#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
DSCAM	1826	genome.wustl.edu	37	21	41416026	41416026	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr21:41416026C>T	ENST00000400454.1	-	31	5839	c.5362G>A	c.(5362-5364)Gtc>Atc	p.V1788I		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1788					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GAGGGGCTGACGCTGTAACTG	0.637													ENSG00000171587																									Melanoma(134;970 1778 1785 21664 32388)												0													109.0	117.0	114.0					21																	41416026		2186	4294	6480	SO:0001583	missense	0			-	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5362G>A	21.37:g.41416026C>T	ENSP00000383303:p.Val1788Ile		O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1788I	ENST00000400454.1	37	c.5362	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	c	20.3	3.961060	0.74016	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.60040	0.22;0.32	5.53	5.53	0.82687	.	0.060719	0.64402	D	0.000003	T	0.66167	0.2762	L	0.27053	0.805	0.37713	D	0.924639	D	0.76494	0.999	D	0.71184	0.972	T	0.68723	-0.5333	10	0.42905	T	0.14	.	19.4936	0.95062	0.0:1.0:0.0:0.0	.	1788	O60469	DSCAM_HUMAN	I	1788;1540	ENSP00000383303:V1788I;ENSP00000385342:V1540I	ENSP00000383303:V1788I	V	-	1	0	DSCAM	40337896	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	6.003000	0.70701	2.605000	0.88082	0.655000	0.94253	GTC	-	DSCAM	-	NULL		0.637	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	0	0	0	25	25	57	0.00	0.00	C	NM_001389		41416026	-1	16	51	17	36	tier1	no_errors	ENST00000400454	ensembl	human	known	74_37	missense	48.48	58.62	SNP	1.000	T	16	17
TMEM131	23505	genome.wustl.edu	37	2	98428883	98428883	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:98428883C>A	ENST00000186436.5	-	17	2092		c.e17+1			NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						AGTTTACTTACCGATGATTGA	0.338													ENSG00000075568																																					0													90.0	84.0	86.0					2																	98428883		1841	4091	5932	SO:0001630	splice_region_variant	0			-	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1863+1G>T	2.37:g.98428883C>A				Splice_Site	SNP	-	e17+1	ENST00000186436.5	37	c.1863+1	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093046	0.76756	.	.	ENSG00000075568	ENST00000186436	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3239	0.87242	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM131	97795315	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	6.072000	0.71238	2.832000	0.97577	0.655000	0.94253	.	-	TMEM131	-	-		0.338	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	0	0	0	48	48	87	0.00	0.00	C	XM_371542	Intron	98428883	-1	66	81	39	69	tier1	no_errors	ENST00000186436	ensembl	human	known	74_37	splice_site	62.86	53.64	SNP	1.000	A	66	39
FSTL4	23105	genome.wustl.edu	37	5	132902896	132902896	+	Silent	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:132902896A>G	ENST00000265342.7	-	3	390	c.141T>C	c.(139-141)ttT>ttC	p.F47F		NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	47						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTGTGACTTCAAAGCTTCTGG	0.348													ENSG00000053108																																					0													99.0	102.0	101.0					5																	132902896		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.141T>C	5.37:g.132902896A>G			Q8TBU0|Q9UPU1	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal_dom,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.F47	ENST00000265342.7	37	c.141	CCDS34238.1	5																																																																																			-	FSTL4	-	NULL		0.348	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	HGNC	protein_coding	OTTHUMT00000370212.1	0	0	0	56	56	99	0.00	0.00	A	XM_048786		132902896	-1	12	27	58	95	tier1	no_errors	ENST00000265342	ensembl	human	known	74_37	silent	17.14	22.13	SNP	1.000	G	12	58
ZNF80	7634	genome.wustl.edu	37	3	113955795	113955795	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:113955795C>T	ENST00000482457.2	-	1	630	c.127G>A	c.(127-129)Gtt>Att	p.V43I	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	43					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				CCCTCACGAACCAAAGTGTCT	0.498													ENSG00000174255																									GBM(23;986 1114 21716)												0													119.0	109.0	113.0					3																	113955795		2203	4300	6503	SO:0001583	missense	0			-	X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.127G>A	3.37:g.113955795C>T	ENSP00000417192:p.Val43Ile		Q6NSW4|Q6NT14	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V43I	ENST00000482457.2	37	c.127	CCDS2979.1	3	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.468697	0.01053	.	.	ENSG00000174255	ENST00000482457	T	0.05717	3.4	2.45	0.25	0.15535	.	.	.	.	.	T	0.01940	0.0061	N	0.02721	-0.515	0.09310	N	1	B	0.15719	0.014	B	0.19666	0.026	T	0.46275	-0.9203	9	0.02654	T	1	.	2.8499	0.05554	0.0:0.3751:0.2407:0.3841	.	43	P51504	ZNF80_HUMAN	I	43	ENSP00000417192:V43I	ENSP00000309812:V43I	V	-	1	0	ZNF80	115438485	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.022000	0.13511	0.040000	0.15660	-0.150000	0.13652	GTT	-	ZNF80	-	NULL		0.498	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF80	HGNC	protein_coding	OTTHUMT00000354696.2	0	0	0	52	52	101	0.00	0.00	C	NM_007136		113955795	-1	15	39	71	178	tier1	no_errors	ENST00000308095	ensembl	human	known	74_37	missense	17.44	17.89	SNP	0.002	T	15	71
IGSF1	3547	genome.wustl.edu	37	X	130408685	130408685	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408685G>A	ENST00000361420.3	-	18	3718	c.3639C>T	c.(3637-3639)atC>atT	p.I1213I	IGSF1_ENST00000370903.3_Silent_p.I1218I|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Silent_p.I1204I|IGSF1_ENST00000370904.1_Silent_p.I1204I			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1213	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						CTACGTTGTTGATGACAAAGT	0.522													ENSG00000147255																																					0													229.0	211.0	217.0					X																	130408685		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3639C>T	X.37:g.130408685G>A			B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I1218	ENST00000361420.3	37	c.3654	CCDS14629.1	X																																																																																			-	IGSF1	-	smart_Ig_sub,smart_Ig_sub2		0.522	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	0	0	0	42	42	107	0.00	0.00	G			130408685	-1	10	24	80	200	tier1	no_errors	ENST00000370903	ensembl	human	known	74_37	silent	11.11	10.71	SNP	0.983	A	10	80
