#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TTC16	158248	genome.wustl.edu	37	9	130493785	130493785	+	3'UTR	SNP	A	A	G			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr9:130493785A>G	ENST00000373289.3	+	0	2803				TTC16_ENST00000489226.1_3'UTR|TOR2A_ENST00000472723.1_5'Flank	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16											central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						GAGCAATTAAAAGTCTTAGCA	0.493													ENSG00000167094																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.*101A>G	9.37:g.130493785A>G			B4DYG4|B5ME24|Q5JU66|Q96M72	R	SNP	-	NULL	ENST00000373289.3	37	NULL	CCDS6875.1	9																																																																																			-	TTC16	-	-		0.493	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	0	0	0	25	25	78	0.00	0.00	A	NM_144965		130493785	+1	5	20	19	54	tier1	no_errors	ENST00000488285	ensembl	human	known	74_37	rna	20.83	26.67	SNP	0.004	G	5	19
DTX3	196403	genome.wustl.edu	37	12	58002321	58002321	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr12:58002321G>A	ENST00000548198.1	+	4	2273	c.769G>A	c.(769-771)Gga>Aga	p.G257R	ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000551632.1_Missense_Mutation_p.G260R|DTX3_ENST00000337737.3_Missense_Mutation_p.G257R|ARHGEF25_ENST00000286494.4_5'Flank|DTX3_ENST00000548804.1_Missense_Mutation_p.G257R			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	257					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					CCCAAACCCAGGAGTTCGGTA	0.617													ENSG00000178498																																					0													62.0	65.0	64.0					12																	58002321		2077	4212	6289	SO:0001583	missense	0			-	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.769G>A	12.37:g.58002321G>A	ENSP00000447873:p.Gly257Arg		Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.G260R	ENST00000548198.1	37	c.778	CCDS41800.1	12	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694607	0.88830	.	.	ENSG00000178498	ENST00000548804;ENST00000337737;ENST00000548198;ENST00000551632;ENST00000550300	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.59418	0.2192	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71652	-0.4528	10	0.87932	D	0	-3.6819	15.6095	0.76704	0.0:0.0:1.0:0.0	.	257	Q8N9I9	DTX3_HUMAN	R	257;257;257;260;45	ENSP00000449294:G257R;ENSP00000338050:G257R;ENSP00000447873:G257R;ENSP00000448696:G260R;ENSP00000446996:G45R	ENSP00000338050:G257R	G	+	1	0	DTX3	56288588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.504000	0.97986	2.044000	0.60594	0.585000	0.79938	GGA	-	DTX3	-	NULL		0.617	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DTX3	HGNC	protein_coding	OTTHUMT00000407848.1	0	0	0	80	80	75	0.00	0.00	G	NM_178502		58002321	+1	321	377	386	550	tier1	no_errors	ENST00000551632	ensembl	human	known	74_37	missense	45.40	40.58	SNP	1.000	A	321	386
GJD2	57369	genome.wustl.edu	37	15	35044752	35044752	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr15:35044752C>T	ENST00000290374.4	-	2	1369	c.893G>A	c.(892-894)cGt>cAt	p.R298H	RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	298					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GTCCTTGTTACGAATCTCATA	0.537													ENSG00000159248																																					0													87.0	73.0	77.0					15																	35044752		2201	4298	6499	SO:0001583	missense	0			-	AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.893G>A	15.37:g.35044752C>T	ENSP00000290374:p.Arg298His		Q2M241|Q9P2R0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.R298H	ENST00000290374.4	37	c.893	CCDS10040.1	15	.	.	.	.	.	.	.	.	.	.	C	21.9	4.217329	0.79352	.	.	ENSG00000159248	ENST00000290374	D	0.98221	-4.8	5.86	5.86	0.93980	.	1.877190	0.02285	N	0.069770	D	0.98416	0.9473	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.64410	0.925	D	0.90709	0.4626	10	0.36615	T	0.2	.	20.1864	0.98220	0.0:1.0:0.0:0.0	.	298	Q9UKL4	CXD2_HUMAN	H	298	ENSP00000290374:R298H	ENSP00000290374:R298H	R	-	2	0	GJD2	32832044	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.818000	0.86416	2.781000	0.95711	0.650000	0.86243	CGT	-	GJD2	-	NULL		0.537	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	HGNC	protein_coding	OTTHUMT00000251875.2	0	0	0	106	106	85	0.00	0.00	C			35044752	-1	20	36	57	52	tier1	no_errors	ENST00000290374	ensembl	human	known	74_37	missense	25.97	40.91	SNP	1.000	T	20	57
