#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ABCA13	154664	genome.wustl.edu	37	7	48314976	48314976	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr7:48314976G>T	ENST00000435803.1	+	17	5737	c.5713G>T	c.(5713-5715)Gaa>Taa	p.E1905*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1905					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GGAGCTCTCTGAAGTCTTCCA	0.373													ENSG00000179869																																					0													93.0	97.0	95.0					7																	48314976		1824	4072	5896	SO:0001587	stop_gained	0			-	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5713G>T	7.37:g.48314976G>T	ENSP00000411096:p.Glu1905*		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E1905*	ENST00000435803.1	37	c.5713	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	42	9.625111	0.99223	.	.	ENSG00000179869	ENST00000435803	.	.	.	5.95	3.17	0.36434	.	0.249386	0.27871	N	0.017509	.	.	.	.	.	.	0.19575	N	0.999968	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7605	0.40530	0.0701:0.2629:0.667:0.0	.	.	.	.	X	1905	.	.	E	+	1	0	ABCA13	48285522	0.924000	0.31332	0.001000	0.08648	0.002000	0.02628	1.848000	0.39309	0.407000	0.25591	-0.172000	0.13284	GAA	-	ABCA13	-	NULL		0.373	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	0	0	0	105	105	110	0.00	0.00	G	NM_152701		48314976	+1	43	45	49	51	tier1	no_errors	ENST00000435803	ensembl	human	known	74_37	nonsense	46.74	46.88	SNP	0.014	T	43	49
PKHD1	5314	genome.wustl.edu	37	6	51930781	51930781	+	Silent	SNP	G	G	C			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr6:51930781G>C	ENST00000371117.3	-	12	1148	c.873C>G	c.(871-873)acC>acG	p.T291T	PKHD1_ENST00000340994.4_Silent_p.T291T	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	291	IPT/TIG 3.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TACCTGCAATGGTAACCTGGG	0.403													ENSG00000170927																																					0													95.0	94.0	94.0					6																	51930781		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.873C>G	6.37:g.51930781G>C			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.T291	ENST00000371117.3	37	c.873	CCDS4935.1	6																																																																																			-	PKHD1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT		0.403	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	0	0	0	319	319	105	0.00	0.00	G	NM_138694		51930781	-1	150	65	152	76	tier1	no_errors	ENST00000371117	ensembl	human	known	74_37	silent	49.67	46.10	SNP	0.006	C	150	152
SNHG14	104472715	genome.wustl.edu	37	15	25328601	25328601	+	RNA	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr15:25328601C>T	ENST00000546682.1	+	0	247				SNHG14_ENST00000549804.2_RNA|SNHG14_ENST00000553108.1_RNA|SNORD116-17_ENST00000383929.1_RNA|SNORD116-18_ENST00000383961.1_RNA|SNORD116-16_ENST00000384533.1_RNA|SNORD116-15_ENST00000384445.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		CTTGTGCGATCCTTGGAGATG	0.502													ENSG00000224078																																					0																																												0			-			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25328601C>T				R	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			-	SNHG14	-	-		0.502	SNHG14-022	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408281.1	0	0	1	246	246	115	0.00	0.86	C			25328601	+1	117	44	117	26	tier1	no_errors	ENST00000383025	ensembl	human	known	74_37	rna	50.00	62.86	SNP	0.002	T	117	117
MUC16	94025	genome.wustl.edu	37	19	9066039	9066039	+	Missense_Mutation	SNP	G	G	A	rs376066548		TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:9066039G>A	ENST00000397910.4	-	3	21610	c.21407C>T	c.(21406-21408)aCg>aTg	p.T7136M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7138	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCTGTGGTCGTTACCGGGCT	0.522													ENSG00000181143																																					0								T	MET/THR	1,4119		0,1,2059	204.0	187.0	193.0		21407	-5.6	0.0	19		193	0,8402		0,0,4201	no	missense	MUC16	NM_024690.2	81	0,1,6260	AA,AG,GG		0.0,0.0243,0.0080	probably-damaging	7136/14508	9066039	1,12521	2060	4201	6261	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21407C>T	19.37:g.9066039G>A	ENSP00000381008:p.Thr7136Met		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T7136M	ENST00000397910.4	37	c.21407	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.249	-1.007904	0.02112	2.43E-4	0.0	ENSG00000181143	ENST00000397910	T	0.22945	1.93	2.8	-5.6	0.02497	.	.	.	.	.	T	0.16811	0.0404	N	0.12182	0.205	.	.	.	D	0.67145	0.996	P	0.50659	0.647	T	0.43410	-0.9393	8	0.87932	D	0	.	7.0817	0.25235	0.0:0.1914:0.4767:0.3318	.	7136	B5ME49	.	M	7136	ENSP00000381008:T7136M	ENSP00000381008:T7136M	T	-	2	0	MUC16	8927039	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.686000	0.00198	-2.963000	0.00289	-1.974000	0.00461	ACG	-	MUC16	-	NULL		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	1	272	272	141	0.00	0.70	G	NM_024690		9066039	-1	128	47	127	58	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	50.20	44.76	SNP	0.000	A	128	127
COL6A1	1291	genome.wustl.edu	37	21	47423972	47423972	+	3'UTR	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr21:47423972C>T	ENST00000361866.3	+	0	3246				COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CCACCCCTCCCCACTCATCAC	0.547													ENSG00000142156																																					0													25.0	29.0	27.0					21																	47423972		2200	4294	6494	SO:0001624	3_prime_UTR_variant	0			-	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.*45C>T	21.37:g.47423972C>T			O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	R	SNP	-	NULL	ENST00000361866.3	37	NULL	CCDS13727.1	21																																																																																			-	COL6A1	-	-		0.547	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	0	0	0	76	76	82	0.00	0.00	C	NM_001848		47423972	+1	14	13	66	54	tier1	no_errors	ENST00000486023	ensembl	human	known	74_37	rna	17.28	19.40	SNP	0.010	T	14	66
HIST2H3PS2	440686	genome.wustl.edu	37	1	149400241	149400241	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr1:149400241A>T	ENST00000392948.2	-	1	301	c.302T>A	c.(301-303)cTg>cAg	p.L101Q	RP5-998N21.10_ENST00000609879.1_RNA|HIST2H2BB_ENST00000609585.1_RNA|RP5-998N21.7_ENST00000444624.1_RNA					histone cluster 2, H3, pseudogene 2											lung(1)|ovary(1)	2						CAGCCCCACCAGGTAGGCCTC	0.637													ENSG00000203818																																					0													24.0	26.0	26.0					1																	149400241		687	1559	2246	SO:0001583	missense	0			-	AL109948		1q21.1	2012-04-11	2006-10-11		ENSG00000203818	ENSG00000203818		"""Histones / Replication-dependent"""	32060	pseudogene	pseudogene			"""histone 2, H3, pseudogene 2"""				Standard	NG_012783		Approved	p06			OTTHUMG00000041033	ENST00000392948.2:c.302T>A	1.37:g.149400241A>T	ENSP00000476960:p.Leu101Gln			Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.L101Q	ENST00000392948.2	37	c.302		1	.	.	.	.	.	.	.	.	.	.	a	14.78	2.638214	0.47153	.	.	ENSG00000203818	ENST00000392948	.	.	.	1.98	1.98	0.26296	.	5.481260	0.02400	U	0.080604	T	0.50429	0.1615	.	.	.	0.48632	D	0.999689	.	.	.	.	.	.	T	0.55425	-0.8143	6	0.72032	D	0.01	.	7.9484	0.29999	1.0:0.0:0.0:0.0	.	.	.	.	Q	101	.	ENSP00000376675:L101Q	L	-	2	0	HIST2H3PS2	147666865	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.422000	0.73357	1.166000	0.42689	0.369000	0.22263	CTG	-	HIST2H3PS2	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.637	HIST2H3PS2-001	PUTATIVE	basic|appris_principal	protein_coding	HIST2H3PS2	HGNC	protein_coding	OTTHUMT00000098436.3	0	0	0	729	729	46	0.00	0.00	A	NG_012783		149400241	-1	171	16	604	47	tier1	no_errors	ENST00000392948	ensembl	human	putative	74_37	missense	22.06	25.40	SNP	1.000	T	171	604
MAGI2	9863	genome.wustl.edu	37	7	78636524	78636524	+	Splice_Site	SNP	T	T	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr7:78636524T>A	ENST00000354212.4	-	2	555		c.e2-2		MAGI2-AS2_ENST00000411616.1_RNA|MAGI2_ENST00000522391.1_Splice_Site|MAGI2_ENST00000419488.1_Splice_Site	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2						cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CAATTCCTCCTAAAAATAAAA	0.353													ENSG00000187391																																					0													71.0	67.0	69.0					7																	78636524		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.302-2A>T	7.37:g.78636524T>A			A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Splice_Site	SNP	-	e2-2	ENST00000354212.4	37	c.302-2	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	T	21.3	4.122420	0.77436	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2353	0.65922	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAGI2	78474460	1.000000	0.71417	0.968000	0.41197	0.803000	0.45373	7.902000	0.87389	1.960000	0.56953	0.467000	0.42956	.	-	MAGI2	-	-		0.353	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	0	0	0	78	78	68	0.00	0.00	T	NM_012301	Intron	78636524	-1	16	29	54	59	tier1	no_errors	ENST00000354212	ensembl	human	known	74_37	splice_site	22.86	32.58	SNP	1.000	A	16	54
MEIG1	644890	genome.wustl.edu	37	10	15014543	15014543	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr10:15014543A>G	ENST00000378240.1	+	2	200	c.170A>G	c.(169-171)aAg>aGg	p.K57R	MEIG1_ENST00000407572.1_Missense_Mutation_p.K57R			Q5JSS6	MEIG1_HUMAN	meiosis/spermiogenesis associated 1	57					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)				kidney(1)|ovary(1)|prostate(1)	3						GGATATGTGAAGAAACTTCAG	0.383													ENSG00000197889																																					0													186.0	175.0	179.0					10																	15014543		2203	4300	6503	SO:0001583	missense	0			-		CCDS31151.1	10p13	2013-08-05	2013-08-05		ENSG00000197889	ENSG00000197889			23429	protein-coding gene	gene with protein product	"""spermatogenesis associated 39"""	614174	"""meiosis expressed gene 1 homolog (mouse)"""			23258628	Standard	NM_001080836		Approved	bA2K17.3, SPATA39	uc009xjk.1	Q5JSS6	OTTHUMG00000017717	ENST00000378240.1:c.170A>G	10.37:g.15014543A>G	ENSP00000367486:p.Lys57Arg			Missense_Mutation	SNP	NULL	p.K57R	ENST00000378240.1	37	c.170	CCDS31151.1	10	.	.	.	.	.	.	.	.	.	.	a	19.23	3.788353	0.70337	.	.	ENSG00000197889	ENST00000407572;ENST00000378240	T;T	0.52983	0.64;0.64	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.67618	0.2912	.	.	.	0.54753	D	0.999986	D	0.67145	0.996	D	0.73708	0.981	T	0.69327	-0.5174	9	0.45353	T	0.12	-13.0612	14.9494	0.71060	1.0:0.0:0.0:0.0	.	57	Q5JSS6	MEIG1_HUMAN	R	57	ENSP00000384334:K57R;ENSP00000367486:K57R	ENSP00000367486:K57R	K	+	2	0	MEIG1	15054549	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.739000	0.84976	2.005000	0.58758	0.533000	0.62120	AAG	-	MEIG1	-	NULL		0.383	MEIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIG1	HGNC	protein_coding	OTTHUMT00000046942.1	0	0	0	173	173	142	0.00	0.00	A	XM_927975		15014543	+1	69	42	84	52	tier1	no_errors	ENST00000378240	ensembl	human	known	74_37	missense	45.10	44.68	SNP	1.000	G	69	84
PSTPIP2	9050	genome.wustl.edu	37	18	43571883	43571883	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr18:43571883C>T	ENST00000409746.5	-	12	976	c.905G>A	c.(904-906)gGg>gAg	p.G302E	RN7SKP26_ENST00000410247.1_RNA|PSTPIP2_ENST00000589328.1_Missense_Mutation_p.G270S|PSTPIP2_ENST00000588801.1_Intron	NM_024430.3	NP_077748.3	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting protein 2	302						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	17						CAAGTTAGGCCCTGTAGCCTT	0.408													ENSG00000152229																																					0													105.0	101.0	102.0					18																	43571883		2203	4300	6503	SO:0001583	missense	0			-		CCDS32820.2	18q12	2008-07-28			ENSG00000152229	ENSG00000152229			9581	protein-coding gene	gene with protein product						9804817	Standard	NM_024430		Approved		uc002lbp.4	Q9H939	OTTHUMG00000152674	ENST00000409746.5:c.905G>A	18.37:g.43571883C>T	ENSP00000387261:p.Gly302Glu			Missense_Mutation	SNP	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.G302E	ENST00000409746.5	37	c.905	CCDS32820.2	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.64|15.64	2.893957|2.893957	0.52121|0.52121	.|.	.|.	ENSG00000152229|ENSG00000152229	ENST00000409746|ENST00000360076	T|.	0.34859|.	1.34|.	5.42|5.42	2.52|2.52	0.30459|0.30459	.|.	0.372077|0.372077	0.28156|0.28156	N|N	0.016390|0.016390	T|T	0.33731|0.33731	0.0873|0.0873	M|M	0.64997|0.64997	1.995|1.995	0.19575|0.19575	N|N	0.999964|0.999964	P|B	0.51653|0.33238	0.947|0.403	P|B	0.46659|0.25291	0.523|0.059	T|T	0.28170|0.28170	-1.0052|-1.0052	10|9	0.18710|0.07325	T|T	0.47|0.83	.|.	14.4271|14.4271	0.67222|0.67222	0.0:0.5724:0.4276:0.0|0.0:0.5724:0.4276:0.0	.|.	302|270	Q9H939|Q9H939-2	PPIP2_HUMAN|.	E|S	302|270	ENSP00000387261:G302E|.	ENSP00000387261:G302E|ENSP00000353189:G270S	G|G	-|-	2|1	0|0	PSTPIP2|PSTPIP2	41825881|41825881	0.101000|0.101000	0.21875|0.21875	0.013000|0.013000	0.15412|0.15412	0.165000|0.165000	0.22458|0.22458	-0.126000|-0.126000	0.10563|0.10563	0.301000|0.301000	0.22738|0.22738	-0.224000|-0.224000	0.12420|0.12420	GGG|GGC	-	PSTPIP2	-	NULL		0.408	PSTPIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSTPIP2	HGNC	protein_coding	OTTHUMT00000327522.1	0	0	1	128	128	94	0.00	1.05	C			43571883	-1	63	28	67	36	tier1	no_errors	ENST00000409746	ensembl	human	known	74_37	missense	48.09	43.08	SNP	0.170	T	63	67
