#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PLEKHA6	22874	genome.wustl.edu	37	1	204210828	204210828	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:204210828C>G	ENST00000272203.3	-	16	2603	c.2287G>C	c.(2287-2289)Gca>Cca	p.A763P	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.A783P	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	763										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TTGAGAGCTGCCTGCTTCTCT	0.552													ENSG00000143850																																					0													142.0	128.0	132.0					1																	204210828		2203	4300	6503	SO:0001583	missense	0			-	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2287G>C	1.37:g.204210828C>G	ENSP00000272203:p.Ala763Pro		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A763P	ENST00000272203.3	37	c.2287	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.688429	0.48097	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.10477	2.87;3.34	5.24	3.37	0.38596	.	0.457832	0.21336	N	0.076218	T	0.08133	0.0203	L	0.36672	1.1	0.29491	N	0.855623	P	0.47409	0.895	B	0.39706	0.307	T	0.14035	-1.0487	10	0.20046	T	0.44	-2.4044	9.792	0.40710	0.0:0.8394:0.0:0.1606	.	763	Q9Y2H5	PKHA6_HUMAN	P	763;783	ENSP00000272203:A763P;ENSP00000402046:A783P	ENSP00000272203:A763P	A	-	1	0	PLEKHA6	202477451	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.258000	0.32944	0.797000	0.33971	0.644000	0.83932	GCA	-	PLEKHA6	-	NULL		0.552	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	1	1	0	118	118	48	0.84	0.00	C	NM_014935		204210828	-1	44	8	100	47	tier1	no_errors	ENST00000272203	ensembl	human	known	74_37	missense	30.56	14.55	SNP	1.000	G	44	100
VEGFC	7424	genome.wustl.edu	37	4	177609025	177609025	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr4:177609025C>T	ENST00000280193.2	-	5	1176	c.761G>A	c.(760-762)tGc>tAc	p.C254Y	RP11-313E19.2_ENST00000504017.1_RNA|RP11-313E19.2_ENST00000509194.1_RNA|VEGFC_ENST00000507638.1_5'Flank	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	254					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		CAGGCATCTGCAGATGTGATT	0.453													ENSG00000150630																																					0													112.0	107.0	109.0					4																	177609025		1915	4132	6047	SO:0001583	missense	0			-	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.761G>A	4.37:g.177609025C>T	ENSP00000280193:p.Cys254Tyr		B2R9Q8	Missense_Mutation	SNP	pfam_PDGF/VEGF_dom,pfam_CXCXC_repeat,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.C254Y	ENST00000280193.2	37	c.761	CCDS43285.1	4	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046127	0.75846	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.57	4.73	0.59995	.	0.051100	0.85682	N	0.000000	T	0.79185	0.4403	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82468	-0.0442	9	0.87932	D	0	-13.7135	14.8702	0.70450	0.0:0.9308:0.0:0.0692	.	254	P49767	VEGFC_HUMAN	Y	254	.	ENSP00000280193:C254Y	C	-	2	0	VEGFC	177846019	1.000000	0.71417	0.997000	0.53966	0.877000	0.50540	6.478000	0.73596	1.490000	0.48466	0.650000	0.86243	TGC	-	VEGFC	-	NULL		0.453	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEGFC	HGNC	protein_coding	OTTHUMT00000361991.1	0	0	0	109	109	98	0.00	0.00	C	NM_005429		177609025	-1	115	68	175	78	tier1	no_errors	ENST00000280193	ensembl	human	known	74_37	missense	39.66	46.26	SNP	1.000	T	115	175
APCS	325	genome.wustl.edu	37	1	159558150	159558150	+	Silent	SNP	G	G	C	rs28383572	byFrequency	TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:159558150G>C	ENST00000255040.2	+	2	421	c.324G>C	c.(322-324)ccG>ccC	p.P108P		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	108	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					AAAAGTTCCCGGCTCCAGTGC	0.433													ENSG00000132703																																					0													81.0	82.0	82.0					1																	159558150		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.324G>C	1.37:g.159558150G>C				Silent	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.P108	ENST00000255040.2	37	c.324	CCDS1186.1	1																																																																																			-	APCS	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.433	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APCS	HGNC	protein_coding	OTTHUMT00000059024.2	0	0	0	164	164	155	0.00	0.00	G	NM_001639		159558150	+1	28	28	143	104	tier1	no_errors	ENST00000255040	ensembl	human	known	74_37	silent	16.37	21.21	SNP	0.000	C	28	143
CDK14	5218	genome.wustl.edu	37	7	90355898	90355898	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:90355898G>A	ENST00000380050.3	+	3	272	c.141G>A	c.(139-141)atG>atA	p.M47I	CDK14_ENST00000436577.2_5'UTR|CDK14_ENST00000265741.3_Missense_Mutation_p.M29I|CDK14_ENST00000406263.1_Start_Codon_SNP_p.M1I|CDK14_ENST00000496279.1_3'UTR			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	47					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						TCACAAAGATGTCTACACGGA	0.388													ENSG00000058091																									GBM(83;1228 1256 8311 16577 31299)												0													79.0	72.0	74.0					7																	90355898		2203	4300	6503	SO:0001583	missense	0			-		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.141G>A	7.37:g.90355898G>A	ENSP00000369390:p.Met47Ile		A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M47I	ENST00000380050.3	37	c.141		7	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756667	0.49362	.	.	ENSG00000058091	ENST00000449528;ENST00000446224;ENST00000430760;ENST00000456689;ENST00000380050;ENST00000446790;ENST00000265741;ENST00000406263	T;T;T;T;T;T;T	0.69306	2.15;2.15;2.15;2.15;-0.39;-0.37;-0.38	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.66167	0.2762	L	0.27053	0.805	0.80722	D	1	P;P	0.39044	0.656;0.525	P;P	0.48627	0.584;0.48	T	0.59947	-0.7358	10	0.23891	T	0.37	-19.0256	19.8788	0.96888	0.0:0.0:1.0:0.0	.	29;47	O94921-2;O94921	.;CDK14_HUMAN	I	1;1;1;1;47;1;29;1	ENSP00000393616:M1I;ENSP00000410770:M1I;ENSP00000394570:M1I;ENSP00000406848:M1I;ENSP00000369390:M47I;ENSP00000265741:M29I;ENSP00000385034:M1I	ENSP00000265741:M29I	M	+	3	0	CDK14	90193834	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.998000	0.93550	2.704000	0.92352	0.563000	0.77884	ATG	-	CDK14	-	NULL		0.388	CDK14-001	KNOWN	basic|appris_principal	protein_coding	CDK14	HGNC	protein_coding	OTTHUMT00000059970.5	0	0	0	141	141	86	0.00	0.00	G	NM_012395		90355898	+1	18	12	76	35	tier1	no_errors	ENST00000380050	ensembl	human	known	74_37	missense	19.15	25.53	SNP	1.000	A	18	76
SIRT7	51547	genome.wustl.edu	37	17	79872574	79872574	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:79872574T>C	ENST00000328666.6	-	6	547	c.485A>G	c.(484-486)cAg>cGg	p.Q162R		NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	162	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CACCACATGCTGCACCTGGAA	0.647													ENSG00000187531																																					0													54.0	51.0	52.0					17																	79872574		2202	4294	6496	SO:0001583	missense	0			-	AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.485A>G	17.37:g.79872574T>C	ENSP00000329466:p.Gln162Arg		A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.Q162R	ENST00000328666.6	37	c.485	CCDS11792.1	17	.	.	.	.	.	.	.	.	.	.	T	10.06	1.245898	0.22796	.	.	ENSG00000187531	ENST00000328666;ENST00000536038	T	0.16743	2.32	4.2	4.2	0.49525	.	0.131711	0.52532	D	0.000076	T	0.08403	0.0209	N	0.04260	-0.245	0.51482	D	0.999926	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.006	T	0.22836	-1.0205	10	0.21014	T	0.42	-24.8158	13.4573	0.61206	0.0:0.0:0.0:1.0	.	162;162	A8K2K0;Q9NRC8	.;SIRT7_HUMAN	R	162;145	ENSP00000329466:Q162R	ENSP00000329466:Q162R	Q	-	2	0	SIRT7	77465866	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	1.450000	0.35134	1.762000	0.52044	0.459000	0.35465	CAG	-	SIRT7	-	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom		0.647	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT7	HGNC	protein_coding	OTTHUMT00000439961.1	0	0	0	72	72	41	0.00	0.00	T	NM_016538		79872574	-1	76	27	64	16	tier1	no_errors	ENST00000328666	ensembl	human	known	74_37	missense	54.29	62.79	SNP	1.000	C	76	64
FMNL3	91010	genome.wustl.edu	37	12	50050265	50050265	+	Silent	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:50050265G>T	ENST00000293590.5	-	9	1040	c.807C>A	c.(805-807)gtC>gtA	p.V269V	FMNL3_ENST00000335154.5_Silent_p.V269V|FMNL3_ENST00000550488.1_Silent_p.V269V|FMNL3_ENST00000352151.5_Silent_p.V218V			Q8IVF7	FMNL3_HUMAN	formin-like 3	269	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						GAAGCTCTAAGACAAGGGCTT	0.493													ENSG00000161791																																					0													69.0	70.0	70.0					12																	50050265		2041	4218	6259	SO:0001819	synonymous_variant	0			-	AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.807C>A	12.37:g.50050265G>T			B0JZA7|Q6ZRJ1	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.V269	ENST00000293590.5	37	c.807		12																																																																																			-	FMNL3	-	pfam_GTPase-bd,superfamily_ARM-type_fold		0.493	FMNL3-201	KNOWN	basic	protein_coding	FMNL3	HGNC	protein_coding		0	0	0	137	137	115	0.00	0.00	G	NM_175736		50050265	-1	49	49	58	60	tier1	no_errors	ENST00000293590	ensembl	human	known	74_37	silent	45.79	44.95	SNP	0.998	T	49	58
LINC00521	256369	genome.wustl.edu	37	14	94468031	94468031	+	RNA	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:94468031A>G	ENST00000444118.1	+	0	1109					NR_024182.1		Q8NCU1	CN048_HUMAN	long intergenic non-protein coding RNA 521																		cctagttgctagcgtccttgc	0.493													ENSG00000175699																																					0																																												0			-	BI463117		14q32.12	2012-10-12	2011-11-29	2011-11-29	ENSG00000175699	ENSG00000175699		"""Long non-coding RNAs"""	19860	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 48"""	C14orf48			Standard	NR_024182		Approved		uc001ycg.1	Q8NCU1	OTTHUMG00000156974		14.37:g.94468031A>G			Q8N7S1	R	SNP	-	NULL	ENST00000444118.1	37	NULL		14																																																																																			-	LINC00521	-	-		0.493	LINC00521-003	KNOWN	basic	processed_transcript	LINC00521	HGNC	processed_transcript	OTTHUMT00000346916.1	0	0	1	68	68	66	0.00	1.49	A			94468031	+1	18	10	32	53	tier1	no_errors	ENST00000444118	ensembl	human	known	74_37	rna	36.00	15.87	SNP	0.002	G	18	32
ITGB1BP2	26548	genome.wustl.edu	37	X	70524458	70524458	+	Intron	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:70524458A>C	ENST00000373829.3	+	10	889				ITGB1BP2_ENST00000538820.1_Intron|ITGB1BP2_ENST00000465388.1_3'UTR	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2						muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					CTGGGGGGTAAGTGAAGACCA	0.483													ENSG00000147166																																					0													82.0	65.0	71.0					X																	70524458		2203	4300	6503	SO:0001627	intron_variant	0			-	AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.816+4A>C	X.37:g.70524458A>C			Q32N04|Q549J7	R	SNP	-	NULL	ENST00000373829.3	37	NULL	CCDS14411.1	X																																																																																			-	ITGB1BP2	-	-		0.483	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB1BP2	HGNC	protein_coding	OTTHUMT00000057126.1	0	0	0	144	144	125	0.00	0.00	A	NM_012278		70524458	+1	17	21	121	69	tier1	no_errors	ENST00000465388	ensembl	human	known	74_37	rna	12.32	23.33	SNP	1.000	C	17	121
MYB	4602	genome.wustl.edu	37	6	135515004	135515004	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr6:135515004C>A	ENST00000367814.4	+	7	977	c.791C>A	c.(790-792)gCg>gAg	p.A264E	MYB_ENST00000442647.2_Missense_Mutation_p.A264E|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000316528.8_Missense_Mutation_p.A264E|MYB_ENST00000527615.1_Missense_Mutation_p.A264E|MYB_ENST00000534121.1_Missense_Mutation_p.A264E|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000534044.1_Missense_Mutation_p.A264E|MYB_ENST00000341911.5_Missense_Mutation_p.A264E|MYB_ENST00000533624.1_Missense_Mutation_p.A264E|MYB_ENST00000528774.1_Missense_Mutation_p.A264E|MYB_ENST00000420123.2_Missense_Mutation_p.A240E|MYB_ENST00000525369.1_Missense_Mutation_p.A264E	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	264					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TACCCTGTAGCGTTACATGTA	0.448			T	NFIB	adenoid cystic carcinoma								ENSG00000118513																												Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0													235.0	206.0	216.0					6																	135515004		2203	4300	6503	SO:0001583	missense	0			-		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.791C>A	6.37:g.135515004C>A	ENSP00000356788:p.Ala264Glu		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.A264E	ENST00000367814.4	37	c.791	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	C	26.7	4.764782	0.90020	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000420123;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624;ENST00000430686	T;T;T;T;T;T;T;T;T;T	0.31769	2.77;2.25;2.23;2.24;1.48;1.97;2.77;2.76;1.9;2.27	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.51381	0.1671	M	0.74258	2.255	0.80722	D	1	D;D;D;D;D;D;P;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;0.989;0.892;1.0;0.987;1.0	D;D;D;D;D;P;B;D;P;D	0.91635	0.994;0.987;0.998;0.991;0.999;0.867;0.334;0.999;0.698;0.998	T	0.56396	-0.7986	10	0.72032	D	0.01	-7.0423	18.8089	0.92050	0.0:1.0:0.0:0.0	.	264;264;240;264;264;264;264;264;264;264	E9PI07;E9PLZ5;E9PMQ0;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242;Q708E1	.;.;.;.;.;.;.;.;MYB_HUMAN;.	E	264;264;264;264;264;264;240;264;264;264;264;264;218	ENSP00000339992:A264E;ENSP00000410825:A264E;ENSP00000326328:A264E;ENSP00000356788:A264E;ENSP00000433227:A264E;ENSP00000435938:A264E;ENSP00000434723:A264E;ENSP00000432851:A264E;ENSP00000435055:A264E;ENSP00000436605:A264E	ENSP00000237302:A264E	A	+	2	0	MYB	135556697	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.204000	0.72143	2.437000	0.82529	0.650000	0.86243	GCG	-	MYB	-	NULL		0.448	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	0	0	0	181	181	99	0.00	0.00	C			135515004	+1	87	35	185	75	tier1	no_errors	ENST00000341911	ensembl	human	known	74_37	missense	31.99	31.82	SNP	1.000	A	87	185
MMP7	4316	genome.wustl.edu	37	11	102398334	102398334	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:102398334C>A	ENST00000260227.4	-	3	457	c.405G>T	c.(403-405)atG>atT	p.M135I		NM_002423.3	NP_002414.1	P09237	MMP7_HUMAN	matrix metallopeptidase 7 (matrilysin, uterine)	135					antibacterial peptide secretion (GO:0002779)|collagen catabolic process (GO:0030574)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	Marimastat(DB00786)	CTTTGCCCCACATGTTTAAAG	0.438													ENSG00000137673																																					0													124.0	120.0	121.0					11																	102398334		2203	4299	6502	SO:0001583	missense	0			-	Z11887	CCDS8317.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000137673	ENSG00000137673	3.4.24.23		7174	protein-coding gene	gene with protein product		178990	"""matrix metalloproteinase 7 (matrilysin, uterine)"""	MPSL1		8978768	Standard	NM_002423		Approved	PUMP-1	uc001phb.3	P09237	OTTHUMG00000048193	ENST00000260227.4:c.405G>T	11.37:g.102398334C>A	ENSP00000260227:p.Met135Ile		Q9BTK9	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,prints_Pept_M10A	p.M135I	ENST00000260227.4	37	c.405	CCDS8317.1	11	.	.	.	.	.	.	.	.	.	.	C	11.24	1.579246	0.28180	.	.	ENSG00000137673	ENST00000260227	T	0.48836	0.8	4.85	1.9	0.25705	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.671381	0.13295	N	0.398721	T	0.27134	0.0665	L	0.28192	0.835	0.24613	N	0.993714	B;B;B	0.30914	0.3;0.001;0.006	B;B;B	0.25987	0.065;0.005;0.026	T	0.17077	-1.0381	10	0.44086	T	0.13	0.6303	1.5284	0.02530	0.1362:0.4069:0.1331:0.3239	.	135;135;135	B4DDW4;Q53GF1;P09237	.;.;MMP7_HUMAN	I	135	ENSP00000260227:M135I	ENSP00000260227:M135I	M	-	3	0	MMP7	101903544	0.010000	0.17322	0.629000	0.29254	0.963000	0.63663	-1.190000	0.03058	0.461000	0.27071	0.563000	0.77884	ATG	-	MMP7	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,prints_Pept_M10A		0.438	MMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP7	HGNC	protein_coding	OTTHUMT00000109633.2	0	0	0	150	150	94	0.00	0.00	C			102398334	-1	52	52	42	31	tier1	no_errors	ENST00000260227	ensembl	human	known	74_37	missense	55.32	62.65	SNP	0.104	A	52	42
CH25H	9023	genome.wustl.edu	37	10	90966518	90966518	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:90966518C>T	ENST00000371852.2	-	1	553	c.532G>A	c.(532-534)Gaa>Aaa	p.E178K		NM_003956.3	NP_003947.1	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	178					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholesterol 25-hydroxylase activity (GO:0001567)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			kidney(1)|large_intestine(2)|lung(3)|stomach(1)	7		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		GAAAACAGTTCCCAGACGCTC	0.577													ENSG00000138135																																					0													161.0	157.0	158.0					10																	90966518		2203	4300	6503	SO:0001583	missense	0			-	AF059212	CCDS7400.1	10q23	2013-03-04			ENSG00000138135	ENSG00000138135	1.14.99.38	"""Fatty acid hydroxylase domain containing"""	1907	protein-coding gene	gene with protein product		604551				9852097	Standard	NM_003956		Approved		uc001kfz.3	O95992	OTTHUMG00000018705	ENST00000371852.2:c.532G>A	10.37:g.90966518C>T	ENSP00000360918:p.Glu178Lys		B2RBY3	Missense_Mutation	SNP	pfam_Fatty_acid_hydroxylase	p.E178K	ENST00000371852.2	37	c.532	CCDS7400.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.422104	0.96111	.	.	ENSG00000138135	ENST00000371852	D	0.85861	-2.04	4.88	4.88	0.63580	Fatty acid hydroxylase (1);	0.000000	0.85682	D	0.000000	D	0.95201	0.8444	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96684	0.9506	10	0.87932	D	0	-39.757	17.8989	0.88897	0.0:1.0:0.0:0.0	.	178	O95992	CH25H_HUMAN	K	178	ENSP00000360918:E178K	ENSP00000360918:E178K	E	-	1	0	CH25H	90956498	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.625000	0.83145	2.628000	0.89032	0.563000	0.77884	GAA	-	CH25H	-	pfam_Fatty_acid_hydroxylase		0.577	CH25H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CH25H	HGNC	protein_coding	OTTHUMT00000049291.1	0	0	0	81	81	93	0.00	0.00	C	NM_003956		90966518	-1	25	17	58	67	tier1	no_errors	ENST00000371852	ensembl	human	known	74_37	missense	30.12	20.24	SNP	1.000	T	25	58
