#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
CLCN7	1186	genome.wustl.edu	37	16	1497076	1497076	+	Silent	SNP	G	G	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr16:1497076G>C	ENST00000382745.4	-	24	2867	c.2262C>G	c.(2260-2262)ctC>ctG	p.L754L	CLCN7_ENST00000262318.8_Missense_Mutation_p.P731A|CCDC154_ENST00000389176.3_5'Flank|CCDC154_ENST00000409671.1_5'Flank|CLCN7_ENST00000448525.1_Silent_p.L730L|LA16c-390E6.5_ENST00000566287.1_RNA	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	754	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				ACACCCGTGGGAGCGACGCCT	0.706													ENSG00000103249																																					0													19.0	20.0	20.0					16																	1497076		2178	4285	6463	SO:0001819	synonymous_variant	0			-	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.2262C>G	16.37:g.1497076G>C			A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-7	p.P731A	ENST00000382745.4	37	c.2191	CCDS32361.1	16																																																																																			-	CLCN7	-	NULL		0.706	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	HGNC	protein_coding	OTTHUMT00000103598.2	0	0	0	30	30	21	0.00	0.00	G	NM_001287		1497076	-1	4	2	16	10	tier1	no_errors	ENST00000262318	ensembl	human	putative	74_37	missense	20.00	16.67	SNP	0.098	C	4	16
SNX27	81609	genome.wustl.edu	37	1	151611519	151611519	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:151611519A>G	ENST00000458013.2	+	2	587	c.467A>G	c.(466-468)gAt>gGt	p.D156G	SNX27_ENST00000368843.3_Missense_Mutation_p.D156G|SNX27_ENST00000368838.1_Missense_Mutation_p.D63G			Q96L92	SNX27_HUMAN	sorting nexin family member 27	156					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCATTTTATGATTACACAGAA	0.473													ENSG00000143376																									Colon(46;291 966 40145 41237 41888)												0													114.0	104.0	107.0					1																	151611519		2203	4300	6503	SO:0001583	missense	0			-	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.467A>G	1.37:g.151611519A>G	ENSP00000400333:p.Asp156Gly		Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.D156G	ENST00000458013.2	37	c.467		1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.173871	0.78452	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	T;T;T	0.29397	1.57;1.57;1.57	4.66	4.66	0.58398	Phox homologous domain (3);	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.962;0.993	T	0.51973	-0.8637	10	0.59425	D	0.04	.	13.0435	0.58913	1.0:0.0:0.0:0.0	.	156;156	Q96L92;Q96L92-3	SNX27_HUMAN;.	G	156;156;63	ENSP00000400333:D156G;ENSP00000357836:D156G;ENSP00000357831:D63G	ENSP00000357831:D63G	D	+	2	0	SNX27	149878143	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.735000	0.91549	1.954000	0.56735	0.482000	0.46254	GAT	-	SNX27	-	superfamily_Phox,smart_Phox		0.473	SNX27-003	NOVEL	basic	protein_coding	SNX27	HGNC	protein_coding	OTTHUMT00000036624.3	0	0	0	65	65	118	0.00	0.00	A	NM_030918		151611519	+1	11	22	43	78	tier1	no_errors	ENST00000368843	ensembl	human	known	74_37	missense	20.37	22.00	SNP	1.000	G	11	43
DPPA2	151871	genome.wustl.edu	37	3	109028041	109028041	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr3:109028041T>G	ENST00000478945.1	-	4	564	c.318A>C	c.(316-318)caA>caC	p.Q106H		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	106	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCAAACCGAGTTGTTGACACC	0.438													ENSG00000163530																																					0													215.0	222.0	219.0					3																	109028041		2203	4300	6503	SO:0001583	missense	0			-	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.318A>C	3.37:g.109028041T>G	ENSP00000417710:p.Gln106His		Q8WVF0	Missense_Mutation	SNP	pfscan_SAP_dom	p.Q106H	ENST00000478945.1	37	c.318	CCDS2956.1	3	.	.	.	.	.	.	.	.	.	.	T	10.71	1.426287	0.25726	.	.	ENSG00000163530	ENST00000478945	T	0.50001	0.76	4.48	-2.3	0.06785	DNA-binding SAP (2);	0.796261	0.11023	N	0.608169	T	0.38878	0.1057	M	0.65498	2.005	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.42965	-0.9420	10	0.72032	D	0.01	-3.9934	3.1136	0.06367	0.436:0.1919:0.0:0.372	.	106	Q7Z7J5	DPPA2_HUMAN	H	106	ENSP00000417710:Q106H	ENSP00000417710:Q106H	Q	-	3	2	DPPA2	110510731	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.161000	0.10026	-0.452000	0.07087	-0.441000	0.05720	CAA	-	DPPA2	-	pfscan_SAP_dom		0.438	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA2	HGNC	protein_coding	OTTHUMT00000353938.1	0	0	0	75	75	156	0.00	0.00	T	NM_138815		109028041	-1	19	35	57	67	tier1	no_errors	ENST00000478945	ensembl	human	known	74_37	missense	25.00	33.98	SNP	0.000	G	19	57
SYNGR4	23546	genome.wustl.edu	37	19	48876925	48876925	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr19:48876925C>T	ENST00000344846.2	+	3	495	c.245C>T	c.(244-246)gCc>gTc	p.A82V	SYNGR4_ENST00000601610.1_Missense_Mutation_p.A33V|SYNGR4_ENST00000595322.1_Missense_Mutation_p.A33V	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	82	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		AGCTGCCTGGCCTTCCTCGTC	0.627													ENSG00000105467																																					0													91.0	83.0	86.0					19																	48876925		2203	4300	6503	SO:0001583	missense	0			-	AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.245C>T	19.37:g.48876925C>T	ENSP00000344041:p.Ala82Val		Q3KP58	Missense_Mutation	SNP	pfam_Marvel,pirsf_Synaptogyrin	p.A82V	ENST00000344846.2	37	c.245	CCDS12717.1	19	.	.	.	.	.	.	.	.	.	.	C	9.988	1.229932	0.22542	.	.	ENSG00000105467	ENST00000344846	T	0.25579	1.79	3.96	-7.92	0.01160	Marvel (1);MARVEL-like domain (1);	0.618562	0.16849	N	0.197037	T	0.09642	0.0237	L	0.28274	0.84	0.24034	N	0.996107	B	0.10296	0.003	B	0.12156	0.007	T	0.29119	-1.0022	10	0.13108	T	0.6	-13.9006	3.3676	0.07208	0.1111:0.1114:0.2234:0.5541	.	82	O95473	SNG4_HUMAN	V	82	ENSP00000344041:A82V	ENSP00000344041:A82V	A	+	2	0	SYNGR4	53568737	0.000000	0.05858	0.654000	0.29608	0.933000	0.57130	-1.562000	0.02156	-1.393000	0.02079	-0.378000	0.06908	GCC	-	SYNGR4	-	pfam_Marvel,pirsf_Synaptogyrin		0.627	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR4	HGNC	protein_coding	OTTHUMT00000465704.1	0	0	0	20	20	43	0.00	0.00	C			48876925	+1	9	16	13	15	tier1	no_errors	ENST00000344846	ensembl	human	known	74_37	missense	40.91	51.61	SNP	0.877	T	9	13
RUNX3	864	genome.wustl.edu	37	1	25229150	25229150	+	Silent	SNP	C	C	T	rs567207182		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:25229150C>T	ENST00000308873.6	-	5	719	c.711G>A	c.(709-711)tcG>tcA	p.S237S	RUNX3_ENST00000496967.1_5'UTR|RUNX3_ENST00000540420.1_Silent_p.S144S|RUNX3_ENST00000338888.3_Silent_p.S251S|RUNX3_ENST00000399916.1_Silent_p.S251S	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	237	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GGTTCAGTTCCGAGGTGCCTG	0.617													ENSG00000020633	C|||	1	0.000199681	0.0	0.0	5008	,	,		14814	0.0		0.0	False		,,,				2504	0.001																0													60.0	54.0	56.0					1																	25229150		2170	4261	6431	SO:0001819	synonymous_variant	0			-	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.711G>A	1.37:g.25229150C>T			B1AJV5|Q12969|Q13760	Silent	SNP	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_D-bd,pirsf_TF_Runt-rel_RUNX,pfscan_Runt_dom,prints_AML1_Runt	p.S251	ENST00000308873.6	37	c.753	CCDS257.1	1																																																																																			-	RUNX3	-	pirsf_TF_Runt-rel_RUNX		0.617	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RUNX3	HGNC	protein_coding	OTTHUMT00000009284.1	0	0	0	166	166	112	0.00	0.00	C	NM_004350		25229150	-1	24	13	39	28	tier1	no_errors	ENST00000338888	ensembl	human	known	74_37	silent	38.10	31.71	SNP	0.997	T	24	39