FRS3	10817	genome.wustl.edu	37	6	41745817	41745817	+	5'UTR	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr6:41745817G>A	ENST00000373018.3	-	0	182				FRS3_ENST00000259748.2_5'UTR|FRS3_ENST00000466420.1_5'UTR|PRICKLE4_ENST00000359201.5_5'Flank|PRICKLE4_ENST00000458694.1_5'Flank	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3						fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCATGGGGAAGGGTTCCCACT	0.582											OREG0004072	type=REGULATORY REGION|Gene=FRS3|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	ENSG00000137218																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.-70C>T	6.37:g.41745817G>A		903	Q5T3D5	R	SNP	-	NULL	ENST00000373018.3	37	NULL	CCDS4860.1	6																																																																																			-	FRS3	-	-		0.582	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS3	HGNC	protein_coding	OTTHUMT00000040532.2	0	0	0	86	86	82	0.00	0.00	G	NM_006653		41745817	-1	210	326	985	1618	tier1	no_errors	ENST00000466420	ensembl	human	known	74_37	rna	17.56	16.73	SNP	0.538	A	210	985
FLNA	2316	genome.wustl.edu	37	X	153591107	153591107	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chrX:153591107C>T	ENST00000369850.3	-	16	2562	c.2326G>A	c.(2326-2328)Ggc>Agc	p.G776S	FLNA_ENST00000422373.1_Missense_Mutation_p.G776S|FLNA_ENST00000360319.4_Missense_Mutation_p.G776S|FLNA_ENST00000344736.4_Missense_Mutation_p.G776S	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	776					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACTCCGGGGCCGTATACTTTG	0.637													ENSG00000196924																																					0													25.0	28.0	27.0					X																	153591107		2029	4152	6181	SO:0001583	missense	0			-	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.2326G>A	X.37:g.153591107C>T	ENSP00000358866:p.Gly776Ser		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.G776S	ENST00000369850.3	37	c.2326	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352607	0.82132	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9	5.43	5.43	0.79202	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.97346	0.9132	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98487	1.0608	10	0.87932	D	0	.	18.3446	0.90317	0.0:1.0:0.0:0.0	.	776;776	P21333-2;P21333	.;FLNA_HUMAN	S	776;749;776;776;776	ENSP00000353467:G776S;ENSP00000416926:G776S;ENSP00000358866:G776S;ENSP00000358863:G776S	ENSP00000358863:G776S	G	-	1	0	FLNA	153244301	1.000000	0.71417	0.846000	0.33378	0.405000	0.30901	7.818000	0.86416	2.272000	0.75746	0.529000	0.55759	GGC	-	FL	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.637	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FL	HGNC	protein_coding	OTTHUMT00000058942.3	0	0	0	182	182	51	0.00	0.00	C			153591107	-1	98	26	43	13	tier1	no_errors	ENST00000369850	ensembl	human	known	74_37	missense	69.50	66.67	SNP	1.000	T	98	43
MTTP	4547	genome.wustl.edu	37	4	100521804	100521804	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr4:100521804G>A	ENST00000265517.5	+	9	1353	c.1150G>A	c.(1150-1152)Gac>Aac	p.D384N	RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000511045.1_Missense_Mutation_p.D411N|MTTP_ENST00000457717.1_Missense_Mutation_p.D384N			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	384	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.		D -> A (in dbSNP:rs17029215). {ECO:0000269|PubMed:8939939}.		cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TTTCAAAAGTGACAGCAGCAT	0.433													ENSG00000138823																																					0													109.0	108.0	108.0					4																	100521804		2203	4300	6503	SO:0001583	missense	0			-		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1150G>A	4.37:g.100521804G>A	ENSP00000265517:p.Asp384Asn		A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.D384N	ENST00000265517.5	37	c.1150	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772568	0.31411	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517;ENST00000538053	T;T;T	0.39229	1.09;1.09;1.09	4.86	3.14	0.36123	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.664814	0.16092	N	0.230019	T	0.33789	0.0875	L	0.57536	1.79	0.09310	N	1	P;B	0.35226	0.491;0.351	B;B	0.32022	0.139;0.061	T	0.14282	-1.0478	10	0.15066	T	0.55	-13.1503	9.1662	0.37052	0.235:0.0:0.765:0.0	.	