LINC01330	646168	genome.wustl.edu	37	3	167632987	167632987	+	lincRNA	SNP	C	C	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr3:167632987C>A	ENST00000481578.1	+	0	630																											CATAAGATTGCCAAGGTATCT	0.393													ENSG00000244227																																					0																																												0			-																													3.37:g.167632987C>A				R	SNP	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			-	RP11-298O21.5	-	-		0.393	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	Clone_based_vega_gene	lincRNA	OTTHUMT00000351188.1	0	0	0	109	109	104	0.00	0.00	C			167632987	+1	72	43	56	27	tier1	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	56.25	61.43	SNP	1.000	A	72	56
HFM1	164045	genome.wustl.edu	37	1	91726828	91726828	+	3'UTR	SNP	T	T	C			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr1:91726828T>C	ENST00000370425.3	-	0	4425				HFM1_ENST00000370424.3_3'UTR|HFM1_ENST00000294696.5_3'UTR|HFM1_ENST00000462405.1_5'UTR|Y_RNA_ENST00000384090.1_RNA	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)						resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CTTATCAATATAAAAAGTATT	0.279													ENSG00000162669																																					0													25.0	21.0	23.0					1																	91726828		1719	3926	5645	SO:0001624	3_prime_UTR_variant	0			-	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.*19A>G	1.37:g.91726828T>C			B1B0B6|Q8N9Q0	R	SNP	-	NULL	ENST00000370425.3	37	NULL	CCDS30769.2	1																																																																																			-	HFM1	-	-		0.279	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HFM1	HGNC	protein_coding	OTTHUMT00000316716.2	0	0	0	89	89	54	0.00	0.00	T	NM_001017975		91726828	-1	41	51	51	66	tier1	no_errors	ENST00000462405	ensembl	human	known	74_37	rna	44.57	43.59	SNP	0.000	C	41	51
MPDZ	8777	genome.wustl.edu	37	9	13223587	13223587	+	Silent	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr9:13223587C>T	ENST00000319217.7	-	5	763	c.516G>A	c.(514-516)gaG>gaA	p.E172E	MPDZ_ENST00000381015.4_Silent_p.E172E|MPDZ_ENST00000447879.1_Silent_p.E172E|MPDZ_ENST00000541718.1_Silent_p.E172E|MPDZ_ENST00000546205.1_Silent_p.E172E|MPDZ_ENST00000536827.1_Silent_p.E172E|MPDZ_ENST00000381022.2_Silent_p.E172E	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	172	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CCACACTGCCCTCTTGTATCT	0.443													ENSG00000107186																																					0													99.0	97.0	98.0					9																	13223587		1864	4110	5974	SO:0001819	synonymous_variant	0			-	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.516G>A	9.37:g.13223587C>T			A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.E172	ENST00000319217.7	37	c.516		9																																																																																			-	MPDZ	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.443	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2	0	0	1	125	125	123	0.00	0.81	C	NM_003829		13223587	-1	44	37	63	38	tier1	no_errors	ENST00000319217	ensembl	human	known	74_37	silent	41.12	49.33	SNP	0.997	T	44	63
MYH2	4620	genome.wustl.edu	37	17	10432961	10432961	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr17:10432961G>C	ENST00000245503.5	-	24	3421	c.3037C>G	c.(3037-3039)Ctg>Gtg	p.L1013V	MYH2_ENST00000532183.2_Intron|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.L1013V	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1013					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						AGGTCATCCAGGGTCTGCTGG	0.488													ENSG00000125414																																					0													149.0	146.0	147.0					17																	10432961		2202	4281	6483	SO:0001583	missense	0			-		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3037C>G	17.37:g.10432961G>C	ENSP00000245503:p.Leu1013Val		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SRE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1013V	ENST00000245503.5	37	c.3037	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070279	0.76301	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	D;D	0.87256	-2.23;-2.23	5.24	5.24	0.73138	.	0.000000	0.31312	U	0.007879	D	0.95449	0.8522	H	0.94503	3.545	0.58432	D	0.999997	D	0.71674	0.998	D	0.70016	0.967	D	0.96265	0.9194	10	0.72032	D	0.01	.	19.0151	0.92890	0.0:0.0:1.0:0.0	.	1013	Q9UKX2	MYH2_HUMAN	V	1013	ENSP00000245503:L1013V;ENSP00000380367:L1013V	ENSP00000245503:L1013V	L	-	1	2	MYH2	10373686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.144000	0.71762	2.718000	0.92993	0.591000	0.81541	CTG	-	MYH2	-	superfamily_Prefoldin		0.488	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	0	0	0	373	373	47	0.00	0.00	G	NM_017534		10432961	-1	953	121	3600	487	tier1	no_errors	ENST00000245503	ensembl	human	known	74_37	missense	20.91	19.90	SNP	1.000	C	953	3600
TTN	7273	genome.wustl.edu	37	2	179431620	179431620	+	Silent	SNP	A	A	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr2:179431620A>G	ENST00000591111.1	-	276	74540	c.74316T>C	c.(74314-74316)gaT>gaC	p.D24772D	TTN_ENST00000342992.6_Silent_p.D23845D|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.D17540D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.D17473D|TTN_ENST00000460472.2_Silent_p.D17348D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Silent_p.D26413D			Q8WZ42	TITIN_HUMAN	titin	24772	Fibronectin type-III 80. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTTCCACCATCACTATCTG	0.408													ENSG00000155657																																					0													70.0	68.0	68.0					2																	179431620		1873	4104	5977	SO:0001819	synonymous_variant	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.74316T>C	2.37:g.179431620A>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.D23845	ENST00000591111.1	37	c.71535		2																																																																																			-	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	63	63	98	0.00	0.00	A	NM_133378		179431620	-1	36	26	41	52	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	46.75	32.91	SNP	1.000	G	36	41
HLTF	6596	genome.wustl.edu	37	3	148792110	148792110	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr3:148792110C>T	ENST00000310053.5	-	4	614	c.421G>A	c.(421-423)Gct>Act	p.A141T	HLTF_ENST00000465259.1_Missense_Mutation_p.A141T|HLTF_ENST00000494055.1_Missense_Mutation_p.A141T|HLTF_ENST00000392912.2_Missense_Mutation_p.A141T	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	141					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATGGTAAAAGCATTGTTTGCA	0.353													ENSG00000071794																																					0													88.0	87.0	87.0					3																	148792110		2203	4300	6503	SO:0001583	missense	0			-	L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.421G>A	3.37:g.148792110C>T	ENSP00000308944:p.Ala141Thr		D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HIP116_Rad5p_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HIP116_Rad5p_N,smart_Helicase_ATP-bd,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A141T	ENST00000310053.5	37	c.421	CCDS33875.1	3	.	.	.	.	.	.	.	.	.	.	C	11.07	1.529686	0.27387	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000416117;ENST00000392913	D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54	5.4	0.21	0.15231	HIP116, Rad5p N-terminal (2);	.	.	.	.	T	0.76793	0.4037	L	0.28192	0.835	0.33259	D	0.559556	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.64601	-0.6369	9	0.13853	T	0.58	-13.9535	5.1953	0.15233	0.1331:0.5597:0.0:0.3072	.	141;141;141	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	T	141;141;141;141;138;138	ENSP00000420745:A141T;ENSP00000308944:A141T;ENSP00000376644:A141T;ENSP00000420429:A141T	ENSP00000308944:A141T	A	-	1	0	HLTF	150274800	0.755000	0.28372	0.997000	0.53966	0.980000	0.70556	-0.183000	0.09712	0.018000	0.15052	-0.274000	0.10170	GCT	-	HLTF	-	pfam_HIP116_Rad5p_N,smart_HIP116_Rad5p_N		0.353	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HLTF	HGNC	protein_coding	OTTHUMT00000356064.1	0	0	0	62	62	106	0.00	0.00	C			148792110	-1	24	43	59	114	tier1	no_errors	ENST00000310053	ensembl	human	known	74_37	missense	28.92	27.39	SNP	0.996	T	24	59
SLC2A2	6514	genome.wustl.edu	37	3	170723821	170723821	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr3:170723821G>A	ENST00000314251.3	-	6	765	c.686C>T	c.(685-687)gCc>gTc	p.A229V	SLC2A2_ENST00000382808.4_Missense_Mutation_p.A110V	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	229					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	CTGAAGGATGGCTCGCACACC	0.423													ENSG00000163581																																					0													112.0	105.0	107.0					3																	170723821		2203	4299	6502	SO:0001583	missense	0			-	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.686C>T	3.37:g.170723821G>A	ENSP00000323568:p.Ala229Val		A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_2,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.A229V	ENST00000314251.3	37	c.686	CCDS3215.1	3	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250532	0.59212	.	.	ENSG00000163581	ENST00000314251;ENST00000382808;ENST00000461867	T;T;T	0.78595	-1.19;-1.19;-1.19	5.62	4.75	0.60458	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.88055	0.6334	M	0.89601	3.045	0.80722	D	1	D	0.54397	0.966	P	0.58391	0.838	D	0.90219	0.4270	10	0.62326	D	0.03	.	14.0613	0.64802	0.0724:0.0:0.9276:0.0	.	229	P11168	GTR2_HUMAN	V	229;110;56	ENSP00000323568:A229V;ENSP00000372258:A110V;ENSP00000418888:A56V	ENSP00000323568:A229V	A	-	2	0	SLC2A2	172206515	1.000000	0.71417	0.074000	0.20217	0.026000	0.11368	9.441000	0.97557	1.528000	0.49103	0.650000	0.86243	GCC	-	SLC2A2	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.423	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A2	HGNC	protein_coding	OTTHUMT00000352834.1	0	0	0	61	61	58	0.00	0.00	G	NM_000340		170723821	-1	19	30	17	13	tier1	no_errors	ENST00000314251	ensembl	human	known	74_37	missense	52.78	69.77	SNP	0.998	A	19	17
MYH2	4620	genome.wustl.edu	37	17	10432929	10432929	+	Silent	SNP	G	G	C			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr17:10432929G>C	ENST00000245503.5	-	24	3453	c.3069C>G	c.(3067-3069)gtC>gtG	p.V1023V	MYH2_ENST00000532183.2_Intron|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Silent_p.V1023V	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1023					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TCAGGGTGTTGACTTTGTCCT	0.463													ENSG00000125414																																					0													203.0	193.0	196.0					17																	10432929		2203	4297	6500	SO:0001819	synonymous_variant	0			-		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3069C>G	17.37:g.10432929G>C			A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SRE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1023	ENST00000245503.5	37	c.3069	CCDS11156.1	17																																																																																			-	MYH2	-	superfamily_Prefoldin		0.463	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	0	0	0	443	443	55	0.00	0.00	G	NM_017534		10432929	-1	1107	155	4268	607	tier1	no_errors	ENST00000245503	ensembl	human	known	74_37	silent	20.57	20.26	SNP	1.000	C	1107	4268