CRHR2	1395	genome.wustl.edu	37	7	30721617	30721617	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:30721617C>T	ENST00000471646.1	-	2	560	c.143G>A	c.(142-144)gGa>gAa	p.G48E	CRHR2_ENST00000341843.4_Missense_Mutation_p.G34E|CRHR2_ENST00000506074.2_Missense_Mutation_p.G48E|CRHR2_ENST00000348438.4_Missense_Mutation_p.G75E	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	48					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCAGCACGTTCCGATCTGGTC	0.692													ENSG00000106113																																					0													30.0	28.0	28.0					7																	30721617		2200	4295	6495	SO:0001583	missense	0			-		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.143G>A	7.37:g.30721617C>T	ENSP00000418722:p.Gly48Glu		B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.G75E	ENST00000471646.1	37	c.224	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.173737	0.94807	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	4.27	4.27	0.50696	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.64402	D	0.000001	T	0.74107	0.3673	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0	D;D;D;D;D	0.85130	0.997;0.995;0.991;0.981;0.997	T	0.77890	-0.2419	10	0.52906	T	0.07	.	14.6183	0.68565	0.0:1.0:0.0:0.0	.	48;48;75;34;48	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	E	48;75;34;48	ENSP00000418722:G48E;ENSP00000340943:G75E;ENSP00000344304:G34E;ENSP00000426498:G48E	ENSP00000344304:G34E	G	-	2	0	CRHR2	30688142	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.521000	0.73778	2.379000	0.81126	0.655000	0.94253	GGA	-	CRHR2	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.692	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	HGNC	protein_coding	OTTHUMT00000250448.3	0	0	0	205	205	25	0.00	0.00	C			30721617	-1	195	22	158	13	tier1	no_errors	ENST00000348438	ensembl	human	known	74_37	missense	55.24	62.86	SNP	1.000	T	195	158
OR13C5	138799	genome.wustl.edu	37	9	107360878	107360878	+	Silent	SNP	A	A	G	rs141268591		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr9:107360878A>G	ENST00000374779.2	-	1	910	c.817T>C	c.(817-819)Ttg>Ctg	p.L273L		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L273M(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GTGGCATCCAAGTCATCTGAA	0.428													ENSG00000255800																																					1	Substitution - Missense(1)	large_intestine(1)						A		1,4405	2.1+/-5.4	0,1,2202	136.0	126.0	129.0		817	-6.3	0.0	9	dbSNP_134	129	0,8600		0,0,4300	no	coding-synonymous	OR13C5	NM_001004482.1		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		273/319	107360878	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.817T>C	9.37:g.107360878A>G			B2RNE5|B9EGW5|Q6IF53	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L273	ENST00000374779.2	37	c.817	CCDS35091.1	9																																																																																			rs141268591	OR13C5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.428	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	HGNC	protein_coding	OTTHUMT00000053479.2	0	0	0	185	185	52	0.00	0.00	A	NM_001004482		107360878	-1	44	7	240	55	tier1	no_errors	ENST00000374779	ensembl	human	known	74_37	silent	15.49	11.29	SNP	0.000	G	44	240
DPY19L2	283417	genome.wustl.edu	37	12	63991687	63991687	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:63991687G>A	ENST00000324472.4	-	14	1546	c.1363C>T	c.(1363-1365)Cgc>Tgc	p.R455C		NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	455					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCACTCAGGCGAATCTGGGAG	0.313													ENSG00000177990																																					0													35.0	39.0	38.0					12																	63991687		2195	4277	6472	SO:0001583	missense	0			-		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.1363C>T	12.37:g.63991687G>A	ENSP00000315988:p.Arg455Cys		A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	pfam_Dpy-19	p.R455C	ENST00000324472.4	37	c.1363	CCDS31851.1	12	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639038	0.29157	.	.	ENSG00000177990	ENST00000324472;ENST00000541083	T;T	0.56275	0.47;0.47	3.14	3.14	0.36123	.	0.175210	0.49305	D	0.000149	T	0.34978	0.0916	.	.	.	0.80722	D	1	B	0.22080	0.064	B	0.18561	0.022	T	0.12708	-1.0537	8	.	.	.	.	9.9551	0.41661	0.0:0.0:1.0:0.0	.	455	Q6NUT2	D19L2_HUMAN	C	455;121	ENSP00000315988:R455C;ENSP00000443126:R121C	.	R	-	1	0	DPY19L2	62277954	1.000000	0.71417	0.964000	0.40570	0.846000	0.48090	2.984000	0.49353	1.748000	0.51833	0.580000	0.79431	CGC	-	DPY19L2	-	pfam_Dpy-19		0.313	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	HGNC	protein_coding	OTTHUMT00000400689.2	1	1	0	135	135	101	0.74	0.00	G	NM_173812		63991687	-1	1866	1199	1411	1087	tier1	no_errors	ENST00000324472	ensembl	human	known	74_37	missense	56.92	52.36	SNP	0.996	A	1866	1411
ANKZF1	55139	genome.wustl.edu	37	2	220098857	220098857	+	Missense_Mutation	SNP	G	G	A	rs375422658		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:220098857G>A	ENST00000323348.5	+	9	1225	c.1051G>A	c.(1051-1053)Gaa>Aaa	p.E351K	ANKZF1_ENST00000409849.1_Missense_Mutation_p.E141K|ANKZF1_ENST00000410034.3_Missense_Mutation_p.E351K|GLB1L_ENST00000497855.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	351						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATGGCAGAAGAAGACCCTCG	0.463													ENSG00000163516																																					0								G	LYS/GLU,LYS/GLU	1,3761		0,1,1880	41.0	40.0	40.0		1051,1051	4.1	1.0	2		40	0,8238		0,0,4119	no	missense,missense	ANKZF1	NM_001042410.1,NM_018089.2	56,56	0,1,5999	AA,AG,GG		0.0,0.0266,0.0083	benign,benign	351/727,351/727	220098857	1,11999	1881	4119	6000	SO:0001583	missense	0			-	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1051G>A	2.37:g.220098857G>A	ENSP00000321617:p.Glu351Lys		Q9NVZ4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E351K	ENST00000323348.5	37	c.1051	CCDS42821.1	2	.	.	.	.	.	.	.	.	.	.	G	3.456	-0.110993	0.06924	2.66E-4	0.0	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.25579	1.79;2.03;1.79	4.94	4.07	0.47477	.	0.383548	0.30528	N	0.009423	T	0.17831	0.0428	L	0.45698	1.435	0.29762	N	0.835455	P;B;B	0.37330	0.59;0.05;0.053	B;B;B	0.36378	0.223;0.009;0.026	T	0.08806	-1.0704	10	0.06099	T	0.92	-5.9175	8.76	0.34669	0.1007:0.0:0.8993:0.0	.	295;141;351	B4DZT1;B4E0V1;Q9H8Y5	.;.;ANKZ1_HUMAN	K	351;141;351	ENSP00000321617:E351K;ENSP00000386815:E141K;ENSP00000386337:E351K	ENSP00000321617:E351K	E	+	1	0	ANKZF1	219807101	1.000000	0.71417	0.995000	0.50966	0.274000	0.26718	2.213000	0.42844	1.299000	0.44798	0.655000	0.94253	GAA	-	ANKZF1	-	NULL		0.463	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	HGNC	protein_coding	OTTHUMT00000335790.1	0	0	0	51	51	65	0.00	0.00	G	NM_018089		220098857	+1	14	22	38	32	tier1	no_errors	ENST00000323348	ensembl	human	known	74_37	missense	26.92	40.74	SNP	1.000	A	14	38
FADS1	3992	genome.wustl.edu	37	11	61569925	61569925	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:61569925C>G	ENST00000350997.7	-	12	1696	c.1464G>C	c.(1462-1464)aaG>aaC	p.K488N	FADS1_ENST00000460649.1_Missense_Mutation_p.K133N|FADS1_ENST00000536991.1_Missense_Mutation_p.K179N|FADS1_ENST00000433932.1_Missense_Mutation_p.K347N|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000542506.1_Missense_Mutation_p.K347N	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	431					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCCCTGACTCCTTTAGTGAGC	0.542													ENSG00000149485																																					0													33.0	34.0	33.0					11																	61569925		2056	4212	6268	SO:0001583	missense	0			-		CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.1464G>C	11.37:g.61569925C>G	ENSP00000322229:p.Lys488Asn		A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd	p.K488N	ENST00000350997.7	37	c.1464	CCDS8011.2	11	.	.	.	.	.	.	.	.	.	.	C	19.35	3.811074	0.70797	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000536991;ENST00000433932;ENST00000460649;ENST00000542506	T;T;T;T	0.60672	0.17;0.78;1.79;1.79	5.21	3.33	0.38152	.	0.000000	0.50627	U	0.000111	T	0.69575	0.3126	L	0.55990	1.75	0.45852	D	0.998716	D	0.89917	1.0	D	0.85130	0.997	T	0.70952	-0.4732	10	0.87932	D	0	-11.0637	12.061	0.53562	0.0:0.8562:0.0:0.1438	.	431	O60427	FADS1_HUMAN	N	363;488;347;179;347;133;347	ENSP00000322229:K488N;ENSP00000439097:K179N;ENSP00000405087:K347N;ENSP00000441403:K347N	ENSP00000322229:K488N	K	-	3	2	FADS1	61326501	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	1.254000	0.32897	0.712000	0.32039	-0.137000	0.14449	AAG	-	FADS1	-	pirsf_Fatty_acid/sphinglp_desaturase		0.542	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	HGNC	protein_coding	OTTHUMT00000347648.2	0	0	0	157	157	54	0.00	0.00	C	NM_013402		61569925	-1	66	7	118	55	tier1	no_errors	ENST00000350997	ensembl	human	known	74_37	missense	35.87	11.29	SNP	1.000	G	66	118
ACTRT3	84517	genome.wustl.edu	37	3	169482775	169482775	+	IGR	SNP	G	G	A	rs199422264		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:169482775G>A	ENST00000330368.2	-	0	2005				TERC_ENST00000602385.1_lincRNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											CAAAAGCACGGCGCCTACGCC	0.607													ENSG00000270141																																					0													30.0	33.0	32.0					3																	169482775		876	1991	2867	SO:0001628	intergenic_variant	0			-	AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9			3.37:g.169482775G>A			Q96IS0|Q96NJ0	R	SNP	-	NULL	ENST00000330368.2	37	NULL	CCDS3206.1	3																																																																																			-	TERC	-	-		0.607	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TERC	HGNC	protein_coding	OTTHUMT00000467797.1	0	0	0	222	222	73	0.00	0.00	G	NM_032487		169482775	-1	64	8	234	57	tier1	no_errors	ENST00000363312	ensembl	human	known	74_37	rna	21.40	12.31	SNP	0.027	A	64	234
ING4	51147	genome.wustl.edu	37	12	6760372	6760372	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:6760372T>A	ENST00000396807.4	-	8	777	c.739A>T	c.(739-741)Aag>Tag	p.K247*	ING4_ENST00000486287.1_5'UTR|ING4_ENST00000412586.2_Nonsense_Mutation_p.K244*|ING4_ENST00000341550.4_Nonsense_Mutation_p.K246*|ING4_ENST00000446105.2_Nonsense_Mutation_p.K243*|ING4_ENST00000444704.2_Nonsense_Mutation_p.K223*|ING4_ENST00000423703.2_3'UTR	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	247					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						TATTTCTTCTTCCGTTCTTGG	0.527													ENSG00000111653																																					0													98.0	89.0	92.0					12																	6760372		2203	4300	6503	SO:0001587	stop_gained	0			-	AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.739A>T	12.37:g.6760372T>A	ENSP00000380024:p.Lys247*		A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K247*	ENST00000396807.4	37	c.739	CCDS44813.1	12	.	.	.	.	.	.	.	.	.	.	T	19.21	3.783834	0.70222	.	.	ENSG00000111653	ENST00000341550;ENST00000396807;ENST00000446105;ENST00000444704;ENST00000412586	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.39297	D	0.964849	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.006	13.5557	0.61757	0.0:0.0:0.0:1.0	.	.	.	.	X	246;247;243;223;244	.	ENSP00000343396:K246X	K	-	1	0	ING4	6630633	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.625000	0.74248	2.068000	0.61886	0.459000	0.35465	AAG	-	ING4	-	superfamily_Znf_FYVE_PHD		0.527	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ING4	HGNC	protein_coding	OTTHUMT00000280467.2	0	0	1	227	227	109	0.00	0.91	T	NM_198287		6760372	-1	98	32	191	62	tier1	no_errors	ENST00000396807	ensembl	human	known	74_37	nonsense	33.91	33.68	SNP	1.000	A	98	191
HELB	92797	genome.wustl.edu	37	12	66725161	66725161	+	Silent	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:66725161G>T	ENST00000247815.4	+	12	2957	c.2898G>T	c.(2896-2898)ccG>ccT	p.P966P		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	966			P -> L (in dbSNP:rs1185244). {ECO:0000269|PubMed:14702039}.		DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		CAGATTTTCCGTCCCCACGGA	0.498													ENSG00000127311																																					0													68.0	61.0	63.0					12																	66725161		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.2898G>T	12.37:g.66725161G>T			A8K4C9|Q4G0T2|Q9H7L5	Silent	SNP	superfamily_P-loop_NTPase	p.P966	ENST00000247815.4	37	c.2898	CCDS8976.1	12																																																																																			-	HELB	-	NULL		0.498	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	HGNC	protein_coding	OTTHUMT00000401919.1	0	0	0	52	52	48	0.00	0.00	G			66725161	+1	7	6	32	40	tier1	no_errors	ENST00000247815	ensembl	human	known	74_37	silent	17.95	13.04	SNP	0.000	T	7	32
TTN	7273	genome.wustl.edu	37	2	179442717	179442717	+	Missense_Mutation	SNP	A	A	G	rs368301580		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:179442717A>G	ENST00000591111.1	-	272	63826	c.63602T>C	c.(63601-63603)aTt>aCt	p.I21201T	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I20274T|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I13902T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I13969T|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I13777T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I22842T|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21201					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGACTTACCAATTGGGTCCAG	0.408													ENSG00000155657																																					0								A	THR/ILE,THR/ILE,THR/ILE,THR/ILE	0,3766		0,0,1883	70.0	66.0	67.0		41330,60821,41705,41906	5.7	1.0	2		67	1,8217		0,1,4108	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	89,89,89,89	0,1,5991	GG,GA,AA		0.0122,0.0,0.0083	probably-damaging,probably-damaging,probably-damaging,probably-damaging	13777/26927,20274/33424,13902/27052,13969/27119	179442717	1,11983	1883	4109	5992	SO:0001583	missense	0			-	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63602T>C	2.37:g.179442717A>G	ENSP00000465570:p.Ile21201Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I20274T	ENST00000591111.1	37	c.60821		2	.	.	.	.	.	.	.	.	.	.	A	11.30	1.597209	0.28445	0.0	1.22E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62498	0.02;0.28;0.24;0.25	5.68	5.68	0.88126	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77961	0.4209	M	0.65975	2.015	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.87578	0.991;0.998;0.998;0.991	T	0.80398	-0.1399	9	0.87932	D	0	.	15.9184	0.79542	1.0:0.0:0.0:0.0	.	13777;13902;13969;21201	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	20274;13777;13969;13902;13775	ENSP00000343764:I20274T;ENSP00000434586:I13777T;ENSP00000340554:I13969T;ENSP00000352154:I13902T	ENSP00000340554:I13969T	I	-	2	0	TTN	179150963	1.000000	0.71417	1.000000	0.80357	0.625000	0.37756	9.339000	0.96797	2.175000	0.68902	0.528000	0.53228	ATT	-	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	0	0	0	128	128	99	0.00	0.00	A	NM_133378		179442717	-1	53	26	112	76	tier1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	32.12	25.49	SNP	1.000	G	53	112
SLC35F4	341880	genome.wustl.edu	37	14	58063546	58063546	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:58063546G>A	ENST00000339762.6	-	1	69	c.70C>T	c.(70-72)Ctt>Ttt	p.L24F	SLC35F4_ENST00000556826.1_Intron|SLC35F4_ENST00000554729.1_5'UTR|SLC35F4_ENST00000557430.1_Intron			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	24					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATACCGCAAAGCCCATTGCCT	0.418													ENSG00000151812																																					0													78.0	79.0	79.0					14																	58063546		2012	4190	6202	SO:0001583	missense	0			-			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.70C>T	14.37:g.58063546G>A	ENSP00000342518:p.Leu24Phe		A6NDQ3	Missense_Mutation	SNP	pfam_DMT,pfam_SLC35_F1/F2/F6	p.L24F	ENST00000339762.6	37	c.70		14	.	.	.	.	.	.	.	.	.	.	G	9.844	1.191738	0.21954	.	.	ENSG00000151812	ENST00000339762	T	0.53640	0.61	4.01	0.683	0.17998	.	.	.	.	.	T	0.30792	0.0776	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.29488	-1.0010	8	0.59425	D	0.04	.	1.6694	0.02808	0.1394:0.189:0.4771:0.1944	.	24	A4IF30	S35F4_HUMAN	F	24	ENSP00000342518:L24F	ENSP00000342518:L24F	L	-	1	0	SLC35F4	57133299	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.280000	0.02804	0.113000	0.18004	0.557000	0.71058	CTT	-	SLC35F4	-	NULL		0.418	SLC35F4-201	KNOWN	basic	protein_coding	SLC35F4	HGNC	protein_coding		0	0	0	99	99	71	0.00	0.00	G	XM_292260		58063546	-1	38	23	82	51	tier1	no_errors	ENST00000339762	ensembl	human	known	74_37	missense	31.67	30.67	SNP	0.000	A	38	82
SLC22A10	387775	genome.wustl.edu	37	11	63064875	63064875	+	Missense_Mutation	SNP	C	C	T	rs200183991		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:63064875C>T	ENST00000332793.6	+	3	609	c.607C>T	c.(607-609)Cgc>Tgc	p.R203C	SLC22A10_ENST00000535888.1_5'UTR|SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000544661.1_Missense_Mutation_p.R48C	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	203						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	CTGTGTACTACGCTTCTTGGC	0.408													ENSG00000184999																																					0								C	CYS/ARG	2,4092		0,2,2045	170.0	169.0	169.0		607	2.3	0.3	11		169	0,8428		0,0,4214	yes	missense	SLC22A10	NM_001039752.3	180	0,2,6259	TT,TC,CC		0.0,0.0489,0.016	probably-damaging	203/542	63064875	2,12520	2047	4214	6261	SO:0001583	missense	0			-	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.607C>T	11.37:g.63064875C>T	ENSP00000327569:p.Arg203Cys		Q68CJ0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R203C	ENST00000332793.6	37	c.607	CCDS41661.1	11	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306314	0.60305	4.89E-4	0.0	ENSG00000184999	ENST00000544661;ENST00000332793	D;D	0.90261	-2.64;-2.64	3.26	2.34	0.29019	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.066213	0.64402	N	0.000009	D	0.93341	0.7877	M	0.92077	3.27	0.80722	D	1	P	0.50819	0.939	P	0.50352	0.638	D	0.92539	0.6040	10	0.72032	D	0.01	.	8.4548	0.32893	0.0:0.8776:0.0:0.1224	.	203	Q63ZE4	S22AA_HUMAN	C	48;203	ENSP00000445667:R48C;ENSP00000327569:R203C	ENSP00000327569:R203C	R	+	1	0	SLC22A10	62821451	0.772000	0.28567	0.265000	0.24526	0.132000	0.20833	1.238000	0.32707	0.751000	0.32900	0.447000	0.29281	CGC	rs200183991	SLC22A10	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.408	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	HGNC	protein_coding	OTTHUMT00000382622.3	0	0	0	122	122	100	0.00	0.00	C	NM_001039752		63064875	+1	65	39	54	39	tier1	no_errors	ENST00000332793	ensembl	human	known	74_37	missense	54.62	50.00	SNP	0.874	T	65	54
