1	0	CDHR4	49805604	0.874000	0.30092	0.651000	0.29564	0.196000	0.23810	1.187000	0.32090	0.366000	0.24427	0.650000	0.86243	GTG	-	CDHR4	-	superfamily_Cadherin-like		0.572	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR4	HGNC	protein_coding	OTTHUMT00000350387.1	0	0	0	60	60	90	0.00	0.00	C	NM_001007540		49830600	-1	17	17	96	86	tier1	no_errors	ENST00000412678	ensembl	human	known	74_37	missense	14.91	16.50	SNP	0.789	T	17	96
BAG4	9530	genome.wustl.edu	37	8	38067571	38067571	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr8:38067571C>A	ENST00000287322.4	+	5	1205	c.934C>A	c.(934-936)Cac>Aac	p.H312N	BAG4_ENST00000432471.2_Missense_Mutation_p.H276N	NM_004874.3	NP_004865.1	O95429	BAG4_HUMAN	BCL2-associated athanogene 4	312					cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to tumor necrosis factor (GO:0071356)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA modification (GO:0090367)|negative regulation of phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:2001145)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein localization to plasma membrane (GO:0072659)|ruffle assembly (GO:0097178)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	11	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				CATGAACCGGCACAACTTTCC	0.448													ENSG00000156735																																					0													158.0	140.0	146.0					8																	38067571		2203	4300	6503	SO:0001583	missense	0			-	AF095194	CCDS6104.1, CCDS56533.1	8p11.23	2008-08-07			ENSG00000156735	ENSG00000156735			940	protein-coding gene	gene with protein product	"""silencer of death domains"""	603884				9873016, 9915703	Standard	NM_004874		Approved	SODD	uc003xky.2	O95429	OTTHUMG00000164064	ENST00000287322.4:c.934C>A	8.37:g.38067571C>A	ENSP00000287322:p.His312Asn		B4E217|O95818	Missense_Mutation	SNP	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	p.H312N	ENST00000287322.4	37	c.934	CCDS6104.1	8	.	.	.	.	.	.	.	.	.	.	C	11.63	1.696737	0.30142	.	.	ENSG00000156735	ENST00000432471;ENST00000287322	T;D	0.81579	-1.44;-1.51	5.11	4.18	0.49190	.	0.329246	0.34025	N	0.004331	T	0.66499	0.2795	N	0.19112	0.55	0.30398	N	0.780318	B;B	0.17852	0.005;0.024	B;B	0.15052	0.005;0.012	T	0.59883	-0.7370	10	0.23302	T	0.38	-23.7594	12.9751	0.58532	0.1603:0.8397:0.0:0.0	.	276;312	B4E217;O95429	.;BAG4_HUMAN	N	276;312	ENSP00000393298:H276N;ENSP00000287322:H312N	ENSP00000287322:H312N	H	+	1	0	BAG4	38186728	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.753000	0.38359	2.515000	0.84797	0.650000	0.86243	CAC	-	BAG4	-	NULL		0.448	BAG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG4	HGNC	protein_coding	OTTHUMT00000377038.2	0	0	0	39	39	42	0.00	0.00	C	NM_004874		38067571	+1	30	18	47	22	tier1	no_errors	ENST00000287322	ensembl	human	known	74_37	missense	38.96	45.00	SNP	1.000	A	30	47
PLOD2	5352	genome.wustl.edu	37	3	145788914	145788914	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr3:145788914T>A	ENST00000360060.3	-	18	2150	c.1973A>T	c.(1972-1974)gAa>gTa	p.E658V	RP11-274H2.2_ENST00000494745.2_RNA|PLOD2_ENST00000282903.5_Missense_Mutation_p.E679V|PLOD2_ENST00000494950.1_Missense_Mutation_p.E624V|PLOD2_ENST00000461497.1_Missense_Mutation_p.E339V|RP11-274H2.3_ENST00000490375.1_RNA|RP11-274H2.2_ENST00000480247.1_RNA	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	658	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	ACGCTGTCGTTCAGGGGAGTA	0.358													ENSG00000152952																																					0													74.0	77.0	76.0					3																	145788914		2202	4300	6502	SO:0001583	missense	0			-	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1973A>T	3.37:g.145788914T>A	ENSP00000353170:p.Glu658Val		B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.E679V	ENST00000360060.3	37	c.2036	CCDS3131.1	3	.	.	.	.	.	.	.	.	.	.	T	14.27	2.484433	0.44147	.	.	ENSG00000152952	ENST00000461497;ENST00000282903;ENST00000360060;ENST00000494950	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.9	4.9	0.64082	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.578836	0.19081	N	0.123255	T	0.78355	0.4270	M	0.62723	1.935	0.58432	D	0.999996	B;B;B;P	0.34699	0.053;0.019;0.009;0.464	B;B;B;B	0.39027	0.082;0.099;0.038;0.288	T	0.80233	-0.1467	10	0.72032	D	0.01	-0.9995	14.507	0.67761	0.0:0.0:0.0:1.0	.	624;658;679;339	E7ETU9;O00469;O00469-2;B3KWS3	.;PLOD2_HUMAN;.;.	V	339;679;658;624	ENSP00000419354:E339V;ENSP00000282903:E679V;ENSP00000353170:E658V;ENSP00000420094:E624V	ENSP00000282903:E679V	E	-	2	0	PLOD2	147271604	1.000000	0.71417	0.314000	0.25224	0.561000	0.35649	4.884000	0.63135	1.851000	0.53745	0.477000	0.44152	GAA	-	PLOD2	-	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph		0.358	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD2	HGNC	protein_coding	OTTHUMT00000355185.1	0	0	0	47	47	118	0.00	0.00	T	NM_000935		145788914	-1	35	44	56	60	tier1	no_errors	ENST00000282903	ensembl	human	known	74_37	missense	38.46	42.31	SNP	0.991	A	35	56
NCLN	56926	genome.wustl.edu	37	19	3206314	3206314	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr19:3206314C>G	ENST00000246117.4	+	12	1821	c.1390C>G	c.(1390-1392)Cgg>Ggg	p.R464G	NCLN_ENST00000590671.1_Missense_Mutation_p.R390G	NM_020170.3	NP_064555.2	Q969V3	NCLN_HUMAN	nicalin	464					regulation of signal transduction (GO:0009966)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|lung(3)|skin(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)		CAACCAGCCGCGGGCCGCGCA	0.657													ENSG00000125912																																					0													28.0	21.0	23.0					19																	3206314		1977	3793	5770	SO:0001583	missense	0			-	BC025926	CCDS32869.1	19p13.3	2010-08-13	2010-08-13			ENSG00000125912			26923	protein-coding gene	gene with protein product	"""nicastrin-like protein"""	609156	"""nicalin homolog (zebrafish)"""			11230166	Standard	NM_020170		Approved	NICALIN, NET59	uc002lxi.3	Q969V3		ENST00000246117.4:c.1390C>G	19.37:g.3206314C>G	ENSP00000246117:p.Arg464Gly		D6W613|O75252|Q6FI60|Q6ZMB7|Q8TAT7|Q96H48|Q96IS7|Q9BQH9|Q9BTX4|Q9NPP2	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Nicastrin,pirsf_Nicalin	p.R464G	ENST00000246117.4	37	c.1390	CCDS32869.1	19	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849979	0.51270	.	.	ENSG00000125912	ENST00000246117	T	0.52754	0.65	4.05	4.05	0.47172	.	0.125415	0.53938	D	0.000049	T	0.56381	0.1981	M	0.74647	2.275	0.80722	D	1	P;P	0.51537	0.946;0.91	P;P	0.50896	0.653;0.451	T	0.63400	-0.6646	10	0.87932	D	0	-11.8179	11.029	0.47761	0.1866:0.8134:0.0:0.0	.	463;464	Q969V3-2;Q969V3	.;NCLN_HUMAN	G	464	ENSP00000246117:R464G	ENSP00000246117:R464G	R	+	1	2	NCLN	3157314	0.960000	0.32886	0.428000	0.26697	0.339000	0.28857	2.252000	0.43196	1.802000	0.52723	0.549000	0.68633	CGG	-	NCLN	-	pirsf_Nicalin		0.657	NCLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCLN	HGNC	protein_coding	OTTHUMT00000452545.1	0	0	0	14	14	19	0.00	0.00	C	NM_020170		3206314	+1	9	7	15	13	tier1	no_errors	ENST00000246117	ensembl	human	known	74_37	missense	37.50	35.00	SNP	0.957	G	9	15
LHFPL4	375323	genome.wustl.edu	37	3	9547832	9547832	+	Silent	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr3:9547832G>A	ENST00000287585.6	-	3	747	c.462C>T	c.(460-462)acC>acT	p.T154T		NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4	167						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					TGTCCCGGATGGTCTCGGCAT	0.632													ENSG00000156959																																					0													124.0	105.0	111.0					3																	9547832		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.462C>T	3.37:g.9547832G>A			A1L383|A4D0Q5	Silent	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.T154	ENST00000287585.6	37	c.462	CCDS33691.1	3																																																																																			-	LHFPL4	-	pfam_Lipome_HGMIC_fus_partner-like		0.632	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL4	HGNC	protein_coding	OTTHUMT00000338298.1	0	0	0	61	61	87	0.00	0.00	G	NM_198560		9547832	-1	52	40	63	39	tier1	no_errors	ENST00000287585	ensembl	human	known	74_37	silent	45.22	50.63	SNP	0.894	A	52	63