TOX	9760	genome.wustl.edu	37	8	59727987	59727987	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr8:59727987C>A	ENST00000361421.1	-	7	1522	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H	RNU4-50P_ENST00000364361.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	434						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GCTGGTGCTGCTGCATGTTGA	0.567													ENSG00000198846																									Pancreas(161;610 1969 17913 21374 22725)												0													64.0	67.0	66.0					8																	59727987		2203	4300	6503	SO:0001583	missense	0			-		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.1302G>T	8.37:g.59727987C>A	ENSP00000354842:p.Gln434His		Q96AV5	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Q434H	ENST00000361421.1	37	c.1302	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657589	0.29425	.	.	ENSG00000198846	ENST00000361421;ENST00000456290	T	0.12569	2.67	5.91	5.04	0.67666	.	0.115474	0.64402	D	0.000014	T	0.09642	0.0237	N	0.02247	-0.625	0.48901	D	0.999723	D	0.56521	0.976	P	0.53809	0.735	T	0.45963	-0.9225	9	.	.	.	.	12.0087	0.53274	0.0:0.8611:0.0:0.1389	.	434	O94900	TOX_HUMAN	H	434;184	ENSP00000354842:Q434H	.	Q	-	3	2	TOX	59890541	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.167000	0.31847	1.500000	0.48636	0.591000	0.81541	CAG	-	TOX	-	NULL		0.567	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1	0	0	0	50	50	58	0.00	0.00	C	NM_014729		59727987	-1	14	6	46	31	tier1	no_errors	ENST00000361421	ensembl	human	known	74_37	missense	23.33	15.79	SNP	1.000	A	14	46
MYCBP2	23077	genome.wustl.edu	37	13	77799597	77799597	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr13:77799597G>A	ENST00000544440.2	-	19	2733	c.2716C>T	c.(2716-2718)Caa>Taa	p.Q906*	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Nonsense_Mutation_p.Q944*|MYCBP2_ENST00000357337.6_Nonsense_Mutation_p.Q906*					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CAGCTGACTTGGACTGCCCGG	0.453													ENSG00000005810																																					0													164.0	139.0	147.0					13																	77799597		2203	4300	6503	SO:0001587	stop_gained	0			-	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2716C>T	13.37:g.77799597G>A	ENSP00000444596:p.Gln906*			Nonsense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.Q944*	ENST00000544440.2	37	c.2830		13	.	.	.	.	.	.	.	.	.	.	G	42	9.477140	0.99181	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	X	906;944;906	.	ENSP00000349892:Q906X	Q	-	1	0	MYCBP2	76697598	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.452000	0.97615	2.861000	0.98227	0.655000	0.94253	CAA	-	MYCBP2	-	superfamily_RCC1/BLIP-II,superfamily_ARM-type_fold		0.453	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	0	0	0	61	61	127	0.00	0.00	G	NM_015057		77799597	-1	32	45	78	104	tier1	no_errors	ENST00000407578	ensembl	human	known	74_37	nonsense	29.09	30.20	SNP	1.000	A	32	78
SLC26A4	5172	genome.wustl.edu	37	7	107353040	107353040	+	Silent	SNP	G	G	A	rs139556627		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr7:107353040G>A	ENST00000265715.3	+	20	2516	c.2292G>A	c.(2290-2292)acG>acA	p.T764T	SLC26A4_ENST00000541474.1_Silent_p.T325T|SLC26A4_ENST00000544569.1_Silent_p.T351T|SLC26A4_ENST00000543100.1_Silent_p.T333T	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	764					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.T764T(1)		central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CAGAGCTGACGGAAGAAGAAC	0.323									Pendred syndrome				ENSG00000091137	G|||	1	0.000199681	0.0008	0.0	5008	,	,		18435	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)						G		1,4405	2.1+/-5.4	0,1,2202	130.0	129.0	130.0		2292	0.3	0.2	7	dbSNP_134	130	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC26A4	NM_000441.1		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		764/781	107353040	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Goiter-Deafness syndrome	-	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.2292G>A	7.37:g.107353040G>A			B7Z266|O43170	Silent	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.T764	ENST00000265715.3	37	c.2292	CCDS5746.1	7																																																																																			rs139556627	SLC26A4	-	NULL		0.323	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	HGNC	protein_coding	OTTHUMT00000337148.1	0	0	0	62	62	125	0.00	0.00	G	NM_000441		107353040	+1	14	30	59	133	tier1	no_errors	ENST00000265715	ensembl	human	known	74_37	silent	19.18	18.40	SNP	0.076	A	14	59
KANK4	163782	genome.wustl.edu	37	1	62737171	62737171	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:62737171T>G	ENST00000371153.4	-	4	2369	c.1991A>C	c.(1990-1992)cAg>cCg	p.Q664P	KANK4_ENST00000371150.1_Missense_Mutation_p.Q20P|KANK4_ENST00000354381.3_Missense_Mutation_p.Q36P	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	664						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						CCCAACAAACTGAAGGTTCTT	0.473													ENSG00000132854																																					0													210.0	193.0	199.0					1																	62737171		2203	4300	6503	SO:0001583	missense	0			-	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.1991A>C	1.37:g.62737171T>G	ENSP00000360195:p.Gln664Pro		B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	pfam_KN_motif,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q664P	ENST00000371153.4	37	c.1991	CCDS620.1	1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.575873	0.86645	.	.	ENSG00000132854	ENST00000371153;ENST00000354381;ENST00000371150	T;T;T	0.61040	0.14;0.33;0.29	5.67	5.67	0.87782	.	0.206588	0.24573	N	0.037370	T	0.79499	0.4456	M	0.86420	2.815	0.53005	D	0.999969	D;D	0.76494	0.999;0.999	D;D	0.75484	0.961;0.986	T	0.83343	-0.0007	10	0.87932	D	0	-13.621	15.924	0.79597	0.0:0.0:0.0:1.0	.	36;664	Q5T7N3-2;Q5T7N3	.;KANK4_HUMAN	P	664;36;20	ENSP00000360195:Q664P;ENSP00000346352:Q36P;ENSP00000360192:Q20P	ENSP00000346352:Q36P	Q	-	2	0	KANK4	62509759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.532000	0.81985	2.163000	0.67991	0.459000	0.35465	CAG	-	KANK4	-	NULL		0.473	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK4	HGNC	protein_coding	OTTHUMT00000024877.1	0	0	0	119	119	176	0.00	0.00	T	NM_181712		62737171	-1	68	67	149	197	tier1	no_errors	ENST00000371153	ensembl	human	known	74_37	missense	31.19	25.38	SNP	1.000	G	68	149
MMP9	4318	genome.wustl.edu	37	20	44641114	44641114	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr20:44641114G>T	ENST00000372330.3	+	8	1242	c.1223G>T	c.(1222-1224)gGc>gTc	p.G408V	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	408					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	CACGCGCTGGGCTTAGATCAT	0.637													ENSG00000100985																																					0													77.0	70.0	72.0					20																	44641114		2203	4300	6503	SO:0001583	missense	0			-		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1223G>T	20.37:g.44641114G>T	ENSP00000361405:p.Gly408Val		B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin-like_repeat,pfam_PT,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin-like_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A	p.G408V	ENST00000372330.3	37	c.1223	CCDS13390.1	20	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854531	0.91355	.	.	ENSG00000100985	ENST00000372330;ENST00000545925	D	0.84730	-1.89	4.99	4.99	0.66335	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94984	0.8377	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96392	0.9290	10	0.87932	D	0	.	17.4497	0.87588	0.0:0.0:1.0:0.0	.	408	P14780	MMP9_HUMAN	V	408;53	ENSP00000361405:G408V	ENSP00000361405:G408V	G	+	2	0	MMP9	44074521	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.519000	0.98025	2.606000	0.88127	0.561000	0.74099	GGC	-	MMP9	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,prints_Pept_M10A		0.637	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP9	HGNC	protein_coding	OTTHUMT00000080337.1	0	0	0	66	66	44	0.00	0.00	G			44641114	+1	14	9	72	51	tier1	no_errors	ENST00000372330	ensembl	human	known	74_37	missense	16.28	15.00	SNP	1.000	T	14	72
GUCY1A2	2977	genome.wustl.edu	37	11	106672147	106672147	+	Intron	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr11:106672147G>T	ENST00000526355.2	-	5	2161				GUCY1A2_ENST00000347596.2_Intron|AP001282.1_ENST00000578526.1_RNA|GUCY1A2_ENST00000282249.2_Intron	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CTCATTTTATGTattaaaatt	0.308													ENSG00000264542																																					0																																										SO:0001627	intron_variant	0			-	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1692+8571C>A	11.37:g.106672147G>T			A1L4C4|B7ZLT5	R	SNP	-	NULL	ENST00000526355.2	37	NULL	CCDS8335.1	11																																																																																			-	AP001282.1	-	-		0.308	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000264542	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000389003.2	0	0	0	63	63	139	0.00	0.00	G			106672147	-1	18	12	41	63	tier1	no_errors	ENST00000578526	ensembl	human	novel	74_37	rna	30.51	16.00	SNP	0.000	T	18	41