TNR	7143	genome.wustl.edu	37	1	175372358	175372358	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:175372358C>T	ENST00000367674.2	-	4	1602	c.894G>A	c.(892-894)ctG>ctA	p.L298L	TNR_ENST00000263525.2_Silent_p.L298L			Q92752	TENR_HUMAN	tenascin R	298	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TGCAGGCATTCAGACACTGCC	0.627													ENSG00000116147																																					0													107.0	78.0	88.0					1																	175372358		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.894G>A	1.37:g.175372358C>T			C9J563|Q15568|Q5R3G0	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.L298	ENST00000367674.2	37	c.894	CCDS1318.1	1																																																																																			-	TNR	-	pfam_EGF_extracell,smart_EG-like_dom		0.627	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	0	0	0	58	58	35	0.00	0.00	C	NM_003285		175372358	-1	83	28	62	35	tier1	no_errors	ENST00000263525	ensembl	human	known	74_37	silent	57.24	44.44	SNP	1.000	T	83	62
CCDC141	285025	genome.wustl.edu	37	2	179733848	179733848	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:179733848T>C	ENST00000420890.2	-	15	2507	c.2390A>G	c.(2389-2391)gAa>gGa	p.E797G	CCDC141_ENST00000295723.5_Missense_Mutation_p.E222G	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	797										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CCTTACCTCTTCCTTGACTTG	0.353													ENSG00000163492																																					0													171.0	155.0	161.0					2																	179733848		2203	4300	6503	SO:0001583	missense	0			-	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2390A>G	2.37:g.179733848T>C	ENSP00000395995:p.Glu797Gly		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E797G	ENST00000420890.2	37	c.2390		2	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111778	0.77210	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.51817	0.69;1.3;1.29;1.31	5.49	5.49	0.81192	.	0.098719	0.44285	D	0.000463	T	0.53498	0.1800	L	0.29908	0.895	0.80722	D	1	D	0.63046	0.992	P	0.62560	0.904	T	0.55490	-0.8133	10	0.54805	T	0.06	-8.4263	13.3938	0.60838	0.0:0.0:0.0:1.0	.	222	Q6ZP82	CC141_HUMAN	G	797;241;222;797	ENSP00000395995:E797G;ENSP00000344627:E241G;ENSP00000295723:E222G;ENSP00000390190:E797G	ENSP00000295723:E222G	E	-	2	0	CCDC141	179442093	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.639000	0.61361	2.194000	0.70268	0.533000	0.62120	GAA	-	CCDC141	-	NULL		0.353	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		0	0	0	167	167	107	0.00	0.00	T	NM_173648		179733848	-1	41	10	195	82	tier1	no_errors	ENST00000420890	ensembl	human	known	74_37	missense	17.37	10.87	SNP	1.000	C	41	195
KIAA1217	56243	genome.wustl.edu	37	10	24834028	24834028	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:24834028G>A	ENST00000376454.3	+	20	5360	c.5330G>A	c.(5329-5331)cGt>cAt	p.R1777H	KIAA1217_ENST00000396446.1_Missense_Mutation_p.R861H|KIAA1217_ENST00000376451.2_Missense_Mutation_p.R1460H|KIAA1217_ENST00000396445.1_Missense_Mutation_p.R901H|KIAA1217_ENST00000307544.6_Missense_Mutation_p.R927H|KIAA1217_ENST00000458595.1_Missense_Mutation_p.R1183H|KIAA1217_ENST00000376462.1_Missense_Mutation_p.R1098H|KIAA1217_ENST00000376452.3_Missense_Mutation_p.R1208H	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1777					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CGCCAATATCGTCAGGTAGTT	0.473													ENSG00000120549																																					0													60.0	65.0	63.0					10																	24834028		2203	4300	6503	SO:0001583	missense	0			-	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5330G>A	10.37:g.24834028G>A	ENSP00000365637:p.Arg1777His		A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	pfam_AIP3_C	p.R1777H	ENST00000376454.3	37	c.5330	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040141	0.93630	.	.	ENSG00000120549	ENST00000376462;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T	0.64618	1.14;0.86;0.61;0.97;-0.11;-0.02;0.31;0.57	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.79885	0.4523	M	0.70275	2.135	0.39623	D	0.970059	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;P;D;D;D;D	0.91635	0.999;0.996;0.999;0.904;0.999;0.999;0.999;0.999	T	0.80311	-0.1436	10	0.54805	T	0.06	.	19.9915	0.97366	0.0:0.0:1.0:0.0	.	1183;1208;861;901;1460;927;1777;1178	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	H	1098;1183;1460;1777;1208;927;1366;901;1460;861	ENSP00000365645:R1098H;ENSP00000392625:R1183H;ENSP00000365637:R1777H;ENSP00000365635:R1208H;ENSP00000302343:R927H;ENSP00000379722:R901H;ENSP00000365634:R1460H;ENSP00000379723:R861H	ENSP00000302343:R927H	R	+	2	0	KIAA1217	24874034	1.000000	0.71417	0.990000	0.47175	0.968000	0.65278	9.443000	0.97568	2.723000	0.93209	0.655000	0.94253	CGT	-	KIAA1217	-	NULL		0.473	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	0	0	0	70	70	116	0.00	0.00	G	NM_019590		24834028	+1	11	17	57	79	tier1	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	16.18	17.71	SNP	1.000	A	11	57
ABCA3	21	genome.wustl.edu	37	16	2338234	2338234	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr16:2338234G>T	ENST00000301732.5	-	21	3497	c.2797C>A	c.(2797-2799)Cct>Act	p.P933T	ABCA3_ENST00000382381.3_Missense_Mutation_p.P875T	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	933					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CAGGTCAGAGGCACCAGGACC	0.627													ENSG00000167972																																					0													51.0	42.0	45.0					16																	2338234		2196	4298	6494	SO:0001583	missense	0			-	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2797C>A	16.37:g.2338234G>T	ENSP00000301732:p.Pro933Thr		B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P933T	ENST00000301732.5	37	c.2797	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	G	15.60	2.882623	0.51908	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.93426	-3.22	5.54	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.96488	0.8854	M	0.85710	2.77	0.80722	D	1	B;D	0.76494	0.417;0.999	P;D	0.76575	0.472;0.988	D	0.96176	0.9127	10	0.44086	T	0.13	.	12.9976	0.58657	0.0775:0.0:0.9225:0.0	.	937;933	Q4LE27;Q99758	.;ABCA3_HUMAN	T	933;937	ENSP00000301732:P933T	ENSP00000301732:P933T	P	-	1	0	ABCA3	2278235	1.000000	0.71417	0.245000	0.24217	0.277000	0.26821	9.331000	0.96430	1.570000	0.49709	0.655000	0.94253	CCT	-	ABCA3	-	NULL		0.627	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	0	0	0	96	96	46	0.00	0.00	G	NM_001089		2338234	-1	26	8	84	29	tier1	no_errors	ENST00000301732	ensembl	human	known	74_37	missense	23.64	21.62	SNP	1.000	T	26	84
ATXN7	6314	genome.wustl.edu	37	3	63981233	63981233	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:63981233C>T	ENST00000295900.6	+	12	2285	c.1735C>T	c.(1735-1737)Cac>Tac	p.H579Y	ATXN7_ENST00000398590.3_Missense_Mutation_p.H579Y|ATXN7_ENST00000538065.1_Missense_Mutation_p.H579Y|ATXN7_ENST00000484332.1_Missense_Mutation_p.H434Y|ATXN7_ENST00000487717.1_Missense_Mutation_p.H579Y	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	579					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		ACGTATTCCTCACCGGACAAA	0.517													ENSG00000163635																																					0													91.0	96.0	94.0					3																	63981233		2192	4296	6488	SO:0001583	missense	0			-	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.1735C>T	3.37:g.63981233C>T	ENSP00000295900:p.His579Tyr		B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	pfam_SCA7_dom	p.H579Y	ENST00000295900.6	37	c.1735	CCDS43102.1	3	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481920	0.63849	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.2	5.2	0.72013	.	0.050736	0.85682	D	0.000000	T	0.55049	0.1896	L	0.53249	1.67	0.80722	D	1	B;D;D	0.65815	0.31;0.995;0.976	B;P;P	0.55161	0.133;0.77;0.454	T	0.55891	-0.8069	10	0.51188	T	0.08	-4.1977	18.7972	0.91999	0.0:1.0:0.0:0.0	.	434;579;579	E9PHP9;O15265-2;O15265	.;.;ATX7_HUMAN	Y	579;579;579;579;434	ENSP00000381590:H579Y;ENSP00000295900:H579Y;ENSP00000420234:H579Y;ENSP00000439585:H579Y;ENSP00000428277:H434Y	ENSP00000295900:H579Y	H	+	1	0	ATXN7	63956273	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	7.192000	0.77771	2.442000	0.82660	0.558000	0.71614	CAC	-	ATXN7	-	NULL		0.517	ATXN7-001	KNOWN	basic|CCDS	protein_coding	ATXN7	HGNC	protein_coding	OTTHUMT00000352070.1	0	0	0	63	63	93	0.00	0.00	C	NM_000333		63981233	+1	36	34	50	85	tier1	no_errors	ENST00000398590	ensembl	human	known	74_37	missense	41.86	28.57	SNP	1.000	T	36	50
CAPS2	84698	genome.wustl.edu	37	12	75678836	75678836	+	Silent	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:75678836G>A	ENST00000409445.3	-	16	1673	c.1477C>T	c.(1477-1479)Ctg>Ttg	p.L493L	CAPS2_ENST00000442339.2_Silent_p.L83L|CAPS2_ENST00000393284.3_Silent_p.L261L|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000409799.1_Silent_p.L411L|RP11-560G2.1_ENST00000549953.1_RNA	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	493	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TTGTCATTCAGAATTAGCCAT	0.333													ENSG00000180881																																					0													132.0	120.0	124.0					12																	75678836		2202	4298	6500	SO:0001819	synonymous_variant	0			-	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1477C>T	12.37:g.75678836G>A			Q6PH84|Q8N242|Q8NAY5	Silent	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.L493	ENST00000409445.3	37	c.1477	CCDS9008.2	12																																																																																			-	CAPS2	-	smart_EF_hand_dom,pfscan_EF_hand_dom		0.333	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2	0	0	0	78	78	84	0.00	0.00	G			75678836	-1	481	392	1793	1781	tier1	no_errors	ENST00000409445	ensembl	human	known	74_37	silent	21.15	18.04	SNP	0.948	A	481	1793
ANKRD18A	253650	genome.wustl.edu	37	9	38595594	38595594	+	Silent	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr9:38595594A>C	ENST00000399703.5	-	9	2117	c.1743T>G	c.(1741-1743)ctT>ctG	p.L581L		NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	581										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						TTCCATTCTCAAGACAGTCTC	0.318													ENSG00000180071																																					0													38.0	30.0	33.0					9																	38595594		692	1590	2282	SO:0001819	synonymous_variant	0			-	AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.1743T>G	9.37:g.38595594A>C			A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Silent	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L581	ENST00000399703.5	37	c.1743	CCDS55311.1	9																																																																																			-	ANKRD18A	-	NULL		0.318	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD18A	HGNC	protein_coding	OTTHUMT00000052506.3	0	0	0	156	156	101	0.00	0.00	A			38595594	-1	29	10	145	63	tier1	no_errors	ENST00000399703	ensembl	human	known	74_37	silent	16.67	13.70	SNP	0.000	C	29	145
IL27RA	9466	genome.wustl.edu	37	19	14161662	14161662	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:14161662C>A	ENST00000263379.2	+	11	1620	c.1495C>A	c.(1495-1497)Cct>Act	p.P499T		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	499	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						TGGACAGGGCCCTCCTGGTCC	0.597													ENSG00000104998																									Colon(164;1849 1896 4443 37792 47834)												0													88.0	67.0	74.0					19																	14161662		2203	4300	6503	SO:0001583	missense	0			-	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1495C>A	19.37:g.14161662C>A	ENSP00000263379:p.Pro499Thr		A0N0L1|O60624	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P499T	ENST00000263379.2	37	c.1495	CCDS12303.1	19	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160515	0.38119	.	.	ENSG00000104998	ENST00000263379	T	0.57595	0.39	4.69	3.66	0.41972	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.39407	N	0.001368	T	0.48677	0.1513	L	0.32530	0.975	0.24148	N	0.995704	D	0.62365	0.991	P	0.58013	0.831	T	0.32481	-0.9905	10	0.12766	T	0.61	-18.475	7.814	0.29247	0.0:0.8869:0.0:0.1131	.	499	Q6UWB1	I27RA_HUMAN	T	499	ENSP00000263379:P499T	ENSP00000263379:P499T	P	+	1	0	IL27RA	14022662	0.044000	0.20184	0.991000	0.47740	0.052000	0.14988	2.146000	0.42216	2.151000	0.67156	0.461000	0.40582	CCT	-	IL27RA	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.597	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27RA	HGNC	protein_coding	OTTHUMT00000458539.1	0	0	0	95	95	58	0.00	0.00	C	NM_004843		14161662	+1	25	14	86	26	tier1	no_errors	ENST00000263379	ensembl	human	known	74_37	missense	22.52	35.00	SNP	0.417	A	25	86
ITPR2	3709	genome.wustl.edu	37	12	26985713	26985713	+	Start_Codon_SNP	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:26985713A>C	ENST00000381340.3	-	1	418	c.2T>G	c.(1-3)aTg>aGg	p.M1R	ITPR2_ENST00000242737.5_Start_Codon_SNP_p.M1R	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTTCTCAGTCATGCTGCTTCA	0.622													ENSG00000123104																																					0													96.0	108.0	104.0					12																	26985713		2189	4300	6489	SO:0001582	initiator_codon_variant	0			-	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2T>G	12.37:g.26985713A>C	ENSP00000370744:p.Met1Arg		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.M1R	ENST00000381340.3	37	c.2	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487359	0.84854	.	.	ENSG00000123104	ENST00000381340;ENST00000242737	D	0.92149	-2.98	3.97	3.97	0.46021	.	0.122605	0.64402	D	0.000001	D	0.95360	0.8494	.	.	.	0.31851	N	0.62229	D;P	0.76494	0.999;0.932	D;D	0.83275	0.996;0.917	D	0.95042	0.8179	9	0.87932	D	0	.	12.2742	0.54724	1.0:0.0:0.0:0.0	.	1;1	Q14571-2;Q14571	.;ITPR2_HUMAN	R	1	ENSP00000370744:M1R	ENSP00000242737:M1R	M	-	2	0	ITPR2	26876980	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.271000	0.72569	1.798000	0.52647	0.477000	0.44152	ATG	-	ITPR2	-	NULL		0.622	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	0	0	0	148	148	60	0.00	0.00	A	NM_002223	Missense_Mutation	26985713	-1	62	19	116	41	tier1	no_errors	ENST00000381340	ensembl	human	known	74_37	missense	34.83	31.67	SNP	1.000	C	62	116
LINC00208	83655	genome.wustl.edu	37	8	11438470	11438470	+	lincRNA	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:11438470C>A	ENST00000304233.3	+	0	1769					NR_040035.1		Q96KT6	CH014_HUMAN	long intergenic non-protein coding RNA 208																		CTGGCCTCACCAAGTGAGGTG	0.532													ENSG00000170983																																					0																																												0			-	AJ291678		8p23.1	2012-10-12	2011-08-11	2011-08-11	ENSG00000170983	ENSG00000170983		"""Long non-coding RNAs"""	15535	non-coding RNA	RNA, long non-coding			"""chromosome 8 open reading frame 14"", ""non-protein coding RNA 208"""	C8orf14, NCRNA00208			Standard	NR_040035		Approved		uc022arx.1	Q96KT6	OTTHUMG00000161738		8.37:g.11438470C>A				R	SNP	-	NULL	ENST00000304233.3	37	NULL		8																																																																																			-	LINC00208	-	-		0.532	LINC00208-001	KNOWN	basic	lincRNA	LINC00208	HGNC	lincRNA	OTTHUMT00000365946.2	0	0	0	84	84	105	0.00	0.00	C			11438470	+1	36	43	79	73	tier1	no_errors	ENST00000304233	ensembl	human	known	74_37	rna	31.30	36.75	SNP	0.000	A	36	79
DNAJB11	51726	genome.wustl.edu	37	3	186299271	186299271	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:186299271G>C	ENST00000439351.1	+	6	1497	c.568G>C	c.(568-570)Gag>Cag	p.E190Q	DNAJB11_ENST00000265028.3_Missense_Mutation_p.E190Q			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	190					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		AATGACCCAGGAGGTGGTCTG	0.507													ENSG00000090520																																					0													83.0	86.0	85.0					3																	186299271		2203	4300	6503	SO:0001583	missense	0			-	AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.568G>C	3.37:g.186299271G>C	ENSP00000414398:p.Glu190Gln		Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.E190Q	ENST00000439351.1	37	c.568	CCDS3277.1	3	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702322	0.48307	.	.	ENSG00000090520	ENST00000439351;ENST00000265028	T;T	0.68181	-0.31;-0.31	5.85	5.85	0.93711	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.44307	0.1287	N	0.02960	-0.455	0.80722	D	1	B	0.16396	0.017	B	0.21708	0.036	T	0.42137	-0.9469	10	0.14252	T	0.57	-27.0675	17.6588	0.88185	0.0:0.0:1.0:0.0	.	190	Q9UBS4	DJB11_HUMAN	Q	190	ENSP00000414398:E190Q;ENSP00000265028:E190Q	ENSP00000265028:E190Q	E	+	1	0	DNAJB11	187781965	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.753000	0.94483	0.655000	0.94253	GAG	-	DJB11	-	superfamily_HSP40/DnaJ_pept-bd		0.507	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DJB11	HGNC	protein_coding	OTTHUMT00000344779.1	0	0	0	58	58	113	0.00	0.00	G			186299271	+1	17	16	62	109	tier1	no_errors	ENST00000265028	ensembl	human	known	74_37	missense	21.52	12.60	SNP	1.000	C	17	62
DEFB134	613211	genome.wustl.edu	37	8	11853731	11853731	+	Silent	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:11853731A>G	ENST00000526438.1	-	1	90	c.30T>C	c.(28-30)ttT>ttC	p.F10F	DEFB134_ENST00000382205.4_Silent_p.F10F	NM_001033019.1	NP_001028191.1	Q4QY38	DB134_HUMAN	defensin, beta 134	10					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.159)		AAAGGAAAAGAAAGACAAACA	0.478													ENSG00000205882																																					0													142.0	142.0	142.0					8																	11853731		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY621331, DQ012024	CCDS34847.1	8p23.1	2010-04-15			ENSG00000205882	ENSG00000205882		"""Defensins, beta"""	32399	protein-coding gene	gene with protein product						16033865	Standard	NM_001033019		Approved		uc011kxn.2	Q4QY38	OTTHUMG00000158718	ENST00000526438.1:c.30T>C	8.37:g.11853731A>G			A1L4A4	Silent	SNP	NULL	p.F10	ENST00000526438.1	37	c.30	CCDS34847.1	8																																																																																			-	DEFB134	-	NULL		0.478	DEFB134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB134	HGNC	protein_coding	OTTHUMT00000351887.2	0	0	0	266	266	92	0.00	0.00	A	NM_001033019		11853731	-1	53	26	272	113	tier1	no_errors	ENST00000526438	ensembl	human	known	74_37	silent	16.31	18.71	SNP	0.026	G	53	272