LRRIQ3	127255	genome.wustl.edu	37	1	74540359	74540359	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr1:74540359T>C	ENST00000395089.1	-	5	982	c.983A>G	c.(982-984)cAt>cGt	p.H328R	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.H328R			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	328										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TTGAATGAGATGTCTTGATGT	0.234													ENSG00000162620																																					0													56.0	44.0	48.0					1																	74540359		1725	3966	5691	SO:0001583	missense	0			-	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.983A>G	1.37:g.74540359T>C	ENSP00000378524:p.His328Arg		A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	pfscan_IQ_motif_EF-hand-BS	p.H328R	ENST00000395089.1	37	c.983	CCDS41350.1	1	.	.	.	.	.	.	.	.	.	.	T	6.144	0.394734	0.11638	.	.	ENSG00000162620	ENST00000417067;ENST00000395089;ENST00000354431	T;T	0.11277	2.79;2.79	4.62	3.46	0.39613	.	0.705821	0.11701	N	0.537903	T	0.02807	0.0084	L	0.27053	0.805	0.09310	N	1	P	0.36616	0.561	B	0.34242	0.178	T	0.39522	-0.9610	10	0.72032	D	0.01	.	8.58	0.33623	0.0:0.0:0.1952:0.8048	.	328	A6PVS8	LRIQ3_HUMAN	R	39;328;328	ENSP00000378524:H328R;ENSP00000346414:H328R	ENSP00000346414:H328R	H	-	2	0	LRRIQ3	74312947	0.980000	0.34600	0.344000	0.25628	0.886000	0.51366	1.289000	0.33307	0.821000	0.34540	0.533000	0.62120	CAT	-	LRRIQ3	-	NULL		0.234	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRIQ3	HGNC	protein_coding	OTTHUMT00000316539.1	0	0	0	46	46	110	0.00	0.00	T	NM_145258		74540359	-1	37	40	58	61	tier1	no_errors	ENST00000354431	ensembl	human	known	74_37	missense	38.95	39.60	SNP	0.155	C	37	58
ZNF236	7776	genome.wustl.edu	37	18	74583683	74583683	+	Missense_Mutation	SNP	G	G	A	rs373923548		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr18:74583683G>A	ENST00000253159.8	+	5	761	c.563G>A	c.(562-564)cGg>cAg	p.R188Q	ZNF236_ENST00000583095.1_Intron|ZNF236_ENST00000320610.9_Missense_Mutation_p.R190Q	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	188					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TCTTATAACCGGAATATCGAC	0.413													ENSG00000130856																																					0								G	GLN/ARG	0,3828		0,0,1914	147.0	130.0	136.0		563	4.4	0.5	18		136	1,8245		0,1,4122	no	missense	ZNF236	NM_007345.3	43	0,1,6036	AA,AG,GG		0.0121,0.0,0.0083	probably-damaging	188/1846	74583683	1,12073	1914	4123	6037	SO:0001583	missense	0			-	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.563G>A	18.37:g.74583683G>A	ENSP00000253159:p.Arg188Gln		B2RTX9|Q9UL37	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R188Q	ENST00000253159.8	37	c.563	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894390	0.52121	0.0	1.21E-4	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.11712	2.75;2.9	5.31	4.44	0.53790	.	0.065255	0.64402	D	0.000017	T	0.14874	0.0359	N	0.24115	0.695	0.33255	D	0.559049	D;D	0.71674	0.987;0.998	P;P	0.55999	0.645;0.789	T	0.15378	-1.0439	10	0.34782	T	0.22	.	14.2908	0.66275	0.0722:0.0:0.9278:0.0	.	188;188	Q9NWI2;Q9UL36	.;ZN236_HUMAN	Q	188	ENSP00000253159:R188Q;ENSP00000444524:R188Q	ENSP00000253159:R188Q	R	+	2	0	ZNF236	72712671	1.000000	0.71417	0.497000	0.27552	0.006000	0.05464	6.929000	0.75852	1.374000	0.46228	-0.140000	0.14226	CGG	-	ZNF236	-	NULL		0.413	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	0	0	0	51	51	170	0.00	0.00	G			74583683	+1	28	66	37	48	tier1	no_errors	ENST00000253159	ensembl	human	known	74_37	missense	43.08	57.89	SNP	1.000	A	28	37
DNAJC5B	85479	genome.wustl.edu	37	8	67012211	67012211	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr8:67012211A>G	ENST00000276570.5	+	6	832	c.545A>G	c.(544-546)aAt>aGt	p.N182S	DNAJC5B_ENST00000519330.1_3'UTR	NM_033105.4	NP_149096.2	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 beta	182						membrane (GO:0016020)				endometrium(3)|large_intestine(6)|liver(1)|lung(6)|prostate(1)|skin(3)	20		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			ACAAATGCAAATGAGAAAACA	0.388													ENSG00000147570																																					0													132.0	120.0	124.0					8																	67012211		2203	4300	6503	SO:0001583	missense	0			-	AF368276	CCDS6183.1	8q13.1	2012-10-02			ENSG00000147570	ENSG00000147570		"""Heat shock proteins / DNAJ (HSP40)"""	24138	protein-coding gene	gene with protein product		613945				12477932	Standard	NM_033105		Approved	MGC26226, CSP-beta	uc003xvs.1	Q9UF47	OTTHUMG00000164470	ENST00000276570.5:c.545A>G	8.37:g.67012211A>G	ENSP00000276570:p.Asn182Ser		Q969Y8	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.N182S	ENST00000276570.5	37	c.545	CCDS6183.1	8	.	.	.	.	.	.	.	.	.	.	A	14.21	2.468544	0.43839	.	.	ENSG00000147570	ENST00000276570	T	0.69306	-0.39	5.87	5.87	0.94306	.	0.060586	0.64402	D	0.000005	T	0.52289	0.1725	N	0.25060	0.705	0.37867	D	0.929932	B	0.16166	0.016	B	0.17433	0.018	T	0.52808	-0.8526	10	0.29301	T	0.29	.	12.6519	0.56766	1.0:0.0:0.0:0.0	.	182	Q9UF47	DNJ5B_HUMAN	S	182	ENSP00000276570:N182S	ENSP00000276570:N182S	N	+	2	0	DNAJC5B	67174765	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.286000	0.51724	2.240000	0.73641	0.477000	0.44152	AAT	-	DJC5B	-	NULL		0.388	DNAJC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DJC5B	HGNC	protein_coding	OTTHUMT00000378915.1	0	0	1	121	121	123	0.00	0.81	A	NM_033105		67012211	+1	115	43	146	79	tier1	no_errors	ENST00000276570	ensembl	human	known	74_37	missense	44.06	35.25	SNP	1.000	G	115	146
SLC22A8	9376	genome.wustl.edu	37	11	62762013	62762013	+	Splice_Site	SNP	C	C	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr11:62762013C>A	ENST00000336232.2	-	8	1352		c.e8+1		SLC22A8_ENST00000542795.1_5'Flank|SLC22A8_ENST00000430500.2_Splice_Site|SLC22A8_ENST00000535878.1_Splice_Site|SLC22A8_ENST00000311438.8_Splice_Site|SLC22A8_ENST00000545207.1_Splice_Site	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8						glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CAGTCTCTCACCCAAGGGCAC	0.607													ENSG00000149452																																					0													34.0	33.0	34.0					11																	62762013		2200	4298	6498	SO:0001630	splice_region_variant	0			-	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.1216+1G>T	11.37:g.62762013C>A			B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Splice_Site	SNP	-	e7+1	ENST00000336232.2	37	c.1216+1	CCDS8042.1	11	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392009	0.83011	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8017	0.85616	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC22A8	62518589	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.017000	0.64047	2.550000	0.86006	0.655000	0.94253	.	-	SLC22A8	-	-		0.607	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A8	HGNC	protein_coding	OTTHUMT00000396191.1	0	0	0	25	25	50	0.00	0.00	C	NM_004254	Intron	62762013	-1	6	19	27	28	tier1	no_errors	ENST00000336232	ensembl	human	known	74_37	splice_site	18.18	40.43	SNP	1.000	A	6	27
SMOC1	64093	genome.wustl.edu	37	14	70490038	70490038	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr14:70490038C>T	ENST00000381280.4	+	11	1418	c.1165C>T	c.(1165-1167)Cgc>Tgc	p.R389C	SMOC1_ENST00000361956.3_Missense_Mutation_p.R389C	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	389	EF-hand 1.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GCCCTTCAAGCGCTACGTGAA	0.527													ENSG00000198732																																					0													140.0	127.0	131.0					14																	70490038		2203	4300	6503	SO:0001583	missense	0			-	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.1165C>T	14.37:g.70490038C>T	ENSP00000370680:p.Arg389Cys		A8K1S3|B2R7P5|Q96F78	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.R389C	ENST00000381280.4	37	c.1165	CCDS9798.1	14	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846983	0.71603	.	.	ENSG00000198732	ENST00000361956;ENST00000381280	T;T	0.60040	0.22;0.22	5.34	3.38	0.38709	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.72661	0.3488	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.987;0.998	T	0.76798	-0.2826	10	0.87932	D	0	-21.5896	13.8063	0.63233	0.3856:0.6144:0.0:0.0	.	389;389	Q9H4F8-2;Q9H4F8	.;SMOC1_HUMAN	C	389	ENSP00000355110:R389C;ENSP00000370680:R389C	ENSP00000355110:R389C	R	+	1	0	SMOC1	69559791	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.385000	0.44371	1.352000	0.45808	0.655000	0.94253	CGC	-	SMOC1	-	pfam_SPARC/Testican_Ca-bd-dom		0.527	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMOC1	HGNC	protein_coding	OTTHUMT00000412467.1	0	0	0	28	28	107	0.00	0.00	C			70490038	+1	21	51	30	46	tier1	no_errors	ENST00000361956	ensembl	human	known	74_37	missense	41.18	52.58	SNP	1.000	T	21	30