DLX1	1745	genome.wustl.edu	37	2	172950516	172950516	+	Silent	SNP	C	C	T	rs377533627		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:172950516C>T	ENST00000361725.4	+	1	563	c.111C>T	c.(109-111)caC>caT	p.H37H	DLX1_ENST00000341900.6_Silent_p.H37H	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	37					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CCATGTCCCACGGGCACTACT	0.622													ENSG00000144355																																					0													144.0	136.0	139.0					2																	172950516		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.111C>T	2.37:g.172950516C>T			D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.H37	ENST00000361725.4	37	c.111	CCDS2247.2	2																																																																																			-	DLX1	-	NULL		0.622	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX1	HGNC	protein_coding	OTTHUMT00000405916.1	0	0	0	73	73	132	0.00	0.00	C	XM_087198		172950516	+1	14	28	51	114	tier1	no_errors	ENST00000361725	ensembl	human	known	74_37	silent	21.54	19.72	SNP	1.000	T	14	51
AGTPBP1	23287	genome.wustl.edu	37	9	88247722	88247722	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr9:88247722G>T	ENST00000357081.3	-	14	2014	c.1870C>A	c.(1870-1872)Ctc>Atc	p.L624I	AGTPBP1_ENST00000432218.1_Missense_Mutation_p.L462I|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.L584I|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.L636I			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	624					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						GGGTCATGGAGTGTTGGTCCA	0.433													ENSG00000135049																																					0													172.0	141.0	151.0					9																	88247722		2203	4300	6503	SO:0001583	missense	0			-	AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.1870C>A	9.37:g.88247722G>T	ENSP00000349592:p.Leu624Ile		B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.L636I	ENST00000357081.3	37	c.1906		9	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306121	0.60305	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.53423	2.0;1.99;1.96;0.62	6.03	6.03	0.97812	.	0.114304	0.64402	D	0.000011	T	0.48696	0.1514	L	0.54323	1.7	0.80722	D	1	P;P;P;P	0.48294	0.843;0.908;0.906;0.721	B;B;B;B	0.43123	0.36;0.232;0.409;0.26	T	0.46596	-0.9180	10	0.45353	T	0.12	-10.9082	16.9745	0.86309	0.0:0.1354:0.8646:0.0	.	636;624;462;584	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	I	624;584;636;462	ENSP00000349592:L624I;ENSP00000365251:L584I;ENSP00000365277:L636I;ENSP00000402804:L462I	ENSP00000349592:L624I	L	-	1	0	AGTPBP1	87437542	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.889000	0.69766	2.861000	0.98227	0.655000	0.94253	CTC	-	AGTPBP1	-	NULL		0.433	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1	0	0	0	63	63	160	0.00	0.00	G	NM_015239		88247722	-1	38	41	67	125	tier1	no_errors	ENST00000376109	ensembl	human	known	74_37	missense	36.19	24.70	SNP	1.000	T	38	67
STAU2	27067	genome.wustl.edu	37	8	74351352	74351352	+	Intron	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr8:74351352C>A	ENST00000524300.1	-	14	1881				STAU2-AS1_ENST00000517604.1_lincRNA|STAU2_ENST00000523558.1_Intron|STAU2_ENST00000521210.1_Intron|STAU2_ENST00000522695.1_Intron	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2						transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			aaatatttaacaactgactct	0.483													ENSG00000253302																																					0																																										SO:0001627	intron_variant	0			-	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000524300.1:c.1531-16415G>T	8.37:g.74351352C>A			B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	R	SNP	-	NULL	ENST00000524300.1	37	NULL	CCDS55247.1	8																																																																																			-	STAU2-AS1	-	-		0.483	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2-AS1	HGNC	protein_coding	OTTHUMT00000379000.2	0	0	1	26	26	117	0.00	0.85	C	NM_001164380		74351352	+1	11	37	10	52	tier1	no_errors	ENST00000522703	ensembl	human	known	74_37	rna	52.38	41.57	SNP	0.024	A	11	10
CCSER1	401145	genome.wustl.edu	37	4	92520141	92520141	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr4:92520141A>T	ENST00000509176.1	+	11	2924	c.2636A>T	c.(2635-2637)aAg>aTg	p.K879M	CCSER1_ENST00000333691.8_Missense_Mutation_p.K879M	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	879																	TACAGCAGGAAGAATGTGTTT	0.493													ENSG00000184305																																					0													48.0	42.0	44.0					4																	92520141		692	1591	2283	SO:0001583	missense	0			-		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.2636A>T	4.37:g.92520141A>T	ENSP00000425040:p.Lys879Met		Q4W5M0|Q86V57	Missense_Mutation	SNP	NULL	p.K879M	ENST00000509176.1	37	c.2636	CCDS47099.1	4	.	.	.	.	.	.	.	.	.	.	A	17.72	3.459845	0.63401	.	.	ENSG00000184305	ENST00000509176;ENST00000333691	T;T	0.37411	1.2;1.2	5.49	5.49	0.81192	.	.	.	.	.	T	0.42063	0.1186	N	0.19112	0.55	0.33422	D	0.57994	D	0.69078	0.997	P	0.60345	0.873	T	0.57195	-0.7853	9	0.87932	D	0	-11.6829	14.4428	0.67330	1.0:0.0:0.0:0.0	.	879	Q9C0I3	F190A_HUMAN	M	879	ENSP00000425040:K879M;ENSP00000329482:K879M	ENSP00000329482:K879M	K	+	2	0	FAM190A	92739164	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.648000	0.74359	2.205000	0.71048	0.528000	0.53228	AAG	-	CCSER1	-	NULL		0.493	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSER1	HGNC	protein_coding	OTTHUMT00000363109.3	0	0	0	55	55	172	0.00	0.00	A	NM_001145065		92520141	+1	8	30	36	128	tier1	no_errors	ENST00000333691	ensembl	human	known	74_37	missense	18.18	18.87	SNP	1.000	T	8	36
ALMS1	7840	genome.wustl.edu	37	2	73676274	73676274	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:73676274A>T	ENST00000264448.6	+	8	2728	c.2617A>T	c.(2617-2619)Acc>Tcc	p.T873S	ALMS1_ENST00000377715.1_Missense_Mutation_p.T873S|ALMS1_ENST00000409009.1_Missense_Mutation_p.T831S	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	873	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CTATCAGCAGACCTTACCCAA	0.483													ENSG00000116127																																					0													87.0	91.0	90.0					2																	73676274		1888	4108	5996	SO:0001583	missense	0			-	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2617A>T	2.37:g.73676274A>T	ENSP00000264448:p.Thr873Ser		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.T873S	ENST00000264448.6	37	c.2617	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	A	5.780	0.328326	0.10956	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.16073	3.25;3.25;2.37	3.66	-7.32	0.01436	.	6.448260	0.00541	N	0.000233	T	0.09335	0.0230	N	0.22421	0.69	0.09310	N	1	P;P;P	0.44241	0.825;0.829;0.683	B;B;B	0.38264	0.255;0.269;0.181	T	0.23619	-1.0183	10	0.10377	T	0.69	.	9.4102	0.38487	0.2543:0.1308:0.6149:0.0	.	873;831;873	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	S	831;873;873	ENSP00000386627:T831S;ENSP00000264448:T873S;ENSP00000366944:T873S	ENSP00000264448:T873S	T	+	1	0	ALMS1	73529782	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-2.893000	0.00708	-1.956000	0.01022	0.482000	0.46254	ACC	-	ALMS1	-	NULL		0.483	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	0	0	0	36	36	142	0.00	0.00	A	NM_015120		73676274	+1	11	16	38	99	tier1	no_errors	ENST00000264448	ensembl	human	known	74_37	missense	22.45	13.91	SNP	0.000	T	11	38
ZFHX4	79776	genome.wustl.edu	37	8	77768255	77768255	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr8:77768255C>G	ENST00000521891.2	+	10	9546	c.9098C>G	c.(9097-9099)tCa>tGa	p.S3033*	ZFHX4_ENST00000050961.6_Nonsense_Mutation_p.S2988*|ZFHX4_ENST00000518282.1_Nonsense_Mutation_p.S3007*|ZFHX4_ENST00000455469.2_Nonsense_Mutation_p.S2988*	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2988			V -> G (in dbSNP:rs16939380).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGCACATTTCAAAAGTGAGG	0.537										HNSCC(33;0.089)			ENSG00000091656																																					0													66.0	66.0	66.0					8																	77768255		1959	4144	6103	SO:0001587	stop_gained	0			-		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9098C>G	8.37:g.77768255C>G	ENSP00000430497:p.Ser3033*		G3V138|Q18PS0|Q6ZN20	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.S3033*	ENST00000521891.2	37	c.9098	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	51	18.191760	0.99901	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	.	.	.	5.33	4.46	0.54185	.	0.204155	0.24492	U	0.038046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	10.2922	0.43603	0.0:0.8508:0.0:0.1492	.	.	.	.	X	3033;3017;2988;2988;3007	.	ENSP00000050961:S2988X	S	+	2	0	ZFHX4	77930810	0.998000	0.40836	0.976000	0.42696	0.972000	0.66771	4.678000	0.61641	1.491000	0.48482	0.655000	0.94253	TCA	-	ZFHX4	-	smart_Znf_U1		0.537	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	0	0	0	38	38	92	0.00	0.00	C	NM_024721		77768255	+1	9	19	39	68	tier1	no_errors	ENST00000521891	ensembl	human	known	74_37	nonsense	18.75	21.84	SNP	0.983	G	9	39