ROM1	6094	genome.wustl.edu	37	11	62381881	62381881	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr11:62381881C>T	ENST00000278833.3	+	2	1283	c.742C>T	c.(742-744)Ctc>Ttc	p.L248F	ROM1_ENST00000534093.1_Silent_p.T38T|EML3_ENST00000394773.2_5'Flank|EML3_ENST00000529309.1_5'Flank|EML3_ENST00000494176.2_5'Flank|EML3_ENST00000278845.4_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	248					camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						CAACCAAAACCTCTGGGCCCA	0.607													ENSG00000149489																																					0													85.0	83.0	83.0					11																	62381881		2202	4299	6501	SO:0001583	missense	0			-	L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.742C>T	11.37:g.62381881C>T	ENSP00000278833:p.Leu248Phe		B2R978	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Peripherin/rom-1	p.L248F	ENST00000278833.3	37	c.742	CCDS8024.1	11	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154672	0.78114	.	.	ENSG00000149489	ENST00000278833	T	0.80566	-1.39	5.38	5.38	0.77491	Tetraspanin, EC2 domain (1);	0.406771	0.24417	N	0.038709	D	0.89227	0.6655	M	0.73962	2.25	0.45502	D	0.998462	D	0.76494	0.999	D	0.75020	0.985	D	0.90126	0.4203	10	0.72032	D	0.01	-30.1864	16.6182	0.84922	0.0:1.0:0.0:0.0	.	248	Q03395	ROM1_HUMAN	F	248	ENSP00000278833:L248F	ENSP00000278833:L248F	L	+	1	0	ROM1	62138457	0.981000	0.34729	1.000000	0.80357	0.979000	0.70002	0.539000	0.23175	2.514000	0.84764	0.462000	0.41574	CTC	-	ROM1	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2		0.607	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROM1	HGNC	protein_coding	OTTHUMT00000394929.1	0	0	1	63	63	110	0.00	0.90	C	NM_000327		62381881	+1	22	44	42	40	tier1	no_errors	ENST00000278833	ensembl	human	known	74_37	missense	34.38	52.38	SNP	1.000	T	22	42
ARFGEF1	10565	genome.wustl.edu	37	8	68113722	68113722	+	Silent	SNP	C	C	T	rs141949495	byFrequency	TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr8:68113722C>T	ENST00000262215.3	-	37	5636	c.5247G>A	c.(5245-5247)gaG>gaA	p.E1749E	ARFGEF1_ENST00000518230.1_Silent_p.E587E|ARFGEF1_ENST00000520381.1_Silent_p.E1203E|ARFGEF1_ENST00000517955.1_5'UTR	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1749					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCTGCTGGACCTCCTCCCAGG	0.582													ENSG00000066777																																					0													71.0	65.0	67.0					8																	68113722		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.5247G>A	8.37:g.68113722C>T			Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.E1749	ENST00000262215.3	37	c.5247	CCDS6199.1	8																																																																																			-	ARFGEF1	-	NULL		0.582	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	0	0	0	93	93	91	0.00	0.00	C	NM_006421		68113722	-1	46	24	29	26	tier1	no_errors	ENST00000262215	ensembl	human	known	74_37	silent	61.33	48.00	SNP	1.000	T	46	29
JAG1	182	genome.wustl.edu	37	20	10625904	10625904	+	Splice_Site	SNP	C	C	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr20:10625904C>G	ENST00000254958.5	-	17	2629	c.2114G>C	c.(2113-2115)cGt>cCt	p.R705P	JAG1_ENST00000488480.1_RNA|JAG1_ENST00000423891.2_Splice_Site_p.R546P	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	705	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						CTGACTGTCACCTGGAGGAAA	0.547									Alagille Syndrome				ENSG00000101384																																					0													112.0	97.0	102.0					20																	10625904		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	-	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2114-1G>C	20.37:g.10625904C>G			A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,smart_DSL,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom	p.R705P	ENST00000254958.5	37	c.2114	CCDS13112.1	20	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554516	0.86231	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.87491	-2.26;-2.26	5.52	5.52	0.82312	Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.87402	0.6168	M	0.69823	2.125	0.80722	D	1	P	0.42785	0.79	B	0.38327	0.271	D	0.89121	0.3503	10	0.72032	D	0.01	.	19.4741	0.94979	0.0:1.0:0.0:0.0	.	705	P78504	JAG1_HUMAN	P	705;546	ENSP00000254958:R705P;ENSP00000389519:R546P	ENSP00000254958:R705P	R	-	2	0	JAG1	10573904	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.818000	0.86416	2.595000	0.87683	0.655000	0.94253	CGT	-	JAG1	-	pfscan_EG-like_dom		0.547	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG1	HGNC	protein_coding		0	0	0	103	103	83	0.00	0.00	C	NM_000214	Missense_Mutation	10625904	-1	38	41	56	37	tier1	no_errors	ENST00000254958	ensembl	human	known	74_37	missense	40.00	51.90	SNP	1.000	G	38	56
MDN1	23195	genome.wustl.edu	37	6	90388356	90388356	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr6:90388356C>T	ENST00000369393.3	-	75	12489	c.12374G>A	c.(12373-12375)cGa>cAa	p.R4125Q	MDN1_ENST00000428876.1_Missense_Mutation_p.R4125Q|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4125					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.R4125L(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGACAAAGCTCGCTGTTTTTG	0.443													ENSG00000112159																																					1	Substitution - Missense(1)	lung(1)											190.0	171.0	177.0					6																	90388356		2203	4300	6503	SO:0001583	missense	0			-	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12374G>A	6.37:g.90388356C>T	ENSP00000358400:p.Arg4125Gln		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.R4125Q	ENST00000369393.3	37	c.12374	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285564	0.40394	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03358	3.96;3.96	4.92	4.92	0.64577	.	0.000000	0.64402	D	0.000002	T	0.10380	0.0254	M	0.63843	1.955	0.54753	D	0.999986	D	0.89917	1.0	D	0.80764	0.994	T	0.07177	-1.0786	10	0.45353	T	0.12	.	18.1211	0.89572	0.0:1.0:0.0:0.0	.	4125	Q9NU22	MDN1_HUMAN	Q	4125	ENSP00000358400:R4125Q;ENSP00000413970:R4125Q	ENSP00000358400:R4125Q	R	-	2	0	MDN1	90445077	1.000000	0.71417	0.998000	0.56505	0.077000	0.17291	7.382000	0.79729	2.277000	0.76020	0.561000	0.74099	CGA	-	MDN1	-	pirsf_Midasin		0.443	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	0	0	0	151	151	88	0.00	0.00	C			90388356	-1	84	59	83	46	tier1	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	50.30	56.19	SNP	1.000	T	84	83
GLP2R	9340	genome.wustl.edu	37	17	9760833	9760833	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr17:9760833C>G	ENST00000262441.5	+	6	1218	c.705C>G	c.(703-705)ttC>ttG	p.F235L	GLP2R_ENST00000574745.1_Missense_Mutation_p.F55L	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	235					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	ACGTCGTCTTCTACAACTCTT	0.507													ENSG00000065325																																					0													202.0	160.0	174.0					17																	9760833		2203	4300	6503	SO:0001583	missense	0			-	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.705C>G	17.37:g.9760833C>G	ENSP00000262441:p.Phe235Leu		Q4VAT3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.F235L	ENST00000262441.5	37	c.705	CCDS11150.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.33|10.33	1.321725|1.321725	0.23994|0.23994	.|.	.|.	ENSG00000065325|ENSG00000065325	ENST00000396206;ENST00000304773;ENST00000262441|ENST00000458005	T|.	0.37058|.	1.22|.	5.28|5.28	3.14|3.14	0.36123|0.36123	GPCR, family 2-like (1);|.	0.597927|.	0.14049|.	N|.	0.344913|.	T|T	0.12987|0.12987	0.0315|0.0315	N|N	0.01640|0.01640	-0.785|-0.785	0.09310|0.09310	N|N	1|1	B|.	0.09022|.	0.002|.	B|.	0.09377|.	0.004|.	T|T	0.18304|0.18304	-1.0341|-1.0341	10|5	0.02654|.	T|.	1|.	.|.	9.9952|9.9952	0.41896|0.41896	0.193:0.6841:0.1229:0.0|0.193:0.6841:0.1229:0.0	.|.	235|.	O95838|.	GLP2R_HUMAN|.	L|C	235;210;235|88	ENSP00000262441:F235L|.	ENSP00000262441:F235L|.	F|S	+|+	3|2	2|0	GLP2R|GLP2R	9701558|9701558	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.941000|0.941000	0.58515|0.58515	-0.077000|-0.077000	0.11394|0.11394	1.438000|1.438000	0.47492|0.47492	0.655000|0.655000	0.94253|0.94253	TTC|TCT	-	GLP2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.507	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	0	0	0	189	189	108	0.00	0.00	C			9760833	+1	513	228	1514	714	tier1	no_errors	ENST00000262441	ensembl	human	known	74_37	missense	25.30	24.15	SNP	0.000	G	513	1514
OR2T3	343173	genome.wustl.edu	37	1	248637398	248637398	+	Silent	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr1:248637398C>T	ENST00000359594.2	+	1	772	c.747C>T	c.(745-747)caC>caT	p.H249H		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTCCTCCCACATGATCATAG	0.547													ENSG00000196539																																					0																																										SO:0001819	synonymous_variant	0			-		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.747C>T	1.37:g.248637398C>T			B2RNJ1	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H249	ENST00000359594.2	37	c.747	CCDS31117.1	1																																																																																			-	OR2T3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.547	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	0	0	0	257	257	85	0.00	0.00	C	NM_001005495		248637398	+1	47	12	227	51	tier1	no_errors	ENST00000359594	ensembl	human	known	74_37	silent	17.15	19.05	SNP	0.911	T	47	227
KCNH5	27133	genome.wustl.edu	37	14	63269300	63269300	+	Splice_Site	SNP	C	C	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr14:63269300C>A	ENST00000322893.7	-	9	1838		c.e9-1		KCNH5_ENST00000420622.2_Splice_Site|KCNH5_ENST00000394968.1_Splice_Site	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5						potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TGGAGAGGACCTAAAGAAGGT	0.413													ENSG00000140015																																					0													33.0	35.0	34.0					14																	63269300		2203	4300	6503	SO:0001630	splice_region_variant	0			-	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1570-1G>T	14.37:g.63269300C>A			C9JP98	Splice_Site	SNP	-	e9-1	ENST00000322893.7	37	c.1570-1	CCDS9756.1	14	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586479	0.86851	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4311	0.94768	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KCNH5	62339053	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.776000	0.85560	2.681000	0.91329	0.563000	0.77884	.	-	KCNH5	-	-		0.413	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1	0	0	0	90	90	37	0.00	0.00	C	NM_139318	Intron	63269300	-1	49	24	45	12	tier1	no_errors	ENST00000322893	ensembl	human	known	74_37	splice_site	52.13	66.67	SNP	1.000	A	49	45
ROM1	6094	genome.wustl.edu	37	11	62381818	62381818	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr11:62381818C>T	ENST00000278833.3	+	2	1220	c.679C>T	c.(679-681)Caa>Taa	p.Q227*	ROM1_ENST00000534093.1_Silent_p.C17C|EML3_ENST00000394773.2_5'Flank|EML3_ENST00000529309.1_5'Flank|EML3_ENST00000494176.2_5'Flank|EML3_ENST00000278845.4_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	227					camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						GCCTTGCCTGCAAAACCGTCT	0.592													ENSG00000149489																																					0													126.0	121.0	123.0					11																	62381818		2202	4299	6501	SO:0001587	stop_gained	0			-	L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.679C>T	11.37:g.62381818C>T	ENSP00000278833:p.Gln227*		B2R978	Nonsense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Peripherin/rom-1	p.Q227*	ENST00000278833.3	37	c.679	CCDS8024.1	11	.	.	.	.	.	.	.	.	.	.	C	40	8.175031	0.98691	.	.	ENSG00000149489	ENST00000278833	.	.	.	5.38	5.38	0.77491	.	0.073762	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-25.2681	16.6182	0.84922	0.0:1.0:0.0:0.0	.	.	.	.	X	227	.	ENSP00000278833:Q227X	Q	+	1	0	ROM1	62138394	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	5.752000	0.68728	2.514000	0.84764	0.462000	0.41574	CAA	-	ROM1	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Peripherin/rom-1		0.592	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROM1	HGNC	protein_coding	OTTHUMT00000394929.1	0	0	0	70	70	108	0.00	0.00	C	NM_000327		62381818	+1	27	51	46	37	tier1	no_errors	ENST00000278833	ensembl	human	known	74_37	nonsense	36.49	57.95	SNP	1.000	T	27	46