EHD1	10938	genome.wustl.edu	37	11	64621782	64621782	+	3'UTR	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr11:64621782G>A	ENST00000320631.3	-	0	1882				EHD1_ENST00000359393.2_3'UTR|EHD1_ENST00000488711.1_5'UTR	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1						blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						GCGTGCAAATGGCAGGTGCGG	0.662													ENSG00000110047																																					0													7.0	9.0	8.0					11																	64621782		2157	4215	6372	SO:0001624	3_prime_UTR_variant	0			-	AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.*23C>T	11.37:g.64621782G>A			O14611|Q2M3Q4|Q9UNR3	R	SNP	-	NULL	ENST00000320631.3	37	NULL	CCDS8084.1	11																																																																																			-	EHD1	-	-		0.662	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	0	0	0	69	69	37	0.00	0.00	G	NM_006795		64621782	-1	53	14	78	27	tier1	no_errors	ENST00000488711	ensembl	human	known	74_37	rna	40.46	34.15	SNP	0.002	A	53	78
FAT3	120114	genome.wustl.edu	37	11	92531873	92531873	+	Silent	SNP	T	T	G			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr11:92531873T>G	ENST00000298047.6	+	9	5711	c.5694T>G	c.(5692-5694)gtT>gtG	p.V1898V	FAT3_ENST00000409404.2_Silent_p.V1898V|FAT3_ENST00000525166.1_Silent_p.V1748V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1898	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTACCTATGTTGGAGTGGAGG	0.438										TCGA Ovarian(4;0.039)			ENSG00000165323																																					0													102.0	91.0	94.0					11																	92531873		1941	4168	6109	SO:0001819	synonymous_variant	0			-	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5694T>G	11.37:g.92531873T>G			B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V1898	ENST00000298047.6	37	c.5694		11																																																																																			-	FAT3	-	superfamily_Cadherin-like		0.438	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		0	0	0	40	40	180	0.00	0.00	T	NM_001008781		92531873	+1	29	71	48	68	tier1	no_errors	ENST00000298047	ensembl	human	known	74_37	silent	37.66	50.71	SNP	0.248	G	29	48
TNS1	7145	genome.wustl.edu	37	2	218723259	218723259	+	Intron	SNP	G	G	A	rs557122007		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr2:218723259G>A	ENST00000171887.4	-	17	1507				TNS1_ENST00000419504.1_Intron|TNS1_ENST00000480665.1_5'UTR|TNS1_ENST00000430930.1_Intron	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1						cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		agggaAGCCCGCTCTGATTTG	0.562													ENSG00000079308	G|||	1	0.000199681	0.0	0.0014	5008	,	,		16155	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			-	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1055-9449C>T	2.37:g.218723259G>A			Q4ZG71|Q6IPI5	R	SNP	-	NULL	ENST00000171887.4	37	NULL	CCDS2407.1	2																																																																																			-	TNS1	-	-		0.562	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	0	0	0	34	34	90	0.00	0.00	G	NM_022648		218723259	-1	32	35	59	39	tier1	no_errors	ENST00000480665	ensembl	human	putative	74_37	rna	35.16	47.30	SNP	0.000	A	32	59
CA12	771	genome.wustl.edu	37	15	63618489	63618489	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr15:63618489C>G	ENST00000178638.3	-	11	1500	c.1060G>C	c.(1060-1062)Gct>Cct	p.A354P	CA12_ENST00000560666.1_5'UTR|CA12_ENST00000344366.3_Missense_Mutation_p.A343P|CA12_ENST00000422263.2_Missense_Mutation_p.A283P	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	354					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	GGACCTCAAGCGTGGGCCTCA	0.507													ENSG00000074410																																					0													110.0	107.0	108.0					15																	63618489		2203	4300	6503	SO:0001583	missense	0			-	AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.1060G>C	15.37:g.63618489C>G	ENSP00000178638:p.Ala354Pro		B2RE24|Q53YE5|Q9BWG2	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.A354P	ENST00000178638.3	37	c.1060	CCDS10185.1	15	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490594	0.64074	.	.	ENSG00000074410	ENST00000178638;ENST00000344366;ENST00000422263	T;T;T	0.78126	-0.39;-0.45;-1.15	5.75	3.71	0.42584	.	0.851251	0.10403	N	0.678867	T	0.71779	0.3380	L	0.48362	1.52	0.24790	N	0.992767	B;B;B	0.20671	0.015;0.047;0.028	B;B;B	0.18871	0.01;0.023;0.015	T	0.64428	-0.6410	10	0.87932	D	0	.	9.8548	0.41079	0.1465:0.6923:0.1612:0.0	.	283;343;354	B3KUB4;O43570-2;O43570	.;.;CAH12_HUMAN	P	354;343;283	ENSP00000178638:A354P;ENSP00000343088:A343P;ENSP00000403028:A283P	ENSP00000178638:A354P	A	-	1	0	CA12	61405542	0.372000	0.25064	0.908000	0.35775	0.692000	0.40212	0.487000	0.22356	1.394000	0.46624	0.655000	0.94253	GCT	-	CA12	-	NULL		0.507	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CA12	HGNC	protein_coding	OTTHUMT00000256370.1	0	0	0	74	74	108	0.00	0.00	C	NM_001218		63618489	-1	87	38	81	57	tier1	no_errors	ENST00000178638	ensembl	human	known	74_37	missense	51.79	40.00	SNP	0.506	G	87	81
CARS2	79587	genome.wustl.edu	37	13	111357899	111357899	+	Missense_Mutation	SNP	C	C	G	rs117788141		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr13:111357899C>G	ENST00000257347.4	-	2	307	c.244G>C	c.(244-246)Gta>Cta	p.V82L	CARS2_ENST00000535398.1_Intron	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)	82					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	TGATCATATACAGTTGGTCCA	0.363													ENSG00000134905																																					0													91.0	85.0	87.0					13																	111357899		2203	4300	6503	SO:0001583	missense	0			-	BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.244G>C	13.37:g.111357899C>G	ENSP00000257347:p.Val82Leu		Q8NI84|Q96IV4	Missense_Mutation	SNP	pfam_Cys-tR/MSH_ligase,pfam_Methionyl/Leucyl_tR_Synth,pfam_aa-tR-synth_Ia,superfamily_tRsynth_1a_anticodon-bd,prints_Cys-tR/MSH_ligase,tigrfam_Cys-tR-ligase	p.V82L	ENST00000257347.4	37	c.244	CCDS9514.1	13	.	.	.	.	.	.	.	.	.	.	C	32	5.162217	0.94727	.	.	ENSG00000134905	ENST00000257347;ENST00000542709	T	0.44881	0.91	4.94	4.94	0.65067	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.74435	0.3716	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82928	-0.0214	10	0.72032	D	0.01	-33.3166	16.95	0.86242	0.0:1.0:0.0:0.0	.	82	Q9HA77	SYCM_HUMAN	L	82;73	ENSP00000257347:V82L	ENSP00000257347:V82L	V	-	1	0	CARS2	110155900	0.999000	0.42202	0.855000	0.33649	0.896000	0.52359	4.781000	0.62389	2.281000	0.76405	0.455000	0.32223	GTA	-	CARS2	-	pfam_Cys-tR/MSH_ligase,prints_Cys-tR/MSH_ligase,tigrfam_Cys-tR-ligase		0.363	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARS2	HGNC	protein_coding	OTTHUMT00000045772.3	0	0	0	29	29	137	0.00	0.00	C	NM_024537		111357899	-1	20	44	33	92	tier1	no_errors	ENST00000257347	ensembl	human	known	74_37	missense	37.74	32.35	SNP	0.998	G	20	33
PMF1	11243	genome.wustl.edu	37	1	156195368	156195396	+	Frame_Shift_Del	DEL	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	-	rs200802676	byFrequency	TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	-	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr1:156195368_156195396delACGGAAGTGCTGGTCCCCGCCTGCCCTCT	ENST00000368273.4	+	2	192_220	c.182_210delACGGAAGTGCTGGTCCCCGCCTGCCCTCT	c.(181-210)gacggaagtgctggtccccgcctgccctctfs	p.DGSAGPRLPS61fs	PMF1-BGLAP_ENST00000320139.5_Intron|PMF1_ENST00000368277.3_Intron|PMF1_ENST00000565805.1_Intron|PMF1-BGLAP_ENST00000368276.4_Intron|PMF1-BGLAP_ENST00000490491.1_Intron|PMF1_ENST00000368279.3_Intron|PMF1_ENST00000567140.1_Intron	NM_001199654.1	NP_001186583.1			polyamine-modulated factor 1											kidney(1)|large_intestine(2)|lung(3)	6	Hepatocellular(266;0.158)					CTTCATTGGGACGGAAGTGCTGGTCCCCGCCTGCCCTCTGGTGGACAGT	0.541													ENSG00000160783																									Pancreas(32;764 914 7316 34504 37150)|Ovarian(64;846 1195 21996 34382 40415)												0																																										SO:0001589	frameshift_variant	0				AF141310	CCDS30886.1, CCDS55648.1, CCDS55649.1	1q22	2013-07-03			ENSG00000160783	ENSG00000160783			9112	protein-coding gene	gene with protein product		609176				10419538	Standard	NM_007221		Approved			Q6P1K2	OTTHUMG00000177123	ENST00000368273.4:c.182_210delACGGAAGTGCTGGTCCCCGCCTGCCCTCT	1.37:g.156195368_156195396delACGGAAGTGCTGGTCCCCGCCTGCCCTCT	ENSP00000357256:p.Asp61fs			Frame_Shift_Del	DEL	pfam_Nnf1	p.D61fs	ENST00000368273.4	37	c.182_210	CCDS55648.1	1																																																																																				PMF1	-	NULL		0.541	PMF1-005	KNOWN	basic|exp_conf|CCDS	protein_coding	PMF1	HGNC	protein_coding	OTTHUMT00000040864.2	0	0	0	78	78	78	0.00	0.00	ACGGAAGTGCTGGTCCCCGCCTGCCCTCT	NM_007221		156195396	+1	5	5	34	34	tier1	no_errors	ENST00000368273	ensembl	human	known	74_37	frame_shift_del	12.82	12.82	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.440:0.512:0.591:0.968:0.997:1.000:0.999:0.988:0.964:0.869	-	5	34