SLC39A10	57181	genome.wustl.edu	37	2	196581640	196581640	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:196581640C>T	ENST00000409086.3	+	7	2251	c.1976C>T	c.(1975-1977)tCc>tTc	p.S659F	SLC39A10_ENST00000541054.1_Missense_Mutation_p.S209F|SLC39A10_ENST00000359634.5_Missense_Mutation_p.S659F	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	659					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			CATTCTGGATCCGATCTGAAA	0.488													ENSG00000196950																																					0													136.0	127.0	130.0					2																	196581640		2203	4300	6503	SO:0001583	missense	0			-		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.1976C>T	2.37:g.196581640C>T	ENSP00000386766:p.Ser659Phe		A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	pfam_ZIP	p.S659F	ENST00000409086.3	37	c.1976	CCDS33353.1	2	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831824	0.71258	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.50813	0.73;0.73;0.73	5.54	5.54	0.83059	.	0.249082	0.39687	N	0.001290	T	0.55242	0.1908	L	0.39898	1.24	0.37215	D	0.904984	D	0.61080	0.989	P	0.61070	0.883	T	0.61033	-0.7144	10	0.66056	D	0.02	.	12.275	0.54730	0.2788:0.7212:0.0:0.0	.	659	Q9ULF5	S39AA_HUMAN	F	659;659;209	ENSP00000386766:S659F;ENSP00000352655:S659F;ENSP00000437787:S209F	ENSP00000352655:S659F	S	+	2	0	SLC39A10	196289885	0.999000	0.42202	0.782000	0.31804	0.587000	0.36485	6.194000	0.72082	2.890000	0.99128	0.650000	0.86243	TCC	-	SLC39A10	-	pfam_ZIP		0.488	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A10	HGNC	protein_coding	OTTHUMT00000335186.1	0	0	0	80	80	86	0.00	0.00	C	XM_047707		196581640	+1	8	11	58	72	tier1	no_errors	ENST00000359634	ensembl	human	known	74_37	missense	12.12	13.25	SNP	0.989	T	8	58
UBXN10	127733	genome.wustl.edu	37	1	20517768	20517768	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:20517768C>T	ENST00000375099.3	+	2	798	c.714C>T	c.(712-714)caC>caT	p.H238H		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	238	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.									endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						CCTACCGACACTGCAGCATTG	0.502													ENSG00000162543																																					0													74.0	75.0	75.0					1																	20517768		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.714C>T	1.37:g.20517768C>T			Q5R386	Silent	SNP	pfam_UBX,smart_UBX,pfscan_UBX	p.H238	ENST00000375099.3	37	c.714	CCDS205.1	1																																																																																			-	UBXN10	-	pfam_UBX,smart_UBX,pfscan_UBX		0.502	UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN10	HGNC	protein_coding	OTTHUMT00000007693.1	0	0	0	47	47	205	0.00	0.00	C	NM_152376		20517768	+1	9	38	13	42	tier1	no_errors	ENST00000375099	ensembl	human	known	74_37	silent	40.91	46.91	SNP	0.976	T	9	13
LINGO1	84894	genome.wustl.edu	37	15	77907078	77907078	+	Missense_Mutation	SNP	G	G	A	rs199628078		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr15:77907078G>A	ENST00000355300.6	-	2	1345	c.1171C>T	c.(1171-1173)Cgg>Tgg	p.R391W	LINGO1_ENST00000561030.1_Missense_Mutation_p.R385W	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	391	LRRCT.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GGCTGCTGCCGGTTGAAGTTG	0.652													ENSG00000169783																																					0								G	TRP/ARG	0,4128		0,0,2064	20.0	24.0	23.0		1171	2.7	1.0	15		23	2,8378		0,2,4188	yes	missense	LINGO1	NM_032808.5	101	0,2,6252	AA,AG,GG		0.0239,0.0,0.016	benign	391/621	77907078	2,12506	2064	4190	6254	SO:0001583	missense	0			-	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1171C>T	15.37:g.77907078G>A	ENSP00000347451:p.Arg391Trp		D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R391W	ENST00000355300.6	37	c.1171	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613981	0.28712	0.0	2.39E-4	ENSG00000169783	ENST00000355300	T	0.55760	0.5	4.93	2.72	0.32119	Cysteine-rich flanking region, C-terminal (1);	0.222919	0.40640	N	0.001046	T	0.46946	0.1419	L	0.51422	1.61	0.51482	D	0.999929	B	0.12013	0.005	B	0.04013	0.001	T	0.51741	-0.8667	10	0.72032	D	0.01	.	13.7055	0.62636	0.0:0.0:0.6353:0.3647	.	391	Q96FE5	LIGO1_HUMAN	W	391	ENSP00000347451:R391W	ENSP00000347451:R391W	R	-	1	2	LINGO1	75694133	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.058000	0.41374	1.001000	0.39076	0.462000	0.41574	CGG	rs199628078	LINGO1	-	NULL		0.652	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	0	0	0	68	68	37	0.00	0.00	G	NM_032808		77907078	-1	9	5	47	38	tier1	no_errors	ENST00000355300	ensembl	human	known	74_37	missense	16.07	11.36	SNP	0.995	A	9	47
LY75	4065	genome.wustl.edu	37	2	160750457	160750457	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr2:160750457T>C	ENST00000263636.4	-	3	632	c.605A>G	c.(604-606)tAt>tGt	p.Y202C	LY75-CD302_ENST00000505052.1_Missense_Mutation_p.Y202C|LY75_ENST00000553424.1_Missense_Mutation_p.Y202C|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.Y202C|LY75_ENST00000554112.1_Missense_Mutation_p.Y202C	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	202	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		CTTTCGGTCATATTCATAATT	0.408													ENSG00000054219																																					0													101.0	95.0	97.0					2																	160750457		2203	4300	6503	SO:0001583	missense	0			-	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.605A>G	2.37:g.160750457T>C	ENSP00000263636:p.Tyr202Cys		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.Y202C	ENST00000263636.4	37	c.605	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	T	12.47	1.948141	0.34377	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.54	5.54	0.83059	Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);	0.000000	0.32190	N	0.006453	T	0.61148	0.2324	M	0.72118	2.19	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.65573	0.936;0.935;0.912	T	0.58335	-0.7654	10	0.46703	T	0.11	-11.1798	6.8042	0.23768	0.0:0.082:0.1536:0.7643	.	202;202;202	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	C	202	ENSP00000451511:Y202C;ENSP00000451446:Y202C;ENSP00000263636:Y202C;ENSP00000423463:Y202C;ENSP00000421035:Y202C	ENSP00000423463:Y202C	Y	-	2	0	LY75;LY75-CD302	160458703	0.001000	0.12720	0.996000	0.52242	0.676000	0.39594	0.092000	0.15066	2.230000	0.72887	0.455000	0.32223	TAT	-	LY75	-	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd		0.408	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	0	0	0	39	39	145	0.00	0.00	T			160750457	-1	20	43	29	49	tier1	no_errors	ENST00000554112	ensembl	human	known	74_37	missense	40.82	46.74	SNP	0.159	C	20	29
SMG1	23049	genome.wustl.edu	37	16	18840640	18840640	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr16:18840640G>A	ENST00000446231.2	-	54	9983	c.9571C>T	c.(9571-9573)Cag>Tag	p.Q3191*	SMG1_ENST00000389467.3_Nonsense_Mutation_p.Q3191*			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3191					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGAACCCGCTGCAGGCTTGTC	0.418													ENSG00000157106																																					0													45.0	42.0	43.0					16																	18840640		1881	4109	5990	SO:0001587	stop_gained	0			-	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9571C>T	16.37:g.18840640G>A	ENSP00000402515:p.Gln3191*		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q3191*	ENST00000446231.2	37	c.9571	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	52	19.984588	0.99925	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	.	.	.	5.71	5.71	0.89125	.	0.097264	0.45867	D	0.000332	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	19.9183	0.97074	0.0:0.0:1.0:0.0	.	.	.	.	X	3191	.	ENSP00000374118:Q3191X	Q	-	1	0	SMG1	18748141	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.827000	0.99397	2.697000	0.92050	0.579000	0.79373	CAG	-	SMG1	-	NULL		0.418	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	0	0	0	50	50	132	0.00	0.00	G	NM_015092		18840640	-1	18	48	38	49	tier1	no_errors	ENST00000389467	ensembl	human	known	74_37	nonsense	32.14	48.98	SNP	1.000	A	18	38