411;384	E9PBP6;P55157	.;MTP_HUMAN	N	411;384;384;384	ENSP00000427679:D411N;ENSP00000400821:D384N;ENSP00000265517:D384N	ENSP00000265517:D384N	D	+	1	0	MTTP	100740827	0.814000	0.29104	0.528000	0.27938	0.896000	0.52359	2.506000	0.45433	0.461000	0.27071	0.655000	0.94253	GAC	-	MTTP	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N		0.433	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	0	0	1	134	134	96	0.00	1.03	G			100521804	+1	46	42	73	73	tier1	no_errors	ENST00000265517	ensembl	human	known	74_37	missense	38.66	36.52	SNP	0.190	A	46	73
RTL1	388015	genome.wustl.edu	37	14	101347411	101347411	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr14:101347411C>T	ENST00000534062.1	-	1	3773	c.3715G>A	c.(3715-3717)Gac>Aac	p.D1239N	MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1239					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CGTTGCAGGTCGTCTTGCAGG	0.637													ENSG00000254656																																					0													18.0	19.0	19.0					14																	101347411		1568	3580	5148	SO:0001583	missense	0			-		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3715G>A	14.37:g.101347411C>T	ENSP00000435342:p.Asp1239Asn		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.D1239N	ENST00000534062.1	37	c.3715	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651895	0.88056	.	.	ENSG00000254656	ENST00000534062	T	0.46451	0.87	3.48	3.48	0.39840	.	0.000000	0.36555	N	0.002533	T	0.46833	0.1413	L	0.29908	0.895	0.26988	N	0.965217	D	0.89917	1.0	D	0.67103	0.949	T	0.21895	-1.0232	10	0.42905	T	0.14	.	10.771	0.46323	0.0:1.0:0.0:0.0	.	1239	E9PKS8	.	N	1239	ENSP00000435342:D1239N	ENSP00000435342:D1239N	D	-	1	0	RTL1	100417164	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.960000	0.29253	2.239000	0.73571	0.655000	0.94253	GAC	-	RTL1	-	NULL		0.637	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	0	0	0	136	136	40	0.00	0.00	C	NM_001134888		101347411	-1	43	8	83	23	tier1	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	33.86	25.81	SNP	1.000	T	43	83
NOTCH4	4855	genome.wustl.edu	37	6	32188317	32188317	+	Missense_Mutation	SNP	C	C	T	rs144492578	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr6:32188317C>T	ENST00000375023.3	-	6	1162	c.1024G>A	c.(1024-1026)Gtg>Atg	p.V342M		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	342	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTCACACACACGCAGTGAAAG	0.612													ENSG00000204301	C|||	2	0.000399361	0.0015	0.0	5008	,	,		18417	0.0		0.0	False		,,,				2504	0.0																0								C	MET/VAL	3,3019		0,3,1508	102.0	100.0	101.0		1024	4.9	1.0	6	dbSNP_134	101	0,5418		0,0,2709	yes	missense	NOTCH4	NM_004557.3	21	0,3,4217	TT,TC,CC		0.0,0.0993,0.0355	probably-damaging	342/2004	32188317	3,8437	1511	2709	4220	SO:0001583	missense	0			-		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1024G>A	6.37:g.32188317C>T	ENSP00000364163:p.Val342Met		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.V342M	ENST00000375023.3	37	c.1024	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154163	0.78114	9.93E-4	0.0	ENSG00000204301	ENST00000375023	D	0.91894	-2.93	4.9	4.9	0.64082	EGF-like region, conserved site (2);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.39687	N	0.001289	D	0.93779	0.8011	L	0.55103	1.725	0.80722	D	1	D;P	0.89917	1.0;0.915	D;B	0.97110	1.0;0.378	D	0.93414	0.6771	10	0.48119	T	0.1	.	15.6115	0.76721	0.0:1.0:0.0:0.0	.	342;342	Q6P3V5;Q99466	.;NOTC4_HUMAN	M	342	ENSP00000364163:V342M	ENSP00000364163:V342M	V	-	1	0	NOTCH4	32296295	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	5.366000	0.66122	2.539000	0.85634	0.491000	0.48974	GTG	rs144492578	NOTCH4	-	pirsf_Notch,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	0	0	1	111	111	70	0.00	1.41	C			32188317	-1	42	35	41	45	tier1	no_errors	ENST00000375023	ensembl	human	known	74_37	missense	50.60	43.75	SNP	1.000	T	42	41