KRT83	3889	genome.wustl.edu	37	12	52708514	52708514	+	Silent	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:52708514G>A	ENST00000293670.3	-	9	1445	c.1383C>T	c.(1381-1383)ccC>ccT	p.P461P	AC121757.1_ENST00000594763.1_5'Flank	NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	461	Tail.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCCGTTGCAGGGGGCACTGC	0.667													ENSG00000170523																									GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)												0													26.0	23.0	24.0					12																	52708514		2197	4298	6495	SO:0001819	synonymous_variant	0			-	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.1383C>T	12.37:g.52708514G>A			A1A4S9|B2RC21|Q6NT21|Q9NSB3	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.P461	ENST00000293670.3	37	c.1383	CCDS8823.1	12																																																																																			-	KRT83	-	NULL		0.667	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT83	HGNC	protein_coding	OTTHUMT00000405182.1	0	0	0	140	140	18	0.00	0.00	G	NM_002282		52708514	-1	29	2	98	14	tier1	no_errors	ENST00000293670	ensembl	human	known	74_37	silent	22.83	12.50	SNP	0.984	A	29	98
DPY19L2P2	349152	genome.wustl.edu	37	7	102898150	102898150	+	RNA	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:102898150G>A	ENST00000312132.4	-	0	2422							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ATGAATGTGCGATACCAGGAG	0.308													ENSG00000170629																																					0																																												0			-	AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102898150G>A			Q8N9V4|Q8ND62	R	SNP	-	NULL	ENST00000312132.4	37	NULL		7																																																																																			-	DPY19L2P2	-	-		0.308	DPY19L2P2-002	KNOWN	basic	processed_transcript	DPY19L2P2	HGNC	pseudogene	OTTHUMT00000347877.1	1	1	0	256	256	33	0.39	0.00	G	NM_182634		102898150	-1	108	55	165	25	tier1	no_errors	ENST00000312132	ensembl	human	known	74_37	rna	39.56	68.75	SNP	0.725	A	108	165
GBE1	2632	genome.wustl.edu	37	3	81548345	81548345	+	Silent	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:81548345T>C	ENST00000429644.2	-	15	2611	c.1968A>G	c.(1966-1968)gaA>gaG	p.E656E	GBE1_ENST00000489715.1_Silent_p.E615E	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	656					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		GCCCTCCATATTCCGCTGCAT	0.408									Glycogen Storage Disease, type IV				ENSG00000114480																																					0													99.0	94.0	96.0					3																	81548345		1889	4115	6004	SO:0001819	synonymous_variant	0	Familial Cancer Database	Andersen Disease, Brancher deficiency	-		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.1968A>G	3.37:g.81548345T>C			B3KWV3|Q96EN0	Silent	SNP	pfam_A-amylase_b_C,pfam_Glyco_hydro_13_cat_dom,pfam_Glyco_hydro_13_N,superfamily_Glycoside_hydrolase_SF,superfamily_Ig_E-set,smart_Glyco_hydro_13_sub_cat_dom	p.E656	ENST00000429644.2	37	c.1968	CCDS54612.1	3																																																																																			-	GBE1	-	pfam_A-amylase_b_C		0.408	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBE1	HGNC	protein_coding	OTTHUMT00000352760.2	0	0	0	140	140	92	0.00	0.00	T			81548345	-1	56	34	110	74	tier1	no_errors	ENST00000429644	ensembl	human	known	74_37	silent	33.53	31.48	SNP	0.449	C	56	110
RBM11	54033	genome.wustl.edu	37	21	15596712	15596712	+	Intron	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr21:15596712A>G	ENST00000400577.3	+	4	341				RBM11_ENST00000468643.1_Intron	NM_144770.3	NP_658983.3	P57052	RBM11_HUMAN	RNA binding motif protein 11						cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(U) RNA binding (GO:0008266)|protein homodimerization activity (GO:0042803)			endometrium(3)|kidney(3)|lung(7)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		TGACATTTGTAATAGGAATTT	0.358													ENSG00000185272																																					0													69.0	61.0	63.0					21																	15596712		692	1586	2278	SO:0001627	intron_variant	0			-	AF130358	CCDS46635.1	21q11	2013-02-12			ENSG00000185272	ENSG00000185272		"""RNA binding motif (RRM) containing"""	9897	protein-coding gene	gene with protein product						12036298	Standard	NM_144770		Approved		uc002yjo.4	P57052	OTTHUMG00000074263	ENST00000400577.3:c.333-47A>G	21.37:g.15596712A>G			Q6YNC2|Q8NBA1|Q8NFF6	R	SNP	-	NULL	ENST00000400577.3	37	NULL	CCDS46635.1	21																																																																																			-	RBM11	-	-		0.358	RBM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM11	HGNC	protein_coding	OTTHUMT00000157818.1	0	0	0	68	68	74	0.00	0.00	A	NM_144770		15596712	+1	10	15	60	91	tier1	no_errors	ENST00000475864	ensembl	human	putative	74_37	rna	14.29	14.02	SNP	0.000	G	10	60
HDGFRP3	50810	genome.wustl.edu	37	15	83826716	83826716	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr15:83826716C>T	ENST00000299633.4	-	3	842	c.239G>A	c.(238-240)gGa>gAa	p.G80E		NM_016073.3	NP_057157.1	Q9Y3E1	HDGR3_HUMAN		80					cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						TTCGTTAAATCCTTTCCGTTT	0.368													ENSG00000166503																																					0													155.0	138.0	144.0					15																	83826716		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000299633.4:c.239G>A	15.37:g.83826716C>T	ENSP00000299633:p.Gly80Glu			Missense_Mutation	SNP	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	p.G80E	ENST00000299633.4	37	c.239	CCDS32314.1	15	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951441	0.92660	.	.	ENSG00000166503	ENST00000299633	T	0.70164	-0.46	5.28	5.28	0.74379	PWWP (1);	0.000000	0.85682	D	0.000000	D	0.85544	0.5721	M	0.89904	3.07	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86817	0.2002	10	0.48119	T	0.1	.	19.2734	0.94019	0.0:1.0:0.0:0.0	.	80	Q9Y3E1	HDGR3_HUMAN	E	80	ENSP00000299633:G80E	ENSP00000299633:G80E	G	-	2	0	AC024270.1	81617720	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.702000	0.84576	2.629000	0.89072	0.563000	0.77884	GGA	-	HDGFRP3	-	pfam_PWWP_dom		0.368	HDGFRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGFRP3	Uniprot_gn	protein_coding	OTTHUMT00000419898.1	0	0	0	250	250	195	0.00	0.00	C			83826716	-1	109	51	155	61	tier1	no_errors	ENST00000299633	ensembl	human	known	74_37	missense	41.29	45.13	SNP	1.000	T	109	155
ALK	238	genome.wustl.edu	37	2	29456563	29456563	+	Splice_Site	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:29456563C>G	ENST00000389048.3	-	14	3262		c.e14-1		ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase						activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	ACTGGTTTGTCTGTAGAAACA	0.448			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome				ENSG00000171094																											yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													128.0	126.0	127.0					2																	29456563		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	-	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2356-1G>C	2.37:g.29456563C>G			Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Splice_Site	SNP	-	e14-1	ENST00000389048.3	37	c.2356-1	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380951	0.82792	.	.	ENSG00000171094	ENST00000389048	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5908	0.91212	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALK	29310067	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.229000	0.65316	2.395000	0.81488	0.561000	0.74099	.	-	ALK	-	-		0.448	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	0	0	0	127	127	56	0.00	0.00	C	NM_004304	Intron	29456563	-1	49	21	106	48	tier1	no_errors	ENST00000389048	ensembl	human	known	74_37	splice_site	31.61	30.43	SNP	1.000	G	49	106
WNK4	65266	genome.wustl.edu	37	17	40934869	40934869	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:40934869G>A	ENST00000246914.5	+	2	733	c.712G>A	c.(712-714)Gat>Aat	p.D238N		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CCGCTTCTATGATTCGTGGAA	0.597													ENSG00000126562																									Esophageal Squamous(6;201 374 4964 23855 42828)												0													104.0	91.0	95.0					17																	40934869		2203	4300	6503	SO:0001583	missense	0			-	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.712G>A	17.37:g.40934869G>A	ENSP00000246914:p.Asp238Asn		B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D238N	ENST00000246914.5	37	c.712	CCDS11439.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.394699	0.96009	.	.	ENSG00000126562	ENST00000246914	T	0.27720	1.65	3.97	3.97	0.46021	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.166856	0.28914	N	0.013727	T	0.52677	0.1749	M	0.66297	2.02	0.46376	D	0.999016	D	0.54047	0.964	D	0.65684	0.937	T	0.59177	-0.7503	10	0.72032	D	0.01	-9.3159	16.2013	0.82084	0.0:0.0:1.0:0.0	.	238	Q96J92	WNK4_HUMAN	N	238	ENSP00000246914:D238N	ENSP00000246914:D238N	D	+	1	0	WNK4	38188395	1.000000	0.71417	0.980000	0.43619	0.956000	0.61745	9.616000	0.98359	2.045000	0.60652	0.462000	0.41574	GAT	-	WNK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.597	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	HGNC	protein_coding	OTTHUMT00000452389.1	0	0	0	92	92	51	0.00	0.00	G			40934869	+1	45	38	102	67	tier1	no_errors	ENST00000246914	ensembl	human	known	74_37	missense	30.61	36.19	SNP	1.000	A	45	102
KLHL32	114792	genome.wustl.edu	37	6	97561755	97561755	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr6:97561755C>A	ENST00000369261.4	+	7	1087	c.724C>A	c.(724-726)Cat>Aat	p.H242N	KLHL32_ENST00000536676.1_Missense_Mutation_p.H206N|KLHL32_ENST00000544166.1_Intron|KLHL32_ENST00000539200.1_Missense_Mutation_p.H173N	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	242								p.H242N(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GGATACTCTCCATACAGTTGC	0.537													ENSG00000186231																																					1	Substitution - Missense(1)	lung(1)											163.0	134.0	144.0					6																	97561755		2203	4300	6503	SO:0001583	missense	0			-	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.724C>A	6.37:g.97561755C>A	ENSP00000358265:p.His242Asn		B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.H242N	ENST00000369261.4	37	c.724	CCDS5038.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.53|13.53	2.264738|2.264738	0.40095|0.40095	.|.	.|.	ENSG00000186231|ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200|ENST00000369255;ENST00000447886	T;T;T|T	0.68025|0.34072	-0.3;-0.3;-0.3|1.38	5.09|5.09	5.09|5.09	0.68999|0.68999	BTB/Kelch-associated (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.32645|0.32645	0.0836|0.0836	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;D;B;P|.	0.53619|.	0.959;0.961;0.006;0.943|.	B;P;B;P|.	0.49192|.	0.37;0.484;0.006;0.602|.	T|T	0.09729|0.09729	-1.0661|-1.0661	10|7	0.72032|0.54805	D|T	0.01|0.06	.|.	18.6745|18.6745	0.91524|0.91524	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	173;206;242;242|.	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08|.	.;.;KLH32_HUMAN;.|.	N|Q	242;206;173|194;164	ENSP00000358265:H242N;ENSP00000440382:H206N;ENSP00000441527:H173N|ENSP00000389310:P164Q	ENSP00000358265:H242N|ENSP00000358259:P194Q	H|P	+|+	1|2	0|0	KLHL32|KLHL32	97668476|97668476	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.896000|0.896000	0.52359|0.52359	6.892000|6.892000	0.75644|0.75644	2.632000|2.632000	0.89209|0.89209	0.655000|0.655000	0.94253|0.94253	CAT|CCA	-	KLHL32	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin		0.537	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	HGNC	protein_coding	OTTHUMT00000041570.1	0	0	0	97	97	118	0.00	0.00	C	NM_052904		97561755	+1	48	45	87	85	tier1	no_errors	ENST00000369261	ensembl	human	known	74_37	missense	35.56	34.62	SNP	1.000	A	48	87
SPATA17	128153	genome.wustl.edu	37	1	217955579	217955579	+	Missense_Mutation	SNP	C	C	T	rs200145412		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:217955579C>T	ENST00000366933.4	+	8	842	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W	RP11-415L24.1_ENST00000415765.1_RNA	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	263						cytoplasm (GO:0005737)		p.R263W(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		GCCAACGTTGCGGGTGGCAGA	0.453													ENSG00000162814																																					1	Substitution - Missense(1)	large_intestine(1)											92.0	95.0	94.0					1																	217955579		2203	4300	6503	SO:0001583	missense	0			-	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.787C>T	1.37:g.217955579C>T	ENSP00000355900:p.Arg263Trp		A5D6N2	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R263W	ENST00000366933.4	37	c.787	CCDS1519.1	1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475316	0.63737	.	.	ENSG00000162814	ENST00000366933	T	0.61510	0.1	4.73	-2.29	0.06805	.	0.224021	0.37530	N	0.002041	T	0.69548	0.3123	M	0.81942	2.565	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.63233	-0.6683	10	0.62326	D	0.03	-20.1943	7.058	0.25109	0.1875:0.5633:0.0:0.2492	.	263	Q96L03	SPT17_HUMAN	W	263	ENSP00000355900:R263W	ENSP00000355900:R263W	R	+	1	2	SPATA17	216022202	1.000000	0.71417	0.000000	0.03702	0.531000	0.34715	0.845000	0.27668	-1.105000	0.03011	-1.969000	0.00466	CGG	rs200145412	SPATA17	-	NULL		0.453	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	HGNC	protein_coding	OTTHUMT00000092433.2	1	1	0	100	100	87	0.99	0.00	C	NM_138796		217955579	+1	18	17	59	56	tier1	no_errors	ENST00000366933	ensembl	human	known	74_37	missense	23.38	23.29	SNP	0.068	T	18	59
RAPGEF4	11069	genome.wustl.edu	37	2	173608905	173608905	+	Intron	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:173608905G>T	ENST00000397081.3	+	1	208				RAPGEF4_ENST00000264111.6_Intron|RAPGEF4_ENST00000409036.1_Intron	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GTCACTAATTGTCTTGACTTT	0.368													ENSG00000091428																																					0																																										SO:0001627	intron_variant	0			-	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.65+8129G>T	2.37:g.173608905G>T			B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	R	SNP	-	NULL	ENST00000397081.3	37	NULL	CCDS42775.1	2																																																																																			-	RAPGEF4	-	-		0.368	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	0	0	0	34	34	125	0.00	0.00	G	NM_007023		173608905	+1	33	68	26	82	tier1	no_errors	ENST00000464976	ensembl	human	known	74_37	rna	55.93	45.03	SNP	0.003	T	33	26
ZMAT4	79698	genome.wustl.edu	37	8	40532319	40532319	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:40532319G>T	ENST00000297737.6	-	5	627	c.481C>A	c.(481-483)Cag>Aag	p.Q161K	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	161						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			TAATGTTGCTGGGCCATCAGA	0.483													ENSG00000165061																																					0													199.0	192.0	195.0					8																	40532319		2203	4300	6503	SO:0001583	missense	0			-	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.481C>A	8.37:g.40532319G>T	ENSP00000297737:p.Gln161Lys		Q8WUT8	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.Q161K	ENST00000297737.6	37	c.481	CCDS34885.1	8	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541691	0.85917	.	.	ENSG00000165061	ENST00000297737;ENST00000519406	T;T	0.42513	0.97;0.97	5.94	5.94	0.96194	Zinc finger, C2H2-like (1);Zinc finger, double-stranded RNA binding (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.119769	0.64402	D	0.000007	T	0.48277	0.1491	L	0.59436	1.845	0.54753	D	0.999986	P	0.46859	0.885	P	0.45538	0.484	T	0.35375	-0.9791	10	0.36615	T	0.2	-27.6248	18.9244	0.92538	0.0:0.0:1.0:0.0	.	161	Q9H898	ZMAT4_HUMAN	K	161	ENSP00000297737:Q161K;ENSP00000428423:Q161K	ENSP00000297737:Q161K	Q	-	1	0	ZMAT4	40651476	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.366000	0.97143	2.817000	0.96982	0.557000	0.71058	CAG	-	ZMAT4	-	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like		0.483	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT4	HGNC	protein_coding	OTTHUMT00000376950.1	0	0	0	173	173	45	0.00	0.00	G	NM_024645		40532319	-1	38	8	172	51	tier1	no_errors	ENST00000297737	ensembl	human	known	74_37	missense	18.10	13.56	SNP	1.000	T	38	172
TNR	7143	genome.wustl.edu	37	1	175372327	175372327	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:175372327C>T	ENST00000367674.2	-	4	1633	c.925G>A	c.(925-927)Gag>Aag	p.E309K	TNR_ENST00000263525.2_Missense_Mutation_p.E309K			Q92752	TENR_HUMAN	tenascin R	309	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.E309K(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CAGAGCCCCTCCTCACATTGT	0.607													ENSG00000116147																																					1	Substitution - Missense(1)	lung(1)											97.0	78.0	84.0					1																	175372327		2203	4300	6503	SO:0001583	missense	0			-	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.925G>A	1.37:g.175372327C>T	ENSP00000356646:p.Glu309Lys		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.E309K	ENST00000367674.2	37	c.925	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781250	0.70222	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.03441	3.93;3.93	6.04	6.04	0.98038	EGF, extracellular (1);	0.059909	0.64402	D	0.000003	T	0.04227	0.0117	N	0.26042	0.785	0.42105	D	0.991354	P;P	0.37594	0.501;0.601	B;B	0.34038	0.081;0.174	T	0.57774	-0.7753	10	0.28530	T	0.3	.	20.1743	0.98175	0.0:1.0:0.0:0.0	.	309;309	B4DIX8;Q92752	.;TENR_HUMAN	K	309	ENSP00000356646:E309K;ENSP00000263525:E309K	ENSP00000263525:E309K	E	-	1	0	TNR	173638950	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	3.239000	0.51360	2.873000	0.98535	0.561000	0.74099	GAG	-	TNR	-	pfam_EGF_extracell,smart_EG-like_dom		0.607	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	0	0	0	43	43	32	0.00	0.00	C	NM_003285		175372327	-1	61	22	42	29	tier1	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	59.22	43.14	SNP	1.000	T	61	42