CBX7	23492	genome.wustl.edu	37	22	39516197	39516198	+	5'UTR	INS	-	-	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr22:39516197_39516198insT	ENST00000475962.1	-	0	424_425							O95931	CBX7_HUMAN	chromobox homolog 7						chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sebaceous gland development (GO:0048733)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	Melanoma(58;0.04)					gccCTTTCTTCTTTTTTTTTTA	0.495													ENSG00000100307																									GBM(46;845 904 3560 9866 23971)												0																																										SO:0001623	5_prime_UTR_variant	0					CCDS13986.1	22q13.1	2010-07-06			ENSG00000100307	ENSG00000100307			1557	protein-coding gene	gene with protein product		608457					Standard	NM_175709		Approved		uc003axb.3	O95931	OTTHUMG00000150418	ENST00000475962.1:c.-27->A	22.37:g.39516207_39516207dupT			Q86T17	R	INS	-	NULL	ENST00000475962.1	37	NULL		22																																																																																				CBX7	-	-		0.495	CBX7-007	KNOWN	basic	processed_transcript	CBX7	HGNC	protein_coding	OTTHUMT00000318026.1	0	0	0	11	11	8	0.00	0.00	-	NM_175709		39516198	-1	4	3	12	10	tier1	no_errors	ENST00000475962	ensembl	human	known	74_37	rna	25.00	23.08	INS	0.190:0.272	T	4	12
LINC00359	100887754	genome.wustl.edu	37	13	97600392	97600392	+	lincRNA	DEL	C	C	-	rs370378722	byFrequency	TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr13:97600392delC	ENST00000442322.1	-	0	125				RN7SKP7_ENST00000410540.1_RNA|RP11-65L19.4_ENST00000606096.1_lincRNA					long intergenic non-protein coding RNA 359																		GGAGCAGGGGCCCCAATCCAT	0.423													ENSG00000243300																																					0																																												0						13q32.1	2013-06-03			ENSG00000243300	ENSG00000243300		"""Long non-coding RNAs"""	42679	non-coding RNA	RNA, long non-coding							Standard	NR_051966		Approved		uc031qmy.1		OTTHUMG00000185759		13.37:g.97600392delC				R	DEL	-	NULL	ENST00000442322.1	37	NULL		13																																																																																				LINC00359	-	-		0.423	LINC00359-002	KNOWN	basic|exp_conf	lincRNA	LINC00359	HGNC	lincRNA	OTTHUMT00000471175.1	0	0	0	49	49	112	0.00	0.00	C			97600392	-1	29	20	68	54	tier1	no_errors	ENST00000442322	ensembl	human	known	74_37	rna	29.90	27.03	DEL	1.000	-	29	68
SURF6	6838	genome.wustl.edu	37	9	136198995	136199015	+	In_Frame_Del	DEL	CCTCCAGCTCCTGCGCCTTCC	CCTCCAGCTCCTGCGCCTTCC	-			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	CCTCCAGCTCCTGCGCCTTCC	CCTCCAGCTCCTGCGCCTTCC	CCTCCAGCTCCTGCGCCTTCC	-	CCTCCAGCTCCTGCGCCTTCC	CCTCCAGCTCCTGCGCCTTCC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr9:136198995_136199015delCCTCCAGCTCCTGCGCCTTCC	ENST00000372022.4	-	5	1041_1061	c.776_796delGGAAGGCGCAGGAGCTGGAGG	c.(775-798)gggaaggcgcaggagctggaggcg>gcg	p.GKAQELE259del	SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	259					ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		TTCATCTTCGCCTCCAGCTCCTGCGCCTTCCCCTCATCCTG	0.67													ENSG00000148296																																					0																																										SO:0001651	inframe_deletion	0				AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.776_796delGGAAGGCGCAGGAGCTGGAGG	9.37:g.136198995_136199015delCCTCCAGCTCCTGCGCCTTCC	ENSP00000361092:p.Gly259_Glu265del		Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	In_Frame_Del	DEL	pfam_Surf6	p.GKAQELE259in_frame_del	ENST00000372022.4	37	c.796_776	CCDS6962.1	9																																																																																				SURF6	-	pfam_Surf6		0.670	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF6	HGNC	protein_coding	OTTHUMT00000054905.1	0	0	0	49	49	49	0.00	0.00	CCTCCAGCTCCTGCGCCTTCC	NM_006753		136199015	-1	6	6	31	31	tier1	no_errors	ENST00000372022	ensembl	human	known	74_37	in_frame_del	16.22	16.22	DEL	0.341:0.858:0.996:0.998:0.989:0.996:0.996:0.998:0.999:0.997:0.926:0.236:0.248:0.246:0.979:0.994:0.929:0.700:0.233:0.002:0.003	-	6	31
KIAA0196	9897	genome.wustl.edu	37	8	126056836	126056837	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr8:126056836_126056837insT	ENST00000318410.7	-	21	2957_2958	c.2608_2609insA	c.(2608-2610)accfs	p.T870fs	KIAA0196_ENST00000517845.1_Frame_Shift_Ins_p.T722fs|KIAA0196-AS1_ENST00000519140.1_RNA	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	870					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TAGACCAAAGGTTCCCAAGGTG	0.46													ENSG00000164961																																					0																																										SO:0001589	frameshift_variant	0					CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.2609dupA	8.37:g.126056838_126056838dupT	ENSP00000318016:p.Thr870fs		A8K4R7|Q3KQX5|Q8TBQ2	Frame_Shift_Ins	INS	pfam_WASH_strumpellin,superfamily_Ig_E-set	p.T870fs	ENST00000318410.7	37	c.2609_2608	CCDS6355.1	8																																																																																				KIAA0196	-	pfam_WASH_strumpellin		0.460	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0196	HGNC	protein_coding	OTTHUMT00000381369.1	0	0	0	82	82	113	0.00	0.00	-	NM_014846		126056837	-1	26	22	123	86	tier1	no_errors	ENST00000318410	ensembl	human	known	74_37	frame_shift_ins	17.45	20.37	INS	1.000:1.000	T	26	123
FST	10468	genome.wustl.edu	37	5	52781023	52781023	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr5:52781023delG	ENST00000256759.3	+	5	1301	c.918delG	c.(916-918)gtgfs	p.V306fs	FST_ENST00000396947.3_Frame_Shift_Del_p.V306fs	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	306	Kazal-like 3. {ECO:0000255|PROSITE- ProRule:PRU00798}.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				CCTCAGGTGTGCTACTGGAAG	0.517													ENSG00000134363																																					0													130.0	113.0	118.0					5																	52781023		2203	4300	6503	SO:0001589	frameshift_variant	0				M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.918delG	5.37:g.52781023delG	ENSP00000256759:p.Val306fs		B5BU94|Q9BTH0	Frame_Shift_Del	DEL	pfam_Kazal_dom,pfam_Follistatin/Osteonectin_EGF,superfamily_TB_dom,smart_Fol_N,smart_Kazal_dom	p.L307fs	ENST00000256759.3	37	c.918	CCDS3959.1	5																																																																																				FST	-	pfam_Kazal_dom,smart_Kazal_dom		0.517	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FST	HGNC	protein_coding	OTTHUMT00000253906.1	0	0	0	27	27	46	0.00	0.00	G	NM_013409		52781023	+1	39	17	54	26	tier1	no_errors	ENST00000256759	ensembl	human	known	74_37	frame_shift_del	41.94	39.53	DEL	1.000	-	39	54
PRDM16	63976	genome.wustl.edu	37	1	3322205	3322206	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	-	-	-	TG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr1:3322205_3322206insTG	ENST00000270722.5	+	8	1228_1229	c.1179_1180insTG	c.(1180-1182)ttcfs	p.F394fs	PRDM16_ENST00000514189.1_Frame_Shift_Ins_p.F395fs|PRDM16_ENST00000511072.1_Frame_Shift_Ins_p.F395fs|PRDM16_ENST00000442529.2_Frame_Shift_Ins_p.F394fs|PRDM16_ENST00000441472.2_Frame_Shift_Ins_p.F394fs|PRDM16_ENST00000378391.2_Frame_Shift_Ins_p.F394fs|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378398.3_Frame_Shift_Ins_p.F395fs			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	394					brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CGGTGAAGCCTTTCATATGTGA	0.698			T	EVI1	"""MDS, AML"""								ENSG00000142611																												Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0																																										SO:0001589	frameshift_variant	0				AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	Exception_encountered	1.37:g.3322205_3322206insTG	ENSP00000270722:p.Phe394fs		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.F393fs	ENST00000270722.5	37	c.1179_1180	CCDS41236.2	1																																																																																				PRDM16	-	pfscan_Znf_C2H2		0.698	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	0	0	0	26	26	31	0.00	0.00	-	NM_022114		3322206	+1	17	2	10	1	tier1	no_errors	ENST00000270722	ensembl	human	known	74_37	frame_shift_ins	62.96	66.67	INS	0.994:1.000	TG	17	10