ZNF850	342892	genome.wustl.edu	37	19	37266238	37266238	+	5'Flank	DEL	C	C	-			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr19:37266238delC	ENST00000591344.1	-	0	0				ZNF850_ENST00000589390.1_5'Flank|CTD-2162K18.4_ENST00000590750.1_Intron|CTD-2162K18.3_ENST00000588717.1_lincRNA	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACCAAATACACCTACAGGAGT	0.438													ENSG00000267353																																					0																																										SO:0001631	upstream_gene_variant	0				BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14			19.37:g.37266238delC	Exception_encountered			R	DEL	-	NULL	ENST00000591344.1	37	NULL	CCDS59379.1	19																																																																																				CTD-2162K18.3	-	-		0.438	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267353	Clone_based_vega_gene	protein_coding	OTTHUMT00000453557.1	0	0	0	71	71	157	0.00	0.00	C	XM_001720258		37266238	-1	12	47	26	112	tier1	no_errors	ENST00000588717	ensembl	human	known	74_37	rna	31.58	29.56	DEL	0.043	-	12	26
FAM163A	148753	genome.wustl.edu	37	1	179783087	179783087	+	Silent	SNP	G	G	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr1:179783087G>T	ENST00000341785.4	+	5	663	c.267G>T	c.(265-267)ggG>ggT	p.G89G	RP11-12M5.3_ENST00000415218.1_RNA|RP11-12M5.3_ENST00000453051.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	89						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						AGCCCTGTGGGGTGGCCGCGA	0.667													ENSG00000143340																																					0													33.0	31.0	32.0					1																	179783087		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.267G>T	1.37:g.179783087G>T			A8K8R7	Silent	SNP	NULL	p.G89	ENST00000341785.4	37	c.267	CCDS1333.1	1																																																																																			-	FAM163A	-	NULL		0.667	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM163A	HGNC	protein_coding	OTTHUMT00000085300.1	0	0	0	78	78	13	0.00	0.00	G	NM_173509		179783087	+1	26	11	34	7	tier1	no_errors	ENST00000341785	ensembl	human	known	74_37	silent	43.33	61.11	SNP	0.638	T	26	34
HAUS7	55559	genome.wustl.edu	37	X	152722238	152722238	+	Intron	SNP	C	C	T			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chrX:152722238C>T	ENST00000370211.4	-	6	520				HAUS7_ENST00000484394.1_Intron|TREX2_ENST00000334497.2_Intron|TREX2_ENST00000338525.2_Intron|HAUS7_ENST00000370212.3_Intron|TREX2_ENST00000330912.2_Intron|HAUS7_ENST00000421080.2_Intron|TREX2_ENST00000370232.1_Intron	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						AGCCCCACCGCGCAGAATCCT	0.667													ENSG00000213397																																					0																																										SO:0001627	intron_variant	0			-	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.477-129G>A	X.37:g.152722238C>T			B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	R	SNP	-	NULL	ENST00000370211.4	37	NULL	CCDS35438.1	X																																																																																			-	HAUS7	-	-		0.667	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HAUS7	HGNC	protein_coding	OTTHUMT00000060963.2	0	0	0	25	25	11	0.00	0.00	C	NM_017518		152722238	-1	12	11	2	0	tier1	no_errors	ENST00000464993	ensembl	human	known	74_37	rna	85.71	100.00	SNP	0.001	T	12	2
RABEP1	9135	genome.wustl.edu	37	17	5253801	5253801	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:5253801G>A	ENST00000546142.2	+	7	1027	c.840G>A	c.(838-840)tgG>tgA	p.W280*	RABEP1_ENST00000262477.6_Nonsense_Mutation_p.W280*|RABEP1_ENST00000341923.6_Nonsense_Mutation_p.W280*|RABEP1_ENST00000408982.2_Nonsense_Mutation_p.W280*|RABEP1_ENST00000537505.1_Nonsense_Mutation_p.W237*			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	280					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						AACATACGTGGCAGAAGGCCA	0.448													ENSG00000029725																																					0													89.0	87.0	88.0					17																	5253801		1945	4145	6090	SO:0001587	stop_gained	0			-	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.840G>A	17.37:g.5253801G>A	ENSP00000437701:p.Trp280*		B2RAG7|O95369|Q8IVX3	Nonsense_Mutation	SNP	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.W280*	ENST00000546142.2	37	c.840	CCDS45592.