PTPRT	11122	genome.wustl.edu	37	20	41419840	41419840	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:41419840A>G	ENST00000373187.1	-	3	480	c.481T>C	c.(481-483)Tat>Cat	p.Y161H	PTPRT_ENST00000373184.1_Missense_Mutation_p.Y161H|PTPRT_ENST00000373201.1_Missense_Mutation_p.Y161H|PTPRT_ENST00000373193.3_Missense_Mutation_p.Y161H|PTPRT_ENST00000356100.2_Missense_Mutation_p.Y161H|PTPRT_ENST00000373198.4_Missense_Mutation_p.Y161H|PTPRT_ENST00000373190.1_Missense_Mutation_p.Y161H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	161	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CATACCTGATAGAAATGTGGC	0.478													ENSG00000196090																																					0													96.0	100.0	99.0					20																	41419840		1967	4171	6138	SO:0001583	missense	0			-	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.481T>C	20.37:g.41419840A>G	ENSP00000362283:p.Tyr161His		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Y161H	ENST00000373187.1	37	c.481	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	A	24.8	4.567167	0.86439	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02498	4.27;4.27;4.27;4.27;4.27;4.27;4.27	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00611	-1.1645	10	0.87932	D	0	.	15.9059	0.79430	1.0:0.0:0.0:0.0	.	161;161	O14522-1;O14522	.;PTPRT_HUMAN	H	161	ENSP00000362286:Y161H;ENSP00000362283:Y161H;ENSP00000362289:Y161H;ENSP00000348408:Y161H;ENSP00000362294:Y161H;ENSP00000362280:Y161H;ENSP00000362297:Y161H	ENSP00000348408:Y161H	Y	-	1	0	PTPRT	40853254	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.339000	0.96797	2.161000	0.67846	0.459000	0.35465	TAT	-	PTPRT	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom		0.478	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	0	0	0	76	76	65	0.00	0.00	A			41419840	-1	25	31	84	113	tier1	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	22.94	21.53	SNP	1.000	G	25	84
MTHFD2L	441024	genome.wustl.edu	37	4	75041117	75041117	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:75041117C>T	ENST00000395759.2	+	3	475	c.448C>T	c.(448-450)Cca>Tca	p.P150S	MTHFD2L_ENST00000325278.6_Missense_Mutation_p.P92S|MTHFD2L_ENST00000331145.6_Missense_Mutation_p.P92S|MTHFD2L_ENST00000433372.1_Missense_Mutation_p.P15S	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	150					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			GTTACCACTACCAGGTACATA	0.333													ENSG00000163738																																					0													129.0	129.0	129.0					4																	75041117		2203	4300	6503	SO:0001583	missense	0			-	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.448C>T	4.37:g.75041117C>T	ENSP00000379108:p.Pro150Ser		Q6P079|Q8N560	Missense_Mutation	SNP	pfam_THF_DH/CycHdrlase_D-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.P150S	ENST00000395759.2	37	c.448	CCDS47075.1	4	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530470	0.85706	.	.	ENSG00000163738	ENST00000433372;ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T;T	0.38560	1.13;1.55;1.22;1.23;1.62	5.36	5.36	0.76844	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.76637	0.4015	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.989;0.999	D	0.84323	0.0517	10	0.87932	D	0	-22.9907	16.6388	0.85066	0.0:1.0:0.0:0.0	.	150;92	Q9H903;Q9H903-3	MTD2L_HUMAN;.	S	15;150;92;92;92	ENSP00000405692:P15S;ENSP00000379108:P150S;ENSP00000330982:P92S;ENSP00000352012:P92S;ENSP00000321984:P92S	ENSP00000321984:P92S	P	+	1	0	MTHFD2L	75259981	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	7.098000	0.76974	2.803000	0.96430	0.643000	0.83706	CCA	-	MTHFD2L	-	pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase		0.333	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2L	HGNC	protein_coding		0	0	0	74	74	133	0.00	0.00	C	NM_001004346		75041117	+1	36	42	134	202	tier1	no_errors	ENST00000395759	ensembl	human	known	74_37	missense	21.18	17.21	SNP	1.000	T	36	134
CCDC117	150275	genome.wustl.edu	37	22	29169758	29169758	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:29169758G>C	ENST00000249064.4	+	2	407	c.231G>C	c.(229-231)gaG>gaC	p.E77D	CCDC117_ENST00000421503.2_Missense_Mutation_p.E77D|CCDC117_ENST00000443309.2_5'UTR|CCDC117_ENST00000448492.2_Intron	NM_001284263.1|NM_001284265.1|NM_173510.2	NP_001271192.1|NP_001271194.1|NP_775781.1	Q8IWD4	CC117_HUMAN	coiled-coil domain containing 117	77								p.E77D(1)		breast(1)|kidney(1)|large_intestine(4)|upper_aerodigestive_tract(1)	7						AGGAGGAGGAGGATGATGAGT	0.368													ENSG00000159873																																					1	Substitution - Missense(1)	large_intestine(1)											301.0	264.0	277.0					22																	29169758		2203	4300	6503	SO:0001583	missense	0			-	AK091133	CCDS13846.1, CCDS63435.1, CCDS63436.1	22q12.1	2006-06-27			ENSG00000159873	ENSG00000159873			26599	protein-coding gene	gene with protein product						12477932	Standard	NM_001284263		Approved	FLJ33814	uc003aeb.3	Q8IWD4	OTTHUMG00000151091	ENST00000249064.4:c.231G>C	22.37:g.29169758G>C	ENSP00000249064:p.Glu77Asp		A8K0F1|B7Z2V1|B7Z860|Q6ICA7|Q8N278	Missense_Mutation	SNP	NULL	p.E77D	ENST00000249064.4	37	c.231	CCDS13846.1	22	.	.	.	.	.	.	.	.	.	.	G	13.46	2.245039	0.39697	.	.	ENSG00000159873	ENST00000249064;ENST00000421503	T;T	0.15256	2.44;2.46	5.03	-3.0	0.05480	.	0.305004	0.29616	N	0.011657	T	0.04634	0.0126	N	0.08118	0	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.14578	0.011;0.011	T	0.44236	-0.9341	10	0.02654	T	1	.	3.5404	0.07809	0.3397:0.0:0.3715:0.2888	.	77;77	B7Z2V1;Q8IWD4	.;CC117_HUMAN	D	77	ENSP00000249064:E77D;ENSP00000387827:E77D	ENSP00000249064:E77D	E	+	3	2	CCDC117	27499758	0.988000	0.35896	0.656000	0.29637	0.955000	0.61496	-0.014000	0.12656	-0.666000	0.05310	-0.367000	0.07326	GAG	-	CCDC117	-	NULL		0.368	CCDC117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC117	HGNC	protein_coding	OTTHUMT00000321258.1	0	0	0	65	65	143	0.00	0.00	G	NM_173510		29169758	+1	20	36	35	108	tier1	no_errors	ENST00000249064	ensembl	human	known	74_37	missense	36.36	25.00	SNP	0.860	C	20	35
