#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PIN1	5300	genome.wustl.edu	37	19	9960266	9960266	+	3'UTR	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:9960266C>T	ENST00000247970.4	+	0	905				PIN1_ENST00000588695.1_3'UTR|PIN1_ENST00000380889.6_3'UTR|AC008752.3_ENST00000582439.1_RNA	NM_006221.3	NP_006212.1	Q13526	PIN1_HUMAN	peptidylprolyl cis/trans isomerase, NIMA-interacting 1						cell cycle (GO:0007049)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|negative regulation of cell motility (GO:2000146)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase activating protein binding (GO:0032794)|mitogen-activated protein kinase kinase binding (GO:0031434)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)			skin(3)	3						CTCCTCTGTTCAGTCGCAAAG	0.592													ENSG00000127445																																					0													56.0	56.0	56.0					19																	9960266		876	1991	2867	SO:0001624	3_prime_UTR_variant	0			-		CCDS12220.1	19p13	2014-09-17	2008-03-25		ENSG00000127445	ENSG00000127445			8988	protein-coding gene	gene with protein product		601052	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1"""			8606777	Standard	NM_006221		Approved	dod	uc002mml.2	Q13526		ENST00000247970.4:c.*391C>T	19.37:g.9960266C>T			A8K4V9|Q53X75	R	SNP	-	NULL	ENST00000247970.4	37	NULL	CCDS12220.1	19																																																																																			-	PIN1	-	-		0.592	PIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1	HGNC	protein_coding	OTTHUMT00000451107.1	0	0	0	52	52	69	0.00	0.00	C			9960266	+1	70	50	397	379	tier1	no_errors	ENST00000380889	ensembl	human	known	74_37	rna	14.99	11.66	SNP	0.806	T	70	397
YOD1	55432	genome.wustl.edu	37	1	207222921	207222921	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:207222921C>T	ENST00000315927.4	-	2	537	c.491G>A	c.(490-492)aGt>aAt	p.S164N	PFKFB2_ENST00000411990.2_5'UTR|YOD1_ENST00000367084.1_Missense_Mutation_p.S120N|YOD1_ENST00000391927.1_Missense_Mutation_p.S120N	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	164	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					ATAGTACACACTAGTAAAGAG	0.483													ENSG00000180667																																					0													71.0	65.0	67.0					1																	207222921		2203	4300	6503	SO:0001583	missense	0			-		CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.491G>A	1.37:g.207222921C>T	ENSP00000326813:p.Ser164Asn		B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.S164N	ENST00000315927.4	37	c.491	CCDS31002.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967186	0.92855	.	.	ENSG00000180667	ENST00000367084;ENST00000315927;ENST00000391927	T;T;T	0.56103	0.48;0.48;0.48	5.97	5.97	0.96955	Ovarian tumour, otubain (2);	0.037718	0.85682	D	0.000000	T	0.77432	0.4129	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.994;0.998	T	0.79584	-0.1743	10	0.87932	D	0	-8.3519	19.4269	0.94746	0.0:1.0:0.0:0.0	.	120;164	Q5VVQ6-2;Q5VVQ6	.;OTU1_HUMAN	N	120;164;120	ENSP00000356051:S120N;ENSP00000326813:S164N;ENSP00000375793:S120N	ENSP00000326813:S164N	S	-	2	0	YOD1	205289544	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.724000	0.84798	2.836000	0.97738	0.655000	0.94253	AGT	-	YOD1	-	pfam_OTU,pfscan_OTU		0.483	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	YOD1	HGNC	protein_coding	OTTHUMT00000087837.1	0	0	0	59	59	115	0.00	0.00	C	NM_018566		207222921	-1	8	23	49	86	tier1	no_errors	ENST00000315927	ensembl	human	known	74_37	missense	14.04	21.10	SNP	1.000	T	8	49
C9orf41	138199	genome.wustl.edu	37	9	77611400	77611400	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:77611400C>G	ENST00000376834.3	-	6	1139	c.987G>C	c.(985-987)tgG>tgC	p.W329C	RP11-197P3.4_ENST00000455609.1_RNA|C9orf41_ENST00000376837.3_3'UTR	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	329										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TGAGTATTTTCCATATTGTAT	0.294													ENSG00000156017																																					0													90.0	93.0	92.0					9																	77611400		2203	4290	6493	SO:0001583	missense	0			-	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.987G>C	9.37:g.77611400C>G	ENSP00000366030:p.Trp329Cys		Q7Z383|Q8N7C5	Missense_Mutation	SNP	pfam_N2227	p.W329C	ENST00000376834.3	37	c.987	CCDS6649.1	9	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703999	0.68501	.	.	ENSG00000156017	ENST00000376834	T	0.03801	3.8	5.67	4.77	0.60923	N2227-like (1);	0.000000	0.85682	D	0.000000	T	0.15478	0.0373	M	0.63843	1.955	0.80722	D	1	P	0.52061	0.95	P	0.58130	0.833	T	0.00819	-1.1553	10	0.41790	T	0.15	-5.6822	15.7033	0.77558	0.138:0.862:0.0:0.0	.	329	Q8N4J0	CI041_HUMAN	C	329	ENSP00000366030:W329C	ENSP00000366030:W329C	W	-	3	0	C9orf41	76801220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.431000	0.80335	1.394000	0.46624	0.650000	0.86243	TGG	-	C9orf41	-	pfam_N2227		0.294	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	HGNC	protein_coding	OTTHUMT00000052703.1	0	0	0	49	49	98	0.00	0.00	C	NM_152420		77611400	-1	108	114	484	591	tier1	no_errors	ENST00000376834	ensembl	human	known	74_37	missense	18.21	16.17	SNP	1.000	G	108	484
KRT81	3887	genome.wustl.edu	37	12	52681806	52681806	+	Missense_Mutation	SNP	G	G	A	rs144716678	byFrequency	TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:52681806G>A	ENST00000327741.5	-	5	930	c.862C>T	c.(862-864)Cgc>Tgc	p.R288C	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	288	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCCCGGCTGCGGGTGACAATG	0.572													ENSG00000205426	.|||	3	0.000599042	0.0	0.0	5008	,	,		20689	0.0		0.0	False		,,,				2504	0.0031																0								G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	118.0	98.0	105.0		862	3.5	1.0	12	dbSNP_134	105	4,8596	3.7+/-12.6	0,4,4296	no	missense	KRT81	NM_002281.3	180	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	probably-damaging	288/506	52681806	5,13001	2203	4300	6503	SO:0001583	missense	0			-	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.862C>T	12.37:g.52681806G>A	ENSP00000369349:p.Arg288Cys		Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.R288C	ENST00000327741.5	37	c.862	CCDS31805.1	12	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539428	0.45176	2.27E-4	4.65E-4	ENSG00000205426	ENST00000327741;ENST00000389388	T	0.75821	-0.97	4.48	3.55	0.40652	Filament (1);	0.000000	0.42053	U	0.000779	T	0.74801	0.3764	M	0.83774	2.66	0.44807	D	0.99781	P	0.36633	0.562	B	0.36186	0.219	T	0.80108	-0.1520	10	0.72032	D	0.01	.	11.8153	0.52207	0.0:0.0:0.6857:0.3143	.	288	Q14533	KRT81_HUMAN	C	288	ENSP00000369349:R288C	ENSP00000369349:R288C	R	-	1	0	KRT81	50968073	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	1.881000	0.39638	2.052000	0.61016	0.556000	0.70494	CGC	rs144716678	KRT81	-	pfam_IF,superfamily_Prefoldin		0.572	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT81	HGNC	protein_coding	OTTHUMT00000395128.2	0	0	0	54	54	31	0.00	0.00	G	NM_002281		52681806	-1	9	5	55	30	tier1	no_errors	ENST00000327741	ensembl	human	known	74_37	missense	14.06	14.29	SNP	1.000	A	9	55