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.378856	0.98248	.	.	ENSG00000029725	ENST00000262477;ENST00000408982;ENST00000539669;ENST00000546142;ENST00000341923;ENST00000537505	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-7.8874	19.2026	0.93717	0.0:0.0:1.0:0.0	.	.	.	.	X	280;280;273;280;280;237	.	ENSP00000262477:W280X	W	+	3	0	RABEP1	5194525	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.266000	0.95659	2.850000	0.98022	0.650000	0.86243	TGG	-	RABEP1	-	NULL		0.448	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEP1	HGNC	protein_coding	OTTHUMT00000439349.1	0	0	0	74	74	130	0.00	0.00	G	NM_004703		5253801	+1	5	17	44	157	tier1	no_errors	ENST00000262477	ensembl	human	known	74_37	nonsense	10.20	9.77	SNP	1.000	A	5	44
C1QTNF1	114897	genome.wustl.edu	37	17	77044218	77044219	+	3'UTR	INS	-	-	GCTGACCCCAGGGCTCAGCACCAG	rs3833103|rs11271151	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:77044218_77044219insGCTGACCCCAGGGCTCAGCACCAG	ENST00000339142.2	+	0	1449_1450				C1QTNF1_ENST00000580454.1_3'UTR|C1QTNF1_ENST00000581774.1_3'UTR|C1QTNF1_ENST00000579760.1_3'UTR|C1QTNF1_ENST00000578229.1_3'UTR|C1QTNF1_ENST00000311661.4_3'UTR|C1QTNF1_ENST00000583904.1_3'UTR|C1QTNF1_ENST00000582625.1_3'UTR|C1QTNF1_ENST00000580474.1_3'UTR|C1QTNF1_ENST00000354124.3_3'UTR|C1QTNF1_ENST00000392445.2_3'UTR	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1						negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			CCCTGCGCTGTGCTGACCCCAC	0.629													ENSG00000173918		1705	0.340455	0.2844	0.3732	5008	,	,		18061	0.5694		0.166	False		,,,				2504	0.3364																0																																										SO:0001624	3_prime_UTR_variant	0				AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.*49->GCTGACCCCAGGGCTCAGCACCAG	17.37:g.77044218_77044219insGCTGACCCCAGGGCTCAGCACCAG			Q6ZMH6|Q96NF2|Q9GZR4	R	INS	-	NULL	ENST00000339142.2	37	NULL	CCDS11761.1	17																																																																																				C1QTNF1	-	-		0.629	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF1	HGNC	protein_coding	OTTHUMT00000437388.2	0	0	0	18	18	18	0.00	0.00	-	NM_030968		77044219	+1	0	0	2	2	tier1	no_errors	ENST00000582625	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.000:0.002	GCTGACCCCAGGGCTCAGCACCAG	0	2
UPK3B	80761	genome.wustl.edu	37	7	76144537	76144538	+	Frame_Shift_Ins	INS	-	-	GGGGCTGGGGGAGATGG			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr7:76144537_76144538insGGGGCTGGGGGAGATGG	ENST00000257632.5	+	4	1060_1061	c.932_933insGGGGCTGGGGGAGATGG	c.(931-936)atggggfs	p.MG311fs	UPK3B_ENST00000443097.2_3'UTR|UPK3B_ENST00000448265.3_Frame_Shift_Ins_p.MG311fs|UPK3B_ENST00000334348.3_3'UTR|UPK3B_ENST00000419923.2_Frame_Shift_Ins_p.MG311fs|UPK3B_ENST00000394849.1_Frame_Shift_Ins_p.MG256fs			Q9BT76	UPK3B_HUMAN	uroplakin 3B	311					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				CCTCTTTGCATGGGGCTGGGGG	0.693													ENSG00000243566																																					0																																										SO:0001589	frameshift_variant	0				BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.933_949dupGGGGCTGGGGGAGATGG	7.37:g.76144537_76144538insGGGGCTGGGGGAGATGG	ENSP00000257632:p.Met311fs		A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Frame_Shift_Ins	INS	NULL	p.G315fs	ENST00000257632.5	37	c.932_933	CCDS5588.1	7																																																																																				UPK3B	-	NULL		0.693	UPK3B-002	KNOWN	basic|CCDS	protein_coding	UPK3B	HGNC	protein_coding	OTTHUMT00000313978.2	0	0	0	5	5	5	0.00	0.00	-	NM_030570		76144538	+1	0	0	2	2	tier1	no_errors	ENST00000257632	ensembl	human	known	74_37	frame_shift_ins	0.00	0.00	INS	0.004:0.021	GGGGCTGGGGGAGATGG	0	2