PGLYRP3	114771	genome.wustl.edu	37	1	153271624	153271624	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:153271624A>G	ENST00000290722.1	-	6	864	c.812T>C	c.(811-813)aTt>aCt	p.I271T		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	271					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCTAGGGCAATATCGTTGAA	0.532													ENSG00000159527																																					0													114.0	96.0	102.0					1																	153271624		2203	4300	6503	SO:0001583	missense	0			-	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.812T>C	1.37:g.153271624A>G	ENSP00000290722:p.Ile271Thr		A1A4U8|Q5SY65	Missense_Mutation	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.I271T	ENST00000290722.1	37	c.812	CCDS1035.1	1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.007623	0.35415	.	.	ENSG00000159527	ENST00000290722	T	0.12672	2.66	4.59	4.59	0.56863	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.096973	0.43416	D	0.000566	T	0.13329	0.0323	M	0.79805	2.47	0.34518	D	0.707825	P	0.51537	0.946	P	0.50617	0.646	T	0.12785	-1.0534	10	0.17832	T	0.49	-33.1972	10.3569	0.43969	1.0:0.0:0.0:0.0	.	271	Q96LB9	PGRP3_HUMAN	T	271	ENSP00000290722:I271T	ENSP00000290722:I271T	I	-	2	0	PGLYRP3	151538248	0.719000	0.27986	0.995000	0.50966	0.782000	0.44232	4.643000	0.61390	1.700000	0.51204	0.260000	0.18958	ATT	-	PGLYRP3	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain		0.532	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	HGNC	protein_coding	OTTHUMT00000039488.1	0	0	0	53	53	89	0.00	0.00	A	NM_052891		153271624	-1	16	32	41	101	tier1	no_errors	ENST00000290722	ensembl	human	known	74_37	missense	28.07	24.06	SNP	0.995	G	16	41
DMTF1	9988	genome.wustl.edu	37	7	86811368	86811368	+	Intron	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:86811368A>G	ENST00000394703.5	+	12	1273				DMTF1_ENST00000331242.7_Intron|DMTF1_ENST00000414194.2_Intron|DMTF1_ENST00000432937.2_Intron|DMTF1_ENST00000413276.2_Intron|DMTF1_ENST00000394702.3_Missense_Mutation_p.H249R|DMTF1_ENST00000411766.2_Missense_Mutation_p.H208R	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					TTTTTCACCCACAGACAACTG	0.418													ENSG00000135164																																					0																																										SO:0001627	intron_variant	0			-	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.711-176A>G	7.37:g.86811368A>G			B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	NULL	p.H249R	ENST00000394703.5	37	c.746	CCDS5601.1	7	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518135	0.64634	.	.	ENSG00000135164	ENST00000394702;ENST00000447863;ENST00000425406;ENST00000411766	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	T	0.72946	0.3524	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76323	-0.3001	5	0.87932	D	0	.	12.3173	0.54964	1.0:0.0:0.0:0.0	.	.	.	.	R	249;249;208;208	.	ENSP00000378192:H249R	H	+	2	0	DMTF1	86649304	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.194000	0.58393	2.222000	0.72286	0.528000	0.53228	CAC	-	DMTF1	-	NULL		0.418	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	DMTF1	HGNC	protein_coding	OTTHUMT00000334025.5	0	0	0	69	69	82	0.00	0.00	A	NM_021145		86811368	+1	23	50	36	65	tier1	no_errors	ENST00000394702	ensembl	human	known	74_37	missense	38.98	43.48	SNP	1.000	G	23	36
TRIM21	6737	genome.wustl.edu	37	11	4407544	4407544	+	Intron	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:4407544C>T	ENST00000254436.7	-	6	871				TRIM21_ENST00000543625.1_Missense_Mutation_p.V249M	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21						cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		AACCCTAACACTATAACCTCC	0.468													ENSG00000132109																																					0																																										SO:0001627	intron_variant	0			-	AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.759-57G>A	11.37:g.4407544C>T			Q5XPV5|Q96RF8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Ubox_domain,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.V249M	ENST00000254436.7	37	c.745	CCDS44525.1	11	.	.	.	.	.	.	.	.	.	.	C	7.155	0.584486	0.13749	.	.	ENSG00000132109	ENST00000543625	T	0.04862	3.54	3.84	0.742	0.18341	.	2.042700	0.02175	N	0.060054	T	0.07548	0.0190	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33033	-0.9884	7	0.51188	T	0.08	.	4.6814	0.12736	0.3652:0.5265:0.0:0.1083	.	.	.	.	M	249	ENSP00000444045:V249M	ENSP00000444045:V249M	V	-	1	0	TRIM21	4364120	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.197000	0.17197	0.167000	0.19631	0.655000	0.94253	GTG	-	TRIM21	-	NULL		0.468	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM21	HGNC	protein_coding	OTTHUMT00000385842.1	0	0	0	23	23	86	0.00	0.00	C	NM_003141		4407544	-1	17	62	8	35	tier1	no_errors	ENST00000543625	ensembl	human	known	74_37	missense	65.38	63.27	SNP	0.000	T	17	8
ZNF300	91975	genome.wustl.edu	37	5	150282891	150282891	+	Intron	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:150282891A>G	ENST00000274599.5	-	3	394				ZNF300_ENST00000394226.2_Intron|ZNF300_ENST00000418587.2_Intron|ZNF300_ENST00000446148.2_Splice_Site_p.S7S|ZNF300_ENST00000427179.1_Intron	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAGCCTTACAGAAGTCTCAG	0.418													ENSG00000145908																																					0																																										SO:0001627	intron_variant	0			-	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.27-147T>C	5.37:g.150282891A>G			A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S7	ENST00000274599.5	37	c.21	CCDS4311.2	5																																																																																			-	ZNF300	-	NULL		0.418	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF300	HGNC	protein_coding		0	0	0	61	61	99	0.00	0.00	A	NM_052860		150282891	-1	22	38	94	141	tier1	no_errors	ENST00000446148	ensembl	human	known	74_37	silent	18.97	21.23	SNP	0.001	G	22	94