DKK2	27123	genome.wustl.edu	37	4	107845150	107845150	+	Silent	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr4:107845150G>A	ENST00000285311.3	-	4	1446	c.741C>T	c.(739-741)taC>taT	p.Y247Y	DKK2_ENST00000510463.1_Silent_p.Y201Y|DKK2_ENST00000513208.1_Silent_p.Y147Y	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	247	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CTTTGGAGGAGTAGGTGGCAT	0.448													ENSG00000155011																																					0													147.0	136.0	140.0					4																	107845150		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.741C>T	4.37:g.107845150G>A			A0AVE9|B2R6S7|Q9UIU3	Silent	SNP	pfam_Dickkopf_N,superfamily_Zn2-C6_fun-type_D-bd	p.Y247	ENST00000285311.3	37	c.741	CCDS3675.1	4																																																																																			-	DKK2	-	NULL		0.448	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DKK2	HGNC	protein_coding	OTTHUMT00000253959.4	0	0	1	34	34	133	0.00	0.75	G			107845150	-1	7	21	10	87	tier1	no_errors	ENST00000285311	ensembl	human	novel	74_37	silent	41.18	19.44	SNP	1.000	A	7	10
SLC44A5	204962	genome.wustl.edu	37	1	75669436	75669436	+	Silent	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:75669436T>C	ENST00000370859.3	-	24	2275	c.2130A>G	c.(2128-2130)gaA>gaG	p.E710E		NM_001130058.1	NP_001123530.1	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	710					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TTTGTGGATTTTCCTCCTGGA	0.408													ENSG00000137968																																					0													226.0	228.0	227.0					1																	75669436		692	1591	2283	SO:0001819	synonymous_variant	0			-	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370859.3:c.2130A>G	1.37:g.75669436T>C			B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	pfam_Choline_transptr-like	p.E710	ENST00000370859.3	37	c.2130	CCDS44164.1	1																																																																																			-	SLC44A5	-	NULL		0.408	SLC44A5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026823.3	0	0	0	55	55	146	0.00	0.00	T	NM_152697		75669436	-1	60	152	30	58	tier1	no_errors	ENST00000370859	ensembl	human	known	74_37	silent	66.67	72.38	SNP	0.000	C	60	30
C5orf45	51149	genome.wustl.edu	37	5	179268934	179268934	+	Missense_Mutation	SNP	C	C	T	rs373245055	byFrequency	TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr5:179268934C>T	ENST00000292586.6	-	5	512	c.422G>A	c.(421-423)cGc>cAc	p.R141H	C5orf45_ENST00000403396.2_Missense_Mutation_p.R183H|C5orf45_ENST00000518235.1_Missense_Mutation_p.R141H|C5orf45_ENST00000520698.1_Missense_Mutation_p.R86H|C5orf45_ENST00000518219.1_Missense_Mutation_p.R141H|C5orf45_ENST00000376931.2_Missense_Mutation_p.R86H|C5orf45_ENST00000523084.1_Missense_Mutation_p.R7H|C5orf45_ENST00000521333.1_Intron|C5orf45_ENST00000523267.1_Intron	NM_016175.3	NP_057259.2	Q6NTE8	CE045_HUMAN	chromosome 5 open reading frame 45	141										breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12						TTGACTGAAGCGGGGGCCTGG	0.567													ENSG00000161010	c|||	2	0.000399361	0.0015	0.0	5008	,	,		18572	0.0		0.0	False		,,,				2504	0.0																0								T	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	167.0	178.0	174.0		257,422	0.5	0.0	5		174	0,8600		0,0,4300	no	missense,missense	C5orf45	NM_001017987.2,NM_016175.3	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	86/289,141/344	179268934	1,13005	2203	4300	6503	SO:0001583	missense	0			-		CCDS34318.1, CCDS34319.1	5q35.3	2008-07-10			ENSG00000161010	ENSG00000161010			30817	protein-coding gene	gene with protein product	"""truncated calcium binding protein"""						Standard	NM_016175		Approved	MGC65027, MGC78537, DKFZp686L2452, LOC51149	uc003mla.3	Q6NTE8	OTTHUMG00000163490	ENST00000292586.6:c.422G>A	5.37:g.179268934C>T	ENSP00000292586:p.Arg141His		B5MD09|E9PAK6|Q7Z3D8|Q9BUC1|Q9UN54	Missense_Mutation	SNP	NULL	p.R141H	ENST00000292586.6	37	c.422	CCDS34319.1	5	.	.	.	.	.	.	.	.	.	.	c	5.961	0.361326	0.11296	2.27E-4	0.0	ENSG00000161010	ENST00000403396;ENST00000518235;ENST00000520698;ENST00000376931;ENST00000518219;ENST00000523084;ENST00000292586	T;T;T;T;T;T;T	0.34072	1.95;1.95;1.95;2.13;1.95;1.38;1.95	4.61	0.509	0.16977	.	0.642318	0.13077	N	0.415634	T	0.17534	0.0421	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.001;0.001	B;B;B;B;B	0.04013	0.0;0.001;0.0;0.001;0.0	T	0.18871	-1.0323	10	0.39692	T	0.17	-1.1032	8.0651	0.30657	0.0:0.2736:0.3231:0.4033	.	86;141;86;141;183	E7EMV9;B7Z1T6;E9PAK6;Q6NTE8;Q6NTE8-2	.;.;.;CE045_HUMAN;.	H	183;141;86;86;141;7;141	ENSP00000384599:R183H;ENSP00000430298:R141H;ENSP00000427849:R86H;ENSP00000366130:R86H;ENSP00000428460:R141H;ENSP00000429107:R7H;ENSP00000292586:R141H	ENSP00000292586:R141H	R	-	2	0	C5orf45	179201540	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.044000	0.13992	-0.228000	0.09869	-3.833000	0.00019	CGC	-	C5orf45	-	NULL		0.567	C5orf45-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C5orf45	HGNC	protein_coding	OTTHUMT00000373760.2	0	0	1	46	46	70	0.00	1.41	C	NM_016175		179268934	-1	21	31	13	24	tier1	no_errors	ENST00000292586	ensembl	human	known	74_37	missense	61.76	56.36	SNP	0.000	T	21	13
ZEB1	6935	genome.wustl.edu	37	10	31812861	31812861	+	Splice_Site	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr10:31812861G>A	ENST00000320985.10	+	8	2712	c.2602G>A	c.(2602-2604)Gat>Aat	p.D868N	ZEB1_ENST00000560721.2_Splice_Site_p.D848N|ZEB1_ENST00000361642.5_Splice_Site_p.D869N|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000446923.2_Splice_Site_p.D852N|ZEB1_ENST00000542815.3_Splice_Site_p.D801N			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	868					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				CTCCCTCTAGGATGAAAGACA	0.333													ENSG00000148516																									Ovarian(40;423 959 14296 36701 49589)												0													60.0	60.0	60.0					10																	31812861		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2602-1G>A	10.37:g.31812861G>A			B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.D869N	ENST00000320985.10	37	c.2605	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470067	0.63625	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T	0.12039	3.03;2.72;2.76;2.72;2.78	5.57	5.57	0.84162	.	0.803616	0.11117	N	0.597829	T	0.15046	0.0363	L	0.29908	0.895	0.80722	D	1	B;P;B;P;P	0.36282	0.046;0.546;0.027;0.546;0.546	B;B;B;B;B	0.37239	0.015;0.244;0.011;0.164;0.136	T	0.30534	-0.9975	9	.	.	.	-10.7713	19.5459	0.95297	0.0:0.0:1.0:0.0	.	801;852;848;869;868	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	N	650;868;869;863;801;868;848;759;852	ENSP00000444282:D650N;ENSP00000354487:D869N;ENSP00000444891:D801N;ENSP00000319248:D868N;ENSP00000391612:D852N	.	D	+	1	0	ZEB1	31852867	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.230000	0.95299	2.635000	0.89317	0.585000	0.79938	GAT	-	ZEB1	-	NULL		0.333	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2	0	0	0	22	22	102	0.00	0.00	G	NM_030751	Missense_Mutation	31812861	+1	5	15	25	34	tier1	no_errors	ENST00000361642	ensembl	human	known	74_37	missense	16.67	30.61	SNP	1.000	A	5	25
GPX5	2880	genome.wustl.edu	37	6	28500188	28500188	+	Silent	SNP	T	T	C			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:28500188T>C	ENST00000412168.2	+	4	539	c.450T>C	c.(448-450)agT>agC	p.S150S	GPX5_ENST00000442674.2_3'UTR|GPX5_ENST00000469384.1_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	150					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	AAGTCTTCAGTTTCTTGAAGG	0.443													ENSG00000224586																																					0													128.0	122.0	124.0					6																	28500188		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.450T>C	6.37:g.28500188T>C			A1A4Y0	Silent	SNP	pfam_Glutathione_peroxidase,superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase,prints_Glutathione_peroxidase	p.S150	ENST00000412168.2	37	c.450	CCDS4652.1	6																																																																																			-	GPX5	-	pfam_Glutathione_peroxidase,superfamily_Thioredoxin-like_fold,pirsf_Glutathione_peroxidase		0.443	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPX5	HGNC	protein_coding	OTTHUMT00000043672.2	0	0	0	76	76	153	0.00	0.00	T			28500188	+1	12	22	33	53	tier1	no_errors	ENST00000412168	ensembl	human	known	74_37	silent	26.67	29.33	SNP	0.971	C	12	33