ATXN8OS	6315	genome.wustl.edu	37	13	70713513	70713533	+	RNA	DEL	CTACTGCTGCTGCTGCTGCTG	CTACTGCTGCTGCTGCTGCTG	-	rs566930154|rs143757288|rs633100|rs5002471|rs4296152|rs377274687|rs547120017|rs370770198|rs112128542	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	CTACTGCTGCTGCTGCTGCTG	CTACTGCTGCTGCTGCTGCTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr13:70713513_70713533delCTACTGCTGCTGCTGCTGCTG	ENST00000414504.2	+	0	1100_1120					NR_002717.2				ATXN8 opposite strand (non-protein coding)																		actactactactactgctgctgctgctgctgctgctgctgc	0.398													ENSG00000230223																																					0																																												0				AF126749		13q21	2012-10-19	2008-08-13	2006-07-18	ENSG00000230223	ENSG00000230223		"""Long non-coding RNAs"", ""-"""	10561	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 3"""	603680	"""spinocerebellar ataxia 8"", ""kelch-like 1 antisense (Drosophila)"""	SCA8, KLHL1AS		10192387, 16804541	Standard	NR_002717		Approved	NCRNA00003	uc010aej.1		OTTHUMG00000017057		13.37:g.70713513_70713533delCTACTGCTGCTGCTGCTGCTG				R	DEL	-	NULL	ENST00000414504.2	37	NULL		13																																																																																				ATXN8OS	-	-		0.398	ATXN8OS-002	KNOWN	basic	antisense	ATXN8OS	HGNC	antisense	OTTHUMT00000045233.2	0	0	0	1	1	1	0.00	0.00	CTACTGCTGCTGCTGCTGCTG	NR_002717		70713533	+1	0	0	0	0	tier1	no_errors	ENST00000414504	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.001:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000	-	0	0
DEFB104B	503618	genome.wustl.edu	37	8	7332563	7332563	+	Missense_Mutation	SNP	T	T	C	rs200740890		TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr8:7332563T>C	ENST00000316169.2	-	1	41	c.28A>G	c.(28-30)Att>Gtt	p.I10V		NM_001040702.1	NP_001035792.1	Q8WTQ1	D104A_HUMAN	defensin, beta 104B	10			I -> V (in dbSNP:rs2680507). {ECO:0000269|PubMed:11481241, ECO:0000269|PubMed:15489334}.		defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)									COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		AGAAGAGAAATGGCTAATAGC	0.502													ENSG00000177023																																					0													5.0	4.0	4.0					8																	7332563		1628	2812	4440	SO:0001583	missense	0			-		CCDS34812.1	8p23.1	2011-03-29			ENSG00000177023	ENSG00000177023		"""Defensins, beta"""	26165	protein-coding gene	gene with protein product							Standard	NM_001040702		Approved		uc003wrn.3	Q8WTQ1	OTTHUMG00000149986	ENST00000316169.2:c.28A>G	8.37:g.7332563T>C	ENSP00000322191:p.Ile10Val		Q496I2|Q496I3|Q496I4	Missense_Mutation	SNP	NULL	p.I10V	ENST00000316169.2	37	c.28	CCDS34812.1	8	.	.	.	.	.	.	.	.	.	.	T	2.033	-0.421928	0.04734	.	.	ENSG00000177023	ENST00000316169	T	0.14144	2.53	2.6	-1.3	0.09259	.	.	.	.	.	T	0.07683	0.0193	.	.	.	0.80722	P	0.0	B	0.11235	0.004	B	0.04013	0.001	T	0.32322	-0.9911	7	0.32370	T	0.25	.	5.6826	0.17784	0.0:0.4706:0.0:0.5294	.	10	Q8WTQ1	D104A_HUMAN	V	10	ENSP00000322191:I10V	ENSP00000322191:I10V	I	-	1	0	DEFB104B	7319973	0.000000	0.05858	0.005000	0.12908	0.026000	0.11368	-0.670000	0.05256	-0.133000	0.11537	0.369000	0.22263	ATT	rs200740890	DEFB104B	-	NULL		0.502	DEFB104B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB104B	HGNC	protein_coding	OTTHUMT00000315230.1	0	0	0	27	27	1	0.00	0.00	T			7332563	-1	4	0	28	2	tier1	no_errors	ENST00000316169	ensembl	human	known	74_37	missense	12.50	0.00	SNP	0.005	C	4	28
SCPEP1	59342	genome.wustl.edu	37	17	55062464	55062465	+	Intron	INS	-	-	GAAAA	rs34242828|rs397829366|rs3056052|rs573491470	byFrequency	TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:55062464_55062465insGAAAA	ENST00000262288.3	+	3	280				RP5-1107A17.4_ENST00000572877.1_RNA|SCPEP1_ENST00000571898.1_Intron	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1						negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					agactctgtctgaaaagaaaag	0.475													ENSG00000263120																																					0																																										SO:0001627	intron_variant	0				AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.226-274->GAAAA	17.37:g.55062470_55062474dupGAAAA			Q96A94|Q9H3F0	R	INS	-	NULL	ENST00000262288.3	37	NULL	CCDS11593.1	17																																																																																				RP5-1107A17.4	-	-		0.475	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263120	Clone_based_vega_gene	protein_coding	OTTHUMT00000440622.1	0	0	0	0	0	0	0.00	0.00	-	NM_021626		55062465	+1	0	0	0	0	tier1	no_errors	ENST00000572877	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.001:0.001	GAAAA	0	0