GLP2R	9340	genome.wustl.edu	37	17	9760880	9760880	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr17:9760880C>G	ENST00000262441.5	+	6	1265	c.752C>G	c.(751-753)tCc>tGc	p.S251C	GLP2R_ENST00000574745.1_Missense_Mutation_p.S71C	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	251					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	GGGTGGATGTCCTACCTGTCA	0.522													ENSG00000065325																																					0													179.0	142.0	154.0					17																	9760880		2203	4300	6503	SO:0001583	missense	0			-	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.752C>G	17.37:g.9760880C>G	ENSP00000262441:p.Ser251Cys		Q4VAT3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S251C	ENST00000262441.5	37	c.752	CCDS11150.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.04|11.04	1.521898|1.521898	0.27211|0.27211	.|.	.|.	ENSG00000065325|ENSG00000065325	ENST00000458005|ENST00000396206;ENST00000304773;ENST00000262441	.|T	.|0.57752	.|0.38	5.28|5.28	5.28|5.28	0.74379|0.74379	.|GPCR, family 2-like (1);	.|0.000000	.|0.38548	.|N	.|0.001656	T|T	0.67325|0.67325	0.2881|0.2881	L|L	0.51914|0.51914	1.62|1.62	0.46927|0.46927	D|D	0.999256|0.999256	.|D	.|0.71674	.|0.998	.|D	.|0.69142	.|0.962	T|T	0.66760|0.66760	-0.5842|-0.5842	5|10	.|0.52906	.|T	.|0.07	.|.	17.8584|17.8584	0.88773|0.88773	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|251	.|O95838	.|GLP2R_HUMAN	A|C	104|251;226;251	.|ENSP00000262441:S251C	.|ENSP00000262441:S251C	P|S	+|+	1|2	0|0	GLP2R|GLP2R	9701605|9701605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.629000|0.629000	0.37895|0.37895	3.700000|3.700000	0.54786|0.54786	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	CCT|TCC	-	GLP2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.522	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	0	0	1	123	123	120	0.00	0.81	C			9760880	+1	400	234	1235	809	tier1	no_errors	ENST00000262441	ensembl	human	known	74_37	missense	24.42	22.33	SNP	1.000	G	400	1235
PTRF	284119	genome.wustl.edu	37	17	40556897	40556897	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr17:40556897C>G	ENST00000357037.5	-	2	1400	c.981G>C	c.(979-981)aaG>aaC	p.K327N		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CCTCGCGGATCTTCTTGACGT	0.677													ENSG00000177469																																					0													82.0	73.0	76.0					17																	40556897		2203	4300	6503	SO:0001583	missense	0			-	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.981G>C	17.37:g.40556897C>G	ENSP00000349541:p.Lys327Asn			Missense_Mutation	SNP	NULL	p.K327N	ENST00000357037.5	37	c.981	CCDS11425.1	17	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413683	0.83449	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.67698	-0.28	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.78629	0.4313	M	0.67397	2.05	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80294	-0.1443	10	0.72032	D	0.01	-42.0485	11.8171	0.52218	0.0:0.9077:0.0:0.0923	.	309;327	B4DNU9;Q6NZI2	.;PTRF_HUMAN	N	327;282	ENSP00000349541:K327N	ENSP00000349541:K327N	K	-	3	2	PTRF	37810423	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.910000	0.56371	2.445000	0.82738	0.557000	0.71058	AAG	-	PTRF	-	NULL		0.677	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRF	HGNC	protein_coding	OTTHUMT00000449938.1	0	0	0	57	57	25	0.00	0.00	C	NM_012232		40556897	-1	23	16	25	15	tier1	no_errors	ENST00000357037	ensembl	human	known	74_37	missense	47.92	51.61	SNP	1.000	G	23	25
GCGR	2642	genome.wustl.edu	37	17	79770102	79770102	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr17:79770102C>T	ENST00000400723.3	+	10	1215	c.922C>T	c.(922-924)Cgg>Tgg	p.R308W	GCGR_ENST00000570996.1_Missense_Mutation_p.R338W	NM_000160.3	NP_000151.1	P47871	GLR_HUMAN	glucagon receptor	308					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|hormone-mediated signaling pathway (GO:0009755)|positive regulation of GTPase activity (GO:0043547)|regulation of blood pressure (GO:0008217)|regulation of glycogen metabolic process (GO:0070873)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|guanyl-nucleotide exchange factor activity (GO:0005085)|peptide hormone binding (GO:0017046)			endometrium(2)	2					Glucagon recombinant(DB00040)	GTGGATCCTGCGGTTCCCCGT	0.657													ENSG00000215644																																					0													56.0	62.0	60.0					17																	79770102		692	1591	2283	SO:0001583	missense	0			-	U03469, L20316	CCDS54177.1	17q25	2012-08-10			ENSG00000215644	ENSG00000215644		"""GPCR / Class B : Glucagon receptors"""	4192	protein-coding gene	gene with protein product		138033				8020989	Standard	XM_006722276		Approved	GGR	uc010wuw.2	P47871		ENST00000400723.3:c.922C>T	17.37:g.79770102C>T	ENSP00000383558:p.Arg308Trp		Q2M3M5	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_glucagon_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.R308W	ENST00000400723.3	37	c.922	CCDS54177.1	17	.	.	.	.	.	.	.	.	.	.	c	21.3	4.121996	0.77436	.	.	ENSG00000215644	ENST00000400723	T	0.36878	1.23	4.98	3.98	0.46160	GPCR, family 2-like (1);	.	.	.	.	T	0.67636	0.2914	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75994	-0.3121	9	0.87932	D	0	.	12.2878	0.54800	0.3084:0.6916:0.0:0.0	.	308	P47871	GLR_HUMAN	W	308	ENSP00000383558:R308W	ENSP00000383558:R308W	R	+	1	2	GCGR	.	0.991000	0.36638	0.876000	0.34364	0.944000	0.59088	2.695000	0.47043	1.161000	0.42604	0.561000	0.74099	CGG	-	GCGR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.657	GCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCGR	HGNC	protein_coding	OTTHUMT00000439676.1	0	0	1	148	148	72	0.00	1.37	C	NM_000160		79770102	+1	53	15	76	18	tier1	no_errors	ENST00000400723	ensembl	human	known	74_37	missense	41.09	45.45	SNP	1.000	T	53	76
ZMAT3	64393	genome.wustl.edu	37	3	178785423	178785423	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr3:178785423C>G	ENST00000311417.2	-	2	859	c.118G>C	c.(118-120)Ggg>Cgg	p.G40R	ZMAT3_ENST00000432729.1_Missense_Mutation_p.G40R	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3											breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			GCCTCCTGCCCAAAAGGCTTC	0.582													ENSG00000172667																																					0													121.0	117.0	119.0					3																	178785423		2203	4300	6503	SO:0001583	missense	0			-	AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.118G>C	3.37:g.178785423C>G	ENSP00000311221:p.Gly40Arg			Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.G40R	ENST00000311417.2	37	c.118	CCDS3224.1	3	.	.	.	.	.	.	.	.	.	.	C	18.48	3.633071	0.67015	.	.	ENSG00000172667	ENST00000311417;ENST00000432729;ENST00000414084	T;T;T	0.44482	0.92;0.93;0.92	5.86	5.86	0.93980	.	0.308349	0.31709	N	0.007183	T	0.29684	0.0741	L	0.27053	0.805	0.38465	D	0.947314	P;P	0.43701	0.815;0.718	B;B	0.37508	0.252;0.128	T	0.12656	-1.0539	10	0.35671	T	0.21	-19.1239	13.3953	0.60849	0.0:0.9285:0.0:0.0715	.	40;40	Q9HA38-2;Q9HA38	.;ZMAT3_HUMAN	R	40	ENSP00000311221:G40R;ENSP00000396506:G40R;ENSP00000398920:G40R	ENSP00000311221:G40R	G	-	1	0	ZMAT3	180268117	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	2.838000	0.48199	2.771000	0.95319	0.563000	0.77884	GGG	-	ZMAT3	-	NULL		0.582	ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZMAT3	HGNC	protein_coding	OTTHUMT00000348336.2	0	0	0	184	184	59	0.00	0.00	C	NM_152240		178785423	-1	111	37	63	13	tier1	no_errors	ENST00000311417	ensembl	human	known	74_37	missense	63.43	74.00	SNP	1.000	G	111	63
ABCA13	154664	genome.wustl.edu	37	7	48314977	48314977	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr7:48314977A>T	ENST00000435803.1	+	17	5738	c.5714A>T	c.(5713-5715)gAa>gTa	p.E1905V		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1905					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GAGCTCTCTGAAGTCTTCCAT	0.378													ENSG00000179869																																					0													94.0	97.0	96.0					7																	48314977		1823	4072	5895	SO:0001583	missense	0			-	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5714A>T	7.37:g.48314977A>T	ENSP00000411096:p.Glu1905Val		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E1905V	ENST00000435803.1	37	c.5714	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	A	9.065	0.995380	0.19043	.	.	ENSG00000179869	ENST00000435803	T	0.33216	1.42	5.95	4.8	0.61643	.	0.249386	0.27871	N	0.017509	T	0.35364	0.0929	M	0.66939	2.045	0.24994	N	0.991516	P	0.45396	0.857	P	0.44477	0.451	T	0.25152	-1.0140	9	.	.	.	.	10.046	0.42186	0.9244:0.0:0.0756:0.0	.	1905	Q86UQ4	ABCAD_HUMAN	V	1905	ENSP00000411096:E1905V	.	E	+	2	0	ABCA13	48285523	0.917000	0.31117	0.003000	0.11579	0.002000	0.02628	3.043000	0.49823	1.074000	0.40909	0.528000	0.53228	GAA	-	ABCA13	-	NULL		0.378	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	1	1	0	105	105	109	0.94	0.00	A	NM_152701		48314977	+1	42	44	50	52	tier1	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	45.65	45.83	SNP	0.018	T	42	50
OR2T34	127068	genome.wustl.edu	37	1	248737312	248737312	+	Silent	SNP	G	G	A	rs143585056	byFrequency	TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr1:248737312G>A	ENST00000328782.2	-	1	768	c.747C>T	c.(745-747)caC>caT	p.H249H		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTATGATCATGTGGGAGGAGC	0.552													ENSG00000183310	g|||	12	0.00239617	0.0008	0.0029	5008	,	,		13407	0.0		0.008	False		,,,				2504	0.001																0								G		9,4339		0,9,2165	82.0	92.0	89.0		747	0.2	0.8	1	dbSNP_134	89	48,8552		0,48,4252	no	coding-synonymous	OR2T34	NM_001001821.1		0,57,6417	AA,AG,GG		0.5581,0.207,0.4402		249/319	248737312	57,12891	2174	4300	6474	SO:0001819	synonymous_variant	0			-	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.747C>T	1.37:g.248737312G>A			B2RNJ8|Q6IEY5|Q96R31	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H249	ENST00000328782.2	37	c.747	CCDS31120.1	1																																																																																			rs143585056	OR2T34	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.552	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	0	0	0	121	121	38	0.00	0.00	G	NM_001001821		248737312	-1	40	7	92	26	tier1	no_errors	ENST00000328782	ensembl	human	known	74_37	silent	30.30	21.21	SNP	0.995	A	40	92
FCGBP	8857	genome.wustl.edu	37	19	40421292	40421292	+	Missense_Mutation	SNP	C	C	T	rs549995848		TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:40421292C>T	ENST00000221347.6	-	5	2636	c.2629G>A	c.(2629-2631)Ggc>Agc	p.G877S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	877	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AAGCGCCGGCCGTCGAAGCTC	0.672													ENSG00000090920	C|||	1	0.000199681	0.0	0.0	5008	,	,		13712	0.0		0.0	False		,,,				2504	0.001																0													28.0	28.0	28.0					19																	40421292		2202	4300	6502	SO:0001583	missense	0			-	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2629G>A	19.37:g.40421292C>T	ENSP00000221347:p.Gly877Ser		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.G877S	ENST00000221347.6	37	c.2629	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577743	0.86645	.	.	ENSG00000090920	ENST00000221347	T	0.70045	-0.45	4.59	3.54	0.40534	von Willebrand factor, type D domain (3);	0.247257	0.32518	N	0.005991	T	0.79947	0.4534	M	0.81802	2.56	0.32766	N	0.504401	D	0.76494	0.999	D	0.73708	0.981	D	0.84574	0.0657	10	0.66056	D	0.02	.	11.3155	0.49390	0.0:0.9077:0.0:0.0923	.	877	Q9Y6R7	FCGBP_HUMAN	S	877	ENSP00000221347:G877S	ENSP00000221347:G877S	G	-	1	0	FCGBP	45113132	0.002000	0.14202	0.989000	0.46669	0.994000	0.84299	0.870000	0.28010	2.275000	0.75901	0.491000	0.48974	GGC	-	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D		0.672	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	0	0	0	173	173	15	0.00	0.00	C	NM_003890		40421292	-1	86	6	335	24	tier1	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	20.38	20.00	SNP	0.865	T	86	335