TNR	7143	genome.wustl.edu	37	1	175372402	175372402	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:175372402C>T	ENST00000367674.2	-	4	1558	c.850G>A	c.(850-852)Gag>Aag	p.E284K	TNR_ENST00000263525.2_Missense_Mutation_p.E284K			Q92752	TENR_HUMAN	tenascin R	284	Cys-rich.|EGF-like 4.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TAGCCCTCCTCGCATAAACAG	0.612													ENSG00000116147																																					0													134.0	88.0	103.0					1																	175372402		2203	4300	6503	SO:0001583	missense	0			-	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.850G>A	1.37:g.175372402C>T	ENSP00000356646:p.Glu284Lys		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.E284K	ENST00000367674.2	37	c.850	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502289	0.26949	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.04454	3.62;3.62	6.04	5.13	0.70059	EGF-like region, conserved site (2);	0.360210	0.29602	N	0.011688	T	0.05593	0.0147	L	0.33137	0.985	0.23988	N	0.996254	B;B	0.14805	0.011;0.0	B;B	0.04013	0.001;0.001	T	0.30880	-0.9963	10	0.28530	T	0.3	.	16.1971	0.82040	0.0:0.2611:0.7389:0.0	.	284;284	B4DIX8;Q92752	.;TENR_HUMAN	K	284	ENSP00000356646:E284K;ENSP00000263525:E284K	ENSP00000263525:E284K	E	-	1	0	TNR	173639025	0.997000	0.39634	1.000000	0.80357	0.224000	0.24922	1.520000	0.35899	1.564000	0.49628	-0.311000	0.09066	GAG	-	TNR	-	pfam_EGF_extracell,smart_EG-like_dom		0.612	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	0	0	0	68	68	32	0.00	0.00	C	NM_003285		175372402	-1	92	23	83	34	tier1	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	52.57	40.35	SNP	1.000	T	92	83
GRIA1	2890	genome.wustl.edu	37	5	153078447	153078447	+	Silent	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr5:153078447C>G	ENST00000285900.5	+	10	1609	c.1266C>G	c.(1264-1266)ctC>ctG	p.L422L	GRIA1_ENST00000340592.5_Silent_p.L422L|GRIA1_ENST00000521843.2_Silent_p.L353L|GRIA1_ENST00000518783.1_Silent_p.L432L|GRIA1_ENST00000448073.4_Silent_p.L432L|GRIA1_ENST00000518142.1_Silent_p.L342L	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	422					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	ATGTGATGCTCAAGAAGAACG	0.507													ENSG00000155511																																					0													124.0	106.0	112.0					5																	153078447		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1266C>G	5.37:g.153078447C>G			B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L432	ENST00000285900.5	37	c.1296	CCDS4322.1	5																																																																																			-	GRIA1	-	pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd		0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	0	0	0	90	90	93	0.00	0.00	C			153078447	+1	23	11	103	66	tier1	no_errors	ENST00000448073	ensembl	human	known	74_37	silent	18.25	14.29	SNP	1.000	G	23	103
OR1C1	26188	genome.wustl.edu	37	1	247921188	247921188	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:247921188A>G	ENST00000408896.2	-	1	794	c.521T>C	c.(520-522)aTc>aCc	p.I174T		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	174					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GAAATGATGGATGATATTGGA	0.478													ENSG00000221888																																					0													67.0	67.0	67.0					1																	247921188		2115	4243	6358	SO:0001583	missense	0			-	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.521T>C	1.37:g.247921188A>G	ENSP00000386138:p.Ile174Thr		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I174T	ENST00000408896.2	37	c.521	CCDS41481.1	1	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555262	0.65425	.	.	ENSG00000221888	ENST00000408896	T	0.00211	8.54	3.19	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00967	0.0032	H	0.97896	4.1	0.22240	N	0.99927	D	0.76494	0.999	D	0.77557	0.99	T	0.18085	-1.0348	9	0.87932	D	0	.	11.5853	0.50914	1.0:0.0:0.0:0.0	.	174	Q15619	OR1C1_HUMAN	T	174	ENSP00000386138:I174T	ENSP00000386138:I174T	I	-	2	0	OR1C1	245987811	0.173000	0.23056	0.978000	0.43139	0.973000	0.67179	4.748000	0.62148	1.459000	0.47892	0.473000	0.43528	ATC	-	OR1C1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1C1	HGNC	protein_coding	OTTHUMT00000096855.1	0	0	0	48	48	62	0.00	0.00	A			247921188	-1	14	8	63	34	tier1	no_errors	ENST00000408896	ensembl	human	known	74_37	missense	18.18	19.05	SNP	0.749	G	14	63
MON2	23041	genome.wustl.edu	37	12	62931931	62931931	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:62931931G>T	ENST00000393632.2	+	17	2565	c.2174G>T	c.(2173-2175)gGg>gTg	p.G725V	MON2_ENST00000552738.1_Missense_Mutation_p.G702V|MON2_ENST00000393630.3_Missense_Mutation_p.G725V|MON2_ENST00000546600.1_Missense_Mutation_p.G725V|MON2_ENST00000393629.2_Missense_Mutation_p.G725V|MON2_ENST00000552115.1_Missense_Mutation_p.G725V|MON2_ENST00000280379.6_Missense_Mutation_p.G725V	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	725					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTGAAACCTGGGAGAGCTGTA	0.358													ENSG00000061987																																					0													52.0	63.0	59.0					12																	62931931		2203	4300	6503	SO:0001583	missense	0			-		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2174G>T	12.37:g.62931931G>T	ENSP00000377252:p.Gly725Val		A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold	p.G725V	ENST00000393632.2	37	c.2174	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861111	0.71949	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.38;0.36;0.4	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	L	0.58101	1.795	0.80722	D	1	P;P;B;P	0.50528	0.604;0.724;0.39;0.936	B;B;B;P	0.48921	0.205;0.284;0.439;0.595	T	0.58335	-0.7654	9	.	.	.	-11.5637	19.4611	0.94918	0.0:0.0:1.0:0.0	.	725;702;725;725	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	V	725;725;725;725;653;702;725;725	ENSP00000377252:G725V;ENSP00000377250:G725V;ENSP00000280379:G725V;ENSP00000447407:G725V;ENSP00000449215:G702V;ENSP00000377249:G725V;ENSP00000446635:G725V	.	G	+	2	0	MON2	61218198	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.718000	0.84743	2.657000	0.90304	0.655000	0.94253	GGG	-	MON2	-	NULL		0.358	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	0	0	0	162	162	118	0.00	0.00	G	NM_015026		62931931	+1	116	98	737	511	tier1	no_errors	ENST00000393630	ensembl	human	known	74_37	missense	13.60	16.09	SNP	1.000	T	116	737
CFAP54	144535	genome.wustl.edu	37	12	97043825	97043825	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:97043825T>G	ENST00000524981.4	+	35	4870	c.4847T>G	c.(4846-4848)aTc>aGc	p.I1616S				Q96N23	CL055_HUMAN		0																	TTTATGAAAATCTTTTTATAC	0.368													ENSG00000188596																																					0													111.0	116.0	114.0					12																	97043825		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000524981.4:c.4847T>G	12.37:g.97043825T>G	ENSP00000431759:p.Ile1616Ser			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.I1616S	ENST00000524981.4	37	c.4847		12	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915735	0.33815	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.75	3.09	0.35607	.	0.194613	0.35646	N	0.003080	T	0.38746	0.1052	L	0.55481	1.735	0.30000	N	0.816127	P	0.49358	0.923	B	0.43916	0.436	T	0.42799	-0.9430	9	0.56958	D	0.05	-5.1623	8.9103	0.35548	0.0:0.1726:0.0:0.8274	.	41	Q6ZTY8	CL063_HUMAN	S	1616;41	.	ENSP00000345466:I41S	I	+	2	0	C12orf63	95567956	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	1.441000	0.35035	1.019000	0.39547	0.533000	0.62120	ATC	-	C12orf55	-	NULL		0.368	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	0	0	0	136	136	107	0.00	0.00	T			97043825	+1	33	15	181	90	tier1	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	15.42	14.29	SNP	0.972	G	33	181
FAM71A	149647	genome.wustl.edu	37	1	212798632	212798632	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:212798632A>T	ENST00000294829.3	+	1	844	c.413A>T	c.(412-414)cAg>cTg	p.Q138L	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	138						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GAGAAACAACAGCTGCGCCTG	0.483													ENSG00000162771																																					0													98.0	103.0	101.0					1																	212798632		2203	4300	6503	SO:0001583	missense	0			-		CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.413A>T	1.37:g.212798632A>T	ENSP00000294829:p.Gln138Leu		Q5VTZ1	Missense_Mutation	SNP	pfam_DUF3699	p.Q138L	ENST00000294829.3	37	c.413	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.623629	0.66901	.	.	ENSG00000162771	ENST00000294829	T	0.17691	2.26	4.29	4.29	0.51040	.	0.000000	0.49916	D	0.000136	T	0.43188	0.1236	M	0.85299	2.745	0.38450	D	0.946945	D	0.76494	0.999	D	0.91635	0.999	T	0.51888	-0.8648	10	0.72032	D	0.01	-22.3147	10.0499	0.42210	1.0:0.0:0.0:0.0	.	138	Q8IYT1	FA71A_HUMAN	L	138	ENSP00000294829:Q138L	ENSP00000294829:Q138L	Q	+	2	0	FAM71A	210865255	0.992000	0.36948	1.000000	0.80357	0.694000	0.40290	2.083000	0.41615	1.949000	0.56562	0.455000	0.32223	CAG	-	FAM71A	-	pfam_DUF3699		0.483	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	0	0	0	69	69	63	0.00	0.00	A	NM_153606		212798632	+1	31	12	39	19	tier1	no_errors	ENST00000294829	ensembl	human	known	74_37	missense	44.29	38.71	SNP	1.000	T	31	39
KIAA1210	57481	genome.wustl.edu	37	X	118221164	118221164	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:118221164C>T	ENST00000402510.2	-	11	4028	c.4029G>A	c.(4027-4029)caG>caA	p.Q1343Q		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1343										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						ACATCTGTGGCTGGAATTTAG	0.483													ENSG00000250423																																					0													211.0	199.0	203.0					X																	118221164		1931	4138	6069	SO:0001819	synonymous_variant	0			-	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4029G>A	X.37:g.118221164C>T			B7ZCI8|Q5JPN4	Silent	SNP	NULL	p.Q1343	ENST00000402510.2	37	c.4029	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	C	1.808	-0.475486	0.04414	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.38	1.65	0.23941	.	.	.	.	.	T	0.31295	0.0792	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23368	-1.0190	4	.	.	.	.	5.9841	0.19423	0.0:0.6576:0.0:0.3424	.	.	.	.	T	750	.	.	A	-	1	0	KIAA1210	118105192	0.021000	0.18746	0.000000	0.03702	0.010000	0.07245	0.453000	0.21811	0.210000	0.20664	0.513000	0.50165	GCC	-	KIAA1210	-	NULL		0.483	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	0	0	0	122	122	136	0.00	0.00	C	NM_020721		118221164	-1	25	42	98	69	tier1	no_errors	ENST00000402510	ensembl	human	known	74_37	silent	20.33	37.84	SNP	0.000	T	25	98
NR1H4	9971	genome.wustl.edu	37	12	100926316	100926316	+	Nonsense_Mutation	SNP	C	C	T	rs113090017		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:100926316C>T	ENST00000551379.1	+	3	584	c.556C>T	c.(556-558)Cga>Tga	p.R186*	NR1H4_ENST00000188403.7_Nonsense_Mutation_p.R186*|NR1H4_ENST00000549996.1_Intron|NR1H4_ENST00000548884.1_Nonsense_Mutation_p.R176*|NR1H4_ENST00000392986.3_Nonsense_Mutation_p.R176*			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	186					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	TATGTACATGCGAAGAAAGTG	0.408													ENSG00000012504																																					0													213.0	189.0	197.0					12																	100926316		2203	4300	6503	SO:0001587	stop_gained	0			-	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.556C>T	12.37:g.100926316C>T	ENSP00000447149:p.Arg186*		A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.R186*	ENST00000551379.1	37	c.556	CCDS55876.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.639807	0.97726	.	.	ENSG00000012504	ENST00000548884;ENST00000392986;ENST00000551379;ENST00000188403	.	.	.	5.67	-0.234	0.13074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6076	0.88042	0.6927:0.3073:0.0:0.0	.	.	.	.	X	176;176;186;186	.	ENSP00000188403:R186X	R	+	1	2	NR1H4	99450447	0.997000	0.39634	0.575000	0.28536	0.909000	0.53808	0.545000	0.23268	-0.168000	0.10853	-1.367000	0.01198	CGA	-	NR1H4	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt		0.408	NR1H4-006	KNOWN	basic|CCDS	protein_coding	NR1H4	HGNC	protein_coding	OTTHUMT00000409140.1	0	0	0	159	159	117	0.00	0.00	C	NM_005123		100926316	+1	695	406	149	68	tier1	no_errors	ENST00000551379	ensembl	human	known	74_37	nonsense	82.15	85.65	SNP	0.997	T	695	149
MEGF6	1953	genome.wustl.edu	37	1	3418451	3418451	+	Silent	SNP	C	C	A	rs200439973	byFrequency	TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:3418451C>A	ENST00000356575.4	-	18	2449	c.2223G>T	c.(2221-2223)tcG>tcT	p.S741S	MEGF6_ENST00000294599.4_Silent_p.S636S	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	741	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		AGCAGGAGCTCGAGCAGTTCA	0.682													ENSG00000162591																									Ovarian(73;978 3658)												0													23.0	32.0	29.0					1																	3418451		2000	4141	6141	SO:0001819	synonymous_variant	0			-	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.2223G>T	1.37:g.3418451C>A			Q4AC86|Q5VV39	Silent	SNP	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.S741	ENST00000356575.4	37	c.2223	CCDS41237.1	1																																																																																			-	MEGF6	-	smart_EG-like_dom		0.682	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	HGNC	protein_coding	OTTHUMT00000354866.1	0	0	0	77	77	19	0.00	0.00	C	NM_001409		3418451	-1	26	8	48	14	tier1	no_errors	ENST00000356575	ensembl	human	known	74_37	silent	35.14	36.36	SNP	0.000	A	26	48
RABGAP1L	9910	genome.wustl.edu	37	1	174769479	174769479	+	Silent	SNP	A	A	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:174769479A>G	ENST00000489615.1	+	1	410	c.9A>G	c.(7-9)gaA>gaG	p.E3E	RABGAP1L_ENST00000367686.3_Intron|RABGAP1L_ENST00000367687.1_Intron|RABGAP1L_ENST00000347255.2_Intron|RABGAP1L_ENST00000251507.4_Intron|RABGAP1L_ENST00000325589.5_Intron	NM_001243765.1	NP_001230694.1	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						TCATGGAAGAAGGGGTGCCCT	0.522													ENSG00000152061																																					0																																										SO:0001819	synonymous_variant	0			-	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000489615.1:c.9A>G	1.37:g.174769479A>G			B7ZAA4	Silent	SNP	superfamily_Rab-GTPase-TBC_dom	p.E3	ENST00000489615.1	37	c.9	CCDS58046.1	1																																																																																			-	RABGAP1L	-	NULL		0.522	RABGAP1L-006	KNOWN	basic|CCDS	protein_coding	RABGAP1L	HGNC	protein_coding	OTTHUMT00000084502.3	0	0	0	108	108	53	0.00	0.00	A	NM_001243765		174769479	+1	88	15	94	68	tier1	no_errors	ENST00000489615	ensembl	human	known	74_37	silent	48.35	18.07	SNP	1.000	G	88	94
GOLGA2P5	55592	genome.wustl.edu	37	12	100560181	100560181	+	RNA	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:100560181G>A	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GCACGTGGCTGATGGTGGTGC	0.582													ENSG00000238105																																					0																																												0			-																													12.37:g.100560181G>A			Q9NSV2	R	SNP	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			-	GOLGA2B	-	-		0.582	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	Clone_based_vega_gene	pseudogene	OTTHUMT00000396439.2	0	0	0	278	278	72	0.00	0.00	G			100560181	-1	999	224	1383	306	tier1	no_errors	ENST00000421840	ensembl	human	known	74_37	rna	41.92	42.18	SNP	1.000	A	999	1383
RNASE10	338879	genome.wustl.edu	37	14	20979050	20979050	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:20979050C>A	ENST00000328444.5	+	1	439	c.420C>A	c.(418-420)ttC>ttA	p.F140L	RNASE10_ENST00000430083.1_Missense_Mutation_p.F168L	NM_001012975.1	NP_001012993.1	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	140					epithelial cell morphogenesis (GO:0003382)|heterotypic cell-cell adhesion (GO:0034113)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of sperm motility (GO:1902093)|regulation of fertilization (GO:0080154)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	12	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		AGTATGCATTCATCCATGAGG	0.458													ENSG00000182545																																					0													136.0	98.0	111.0					14																	20979050		2203	4300	6503	SO:0001583	missense	0			-		CCDS32035.1	14q11.1	2004-11-16				ENSG00000182545		"""Ribonucleases, RNase A"""	19275	protein-coding gene	gene with protein product						12920233	Standard	XM_005267584		Approved	RNASE9	uc010tlj.2	Q5GAN6		ENST00000328444.5:c.420C>A	14.37:g.20979050C>A	ENSP00000333358:p.Phe140Leu		A2RUQ3|B4DKY4	Missense_Mutation	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.F140L	ENST00000328444.5	37	c.420	CCDS32035.1	14	.	.	.	.	.	.	.	.	.	.	C	13.29	2.191938	0.38707	.	.	ENSG00000182545	ENST00000430083;ENST00000328444	T;T	0.38240	1.15;1.15	4.82	1.71	0.24356	Ribonuclease A, domain (3);	0.000000	0.85682	D	0.000000	T	0.58293	0.2112	M	0.87547	2.89	0.33160	D	0.54679	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.66913	-0.5803	10	0.87932	D	0	-9.3092	6.523	0.22285	0.0:0.6737:0.0:0.3263	.	140;168	Q5GAN6;B4DKY4	RNS10_HUMAN;.	L	168;140	ENSP00000392996:F168L;ENSP00000333358:F140L	ENSP00000333358:F140L	F	+	3	2	RNASE10	20048890	1.000000	0.71417	0.993000	0.49108	0.038000	0.13279	0.734000	0.26101	0.632000	0.30432	0.655000	0.94253	TTC	-	RSE10	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA		0.458	RNASE10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSE10	HGNC	protein_coding	OTTHUMT00000411088.1	0	0	0	36	36	62	0.00	0.00	C	XM_292225		20979050	+1	17	22	39	53	tier1	no_errors	ENST00000328444	ensembl	human	known	74_37	missense	30.36	29.33	SNP	0.995	A	17	39