GOLGA6L6	727832	genome.wustl.edu	37	15	20740571	20740571	+	Missense_Mutation	SNP	T	T	C	rs200650686		TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr15:20740571T>C	ENST00000427390.2	-	8	1269	c.1179A>G	c.(1177-1179)atA>atG	p.I393M		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	393	Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ccagctcccgtatcttctcct	0.562													ENSG00000215405																																					0													1.0	1.0	1.0					15																	20740571		66	48	114	SO:0001583	missense	0			-	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1179A>G	15.37:g.20740571T>C	ENSP00000398615:p.Ile393Met		D3YTC0	Missense_Mutation	SNP	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.I393M	ENST00000427390.2	37	c.1179	CCDS45184.1	15	.	.	.	.	.	.	.	.	.	.	t	1.235	-0.622956	0.03636	.	.	ENSG00000215405	ENST00000427390	T	0.12039	2.72	.	.	.	.	.	.	.	.	T	0.04272	0.0118	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.35351	-0.9792	6	0.33141	T	0.24	.	.	.	.	.	393	A8MZA4	GG6L6_HUMAN	M	393	ENSP00000398615:I393M	ENSP00000398615:I393M	I	-	3	3	GOLGA6L6	19000585	0.254000	0.23992	0.018000	0.16275	0.018000	0.09664	0.755000	0.26405	-1.371000	0.02141	-1.353000	0.01230	ATA	rs200650686	GOLGA6L6	-	prints_Tropomyosin		0.562	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	HGNC	protein_coding	OTTHUMT00000414660.3	0	0	0	14	14	0	0.00	0.00	T	NM_001145004		20740571	-1	3	0	7	0	tier1	no_errors	ENST00000427390	ensembl	human	known	74_37	missense	30.00	0.00	SNP	0.096	C	3	7
EVPLL	645027	genome.wustl.edu	37	17	18286742	18286742	+	Intron	DEL	G	G	-			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr17:18286742delG	ENST00000399134.4	+	8	1138				RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like											NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						gggcggggaaggggggggtgg	0.731													ENSG00000264177																																					0										34,91,2697		10,0,14,18,55,1314	5.0	6.0	6.0			0.5	0.0	17		6	52,156,5780		10,0,32,18,120,2814	no	intron	EVPLL	NM_001145127.1		20,0,46,36,175,4128	A1A1,A1A2,A1R,A2A2,A2R,RR		3.4736,4.4295,3.7798			18286742	86,247,8477	657	1510	2167	SO:0001627	intron_variant	0					CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.780+50G>-	17.37:g.18286742delG			B4DPD4	R	DEL	-	NULL	ENST00000399134.4	37	NULL	CCDS45626.1	17																																																																																				RP1-37N7.1	-	-		0.731	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC101928729	Clone_based_vega_gene	protein_coding	OTTHUMT00000130836.2	0	0	0	25	25	0	0.00	0.00	G	NM_001145127		18286742	-1	2	0	19	0	tier1	no_errors	ENST00000579352	ensembl	human	known	74_37	rna	9.52	0.00	DEL	0.026	-	2	19
RBMXL2	27288	genome.wustl.edu	37	11	7110476	7110476	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr11:7110476A>G	ENST00000306904.5	+	1	312	c.125A>G	c.(124-126)gAc>gGc	p.D42G		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	42	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTGATGAAAGACCGAGAAACC	0.582													ENSG00000170748																																					0													44.0	43.0	43.0					11																	7110476		2201	4296	6497	SO:0001583	missense	0			-	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.125A>G	11.37:g.7110476A>G	ENSP00000304139:p.Asp42Gly		Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.D42G	ENST00000306904.5	37	c.125	CCDS7777.1	11	.	.	.	.	.	.	.	.	.	.	A	18.65	3.668814	0.67814	.	.	ENSG00000170748	ENST00000306904	D	0.91792	-2.91	2.39	2.39	0.29439	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	D	0.94899	0.8351	M	0.81942	2.565	0.58432	D	0.999999	D	0.64830	0.994	D	0.77004	0.989	D	0.94111	0.7371	10	0.66056	D	0.02	.	8.6459	0.34005	1.0:0.0:0.0:0.0	.	42	O75526	HNRGT_HUMAN	G	42	ENSP00000304139:D42G	ENSP00000304139:D42G	D	+	2	0	RBMXL2	7067052	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.685000	0.91246	1.330000	0.45394	0.374000	0.22700	GAC	-	RBMXL2	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom		0.582	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	HGNC	protein_coding	OTTHUMT00000384552.1	0	0	0	72	72	90	0.00	0.00	A	NM_014469		7110476	+1	6	3	60	91	tier1	no_errors	ENST00000306904	ensembl	human	known	74_37	missense	9.09	3.19	SNP	1.000	G	6	60