MYH2	4620	genome.wustl.edu	37	17	10432323	10432323	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr17:10432323G>C	ENST00000245503.5	-	27	3812	c.3428C>G	c.(3427-3429)tCt>tGt	p.S1143C	MYH2_ENST00000532183.2_Intron|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.S1143C	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1143					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GGAGAGGTCAGAGCGCTGCTT	0.602													ENSG00000125414																																					0													50.0	58.0	55.0					17																	10432323		2203	4297	6500	SO:0001583	missense	0			-		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3428C>G	17.37:g.10432323G>C	ENSP00000245503:p.Ser1143Cys		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SRE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1143C	ENST00000245503.5	37	c.3428	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215788	0.79352	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.79141	-1.24;-1.24	5.09	5.09	0.68999	Myosin tail (1);	0.207006	0.23979	U	0.042691	D	0.89522	0.6739	M	0.88512	2.96	0.49915	D	0.999831	P	0.48294	0.908	P	0.61533	0.89	D	0.91114	0.4924	10	0.87932	D	0	.	18.6832	0.91554	0.0:0.0:1.0:0.0	.	1143	Q9UKX2	MYH2_HUMAN	C	1143	ENSP00000245503:S1143C;ENSP00000380367:S1143C	ENSP00000245503:S1143C	S	-	2	0	MYH2	10373048	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	7.392000	0.79840	2.660000	0.90430	0.591000	0.81541	TCT	-	MYH2	-	pfam_Myosin_tail		0.602	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	0	0	0	166	166	11	0.00	0.00	G	NM_017534		10432323	-1	420	42	1547	119	tier1	no_errors	ENST00000245503	ensembl	human	known	74_37	missense	21.35	25.93	SNP	1.000	C	420	1547
OR1J2	26740	genome.wustl.edu	37	9	125273520	125273520	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr9:125273520T>C	ENST00000335302.5	+	1	440	c.440T>C	c.(439-441)gTa>gCa	p.V147A		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						TTAGTGGCTGTATCTTGGATT	0.498													ENSG00000197233																																					0													206.0	161.0	176.0					9																	125273520		2203	4300	6503	SO:0001583	missense	0			-		CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.440T>C	9.37:g.125273520T>C	ENSP00000335575:p.Val147Ala		A3KFL9|Q6IF14|Q96R90|Q9NZP1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V147A	ENST00000335302.5	37	c.440	CCDS35121.1	9	.	.	.	.	.	.	.	.	.	.	T	7.630	0.678689	0.14841	.	.	ENSG00000197233	ENST00000335302;ENST00000444856	T	0.36878	1.23	5.02	-10.0	0.00425	GPCR, rhodopsin-like superfamily (1);	1.902390	0.03344	U	0.195254	T	0.20455	0.0492	N	0.13327	0.33	0.09310	N	1	B	0.06786	0.001	B	0.15052	0.012	T	0.12682	-1.0538	10	0.31617	T	0.26	.	13.3722	0.60719	0.0:0.1863:0.6442:0.1695	.	147	Q8NGS2	OR1J2_HUMAN	A	147	ENSP00000335575:V147A	ENSP00000335575:V147A	V	+	2	0	OR1J2	124313341	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.413000	0.01038	-1.848000	0.01172	-0.323000	0.08544	GTA	-	OR1J2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.498	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1J2	HGNC	protein_coding	OTTHUMT00000053932.1	0	0	0	187	187	108	0.00	0.00	T			125273520	+1	59	43	69	32	tier1	no_errors	ENST00000335302	ensembl	human	known	74_37	missense	46.09	57.33	SNP	0.000	C	59	69
MCM3AP	8888	genome.wustl.edu	37	21	47669799	47669799	+	Intron	SNP	T	T	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr21:47669799T>A	ENST00000397708.1	-	21	4545				MCM3AP_ENST00000467026.1_Intron|AP001469.7_ENST00000444966.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP_ENST00000291688.1_Intron|AP001469.9_ENST00000447037.1_RNA|AP001469.9_ENST00000430259.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein						DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					ACAGTACCCATACACAGGTGG	0.498													ENSG00000215424																																					0																																										SO:0001627	intron_variant	0			-	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.4290+1643A>T	21.37:g.47669799T>A			C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	R	SNP	-	NULL	ENST00000397708.1	37	NULL	CCDS13734.1	21																																																																																			-	MCM3AP-AS1	-	-		0.498	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP-AS1	HGNC	protein_coding	OTTHUMT00000207254.1	0	0	0	49	49	58	0.00	0.00	T	NM_003906		47669799	+1	21	9	27	21	tier1	no_errors	ENST00000414659	ensembl	human	known	74_37	rna	43.75	30.00	SNP	0.000	A	21	27
ATP5G3	518	genome.wustl.edu	37	2	176044904	176044904	+	Silent	SNP	G	G	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr2:176044904G>T	ENST00000284727.4	-	3	3066	c.42C>A	c.(40-42)atC>atA	p.I14I	ATP5G3_ENST00000392541.3_Silent_p.I14I|ATP5G3_ENST00000409194.1_Silent_p.I14I	NM_001002258.4|NM_001689.4	NP_001002258.1|NP_001680.1	P48201	AT5G3_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)	14					ATP hydrolysis coupled proton transport (GO:0015991)|ATP synthesis coupled proton transport (GO:0015986)	integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)			large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.147)			ATCCAGCTCGGATCTATTAAT	0.348													ENSG00000154518																									GBM(30;387 605 18606 28805 47989)												0													77.0	78.0	77.0					2																	176044904		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC106881	CCDS2263.1	2q31.1	2012-10-12	2010-06-11		ENSG00000154518	ENSG00000154518		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	843	protein-coding gene	gene with protein product		602736	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9) isoform 3"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9)"""			7698763	Standard	NM_001002258		Approved		uc002ujz.4	P48201	OTTHUMG00000132425	ENST00000284727.4:c.42C>A	2.37:g.176044904G>T			B2R4Z0|D3DPF0|Q4ZFX7	Silent	SNP	pfam_ATPase_proteolipid_c_like_dom,superfamily_ATPase_proteolipid_c_like_dom,prints_ATPase_F0-cplx_csu	p.I14	ENST00000284727.4	37	c.42	CCDS2263.1	2																																																																																			-	ATP5G3	-	NULL		0.348	ATP5G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5G3	HGNC	protein_coding	OTTHUMT00000255563.1	0	0	0	114	114	61	0.00	0.00	G	NM_001689		176044904	-1	27	12	107	37	tier1	no_errors	ENST00000284727	ensembl	human	known	74_37	silent	20.15	24.49	SNP	1.000	T	27	107
TFAP2E	339488	genome.wustl.edu	37	1	36060270	36060270	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr1:36060270G>A	ENST00000373235.3	+	7	1530	c.1322G>A	c.(1321-1323)cGg>cAg	p.R441Q		NM_178548.3	NP_848643.2			transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)											endometrium(1)|large_intestine(1)	2		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GCCAAGCATCGGAAATAACTG	0.547													ENSG00000116819																																					0													76.0	74.0	75.0					1																	36060270		2203	4300	6503	SO:0001583	missense	0			-	BC041175	CCDS393.2	1p34.3	2008-02-05			ENSG00000116819	ENSG00000116819			30774	protein-coding gene	gene with protein product		614428				14636996	Standard	NM_178548		Approved	AP2E	uc010ohy.2	Q6VUC0	OTTHUMG00000004388	ENST00000373235.3:c.1322G>A	1.37:g.36060270G>A	ENSP00000362332:p.Arg441Gln			Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C	p.R441Q	ENST00000373235.3	37	c.1322	CCDS393.2	1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593787	0.66219	.	.	ENSG00000116819	ENST00000373235	D	0.98264	-4.83	5.38	3.51	0.40186	.	0.000000	0.85682	D	0.000000	D	0.96030	0.8707	M	0.64170	1.965	0.58432	D	0.999993	B	0.33379	0.41	B	0.17098	0.017	D	0.93778	0.7081	10	0.87932	D	0	-8.3847	11.8313	0.52297	0.1419:0.0:0.8581:0.0	.	441	Q6VUC0	AP2E_HUMAN	Q	441	ENSP00000362332:R441Q	ENSP00000362332:R441Q	R	+	2	0	TFAP2E	35832857	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	6.774000	0.75012	0.648000	0.30732	0.561000	0.74099	CGG	-	TFAP2E	-	NULL		0.547	TFAP2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2E	HGNC	protein_coding	OTTHUMT00000012732.1	0	0	0	59	59	132	0.00	0.00	G	NM_178548		36060270	+1	17	44	31	46	tier1	no_errors	ENST00000373235	ensembl	human	known	74_37	missense	35.42	48.89	SNP	1.000	A	17	31
LRRC8B	23507	genome.wustl.edu	37	1	90050237	90050237	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr1:90050237C>A	ENST00000330947.2	+	5	2388	c.2028C>A	c.(2026-2028)ttC>ttA	p.F676L	LRRC8B_ENST00000358200.4_Missense_Mutation_p.F676L|RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Missense_Mutation_p.F676L	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	676					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TGCAGCTTTTCCTATGCACTA	0.378													ENSG00000197147																																					0													110.0	107.0	108.0					1																	90050237		2203	4300	6503	SO:0001583	missense	0			-	AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.2028C>A	1.37:g.90050237C>A	ENSP00000332674:p.Phe676Leu		D3DT28|Q6UY21|Q8N106|Q92627	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.F676L	ENST00000330947.2	37	c.2028	CCDS724.1	1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.734540	0.48939	.	.	ENSG00000197147	ENST00000330947;ENST00000358200;ENST00000439853	T;T;T	0.00882	5.58;5.58;5.58	5.17	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.00328	0.0010	N	0.25825	0.765	0.43439	D	0.995613	B	0.31256	0.316	B	0.28991	0.097	T	0.61397	-0.7071	9	.	.	.	.	7.9825	0.30192	0.0:0.4419:0.0:0.5581	.	676	Q6P9F7	LRC8B_HUMAN	L	676	ENSP00000332674:F676L;ENSP00000350933:F676L;ENSP00000400704:F676L	.	F	+	3	2	LRRC8B	89822825	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.491000	0.22419	0.522000	0.28464	0.561000	0.74099	TTC	-	LRRC8B	-	smart_Leu-rich_rpt_typical-subtyp		0.378	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8B	HGNC	protein_coding	OTTHUMT00000028008.1	0	0	0	21	21	66	0.00	0.00	C	NM_015350		90050237	+1	13	24	18	43	tier1	no_errors	ENST00000330947	ensembl	human	known	74_37	missense	41.94	35.82	SNP	1.000	A	13	18
HUNK	30811	genome.wustl.edu	37	21	33371084	33371084	+	Missense_Mutation	SNP	C	C	T	rs553993228		TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr21:33371084C>T	ENST00000270112.2	+	11	2092	c.1732C>T	c.(1732-1734)Cat>Tat	p.H578Y		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	578					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						GTCTCCCTCTCATCACTACAG	0.597													ENSG00000142149	C|||	1	0.000199681	0.0	0.0	5008	,	,		17030	0.0		0.001	False		,,,				2504	0.0																0													75.0	57.0	63.0					21																	33371084		2203	4300	6503	SO:0001583	missense	0			-	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1732C>T	21.37:g.33371084C>T	ENSP00000270112:p.His578Tyr			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H578Y	ENST00000270112.2	37	c.1732	CCDS13610.1	21	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603284	0.66445	.	.	ENSG00000142149	ENST00000270112	T	0.70516	-0.49	4.39	3.5	0.40072	.	0.285398	0.32970	N	0.005425	T	0.74696	0.3750	L	0.29908	0.895	0.45035	D	0.998058	D	0.63880	0.993	D	0.70227	0.968	T	0.76061	-0.3097	10	0.51188	T	0.08	-10.4332	14.3929	0.66991	0.0:0.8513:0.1486:0.0	.	578	P57058	HUNK_HUMAN	Y	578	ENSP00000270112:H578Y	ENSP00000270112:H578Y	H	+	1	0	HUNK	32292955	0.928000	0.31464	0.036000	0.18154	0.959000	0.62525	2.482000	0.45224	1.042000	0.40150	0.491000	0.48974	CAT	-	HUNK	-	NULL		0.597	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	HGNC	protein_coding	OTTHUMT00000192782.1	0	0	0	91	91	62	0.00	0.00	C	NM_014586		33371084	+1	33	24	35	29	tier1	no_errors	ENST00000270112	ensembl	human	known	74_37	missense	48.53	45.28	SNP	0.960	T	33	35