SDK1	221935	genome.wustl.edu	37	7	4169604	4169604	+	Missense_Mutation	SNP	C	C	T	rs140791078		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr7:4169604C>T	ENST00000404826.2	+	27	4143	c.4004C>T	c.(4003-4005)aCg>aTg	p.T1335M	SDK1_ENST00000389531.3_Missense_Mutation_p.T1335M	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1335	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T1335M(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGGAACCACACGCAGTCGGCC	0.652													ENSG00000146555																																					1	Substitution - Missense(1)	large_intestine(1)						C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	59.0	55.0	57.0		4004	5.7	1.0	7	dbSNP_134	57	0,8598		0,0,4299	no	missense	SDK1	NM_152744.3	81	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1335/2214	4169604	1,13003	2203	4299	6502	SO:0001583	missense	0			-	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4004C>T	7.37:g.4169604C>T	ENSP00000385899:p.Thr1335Met		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T1335M	ENST00000404826.2	37	c.4004	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	18.46	3.629391	0.67015	2.27E-4	0.0	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.59502	0.26;0.26	5.73	5.73	0.89815	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.069462	0.56097	D	0.000032	T	0.75852	0.3906	M	0.72479	2.2	0.58432	D	0.999991	D;D	0.89917	0.999;1.0	D;D	0.66351	0.91;0.943	T	0.77354	-0.2619	10	0.87932	D	0	.	19.9025	0.96993	0.0:1.0:0.0:0.0	.	1335;1335	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	M	1335	ENSP00000385899:T1335M;ENSP00000374182:T1335M	ENSP00000374182:T1335M	T	+	2	0	SDK1	4136130	0.987000	0.35691	0.975000	0.42487	0.639000	0.38242	3.462000	0.53042	2.722000	0.93159	0.655000	0.94253	ACG	rs140791078	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.652	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	0	0	0	61	61	18	0.00	0.00	C	NM_152744		4169604	+1	21	3	58	7	tier1	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	26.58	30.00	SNP	1.000	T	21	58
SORCS1	114815	genome.wustl.edu	37	10	108924057	108924057	+	Silent	SNP	G	G	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr10:108924057G>T	ENST00000263054.6	-	1	235	c.228C>A	c.(226-228)ccC>ccA	p.P76P	SORCS1_ENST00000344440.6_Silent_p.P76P	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	76					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTGAGAACAGGGGACGCACTA	0.731													ENSG00000108018																																					0													6.0	7.0	7.0					10																	108924057		2158	4226	6384	SO:0001819	synonymous_variant	0			-	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.228C>A	10.37:g.108924057G>T			A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.P76	ENST00000263054.6	37	c.228	CCDS7559.1	10																																																																																			-	SORCS1	-	NULL		0.731	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	0	0	0	14	14	5	0.00	0.00	G	NM_052918		108924057	-1	5	2	15	0	tier1	no_errors	ENST00000344440	ensembl	human	known	74_37	silent	25.00	100.00	SNP	0.799	T	5	15
TSPAN32	10077	genome.wustl.edu	37	11	2334970	2334970	+	Silent	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr11:2334970G>A	ENST00000182290.4	+	5	578	c.441G>A	c.(439-441)gcG>gcA	p.A147A	TSPAN32_ENST00000381121.3_Silent_p.A147A|TSPAN32_ENST00000451520.2_Silent_p.A136A|TSPAN32_ENST00000483227.1_3'UTR	NM_139022.2	NP_620591.3	Q96QS1	TSN32_HUMAN	tetraspanin 32	147					cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|defense response to protozoan (GO:0042832)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid dendritic cell activation (GO:0030886)|platelet aggregation (GO:0070527)|regulation of defense response to virus (GO:0050688)	cell surface (GO:0009986)|integrin alphaIIb-beta3 complex (GO:0070442)|intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|lung(4)|ovary(1)|skin(1)	8		all_epithelial(84;4.89e-05)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.00791)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000533)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		AGGAGCTGGCGGCCATCCAGG	0.647													ENSG00000064201																																					0													47.0	29.0	35.0					11																	2334970		2199	4295	6494	SO:0001819	synonymous_variant	0			-	AF176070	CCDS7733.1	11p15	2013-02-14	2005-08-16	2005-08-16	ENSG00000064201	ENSG00000064201		"""Tetraspanins"""	13410	protein-coding gene	gene with protein product		603853	"""pan-hematopoietic expression"""	TSSC6, PHEMX		10072438, 10950922	Standard	NM_139022		Approved		uc001lvy.1	Q96QS1	OTTHUMG00000009762	ENST00000182290.4:c.441G>A	11.37:g.2334970G>A			Q96KX4|Q9HC50|Q9HC51|Q9Y5U1	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	p.A147	ENST00000182290.4	37	c.441	CCDS7733.1	11																																																																																			-	TSPAN32	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2		0.647	TSPAN32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSPAN32	HGNC	protein_coding	OTTHUMT00000026912.2	0	0	0	135	135	18	0.00	0.00	G	NM_139024		2334970	+1	15	2	111	9	tier1	no_errors	ENST00000182290	ensembl	human	known	74_37	silent	11.90	18.18	SNP	0.036	A	15	111
SAMD9	54809	genome.wustl.edu	37	7	92731334	92731334	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr7:92731334T>C	ENST00000379958.2	-	3	4346	c.4077A>G	c.(4075-4077)atA>atG	p.I1359M		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1359						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TCATAGTGCTTATAGCATCCT	0.358													ENSG00000205413																																					0													100.0	105.0	104.0					7																	92731334		2203	4299	6502	SO:0001583	missense	0			-	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.4077A>G	7.37:g.92731334T>C	ENSP00000369292:p.Ile1359Met		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_SAM,pfscan_SAM	p.I1359M	ENST00000379958.2	37	c.4077	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	T	0.539	-0.854378	0.02630	.	.	ENSG00000205413	ENST00000379958	T	0.23147	1.92	4.41	3.26	0.37387	.	0.983509	0.08275	N	0.970822	T	0.17023	0.0409	N	0.22421	0.69	0.09310	N	1	B	0.15930	0.015	B	0.10450	0.005	T	0.25676	-1.0125	10	0.46703	T	0.11	-2.2807	4.4996	0.11858	0.0:0.1037:0.1989:0.6973	.	1359	Q5K651	SAMD9_HUMAN	M	1359	ENSP00000369292:I1359M	ENSP00000369292:I1359M	I	-	3	3	SAMD9	92569270	0.000000	0.05858	0.005000	0.12908	0.013000	0.08279	-0.281000	0.08456	0.830000	0.34757	0.491000	0.48974	ATA	-	SAMD9	-	NULL		0.358	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1	0	0	0	45	45	86	0.00	0.00	T	NM_017654		92731334	-1	10	6	101	68	tier1	no_errors	ENST00000379958	ensembl	human	known	74_37	missense	9.01	8.11	SNP	0.000	C	10	101