GPR156	165829	genome.wustl.edu	37	3	119900165	119900165	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:119900165C>A	ENST00000464295.1	-	8	1185	c.740G>T	c.(739-741)gGc>gTc	p.G247V	GPR156_ENST00000315843.3_Missense_Mutation_p.G247V|GPR156_ENST00000461057.1_Missense_Mutation_p.G243V			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		GCTGACATGGCCAGTCAGGCC	0.562													ENSG00000175697																																					0													69.0	65.0	66.0					3																	119900165		2203	4300	6503	SO:0001583	missense	0			-	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.740G>T	3.37:g.119900165C>A	ENSP00000417261:p.Gly247Val		B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B	p.G247V	ENST00000464295.1	37	c.740	CCDS2997.1	3	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806265	0.50421	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	D;D;D	0.87571	-2.27;-2.27;-2.27	6.08	3.62	0.41486	GPCR, family 3, C-terminal (2);	0.306556	0.31685	N	0.007240	T	0.73249	0.3563	N	0.08118	0	0.42125	D	0.991442	P;P	0.42584	0.784;0.784	B;B	0.42138	0.377;0.377	T	0.69266	-0.5190	9	.	.	.	-6.1148	8.5445	0.33413	0.0:0.1725:0.0:0.8275	.	243;247	E9PFZ4;Q8NFN8	.;GP156_HUMAN	V	247;247;243	ENSP00000417261:G247V;ENSP00000324553:G247V;ENSP00000418758:G243V	.	G	-	2	0	GPR156	121382855	1.000000	0.71417	0.921000	0.36526	0.958000	0.62258	3.427000	0.52785	1.027000	0.39758	-0.345000	0.07892	GGC	-	GPR156	-	pfam_GPCR_3_C,pfscan_GPCR_3_C		0.562	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR156	HGNC	protein_coding	OTTHUMT00000355139.1	0	0	0	62	62	45	0.00	0.00	C	NM_153002		119900165	-1	30	31	51	47	tier1	no_errors	ENST00000315843	ensembl	human	known	74_37	missense	37.04	39.24	SNP	0.994	A	30	51
AVIL	10677	genome.wustl.edu	37	12	58204272	58204272	+	Silent	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:58204272C>G	ENST00000257861.3	-	6	1051	c.621G>C	c.(619-621)gtG>gtC	p.V207V	AVIL_ENST00000537081.1_Silent_p.V200V	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	207	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					CTCCCTCGATCACTCCTATTT	0.562													ENSG00000135407																																					0													115.0	100.0	105.0					12																	58204272		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.621G>C	12.37:g.58204272C>G			B2RAU7|Q2NKM9	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.V207	ENST00000257861.3	37	c.621	CCDS8959.1	12																																																																																			-	AVIL	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin		0.562	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	HGNC	protein_coding	OTTHUMT00000409276.1	0	0	0	68	68	60	0.00	0.00	C	NM_006576		58204272	-1	492	308	88	60	tier1	no_errors	ENST00000257861	ensembl	human	known	74_37	silent	84.83	83.47	SNP	1.000	G	492	88
TRIP12	9320	genome.wustl.edu	37	2	230683116	230683116	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:230683116C>T	ENST00000283943.5	-	8	1597	c.1419G>A	c.(1417-1419)ctG>ctA	p.L473L	TRIP12_ENST00000389045.3_Silent_p.L176L|TRIP12_ENST00000389044.4_Silent_p.L521L|TRIP12_ENST00000543084.1_Intron	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	473					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GAAACCCTCCCAGTGTCTCCT	0.438													ENSG00000153827																																					0													149.0	143.0	145.0					2																	230683116		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1419G>A	2.37:g.230683116C>T			D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.L473	ENST00000283943.5	37	c.1419	CCDS33391.1	2																																																																																			-	TRIP12	-	superfamily_ARM-type_fold		0.438	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	0	0	0	70	70	124	0.00	0.00	C	NM_004238		230683116	-1	38	46	20	47	tier1	no_errors	ENST00000283943	ensembl	human	known	74_37	silent	65.52	49.46	SNP	1.000	T	38	20
RNF31	55072	genome.wustl.edu	37	14	24620802	24620802	+	Missense_Mutation	SNP	C	C	T	rs374504041		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr14:24620802C>T	ENST00000324103.6	+	10	2166	c.1846C>T	c.(1846-1848)Cgc>Tgc	p.R616C	RP11-468E2.4_ENST00000558468.1_Missense_Mutation_p.R91C|RNF31_ENST00000382687.3_Missense_Mutation_p.R465C|RNF31_ENST00000559275.1_Missense_Mutation_p.R465C	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	616	Interaction with RBCK1.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		ACAGCGCCAACGCCTAGAGCC	0.647													ENSG00000092098																																					0								C	CYS/ARG	0,3998		0,0,1999	44.0	47.0	46.0		1846	5.4	1.0	14		46	1,8339		0,1,4169	no	missense	RNF31	NM_017999.4	180	0,1,6168	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	616/1073	24620802	1,12337	1999	4170	6169	SO:0001583	missense	0			-	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1846C>T	14.37:g.24620802C>T	ENSP00000315112:p.Arg616Cys		A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	pfam_PUB_domain,pfam_Znf_C6HC,superfamily_UBA-like,superfamily_DEATH-like_dom,superfamily_Znf_FYVE_PHD,smart_Znf_RanBP2,smart_Znf_C6HC,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RanBP2	p.R616C	ENST00000324103.6	37	c.1846	CCDS41931.1	14	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317757	0.81469	0.0	1.2E-4	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.45276	0.9;0.9	5.42	5.42	0.78866	.	0.070986	0.64402	D	0.000014	T	0.50871	0.1641	L	0.36672	1.1	0.58432	D	0.999999	D;D;D	0.76494	0.965;0.999;0.999	B;P;P	0.56700	0.443;0.549;0.804	T	0.50964	-0.8765	10	0.72032	D	0.01	-14.5947	18.1527	0.89679	0.0:1.0:0.0:0.0	.	375;616;465	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	C	616;465	ENSP00000315112:R616C;ENSP00000372134:R465C	ENSP00000315112:R616C	R	+	1	0	RNF31	23690642	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.462000	0.53042	2.819000	0.97034	0.655000	0.94253	CGC	-	RNF31	-	superfamily_DEATH-like_dom		0.647	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF31	HGNC	protein_coding	OTTHUMT00000071921.3	0	0	0	66	66	39	0.00	0.00	C	NM_017999		24620802	+1	21	25	66	23	tier1	no_errors	ENST00000324103	ensembl	human	known	74_37	missense	24.14	52.08	SNP	1.000	T	21	66
PBRM1	55193	genome.wustl.edu	37	3	52643669	52643669	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:52643669A>T	ENST00000296302.7	-	16	2228	c.2227T>A	c.(2227-2229)Tct>Act	p.S743T	PBRM1_ENST00000409057.1_Missense_Mutation_p.S743T|PBRM1_ENST00000394830.3_Missense_Mutation_p.S743T|PBRM1_ENST00000356770.4_Missense_Mutation_p.S711T|PBRM1_ENST00000409114.3_Missense_Mutation_p.S758T|PBRM1_ENST00000337303.4_Missense_Mutation_p.S743T|PBRM1_ENST00000409767.1_Missense_Mutation_p.S758T|PBRM1_ENST00000410007.1_Missense_Mutation_p.S743T			Q86U86	PB1_HUMAN	polybromo 1	743	Bromo 5. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TAGATCAAAGACTCCGGCTCA	0.428			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""								ENSG00000163939																												Rec	yes		3	3p21	55193	polybromo 1		E	0													125.0	122.0	123.0					3																	52643669		2203	4300	6503	SO:0001583	missense	0			-	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2227T>A	3.37:g.52643669A>T	ENSP00000296302:p.Ser743Thr		A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.S743T	ENST00000296302.7	37	c.2227		3	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773904	0.69992	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	T;T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	6.17	6.17	0.99709	Bromodomain (5);	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	L	0.49640	1.575	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.76494	0.994;0.987;0.998;0.999;0.987;0.987;0.984;0.999;0.999;0.984;0.984	D;D;D;D;D;D;D;D;D;D;D	0.85130	0.985;0.982;0.996;0.997;0.978;0.978;0.969;0.994;0.997;0.969;0.969	T	0.34502	-0.9826	10	0.54805	T	0.06	-39.086	16.8222	0.85835	1.0:0.0:0.0:0.0	.	743;118;743;743;743;743;758;758;743;711;743	Q86U86-9;Q6IRX1;Q86U86-6;E7EVG2;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;.;.;.;PB1_HUMAN;.;.	T	711;743;743;743;743;743;758;758;743;702	ENSP00000349213:S711T;ENSP00000378307:S743T;ENSP00000296302:S743T;ENSP00000338302:S743T;ENSP00000386593:S743T;ENSP00000386529:S743T;ENSP00000386643:S758T;ENSP00000386601:S758T;ENSP00000387775:S743T;ENSP00000397662:S702T	ENSP00000296302:S743T	S	-	1	0	PBRM1	52618709	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	9.307000	0.96226	2.371000	0.80710	0.533000	0.62120	TCT	-	PBRM1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain		0.428	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1	0	0	0	88	88	60	0.00	0.00	A	NM_018165		52643669	-1	46	27	62	41	tier1	no_errors	ENST00000296302	ensembl	human	known	74_37	missense	42.59	39.71	SNP	1.000	T	46	62
CDH9	1007	genome.wustl.edu	37	5	26988429	26988429	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr5:26988429G>T	ENST00000231021.4	-	2	184	c.12C>A	c.(10-12)taC>taA	p.Y4*		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	4					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y4Y(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GTATATAATGGTAAGTCCTCA	0.323													ENSG00000113100																									Melanoma(8;187 585 15745 40864 52829)												1	Substitution - coding silent(1)	ovary(1)											115.0	121.0	119.0					5																	26988429		2203	4300	6503	SO:0001587	stop_gained	0			-	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.12C>A	5.37:g.26988429G>T	ENSP00000231021:p.Tyr4*		Q3B7I5	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y4*	ENST00000231021.4	37	c.12	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013996	0.75161	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	.	.	.	5.64	-0.691	0.11305	.	1.118860	0.06498	N	0.735813	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6663	0.23042	0.5324:0.0:0.3457:0.1218	.	.	.	.	X	4	.	.	Y	-	3	2	CDH9	27024186	0.010000	0.17322	0.046000	0.18839	0.396000	0.30629	-0.197000	0.09518	-0.188000	0.10499	0.591000	0.81541	TAC	-	CDH9	-	NULL		0.323	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	0	0	1	83	83	149	0.00	0.67	G	NM_016279		26988429	-1	34	54	64	101	tier1	no_errors	ENST00000231021	ensembl	human	known	74_37	nonsense	34.69	34.62	SNP	0.001	T	34	64
CRHR2	1395	genome.wustl.edu	37	7	30721622	30721622	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:30721622C>G	ENST00000471646.1	-	2	555	c.138G>C	c.(136-138)caG>caC	p.Q46H	CRHR2_ENST00000341843.4_Missense_Mutation_p.Q32H|CRHR2_ENST00000506074.2_Missense_Mutation_p.Q46H|CRHR2_ENST00000348438.4_Missense_Mutation_p.Q73H	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	46					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						ACGTTCCGATCTGGTCCAAGG	0.687													ENSG00000106113																																					0													29.0	27.0	28.0					7																	30721622		2200	4293	6493	SO:0001583	missense	0			-		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.138G>C	7.37:g.30721622C>G	ENSP00000418722:p.Gln46His		B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.Q73H	ENST00000471646.1	37	c.219	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667219	0.47677	.	.	ENSG00000106113	ENST00000471646;ENST00000348438;ENST00000341843;ENST00000506074	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	4.27	2.44	0.29823	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.369023	0.25514	N	0.030146	T	0.61800	0.2376	L	0.49126	1.545	0.37606	D	0.920756	P;P;P;P;P	0.48089	0.681;0.792;0.905;0.837;0.681	B;B;P;P;B	0.52217	0.311;0.404;0.693;0.605;0.311	T	0.62153	-0.6914	10	0.41790	T	0.15	.	7.7429	0.28851	0.0:0.7416:0.165:0.0934	.	46;46;73;32;46	B3SXT0;B3SXS6;Q13324-2;Q13324-3;Q13324	.;.;.;.;CRFR2_HUMAN	H	46;73;32;46	ENSP00000418722:Q46H;ENSP00000340943:Q73H;ENSP00000344304:Q32H;ENSP00000426498:Q46H	ENSP00000344304:Q32H	Q	-	3	2	CRHR2	30688147	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	2.326000	0.43849	0.552000	0.29026	-0.140000	0.14226	CAG	-	CRHR2	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.687	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	HGNC	protein_coding	OTTHUMT00000250448.3	0	0	0	209	209	25	0.00	0.00	C			30721622	-1	200	21	165	16	tier1	no_errors	ENST00000348438	ensembl	human	known	74_37	missense	54.79	56.76	SNP	1.000	G	200	165
MUC16	94025	genome.wustl.edu	37	19	9068845	9068845	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:9068845T>G	ENST00000397910.4	-	3	18804	c.18601A>C	c.(18601-18603)Aac>Cac	p.N6201H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6203	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGATCATTGTTCATGACACTG	0.478													ENSG00000181143																																					0													114.0	116.0	116.0					19																	9068845		2075	4191	6266	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18601A>C	19.37:g.9068845T>G	ENSP00000381008:p.Asn6201His		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.N6201H	ENST00000397910.4	37	c.18601	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	0.889	-0.726098	0.03158	.	.	ENSG00000181143	ENST00000397910	T	0.22743	1.94	1.09	-2.17	0.07059	.	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	.	.	.	D	0.53462	0.96	B	0.41299	0.353	T	0.16335	-1.0406	8	0.87932	D	0	.	2.2608	0.04067	0.0:0.2886:0.3088:0.4026	.	6201	B5ME49	.	H	6201	ENSP00000381008:N6201H	ENSP00000381008:N6201H	N	-	1	0	MUC16	8929845	0.001000	0.12720	0.001000	0.08648	0.007000	0.05969	0.365000	0.20348	-0.823000	0.04301	0.317000	0.21355	AAC	-	MUC16	-	NULL		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	199	199	63	0.00	0.00	T	NM_024690		9068845	-1	108	36	174	62	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	38.16	36.73	SNP	0.000	G	108	174
TOX	9760	genome.wustl.edu	37	8	59851920	59851920	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:59851920T>A	ENST00000361421.1	-	3	572	c.352A>T	c.(352-354)Atc>Ttc	p.I118F		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	118						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GAGACTGTGATTTCAGGGAGG	0.473													ENSG00000198846																									Pancreas(161;610 1969 17913 21374 22725)												0													137.0	130.0	132.0					8																	59851920		2203	4300	6503	SO:0001583	missense	0			-		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.352A>T	8.37:g.59851920T>A	ENSP00000354842:p.Ile118Phe		Q96AV5	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.I118F	ENST00000361421.1	37	c.352	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	T	14.89	2.669984	0.47677	.	.	ENSG00000198846	ENST00000361421	T	0.42131	0.98	5.56	5.56	0.83823	.	0.054103	0.64402	D	0.000001	T	0.40956	0.1138	L	0.60455	1.87	0.53005	D	0.999962	P	0.39480	0.675	B	0.36567	0.228	T	0.29971	-0.9994	9	.	.	.	.	15.7046	0.77569	0.0:0.0:0.0:1.0	.	118	O94900	TOX_HUMAN	F	118	ENSP00000354842:I118F	.	I	-	1	0	TOX	60014474	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.705000	0.61838	2.123000	0.65237	0.482000	0.46254	ATC	-	TOX	-	NULL		0.473	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1	0	0	0	278	278	105	0.00	0.00	T	NM_014729		59851920	-1	103	41	165	83	tier1	no_errors	ENST00000361421	ensembl	human	known	74_37	missense	38.43	33.06	SNP	1.000	A	103	165
CD97	976	genome.wustl.edu	37	19	14507287	14507287	+	Splice_Site	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:14507287T>C	ENST00000242786.5	+	5	558		c.e5+2		CD97_ENST00000358600.3_Intron|CD97_ENST00000357355.3_Splice_Site|CD97_ENST00000587728.1_Intron	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule						cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TCTGCACAGGTAGAGGCCCCA	0.612													ENSG00000123146																																					0													101.0	83.0	89.0					19																	14507287		2203	4300	6503	SO:0001630	splice_region_variant	0			-		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.478+2T>C	19.37:g.14507287T>C			A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Splice_Site	SNP	-	e5+2	ENST00000242786.5	37	c.478+2	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	T	10.13	1.266603	0.23136	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000393059	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3798	0.38306	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD97	14368287	0.962000	0.33011	0.919000	0.36401	0.077000	0.17291	1.078000	0.30754	1.713000	0.51359	0.454000	0.30748	.	-	CD97	-	-		0.612	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	1	1	0	182	182	43	0.55	0.00	T	NM_078481	Intron	14507287	+1	56	13	142	40	tier1	no_errors	ENST00000242786	ensembl	human	known	74_37	splice_site	28.14	24.53	SNP	0.995	C	56	142
KRR1	11103	genome.wustl.edu	37	12	75905323	75905323	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:75905323G>A	ENST00000229214.4	-	1	78	c.55C>T	c.(55-57)Cgt>Tgt	p.R19C	KRR1_ENST00000438169.2_Missense_Mutation_p.R19C	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	19					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TTCTGGTTACGAAATTCACTT	0.502													ENSG00000111615																																					0													117.0	107.0	110.0					12																	75905323		2203	4300	6503	SO:0001583	missense	0			-	U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.55C>T	12.37:g.75905323G>A	ENSP00000229214:p.Arg19Cys		A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom	p.R19C	ENST00000229214.4	37	c.55	CCDS9012.1	12	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221026	0.58560	.	.	ENSG00000111615	ENST00000229214;ENST00000438169	T;T	0.51071	0.73;0.72	4.27	4.27	0.50696	.	0.389989	0.24645	N	0.036769	T	0.56108	0.1963	M	0.83603	2.65	0.28453	N	0.916252	D;D;D	0.61697	0.987;0.975;0.99	P;B;B	0.47015	0.534;0.333;0.425	T	0.62072	-0.6931	10	0.87932	D	0	16.4917	12.5093	0.55999	0.0:0.0:1.0:0.0	.	19;19;19	B4DMS5;E7EUQ0;Q13601	.;.;KRR1_HUMAN	C	19	ENSP00000229214:R19C;ENSP00000411740:R19C	ENSP00000229214:R19C	R	-	1	0	KRR1	74191590	0.260000	0.24053	0.387000	0.26183	0.134000	0.20937	2.168000	0.42424	2.661000	0.90470	0.650000	0.86243	CGT	-	KRR1	-	NULL		0.502	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRR1	HGNC	protein_coding	OTTHUMT00000405727.1	0	0	1	79	79	94	0.00	1.05	G	NM_007043		75905323	-1	269	380	744	954	tier1	no_errors	ENST00000229214	ensembl	human	known	74_37	missense	26.55	28.42	SNP	0.414	A	269	744
MUC16	94025	genome.wustl.edu	37	19	9056656	9056656	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:9056656T>C	ENST00000397910.4	-	3	30993	c.30790A>G	c.(30790-30792)Aca>Gca	p.T10264A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10266	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCAAATCTGTACTCAGATGA	0.463													ENSG00000181143																																					0													75.0	76.0	75.0					19																	9056656		1990	4143	6133	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30790A>G	19.37:g.9056656T>C	ENSP00000381008:p.Thr10264Ala		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T10264A	ENST00000397910.4	37	c.30790	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	6.422	0.446073	0.12164	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	3.23	2.21	0.28008	.	.	.	.	.	T	0.04363	0.0120	N	0.19112	0.55	.	.	.	D	0.76494	0.999	D	0.80764	0.994	T	0.39272	-0.9622	8	0.87932	D	0	.	4.8723	0.13639	0.0:0.1418:0.0:0.8582	.	10264	B5ME49	.	A	10264	ENSP00000381008:T10264A	ENSP00000381008:T10264A	T	-	1	0	MUC16	8917656	0.005000	0.15991	0.006000	0.13384	0.033000	0.12548	0.931000	0.28871	0.641000	0.30601	0.378000	0.23410	ACA	-	MUC16	-	NULL		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	67	67	93	0.00	0.00	T	NM_024690		9056656	-1	25	26	67	61	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	27.17	29.89	SNP	0.007	C	25	67