FAM120A	23196	genome.wustl.edu	37	9	96291677	96291677	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr9:96291677G>A	ENST00000277165.6	+	9	1743	c.1549G>A	c.(1549-1551)Gaa>Aaa	p.E517K	FAM120A_ENST00000375389.3_Missense_Mutation_p.E517K|FAM120A_ENST00000340893.4_Missense_Mutation_p.E517K|FAM120A_ENST00000333936.5_Missense_Mutation_p.E545K	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	517				EGKG -> DSRR (in Ref. 1; AAF72867). {ECO:0000305}.		cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CCAACTAGCCGAAGGCAAGGG	0.562													ENSG00000048828																																					0													66.0	59.0	61.0					9																	96291677		2203	4300	6503	SO:0001583	missense	0			-	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.1549G>A	9.37:g.96291677G>A	ENSP00000277165:p.Glu517Lys		A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NULL	p.E545K	ENST00000277165.6	37	c.1633	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353619	0.82243	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.41	5.41	0.78517	.	0.252635	0.34700	N	0.003756	T	0.35219	0.0924	N	0.22421	0.69	0.49798	D	0.999826	P;B;P;B;P	0.52577	0.641;0.308;0.82;0.165;0.954	B;B;B;B;B	0.42062	0.079;0.084;0.054;0.023;0.374	T	0.13098	-1.0522	10	0.09338	T	0.73	-15.8002	19.1972	0.93695	0.0:0.0:1.0:0.0	.	517;545;517;517;517	Q9NZB2-4;Q9NZB2-6;Q9NZB2-5;Q9NZB2;Q9NZB2-2	.;.;.;F120A_HUMAN;.	K	517;517;545;517	ENSP00000364538:E517K;ENSP00000277165:E517K;ENSP00000334918:E545K;ENSP00000344698:E517K	ENSP00000277165:E517K	E	+	1	0	FAM120A	95331498	1.000000	0.71417	0.976000	0.42696	0.997000	0.91878	7.517000	0.81783	2.532000	0.85374	0.655000	0.94253	GAA	-	FAM120A	-	NULL		0.562	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	0	0	0	45	45	69	0.00	0.00	G	NM_014612		96291677	+1	7	8	66	51	tier1	no_errors	ENST00000333936	ensembl	human	known	74_37	missense	9.46	13.56	SNP	1.000	A	7	66
IGSF9	57549	genome.wustl.edu	37	1	159899796	159899796	+	Intron	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:159899796G>A	ENST00000368094.1	-	16	2262				IGSF9_ENST00000493195.1_Intron|IGSF9_ENST00000361509.3_Intron	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9						dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGGAGGGAGGTCAGGGCCCA	0.647													ENSG00000085552																																					0													19.0	18.0	18.0					1																	159899796		2202	4297	6499	SO:0001627	intron_variant	0			-	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.2065-31C>T	1.37:g.159899796G>A				R	SNP	-	NULL	ENST00000368094.1	37	NULL	CCDS44254.1	1																																																																																			-	IGSF9	-	-		0.647	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	HGNC	protein_coding	OTTHUMT00000059115.1	0	0	0	68	68	67	0.00	0.00	G	NM_020789		159899796	-1	40	25	38	32	tier1	no_errors	ENST00000496645	ensembl	human	known	74_37	rna	51.28	43.86	SNP	0.000	A	40	38
TDRD6	221400	genome.wustl.edu	37	6	46657281	46657281	+	Missense_Mutation	SNP	G	G	C	rs200948216		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:46657281G>C	ENST00000316081.6	+	1	1416	c.1416G>C	c.(1414-1416)gaG>gaC	p.E472D	TDRD6_ENST00000544460.1_Missense_Mutation_p.E472D|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	472					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TAGATGAAGAGATTTCACTCC	0.458													ENSG00000180113																																					0													98.0	89.0	92.0					6																	46657281		2203	4300	6503	SO:0001583	missense	0			-	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1416G>C	6.37:g.46657281G>C	ENSP00000346065:p.Glu472Asp		B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.E472D	ENST00000316081.6	37	c.1416	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	G	0.889	-0.726282	0.03158	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.16324	2.35;2.36	5.88	-2.08	0.07254	.	0.767350	0.12638	N	0.451550	T	0.02047	0.0064	N	0.22421	0.69	0.09310	N	1	B;B	0.15930	0.015;0.009	B;B	0.18871	0.023;0.01	T	0.46062	-0.9218	10	0.12430	T	0.62	-0.6945	2.5396	0.04722	0.1404:0.2977:0.3498:0.2122	.	472;472	F5H5M3;O60522	.;TDRD6_HUMAN	D	472	ENSP00000443299:E472D;ENSP00000346065:E472D	ENSP00000346065:E472D	E	+	3	2	TDRD6	46765240	0.002000	0.14202	0.010000	0.14722	0.280000	0.26924	0.022000	0.13511	-0.094000	0.12374	0.655000	0.94253	GAG	-	TDRD6	-	NULL		0.458	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	HGNC	protein_coding	OTTHUMT00000040800.1	0	0	0	39	39	142	0.00	0.00	G	XM_166443		46657281	+1	8	15	22	43	tier1	no_errors	ENST00000316081	ensembl	human	known	74_37	missense	26.67	25.86	SNP	0.003	C	8	22
MRGPRX4	117196	genome.wustl.edu	37	11	18195098	18195098	+	Missense_Mutation	SNP	G	G	A	rs376982271		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr11:18195098G>A	ENST00000314254.3	+	1	715	c.295G>A	c.(295-297)Gtt>Att	p.V99I	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CAAAATCCTCGTTTCTGTGAT	0.532													ENSG00000179817	G|||	1	0.000199681	0.0008	0.0	5008	,	,		23921	0.0		0.0	False		,,,				2504	0.0																0								G	ILE/VAL	1,4397	2.1+/-5.4	0,1,2198	127.0	103.0	111.0		295	-5.7	0.0	11		111	0,8586		0,0,4293	no	missense	MRGPRX4	NM_054032.3	29	0,1,6491	AA,AG,GG		0.0,0.0227,0.0077	benign	99/323	18195098	1,12983	2199	4293	6492	SO:0001583	missense	0			-	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.295G>A	11.37:g.18195098G>A	ENSP00000314042:p.Val99Ile		Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V99I	ENST00000314254.3	37	c.295	CCDS7831.1	11	.	.	.	.	.	.	.	.	.	.	G	1.273	-0.612531	0.03690	2.27E-4	0.0	ENSG00000179817	ENST00000314254	T	0.09911	2.93	2.82	-5.65	0.02459	GPCR, rhodopsin-like superfamily (1);	2.205680	0.01516	N	0.018124	T	0.04543	0.0124	N	0.10809	0.05	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29912	-0.9996	10	0.21540	T	0.41	.	1.0297	0.01535	0.179:0.3617:0.2077:0.2516	.	99	Q96LA9	MRGX4_HUMAN	I	99	ENSP00000314042:V99I	ENSP00000314042:V99I	V	+	1	0	MRGPRX4	18151674	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-11.026000	0.00004	-1.777000	0.01283	-2.811000	0.00111	GTT	-	MRGPRX4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.532	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX4	HGNC	protein_coding	OTTHUMT00000389788.1	0	0	0	43	43	103	0.00	0.00	G	NM_054032		18195098	+1	9	32	20	38	tier1	no_errors	ENST00000314254	ensembl	human	known	74_37	missense	31.03	45.71	SNP	0.000	A	9	20
CCNH	902	genome.wustl.edu	37	5	86707051	86707051	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr5:86707051C>T	ENST00000256897.4	-	2	454	c.230G>A	c.(229-231)aGa>aAa	p.R77K	CCNH_ENST00000508855.1_Missense_Mutation_p.R3K|CCNH_ENST00000513499.1_5'UTR|CCNH_ENST00000504878.1_Missense_Mutation_p.R3K	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	77					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)	p.R77K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		CACAACAGATCTTGGCATTGC	0.383								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)					ENSG00000134480																																					1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											159.0	149.0	152.0					5																	86707051		2203	4300	6503	SO:0001583	missense	0			-	U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.230G>A	5.37:g.86707051C>T	ENSP00000256897:p.Arg77Lys		Q53X72|Q8TBL9	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_CyclinC,tigrfam_CyclinH/Ccl1	p.R77K	ENST00000256897.4	37	c.230	CCDS4064.1	5	.	.	.	.	.	.	.	.	.	.	C	8.400	0.841665	0.16963	.	.	ENSG00000134480	ENST00000508855;ENST00000256897;ENST00000504878	T;T;T	0.10860	2.83;2.83;2.83	6.07	4.29	0.51040	Cyclin, N-terminal (1);Cyclin-like (3);	0.134405	0.64402	N	0.000002	T	0.03434	0.0099	N	0.01631	-0.79	0.32090	N	0.591985	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.24368	-1.0162	10	0.14656	T	0.56	-13.2357	8.6305	0.33917	0.0:0.7265:0.0:0.2735	.	77;24	P51946;E9PDB6	CCNH_HUMAN;.	K	3;77;3	ENSP00000426454:R3K;ENSP00000256897:R77K;ENSP00000426075:R3K	ENSP00000256897:R77K	R	-	2	0	CCNH	86742807	0.901000	0.30685	0.998000	0.56505	0.996000	0.88848	2.337000	0.43947	1.581000	0.49865	0.655000	0.94253	AGA	-	CCNH	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_CyclinC,tigrfam_CyclinH/Ccl1		0.383	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNH	HGNC	protein_coding	OTTHUMT00000239291.3	0	0	0	74	74	231	0.00	0.00	C	NM_001239		86707051	-1	28	54	41	72	tier1	no_errors	ENST00000256897	ensembl	human	known	74_37	missense	40.58	42.86	SNP	0.999	T	28	41