FCRL3	115352	genome.wustl.edu	37	1	157666077	157666077	+	Silent	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:157666077G>A	ENST00000368184.3	-	7	1176	c.885C>T	c.(883-885)acC>acT	p.T295T	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Silent_p.T295T|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	295	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T295T(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					GCTGCCCTCCGGTGGGCCGGA	0.517													ENSG00000160856																																					1	Substitution - coding silent(1)	large_intestine(1)											95.0	91.0	93.0					1																	157666077		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.885C>T	1.37:g.157666077G>A			A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T295	ENST00000368184.3	37	c.885	CCDS1167.1	1																																																																																			-	FCRL3	-	smart_Ig_sub,pfscan_Ig-like_dom		0.517	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	0	0	0	43	43	96	0.00	0.00	G	NM_052939		157666077	-1	13	16	31	84	tier1	no_errors	ENST00000492769	ensembl	human	known	74_37	silent	29.55	15.69	SNP	0.000	A	13	31
RAP1B	5908	genome.wustl.edu	37	12	69053162	69053162	+	3'UTR	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:69053162C>T	ENST00000250559.9	+	0	919				RAP1B_ENST00000543393.1_3'UTR|RAP1B_ENST00000463493.1_3'UTR|RAP1B_ENST00000539091.1_3'UTR|RAP1B_ENST00000450214.2_3'UTR|RAP1B_ENST00000540209.1_3'UTR|RAP1B_ENST00000537460.1_3'UTR|RAP1B_ENST00000543697.1_3'UTR|RAP1B_ENST00000542145.1_3'UTR|RAP1B_ENST00000393436.5_3'UTR	NM_001010942.2|NM_001251921.1|NM_001251922.1|NM_015646.5	NP_001010942.1|NP_001238850.1|NP_001238851.1|NP_056461.1	P61224	RAP1B_HUMAN	RAP1B, member of RAS oncogene family						blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of establishment of cell polarity (GO:2000114)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)|urinary_tract(2)	12	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)		CTTTAAGAGGCGGATGAAAGC	0.388													ENSG00000127314																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS8984.1, CCDS58252.1, CCDS58253.1, CCDS58254.1	12q14	2014-05-09			ENSG00000127314	ENSG00000127314			9857	protein-coding gene	gene with protein product		179530				3137530, 12089143	Standard	NM_015646		Approved	K-REV, RAL1B, DKFZp586H0723	uc001suc.3	P61224	OTTHUMG00000133660	ENST00000250559.9:c.*133C>T	12.37:g.69053162C>T			B2R5Z2|B4DQI8|B4DW74|B4DW94|P09526|Q502X3|Q5TZR4|Q6DCA1|Q6LES0	R	SNP	-	NULL	ENST00000250559.9	37	NULL	CCDS8984.1	12																																																																																			-	RAP1B	-	-		0.388	RAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP1B	HGNC	protein_coding	OTTHUMT00000257821.3	0	0	0	38	38	118	0.00	0.00	C	NM_001010942		69053162	+1	165	365	336	805	tier1	no_errors	ENST00000463493	ensembl	human	known	74_37	rna	32.93	31.17	SNP	0.995	T	165	336
OLFM2	93145	genome.wustl.edu	37	19	9968504	9968504	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:9968504C>G	ENST00000264833.4	-	3	432	c.247G>C	c.(247-249)Gag>Cag	p.E83Q	OLFM2_ENST00000590841.1_Missense_Mutation_p.E5Q	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	83					protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GTCCGCAACTCAAGGACCTCC	0.612													ENSG00000105088																																					0													80.0	70.0	73.0					19																	9968504		2203	4300	6503	SO:0001583	missense	0			-	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.247G>C	19.37:g.9968504C>G	ENSP00000264833:p.Glu83Gln		Q6IMJ3|Q96FC2	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like	p.E83Q	ENST00000264833.4	37	c.247	CCDS12221.1	19	.	.	.	.	.	.	.	.	.	.	c	14.09	2.431016	0.43122	.	.	ENSG00000105088	ENST00000264833	T	0.46063	0.88	3.91	3.91	0.45181	.	0.060593	0.64402	D	0.000005	T	0.29223	0.0727	N	0.22421	0.69	0.35252	D	0.77878	P	0.38788	0.647	B	0.38156	0.266	T	0.39099	-0.9630	9	.	.	.	.	13.4645	0.61245	0.0:1.0:0.0:0.0	.	83	O95897	NOE2_HUMAN	Q	83	ENSP00000264833:E83Q	.	E	-	1	0	OLFM2	9829504	0.997000	0.39634	1.000000	0.80357	0.476000	0.33039	1.823000	0.39062	2.021000	0.59480	0.306000	0.20318	GAG	-	OLFM2	-	pfam_Noelin-1		0.612	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM2	HGNC	protein_coding	OTTHUMT00000451119.1	0	0	0	48	48	99	0.00	0.00	C			9968504	-1	79	104	421	668	tier1	no_errors	ENST00000264833	ensembl	human	known	74_37	missense	15.74	13.42	SNP	1.000	G	79	421
RIMS1	22999	genome.wustl.edu	37	6	73043350	73043350	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr6:73043350G>T	ENST00000521978.1	+	29	4178	c.4178G>T	c.(4177-4179)aGa>aTa	p.R1393I	RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000538414.1_Missense_Mutation_p.R199I|RIMS1_ENST00000264839.7_Missense_Mutation_p.R1242I|RIMS1_ENST00000517960.1_Missense_Mutation_p.R1176I|RIMS1_ENST00000491071.2_Missense_Mutation_p.R1216I|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000348717.5_Missense_Mutation_p.R1176I|RIMS1_ENST00000401910.3_Missense_Mutation_p.R713I|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000425662.2_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1393	Ser-rich.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ACTTCAGGAAGATCCATCATG	0.453													ENSG00000079841																																					0													66.0	66.0	66.0					6																	73043350		1971	4164	6135	SO:0001583	missense	0			-	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4178G>T	6.37:g.73043350G>T	ENSP00000428417:p.Arg1393Ile		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R1393I	ENST00000521978.1	37	c.4178	CCDS47449.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.83|15.83|15.83	2.949877|2.949877|2.949877	0.53186|0.53186|0.53186	.|.|.	.|.|.	ENSG00000079841|ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000264839;ENST00000517960;ENST00000521978;ENST00000401910;ENST00000453976;ENST00000370420;ENST00000538414	.|.|T;T;T;T;T;T;T;T;T	.|.|0.20463	.|.|2.36;2.47;2.47;2.47;2.42;2.5;2.31;2.12;2.07	5.4|5.4|5.4	5.4|5.4|5.4	0.78164|0.78164|0.78164	.|.|.	.|.|0.079158	.|.|0.53938	.|.|D	.|.|0.000060	T|T|T	0.24353|0.24353|0.24353	0.0590|0.0590|0.0590	L|L|L	0.31752|0.31752|0.31752	0.955|0.955|0.955	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|B;D;B;B;B;B;B	.|.|0.69078	.|.|0.001;0.997;0.001;0.001;0.002;0.004;0.002	.|.|B;D;B;B;B;B;B	.|.|0.73708	.|.|0.001;0.981;0.003;0.002;0.001;0.004;0.003	T|T|T	0.01238|0.01238|0.01238	-1.1409|-1.1409|-1.1409	5|5|10	.|.|0.51188	.|.|T	.|.|0.08	-27.4946|-27.4946|-27.4946	14.3911|14.3911|14.3911	0.66978|0.66978|0.66978	0.0:0.0:0.8523:0.1477|0.0:0.0:0.8523:0.1477|0.0:0.0:0.8523:0.1477	.|.|.	.|.|199;1242;713;1176;469;1216;1393	.|.|B7Z7W2;E9PHR1;E9PF48;E7ENC2;Q5JY21;C9JNW6;Q86UR5	.|.|.;.;.;.;.;.;RIMS1_HUMAN	Y|N|I	311|738|1216;1242;1216;1176;1242;1176;1393;713;558;441;199	.|.|ENSP00000430101:R1216I;ENSP00000275037:R1176I;ENSP00000264839:R1242I;ENSP00000429959:R1176I;ENSP00000428417:R1393I;ENSP00000385649:R713I;ENSP00000389503:R558I;ENSP00000359448:R441I;ENSP00000439730:R199I	.|.|ENSP00000264839:R1242I	D|K|R	+|+|+	1|3|2	0|2|0	RIMS1|RIMS1|RIMS1	73100071|73100071|73100071	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.981000|0.981000|0.981000	0.71138|0.71138|0.71138	5.042000|5.042000|5.042000	0.64202|0.64202|0.64202	2.683000|2.683000|2.683000	0.91414|0.91414|0.91414	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAT|AAG|AGA	-	RIMS1	-	NULL		0.453	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	0	0	0	32	32	97	0.00	0.00	G			73043350	+1	7	21	24	93	tier1	no_errors	ENST00000521978	ensembl	human	known	74_37	missense	22.58	18.42	SNP	1.000	T	7	24