SLC17A6	57084	genome.wustl.edu	37	11	22363276	22363276	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr11:22363276G>A	ENST00000263160.3	+	2	726	c.289G>A	c.(289-291)Gac>Aac	p.D97N		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	97					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GGCCATTGTGGACATGGTCAA	0.647													ENSG00000091664																																					0													76.0	62.0	67.0					11																	22363276		2203	4300	6503	SO:0001583	missense	0			-	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.289G>A	11.37:g.22363276G>A	ENSP00000263160:p.Asp97Asn		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D97N	ENST00000263160.3	37	c.289	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618470	0.66787	.	.	ENSG00000091664	ENST00000263160	T	0.57752	0.38	5.86	5.86	0.93980	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.044121	0.85682	D	0.000000	T	0.61689	0.2367	M	0.76170	2.325	0.47245	D	0.999367	B	0.20780	0.048	B	0.33121	0.158	T	0.56697	-0.7936	10	0.34782	T	0.22	.	20.1986	0.98248	0.0:0.0:1.0:0.0	.	97	Q9P2U8	VGLU2_HUMAN	N	97	ENSP00000263160:D97N	ENSP00000263160:D97N	D	+	1	0	SLC17A6	22319852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.298000	0.51818	2.781000	0.95711	0.650000	0.86243	GAC	-	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.647	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	0	0	0	212	212	62	0.00	0.00	G	NM_020346		22363276	+1	18	3	160	84	tier1	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	10.11	3.45	SNP	1.000	A	18	160
OR8B8	26493	genome.wustl.edu	37	11	124310339	124310339	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6BH-01A-12D-A307-09	TCGA-DX-A6BH-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	98f225b0-b093-4073-98ee-cbd5999e7912	2c5832b3-1c6f-4176-8191-6d4b43a5391e	g.chr11:124310339A>G	ENST00000328064.2	-	1	715	c.643T>C	c.(643-645)Ttc>Ctc	p.F215L		NM_012378.1	NP_036510.1	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B, member 8	215					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TAGGAAATGAAGATGGTGACT	0.493													ENSG00000197125																																					0													188.0	161.0	170.0					11																	124310339		2201	4299	6500	SO:0001583	missense	0			-	AF238488	CCDS8446.1	11q24.2	2012-08-09			ENSG00000197125	ENSG00000197125		"""GPCR / Class A : Olfactory receptors"""	8477	protein-coding gene	gene with protein product						9119360	Standard	NM_012378		Approved	TPCR85	uc010sal.2	Q15620	OTTHUMG00000165917	ENST00000328064.2:c.643T>C	11.37:g.124310339A>G	ENSP00000330280:p.Phe215Leu		A1L446|Q96RC8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F215L	ENST00000328064.2	37	c.643	CCDS8446.1	11	.	.	.	.	.	.	.	.	.	.	A	7.878	0.729657	0.15507	.	.	ENSG00000197125	ENST00000328064	T	0.00017	9.09	3.67	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.128358	0.35495	N	0.003169	T	0.00039	0.0001	N	0.01352	-0.895	0.37093	D	0.899541	B	0.26512	0.151	B	0.30782	0.12	T	0.14227	-1.0480	10	0.05525	T	0.97	.	3.2323	0.06752	0.5588:0.0:0.1038:0.3374	.	215	Q15620	OR8B8_HUMAN	L	215	ENSP00000330280:F215L	ENSP00000330280:F215L	F	-	1	0	OR8B8	123815549	0.000000	0.05858	1.000000	0.80357	0.748000	0.42578	-0.228000	0.09114	1.896000	0.54893	0.455000	0.32223	TTC	-	OR8B8	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.493	OR8B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B8	HGNC	protein_coding	OTTHUMT00000387056.1	0	0	0	88	88	131	0.00	0.00	A	NM_012378		124310339	-1	4	2	40	110	tier1	no_errors	ENST00000328064	ensembl	human	known	74_37	missense	9.09	1.79	SNP	0.998	G	4	40