PRPF4B	8899	genome.wustl.edu	37	6	4037782	4037782	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:4037782A>G	ENST00000337659.6	+	3	1490	c.1390A>G	c.(1390-1392)Aga>Gga	p.R464G	PRPF4B_ENST00000538861.1_Missense_Mutation_p.R450G	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	464	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TCCAAGAAGAAGAAGCAGATC	0.458													ENSG00000112739																																					0													97.0	80.0	86.0					6																	4037782		2203	4300	6503	SO:0001583	missense	0			-	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1390A>G	6.37:g.4037782A>G	ENSP00000337194:p.Arg464Gly		A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R464G	ENST00000337659.6	37	c.1390	CCDS4488.1	6	.	.	.	.	.	.	.	.	.	.	A	15.44	2.834768	0.50951	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.70749	-0.51;-0.51	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	L	0.58810	1.83	0.51767	D	0.999938	D	0.54601	0.967	P	0.60789	0.879	T	0.67337	-0.5696	10	0.19590	T	0.45	.	12.0582	0.53548	0.8564:0.1436:0.0:0.0	.	464	Q13523	PRP4B_HUMAN	G	464;450	ENSP00000337194:R464G;ENSP00000439331:R450G	ENSP00000337194:R464G	R	+	1	2	PRPF4B	3982781	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.766000	0.47629	1.898000	0.54952	0.459000	0.35465	AGA	-	PRPF4B	-	NULL		0.458	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	HGNC	protein_coding	OTTHUMT00000314018.2	0	0	0	34	34	82	0.00	0.00	A			4037782	+1	10	41	0	5	tier1	no_errors	ENST00000337659	ensembl	human	known	74_37	missense	100.00	89.13	SNP	1.000	G	10	0
PKHD1	5314	genome.wustl.edu	37	6	51892681	51892681	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr6:51892681T>A	ENST00000371117.3	-	31	3849	c.3574A>T	c.(3574-3576)Atc>Ttc	p.I1192F	PKHD1_ENST00000340994.4_Missense_Mutation_p.I1192F	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1192	IPT/TIG 6; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGGTACTGGATGTGGAGATCA	0.433													ENSG00000170927																																					0													73.0	72.0	72.0					6																	51892681		2203	4300	6503	SO:0001583	missense	0			-	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3574A>T	6.37:g.51892681T>A	ENSP00000360158:p.Ile1192Phe		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.I1192F	ENST00000371117.3	37	c.3574	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	T	23.1	4.375138	0.82682	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88509	-2.23;-2.39	5.71	5.71	0.89125	Cell surface receptor IPT/TIG (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92606	0.7651	M	0.72894	2.215	0.41973	D	0.990761	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.96	D	0.93029	0.6447	10	0.52906	T	0.07	.	15.1592	0.72767	0.0:0.0:0.0:1.0	.	1192;1192	P08F94-2;P08F94	.;PKHD1_HUMAN	F	1192	ENSP00000360158:I1192F;ENSP00000341097:I1192F	ENSP00000341097:I1192F	I	-	1	0	PKHD1	52000640	1.000000	0.71417	0.386000	0.26170	0.959000	0.62525	5.258000	0.65479	2.171000	0.68590	0.533000	0.62120	ATC	-	PKHD1	-	superfamily_Ig_E-set,smart_IPT		0.433	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	0	0	0	47	47	143	0.00	0.00	T	NM_138694		51892681	-1	6	49	6	6	tier1	no_errors	ENST00000371117	ensembl	human	known	74_37	missense	50.00	89.09	SNP	0.984	A	6	6
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	rs28934578	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	27	27	55	0.00	0.00	C	NM_000546		7578406	-1	25	40	4	8	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	86.21	83.33	SNP	1.000	T	25	4
BPIFB6	128859	genome.wustl.edu	37	20	31622058	31622058	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr20:31622058C>T	ENST00000349552.1	+	3	264	c.264C>T	c.(262-264)ttC>ttT	p.F88F		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	88						extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGGGCATCTTCCAATGTGTGT	0.562													ENSG00000167104																																					0													171.0	132.0	145.0					20																	31622058		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.264C>T	20.37:g.31622058C>T				Silent	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C	p.F88	ENST00000349552.1	37	c.264	CCDS13211.1	20																																																																																			-	BPIFB6	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom		0.562	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB6	HGNC	protein_coding	OTTHUMT00000078658.2	0	0	0	44	44	124	0.00	0.00	C	NM_174897		31622058	+1	9	15	50	137	tier1	no_errors	ENST00000349552	ensembl	human	known	74_37	silent	15.25	9.87	SNP	1.000	T	9	50
NRDE2	55051	genome.wustl.edu	37	14	90756883	90756883	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr14:90756883C>T	ENST00000354366.3	-	10	2143	c.1911G>A	c.(1909-1911)gtG>gtA	p.V637V	NRDE2_ENST00000357904.3_Silent_p.V406V	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	637																	GGAAGGCCTCCACCAGCTGGA	0.468													ENSG00000119720																																					0													82.0	84.0	83.0					14																	90756883		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1911G>A	14.37:g.90756883C>T			B4DH71|Q4G0A7|Q9NWH6	Silent	SNP	pfam_NRDE-2	p.V637	ENST00000354366.3	37	c.1911	CCDS9890.1	14																																																																																			-	NRDE2	-	NULL		0.468	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRDE2	HGNC	protein_coding	OTTHUMT00000411264.1	0	0	0	29	29	107	0.00	0.00	C	NM_017970		90756883	-1	6	8	22	98	tier1	no_errors	ENST00000354366	ensembl	human	known	74_37	silent	21.43	7.55	SNP	0.000	T	6	22
CHRFAM7A	89832	genome.wustl.edu	37	15	30665316	30665316	+	Missense_Mutation	SNP	G	G	A	rs527713019		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr15:30665316G>A	ENST00000299847.2	-	6	646	c.193C>T	c.(193-195)Cgc>Tgc	p.R65C	CHRFAM7A_ENST00000401522.3_De_novo_Start_OutOfFrame|CHRFAM7A_ENST00000567722.1_5'Flank|CHRFAM7A_ENST00000397827.3_De_novo_Start_OutOfFrame	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	65						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		GGAAACCAGCGTACATCGATG	0.493													ENSG00000166664	.|||	1	0.000199681	0.0	0.0	5008	,	,		21469	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0			-	AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.193C>T	15.37:g.30665316G>A	ENSP00000299847:p.Arg65Cys		A8KAB9	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	p.R65C	ENST00000299847.2	37	c.193	CCDS32184.1	15	.	.	.	.	.	.	.	.	.	.	.	13.66	2.303252	0.40795	.	.	ENSG00000166664	ENST00000299847	T	0.80393	-1.37	1.94	1.94	0.25998	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.89473	0.6725	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.90009	0.4120	10	0.72032	D	0.01	.	9.9401	0.41576	0.0:0.0:1.0:0.0	.	65	Q494W8	CRFM7_HUMAN	C	65	ENSP00000299847:R65C	ENSP00000299847:R65C	R	-	1	0	CHRFAM7A	28452608	1.000000	0.71417	0.985000	0.45067	0.180000	0.23129	5.561000	0.67339	1.400000	0.46741	0.184000	0.17185	CGC	-	CHRFAM7A	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.493	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRFAM7A	HGNC	protein_coding	OTTHUMT00000430700.1	0	0	0	65	65	96	0.00	0.00	G	NM_148911		30665316	-1	9	6	57	60	tier1	no_errors	ENST00000299847	ensembl	human	known	74_37	missense	13.64	9.09	SNP	1.000	A	9	57