NEB	4703	genome.wustl.edu	37	2	152425138	152425138	+	Silent	SNP	G	G	A	rs377183242		TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr2:152425138G>A	ENST00000172853.10	-	83	12672	c.12525C>T	c.(12523-12525)ctC>ctT	p.L4175L	NEB_ENST00000604864.1_Silent_p.L5876L|NEB_ENST00000409198.1_Silent_p.L4175L|NEB_ENST00000427231.2_Silent_p.L5876L|NEB_ENST00000603639.1_Silent_p.L5876L|NEB_ENST00000397345.3_Silent_p.L5876L			P20929	NEBU_HUMAN	nebulin	4175					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTACATCATCGAGGATCTCGC	0.378													ENSG00000183091																																					0								G	,,	1,3949		0,1,1974	100.0	91.0	94.0		17628,17628,12525	-11.9	0.1	2		94	0,8374		0,0,4187	no	coding-synonymous,coding-synonymous,coding-synonymous	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	,,	0,1,6161	AA,AG,GG		0.0,0.0253,0.0081	,,	5876/8526,5876/8526,4175/6670	152425138	1,12323	1975	4187	6162	SO:0001819	synonymous_variant	0			-	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.12525C>T	2.37:g.152425138G>A			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.L5876	ENST00000172853.10	37	c.17628		2																																																																																			-	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif		0.378	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		0	0	0	127	127	108	0.00	0.00	G	NM_004543		152425138	-1	58	48	73	63	tier1	no_errors	ENST00000397345	ensembl	human	known	74_37	silent	44.27	43.24	SNP	0.010	A	58	73
CUBN	8029	genome.wustl.edu	37	10	16975218	16975218	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr10:16975218C>G	ENST00000377833.4	-	40	6057	c.5992G>C	c.(5992-5994)Gac>Cac	p.D1998H		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1998	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGTAACTGTCAGGCCAGCCC	0.527													ENSG00000107611																																					0													106.0	91.0	96.0					10																	16975218		2203	4300	6503	SO:0001583	missense	0			-	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5992G>C	10.37:g.16975218C>G	ENSP00000367064:p.Asp1998His		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.D1998H	ENST00000377833.4	37	c.5992	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	13.93	2.384716	0.42308	.	.	ENSG00000107611	ENST00000377833	T	0.35789	1.29	5.66	-2.27	0.06846	CUB (5);	1.543370	0.04207	N	0.331073	T	0.27765	0.0683	N	0.26092	0.79	0.09310	N	1	P	0.48998	0.918	P	0.45681	0.49	T	0.20538	-1.0272	10	0.49607	T	0.09	.	4.356	0.11178	0.0942:0.3512:0.0924:0.4622	.	1998	O60494	CUBN_HUMAN	H	1998	ENSP00000367064:D1998H	ENSP00000367064:D1998H	D	-	1	0	CUBN	17015224	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.368000	0.20399	-0.439000	0.07222	-0.793000	0.03317	GAC	-	CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.527	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	0	0	0	80	80	85	0.00	0.00	C	NM_001081		16975218	-1	26	27	37	23	tier1	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	41.27	54.00	SNP	0.000	G	26	37
ROM1	6094	genome.wustl.edu	37	11	62381831	62381831	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr11:62381831C>T	ENST00000278833.3	+	2	1233	c.692C>T	c.(691-693)tCa>tTa	p.S231L	ROM1_ENST00000534093.1_Nonsense_Mutation_p.Q22*|EML3_ENST00000394773.2_5'Flank|EML3_ENST00000529309.1_5'Flank|EML3_ENST00000494176.2_5'Flank|EML3_ENST00000278845.4_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	231					camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						AACCGTCTTTCAGACTCCTAC	0.587													ENSG00000149489																																					0													118.0	114.0	115.0					11																	62381831		2202	4299	6501	SO:0001583	missense	0			-	L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.692C>T	11.37:g.62381831C>T	ENSP00000278833:p.Ser231Leu		B2R978	Nonsense_Mutation	SNP	NULL	p.Q22*	ENST00000278833.3	37	c.64	CCDS8024.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	5.984913|5.984913	0.97173|0.97173	.|.	.|.	ENSG00000149489|ENSG00000149489	ENST00000525801;ENST00000534093;ENST00000525947|ENST00000278833	.|T	.|0.03065	.|4.06	5.38|5.38	5.38|5.38	0.77491|0.77491	.|Tetraspanin, EC2 domain (1);	.|0.155567	.|0.43919	.|D	.|0.000519	.|T	.|0.10766	.|0.0263	L|L	0.45581|0.45581	1.43|1.43	0.49915|0.49915	D|D	0.999831|0.999831	.|D	.|0.61697	.|0.99	.|P	.|0.57846	.|0.828	.|T	.|0.07065	.|-1.0792	.|10	0.87932|0.36615	D|T	0|0.2	-23.7917|-23.7917	16.6182|16.6182	0.84922|0.84922	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|231	.|Q03395	.|ROM1_HUMAN	X|L	22|231	.|ENSP00000278833:S231L	ENSP00000433566:Q22X|ENSP00000278833:S231L	Q|S	+|+	1|2	0|0	ROM1|ROM1	62138407|62138407	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.668000|0.668000	0.39293|0.39293	5.762000|5.762000	0.68809|0.68809	2.514000|2.514000	0.84764|0.84764	0.462000|0.462000	0.41574|0.41574	CAG|TCA	-	ROM1	-	NULL		0.587	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROM1	HGNC	protein_coding	OTTHUMT00000394929.1	0	0	0	65	65	111	0.00	0.00	C	NM_000327		62381831	+1	21	48	42	36	tier1	no_errors	ENST00000534093	ensembl	human	putative	74_37	nonsense	33.33	57.14	SNP	1.000	T	21	42
CCDC61	729440	genome.wustl.edu	37	19	46498369	46498369	+	5'Flank	SNP	G	G	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:46498369G>T	ENST00000595358.1	+	0	0				CCDC61_ENST00000536603.1_5'Flank|CCDC61_ENST00000263284.2_Missense_Mutation_p.G11C	NM_001267723.1	NP_001254652.1	Q9Y6R9	CCD61_HUMAN	coiled-coil domain containing 61							centrosome (GO:0005813)				endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		CTCCCTTCCAGGCCCTCCCCA	0.617													ENSG00000104983																																					0													17.0	17.0	17.0					19																	46498369		1908	4114	6022	SO:0001631	upstream_gene_variant	0			-		CCDS46120.1, CCDS46120.2	19q13.32	2014-09-04			ENSG00000104983	ENSG00000104983			33629	protein-coding gene	gene with protein product							Standard	NM_001267723		Approved		uc031rlj.1	Q9Y6R9	OTTHUMG00000182488		19.37:g.46498369G>T	Exception_encountered		C8CAP4|Q9HDB6	Missense_Mutation	SNP	NULL	p.G11C	ENST00000595358.1	37	c.31	CCDS46120.2	19	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875105	0.51695	.	.	ENSG00000104983	ENST00000263284	.	.	.	4.16	-8.33	0.00992	.	.	.	.	.	T	0.35799	0.0944	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.52335	-0.8589	5	0.87932	D	0	.	7.8607	0.29507	0.5163:0.3076:0.1761:0.0	.	.	.	.	C	11	.	ENSP00000263284:G11C	G	+	1	0	CCDC61	51190209	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-1.117000	0.03283	-2.402000	0.00577	0.460000	0.39030	GGC	-	CCDC61	-	NULL		0.617	CCDC61-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CCDC61	HGNC	protein_coding	OTTHUMT00000461689.1	1	1	0	104	104	13	0.95	0.00	G	NM_001080402		46498369	+1	43	6	118	26	tier1	no_errors	ENST00000263284	ensembl	human	known	74_37	missense	26.71	18.75	SNP	0.000	T	43	118
OR8D1	283159	genome.wustl.edu	37	11	124179837	124179837	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr11:124179837C>T	ENST00000357821.2	-	1	896	c.826G>A	c.(826-828)Gtg>Atg	p.V276M		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GTGTAGAACACAGAGGACACC	0.453													ENSG00000196341																																					0													110.0	106.0	108.0					11																	124179837		2201	4299	6500	SO:0001583	missense	0			-	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.826G>A	11.37:g.124179837C>T	ENSP00000350474:p.Val276Met		B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V276M	ENST00000357821.2	37	c.826	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	c	9.307	1.054562	0.19907	.	.	ENSG00000196341	ENST00000357821	T	0.00274	8.35	4.29	3.35	0.38373	GPCR, rhodopsin-like superfamily (1);	0.261790	0.19736	U	0.107232	T	0.00496	0.0016	M	0.79475	2.455	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.48468	-0.9033	10	0.72032	D	0.01	.	1.9249	0.03315	0.1686:0.4963:0.1636:0.1716	.	276	Q8WZ84	OR8D1_HUMAN	M	276	ENSP00000350474:V276M	ENSP00000350474:V276M	V	-	1	0	OR8D1	123685047	0.000000	0.05858	0.242000	0.24170	0.005000	0.04900	-0.731000	0.04909	2.236000	0.73375	0.508000	0.49915	GTG	-	OR8D1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.453	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	HGNC	protein_coding	OTTHUMT00000387285.1	0	0	1	98	98	119	0.00	0.83	C	NM_001002917		124179837	-1	30	26	38	26	tier1	no_errors	ENST00000357821	ensembl	human	known	74_37	missense	44.12	50.00	SNP	0.001	T	30	38
TAS2R7	50837	genome.wustl.edu	37	12	10954758	10954758	+	Missense_Mutation	SNP	C	C	T	rs554036509	byFrequency	TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr12:10954758C>T	ENST00000240687.2	-	1	468	c.412G>A	c.(412-414)Gtg>Atg	p.V138M		NM_023919.2	NP_076408.1	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	138					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(3)	10						GAGAGAACCACGCACCCCAGT	0.413													ENSG00000121377	C|||	2	0.000399361	0.0	0.0	5008	,	,		19291	0.0		0.0	False		,,,				2504	0.002																0													82.0	76.0	78.0					12																	10954758		2203	4300	6503	SO:0001583	missense	0			-	AF227133	CCDS8631.1	12p13	2012-08-22			ENSG00000121377	ENSG00000121377		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14913	protein-coding gene	gene with protein product		604793				10761934, 10766242	Standard	NM_023919		Approved	T2R7, TRB4	uc001qyv.3	Q9NYW3	OTTHUMG00000168505	ENST00000240687.2:c.412G>A	12.37:g.10954758C>T	ENSP00000240687:p.Val138Met		Q645Y1	Missense_Mutation	SNP	pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.V138M	ENST00000240687.2	37	c.412	CCDS8631.1	12	.	.	.	.	.	.	.	.	.	.	C	2.167	-0.390732	0.04932	.	.	ENSG00000121377	ENST00000240687	T	0.37752	1.18	4.94	-4.6	0.03390	GPCR, rhodopsin-like superfamily (1);	1.207280	0.06246	N	0.691274	T	0.23727	0.0574	L	0.39020	1.185	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.31613	-0.9937	10	0.52906	T	0.07	.	4.0501	0.09791	0.2164:0.5139:0.1514:0.1183	.	138	Q9NYW3	TA2R7_HUMAN	M	138	ENSP00000240687:V138M	ENSP00000240687:V138M	V	-	1	0	TAS2R7	10846025	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.235000	0.01202	-0.846000	0.04174	-1.530000	0.00923	GTG	-	TAS2R7	-	pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.413	TAS2R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R7	HGNC	protein_coding	OTTHUMT00000399931.1	0	0	0	109	109	134	0.00	0.00	C			10954758	-1	49	70	105	144	tier1	no_errors	ENST00000240687	ensembl	human	known	74_37	missense	31.82	32.71	SNP	0.000	T	49	105
HERC2P4	100289574	genome.wustl.edu	37	16	32191961	32191961	+	IGR	SNP	G	G	T	rs574818712		TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr16:32191961G>T								HERC2P4 (9073 upstream) : RP11-17M15.1 (7692 downstream)																							GCTCTGGAACGTTTGCAGCAA	0.532													ENSG00000230267																																					0																																										SO:0001628	intergenic_variant	0			-																													16.37:g.32191961G>T				R	SNP	-	NULL		37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	7.866	0.727137	0.15439	.	.	ENSG00000230267	ENST00000433784	.	.	.	2.51	2.51	0.30379	.	.	.	.	.	T	0.56485	0.1988	.	.	.	.	.	.	.	.	.	.	.	.	T	0.66048	-0.6020	4	0.66056	D	0.02	.	9.1025	0.36678	0.0:0.7717:0.2283:0.0	.	.	.	.	K	82	.	ENSP00000402538:T82K	T	-	2	0	AC133485.1	32099462	1.000000	0.71417	0.648000	0.29521	0.005000	0.04900	5.078000	0.64425	0.393000	0.25203	-1.041000	0.02371	ACG	-	HERC2P4	-	-	0	0.532					HERC2P4	HGNC			1	1	0	349	349	105	0.29	0.00	G			32191961	-1	56	42	199	69	tier1	no_errors	ENST00000566591	ensembl	human	known	74_37	rna	21.96	37.84	SNP	0.996	T	56	199
HNF4A	3172	genome.wustl.edu	37	20	43030126	43030126	+	Splice_Site	DEL	T	T	-			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr20:43030126delT	ENST00000316099.4	+	1	203	c.114delT	c.(112-114)aat>aa	p.N38fs	HNF4A_ENST00000415691.2_Splice_Site_p.N38fs|HNF4A_ENST00000457232.1_Intron|HNF4A_ENST00000316673.4_Intron|HNF4A_ENST00000609795.1_Intron|HNF4A_ENST00000443598.2_Splice_Site_p.N38fs	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	38					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CGATGGGCAATGGTAGGTGGG	0.582													ENSG00000101076																									Colon(79;2 1269 8820 14841 52347)												0													121.0	93.0	102.0					20																	43030126		2203	4300	6503	SO:0001630	splice_region_variant	0				X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.115+1T>-	20.37:g.43030126delT			A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Frame_Shift_Del	DEL	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.N38fs	ENST00000316099.4	37	c.114	CCDS13330.1	20																																																																																				HNF4A	-	NULL		0.582	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	0	0	0	138	138	60	0.00	0.00	T		Frame_Shift_Del	43030126	+1	53	22	81	31	tier1	no_errors	ENST00000316099	ensembl	human	known	74_37	frame_shift_del	39.55	41.51	DEL	1.000	-	53	81