MIR130B	406920	genome.wustl.edu	37	22	22007679	22007679	+	RNA	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr22:22007679C>T	ENST00000385018.1	+	0	82				MIR301B_ENST00000390813.1_RNA	NR_029845.1				microRNA 130b																		CAGGTCCAGCCTGCTaccctg	0.577													ENSG00000100023																																					0													17.0	19.0	19.0					22																	22007679		1538	3506	5044			0			-			22	2011-09-12		2008-12-18	ENSG00000207751	ENSG00000207751		"""ncRNAs / Micro RNAs"""	31515	non-coding RNA	RNA, micro		613682		MIRN130B			Standard	NR_029845		Approved	hsa-mir-130b	uc011aii.1				22.37:g.22007679C>T				R	SNP	-	NULL	ENST00000385018.1	37	NULL		22																																																																																			-	PPIL2	-	-		0.577	MIR130B-201	KNOWN	basic	miRNA	PPIL2	HGNC	miRNA		0	0	0	81	81	52	0.00	0.00	C	NR_029845		22007679	+1	31	12	79	58	tier1	no_errors	ENST00000498589	ensembl	human	known	74_37	rna	28.18	17.14	SNP	0.000	T	31	79
CCDC125	202243	genome.wustl.edu	37	5	68616304	68616304	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr5:68616304C>T	ENST00000396496.2	-	2	171	c.64G>A	c.(64-66)Gac>Aac	p.D22N	CCDC125_ENST00000383374.2_Missense_Mutation_p.D22N|CCDC125_ENST00000396499.1_Missense_Mutation_p.D22N|CCDC125_ENST00000460090.1_5'UTR|CCDC125_ENST00000511257.1_5'UTR			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	22						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TCTGTCATGTCATCCTCTTCT	0.428													ENSG00000183323																																					0													130.0	125.0	126.0					5																	68616304		2203	4300	6503	SO:0001583	missense	0			-	AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.64G>A	5.37:g.68616304C>T	ENSP00000379754:p.Asp22Asn		Q86Z19	Missense_Mutation	SNP	NULL	p.D22N	ENST00000396496.2	37	c.64	CCDS4000.1	5	.	.	.	.	.	.	.	.	.	.	c	22.6	4.307706	0.81247	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000383374	T;T;T	0.58506	0.44;0.44;0.33	4.67	4.67	0.58626	.	0.174808	0.39544	N	0.001329	T	0.73481	0.3592	M	0.72118	2.19	0.29542	N	0.852029	D;D	0.89917	0.999;1.0	D;D	0.87578	0.964;0.998	T	0.71213	-0.4659	10	0.59425	D	0.04	.	13.453	0.61182	0.0:1.0:0.0:0.0	.	22;22	F8W912;Q86Z20	.;CC125_HUMAN	N	22	ENSP00000379754:D22N;ENSP00000379756:D22N;ENSP00000372865:D22N	ENSP00000372865:D22N	D	-	1	0	CCDC125	68652060	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.261000	0.58841	2.334000	0.79466	0.457000	0.33378	GAC	-	CCDC125	-	NULL		0.428	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC125	HGNC	protein_coding	OTTHUMT00000254027.4	0	0	0	34	34	77	0.00	0.00	C	NM_176816		68616304	-1	5	13	28	55	tier1	no_errors	ENST00000396496	ensembl	human	known	74_37	missense	15.15	19.12	SNP	1.000	T	5	28
PTPRO	5800	genome.wustl.edu	37	12	15704508	15704508	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:15704508G>T	ENST00000281171.4	+	15	2791	c.2461G>T	c.(2461-2463)Gta>Tta	p.V821L	PTPRO_ENST00000348962.2_Missense_Mutation_p.V821L|PTPRO_ENST00000544244.1_Missense_Mutation_p.V10L|PTPRO_ENST00000442921.2_Missense_Mutation_p.V10L|PTPRO_ENST00000445537.2_Missense_Mutation_p.V10L|PTPRO_ENST00000542557.1_Missense_Mutation_p.V10L	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	821					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				TCCCAATGTGGTAGTGATCTC	0.403													ENSG00000151490																																					0													271.0	239.0	250.0					12																	15704508		2203	4300	6503	SO:0001583	missense	0			-	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.2461G>T	12.37:g.15704508G>T	ENSP00000281171:p.Val821Leu		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V821L	ENST00000281171.4	37	c.2461	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564913	0.65651	.	.	ENSG00000151490	ENST00000281171;ENST00000348962;ENST00000442921;ENST00000542557;ENST00000445537;ENST00000544244	T;T;T;T;T;T	0.04406	3.81;3.8;3.63;3.74;3.63;3.74	5.2	5.2	0.72013	.	0.157339	0.29159	N	0.012969	T	0.04227	0.0117	N	0.14661	0.345	0.44834	D	0.997846	B;B;B	0.29037	0.231;0.012;0.007	B;B;B	0.22386	0.039;0.016;0.005	T	0.54853	-0.8231	10	0.34782	T	0.22	.	18.921	0.92525	0.0:0.0:1.0:0.0	.	10;821;821	Q9UBT5;Q16827-2;Q16827	.;.;PTPRO_HUMAN	L	821;821;10;10;10;10	ENSP00000281171:V821L;ENSP00000343434:V821L;ENSP00000404188:V10L;ENSP00000437571:V10L;ENSP00000393449:V10L;ENSP00000439234:V10L	ENSP00000281171:V821L	V	+	1	0	PTPRO	15595775	1.000000	0.71417	0.883000	0.34634	0.993000	0.82548	6.797000	0.75150	2.693000	0.91896	0.563000	0.77884	GTA	-	PTPRO	-	NULL		0.403	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	0	0	0	65	65	149	0.00	0.00	G			15704508	+1	10	28	55	124	tier1	no_errors	ENST00000281171	ensembl	human	known	74_37	missense	15.38	18.30	SNP	0.998	T	10	55
SYT1	6857	genome.wustl.edu	37	12	79611315	79611315	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:79611315C>T	ENST00000261205.4	+	4	673	c.16C>T	c.(16-18)Cac>Tac	p.H6Y	SYT1_ENST00000457153.2_Missense_Mutation_p.H6Y|SYT1_ENST00000393240.3_Missense_Mutation_p.H6Y|SYT1_ENST00000552744.1_Missense_Mutation_p.H6Y	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I	6					calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						GAGCGAGAGTCACCATGAGGC	0.542													ENSG00000067715																																					0													42.0	42.0	42.0					12																	79611315		2203	4300	6503	SO:0001583	missense	0			-		CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.16C>T	12.37:g.79611315C>T	ENSP00000261205:p.His6Tyr		Q6AI31	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.H6Y	ENST00000261205.4	37	c.16	CCDS9017.1	12	.	.	.	.	.	.	.	.	.	.	C	17.53	3.411995	0.62511	.	.	ENSG00000067715	ENST00000393240;ENST00000261205;ENST00000457153;ENST00000552074;ENST00000547046;ENST00000549671;ENST00000551304;ENST00000552744;ENST00000552624;ENST00000446242	T;T;T;T;T;T	0.58797	0.32;0.32;0.31;0.32;1.96;2.54	5.51	5.51	0.81932	.	0.275440	0.40469	N	0.001082	T	0.49626	0.1568	L	0.29908	0.895	0.38538	D	0.949135	B;B	0.16603	0.018;0.018	B;B	0.12156	0.007;0.007	T	0.44236	-0.9341	10	0.39692	T	0.17	.	19.4105	0.94670	0.0:1.0:0.0:0.0	.	6;6	Q6AI31;P21579	.;SYT1_HUMAN	Y	6	ENSP00000376932:H6Y;ENSP00000261205:H6Y;ENSP00000391056:H6Y;ENSP00000447575:H6Y;ENSP00000448861:H6Y;ENSP00000401559:H6Y	ENSP00000261205:H6Y	H	+	1	0	SYT1	78135446	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.054000	0.76649	2.583000	0.87209	0.643000	0.83706	CAC	-	SYT1	-	NULL		0.542	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT1	HGNC	protein_coding	OTTHUMT00000259415.1	0	0	0	22	22	58	0.00	0.00	C	NM_005639		79611315	+1	13	45	35	45	tier1	no_errors	ENST00000261205	ensembl	human	known	74_37	missense	27.08	50.00	SNP	1.000	T	13	35