IFT122	55764	genome.wustl.edu	37	3	129226538	129226538	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr3:129226538G>T	ENST00000348417.2	+	23	2896	c.2819G>T	c.(2818-2820)gGc>gTc	p.G940V	IFT122_ENST00000431818.2_Missense_Mutation_p.G790V|IFT122_ENST00000440957.2_Missense_Mutation_p.G731V|IFT122_ENST00000507564.1_Missense_Mutation_p.G933V|IFT122_ENST00000296266.3_Missense_Mutation_p.G991V|IFT122_ENST00000504021.1_Missense_Mutation_p.G817V|IFT122_ENST00000347300.2_Missense_Mutation_p.G881V|IFT122_ENST00000349441.2_Missense_Mutation_p.G830V	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	940					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						ACAATGCTTGGCAAGTTCTAC	0.582													ENSG00000163913																																					0													227.0	185.0	199.0					3																	129226538		2203	4300	6503	SO:0001583	missense	0			-	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2819G>T	3.37:g.129226538G>T	ENSP00000324005:p.Gly940Val		B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G991V	ENST00000348417.2	37	c.2972	CCDS3061.1	3	.	.	.	.	.	.	.	.	.	.	G	8.656	0.899434	0.17686	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000454840;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	T;T;T;T;T;T;T;T	0.60171	0.86;0.21;0.32;0.41;0.99;0.98;0.85;1.89	5.6	-1.09	0.09904	.	0.850636	0.10710	N	0.642940	T	0.31295	0.0792	N	0.08118	0	0.27421	N	0.954298	B;B;B;B;B;B;B;B;B;B	0.34103	0.0;0.0;0.437;0.0;0.0;0.0;0.0;0.0;0.0;0.001	B;B;B;B;B;B;B;B;B;B	0.33042	0.001;0.002;0.157;0.003;0.001;0.001;0.001;0.002;0.0;0.002	T	0.20538	-1.0272	10	0.30854	T	0.27	-2.9309	7.0749	0.25199	0.6069:0.0:0.2693:0.1239	.	731;266;933;328;817;781;830;881;940;991	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	V	881;991;933;881;790;817;830;940;781;731	ENSP00000323973:G881V;ENSP00000296266:G991V;ENSP00000425536:G933V;ENSP00000410946:G790V;ENSP00000422179:G817V;ENSP00000324165:G830V;ENSP00000324005:G940V;ENSP00000401569:G731V	ENSP00000296266:G991V	G	+	2	0	IFT122	130709228	0.091000	0.21658	0.168000	0.22838	0.828000	0.46876	0.441000	0.21611	-0.064000	0.13043	0.561000	0.74099	GGC	-	IFT122	-	NULL		0.582	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT122	HGNC	protein_coding	OTTHUMT00000355852.1	0	0	0	46	46	114	0.00	0.00	G	NM_018262		129226538	+1	7	10	55	96	tier1	no_errors	ENST00000296266	ensembl	human	known	74_37	missense	11.29	9.43	SNP	0.031	T	7	55
GPR112	139378	genome.wustl.edu	37	X	135431967	135431967	+	Silent	SNP	A	A	G			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chrX:135431967A>G	ENST00000394143.1	+	6	6393	c.6102A>G	c.(6100-6102)acA>acG	p.T2034T	GPR112_ENST00000394141.1_Silent_p.T1829T|GPR112_ENST00000287534.4_Silent_p.T1971T|GPR112_ENST00000370652.1_Silent_p.T2034T|GPR112_ENST00000412101.1_Silent_p.T1829T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2034					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CTTCCTCTACAGTAGAGGTGT	0.453													ENSG00000156920																																					0													159.0	125.0	137.0					X																	135431967		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6102A>G	X.37:g.135431967A>G			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T2034	ENST00000394143.1	37	c.6102	CCDS35409.1	X																																																																																			-	GPR112	-	NULL		0.453	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	0	0	0	30	30	99	0.00	0.00	A			135431967	+1	14	9	90	87	tier1	no_errors	ENST00000370652	ensembl	human	known	74_37	silent	13.46	9.38	SNP	0.000	G	14	90
ZNF251	90987	genome.wustl.edu	37	8	145947028	145947029	+	Stop_Codon_Del	DEL	AT	AT	-			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	AT	AT	AT	-	AT	AT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr8:145947028_145947029delAT	ENST00000292562.7	-	0	2291_2292				ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		CATTTATCACATTAAAAATGTC	0.332													ENSG00000198169																																					0																																										SO:0001567	stop_retained_variant	0				AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	Exception_encountered	8.37:g.145947028_145947029delAT	Exception_encountered		Q2M219	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.*672fs	ENST00000292562.7	37	c.2017_2016	CCDS47944.1	8																																																																																				ZNF251	-	NULL		0.332	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	0	0	0	26	26	55	0.00	0.00	AT	NM_138367		145947029	-1	10	4	50	40	tier1	no_errors	ENST00000292562	ensembl	human	known	74_37	frame_shift_del	16.67	9.09	DEL	0.001:0.013	-	10	50
TSPYL2	64061	genome.wustl.edu	37	X	53115089	53115109	+	In_Frame_Del	DEL	TGACAACAATGAGAGTGCAGA	TGACAACAATGAGAGTGCAGA	-	rs377587714		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	TGACAACAATGAGAGTGCAGA	TGACAACAATGAGAGTGCAGA	TGACAACAATGAGAGTGCAGA	-	TGACAACAATGAGAGTGCAGA	TGACAACAATGAGAGTGCAGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chrX:53115089_53115109delTGACAACAATGAGAGTGCAGA	ENST00000375442.4	+	6	1647_1667	c.1515_1535delTGACAACAATGAGAGTGCAGA	c.(1513-1536)actgacaacaatgagagtgcagat>act	p.DNNESAD506del		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	506	Asn-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)	p.D512N(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						acgaaaccactgacaacaatgagagtgcagatgacaacaac	0.448													ENSG00000184205																																					1	Substitution - Missense(1)	lung(1)																																								SO:0001651	inframe_deletion	0				AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1515_1535delTGACAACAATGAGAGTGCAGA	X.37:g.53115089_53115109delTGACAACAATGAGAGTGCAGA	ENSP00000364591:p.Asp506_Asp512del		O94799|Q96DG7|Q9BZW6	In_Frame_Del	DEL	pfam_P_family	p.ESADDNN509in_frame_del	ENST00000375442.4	37	c.1515_1535	CCDS14350.1	X																																																																																				TSPYL2	-	NULL		0.448	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL2	HGNC	protein_coding	OTTHUMT00000056718.1	0	0	0	130	130	130	0.00	0.00	TGACAACAATGAGAGTGCAGA	NM_022117		53115109	+1	10	10	103	103	tier1	no_errors	ENST00000375442	ensembl	human	known	74_37	in_frame_del	8.85	8.85	DEL	0.026:0.024:0.015:0.010:0.008:0.008:0.005:0.003:0.001:0.000:0.001:0.001:0.001:0.002:0.001:0.000:0.000:0.001:0.000:0.000:0.025	-	10	103
PCDHGA2	56113	genome.wustl.edu	37	5	140720410	140720410	+	Silent	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr5:140720410C>T	ENST00000394576.2	+	1	1872	c.1872C>T	c.(1870-1872)ggC>ggT	p.G624G	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCACACGGGCGAGGTGCGCA	0.687													ENSG00000081853																																					0													34.0	41.0	39.0					5																	140720410		2193	4276	6469	SO:0001819	synonymous_variant	0			-	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1872C>T	5.37:g.140720410C>T			Q52LL6|Q9Y5D5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G624	ENST00000394576.2	37	c.1872	CCDS47289.1	5																																																																																			-	PCDHGA2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.687	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	0	0	0	201	201	8	0.00	0.00	C	NM_018915		140720410	+1	42	0	280	6	tier1	no_errors	ENST00000394576	ensembl	human	known	74_37	silent	13.00	0.00	SNP	0.045	T	42	280
PIGQ	9091	genome.wustl.edu	37	16	624230	624230	+	Silent	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr16:624230G>A	ENST00000026218.5	+	2	244	c.156G>A	c.(154-156)gtG>gtA	p.V52V	PIGQ_ENST00000409527.2_Silent_p.V52V|PIGQ_ENST00000470411.2_Silent_p.V52V|PIGQ_ENST00000321878.5_Silent_p.V52V	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	52					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				TGGCCCAGGTGCGGCAGGCCA	0.711													ENSG00000007541																																					0													44.0	36.0	39.0					16																	624230		2194	4298	6492	SO:0001819	synonymous_variant	0			-	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.156G>A	16.37:g.624230G>A			A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Silent	SNP	pfam_Glcc_Gpi1	p.V52	ENST00000026218.5	37	c.156	CCDS10411.1	16																																																																																			-	PIGQ	-	NULL		0.711	PIGQ-002	KNOWN	basic|CCDS	protein_coding	PIGQ	HGNC	protein_coding	OTTHUMT00000239270.2	0	0	0	52	52	8	0.00	0.00	G	NM_004204		624230	+1	33	0	26	3	tier1	no_errors	ENST00000026218	ensembl	human	known	74_37	silent	55.00	0.00	SNP	0.998	A	33	26
DNM1P47	100216544	genome.wustl.edu	37	15	102299838	102299838	+	RNA	SNP	G	G	C			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr15:102299838G>C	ENST00000561463.1	+	0	7884									DNM1 pseudogene 47																		CGGCAGAGCAGGCAGACCAAG	0.592													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299838G>C				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	19	19	0	0.00	0.00	G	NG_009149		102299838	+1	6	0	28	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	17.65	0.00	SNP	0.965	C	6	28