ACSS2	55902	genome.wustl.edu	37	20	33464462	33464462	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr20:33464462A>T	ENST00000360596.2	+	1	225	c.14A>T	c.(13-15)gAg>gTg	p.E5V	ACSS2_ENST00000476922.1_3'UTR|ACSS2_ENST00000253382.5_Missense_Mutation_p.E5V|ACSS2_ENST00000336325.4_Intron	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	5					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGGCTTCCTGAGGAGCGGGTC	0.721													ENSG00000131069																																					0													3.0	5.0	4.0					20																	33464462		1887	3967	5854	SO:0001583	missense	0			-	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.14A>T	20.37:g.33464462A>T	ENSP00000353804:p.Glu5Val		A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.E5V	ENST00000360596.2	37	c.14	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	A	19.27	3.795865	0.70452	.	.	ENSG00000131069	ENST00000360596;ENST00000374693;ENST00000484354;ENST00000493805;ENST00000473172;ENST00000253382	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	4.87	4.87	0.63330	.	1.306700	0.04863	N	0.444566	T	0.50051	0.1593	N	0.08118	0	0.80722	D	1	B;D;B	0.63880	0.267;0.993;0.267	B;D;B	0.72338	0.039;0.977;0.026	T	0.47861	-0.9084	10	0.87932	D	0	-19.8159	7.1533	0.25622	0.9018:0.0:0.0982:0.0	.	5;5;5	Q5QPH3;B4DEH9;Q9NR19	.;.;ACSA_HUMAN	V	5	ENSP00000353804:E5V;ENSP00000419167:E5V;ENSP00000418812:E5V;ENSP00000419925:E5V;ENSP00000253382:E5V	ENSP00000253382:E5V	E	+	2	0	ACSS2	32928123	1.000000	0.71417	0.998000	0.56505	0.500000	0.33767	2.382000	0.44345	2.051000	0.60960	0.379000	0.24179	GAG	-	ACSS2	-	NULL		0.721	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	0	0	0	19	19	8	0.00	0.00	A	NM_018677		33464462	+1	8	6	17	8	tier1	no_errors	ENST00000253382	ensembl	human	known	74_37	missense	30.77	42.86	SNP	0.996	T	8	17
ANGPTL2	23452	genome.wustl.edu	37	9	129870420	129870420	+	Silent	SNP	G	G	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr9:129870420G>A	ENST00000373425.3	-	2	1208	c.591C>T	c.(589-591)atC>atT	p.I197I	ANGPTL2_ENST00000373417.1_Intron|RALGPS1_ENST00000259351.5_Intron|ANGPTL2_ENST00000491991.1_5'Flank|RALGPS1_ENST00000373434.1_Intron|RALGPS1_ENST00000424082.2_Intron|RALGPS1_ENST00000394022.3_Intron|RALGPS1_ENST00000373436.1_Intron	NM_012098.2	NP_036230.1	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2	197					multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|urinary_tract(1)	18						CAAGCTGCGCGATGATCTCTG	0.657													ENSG00000136859																																					0													45.0	42.0	43.0					9																	129870420		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF125175	CCDS6868.1	9q34	2013-02-06			ENSG00000136859	ENSG00000136859		"""Fibrinogen C domain containing"""	490	protein-coding gene	gene with protein product		605001				10473614	Standard	NM_012098		Approved	ARP2, HARP	uc004bqr.1	Q9UKU9	OTTHUMG00000020695	ENST00000373425.3:c.591C>T	9.37:g.129870420G>A			Q5JT58|Q8NCH7	Silent	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.I197	ENST00000373425.3	37	c.591	CCDS6868.1	9																																																																																			-	ANGPTL2	-	NULL		0.657	ANGPTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL2	HGNC	protein_coding	OTTHUMT00000054129.1	0	0	0	53	53	11	0.00	0.00	G	NM_012098		129870420	-1	31	2	24	6	tier1	no_errors	ENST00000373425	ensembl	human	known	74_37	silent	56.36	25.00	SNP	0.077	A	31	24
CC2D1A	54862	genome.wustl.edu	37	19	14024037	14024037	+	Silent	SNP	G	G	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:14024037G>A	ENST00000318003.7	+	5	676	c.435G>A	c.(433-435)gcG>gcA	p.A145A	CC2D1A_ENST00000589606.1_Silent_p.A145A	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	145					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			AGAGGCTGGCGCTCTATCAGA	0.632													ENSG00000132024																																					0													19.0	24.0	23.0					19																	14024037		1970	4150	6120	SO:0001819	synonymous_variant	0			-	AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.435G>A	19.37:g.14024037G>A			Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_DM14,smart_C2_dom	p.A145	ENST00000318003.7	37	c.435	CCDS42512.1	19																																																																																			-	CC2D1A	-	smart_DM14		0.632	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	CC2D1A	HGNC	protein_coding	OTTHUMT00000457954.1	0	0	0	85	85	17	0.00	0.00	G	NM_017721		14024037	+1	41	13	58	4	tier1	no_errors	ENST00000318003	ensembl	human	known	74_37	silent	41.41	76.47	SNP	0.098	A	41	58
AP2A1	160	genome.wustl.edu	37	19	50308789	50308789	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:50308789C>A	ENST00000359032.5	+	20	2490	c.2490C>A	c.(2488-2490)tgC>tgA	p.C830*	AP2A1_ENST00000354293.5_Nonsense_Mutation_p.C808*	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	830					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.C830C(2)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		ATATCGAGTGCCTGCGGGACT	0.726													ENSG00000196961																																					2	Substitution - coding silent(2)	endometrium(2)											9.0	12.0	11.0					19																	50308789		2044	4150	6194	SO:0001587	stop_gained	0			-	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.2490C>A	19.37:g.50308789C>A	ENSP00000351926:p.Cys830*		Q96CI7|Q96PP6|Q96PP7|Q9H070	Nonsense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.C808*	ENST00000359032.5	37	c.2424	CCDS46148.1	19	.	.	.	.	.	.	.	.	.	.	t	41	8.947075	0.99012	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	.	.	.	5.94	1.39	0.22231	.	0.091015	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2361	0.20764	0.1407:0.4512:0.0:0.4081	.	.	.	.	X	808;830	.	ENSP00000346246:C808X	C	+	3	2	AP2A1	55000601	0.001000	0.12720	0.997000	0.53966	0.991000	0.79684	-0.380000	0.07427	-0.049000	0.13379	-0.264000	0.10439	TGC	-	AP2A1	-	pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu		0.726	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	0	0	0	60	60	9	0.00	0.00	C			50308789	+1	46	7	40	1	tier1	no_errors	ENST00000354293	ensembl	human	known	74_37	nonsense	53.49	87.50	SNP	0.988	A	46	40
CDH8	1006	genome.wustl.edu	37	16	61891134	61891134	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr16:61891134C>A	ENST00000577390.1	-	4	1510	c.556G>T	c.(556-558)Gtc>Ttc	p.V186F	CDH8_ENST00000299345.6_Missense_Mutation_p.V186F|CDH8_ENST00000584337.1_Missense_Mutation_p.V186F|CDH8_ENST00000577730.1_Missense_Mutation_p.V186F	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	186	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ACGTTAGTGACAGATGTACCT	0.353													ENSG00000150394																																					0													61.0	56.0	58.0					16																	61891134		2203	4300	6503	SO:0001583	missense	0			-	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.556G>T	16.37:g.61891134C>A	ENSP00000462701:p.Val186Phe		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V186F	ENST00000577390.1	37	c.556	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332381	0.81801	.	.	ENSG00000150394	ENST00000299345	T	0.59364	0.27	5.75	5.75	0.90469	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85642	0.1277	10	0.87932	D	0	.	19.9535	0.97211	0.0:1.0:0.0:0.0	.	186	P55286	CADH8_HUMAN	F	186	ENSP00000299345:V186F	ENSP00000299345:V186F	V	-	1	0	CDH8	60448635	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	7.359000	0.79477	2.710000	0.92621	0.557000	0.71058	GTC	-	CDH8	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.353	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	0	0	0	71	71	52	0.00	0.00	C	NM_001796		61891134	-1	39	22	5	2	tier1	no_errors	ENST00000577390	ensembl	human	known	74_37	missense	88.64	91.67	SNP	1.000	A	39	5
FDPS	2224	genome.wustl.edu	37	1	155290334	155290342	+	In_Frame_Del	DEL	CGCAGCACC	CGCAGCACC	-			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	CGCAGCACC	CGCAGCACC	CGCAGCACC	-	CGCAGCACC	CGCAGCACC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr1:155290334_155290342delCGCAGCACC	ENST00000356657.6	+	11	1356_1364	c.1194_1202delCGCAGCACC	c.(1192-1203)tacgcagcaccc>tac	p.AAP399del	RUSC1_ENST00000368354.3_5'Flank|FDPS_ENST00000368356.4_In_Frame_Del_p.AAP399del|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368352.5_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|FDPS_ENST00000447866.1_In_Frame_Del_p.AAP333del|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	399					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	TTGAACAGTACGCAGCACCCCTGCCCCCA	0.536													ENSG00000160752																																					0																																										SO:0001651	inframe_deletion	0				J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.1194_1202delCGCAGCACC	1.37:g.155290334_155290342delCGCAGCACC	ENSP00000349078:p.Ala399_Pro401del		D3DV91|E9PCI9|Q96G29	In_Frame_Del	DEL	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.AAP399in_frame_del	ENST00000356657.6	37	c.1194_1202	CCDS1110.1	1																																																																																				FDPS	-	superfamily_Terpenoid_synth		0.536	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FDPS	HGNC	protein_coding	OTTHUMT00000039053.1	0	0	0	16	16	16	0.00	0.00	CGCAGCACC	NM_002004		155290342	+1	2	2	7	7	tier1	no_errors	ENST00000356657	ensembl	human	known	74_37	in_frame_del	22.22	22.22	DEL	0.862:0.905:0.903:0.002:0.000:0.001:0.001:0.936:0.989	-	2	7
LENG8	114823	genome.wustl.edu	37	19	54965619	54965619	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:54965619C>G	ENST00000326764.5	+	6	916	c.437C>G	c.(436-438)cCc>cGc	p.P146R	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	0										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CCCCCAGTCCCCGGCATGGAT	0.672													ENSG00000167615																																					0													38.0	42.0	41.0					19																	54965619		2203	4300	6503	SO:0001583	missense	0			-	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.437C>G	19.37:g.54965619C>G	ENSP00000318374:p.Pro146Arg		B0VJY9|Q8IZ27|Q8NCX6	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.P146R	ENST00000326764.5	37	c.437	CCDS12894.1	19	.	.	.	.	.	.	.	.	.	.	C	19.26	3.792774	0.70452	.	.	ENSG00000167615	ENST00000326764;ENST00000301196;ENST00000439657;ENST00000376526;ENST00000431846	T;T;T;T	0.59502	1.27;0.26;1.36;1.18	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.976	T	0.75631	-0.3251	10	0.87932	D	0	-24.7505	16.3144	0.82913	0.0:1.0:0.0:0.0	.	146;109	Q96PV6-2;F8W9Q9	.;.	R	146;109;146;109;146	ENSP00000318374:P146R;ENSP00000399507:P146R;ENSP00000365709:P109R;ENSP00000388053:P146R	ENSP00000301196:P109R	P	+	2	0	LENG8	59657431	0.990000	0.36364	0.972000	0.41901	0.466000	0.32739	4.038000	0.57318	2.525000	0.85131	0.655000	0.94253	CCC	-	LENG8	-	NULL		0.672	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG8	HGNC	protein_coding	OTTHUMT00000140523.2	0	0	0	128	128	11	0.00	0.00	C	NM_052925		54965619	+1	55	11	61	4	tier1	no_errors	ENST00000326764	ensembl	human	known	74_37	missense	47.01	73.33	SNP	1.000	G	55	61
MICA	100507436	genome.wustl.edu	37	6	31378924	31378924	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr6:31378924A>G	ENST00000449934.2	+	3	455	c.401A>G	c.(400-402)tAc>tGc	p.Y134C	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				CAGCATTTCTACTACGATGGG	0.552													ENSG00000204520																																					0													45.0	42.0	43.0					6																	31378924		692	1591	2283	SO:0001583	missense	0			-	L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.401A>G	6.37:g.31378924A>G	ENSP00000413079:p.Tyr134Cys			Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.Y134C	ENST00000449934.2	37	c.401	CCDS56412.1	6	.	.	.	.	.	.	.	.	.	.	N	9.153	1.016731	0.19355	.	.	ENSG00000204520	ENST00000364810;ENST00000449934	T	0.01685	4.69	1.94	-1.76	0.08006	.	2.341720	0.02050	N	0.049981	T	0.02929	0.0087	M	0.73962	2.25	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.19712	-1.0297	10	0.59425	D	0.04	.	3.5661	0.07900	0.4719:0.2051:0.323:0.0	.	134	Q96QC4	.	C	134	ENSP00000413079:Y134C	ENSP00000365394:Y134C	Y	+	2	0	MICA	31486903	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-1.176000	0.03099	-0.759000	0.04684	0.254000	0.18369	TAC	-	MICA	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.552	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	0	0	0	56	56	21	0.00	0.00	A	NM_001177519		31378924	+1	29	14	32	2	tier1	no_errors	ENST00000449934	ensembl	human	known	74_37	missense	46.77	87.50	SNP	0.000	G	29	32