SLC16A13	201232	genome.wustl.edu	37	17	6943237	6943237	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr17:6943237G>C	ENST00000308027.6	+	4	1545	c.1237G>C	c.(1237-1239)Gat>Cat	p.D413H		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	413						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						AGAAGCACTAGATACTAAAGT	0.537													ENSG00000174327																																					0													124.0	132.0	130.0					17																	6943237		2203	4300	6503	SO:0001583	missense	0			-	BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.1237G>C	17.37:g.6943237G>C	ENSP00000309751:p.Asp413His		A3KMG3|A5PKU5|Q2VP92	Missense_Mutation	SNP	pfam_MFS,pfam_Atg22-like,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D413H	ENST00000308027.6	37	c.1237	CCDS11085.1	17	.	.	.	.	.	.	.	.	.	.	G	7.373	0.627196	0.14257	.	.	ENSG00000174327	ENST00000308027	T	0.09538	2.97	5.97	3.95	0.45737	.	1.213990	0.05842	N	0.619584	T	0.09379	0.0231	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33599	-0.9862	10	0.62326	D	0.03	.	8.4654	0.32953	0.0818:0.1536:0.7646:0.0	.	413	Q7RTY0	MOT13_HUMAN	H	413	ENSP00000309751:D413H	ENSP00000309751:D413H	D	+	1	0	SLC16A13	6883961	0.864000	0.29904	0.005000	0.12908	0.004000	0.04260	3.966000	0.56795	0.829000	0.34733	0.655000	0.94253	GAT	-	SLC16A13	-	NULL		0.537	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A13	HGNC	protein_coding	OTTHUMT00000219923.2	0	0	0	28	28	75	0.00	0.00	G			6943237	+1	30	85	16	104	tier1	no_errors	ENST00000308027	ensembl	human	known	74_37	missense	65.22	44.97	SNP	0.005	C	30	16
FLG2	388698	genome.wustl.edu	37	1	152324804	152324804	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr1:152324804G>A	ENST00000388718.5	-	3	5530	c.5458C>T	c.(5458-5460)Cac>Tac	p.H1820Y	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1820					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCGTGAGTGTGGTCTTTGT	0.527													ENSG00000143520																																					0													315.0	277.0	290.0					1																	152324804		2203	4300	6503	SO:0001583	missense	0			-	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5458C>T	1.37:g.152324804G>A	ENSP00000373370:p.His1820Tyr		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.H1820Y	ENST00000388718.5	37	c.5458	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318271	0.23994	.	.	ENSG00000143520	ENST00000388718	T	0.08546	3.08	0.508	0.508	0.16972	.	.	.	.	.	T	0.01940	0.0061	L	0.33485	1.01	0.09310	N	1	P	0.38110	0.618	B	0.32805	0.153	T	0.44097	-0.9350	8	0.59425	D	0.04	.	.	.	.	.	1820	Q5D862	FILA2_HUMAN	Y	1820	ENSP00000373370:H1820Y	ENSP00000373370:H1820Y	H	-	1	0	FLG2	150591428	.	.	0.009000	0.14445	0.129000	0.20672	.	.	0.564000	0.29238	0.297000	0.19635	CAC	-	FLG2	-	prints_Filaggrin		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	0	0	0	74	74	71	0.00	0.00	G	NM_001014342		152324804	-1	23	8	83	64	tier1	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	21.70	11.11	SNP	0.006	A	23	83
PGA5	5222	genome.wustl.edu	37	11	61017218	61017218	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr11:61017218C>T	ENST00000312403.5	+	7	1036	c.851C>T	c.(850-852)aCc>aTc	p.T284I	PGA5_ENST00000451616.2_Missense_Mutation_p.T130I|PGA4_ENST00000422676.2_Missense_Mutation_p.T284I|PGA5_ENST00000541528.1_Missense_Mutation_p.T24I|CTD-2331C18.5_ENST00000537594.1_RNA	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	284					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						TCTCTGCTGACCGGCCCAACC	0.592													ENSG00000256713																																					0													125.0	129.0	127.0					11																	61017218		2202	4297	6499	SO:0001583	missense	0			-	BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.851C>T	11.37:g.61017218C>T	ENSP00000309542:p.Thr284Ile		A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.T284I	ENST00000312403.5	37	c.851	CCDS8001.1	11	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968571	0.34754	.	.	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616;ENST00000541528	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	2.91	-1.36	0.09085	.	1.093690	0.07037	N	0.829508	T	0.46619	0.1402	N	0.25426	0.745	0.09310	N	1	B	0.21225	0.053	B	0.37731	0.257	T	0.50118	-0.8865	10	0.26408	T	0.33	.	5.543	0.17049	0.0:0.5937:0.1432:0.2631	.	284	B7ZW62	.	I	284;284;241;143;130;24	ENSP00000395402:T284I;ENSP00000309542:T284I;ENSP00000408739:T130I;ENSP00000441981:T24I	ENSP00000395402:T284I	T	+	2	0	PGA4;PGA5	60773794	0.035000	0.19736	0.007000	0.13788	0.883000	0.51084	2.498000	0.45363	-0.258000	0.09446	0.420000	0.28162	ACC	-	PGA5	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase		0.592	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGA5	HGNC	protein_coding	OTTHUMT00000397972.1	0	0	0	68	68	11	0.00	0.00	C	NM_014224		61017218	+1	16	6	56	18	tier1	no_errors	ENST00000312403	ensembl	human	known	74_37	missense	22.22	25.00	SNP	0.087	T	16	56
DCTN2	10540	genome.wustl.edu	37	12	57932336	57932336	+	Intron	SNP	C	C	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:57932336C>T	ENST00000548249.1	-	3	373				DCTN2_ENST00000543672.1_Intron|DCTN2_ENST00000537439.1_Intron|DCTN2_ENST00000434715.3_Intron|DCTN2_ENST00000551400.1_5'UTR	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						GTGAGAAAATCAAAAGAGTTA	0.428													ENSG00000175203																																					0													39.0	38.0	38.0					12																	57932336		1851	4098	5949	SO:0001627	intron_variant	0			-	U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.106-2708G>A	12.37:g.57932336C>T			B2RBK5|Q86YN2|Q9BW17	R	SNP	-	NULL	ENST00000548249.1	37	NULL	CCDS58245.1	12																																																																																			-	DCTN2	-	-		0.428	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN2	HGNC	protein_coding	OTTHUMT00000407393.2	0	0	0	49	49	92	0.00	0.00	C	NM_006400		57932336	-1	57	145	165	424	tier1	no_errors	ENST00000551400	ensembl	human	known	74_37	rna	25.68	25.35	SNP	1.000	T	57	165
TRHDE	29953	genome.wustl.edu	37	12	73014948	73014948	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr12:73014948T>C	ENST00000261180.4	+	14	2491	c.2395T>C	c.(2395-2397)Ttt>Ctt	p.F799L		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	799					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GAAAAATAATTTTAATGGATC	0.318													ENSG00000072657																																					0													110.0	102.0	105.0					12																	73014948		2203	4299	6502	SO:0001583	missense	0			-	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2395T>C	12.37:g.73014948T>C	ENSP00000261180:p.Phe799Leu		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.F799L	ENST00000261180.4	37	c.2395	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	T	8.544	0.873999	0.17395	.	.	ENSG00000072657	ENST00000261180	T	0.05855	3.38	5.64	4.5	0.54988	.	0.394831	0.28425	N	0.015390	T	0.02418	0.0074	N	0.02539	-0.55	0.26427	N	0.976001	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	10	0.27785	T	0.31	.	5.7766	0.18283	0.0:0.143:0.1422:0.7148	.	799	Q9UKU6	TRHDE_HUMAN	L	799	ENSP00000261180:F799L	ENSP00000261180:F799L	F	+	1	0	TRHDE	71301215	0.999000	0.42202	0.999000	0.59377	0.251000	0.25915	1.009000	0.29886	1.077000	0.40990	-0.263000	0.10527	TTT	-	TRHDE	-	NULL		0.318	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	0	0	1	47	47	112	0.00	0.88	T	NM_013381		73014948	+1	61	130	335	497	tier1	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	15.40	20.70	SNP	0.981	C	61	335