ESX1	80712	genome.wustl.edu	37	X	103494923	103494923	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:103494923A>T	ENST00000372588.4	-	4	1290	c.1207T>A	c.(1207-1209)Tgt>Agt	p.C403S		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	403					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						AAAAAGGGACATGCATAATAA	0.473													ENSG00000123576																									Pancreas(200;1705 2227 25194 28471 45274)												0													61.0	60.0	60.0					X																	103494923		2203	4300	6503	SO:0001583	missense	0			-	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.1207T>A	X.37:g.103494923A>T	ENSP00000361669:p.Cys403Ser		B0QYU3|Q7Z6K7	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.C403S	ENST00000372588.4	37	c.1207	CCDS14516.1	X	.	.	.	.	.	.	.	.	.	.	A	2.710	-0.268932	0.05716	.	.	ENSG00000123576	ENST00000372588	T	0.52754	0.65	4.09	1.42	0.22433	.	.	.	.	.	T	0.21427	0.0516	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19353	-1.0308	9	0.20519	T	0.43	-0.0475	2.7571	0.05296	0.1774:0.3816:0.3384:0.1025	.	403	Q8N693	ESX1_HUMAN	S	403	ENSP00000361669:C403S	ENSP00000361669:C403S	C	-	1	0	ESX1	103381579	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.154000	0.10130	0.167000	0.19631	-0.819000	0.03115	TGT	-	ESX1	-	NULL		0.473	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	HGNC	protein_coding	OTTHUMT00000057763.2	0	0	0	133	133	109	0.00	0.00	A	NM_153448		103494923	-1	33	23	103	103	tier1	no_errors	ENST00000372588	ensembl	human	known	74_37	missense	24.26	18.11	SNP	0.000	T	33	103
NEFH	4744	genome.wustl.edu	37	22	29885939	29885939	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:29885939G>A	ENST00000310624.6	+	4	2343	c.2310G>A	c.(2308-2310)gcG>gcA	p.A770A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	776	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGACTCCAGCGAAGGAGGAAG	0.542													ENSG00000100285																																					0													76.0	76.0	76.0					22																	29885939		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2310G>A	22.37:g.29885939G>A			B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	pfam_IF,pfam_DUF1388	p.A770	ENST00000310624.6	37	c.2310	CCDS13858.1	22																																																																																			-	NEFH	-	NULL		0.542	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEFH	HGNC	protein_coding	OTTHUMT00000321553.2	0	0	0	89	89	52	0.00	0.00	G	NM_021076		29885939	+1	16	21	51	28	tier1	no_errors	ENST00000310624	ensembl	human	known	74_37	silent	23.88	42.86	SNP	0.004	A	16	51
ZNF727	442319	genome.wustl.edu	37	7	63538202	63538202	+	Missense_Mutation	SNP	G	G	A	rs192720590		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:63538202G>A	ENST00000550760.3	+	4	954	c.775G>A	c.(775-777)Gaa>Aaa	p.E259K	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						CTACAAATGCGAAGAATGTCA	0.393													ENSG00000257482	g|||	1	0.000199681	0.0008	0.0	5008	,	,		19999	0.0		0.0	False		,,,				2504	0.0																0													62.0	65.0	64.0					7																	63538202		692	1591	2283	SO:0001583	missense	0			GMAF=0.0005			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.775G>A	7.37:g.63538202G>A	ENSP00000447987:p.Glu259Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E259K	ENST00000550760.3	37	c.775	CCDS55113.1	7	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	12.07	1.827161	0.32329	.	.	ENSG00000257482	ENST00000550760	T	0.16597	2.33	1.02	-0.714	0.11219	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08088	0.0202	N	0.25485	0.75	0.09310	N	1	P	0.46457	0.878	B	0.36959	0.237	T	0.25257	-1.0137	8	.	.	.	.	2.2746	0.04099	0.2834:0.3349:0.3816:0.0	.	259	A8MUV8	ZN727_HUMAN	K	259	ENSP00000447987:E259K	.	E	+	1	0	ZNF727	63175637	0.000000	0.05858	0.126000	0.21872	0.111000	0.19643	-2.222000	0.01215	0.436000	0.26393	0.436000	0.28706	GAA	rs192720590	ZNF727	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		0	0	0	44	44	21	0.00	0.00	G	NM_001159522		63538202	+1	44	18	34	19	tier1	no_errors	ENST00000550760	ensembl	human	known	74_37	missense	56.41	48.65	SNP	0.400	A	44	34
CSF2RB	1439	genome.wustl.edu	37	22	37334065	37334065	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:37334065G>C	ENST00000403662.3	+	14	2437	c.2215G>C	c.(2215-2217)Gac>Cac	p.D739H	CSF2RB_ENST00000536485.1_Missense_Mutation_p.D686H|CSF2RB_ENST00000406230.1_Missense_Mutation_p.D745H|CSF2RB_ENST00000262825.5_Missense_Mutation_p.D745H			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	739					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CCTCCCCTCAGACCAGACCCC	0.612													ENSG00000100368																																					0													57.0	64.0	61.0					22																	37334065		2203	4300	6503	SO:0001583	missense	0			-	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2215G>C	22.37:g.37334065G>C	ENSP00000384053:p.Asp739His		Q5JZI1|Q6ICE0	Missense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D745H	ENST00000403662.3	37	c.2233	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	G	10.05	1.243148	0.22796	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.92099	-2.46;-2.97;-2.97;-2.97	5.16	2.98	0.34508	.	0.841308	0.10137	N	0.711347	D	0.90212	0.6940	M	0.63428	1.95	0.09310	N	1	B;B	0.29508	0.246;0.159	B;B	0.29663	0.105;0.028	T	0.79417	-0.1812	10	0.39692	T	0.17	-7.7796	11.5954	0.50970	0.0:0.4018:0.5982:0.0	.	745;739	P32927-2;P32927	.;IL3RB_HUMAN	H	739;739;745;745;686	ENSP00000384053:D739H;ENSP00000262825:D745H;ENSP00000385271:D745H;ENSP00000440003:D686H	ENSP00000262825:D745H	D	+	1	0	CSF2RB	35664011	0.096000	0.21769	0.001000	0.08648	0.190000	0.23558	1.810000	0.38932	0.513000	0.28278	0.555000	0.69702	GAC	-	CSF2RB	-	pirsf_IL3_rcpt_beta		0.612	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	0	0	0	30	30	70	0.00	0.00	G	NM_000395		37334065	+1	102	172	32	74	tier1	no_errors	ENST00000262825	ensembl	human	known	74_37	missense	75.56	69.92	SNP	0.001	C	102	32