RP11-402P6.11	0	genome.wustl.edu	37	X	70979225	70979246	+	lincRNA	DEL	CGCGTGCACATGTGCGCGCGCG	CGCGTGCACATGTGCGCGCGCG	-	rs199578322|rs200807082|rs201976710|rs112073596|rs187899953		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	CGCGTGCACATGTGCGCGCGCG	CGCGTGCACATGTGCGCGCGCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chrX:70979225_70979246delCGCGTGCACATGTGCGCGCGCG	ENST00000439926.1	-	0	440				BX276092.1_ENST00000408757.1_RNA																							GGCATGCTCAcgcgtgcacatgtgcgcgcgcgcgcgtgcaca	0.55													ENSG00000221684																																					0																																												0																																X.37:g.70979225_70979246delCGCGTGCACATGTGCGCGCGCG				R	DEL	-	NULL	ENST00000439926.1	37	NULL		X																																																																																				BX276092.1	-	-		0.550	RP11-402P6.11-001	KNOWN	basic	lincRNA	ENSG00000221684	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000057168.1	0	0	0	2	2	2	0.00	0.00	CGCGTGCACATGTGCGCGCGCG			70979246	-1	0	0	2	2	tier1	no_errors	ENST00000408757	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.004:0.003:0.004:0.004:0.003:0.005:0.006:0.010:0.014:0.017:0.020:0.023:0.026:0.028:0.030:0.031:0.032:0.033:0.033:0.033:0.033:0.033	-	0	2
INCENP	3619	genome.wustl.edu	37	11	61914294	61914294	+	Silent	SNP	G	G	C	rs374721937	byFrequency	TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr11:61914294G>C	ENST00000394818.3	+	15	2326	c.2124G>C	c.(2122-2124)cgG>cgC	p.R708R	INCENP_ENST00000278849.4_Silent_p.R704R	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	708					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						aggagcggcgggagcaggagc	0.756													ENSG00000149503	G|||	10	0.00199681	0.0061	0.0029	5008	,	,		11587	0.0		0.0	False		,,,				2504	0.0																0													3.0	5.0	5.0					11																	61914294		1897	3823	5720	SO:0001819	synonymous_variant	0			-	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.2124G>C	11.37:g.61914294G>C			A8MQD2|Q5Y192	Silent	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.R708	ENST00000394818.3	37	c.2124	CCDS44624.1	11																																																																																			-	INCENP	-	NULL		0.756	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	HGNC	protein_coding	OTTHUMT00000394723.2	0	0	0	30	30	1	0.00	0.00	G	NM_020238		61914294	+1	8	0	63	0	tier1	no_errors	ENST00000394818	ensembl	human	known	74_37	silent	11.27	0.00	SNP	0.000	C	8	63
MAGI1	9223	genome.wustl.edu	37	3	65425575	65425576	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr3:65425575_65425576insT	ENST00000497477.2	-	9	1247_1248	c.1248_1249insA	c.(1246-1251)cagcagfs	p.Q417fs	MAGI1_ENST00000330909.8_Frame_Shift_Ins_p.Q417fs|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000483466.1_Frame_Shift_Ins_p.Q417fs|MAGI1_ENST00000402939.2_Frame_Shift_Ins_p.Q417fs			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	417	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		tgctgctgctgctgctgctgct	0.55											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000151276																																					0																																										SO:0001589	frameshift_variant	0				AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1248_1249insA	3.37:g.65425575_65425576insT	ENSP00000424369:p.Gln417fs	1084	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Frame_Shift_Ins	INS	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.Q416fs	ENST00000497477.2	37	c.1249_1248		3																																																																																				MAGI1	-	NULL		0.550	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349132.2	0	0	0	61	61	3	0.00	0.00	-	NM_004742		65425576	-1	12	0	108	3	tier1	no_errors	ENST00000402939	ensembl	human	known	74_37	frame_shift_ins	10.00	0.00	INS	0.437:0.220	T	12	108
POTEB	100996331	genome.wustl.edu	37	15	22049316	22049316	+	IGR	SNP	G	G	A	rs1814008|rs371883145		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr15:22049316G>A	ENST00000439682.1	-	0	1706				MIR3118-6_ENST00000582779.1_RNA	NM_001277304.1	NP_001264233.1	Q6S5H4	POTEB_HUMAN	POTE ankyrin domain family, member B											endometrium(2)|kidney(8)|lung(4)	14						cacaatcaccgtgtgactgca	0.423													ENSG00000265793																																					0																																										SO:0001628	intergenic_variant	0			-	AY465170	CCDS59250.1	15q11.2	2014-01-10	2008-11-26	2008-11-26	ENSG00000233917	ENSG00000233917		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33734	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 5"""	608912	"""ANKRD26-like family B, member 1"""	A26B1			Standard	NM_001277304		Approved	POTE15, POTE-15, CT104.5	uc031qqz.1	Q6S5H4			15.37:g.22049316G>A			Q6NXN7|Q6S5H7	R	SNP	-	NULL	ENST00000439682.1	37	NULL	CCDS59250.1	15																																																																																			-	MIR3118-6	-	-		0.423	POTEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3118-6	HGNC	protein_coding	OTTHUMT00000414911.2	0	0	0	9	9	0	0.00	0.00	G	NM_207355		22049316	+1	11	0	18	3	tier1	no_errors	ENST00000582779	ensembl	human	known	74_37	rna	37.93	0.00	SNP	0.145	A	11	18
MT-ND1	4535	genome.wustl.edu	37	M	617	617	+	5'Flank	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chrM:617G>A	ENST00000361390.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TACACTGAAAATGTTTAGACG	0.468													ENSG00000210049																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.617G>A	Exception_encountered		C0JKH6|Q37523	R	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	MT-TF	-	-		0.468	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-TF	HGNC	protein_coding		0	0	0	341	341	2	0.00	0.00	G	YP_003024026		617	+1	284	0	227	0	tier1	no_errors	ENST00000387314	ensembl	human	known	74_37	rna	55.58	0.00	SNP	NULL	A	284	227
RPL23AP7	118433	genome.wustl.edu	37	2	114369629	114369629	+	RNA	SNP	G	G	T	rs112337169	byFrequency	TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr2:114369629G>T	ENST00000416673.2	-	0	527					NR_000029.3				ribosomal protein L23a pseudogene 7																		GTTTCTCCTGGGGGTGCTCTT	0.532													ENSG00000240356																																					0																																												0			-	BC000596		2q14	2009-03-11				ENSG00000240356		"""L ribosomal proteins"""	17336	pseudogene	pseudogene						19123937	Standard	NR_000029		Approved	RPL23AL1, bA395L14.9	uc010yxy.1				2.37:g.114369629G>T				R	SNP	-	NULL	ENST00000416673.2	37	NULL		2																																																																																			rs112337169	RPL23AP7	-	-		0.532	RPL23AP7-003	KNOWN	basic	processed_transcript	RPL23AP7	HGNC	pseudogene	OTTHUMT00000397215.1	0	0	0	28	28	3	0.00	0.00	G			114369629	-1	14	0	44	1	tier1	no_errors	ENST00000391616	ensembl	human	known	74_37	rna	24.14	0.00	SNP	1.000	T	14	44
SLC12A3	6559	genome.wustl.edu	37	16	56901059	56901059	+	Silent	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr16:56901059C>T	ENST00000563236.1	+	2	385	c.360C>T	c.(358-360)ggC>ggT	p.G120G	SLC12A3_ENST00000438926.2_Silent_p.G120G|SLC12A3_ENST00000566786.1_Silent_p.G119G|SLC12A3_ENST00000262502.5_Silent_p.G119G			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	120					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TGGTGGAGGGCGAGGCAGGCA	0.652													ENSG00000070915																																					0													41.0	44.0	43.0					16																	56901059		2198	4300	6498	SO:0001819	synonymous_variant	0			-		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.360C>T	16.37:g.56901059C>T			A8MSJ2|C9JNN9	Silent	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.G120	ENST00000563236.1	37	c.360	CCDS58464.1	16																																																																																			-	SLC12A3	-	tigrfam_Na/K/Cl_cotransptS		0.652	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	HGNC	protein_coding	OTTHUMT00000432337.1	0	0	0	55	55	3	0.00	0.00	C			56901059	+1	4	0	40	8	tier1	no_errors	ENST00000438926	ensembl	human	known	74_37	silent	9.09	0.00	SNP	0.157	T	4	40