COL11A2	1302	genome.wustl.edu	37	6	33144998	33144998	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr6:33144998A>C	ENST00000374708.4	-	22	1976	c.1718T>G	c.(1717-1719)cTt>cGt	p.L573R	COL11A2_ENST00000374712.1_Missense_Mutation_p.L578R|COL11A2_ENST00000361917.1_Missense_Mutation_p.L552R|COL11A2_ENST00000395197.1_Missense_Mutation_p.L599R|COL11A2_ENST00000374714.1_Missense_Mutation_p.L633R|COL11A2_ENST00000357486.1_Missense_Mutation_p.L638R|COL11A2_ENST00000374713.1_Missense_Mutation_p.L612R|COL11A2_ENST00000341947.2_Missense_Mutation_p.L659R|COL11A2_ENST00000477772.1_5'UTR	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	659	Collagen-like 3.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GGGCCCGGGAAGACCCTACAT	0.562													ENSG00000204248																									Melanoma(1;90 116 3946 5341 17093)												0													45.0	53.0	50.0					6																	33144998		1508	2706	4214	SO:0001583	missense	0			-	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1718T>G	6.37:g.33144998A>C	ENSP00000363840:p.Leu573Arg		A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.L659R	ENST00000374708.4	37	c.1976	CCDS43452.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.42|13.42	2.231338|2.231338	0.39399|0.39399	.|.	.|.	ENSG00000204248|ENSG00000204248	ENST00000395196|ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	.|D;D;D;D;D;D;D;D	.|0.94000	.|-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	4.16|4.16	2.97|2.97	0.34412|0.34412	.|.	.|0.067818	.|0.64402	.|D	.|0.000018	D|D	0.92348|0.92348	0.7572|0.7572	L|L	0.49571|0.49571	1.57|1.57	0.44711|0.44711	D|D	0.997705|0.997705	B|D;D;D	0.13594|0.89917	0.008|0.997;0.975;1.0	B|D;P;D	0.12156|0.76071	0.007|0.947;0.877;0.987	D|D	0.90948|0.90948	0.4803|0.4803	8|10	0.23302|0.46703	T|T	0.38|0.11	.|.	8.0806|8.0806	0.30741|0.30741	0.8189:0.0:0.0:0.1811|0.8189:0.0:0.0:0.1811	.|.	65|552;573;659	A2ABA7|P13942-8;P13942-6;P13942	.|.;.;COBA2_HUMAN	V|R	39|573;659;638;633;612;599;578;552	.|ENSP00000363840:L573R;ENSP00000339915:L659R;ENSP00000350079:L638R;ENSP00000363846:L633R;ENSP00000363845:L612R;ENSP00000378623:L599R;ENSP00000363844:L578R;ENSP00000355123:L552R	ENSP00000378622:F39V|ENSP00000339915:L659R	F|L	-|-	1|2	0|0	COL11A2|COL11A2	33252976|33252976	0.740000|0.740000	0.28207|0.28207	0.804000|0.804000	0.32291|0.32291	0.246000|0.246000	0.25737|0.25737	4.162000|4.162000	0.58177|0.58177	0.634000|0.634000	0.30469|0.30469	-0.350000|-0.350000	0.07774|0.07774	TTC|CTT	-	COL11A2	-	NULL		0.562	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	0	0	0	58	58	99	0.00	0.00	A			33144998	-1	11	26	50	98	tier1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	18.03	20.97	SNP	1.000	C	11	50
NKAIN3	286183	genome.wustl.edu	37	8	63659614	63659614	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr8:63659614G>A	ENST00000523211.1	+	4	529	c.397G>A	c.(397-399)Gtc>Atc	p.V133I	NKAIN3_ENST00000328472.5_Missense_Mutation_p.V133I|NKAIN3_ENST00000519049.1_3'UTR	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				TTACACGTACGTCTCTGTCAC	0.498													ENSG00000185942																																					0													128.0	130.0	129.0					8																	63659614		2085	4223	6308	SO:0001583	missense	0			-	AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.397G>A	8.37:g.63659614G>A	ENSP00000429073:p.Val133Ile			Missense_Mutation	SNP	pfam_Na/K-Atpase_Interacting	p.V133I	ENST00000523211.1	37	c.397	CCDS55239.1	8	.	.	.	.	.	.	.	.	.	.	G	4.022	0.001510	0.07819	.	.	ENSG00000185942	ENST00000545532;ENST00000523211;ENST00000328472	T;T	0.13196	2.61;2.61	5.49	4.62	0.57501	.	0.168540	0.41194	N	0.000937	T	0.05686	0.0149	N	0.04805	-0.155	0.30287	N	0.790765	B	0.22800	0.075	B	0.20767	0.031	T	0.28364	-1.0046	10	0.07644	T	0.81	-21.9403	9.4637	0.38800	0.1595:0.0:0.8405:0.0	.	133	Q8N8D7	NKAI3_HUMAN	I	133	ENSP00000429073:V133I;ENSP00000333627:V133I	ENSP00000333627:V133I	V	+	1	0	NKAIN3	63822168	1.000000	0.71417	0.058000	0.19502	0.549000	0.35272	4.750000	0.62162	1.324000	0.45282	0.650000	0.86243	GTC	-	NKAIN3	-	pfam_Na/K-Atpase_Interacting		0.498	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN3	HGNC	protein_coding	OTTHUMT00000378447.2	0	0	0	43	43	69	0.00	0.00	G	NM_173688		63659614	+1	10	16	40	62	tier1	no_errors	ENST00000328472	ensembl	human	known	74_37	missense	20.00	20.51	SNP	0.974	A	10	40
SCN4A	6329	genome.wustl.edu	37	17	62049824	62049824	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr17:62049824T>C	ENST00000435607.1	-	2	356	c.280A>G	c.(280-282)Atc>Gtc	p.I94V	SCN4A_ENST00000578147.1_Missense_Mutation_p.I94V|CTC-264K15.6_ENST00000577329.1_lincRNA	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	94					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGAGTACGATGAAGGTCTAA	0.597													ENSG00000007314																																					0													71.0	78.0	75.0					17																	62049824		2180	4272	6452	SO:0001583	missense	0			-	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.280A>G	17.37:g.62049824T>C	ENSP00000396320:p.Ile94Val		Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.I94V	ENST00000435607.1	37	c.280	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	T	14.91	2.676696	0.47886	.	.	ENSG00000007314	ENST00000435607	D	0.96073	-3.9	4.23	4.23	0.50019	.	0.104015	0.64402	D	0.000005	D	0.92756	0.7697	L	0.45581	1.43	0.42896	D	0.994217	P	0.37612	0.602	B	0.38954	0.286	D	0.91735	0.5399	10	0.33940	T	0.23	.	12.6526	0.56770	0.0:0.0:0.0:1.0	.	94	P35499	SCN4A_HUMAN	V	94	ENSP00000396320:I94V	ENSP00000396320:I94V	I	-	1	0	SCN4A	59403556	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.740000	0.47418	1.777000	0.52277	0.260000	0.18958	ATC	-	SCN4A	-	NULL		0.597	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		0	0	0	51	51	107	0.00	0.00	T	NM_000334		62049824	-1	10	19	56	75	tier1	no_errors	ENST00000435607	ensembl	human	known	74_37	missense	15.15	20.21	SNP	1.000	C	10	56