PAK3	5063	genome.wustl.edu	37	X	110390987	110390987	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chrX:110390987G>A	ENST00000372010.1	+	8	786	c.344G>A	c.(343-345)cGa>cAa	p.R115Q	PAK3_ENST00000262836.4_Missense_Mutation_p.R115Q|PAK3_ENST00000518291.1_Missense_Mutation_p.R136Q|PAK3_ENST00000446737.1_Missense_Mutation_p.R100Q|PAK3_ENST00000360648.4_Missense_Mutation_p.R136Q|PAK3_ENST00000417227.1_Missense_Mutation_p.R121Q|PAK3_ENST00000519681.1_Missense_Mutation_p.R121Q|PAK3_ENST00000425146.1_Missense_Mutation_p.R100Q|PAK3_ENST00000372007.5_Missense_Mutation_p.R100Q			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	115	Autoregulatory region. {ECO:0000250}.|GTPase-binding. {ECO:0000250}.|Linker.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						CAATGGGCACGATTACTCCAA	0.398										TSP Lung(19;0.15)			ENSG00000077264																																					0													119.0	104.0	109.0					X																	110390987		2203	4300	6503	SO:0001583	missense	0			-	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.344G>A	X.37:g.110390987G>A	ENSP00000361080:p.Arg115Gln		A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.R136Q	ENST00000372010.1	37	c.407	CCDS48153.1	X	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371646	0.61624	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	D;D;D;D;D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01	5.74	5.74	0.90152	PAK-box/P21-Rho-binding (2);	0.000000	0.85682	D	0.000000	D	0.84079	0.5393	L	0.52759	1.655	0.58432	D	0.999999	P;P;P;P	0.47191	0.891;0.891;0.552;0.497	B;B;B;B	0.42625	0.342;0.301;0.393;0.273	D	0.84998	0.0898	10	0.49607	T	0.09	.	18.9393	0.92598	0.0:0.0:1.0:0.0	.	121;136;115;100	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	Q	100;100;115;121;100;136;136;136;121;115	ENSP00000410853:R100Q;ENSP00000401982:R100Q;ENSP00000361080:R115Q;ENSP00000429113:R121Q;ENSP00000361077:R100Q;ENSP00000428921:R136Q;ENSP00000405642:R136Q;ENSP00000353864:R136Q;ENSP00000389172:R121Q;ENSP00000262836:R115Q	ENSP00000262836:R115Q	R	+	2	0	PAK3	110277643	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.421000	0.82119	0.538000	0.68166	CGA	-	PAK3	-	pfam_CRIB_dom		0.398	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	HGNC	protein_coding	OTTHUMT00000057918.1	0	0	0	45	45	95	0.00	0.00	G	NM_002578		110390987	+1	38	66	3	8	tier1	no_errors	ENST00000360648	ensembl	human	known	74_37	missense	92.68	89.19	SNP	1.000	A	38	3
RIPK4	54101	genome.wustl.edu	37	21	43161030	43161030	+	Missense_Mutation	SNP	C	C	T	rs142879262		TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr21:43161030C>T	ENST00000352483.2	-	9	2531	c.2467G>A	c.(2467-2469)Gcc>Acc	p.A823T	RIPK4_ENST00000544709.1_Missense_Mutation_p.A712T|AP001615.9_ENST00000423276.1_RNA|RIPK4_ENST00000332512.3_Missense_Mutation_p.A775T|RIPK4_ENST00000542057.1_Missense_Mutation_p.A712T			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	823					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AGCGTGGCGGCGGGGCCATGG	0.692													ENSG00000183421	C|||	1	0.000199681	0.0	0.0	5008	,	,		15403	0.0		0.0	False		,,,				2504	0.001																0								C	THR/ALA	6,4356		0,6,2175	25.0	27.0	26.0		2323	-4.4	0.0	21	dbSNP_134	26	1,8487		0,1,4243	yes	missense	RIPK4	NM_020639.2	58	0,7,6418	TT,TC,CC		0.0118,0.1376,0.0545	benign	775/785	43161030	7,12843	2181	4244	6425	SO:0001583	missense	0			-	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.2467G>A	21.37:g.43161030C>T	ENSP00000330161:p.Ala823Thr		Q96KH0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A823T	ENST00000352483.2	37	c.2467		21	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.687389	0.00738	0.001376	1.18E-4	ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	T;T;T;T	0.78003	-0.91;-0.92;-1.14;-1.14	4.8	-4.37	0.03633	.	1.578550	0.04134	N	0.318462	T	0.55257	0.1909	N	0.10782	0.045	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36553	-0.9743	10	0.25751	T	0.34	-0.5906	5.2425	0.15479	0.0899:0.497:0.0888:0.3243	.	775	P57078-2	.	T	775;823;712;712	ENSP00000332454:A775T;ENSP00000330161:A823T;ENSP00000441754:A712T;ENSP00000442901:A712T	ENSP00000332454:A775T	A	-	1	0	RIPK4	42034099	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.516000	0.00954	-1.266000	0.02446	-2.151000	0.00333	GCC	rs142879262	RIPK4	-	NULL		0.692	RIPK4-201	KNOWN	basic	protein_coding	RIPK4	HGNC	protein_coding		0	0	0	150	150	12	0.00	0.00	C	NM_020639		43161030	-1	62	7	75	4	tier1	no_errors	ENST00000352483	ensembl	human	known	74_37	missense	44.93	63.64	SNP	0.000	T	62	75
ZC3H18	124245	genome.wustl.edu	37	16	88677733	88677744	+	In_Frame_Del	DEL	GAGCGGGACCGA	GAGCGGGACCGA	-	rs553557301	byFrequency	TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	GAGCGGGACCGA	GAGCGGGACCGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr16:88677733_88677744delGAGCGGGACCGA	ENST00000301011.5	+	8	1464_1475	c.1264_1275delGAGCGGGACCGA	c.(1264-1275)gagcgggaccgadel	p.ERDR422del	ZC3H18_ENST00000452588.2_In_Frame_Del_p.ERDR446del	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	422						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		gcgggagcgggagcgggaccgagagcgggagc	0.66													ENSG00000158545																									Ovarian(121;375 2276 20373 38669)												0																																										SO:0001651	inframe_deletion	0				BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1264_1275delGAGCGGGACCGA	16.37:g.88677733_88677744delGAGCGGGACCGA	ENSP00000301011:p.Glu422_Arg425del		Q96DG4|Q96MP7	In_Frame_Del	DEL	smart_Znf_CCCH	p.DRER424in_frame_del	ENST00000301011.5	37	c.1264_1275	CCDS10967.1	16																																																																																				ZC3H18	-	NULL		0.660	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	HGNC	protein_coding	OTTHUMT00000269168.1	0	0	0	20	20	20	0.00	0.00	GAGCGGGACCGA	NM_144604		88677744	+1	1	1	0	0	tier1	no_errors	ENST00000301011	ensembl	human	known	74_37	in_frame_del	100.00	100.00	DEL	0.989:1.000:1.000:1.000:1.000:0.998:1.000:1.000:0.992:0.997:0.991:0.721	-	1	0
SPPL2B	56928	genome.wustl.edu	37	19	2341094	2341101	+	RNA	DEL	CTCCCTGG	CTCCCTGG	-	rs77642174|rs76166147|rs386805838|rs547300749	byFrequency	TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	CTCCCTGG	CTCCCTGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:2341094_2341101delCTCCCTGG	ENST00000452401.2	+	0	1033							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCCCTGCCCTCCCTGGAGGCCGCCCC	0.702													ENSG00000005206		1248	0.249201	0.0469	0.3718	5008	,	,		14617	0.25		0.4294	False		,,,				2504	0.2495																0																																												0					CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2341094_2341101delCTCCCTGG			D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	R	DEL	-	NULL	ENST00000452401.2	37	NULL		19																																																																																				SPPL2B	-	-		0.702	SPPL2B-202	KNOWN	basic	processed_transcript	SPPL2B	HGNC	processed_transcript		0	0	0	0	0	0	0.00	0.00	CTCCCTGG	NM_020172		2341101	+1	0	0	1	1	tier1	no_errors	ENST00000592738	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.010:0.001:0.000:0.000:0.001:0.000	-	0	1
RYR1	6261	genome.wustl.edu	37	19	38964203	38964203	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr19:38964203G>A	ENST00000359596.3	+	28	3952	c.3952G>A	c.(3952-3954)Gcc>Acc	p.A1318T	RYR1_ENST00000355481.4_Missense_Mutation_p.A1318T|RYR1_ENST00000360985.3_Missense_Mutation_p.A1318T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1318	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCAGCCCCCCGCCGAGGACGA	0.692													ENSG00000196218																																					0													8.0	10.0	9.0					19																	38964203		2137	4174	6311	SO:0001583	missense	0			-	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3952G>A	19.37:g.38964203G>A	ENSP00000352608:p.Ala1318Thr		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.A1318T	ENST00000359596.3	37	c.3952	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	9.299	1.052715	0.19907	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96685	-4.09;-4.09;-4.09	5.07	1.52	0.23074	.	.	.	.	.	D	0.92469	0.7609	N	0.22421	0.69	0.09310	N	1	D;D	0.63046	0.992;0.976	P;B	0.47744	0.556;0.253	D	0.84994	0.0896	9	0.20519	T	0.43	.	10.7368	0.46130	0.0:0.0:0.4954:0.5046	.	1318;1318	P21817-2;P21817	.;RYR1_HUMAN	T	1318	ENSP00000352608:A1318T;ENSP00000347667:A1318T;ENSP00000354254:A1318T	ENSP00000347667:A1318T	A	+	1	0	RYR1	43656043	0.788000	0.28762	0.013000	0.15412	0.087000	0.18053	2.515000	0.45512	0.118000	0.18165	-0.521000	0.04368	GCC	-	RYR1	-	NULL		0.692	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	0	0	0	85	85	0	0.00	0.00	G			38964203	+1	51	0	160	0	tier1	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	24.06	0.00	SNP	0.013	A	51	160
DAPL1	92196	genome.wustl.edu	37	2	159710125	159710125	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr2:159710125C>A	ENST00000409042.1	+	5	375	c.319C>A	c.(319-321)Cca>Aca	p.P107T				A0PJW8	DAPL1_HUMAN	death associated protein-like 1	0					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)					prostate(1)	1						ACACACGGAGCCACGGAATCT	0.502													ENSG00000163331																																					0																																										SO:0001583	missense	0			-		CCDS33307.1	2q24	2007-06-26			ENSG00000163331	ENSG00000163331			21490	protein-coding gene	gene with protein product							Standard	NM_001017920		Approved		uc002uaf.3	A0PJW8	OTTHUMG00000153970	ENST00000409042.1:c.319C>A	2.37:g.159710125C>A	ENSP00000386422:p.Pro107Thr		A0PJW9|B9EIK6	Missense_Mutation	SNP	NULL	p.P107T	ENST00000409042.1	37	c.319		2	.	.	.	.	.	.	.	.	.	.	C	0.405	-0.916458	0.02415	.	.	ENSG00000163331	ENST00000409042	T	0.38560	1.13	.	.	.	.	.	.	.	.	T	0.35038	0.0918	.	.	.	0.19300	N	0.999976	.	.	.	.	.	.	T	0.37174	-0.9717	5	0.87932	D	0	.	2.8356	0.05513	0.4983:0.5012:2.0E-4:3.0E-4	.	.	.	.	T	107	ENSP00000386422:P107T	ENSP00000386422:P107T	P	+	1	0	DAPL1	159418371	0.010000	0.17322	0.378000	0.26068	0.379000	0.30106	-0.652000	0.05366	0.064000	0.16427	0.064000	0.15345	CCA	-	DAPL1	-	NULL		0.502	DAPL1-002	PUTATIVE	basic	protein_coding	DAPL1	HGNC	protein_coding	OTTHUMT00000333266.1	0	0	0	119	119	0	0.00	0.00	C	NM_001017920		159710125	+1	67	3	71	0	tier1	no_errors	ENST00000409042	ensembl	human	putative	74_37	missense	48.55	100.00	SNP	0.834	A	67	71
TREML1	340205	genome.wustl.edu	37	6	41121641	41121641	+	Silent	SNP	C	C	T	rs201231028		TCGA-DX-A48R-01A-11D-A307-09	TCGA-DX-A48R-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	09bcb1b5-568d-4ec4-99a2-5401f231aae8	ab74d2ac-412f-4c3a-988e-920595b8fcc1	g.chr6:41121641C>T	ENST00000426005.2	-	2	274	c.231G>A	c.(229-231)acG>acA	p.T77T	TREML1_ENST00000437044.2_Intron|TREML1_ENST00000373127.4_Silent_p.T77T	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	77	Ig-like V-type.				calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGTGAGAAACGTACGCCTGC	0.627													ENSG00000161911	C|||	1	0.000199681	0.0	0.0	5008	,	,		17837	0.0		0.0	False		,,,				2504	0.001																0								C		0,4406		0,0,2203	43.0	46.0	45.0		231	-11.9	0.0	6		45	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TREML1	NM_178174.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		77/312	41121641	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.231G>A	6.37:g.41121641C>T			Q496B3|Q8IWY1|Q8IWY2	Silent	SNP	pfam_Ig_V-set	p.T77	ENST00000426005.2	37	c.231	CCDS4851.1	6																																																																																			rs201231028	TREML1	-	pfam_Ig_V-set		0.627	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TREML1	HGNC	protein_coding	OTTHUMT00000043538.2	0	0	0	156	156	38	0.00	0.00	C	NM_178174		41121641	-1	23	2	115	27	tier1	no_errors	ENST00000426005	ensembl	human	known	74_37	silent	16.67	6.90	SNP	0.000	T	23	115