ARHGAP27	201176	genome.wustl.edu	37	17	43472839	43472839	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:43472839T>G	ENST00000428638.1	-	17	2652	c.2653A>C	c.(2653-2655)Atc>Ctc	p.I885L	ARHGAP27_ENST00000532891.2_Missense_Mutation_p.I863L|ARHGAP27_ENST00000528384.1_Missense_Mutation_p.I517L|CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000582826.1_5'Flank|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.I858L|ARHGAP27_ENST00000376922.2_Missense_Mutation_p.I544L|ARHGAP27_ENST00000532038.1_Missense_Mutation_p.I663L|ARHGAP27_ENST00000455881.1_Missense_Mutation_p.I544L			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	885	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					GGCGGGAAGATGTCCGCGCAC	0.687											OREG0024481	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000159314																																					0													23.0	19.0	21.0					17																	43472839		2184	4267	6451	SO:0001583	missense	0			-	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.2653A>C	17.37:g.43472839T>G	ENSP00000403323:p.Ile885Leu	916	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.I885L	ENST00000428638.1	37	c.2653		17	.	.	.	.	.	.	.	.	.	.	T	13.33	2.204940	0.38905	.	.	ENSG00000159314	ENST00000532038;ENST00000376922;ENST00000528384;ENST00000532891;ENST00000428638;ENST00000442348;ENST00000455881	T;T;T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76;2.76;2.76	4.45	3.35	0.38373	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.225301	0.36778	N	0.002415	T	0.23249	0.0562	L	0.53249	1.67	0.80722	D	1	B;P	0.47962	0.069;0.903	B;D	0.72075	0.167;0.976	T	0.01212	-1.1417	10	0.28530	T	0.3	.	8.3321	0.32193	0.0:0.0965:0.0:0.9035	.	858;885	F8WBX1;Q6ZUM4	.;RHG27_HUMAN	L	663;544;517;863;885;858;544	ENSP00000432762:I663L;ENSP00000366121:I544L;ENSP00000431591:I517L;ENSP00000433942:I863L;ENSP00000403323:I885L;ENSP00000409330:I858L;ENSP00000408235:I544L	ENSP00000366121:I544L	I	-	1	0	ARHGAP27	40828622	1.000000	0.71417	0.997000	0.53966	0.300000	0.27592	1.299000	0.33424	0.729000	0.32403	0.443000	0.29094	ATC	-	ARHGAP27	-	superfamily_Rho_GTPase_activation_prot,pfscan_RhoGAP_dom		0.687	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	HGNC	protein_coding		0	0	0	29	29	11	0.00	0.00	T	NM_199282		43472839	-1	16	6	18	17	tier1	no_errors	ENST00000428638	ensembl	human	known	74_37	missense	45.71	26.09	SNP	1.000	G	16	18
LCT	3938	genome.wustl.edu	37	2	136570168	136570168	+	Missense_Mutation	SNP	C	C	T	rs146706415	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:136570168C>T	ENST00000264162.2	-	7	2076	c.2066G>A	c.(2065-2067)cGc>cAc	p.R689H	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	689	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCTGATGAGGCGGGAGGTGTA	0.557													ENSG00000115850	C|||	2	0.000399361	0.0015	0.0	5008	,	,		20285	0.0		0.0	False		,,,				2504	0.0																0								C	HIS/ARG	4,4402	6.2+/-15.9	0,4,2199	98.0	90.0	93.0		2066	2.5	1.0	2	dbSNP_134	93	0,8600		0,0,4300	yes	missense	LCT	NM_002299.2	29	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	possibly-damaging	689/1928	136570168	4,13002	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2066G>A	2.37:g.136570168C>T	ENSP00000264162:p.Arg689His		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.R689H	ENST00000264162.2	37	c.2066	CCDS2178.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	16.51	3.144457	0.57044	9.08E-4	0.0	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.34072	1.38	5.49	2.55	0.30701	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.316283	0.34725	N	0.003738	T	0.29882	0.0747	L	0.45698	1.435	0.44816	D	0.997826	P	0.45715	0.865	B	0.43194	0.411	T	0.02713	-1.1120	10	0.37606	T	0.19	-14.8521	7.055	0.25093	0.2448:0.6204:0.0:0.1348	.	689	P09848	LPH_HUMAN	H	689;121	ENSP00000264162:R689H	ENSP00000264162:R689H	R	-	2	0	LCT	136286638	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.562000	0.36353	0.683000	0.31428	0.655000	0.94253	CGC	rs146706415	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1		0.557	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	0	0	0	33	33	76	0.00	0.00	C	NM_002299		136570168	-1	18	61	9	17	tier1	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	64.29	78.21	SNP	1.000	T	18	9
TMEM169	92691	genome.wustl.edu	37	2	216965176	216965176	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:216965176A>T	ENST00000295658.4	+	3	1012	c.805A>T	c.(805-807)Agc>Tgc	p.S269C	TMEM169_ENST00000406027.2_Missense_Mutation_p.S269C|TMEM169_ENST00000437356.2_Missense_Mutation_p.S269C|TMEM169_ENST00000454545.1_Missense_Mutation_p.S269C	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	269						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCTCCCTACAGCATTGTGGA	0.537													ENSG00000163449																																					0													116.0	110.0	112.0					2																	216965176		2203	4300	6503	SO:0001583	missense	0			-	AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.805A>T	2.37:g.216965176A>T	ENSP00000295658:p.Ser269Cys		B2R8W6	Missense_Mutation	SNP	NULL	p.S269C	ENST00000295658.4	37	c.805	CCDS2401.1	2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.442766	0.83993	.	.	ENSG00000163449	ENST00000454545;ENST00000437356;ENST00000295658;ENST00000406027	.	.	.	4.99	4.99	0.66335	.	0.038528	0.85682	D	0.000000	T	0.75496	0.3857	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75819	-0.3183	8	.	.	.	-19.0687	13.9978	0.64414	1.0:0.0:0.0:0.0	.	269	Q96HH4	TM169_HUMAN	C	269	.	.	S	+	1	0	TMEM169	216673421	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.115000	0.94336	2.078000	0.62432	0.533000	0.62120	AGC	-	TMEM169	-	NULL		0.537	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM169	HGNC	protein_coding	OTTHUMT00000256666.2	0	0	0	31	31	64	0.00	0.00	A	NM_138390		216965176	+1	11	49	10	21	tier1	no_errors	ENST00000295658	ensembl	human	known	74_37	missense	52.38	70.00	SNP	1.000	T	11	10
RIMS2	9699	genome.wustl.edu	37	8	105235954	105235954	+	Silent	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:105235954G>T	ENST00000339750.2	+	1	75	c.75G>T	c.(73-75)ctG>ctT	p.L25L	RIMS2_ENST00000436393.2_Intron|RIMS2_ENST00000507740.1_Intron|RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000406091.3_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGAGTAGCCTGTCTGCCTCCT	0.662										HNSCC(12;0.0054)			ENSG00000176406																																					0													18.0	18.0	18.0					8																	105235954		875	1991	2866	SO:0001819	synonymous_variant	0			-	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000339750.2:c.75G>T	8.37:g.105235954G>T			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L25	ENST00000339750.2	37	c.75		8																																																																																			-	RIMS2	-	NULL		0.662	RIMS2-201	KNOWN	basic	protein_coding	RIMS2	HGNC	protein_coding		0	0	0	71	71	22	0.00	0.00	G	NM_001100117		105235954	+1	18	8	33	17	tier1	no_errors	ENST00000339750	ensembl	human	known	74_37	silent	35.29	32.00	SNP	0.970	T	18	33