EMC8	10328	genome.wustl.edu	37	16	85813472	85813472	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr16:85813472C>A	ENST00000253457.3	-	5	719	c.475G>T	c.(475-477)Gac>Tac	p.D159Y	RNU1-103P_ENST00000516502.1_RNA|EMC8_ENST00000435200.2_Splice_Site_p.*127L	NM_006067.4	NP_006058.1	O43402	EMC8_HUMAN	ER membrane protein complex subunit 8	159						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TCACAGTAGTCACTACGGGTC	0.527													ENSG00000131148																																					0													58.0	53.0	55.0					16																	85813472		2198	4300	6498	SO:0001630	splice_region_variant	0			-	AF005888	CCDS10954.1, CCDS45541.1	16q24	2012-05-30	2012-05-30	2012-05-30	ENSG00000131148	ENSG00000131148			7864	protein-coding gene	gene with protein product	"""family with sequence similarity 158, member B"""	604886	"""chromosome 16 open reading frame 4"", ""neighbor of COX4"", ""chromosome 16 open reading frame 2"", ""COX4 neighbor"""	C16orf4, NOC4, C16orf2, COX4NB		10337626, 22119785	Standard	NM_006067		Approved	FAM158B	uc002fjd.3	O43402	OTTHUMG00000137647	ENST00000253457.3:c.474-1G>T	16.37:g.85813472C>A			C9JB21	Missense_Mutation	SNP	pfam_UPF0172	p.D159Y	ENST00000253457.3	37	c.475	CCDS10954.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.12|15.12	2.737858|2.737858	0.49045|0.49045	.|.	.|.	ENSG00000131148|ENSG00000131148	ENST00000253457|ENST00000435200	T|.	0.44482|.	0.92|.	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.55146|.	0.1902|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D|.	0.76494|.	0.999|.	D|.	0.77004|.	0.989|.	T|.	0.49960|.	-0.8883|.	9|.	0.59425|.	D|.	0.04|.	-32.5456|-32.5456	18.8005|18.8005	0.92015|0.92015	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	159|.	O43402|.	CX4NB_HUMAN|.	Y|L	159|127	ENSP00000253457:D159Y|.	ENSP00000253457:D159Y|.	D|X	-|-	1|2	0|2	COX4NB|COX4NB	84370973|84370973	1.000000|1.000000	0.71417|0.71417	0.945000|0.945000	0.38365|0.38365	0.645000|0.645000	0.38454|0.38454	7.380000|7.380000	0.79704|0.79704	2.435000|2.435000	0.82474|0.82474	0.561000|0.561000	0.74099|0.74099	GAC|TGA	-	EMC8	-	pfam_UPF0172		0.527	EMC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC8	HGNC	protein_coding	OTTHUMT00000269099.1	0	0	0	22	22	76	0.00	0.00	C	NM_006067	Missense_Mutation	85813472	-1	4	16	22	67	tier1	no_errors	ENST00000253457	ensembl	human	known	74_37	missense	15.38	19.28	SNP	1.000	A	4	22
C9orf41	138199	genome.wustl.edu	37	9	77611441	77611441	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr9:77611441C>G	ENST00000376834.3	-	6	1098	c.946G>C	c.(946-948)Gac>Cac	p.D316H	RP11-197P3.4_ENST00000455609.1_RNA|C9orf41_ENST00000376837.3_3'UTR	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	316										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TGAGCTGTGTCTATGAAGAAA	0.284													ENSG00000156017																																					0													91.0	96.0	94.0					9																	77611441		2203	4292	6495	SO:0001583	missense	0			-	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.946G>C	9.37:g.77611441C>G	ENSP00000366030:p.Asp316His		Q7Z383|Q8N7C5	Missense_Mutation	SNP	pfam_N2227	p.D316H	ENST00000376834.3	37	c.946	CCDS6649.1	9	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776274	0.90195	.	.	ENSG00000156017	ENST00000376834	T	0.03181	4.02	5.67	5.67	0.87782	N2227-like (1);	0.097766	0.64402	D	0.000002	T	0.27205	0.0667	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08106	-1.0738	10	0.87932	D	0	-15.9196	19.3831	0.94545	0.0:1.0:0.0:0.0	.	316	Q8N4J0	CI041_HUMAN	H	316	ENSP00000366030:D316H	ENSP00000366030:D316H	D	-	1	0	C9orf41	76801261	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.431000	0.80335	2.689000	0.91719	0.650000	0.86243	GAC	-	C9orf41	-	pfam_N2227		0.284	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	HGNC	protein_coding	OTTHUMT00000052703.1	0	0	0	54	54	100	0.00	0.00	C	NM_152420		77611441	-1	87	78	454	560	tier1	no_errors	ENST00000376834	ensembl	human	known	74_37	missense	16.08	12.21	SNP	1.000	G	87	454
MARCH2	51257	genome.wustl.edu	37	19	8495621	8495621	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:8495621T>A	ENST00000602117.1	+	4	907	c.452T>A	c.(451-453)cTg>cAg	p.L151Q	MARCH2_ENST00000215555.2_Missense_Mutation_p.L151Q|MARCH2_ENST00000393944.1_Missense_Mutation_p.L151Q|MARCH2_ENST00000601283.1_Intron|RP11-886P16.6_ENST00000595706.1_RNA|MARCH2_ENST00000381035.4_Intron			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	151					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						ATCACACCGCTGGCCGCCATC	0.672													ENSG00000099785																																					0													107.0	89.0	95.0					19																	8495621		2203	4300	6503	SO:0001583	missense	0			-	AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.452T>A	19.37:g.8495621T>A	ENSP00000471536:p.Leu151Gln		A6NP10|Q5H785|Q8N5A3|Q96B78	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.L151Q	ENST00000602117.1	37	c.452	CCDS12202.1	19	.	.	.	.	.	.	.	.	.	.	T	24.2	4.507307	0.85282	.	.	ENSG00000099785	ENST00000393944;ENST00000215555	T;T	0.23552	1.9;1.9	4.26	4.26	0.50523	.	0.087235	0.47455	D	0.000223	T	0.52092	0.1713	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.60742	-0.7203	10	0.87932	D	0	-12.4912	12.6155	0.56573	0.0:0.0:0.0:1.0	.	151	Q9P0N8	MARH2_HUMAN	Q	151	ENSP00000377518:L151Q;ENSP00000215555:L151Q	ENSP00000215555:L151Q	L	+	2	0	MARCH2	8401621	1.000000	0.71417	0.969000	0.41365	0.978000	0.69477	7.817000	0.86213	1.915000	0.55452	0.368000	0.22195	CTG	-	MARCH2	-	NULL		0.672	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH2	HGNC	protein_coding	OTTHUMT00000460361.2	0	0	0	44	44	37	0.00	0.00	T	NM_016496		8495621	+1	15	11	37	36	tier1	no_errors	ENST00000215555	ensembl	human	known	74_37	missense	28.85	23.40	SNP	1.000	A	15	37
VSIG10L	147645	genome.wustl.edu	37	19	51844520	51844520	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:51844520C>G	ENST00000335624.4	-	2	781	c.782G>C	c.(781-783)cGg>cCg	p.R261P	CTD-2616J11.16_ENST00000594311.1_RNA|CTD-2616J11.16_ENST00000601148.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	261						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						CAGAACCCCCCGGGCCTGGTC	0.677													ENSG00000186806																																					0													11.0	17.0	15.0					19																	51844520		691	1589	2280	SO:0001583	missense	0			-		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.782G>C	19.37:g.51844520C>G	ENSP00000335623:p.Arg261Pro			Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R261P	ENST00000335624.4	37	c.782	CCDS54300.1	19	.	.	.	.	.	.	.	.	.	.	C	12.15	1.851824	0.32699	.	.	ENSG00000186806	ENST00000335624	T	0.27402	1.67	3.73	-4.82	0.03171	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10981	0.0268	N	0.08118	0	0.09310	N	1	P	0.38280	0.625	B	0.33196	0.159	T	0.25047	-1.0143	9	0.30854	T	0.27	.	5.8846	0.18874	0.0:0.2702:0.5:0.2298	.	261	Q86VR7	VS10L_HUMAN	P	261	ENSP00000335623:R261P	ENSP00000335623:R261P	R	-	2	0	VSIG10L	56536332	0.000000	0.05858	0.003000	0.11579	0.984000	0.73092	-0.806000	0.04525	-0.421000	0.07416	0.313000	0.20887	CGG	-	VSIG10L	-	smart_Ig_sub		0.677	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	HGNC	protein_coding	OTTHUMT00000464535.1	0	0	0	26	26	25	0.00	0.00	C	NM_001163922		51844520	-1	10	5	37	19	tier1	no_errors	ENST00000335624	ensembl	human	novel	74_37	missense	21.28	20.83	SNP	0.000	G	10	37