WISP2	8839	genome.wustl.edu	37	20	43343900	43343905	+	5'UTR	DEL	GTGAGC	GTGAGC	-	rs1980802|rs376618937|rs369745130|rs540165300|rs1980801|rs60539660|rs201204669	byFrequency	TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	GTGAGC	GTGAGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr20:43343900_43343905delGTGAGC	ENST00000190983.4	+	0	15_20				WISP2_ENST00000372868.2_Intron|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000372865.4_5'UTR|RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA	NM_003881.2	NP_003872.1	O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				gtgtgtgtgtgtgagcgcgcgcgcgc	0.568													ENSG00000064205																																					0																																										SO:0001623	5_prime_UTR_variant	0				AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000190983.4:c.-127GTGAGC>-	20.37:g.43343900_43343905delGTGAGC			B2R9N4|E1P612|Q6PEG3	R	DEL	-	NULL	ENST00000190983.4	37	NULL	CCDS13336.1	20																																																																																				WISP2	-	-		0.568	WISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000080484.2	0	0	0	0	0	0	0.00	0.00	GTGAGC	NM_003881		43343905	+1	0	0	0	0	tier1	no_errors	ENST00000497421	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.008:0.006:0.005:0.000:0.000:0.000	-	0	0
HSD17B1	3292	genome.wustl.edu	37	17	40705589	40705589	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr17:40705589G>A	ENST00000585807.1	+	3	4118	c.398G>A	c.(397-399)cGc>cAc	p.R133H	HSD17B1_ENST00000225929.5_Missense_Mutation_p.R133H|RP11-400F19.6_ENST00000590513.1_RNA|RP11-400F19.8_ENST00000585572.1_RNA	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	133					bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	ATGAAGAGGCGCGGTTCGGGA	0.637													ENSG00000108786																																					0													68.0	65.0	66.0					17																	40705589		2203	4300	6503	SO:0001583	missense	0			-		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.398G>A	17.37:g.40705589G>A	ENSP00000466799:p.Arg133His		B3KXS1|Q2M2L8	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pirsf_17beta_DH,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR	p.R133H	ENST00000585807.1	37	c.398	CCDS11428.1	17	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472432	0.26423	.	.	ENSG00000108786	ENST00000225929;ENST00000225928	D	0.93859	-3.3	4.41	3.42	0.39159	NAD(P)-binding domain (1);	0.157494	0.47852	D	0.000201	D	0.89955	0.6865	L	0.61387	1.9	0.29273	N	0.870515	P;B;P	0.46457	0.878;0.023;0.671	B;B;B	0.36845	0.234;0.008;0.216	D	0.86170	0.1599	10	0.59425	D	0.04	.	11.4182	0.49965	0.0:0.1833:0.8167:0.0	.	164;133;133	B3RFR9;B4DTD0;P14061	.;.;DHB1_HUMAN	H	133	ENSP00000225929:R133H	ENSP00000225928:R133H	R	+	2	0	HSD17B1	37959115	0.249000	0.23941	0.488000	0.27440	0.002000	0.02628	1.719000	0.38011	1.068000	0.40764	-0.181000	0.13052	CGC	-	HSD17B1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pirsf_17beta_DH,prints_Glc/ribitol_DH		0.637	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD17B1	HGNC	protein_coding	OTTHUMT00000450392.1	0	0	0	118	118	67	0.00	0.00	G	NM_000413		40705589	+1	24	3	187	43	tier1	no_errors	ENST00000585807	ensembl	human	known	74_37	missense	11.37	6.52	SNP	0.329	A	24	187
DPPA3P2	400206	genome.wustl.edu	37	14	36840727	36840727	+	RNA	SNP	T	T	A			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr14:36840727T>A	ENST00000557188.1	+	0	358									developmental pluripotency associated 3 pseudogene 2																		CTCCGAGACGTTGATAAAGAA	0.483													ENSG00000188831																																					0																																												0			-			14q13.3	2012-07-04			ENSG00000188831	ENSG00000188831			20417	pseudogene	pseudogene							Standard	NG_023379		Approved	STELLAR			OTTHUMG00000170728		14.37:g.36840727T>A				R	SNP	-	NULL	ENST00000557188.1	37	NULL		14																																																																																			-	DPPA3P2	-	-		0.483	DPPA3P2-002	KNOWN	basic	processed_transcript	DPPA3P2	HGNC	pseudogene	OTTHUMT00000410122.1	0	0	0	76	76	61	0.00	0.00	T			36840727	+1	14	3	134	51	tier1	no_errors	ENST00000557188	ensembl	human	known	74_37	rna	9.46	5.56	SNP	0.013	A	14	134
C9orf171	389799	genome.wustl.edu	37	9	135374153	135374153	+	Silent	SNP	C	C	T			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr9:135374153C>T	ENST00000343036.2	+	3	423	c.375C>T	c.(373-375)atC>atT	p.I125I	C9orf171_ENST00000393216.2_Silent_p.I89I|C9orf171_ENST00000393215.3_Silent_p.I89I	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	125										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GACTCTACATCCGAGGGCTTG	0.577													ENSG00000188523																																					0													28.0	27.0	27.0					9																	135374153		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.375C>T	9.37:g.135374153C>T			Q147X1	Silent	SNP	NULL	p.I125	ENST00000343036.2	37	c.375	CCDS6949.1	9																																																																																			-	C9orf171	-	NULL		0.577	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf171	HGNC	protein_coding	OTTHUMT00000254589.1	0	0	0	56	56	65	0.00	0.00	C	NM_207417		135374153	+1	10	2	94	61	tier1	no_errors	ENST00000343036	ensembl	human	known	74_37	silent	9.62	3.17	SNP	0.624	T	10	94
SORCS1	114815	genome.wustl.edu	37	10	108458981	108458981	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr10:108458981G>C	ENST00000263054.6	-	9	1411	c.1404C>G	c.(1402-1404)gaC>gaG	p.D468E	SORCS1_ENST00000344440.6_Missense_Mutation_p.D468E|SORCS1_ENST00000369698.1_Missense_Mutation_p.D3E	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	468					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCTCATAGAGGTCGATCATGA	0.532													ENSG00000108018																																					0													211.0	163.0	179.0					10																	108458981		2203	4300	6503	SO:0001583	missense	0			-	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1404C>G	10.37:g.108458981G>C	ENSP00000263054:p.Asp468Glu		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.D468E	ENST00000263054.6	37	c.1404	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907001	0.52333	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.35605	1.3;1.3;1.3	6.16	6.16	0.99307	VPS10 (1);	0.105384	0.64402	D	0.000006	T	0.54806	0.1881	M	0.87617	2.895	0.44985	D	0.998003	B;P;P;B;P	0.35894	0.189;0.526;0.526;0.189;0.526	B;B;B;B;B	0.41723	0.085;0.365;0.365;0.085;0.365	T	0.54268	-0.8319	9	.	.	.	-31.7395	20.8598	0.99761	0.0:0.0:1.0:0.0	.	468;468;468;468;468	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	E	3;468;468	ENSP00000358712:D3E;ENSP00000263054:D468E;ENSP00000345964:D468E	.	D	-	3	2	SORCS1	108448971	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.683000	0.54663	2.937000	0.99478	0.650000	0.86243	GAC	-	SORCS1	-	smart_VPS10		0.532	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	0	0	0	41	41	56	0.00	0.00	G	NM_052918		108458981	-1	4	2	46	30	tier1	no_errors	ENST00000344440	ensembl	human	known	74_37	missense	8.00	6.25	SNP	1.000	C	4	46
AHNAK	79026	genome.wustl.edu	37	11	62298096	62298096	+	Missense_Mutation	SNP	G	G	A	rs150191644		TCGA-DX-A48P-01A-11D-A307-09	TCGA-DX-A48P-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3a574115-0820-47a8-a5fc-3cce465c23c3	6b704732-d99f-45ab-8e4b-ba2b8912031e	g.chr11:62298096G>A	ENST00000378024.4	-	5	4067	c.3793C>T	c.(3793-3795)Cct>Tct	p.P1265S	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1265					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTGAAGCCAGGCATGCTAAAC	0.522													ENSG00000124942																																					0													235.0	244.0	241.0					11																	62298096		2202	4299	6501	SO:0001583	missense	0			-	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3793C>T	11.37:g.62298096G>A	ENSP00000367263:p.Pro1265Ser		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P1265S	ENST00000378024.4	37	c.3793	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	g	15.41	2.825408	0.50739	.	.	ENSG00000124942	ENST00000378024	T	0.02944	4.1	4.66	4.66	0.58398	.	0.000000	0.30193	U	0.010193	T	0.08492	0.0211	L	0.58810	1.83	0.30081	N	0.809181	P	0.43392	0.805	P	0.56042	0.79	T	0.01652	-1.1303	10	0.31617	T	0.26	.	10.4145	0.44314	0.0924:0.0:0.9076:0.0	.	1265	Q09666	AHNK_HUMAN	S	1265	ENSP00000367263:P1265S	ENSP00000367263:P1265S	P	-	1	0	AHNAK	62054672	0.002000	0.14202	0.998000	0.56505	0.951000	0.60555	0.200000	0.17257	2.310000	0.77875	0.650000	0.86243	CCT	-	AHK	-	NULL		0.522	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK	HGNC	protein_coding	OTTHUMT00000395572.1	0	0	0	203	203	32	0.00	0.00	G	NM_024060		62298096	-1	47	3	300	28	tier1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	13.51	9.68	SNP	1.000	A	47	300