ZNF225	7768	genome.wustl.edu	37	19	44622637	44622637	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:44622637C>T	ENST00000262894.6	+	4	425	c.145C>T	c.(145-147)Cat>Tat	p.H49Y	ZNF225_ENST00000592780.1_Missense_Mutation_p.H49Y|ZNF225_ENST00000590612.1_Missense_Mutation_p.H49Y	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	49	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				GTTCACAGGGCATCAATCACT	0.378													ENSG00000256294																																					0													87.0	84.0	85.0					19																	44622637		2203	4300	6503	SO:0001583	missense	0			-	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.145C>T	19.37:g.44622637C>T	ENSP00000262894:p.His49Tyr		A8K8S2|Q53F12|Q9NS46|Q9UID8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H49Y	ENST00000262894.6	37	c.145	CCDS46100.1	19	.	.	.	.	.	.	.	.	.	.	C	9.249	1.040230	0.19669	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	T	0.00724	5.78	1.77	0.707	0.18139	Krueppel-associated box (3);	.	.	.	.	T	0.00468	0.0015	N	0.10945	0.07	0.09310	N	1	P	0.50528	0.936	B	0.43889	0.435	T	0.23119	-1.0197	9	0.02654	T	1	.	4.0899	0.09965	0.0:0.779:0.0:0.221	.	49	Q9UK10	ZN225_HUMAN	Y	49;13	ENSP00000262894:H49Y	ENSP00000262894:H49Y	H	+	1	0	ZNF225	49314477	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-0.089000	0.11180	0.294000	0.22547	0.555000	0.69702	CAT	-	ZNF225	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.378	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	HGNC	protein_coding	OTTHUMT00000460581.1	0	0	0	90	90	57	0.00	0.00	C			44622637	+1	12	24	44	85	tier1	no_errors	ENST00000262894	ensembl	human	known	74_37	missense	21.43	22.02	SNP	0.002	T	12	44
DCX	1641	genome.wustl.edu	37	X	110653472	110653472	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:110653472G>T	ENST00000338081.3	-	2	569	c.398C>A	c.(397-399)gCc>gAc	p.A133D	DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Missense_Mutation_p.A52D|DCX_ENST00000356915.2_Missense_Mutation_p.A52D|DCX_ENST00000488120.1_Missense_Mutation_p.A52D|DCX_ENST00000356220.3_Missense_Mutation_p.A52D	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	133					axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						TACCTTCTTGGCTTTCTTCTC	0.552													ENSG00000077279																																					0													289.0	215.0	240.0					X																	110653472		2203	4300	6503	SO:0001583	missense	0			-	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.398C>A	X.37:g.110653472G>T	ENSP00000337697:p.Ala133Asp		A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	p.A133D	ENST00000338081.3	37	c.398	CCDS14556.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.2|23.2	4.389603|4.389603	0.82902|0.82902	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120;ENST00000468911|ENST00000358070	D;D;D;D;D;D|.	0.94576|.	-2.4;-2.4;-2.4;-2.4;-2.4;-3.46|.	5.37|5.37	4.51|4.51	0.55191|0.55191	Doublecortin domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58206|0.58206	0.2106|0.2106	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D;D|.	0.63880|.	0.993;0.993|.	D;D|.	0.70016|.	0.967;0.956|.	T|T	0.54735|0.54735	-0.8249|-0.8249	10|5	0.87932|.	D|.	0|.	.|.	13.0652|13.0652	0.59030|0.59030	0.0785:0.0:0.9214:0.0|0.0785:0.0:0.9214:0.0	.|.	121;133|.	B4DM53;O43602|.	.;DCX_HUMAN|.	D|T	52;52;133;52;52;52|125	ENSP00000349385:A52D;ENSP00000361061:A52D;ENSP00000337697:A133D;ENSP00000348553:A52D;ENSP00000419861:A52D;ENSP00000418811:A52D|.	ENSP00000337697:A133D|.	A|P	-|-	2|1	0|0	DCX|DCX	110540128|110540128	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.657000|9.657000	0.98554|0.98554	1.238000|1.238000	0.43771|0.43771	0.513000|0.513000	0.50165|0.50165	GCC|CCA	-	DCX	-	smart_Doublecortin_dom,pirsf_Doublecortin_chordata		0.552	DCX-006	KNOWN	basic|CCDS	protein_coding	DCX	HGNC	protein_coding	OTTHUMT00000357058.1	0	0	0	75	75	82	0.00	0.00	G	NM_178153		110653472	-1	18	30	54	110	tier1	no_errors	ENST00000338081	ensembl	human	known	74_37	missense	25.00	21.43	SNP	1.000	T	18	54
IGSF1	3547	genome.wustl.edu	37	X	130408744	130408744	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408744G>C	ENST00000361420.3	-	18	3659	c.3580C>G	c.(3580-3582)Cta>Gta	p.L1194V	IGSF1_ENST00000370903.3_Missense_Mutation_p.L1199V|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.L1185V|IGSF1_ENST00000370904.1_Missense_Mutation_p.L1185V			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1194	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCATGTTCTAGGACAAATTCA	0.502													ENSG00000147255																																					0													168.0	165.0	166.0					X																	130408744		2203	4300	6503	SO:0001583	missense	0			-	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3580C>G	X.37:g.130408744G>C	ENSP00000355010:p.Leu1194Val		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L1199V	ENST00000361420.3	37	c.3595	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	14.63	2.594177	0.46214	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	5.35	3.59	0.41128	Immunoglobulin-like fold (1);	0.168825	0.28296	N	0.015878	T	0.44350	0.1289	M	0.89968	3.075	0.29624	N	0.845943	D;D;D	0.69078	0.979;0.997;0.992	D;D;D	0.76071	0.92;0.976;0.987	T	0.48896	-0.8994	10	0.87932	D	0	.	7.462	0.27300	0.2039:0.0:0.7961:0.0	.	1185;638;1194	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	V	1185;1194;1185;1199	ENSP00000359947:L1185V;ENSP00000355010:L1194V;ENSP00000359941:L1185V;ENSP00000359940:L1199V	ENSP00000355010:L1194V	L	-	1	2	IGSF1	130236425	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.370000	0.34238	0.566000	0.29273	0.594000	0.82650	CTA	-	IGSF1	-	smart_Ig_sub,smart_Ig_sub2		0.502	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	0	0	0	81	81	131	0.00	0.00	G			130408744	-1	11	31	93	208	tier1	no_errors	ENST00000370903	ensembl	human	known	74_37	missense	10.58	12.97	SNP	0.994	C	11	93