MCM10	55388	genome.wustl.edu	37	10	13214625	13214626	+	Splice_Site	INS	-	-	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:13214625_13214626insA	ENST00000484800.2	+	5	558_559	c.455_456insA	c.(454-459)gtagag>gtAagag	p.E153fs	MCM10_ENST00000378694.1_Intron|MCM10_ENST00000378714.3_Intron			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	153	N-terminal domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TTTGATTAAGTAGAGAAGTCTC	0.431													ENSG00000065328																																					0																																										SO:0001630	splice_region_variant	0				AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.455-1->A	10.37:g.13214626_13214626dupA			A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Frame_Shift_Ins	INS	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.E153fs	ENST00000484800.2	37	c.455_456	CCDS7096.1	10																																																																																				MCM10	-	NULL		0.431	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	0	0	0	67	67	74	0.00	0.00	-	NM_182751	Frame_Shift_Ins	13214626	+1	27	31	57	42	tier1	no_errors	ENST00000484800	ensembl	human	known	74_37	frame_shift_ins	32.14	42.47	INS	0.076:0.155	A	27	57
ARC	23237	genome.wustl.edu	37	8	143693600	143693600	+	3'UTR	SNP	G	G	A	rs587661771		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr8:143693600G>A	ENST00000356613.2	-	0	3002				ARC_ENST00000581404.1_5'UTR	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein						apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				CCAGGCGGGCGTGAATCACTG	0.642													ENSG00000198576	G|||	1	0.000199681	0.0	0.0	5008	,	,		14883	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			-	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.*611C>T	8.37:g.143693600G>A			B4DFL0|O60937	R	SNP	-	NULL	ENST00000356613.2	37	NULL	CCDS34950.1	8																																																																																			-	ARC	-	-		0.642	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ARC	HGNC	protein_coding	OTTHUMT00000259274.2	0	0	0	75	75	59	0.00	0.00	G			143693600	-1	59	36	20	8	tier1	no_errors	ENST00000581404	ensembl	human	known	74_37	rna	74.68	81.82	SNP	0.249	A	59	20
GAK	2580	genome.wustl.edu	37	4	862361	862361	+	Silent	SNP	G	G	A	rs112202640		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr4:862361G>A	ENST00000314167.4	-	20	2471	c.2361C>T	c.(2359-2361)gaC>gaT	p.D787D	GAK_ENST00000509566.1_5'UTR|GAK_ENST00000511163.1_Silent_p.D708D	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	787			D -> Y (in dbSNP:rs34585705). {ECO:0000269|PubMed:17344846}.		cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		AGCGACTGGCGTCCGCGCTGC	0.687													ENSG00000178950	G|||	1	0.000199681	0.0008	0.0	5008	,	,		16189	0.0		0.0	False		,,,				2504	0.0																0								G		4,4398	9.9+/-24.2	0,4,2197	37.0	35.0	36.0		2361	-2.2	0.0	4	dbSNP_132	36	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	GAK	NM_005255.2		0,5,6494	AA,AG,GG		0.0116,0.0909,0.0385		787/1312	862361	5,12993	2201	4298	6499	SO:0001819	synonymous_variant	0			-	D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.2361C>T	4.37:g.862361G>A			Q5U4P5|Q9BVY6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_Kinase-like_dom,superfamily_DnaJ_domain,superfamily_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_DnaJ_domain,pfscan_Prot_kinase_dom,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.D787	ENST00000314167.4	37	c.2361	CCDS3340.1	4																																																																																			rs112202640	GAK	-	NULL		0.687	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	HGNC	protein_coding	OTTHUMT00000239188.1	0	0	0	127	127	13	0.00	0.00	G	NM_005255		862361	-1	94	5	109	5	tier1	no_errors	ENST00000314167	ensembl	human	known	74_37	silent	46.31	50.00	SNP	0.003	A	94	109
LILRA5	353514	genome.wustl.edu	37	19	54823155	54823155	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr19:54823155G>T	ENST00000301219.3	-	4	507	c.388C>A	c.(388-390)Ccc>Acc	p.P130T	LILRA5_ENST00000346508.3_Missense_Mutation_p.P118T|LILRA5_ENST00000446712.3_Missense_Mutation_p.P118T|LILRA5_ENST00000432233.3_Missense_Mutation_p.P130T|AC008984.2_ENST00000507363.1_RNA	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	130	Ig-like C2-type 1.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGCTCCAGGGGGTCGCTGGGC	0.612													ENSG00000187116																																					0													130.0	123.0	126.0					19																	54823155		2203	4300	6503	SO:0001583	missense	0			-	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.388C>A	19.37:g.54823155G>T	ENSP00000301219:p.Pro130Thr		A6NHI3	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2	p.P130T	ENST00000301219.3	37	c.388	CCDS12888.1	19	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239551	0.22711	.	.	ENSG00000187116	ENST00000301219;ENST00000346508;ENST00000446712;ENST00000432233	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	3.16	-2.38	0.06622	Immunoglobulin-like fold (1);	0.357134	0.20065	U	0.099994	T	0.16257	0.0391	M	0.81802	2.56	0.21527	N	0.99965	P;P;P;P	0.48589	0.638;0.48;0.912;0.761	B;B;P;P	0.46299	0.13;0.268;0.511;0.459	T	0.09618	-1.0666	10	0.62326	D	0.03	.	1.8919	0.03249	0.1299:0.3789:0.299:0.1922	.	118;130;118;130	A6NI73-4;A6NI73-3;A6NI73-2;A6NI73	.;.;.;LIRA5_HUMAN	T	130;118;118;130	ENSP00000301219:P130T;ENSP00000302948:P118T;ENSP00000389499:P118T;ENSP00000404236:P130T	ENSP00000301219:P130T	P	-	1	0	LILRA5	59514967	0.000000	0.05858	0.232000	0.24009	0.786000	0.44442	-0.947000	0.03901	-0.351000	0.08249	0.411000	0.27672	CCC	-	LILRA5	-	smart_Ig_sub		0.612	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA5	HGNC	protein_coding	OTTHUMT00000140231.1	1	1	0	162	162	18	0.61	0.00	G	NM_181985		54823155	-1	70	10	110	8	tier1	no_errors	ENST00000301219	ensembl	human	known	74_37	missense	38.67	55.56	SNP	0.668	T	70	110
SOX3	6658	genome.wustl.edu	37	X	139586328	139586329	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G|C	G|C	G|C	A|T	G|C	G|C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chrX:139586328_139586329GC>AT	ENST00000370536.2	-	1	896_897	c.897_898GC>AT	c.(895-900)atGCac>atATac	p.299_300MH>IY		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	299				Missing (in Ref. 2; CAA50465). {ECO:0000305}.	central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					TCGTAGCGGTGCATcggcggca	0.738													ENSG00000134595																																					0																																										SO:0001583	missense	0			-		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.897_898delinsAT	X.37:g.139586328_139586329delinsAT	ENSP00000359567:p.M299_H300delinsIY		P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.H300Y|p.M299I	ENST00000370536.2	37	c.898|c.897	CCDS14669.1	X																																																																																			-	SOX3	-	NULL		0.738	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	HGNC	protein_coding	OTTHUMT00000058577.1	0	0	0	10	11|10	6	0.00	0.00	G|C			139586328|139586329	-1	5	4	7	3	tier1	no_errors	ENST00000370536	ensembl	human	known	74_37	missense	41.67	57.14	SNP	1.000	A|T	5	7
UGT1A10	54575	genome.wustl.edu	37	2	234545737	234545737	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr2:234545737delT	ENST00000344644.5	+	1	638	c.569delT	c.(568-570)gtcfs	p.V190fs	UGT1A10_ENST00000373445.1_Frame_Shift_Del_p.V190fs|UGT1A1_ENST00000373450.4_Intron	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	190					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	CTTTCCTATGTCCCCAATGAT	0.468													ENSG00000242515																																					0													167.0	170.0	169.0					2																	234545737		2203	4300	6503	SO:0001589	frameshift_variant	0				U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.569delT	2.37:g.234545737delT	ENSP00000343838:p.Val190fs		O00474|Q6NT91|Q7Z6H8	Frame_Shift_Del	DEL	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V190fs	ENST00000344644.5	37	c.569	CCDS33403.1	2																																																																																				UGT1A10	-	pfam_UDP_glucos_trans		0.468	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A10	HGNC	protein_coding	OTTHUMT00000130986.1	0	0	0	205	205	21	0.00	0.00	T	NM_019075		234545737	+1	43	3	115	9	tier1	no_errors	ENST00000344644	ensembl	human	known	74_37	frame_shift_del	27.22	25.00	DEL	0.999	-	43	115
RABGEF1	27342	genome.wustl.edu	37	7	66274900	66274900	+	3'UTR	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:66274900C>T	ENST00000284957.5	+	0	2182				KCTD7_ENST00000380828.2_3'UTR|KCTD7_ENST00000510829.2_3'UTR|RABGEF1_ENST00000439720.2_3'UTR|GTF2IRD1P1_ENST00000457166.1_RNA|RABGEF1_ENST00000484547.2_3'UTR			Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein targeting to membrane (GO:0006612)	early endosome (GO:0005769)	DNA binding (GO:0003677)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|stomach(1)	27						TCTTTAAGAACGTGTTAGCCT	0.368													ENSG00000154710																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AJ250042	CCDS5535.1, CCDS69308.1, CCDS75610.1	7q11.21	2010-07-09			ENSG00000154710	ENSG00000154710			17676	protein-coding gene	gene with protein product		609700				12505986, 11098082	Standard	NM_014504		Approved	rabex-5, RABEX5	uc003tvh.3	Q9UJ41	OTTHUMG00000129547	ENST00000284957.5:c.*629C>T	7.37:g.66274900C>T			B4DZM7|Q3HKR2|Q3HKR3|Q53FG0	R	SNP	-	NULL	ENST00000284957.5	37	NULL	CCDS5535.1	7																																																																																			-	RABGEF1	-	-		0.368	RABGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGEF1	HGNC	protein_coding	OTTHUMT00000251737.3	0	0	0	57	57	143	0.00	0.00	C	NM_014504		66274900	+1	14	17	104	182	tier1	no_errors	ENST00000484547	ensembl	human	known	74_37	rna	11.86	8.54	SNP	0.000	T	14	104
PANK1	53354	genome.wustl.edu	37	10	91344218	91344218	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:91344218T>C	ENST00000307534.4	-	7	1897	c.1742A>G	c.(1741-1743)tAt>tGt	p.Y581C	PANK1_ENST00000322191.6_Missense_Mutation_p.Y297C|PANK1_ENST00000342512.3_Missense_Mutation_p.Y356C|PANK1_ENST00000371774.2_Missense_Mutation_p.Y383C	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	581					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						GGCTCCAAAATAACCCTACGA	0.393													ENSG00000152782																																					0													135.0	133.0	134.0					10																	91344218		2203	4300	6503	SO:0001583	missense	0			-	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.1742A>G	10.37:g.91344218T>C	ENSP00000302108:p.Tyr581Cys		A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.Y581C	ENST00000307534.4	37	c.1742	CCDS31244.1	10	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660135	0.67586	.	.	ENSG00000152782	ENST00000342512;ENST00000322191;ENST00000371774;ENST00000307534;ENST00000371775	D;D;D;D	0.99809	-6.86;-6.48;-6.86;-6.86	4.8	4.8	0.61643	.	0.123295	0.56097	D	0.000023	D	0.99816	0.9919	M	0.93678	3.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.97110	0.997;1.0;0.975;0.999	D	0.96792	0.9583	10	0.87932	D	0	-21.2291	13.9575	0.64160	0.0:0.0:0.0:1.0	.	383;581;297;356	Q8TE04-4;Q8TE04;Q8TE04-3;Q8TE04-2	.;PANK1_HUMAN;.;.	C	356;297;383;581;444	ENSP00000345118:Y356C;ENSP00000318526:Y297C;ENSP00000360839:Y383C;ENSP00000302108:Y581C	ENSP00000302108:Y581C	Y	-	2	0	PANK1	91334198	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.333000	0.79214	2.134000	0.65973	0.533000	0.62120	TAT	-	PANK1	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK		0.393	PANK1-201	KNOWN	basic|CCDS	protein_coding	PANK1	HGNC	protein_coding		0	0	0	127	127	146	0.00	0.00	T			91344218	-1	12	7	95	99	tier1	no_errors	ENST00000307534	ensembl	human	known	74_37	missense	11.21	6.60	SNP	1.000	C	12	95
SLC25A44	9673	genome.wustl.edu	37	1	156180814	156180814	+	3'UTR	SNP	T	T	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:156180814T>A	ENST00000359511.4	+	0	1709				PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1_ENST00000368273.4_5'Flank|PMF1-BGLAP_ENST00000490491.1_5'Flank|PMF1_ENST00000565805.1_5'Flank|PMF1_ENST00000368277.3_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank|PMF1_ENST00000567140.1_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|PMF1_ENST00000368279.3_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					TTGGAGGGGTTATTAGGTTGG	0.463													ENSG00000160785																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.*592T>A	1.37:g.156180814T>A			O75034	R	SNP	-	NULL	ENST00000359511.4	37	NULL	CCDS1133.1	1																																																																																			-	SLC25A44	-	-		0.463	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	HGNC	protein_coding	OTTHUMT00000040856.1	0	0	0	33	33	43	0.00	0.00	T	NM_014655		156180814	+1	9	6	41	52	tier1	no_errors	ENST00000469537	ensembl	human	known	74_37	rna	18.00	9.84	SNP	0.086	A	9	41
KHDC1	80759	genome.wustl.edu	37	6	74000787	74000787	+	Intron	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr6:74000787C>A	ENST00000370384.3	-	2	707				RP11-398K22.12_ENST00000441363.1_RNA|KHDC1_ENST00000484801.1_Intron|RP11-398K22.12_ENST00000421315.1_RNA	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1							integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						GGAGGAATTTCAAAGTGAATG	0.448													ENSG00000229852																																					0																																										SO:0001627	intron_variant	0			-		CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.206+933G>T	6.37:g.74000787C>A			Q5JSQ7|Q8WTV2|Q96NQ5	R	SNP	-	NULL	ENST00000370384.3	37	NULL	CCDS59027.1	6																																																																																			-	RP11-398K22.12	-	-		0.448	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000229852	Clone_based_vega_gene	protein_coding	OTTHUMT00000148103.2	0	0	0	59	59	50	0.00	0.00	C	NM_030568		74000787	+1	16	5	58	63	tier1	no_errors	ENST00000421315	ensembl	human	known	74_37	rna	21.62	7.35	SNP	1.000	A	16	58
NAV3	89795	genome.wustl.edu	37	12	78515848	78515848	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:78515848C>A	ENST00000397909.2	+	16	4051	c.3878C>A	c.(3877-3879)tCc>tAc	p.S1293Y	NAV3_ENST00000536525.2_Missense_Mutation_p.S1293Y|NAV3_ENST00000228327.6_Missense_Mutation_p.S1293Y|NAV3_ENST00000266692.7_Intron			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1293	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCACCGTCGTCCGGTACGGGC	0.532										HNSCC(70;0.22)			ENSG00000067798																																					0													50.0	51.0	51.0					12																	78515848		2108	4229	6337	SO:0001583	missense	0			-	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3878C>A	12.37:g.78515848C>A	ENSP00000381007:p.Ser1293Tyr		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.S1293Y	ENST00000397909.2	37	c.3878		12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421873	0.83559	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327	T;T;T	0.29655	1.57;1.58;1.56	5.96	5.96	0.96718	.	0.000000	0.38326	U	0.001739	T	0.53818	0.1820	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.961;0.997;0.952	T	0.50092	-0.8868	10	0.72032	D	0.01	-13.2083	20.4082	0.99013	0.0:1.0:0.0:0.0	.	1293;1293;1293	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	Y	1293	ENSP00000446132:S1293Y;ENSP00000381007:S1293Y;ENSP00000228327:S1293Y	ENSP00000228327:S1293Y	S	+	2	0	NAV3	77039979	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.590000	0.82653	2.814000	0.96858	0.655000	0.94253	TCC	-	V3	-	NULL		0.532	NAV3-001	KNOWN	basic	protein_coding	V3	HGNC	protein_coding	OTTHUMT00000406812.1	0	0	0	55	55	63	0.00	0.00	C	NM_001024383		78515848	+1	193	181	1505	1639	tier1	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	11.37	9.93	SNP	1.000	A	193	1505
DCAF7	10238	genome.wustl.edu	37	17	61666657	61666664	+	3'UTR	DEL	TTACCAGA	TTACCAGA	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	TTACCAGA	TTACCAGA	TTACCAGA	-	TTACCAGA	TTACCAGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr17:61666657_61666664delTTACCAGA	ENST00000310827.4	+	0	1369_1376				DCAF7_ENST00000577702.1_3'UTR|DCAF7_ENST00000415273.2_3'UTR|DCAF7_ENST00000431926.1_Frame_Shift_Del_p.CYQK160fs	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7						multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						GCACCCACTGTTACCAGAAGCTGCTCTA	0.534													ENSG00000136485																																					0																																										SO:0001624	3_prime_UTR_variant	0				U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.*130TTACCAGA>-	17.37:g.61666657_61666664delTTACCAGA			B4E039|D3DU14|O15491|Q9DAE4	Frame_Shift_Del	DEL	superfamily_WD40_repeat_dom	p.C160fs	ENST00000310827.4	37	c.480_487		17																																																																																				DCAF7	-	NULL		0.534	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	HGNC	protein_coding		0	0	0	88	88	88	0.00	0.00	TTACCAGA	NM_005828		61666664	+1	6	6	72	72	tier1	no_errors	ENST00000431926	ensembl	human	known	74_37	frame_shift_del	7.69	7.69	DEL	0.998:0.970:0.969:0.992:0.999:1.000:1.000:1.000	-	6	72