BBS9	27241	genome.wustl.edu	37	7	33303966	33303966	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr7:33303966G>A	ENST00000242067.6	+	7	1203	c.682G>A	c.(682-684)Ggt>Agt	p.G228S	BBS9_ENST00000354265.4_Missense_Mutation_p.G228S|BBS9_ENST00000396127.2_Missense_Mutation_p.G228S|BBS9_ENST00000355070.2_Missense_Mutation_p.G228S|BBS9_ENST00000350941.3_Missense_Mutation_p.G228S|BBS9_ENST00000425508.2_Missense_Mutation_p.G183S	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	228					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			GCAAAAACTTGGTTCTGGAAA	0.294									Bardet-Biedl syndrome				ENSG00000122507																																					0													41.0	46.0	44.0					7																	33303966		2201	4299	6500	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	-		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.682G>A	7.37:g.33303966G>A	ENSP00000242067:p.Gly228Ser		E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.G228S	ENST00000242067.6	37	c.682	CCDS43566.1	7	.	.	.	.	.	.	.	.	.	.	G	13.92	2.381850	0.42207	.	.	ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000425508;ENST00000442858;ENST00000537775	T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	5.24	5.24	0.73138	.	0.161449	0.53938	D	0.000041	T	0.63593	0.2524	N	0.17082	0.46	0.43555	D	0.995861	B;B;B;B;B	0.15930	0.003;0.002;0.007;0.002;0.015	B;B;B;B;B	0.20577	0.008;0.009;0.013;0.009;0.03	T	0.58103	-0.7695	10	0.02654	T	1	-7.8611	12.6537	0.56776	0.0865:0.0:0.9135:0.0	.	228;228;228;228;228	B3KQ86;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.;.;.;.;PTHB1_HUMAN	S	228;228;228;228;228;228;228;183;106;106	ENSP00000242067:G228S;ENSP00000313122:G228S;ENSP00000379433:G228S;ENSP00000347182:G228S;ENSP00000346214:G228S;ENSP00000405151:G183S;ENSP00000388646:G106S	ENSP00000242067:G228S	G	+	1	0	BBS9	33270491	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.933000	0.56545	2.448000	0.82819	0.655000	0.94253	GGT	-	BBS9	-	NULL		0.294	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1	0	0	1	144	144	150	0.00	0.66	G			33303966	+1	43	13	164	152	tier1	no_errors	ENST00000242067	ensembl	human	known	74_37	missense	20.77	7.88	SNP	1.000	A	43	164
DMWD	1762	genome.wustl.edu	37	19	46289542	46289544	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:46289542_46289544delCTC	ENST00000270223.6	-	3	1255_1257	c.1210_1212delGAG	c.(1210-1212)gagdel	p.E404del	DMWD_ENST00000601370.1_5'Flank|AC011530.4_ENST00000593999.1_5'Flank|DMWD_ENST00000377735.3_In_Frame_Del_p.E404del	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	404										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		CAGCCTCGGGCTCCTCCTCCTCC	0.695													ENSG00000185800																																					0																																										SO:0001651	inframe_deletion	0				L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.1210_1212delGAG	19.37:g.46289551_46289553delCTC	ENSP00000270223:p.Glu404del			In_Frame_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E404in_frame_del	ENST00000270223.6	37	c.1212_1210	CCDS33054.1	19																																																																																				DMWD	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat		0.695	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DMWD	HGNC	protein_coding	OTTHUMT00000402063.1	0	0	0	17	17	8	0.00	0.00	CTC	NM_004943		46289544	-1	2	0	22	8	tier1	no_errors	ENST00000270223	ensembl	human	known	74_37	in_frame_del	8.33	0.00	DEL	1.000:1.000:1.000	-	2	22
TSC22D4	81628	genome.wustl.edu	37	7	100075194	100075194	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr7:100075194delG	ENST00000300181.2	-	2	1222	c.468delC	c.(466-468)cccfs	p.P156fs	TSC22D4_ENST00000496728.1_5'Flank|TSC22D4_ENST00000393991.1_Intron	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	156					negative regulation of transcription, DNA-templated (GO:0045892)|response to osmotic stress (GO:0006970)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGGAGAGGTGGGGGGTGGAC	0.692													ENSG00000166925																																					0													8.0	10.0	10.0					7																	100075194		2114	4173	6287	SO:0001589	frameshift_variant	0				BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925			21696	protein-coding gene	gene with protein product		611914					Standard	NM_030935		Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000300181.2:c.468delC	7.37:g.100075194delG	ENSP00000300181:p.Pro156fs		A4D2C3|A8MWR6|D6W5V9	Frame_Shift_Del	DEL	pfam_TSC-22_Dip_Bun	p.T157fs	ENST00000300181.2	37	c.468	CCDS5695.1	7																																																																																				TSC22D4	-	NULL		0.692	TSC22D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC22D4	HGNC	protein_coding	OTTHUMT00000316970.1	0	0	0	8	8	14	0.00	0.00	G	NM_030935		100075194	-1	2	0	13	4	tier1	no_errors	ENST00000300181	ensembl	human	known	74_37	frame_shift_del	13.33	0.00	DEL	0.536	-	2	13
GNA11	2767	genome.wustl.edu	37	19	3121300	3121300	+	3'UTR	DEL	T	T	-			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:3121300delT	ENST00000078429.4	+	0	1445				AC005262.2_ENST00000585980.1_RNA|AC005262.3_ENST00000587701.1_RNA|GNA11_ENST00000586180.1_3'UTR	NM_002067.2	NP_002058.2	P29992	GNA11_HUMAN	guanine nucleotide binding protein (G protein), alpha 11 (Gq class)						action potential (GO:0001508)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cellular response to pH (GO:0071467)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|regulation of melanocyte differentiation (GO:0045634)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			endometrium(2)|eye(132)|kidney(1)|large_intestine(2)|lung(1)|meninges(5)|ovary(1)|prostate(1)|skin(16)	161		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.79e-05)|OV - Ovarian serous cystadenocarcinoma(105;2.68e-113)|Epithelial(107;1.22e-111)|all cancers(105;5.78e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00141)|STAD - Stomach adenocarcinoma(1328;0.181)		CGGGAGGAGATTTTTTTTTTT	0.557			Mis		uveal melanoma								ENSG00000088256																												Dom	yes		19	19p13.3	2767	"""guanine nucleotide binding protein (G protein), alpha 11 (Gq class)"""		E	0																																										SO:0001624	3_prime_UTR_variant	0				AF493900	CCDS12103.1	19p13.3	2014-02-04			ENSG00000088256	ENSG00000088256			4379	protein-coding gene	gene with protein product		139313	"""hypocalciuric hypercalcemia 2"""	HHC2		1302014, 23802516	Standard	NM_002067		Approved	FBH, FBH2, FHH2	uc002lxd.3	P29992	OTTHUMG00000180631	ENST00000078429.4:c.*123T>-	19.37:g.3121300delT			O15109|Q14350|Q6IB00	R	DEL	-	NULL	ENST00000078429.4	37	NULL	CCDS12103.1	19																																																																																				G11	-	-		0.557	GNA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G11	HGNC	protein_coding	OTTHUMT00000452261.2	0	0	0	14	14	0	0.00	0.00	T	NM_002067		3121300	+1	4	0	22	1	tier1	no_errors	ENST00000586180	ensembl	human	known	74_37	rna	15.38	0.00	DEL	0.000	-	4	22