ASPDH	554235	genome.wustl.edu	37	19	51017057	51017057	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:51017057C>A	ENST00000389208.4	-	1	85	c.24G>T	c.(22-24)agG>agT	p.R8S	JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_Intron|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Intron	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	8					NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CCACGCCCACCCTCCACGGGC	0.692													ENSG00000204653																																					0													36.0	45.0	42.0					19																	51017057		692	1591	2283	SO:0001583	missense	0			-		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.24G>T	19.37:g.51017057C>A	ENSP00000373860:p.Arg8Ser		Q6NZ37	Missense_Mutation	SNP	pfam_Asp_DH,pfam_Asp/hSer_DH_D-bd	p.R8S	ENST00000389208.4	37	c.24	CCDS46153.1	19	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374864	0.42105	.	.	ENSG00000204653	ENST00000389208	T	0.56611	0.45	3.76	1.57	0.23409	NAD(P)-binding domain (1);	0.260151	0.29501	U	0.011964	T	0.41834	0.1176	L	0.52011	1.625	0.31346	N	0.683123	B	0.23377	0.084	B	0.21360	0.034	T	0.44467	-0.9326	10	0.87932	D	0	.	6.1416	0.20263	0.0:0.7513:0.0:0.2487	.	8	A6ND91	ASPD_HUMAN	S	8	ENSP00000373860:R8S	ENSP00000373860:R8S	R	-	3	2	ASPDH	55708869	0.171000	0.23029	0.940000	0.37924	0.739000	0.42172	0.013000	0.13310	0.215000	0.20761	0.462000	0.41574	AGG	-	ASPDH	-	NULL		0.692	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	HGNC	protein_coding	OTTHUMT00000464861.1	0	0	0	85	85	35	0.00	0.00	C	NM_001024656		51017057	-1	19	20	105	62	tier1	no_errors	ENST00000389208	ensembl	human	known	74_37	missense	15.32	24.39	SNP	0.806	A	19	105
ZNF578	147660	genome.wustl.edu	37	19	52954520	52954520	+	5'Flank	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:52954520G>A	ENST00000421239.2	+	0	0				ZNF534_ENST00000432303.2_Missense_Mutation_p.G75S|ZNF534_ENST00000301085.4_Missense_Mutation_p.G118S	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GGAGCCAACCGGCCCAAACTT	0.577													ENSG00000198633																																					0													4.0	3.0	3.0					19																	52954520		831	1865	2696	SO:0001631	upstream_gene_variant	0			-	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468		19.37:g.52954520G>A	Exception_encountered		B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.G118S	ENST00000421239.2	37	c.352	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	G	6.998	0.554316	0.13374	.	.	ENSG00000198633	ENST00000301085;ENST00000432303	T;T	0.01495	5.59;4.83	0.85	-1.7	0.08159	.	.	.	.	.	T	0.00936	0.0031	.	.	.	0.09310	N	1	P;B	0.45986	0.87;0.0	B;B	0.26310	0.068;0.0	T	0.49485	-0.8935	8	0.35671	T	0.21	.	4.6297	0.12495	0.4461:0.0:0.5539:0.0	.	75;118	Q1T7F6;Q1T7F5	.;.	S	118;75	ENSP00000301085:G118S;ENSP00000409421:G75S	ENSP00000301085:G118S	G	+	1	0	ZNF534	57646332	0.004000	0.15560	0.001000	0.08648	0.006000	0.05464	-1.603000	0.02077	-1.167000	0.02779	-1.328000	0.01277	GGC	-	ZNF534	-	NULL		0.577	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000344298.3	0	0	0	73	73	36	0.00	0.00	G	NM_152472		52954520	+1	19	8	94	56	tier1	no_errors	ENST00000301085	ensembl	human	putative	74_37	missense	16.81	12.50	SNP	0.001	A	19	94
SNRPB	6628	genome.wustl.edu	37	20	2442576	2442576	+	Intron	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:2442576C>T	ENST00000438552.2	-	7	848				SNRPB_ENST00000381342.2_Silent_p.*232*|SNORD119_ENST00000515997.1_RNA	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1						gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						GGCCAAGGGTCAAAGAAGGCC	0.532													ENSG00000125835																																					0													87.0	71.0	76.0					20																	2442576		2203	4300	6503	SO:0001627	intron_variant	0			-		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.686-137G>A	20.37:g.2442576C>T			Q15490|Q6IB35|Q9UIS5	Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP-assoc_SmB/SmN	p.*232	ENST00000438552.2	37	c.695	CCDS13026.1	20	.	.	.	.	.	.	.	.	.	.	C	8.291	0.817791	0.16607	.	.	ENSG00000125835	ENST00000303103	.	.	.	4.9	3.88	0.44766	.	0.204155	0.32987	N	0.005417	T	0.66489	0.2794	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69135	-0.5225	6	0.87932	D	0	.	10.6392	0.45584	0.0:0.806:0.194:0.0	.	.	.	.	N	232	.	ENSP00000303591:D232N	D	-	1	0	SNRPB	2390576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.975000	0.40569	2.717000	0.92951	0.655000	0.94253	GAC	-	SNRPB	-	NULL		0.532	SNRPB-002	KNOWN	basic|CCDS	protein_coding	SNRPB	HGNC	protein_coding	OTTHUMT00000077585.2	0	0	0	67	67	134	0.00	0.00	C			2442576	-1	21	34	81	113	tier1	no_errors	ENST00000381342	ensembl	human	known	74_37	silent	20.59	23.13	SNP	1.000	T	21	81
PKD2L2	27039	genome.wustl.edu	37	5	137226243	137226243	+	Nonsense_Mutation	SNP	C	C	A	rs537075402		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:137226243C>A	ENST00000508883.1	+	2	131	c.105C>A	c.(103-105)taC>taA	p.Y35*	RP11-381K20.2_ENST00000508281.2_RNA|PKD2L2_ENST00000502810.1_Nonsense_Mutation_p.Y35*|PKD2L2_ENST00000508638.1_Nonsense_Mutation_p.Y35*|PKD2L2_ENST00000290431.5_Nonsense_Mutation_p.Y35*|RP11-381K20.2_ENST00000514616.1_RNA|PKD2L2_ENST00000350250.4_Intron			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	35					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGTTACTCTACTTTATTTTTT	0.289													ENSG00000078795																																					0													75.0	77.0	76.0					5																	137226243		1790	4060	5850	SO:0001587	stop_gained	0			-	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.105C>A	5.37:g.137226243C>A	ENSP00000424725:p.Tyr35*		A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Nonsense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2	p.Y35*	ENST00000508883.1	37	c.105		5	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515739	0.85495	.	.	ENSG00000078795	ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	.	.	.	5.8	4.0	0.46444	.	0.000000	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.8203	8.8458	0.35170	0.0:0.7685:0.0:0.2315	.	.	.	.	X	35	.	ENSP00000290431:Y35X	Y	+	3	2	PKD2L2	137254142	0.967000	0.33354	1.000000	0.80357	0.990000	0.78478	0.916000	0.28651	1.430000	0.47334	0.460000	0.39030	TAC	-	PKD2L2	-	NULL		0.289	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	PKD2L2	HGNC	protein_coding	OTTHUMT00000372521.1	1	1	0	103	103	90	0.95	0.00	C	NM_014386		137226243	+1	42	43	122	121	tier1	no_errors	ENST00000508883	ensembl	human	known	74_37	nonsense	25.61	26.22	SNP	1.000	A	42	122