CAND1	55832	genome.wustl.edu	37	12	67675789	67675790	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	-	-	-	G	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:67675789_67675790insG	ENST00000545606.1	+	2	605_606	c.168_169insG	c.(169-171)ttgfs	p.L57fs		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	57					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTTTGAAGTTATTGGAAGATAA	0.361													ENSG00000111530																																					0																																										SO:0001589	frameshift_variant	0					CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	Exception_encountered	12.37:g.67675789_67675790insG	ENSP00000442318:p.Leu57fs		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Frame_Shift_Ins	INS	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.L56fs	ENST00000545606.1	37	c.168_169	CCDS8977.1	12																																																																																				CAND1	-	pfam_HEAT,superfamily_ARM-type_fold		0.361	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1	0	0	0	120	120	102	0.00	0.00	-	NM_018448		67675790	+1	76	14	510	596	tier1	no_errors	ENST00000545606	ensembl	human	known	74_37	frame_shift_ins	12.97	2.30	INS	1.000:1.000	G	76	510
CAND1	55832	genome.wustl.edu	37	12	67675783	67675786	+	Frame_Shift_Del	DEL	GAAG	GAAG	-			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	GAAG	GAAG	GAAG	-	GAAG	GAAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:67675783_67675786delGAAG	ENST00000545606.1	+	2	599_602	c.162_165delGAAG	c.(160-165)ttgaagfs	p.LK54fs		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	54					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AAATGATTTTGAAGTTATTGGAAG	0.363													ENSG00000111530																																					0																																										SO:0001589	frameshift_variant	0					CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.162_165delGAAG	12.37:g.67675783_67675786delGAAG	ENSP00000442318:p.Leu54fs		B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Frame_Shift_Del	DEL	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.L54fs	ENST00000545606.1	37	c.162_165	CCDS8977.1	12																																																																																				CAND1	-	pfam_HEAT,superfamily_ARM-type_fold		0.363	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	HGNC	protein_coding	OTTHUMT00000402105.1	0	0	0	115	115	105	0.00	0.00	GAAG	NM_018448		67675786	+1	74	14	479	593	tier1	no_errors	ENST00000545606	ensembl	human	known	74_37	frame_shift_del	13.38	2.31	DEL	1.000:1.000:1.000:1.000	-	74	479
TMC2	117532	genome.wustl.edu	37	20	2591222	2591222	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr20:2591222T>G	ENST00000358864.1	+	12	1586	c.1571T>G	c.(1570-1572)cTg>cGg	p.L524R	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	524					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CTCTTGGCCCTGATGGATGAC	0.488													ENSG00000149488																																					0													98.0	80.0	86.0					20																	2591222		2203	4300	6503	SO:0001583	missense	0			-	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1571T>G	20.37:g.2591222T>G	ENSP00000351732:p.Leu524Arg		Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	pfam_TMC	p.L524R	ENST00000358864.1	37	c.1571	CCDS13029.2	20	.	.	.	.	.	.	.	.	.	.	T	22.2	4.252978	0.80135	.	.	ENSG00000149488	ENST00000358864	T	0.78246	-1.16	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.89238	0.6658	M	0.88640	2.97	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.91635	0.98;0.999;0.994;0.989	D	0.91144	0.4948	10	0.87932	D	0	-10.8242	13.3454	0.60571	0.0:0.0:0.0:1.0	.	355;356;524;524	B4DFB3;B7ZAE6;Q8TDI7-3;Q8TDI7	.;.;.;TMC2_HUMAN	R	524	ENSP00000351732:L524R	ENSP00000351732:L524R	L	+	2	0	TMC2	2539222	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.977000	0.88081	2.103000	0.63969	0.528000	0.53228	CTG	-	TMC2	-	NULL		0.488	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	0	0	2	133	133	146	0.00	1.35	T			2591222	+1	27	21	158	94	tier1	no_errors	ENST00000358864	ensembl	human	known	74_37	missense	14.44	18.26	SNP	1.000	G	27	158
MIER3	166968	genome.wustl.edu	37	5	56224844	56224845	+	Intron	INS	-	-	CACACACACACACACACACACACACTCTCTCTCT			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr5:56224844_56224845insCACACACACACACACACACACACACTCTCTCTCT	ENST00000381199.3	-	10	840				CTD-2310F14.1_ENST00000606813.1_RNA|MIER3_ENST00000381226.3_Intron|MIER3_ENST00000409421.1_Intron|MIER3_ENST00000381213.3_Intron			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		tctctctctctctctctctctG	0.386													ENSG00000271828																																					0																																										SO:0001627	intron_variant	0				BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.830-156->AGAGAGAGAGTGTGTGTGTGTGTGTGTGTGTGTG	5.37:g.56224844_56224845insCACACACACACACACACACACACACTCTCTCTCT			B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	R	INS	-	NULL	ENST00000381199.3	37	NULL		5																																																																																				CTD-2310F14.1	-	-		0.386	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	ENSG00000271828	Clone_based_vega_gene	protein_coding	OTTHUMT00000132523.2	0	0	0	8	8	8	0.00	0.00	-	NM_152622		56224845	+1	0	0	6	6	tier1	no_errors	ENST00000606813	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.005:0.014	CACACACACACACACACACACACACTCTCTCTCT	0	6
TENM4	26011	genome.wustl.edu	37	11	78780916	78780916	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr11:78780916G>A	ENST00000278550.7	-	5	536	c.74C>T	c.(73-75)tCg>tTg	p.S25L	TENM4_ENST00000533038.1_5'UTR	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	25	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GTCCGCGGACGAGCTGGTGTA	0.687													ENSG00000149256																																					0													32.0	38.0	36.0					11																	78780916		692	1591	2283	SO:0001583	missense	0			-	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.74C>T	11.37:g.78780916G>A	ENSP00000278550:p.Ser25Leu		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.S25L	ENST00000278550.7	37	c.74	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.877602	0.97055	.	.	ENSG00000149256	ENST00000278550	T	0.41400	1.0	4.54	4.54	0.55810	Teneurin intracellular, N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.64057	0.2564	M	0.71581	2.175	0.58432	D	0.999998	D;D	0.76494	0.999;0.997	D;D	0.77557	0.99;0.968	T	0.65076	-0.6256	9	.	.	.	.	17.8567	0.88765	0.0:0.0:1.0:0.0	.	25;25	G3CAT1;Q6N022	.;TEN4_HUMAN	L	25	ENSP00000278550:S25L	.	S	-	2	0	ODZ4	78458564	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.229000	0.95273	2.525000	0.85131	0.655000	0.94253	TCG	-	TENM4	-	pfam_Ten_N		0.687	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	0	0	0	141	141	10	0.00	0.00	G			78780916	-1	53	1	94	5	tier1	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	36.05	16.67	SNP	1.000	A	53	94
TRIM42	287015	genome.wustl.edu	37	3	140401456	140401456	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr3:140401456T>C	ENST00000286349.3	+	2	685	c.494T>C	c.(493-495)cTg>cCg	p.L165P		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	165						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						AACCACAGCCTGTGCGAGAAG	0.602													ENSG00000155890																																					0													111.0	101.0	104.0					3																	140401456		2203	4300	6503	SO:0001583	missense	0			-	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.494T>C	3.37:g.140401456T>C	ENSP00000286349:p.Leu165Pro		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.L165P	ENST00000286349.3	37	c.494	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	T	16.78	3.216675	0.58452	.	.	ENSG00000155890	ENST00000286349	T	0.40756	1.02	5.22	5.22	0.72569	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);	0.202363	0.24886	N	0.034812	T	0.51109	0.1655	L	0.52011	1.625	0.58432	D	0.999995	D	0.67145	0.996	P	0.56700	0.804	T	0.54397	-0.8300	10	0.87932	D	0	-4.5405	11.4966	0.50413	0.0:0.0:0.0:1.0	.	165	Q8IWZ5	TRI42_HUMAN	P	165	ENSP00000286349:L165P	ENSP00000286349:L165P	L	+	2	0	TRIM42	141884146	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	4.703000	0.61824	1.978000	0.57642	0.459000	0.35465	CTG	-	TRIM42	-	pfscan_Znf_RING		0.602	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	0	0	0	50	50	6	0.00	0.00	T	NM_152616		140401456	+1	9	0	34	9	tier1	no_errors	ENST00000286349	ensembl	human	known	74_37	missense	20.93	0.00	SNP	1.000	C	9	34
TUBB8	347688	genome.wustl.edu	37	10	95173	95173	+	Silent	SNP	C	C	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr10:95173C>T	ENST00000309812.4	-	1	68	c.6G>A	c.(4-6)agG>agA	p.R2R	TUBB8_ENST00000332708.5_Silent_p.R2R|TUBB8_ENST00000413237.3_Intron|TUBB8_ENST00000447903.2_Intron	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	2					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GCACGATCTCCCTCATGGCCA	0.672													ENSG00000173876																									Pancreas(192;2041 3010 9013 18103)												0													18.0	16.0	17.0					10																	95173		2196	4295	6491	SO:0001819	synonymous_variant	0			-	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.6G>A	10.37:g.95173C>T			Q5SQX9|Q8WZ78	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.R2	ENST00000309812.4	37	c.6	CCDS7051.1	10																																																																																			-	TUBB8	-	pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase		0.672	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	0	0	0	212	212	7	0.00	0.00	C	NM_177987		95173	-1	81	0	131	4	tier1	no_errors	ENST00000309812	ensembl	human	known	74_37	silent	38.03	0.00	SNP	1.000	T	81	131
CADPS2	93664	genome.wustl.edu	37	7	122526253	122526253	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:122526253G>T	ENST00000449022.2	-	1	158	c.139C>A	c.(139-141)Cgc>Agc	p.R47S	CADPS2_ENST00000313070.7_Missense_Mutation_p.R47S|CADPS2_ENST00000412584.2_Missense_Mutation_p.R47S|CADPS2_ENST00000334010.7_Missense_Mutation_p.R47S	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	47				APGR -> GRG (in Ref. 2; AAN38707). {ECO:0000305}.	cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ccgcccgcgcgccccggcgcg	0.751													ENSG00000081803																																					0													2.0	3.0	3.0					7																	122526253		1020	2374	3394	SO:0001583	missense	0			-		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.139C>A	7.37:g.122526253G>T	ENSP00000398481:p.Arg47Ser		A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,pfam_Pleckstrin_homology,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R47S	ENST00000449022.2	37	c.139	CCDS55158.1	7	.	.	.	.	.	.	.	.	.	.	G	10.31	1.314229	0.23908	.	.	ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000412584;ENST00000449022	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	4.09	4.09	0.47781	.	0.682414	0.13327	N	0.396231	T	0.13798	0.0334	N	0.01874	-0.695	0.34396	D	0.694766	B;B	0.31625	0.081;0.332	B;B	0.26693	0.072;0.049	T	0.21075	-1.0256	10	0.02654	T	1	-5.4813	9.1409	0.36903	0.0:0.0:0.7823:0.2177	.	47;47	Q86UW7-2;Q86UW7	.;CAPS2_HUMAN	S	47	ENSP00000325581:R47S;ENSP00000333940:R47S;ENSP00000400401:R47S;ENSP00000398481:R47S	ENSP00000325581:R47S	R	-	1	0	CADPS2	122313489	1.000000	0.71417	0.976000	0.42696	0.673000	0.39480	1.841000	0.39240	2.080000	0.62538	0.557000	0.71058	CGC	-	CADPS2	-	NULL		0.751	CADPS2-001	KNOWN	basic|CCDS	protein_coding	CADPS2	HGNC	protein_coding	OTTHUMT00000347414.2	0	0	0	33	33	0	0.00	0.00	G	NM_017954		122526253	-1	12	0	17	0	tier1	no_errors	ENST00000449022	ensembl	human	known	74_37	missense	40.00	0.00	SNP	1.000	T	12	17
RP11-435B5.5	0	genome.wustl.edu	37	1	143378628	143378628	+	lincRNA	SNP	G	G	A			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:143378628G>A	ENST00000428624.1	+	0	1348				RP11-435B5.4_ENST00000423249.1_lincRNA|RP11-435B5.3_ENST00000430699.1_lincRNA																							TGAAAGAGATGTATGAAAATG	0.388													ENSG00000238261																																					0																																												0			-																													1.37:g.143378628G>A				R	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	RP11-435B5.5	-	-		0.388	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	0	0	0	58	58	0	0.00	0.00	G			143378628	+1	13	0	52	0	tier1	no_errors	ENST00000428624	ensembl	human	known	74_37	rna	20.00	0.00	SNP	0.061	A	13	52
LOC283683	283683	genome.wustl.edu	37	15	23114586	23114586	+	RNA	SNP	A	A	C			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr15:23114586A>C	ENST00000557922.1	-	0	140					NR_040057.1																						GTACACACACACATGACAGAA	0.517													ENSG00000259344																																					0																																												0			-																													15.37:g.23114586A>C				R	SNP	-	NULL	ENST00000557922.1	37	NULL		15																																																																																			-	RP11-566K19.6	-	-		0.517	RP11-566K19.6-003	KNOWN	basic	processed_transcript	LOC283683	Clone_based_vega_gene	pseudogene	OTTHUMT00000415896.1	0	0	0	19	19	0	0.00	0.00	A			23114586	-1	5	0	17	0	tier1	no_errors	ENST00000561118	ensembl	human	known	74_37	rna	22.73	0.00	SNP	0.000	C	5	17
OR2T8	343172	genome.wustl.edu	37	1	248084655	248084655	+	Silent	SNP	C	C	T	rs112164391		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr1:248084655C>T	ENST00000319968.4	+	1	336	c.336C>T	c.(334-336)ctC>ctT	p.L112L		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGTGCTTCCTCTTAGCAGCCA	0.597													ENSG00000177462																																					0													5.0	2.0	3.0					1																	248084655		1551	3034	4585	SO:0001819	synonymous_variant	0			-		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.336C>T	1.37:g.248084655C>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L112	ENST00000319968.4	37	c.336	CCDS31100.1	1																																																																																			rs112164391	OR2T8	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.597	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	0	0	0	34	34	1	0.00	0.00	C	NM_001005522		248084655	+1	5	0	31	4	tier1	no_errors	ENST00000319968	ensembl	human	known	74_37	silent	13.89	0.00	SNP	0.314	T	5	31
XRCC6BP1	91419	genome.wustl.edu	37	12	58335516	58335525	+	Frame_Shift_Del	DEL	GCCCCGCGGC	GCCCCGCGGC	-	rs369268420		TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	GCCCCGCGGC	GCCCCGCGGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr12:58335516_58335525delGCCCCGCGGC	ENST00000300145.3	+	1	157_166	c.32_41delGCCCCGCGGC	c.(31-42)ggccccgcggcafs	p.GPAA11fs		NM_033276.2	NP_150592.1	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	11					double-strand break repair via nonhomologous end joining (GO:0006303)|protein phosphorylation (GO:0006468)	DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)	DNA-dependent protein kinase activity (GO:0004677)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	11						cgccggcggggccccgcggcAGGGGAGCAG	0.686													ENSG00000166896																																					0																																										SO:0001589	frameshift_variant	0				AF078164	CCDS41802.1	12q14.1	2006-01-09				ENSG00000166896			29452	protein-coding gene	gene with protein product	"""Ku70 binding protein 3"""					10219089	Standard	XM_005269223		Approved	KUB3	uc001sqp.3	Q9Y6H3	OTTHUMG00000170493	ENST00000300145.3:c.32_41delGCCCCGCGGC	12.37:g.58335516_58335525delGCCCCGCGGC	ENSP00000300145:p.Gly11fs		Q1RLM4|Q96E81	Frame_Shift_Del	DEL	pfam_Peptidase_M76_ATP23	p.G11fs	ENST00000300145.3	37	c.32_41	CCDS41802.1	12																																																																																				XRCC6BP1	-	NULL		0.686	XRCC6BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC6BP1	HGNC	protein_coding	OTTHUMT00000409390.1	0	0	0	2	2	2	0.00	0.00	GCCCCGCGGC	NM_033276		58335525	+1	1	1	9	9	tier1	no_errors	ENST00000300145	ensembl	human	known	74_37	frame_shift_del	10.00	10.00	DEL	0.092:0.099:0.094:0.074:0.002:0.002:0.000:0.001:0.003:0.000	-	1	9
CRHR2	1395	genome.wustl.edu	37	7	30721808	30721808	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6BF-01A-11D-A307-09	TCGA-DX-A6BF-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c09472bd-b614-4330-8621-641bd47c0cdc	af336ff1-8473-43df-b844-5310e7d3e162	g.chr7:30721808G>T	ENST00000471646.1	-	1	506	c.89C>A	c.(88-90)cCc>cAc	p.P30H	CRHR2_ENST00000341843.4_Intron|CRHR2_ENST00000506074.2_Missense_Mutation_p.P30H|CRHR2_ENST00000348438.4_Intron	NM_001202482.1|NM_001202483.1|NM_001883.4	NP_001189411.1|NP_001189412.1|NP_001874.2	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	30					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|positive regulation of cAMP-mediated signaling (GO:0043950)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotrophin-releasing factor receptor activity (GO:0015056)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGGGTCCAGGGGTGGCCCCCA	0.741													ENSG00000106113																																					0													8.0	11.0	10.0					7																	30721808		2180	4266	6446	SO:0001583	missense	0			-		CCDS5429.1, CCDS56477.1, CCDS56478.1, CCDS75576.1	7p21-p15	2012-08-10			ENSG00000106113	ENSG00000106113		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2358	protein-coding gene	gene with protein product		602034				8536644	Standard	NM_001883		Approved	CRF2, CRF-RB, HM-CRF	uc003tbp.3	Q13324	OTTHUMG00000023218	ENST00000471646.1:c.89C>A	7.37:g.30721808G>T	ENSP00000418722:p.Pro30His		B2R967|B3SXS6|B3SXS7|B3SXS8|B3SXT0|F8WA81|O43461|Q4QRJ4|Q99431	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF2_rcpt,prints_GPCR_2_diuretic_rcpt	p.P30H	ENST00000471646.1	37	c.89	CCDS5429.1	7	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628719	0.28978	.	.	ENSG00000106113	ENST00000471646;ENST00000506074	T;T	0.42513	0.97;1.06	4.45	2.65	0.31530	GPCR, family 2, extracellular hormone receptor domain (1);	.	.	.	.	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	B;P;B	0.34815	0.196;0.47;0.196	B;B;B	0.28784	0.039;0.094;0.039	T	0.09122	-1.0689	9	0.42905	T	0.14	.	6.8834	0.24187	0.2093:0.0:0.7907:0.0	.	30;30;30	B3SXT0;B3SXS6;Q13324	.;.;CRFR2_HUMAN	H	30	ENSP00000418722:P30H;ENSP00000426498:P30H	ENSP00000418722:P30H	P	-	2	0	CRHR2	30688333	0.029000	0.19370	0.065000	0.19835	0.876000	0.50452	1.499000	0.35671	0.635000	0.30488	0.563000	0.77884	CCC	-	CRHR2	-	pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_CRF2_rcpt		0.741	CRHR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CRHR2	HGNC	protein_coding	OTTHUMT00000250448.3	0	0	0	37	37	4	0.00	0.00	G			30721808	-1	26	2	28	4	tier1	no_errors	ENST00000471646	ensembl	human	known	74_37	missense	48.15	33.33	SNP	0.128	T	26	28