HOXB6	3216	genome.wustl.edu	37	17	46675273	46675273	+	Silent	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr17:46675273G>A	ENST00000484302.2	-	2	862	c.240C>T	c.(238-240)ttC>ttT	p.F80F	HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB6_ENST00000225648.3_Silent_p.F80F|HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000474324.1_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000477144.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB6_ENST00000490419.1_5'Flank|HOXB-AS3_ENST00000460041.1_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000487849.3_RNA			P17509	HXB6_HUMAN	homeobox B6	80					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|erythrocyte homeostasis (GO:0034101)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(4)	7						TCTCGCGGTAGAAGGCCGGCG	0.726													ENSG00000108511																																					0													5.0	6.0	6.0					17																	46675273		2132	4143	6275	SO:0001819	synonymous_variant	0			-		CCDS11531.1	17q21.32	2011-06-20	2005-12-22		ENSG00000108511	ENSG00000108511		"""Homeoboxes / ANTP class : HOXL subclass"""	5117	protein-coding gene	gene with protein product		142961	"""homeo box B6"""	HOX2, HOX2B		1973146, 1358459	Standard	XM_005257284		Approved		uc002ins.1	P17509	OTTHUMG00000159912	ENST00000484302.2:c.240C>T	17.37:g.46675273G>A			A8K835|D3DTV5|P09068|Q9HB11|Q9UGH2	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.F80	ENST00000484302.2	37	c.240	CCDS11531.1	17																																																																																			-	HOXB6	-	NULL		0.726	HOXB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB6	HGNC	protein_coding	OTTHUMT00000358146.2	0	0	0	37	37	2	0.00	0.00	G			46675273	-1	5	0	19	0	tier1	no_errors	ENST00000225648	ensembl	human	known	74_37	silent	20.83	0.00	SNP	1.000	A	5	19
NDUFA7	4701	genome.wustl.edu	37	19	8386199	8386199	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr19:8386199G>T	ENST00000301457.2	-	1	81	c.44C>A	c.(43-45)gCg>gAg	p.A15E	RPS28_ENST00000600659.2_5'Flank|NDUFA7_ENST00000598884.1_Missense_Mutation_p.A15E	NM_005001.3	NP_004992.2	O95182	NDUA7_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa	15					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			NS(1)|central_nervous_system(1)|lung(2)|ovary(1)	5						CACCCCGGACGCCCAGTTCCG	0.716													ENSG00000267855																																					0													5.0	9.0	8.0					19																	8386199		1855	4007	5862	SO:0001583	missense	0			-	AF050637	CCDS42492.1	19p13.2	2013-05-14	2002-08-29		ENSG00000267855	ENSG00000267855		"""Mitochondrial respiratory chain complex / Complex I"""	7691	protein-coding gene	gene with protein product	"""complex I B14.5a subunit"""	602139	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (14.5kD, B14.5a)"""			9763676	Standard	NM_005001		Approved	B14.5a	uc002mjm.2	O95182	OTTHUMG00000182459	ENST00000301457.2:c.44C>A	19.37:g.8386199G>T	ENSP00000301457:p.Ala15Glu			Missense_Mutation	SNP	pfam_DH-UbQ_OxRdtase_B14.5a_su	p.A15E	ENST00000301457.2	37	c.44	CCDS42492.1	19	.	.	.	.	.	.	.	.	.	.	G	17.62	3.435192	0.62955	.	.	ENSG00000167774	ENST00000301457	T	0.45276	0.9	5.54	4.51	0.55191	.	0.166015	0.41823	D	0.000817	T	0.37785	0.1016	L	0.40543	1.245	0.30085	N	0.808798	P	0.37038	0.579	B	0.41332	0.354	T	0.46205	-0.9208	10	0.72032	D	0.01	-5.6882	10.1648	0.42873	0.1583:0.0:0.8417:0.0	.	15	O95182	NDUA7_HUMAN	E	15	ENSP00000301457:A15E	ENSP00000301457:A15E	A	-	2	0	NDUFA7	8292199	0.495000	0.26051	0.888000	0.34837	0.310000	0.27922	3.319000	0.51983	1.584000	0.49913	0.655000	0.94253	GCG	-	NDUFA7	-	pfam_DH-UbQ_OxRdtase_B14.5a_su		0.716	NDUFA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA7	HGNC	protein_coding	OTTHUMT00000461373.1	0	0	0	25	25	2	0.00	0.00	G	NM_005001		8386199	-1	8	0	18	1	tier1	no_errors	ENST00000301457	ensembl	human	known	74_37	missense	30.77	0.00	SNP	0.759	T	8	18
RIMBP3C	150221	genome.wustl.edu	37	22	21899852	21899852	+	IGR	SNP	C	C	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr22:21899852C>A	ENST00000433039.1	-	0	5784				SCARNA18_ENST00000516796.1_RNA|SCARNA17_ENST00000516334.1_RNA|RN7SKP221_ENST00000410420.1_RNA|RIMBP3C_ENST00000331505.5_3'UTR	NM_001128633.1	NP_001122105.1	A6NJZ7	RIM3C_HUMAN	RIMS binding protein 3C											large_intestine(1)	1						aaggggatacccgcctagtca	0.542													ENSG00000222352																																					0																																										SO:0001628	intergenic_variant	0			-		CCDS46669.1	22q11.21	2008-10-21			ENSG00000183246	ENSG00000183246			33892	protein-coding gene	gene with protein product		612701				17855024	Standard	NM_001128633		Approved		uc002zuq.4	A6NJZ7	OTTHUMG00000150825		22.37:g.21899852C>A				R	SNP	-	NULL	ENST00000433039.1	37	NULL	CCDS46669.1	22																																																																																			-	RN7SKP221	-	-		0.542	RIMBP3C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RN7SKP221	HGNC	protein_coding		0	0	0	38	38	1	0.00	0.00	C	XM_036942		21899852	-1	4	0	32	0	tier1	no_errors	ENST00000410420	ensembl	human	known	74_37	rna	11.11	0.00	SNP	0.314	A	4	32
MT-CO1	4512	genome.wustl.edu	37	M	3079	3079	+	5'Flank	SNP	G	G	A			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chrM:3079G>A	ENST00000361624.2	+	0	0				MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TGAGTTCAGACCGGAGTAATC	0.463													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3079G>A	Exception_encountered		Q34770	R	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.463	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		0	0	0	39	39	4	0.00	0.00	G	YP_003024028		3079	+1	30	4	63	5	tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	32.26	44.44	SNP	NULL	A	30	63
KIAA1109	84162	genome.wustl.edu	37	4	123280877	123280877	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6BE-01A-41D-A32I-09	TCGA-DX-A6BE-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	406790e5-4047-4f74-86ed-6ce0c93069a3	33cfaab4-e272-46bf-9cf9-18bc3880eddf	g.chr4:123280877G>T	ENST00000264501.4	+	85	15174	c.14801G>T	c.(14800-14802)aGa>aTa	p.R4934I	KIAA1109_ENST00000388738.3_Splice_Site_p.R4934I			Q2LD37	K1109_HUMAN	KIAA1109	4934					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CCTACTCTTAGGTAAGTAATG	0.308													ENSG00000138688																																					0													106.0	95.0	98.0					4																	123280877		1856	4090	5946	SO:0001630	splice_region_variant	0			-	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14801+1G>T	4.37:g.123280877G>T			Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.R4934I	ENST00000264501.4	37	c.14801	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.454354|5.454354	0.96223|0.96223	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	.|T;T;T	.|0.62364	.|0.03;0.03;0.03	5.94|5.94	5.94|5.94	0.96194|0.96194	.|Fragile site-associated protein, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80675|0.80675	0.4668|0.4668	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.994;0.997	.|D;D	.|0.81914	.|0.975;0.995	T|T	0.81145|0.81145	-0.1066|-0.1066	5|10	.|0.87932	.|D	.|0	.|.	20.3731|20.3731	0.98895|0.98895	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|4933;4934	.|Q2LD37-4;Q2LD37	.|.;K1109_HUMAN	Y|I	1310|4934;4934;1603;535	.|ENSP00000264501:R4934I;ENSP00000373390:R4934I;ENSP00000410874:R1603I	.|ENSP00000264501:R4934I	D|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123500327|123500327	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	9.789000|9.789000	0.99068|0.99068	2.829000|2.829000	0.97493|0.97493	0.650000|0.650000	0.86243|0.86243	GAT|AGA	-	KIAA1109	-	pfam_Fragile_site-assoc_C		0.308	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	0	0	0	36	36	86	0.00	0.00	G	NM_020797	Missense_Mutation	123280877	+1	4	2	40	120	tier1	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	9.09	1.64	SNP	1.000	T	4	40