SOX5	6660	genome.wustl.edu	37	12	23998927	23998927	+	Silent	SNP	G	G	A	rs149450279		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr12:23998927G>A	ENST00000451604.2	-	3	572	c.471C>T	c.(469-471)aaC>aaT	p.N157N	SOX5_ENST00000309359.1_Silent_p.N144N|SOX5_ENST00000545921.1_Silent_p.N147N|SOX5_ENST00000541536.1_Silent_p.N144N|SOX5_ENST00000441133.2_Silent_p.N122N|SOX5_ENST00000537393.1_Silent_p.N122N|SOX5_ENST00000541847.1_Silent_p.N147N|SOX5_ENST00000381381.2_Silent_p.N144N|SOX5_ENST00000546136.1_Silent_p.N144N			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	157					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.N157N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CTTCCGGCTCGTTTTTGATGA	0.403													ENSG00000134532	G|||	1	0.000199681	0.0008	0.0	5008	,	,		17504	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	large_intestine(1)						G	,	0,4406		0,0,2203	105.0	96.0	99.0		471,432	-3.0	1.0	12	dbSNP_134	99	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous,coding-synonymous	SOX5	NM_006940.4,NM_152989.2	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	157/764,144/751	23998927	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.471C>T	12.37:g.23998927G>A			B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.N157	ENST00000451604.2	37	c.471	CCDS8699.1	12																																																																																			rs149450279	SOX5	-	NULL		0.403	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	HGNC	protein_coding	OTTHUMT00000402006.2	0	0	1	28	28	99	0.00	1.00	G	NM_006940		23998927	-1	4	4	28	60	tier1	no_errors	ENST00000451604	ensembl	human	known	74_37	silent	12.50	6.25	SNP	0.994	A	4	28
SYCP1	6847	genome.wustl.edu	37	1	115537600	115537601	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:115537600_115537601insA	ENST00000369522.3	+	32	3131_3132	c.2891_2892insA	c.(2890-2895)agaaaafs	p.RK964fs	SYCP1_ENST00000369518.1_Frame_Shift_Ins_p.RK964fs|SYCP1_ENST00000477590.1_3'UTR	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	964	Arg/Lys-rich (basic).				chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATGGATAGAAAAAAAAAAC	0.356													ENSG00000198765																																					0																																										SO:0001589	frameshift_variant	0				D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2901dupA	1.37:g.115537610_115537610dupA	ENSP00000358535:p.Arg964fs		O14963|Q5VXJ6	Frame_Shift_Ins	INS	pfam_SCP-1	p.K968fs	ENST00000369522.3	37	c.2891_2892	CCDS879.1	1																																																																																				SYCP1	-	NULL		0.356	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1	0	0	0	44	44	95	0.00	0.00	-	NM_003176		115537601	+1	3	8	31	43	tier1	no_errors	ENST00000369518	ensembl	human	known	74_37	frame_shift_ins	8.82	15.69	INS	1.000:1.000	A	3	31
ATXN8OS	6315	genome.wustl.edu	37	13	70713512	70713512	+	RNA	SNP	A	A	G	rs2021426|rs143757288		TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr13:70713512A>G	ENST00000414504.2	+	0	1099					NR_002717.2				ATXN8 opposite strand (non-protein coding)																		tactactactactactgctgc	0.408													ENSG00000230223																																					0																																												0			-	AF126749		13q21	2012-10-19	2008-08-13	2006-07-18	ENSG00000230223	ENSG00000230223		"""Long non-coding RNAs"", ""-"""	10561	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 3"""	603680	"""spinocerebellar ataxia 8"", ""kelch-like 1 antisense (Drosophila)"""	SCA8, KLHL1AS		10192387, 16804541	Standard	NR_002717		Approved	NCRNA00003	uc010aej.1		OTTHUMG00000017057		13.37:g.70713512A>G				R	SNP	-	NULL	ENST00000414504.2	37	NULL		13																																																																																			rs2021426	ATXN8OS	-	-		0.408	ATXN8OS-002	KNOWN	basic	antisense	ATXN8OS	HGNC	antisense	OTTHUMT00000045233.2	0	0	0	36	36	0	0.00	0.00	A	NR_002717		70713512	+1	6	0	41	2	tier1	no_errors	ENST00000414504	ensembl	human	known	74_37	rna	12.77	0.00	SNP	0.000	G	6	41
MT-CO1	4512	genome.wustl.edu	37	M	7198	7198	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chrM:7198G>A	ENST00000361624.2	+	1	1295	c.1295G>A	c.(1294-1296)gGc>gAc	p.G432D	MT-TS1_ENST00000387416.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TY_ENST00000387409.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	432					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACACTTTCTCGGCCTATCCGG	0.458													ENSG00000198804																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1295G>A	M.37:g.7198G>A	ENSP00000354499:p.Gly432Asp		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.G432D	ENST00000361624.2	37	c.1295		MT																																																																																			-	MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1		0.458	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		0	0	0	47	47	1	0.00	0.00	G	YP_003024028		7198	+1	2	0	13	1	tier1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	13.33	0.00	SNP	NULL	A	2	13
IGFN1	91156	genome.wustl.edu	37	1	201166387	201166387	+	Silent	SNP	C	C	T			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr1:201166387C>T	ENST00000335211.4	+	5	439	c.309C>T	c.(307-309)tgC>tgT	p.C103C	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Silent_p.C103C	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	103	Ig-like 1.					nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGTACCGCTGCACAGCAGTAA	0.552													ENSG00000163395																																					0													152.0	139.0	143.0					1																	201166387		692	1591	2283	SO:0001819	synonymous_variant	0			-	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.309C>T	1.37:g.201166387C>T			F8WAI1|Q9NT72	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C103	ENST00000335211.4	37	c.309	CCDS53455.1	1																																																																																			-	IGFN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.552	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		0	0	0	44	44	58	0.00	0.00	C	NM_178275		201166387	+1	4	3	42	43	tier1	no_errors	ENST00000335211	ensembl	human	known	74_37	silent	8.70	6.52	SNP	0.676	T	4	42
PAK1	5058	genome.wustl.edu	37	11	77048422	77048422	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BB-01A-12D-A32I-09	TCGA-DX-A6BB-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b14de9fa-e0f4-4b94-90c3-e3f0392b5f17	2aa256b7-1d6e-4de9-89f3-c13f1318af23	g.chr11:77048422C>A	ENST00000356341.3	-	12	1694	c.1163G>T	c.(1162-1164)aGa>aTa	p.R388I	PAK1_ENST00000525542.1_5'UTR|PAK1_ENST00000530617.1_Missense_Mutation_p.R388I|PAK1_ENST00000278568.4_Missense_Mutation_p.R388I|PAK1_ENST00000528203.1_Missense_Mutation_p.R290I	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	388	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					CTTGATGTCTCTGTGAATGAC	0.458													ENSG00000149269																																					0													99.0	80.0	86.0					11																	77048422		2200	4292	6492	SO:0001583	missense	0			-	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.1163G>T	11.37:g.77048422C>A	ENSP00000348696:p.Arg388Ile		O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,superfamily_WASP_C,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.R388I	ENST00000356341.3	37	c.1163	CCDS8250.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.273678|5.273678	0.95459|0.95459	.|.	.|.	ENSG00000149269|ENSG00000149269	ENST00000533285|ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203	.|T;T;T;T	.|0.30182	.|1.54;1.54;1.54;1.54	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.047154	.|0.85682	.|D	.|0.000000	T|T	0.72977|0.72977	0.3528|0.3528	H|H	0.97783|0.97783	4.075|4.075	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.995;1.0;1.0;1.0	D|D	0.83829|0.83829	0.0251|0.0251	5|10	.|0.87932	.|D	.|0	.|.	19.5071|19.5071	0.95124|0.95124	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|290;388;388;388	.|E9PM17;B3KNX7;Q13153;Q13153-2	.|.;.;PAK1_HUMAN;.	H|I	109|388;388;388;290	.|ENSP00000348696:R388I;ENSP00000433423:R388I;ENSP00000278568:R388I;ENSP00000433211:R290I	.|ENSP00000278568:R388I	Q|R	-|-	3|2	2|0	PAK1|PAK1	76726070|76726070	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.480000|7.480000	0.81109|0.81109	2.617000|2.617000	0.88574|0.88574	0.557000|0.557000	0.71058|0.71058	CAG|AGA	-	PAK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.458	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAK1	HGNC	protein_coding	OTTHUMT00000382083.2	0	0	0	40	40	113	0.00	0.00	C	NM_002576		77048422	-1	4	2	36	74	tier1	no_errors	ENST00000278568	ensembl	human	known	74_37	missense	10.00	2.63	SNP	1.000	A	4	36