FAM155A	728215	genome.wustl.edu	37	13	107822972	107822972	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr13:107822972A>T	ENST00000375915.2	-	3	1388	c.1250T>A	c.(1249-1251)cTc>cAc	p.L417H		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	417						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						ACACAGCTTGAGTCTGCTGTT	0.502													ENSG00000204442																																					0													263.0	182.0	210.0					13																	107822972		2203	4300	6503	SO:0001583	missense	0			-	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.1250T>A	13.37:g.107822972A>T	ENSP00000365080:p.Leu417His		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.L417H	ENST00000375915.2	37	c.1250	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	A	26.0	4.695882	0.88830	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73353	-0.4009	9	0.87932	D	0	.	15.2977	0.73922	1.0:0.0:0.0:0.0	.	417	B1AL88	F155A_HUMAN	H	417	.	ENSP00000365080:L417H	L	-	2	0	FAM155A	106620973	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.533000	0.90617	2.199000	0.70637	0.519000	0.50382	CTC	-	FAM155A	-	NULL		0.502	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	0	0	0	57	57	41	0.00	0.00	A	NM_001080396		107822972	-1	8	19	29	41	tier1	no_errors	ENST00000375915	ensembl	human	known	74_37	missense	21.62	31.67	SNP	1.000	T	8	29
ANO7	50636	genome.wustl.edu	37	2	242149951	242149951	+	Missense_Mutation	SNP	C	C	G	rs189738174		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:242149951C>G	ENST00000274979.8	+	15	1792	c.1689C>G	c.(1687-1689)atC>atG	p.I563M	ANO7_ENST00000402430.3_Missense_Mutation_p.I562M	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	563					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						TCTCCAAGATCTATGTATCCC	0.642													ENSG00000146205																																					0													108.0	91.0	97.0					2																	242149951		2203	4300	6503	SO:0001583	missense	0			-	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1689C>G	2.37:g.242149951C>G	ENSP00000274979:p.Ile563Met		Q6IWH6	Missense_Mutation	SNP	pfam_Anoctamin	p.I563M	ENST00000274979.8	37	c.1689	CCDS33423.1	2	.	.	.	.	.	.	.	.	.	.	C	11.72	1.721326	0.30503	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.66280	-0.2;-0.2	3.34	2.34	0.29019	.	2.468800	0.02314	U	0.072346	T	0.71558	0.3354	M	0.64170	1.965	0.30702	N	0.750212	P	0.44690	0.841	P	0.50617	0.646	T	0.61347	-0.7081	10	0.44086	T	0.13	.	10.9405	0.47270	0.0:0.8076:0.1923:0.0	.	563	Q6IWH7	ANO7_HUMAN	M	563;562	ENSP00000274979:I563M;ENSP00000385418:I562M	ENSP00000274979:I563M	I	+	3	3	ANO7	241798624	0.233000	0.23772	0.064000	0.19789	0.297000	0.27493	-0.167000	0.09940	1.576000	0.49790	0.313000	0.20887	ATC	-	ANO7	-	pfam_Anoctamin		0.642	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO7	HGNC	protein_coding	OTTHUMT00000323509.1	0	0	0	20	20	69	0.00	0.00	C	NM_001001891		242149951	+1	11	42	10	26	tier1	no_errors	ENST00000274979	ensembl	human	known	74_37	missense	52.38	61.76	SNP	0.998	G	11	10
GBF1	8729	genome.wustl.edu	37	10	104121645	104121645	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:104121645G>C	ENST00000369983.3	+	14	1919	c.1659G>C	c.(1657-1659)gaG>gaC	p.E553D		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	553					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		ACCTCTTTGAGGAACTCACAA	0.473													ENSG00000107862																																					0													102.0	89.0	93.0					10																	104121645		2203	4300	6503	SO:0001583	missense	0			-	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.1659G>C	10.37:g.104121645G>C	ENSP00000359000:p.Glu553Asp		Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.E553D	ENST00000369983.3	37	c.1659	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933518	0.52866	.	.	ENSG00000107862	ENST00000369983	T	0.68903	-0.36	6.17	-1.5	0.08691	.	0.000000	0.85682	D	0.000000	T	0.61413	0.2345	M	0.63843	1.955	0.58432	D	0.999991	B;B;B	0.27594	0.182;0.146;0.012	B;B;B	0.29176	0.099;0.04;0.007	T	0.61342	-0.7082	10	0.62326	D	0.03	-17.6937	13.8793	0.63674	0.7309:0.0:0.2691:0.0	.	553;553;553	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	D	553	ENSP00000359000:E553D	ENSP00000359000:E553D	E	+	3	2	GBF1	104111635	0.995000	0.38212	0.994000	0.49952	0.985000	0.73830	0.465000	0.22004	-0.151000	0.11176	-0.136000	0.14681	GAG	-	GBF1	-	superfamily_ARM-type_fold		0.473	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1	0	0	0	18	18	56	0.00	0.00	G			104121645	+1	17	21	9	45	tier1	no_errors	ENST00000369983	ensembl	human	known	74_37	missense	65.38	31.82	SNP	0.984	C	17	9
RANGAP1	5905	genome.wustl.edu	37	22	41642614	41642614	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:41642614T>C	ENST00000455915.2	-	15	3226	c.1757A>G	c.(1756-1758)aAg>aGg	p.K586R	RANGAP1_ENST00000405486.1_Missense_Mutation_p.K586R|RANGAP1_ENST00000356244.3_Missense_Mutation_p.K586R|RANGAP1_ENST00000407260.4_Missense_Mutation_p.K531R			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	586					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGTCTAGACCTTGTACAGCGT	0.627													ENSG00000100401																																					0													58.0	45.0	49.0					22																	41642614		2192	4292	6484	SO:0001583	missense	0			-	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1757A>G	22.37:g.41642614T>C	ENSP00000401470:p.Lys586Arg		Q96JJ2	Missense_Mutation	SNP	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.K586R	ENST00000455915.2	37	c.1757	CCDS14012.1	22	.	.	.	.	.	.	.	.	.	.	T	14.57	2.574360	0.45902	.	.	ENSG00000100401	ENST00000405486;ENST00000356244;ENST00000405383;ENST00000455915;ENST00000407260	T;T;T;T	0.44881	0.91;0.91;0.91;1.37	5.68	4.63	0.57726	Ran-GTPase activating protein 1, C-terminal (3);	0.647288	0.16499	N	0.211758	T	0.31949	0.0813	L	0.33485	1.01	0.21445	N	0.99969	B;B	0.06786	0.0;0.001	B;B	0.10450	0.005;0.005	T	0.18085	-1.0348	10	0.30854	T	0.27	-17.066	10.4868	0.44726	0.0:0.1362:0.0:0.8638	.	531;586	F8W7I9;P46060	.;RAGP1_HUMAN	R	586;586;586;586;531	ENSP00000385866:K586R;ENSP00000348577:K586R;ENSP00000401470:K586R;ENSP00000385354:K531R	ENSP00000348577:K586R	K	-	2	0	RANGAP1	39972560	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	3.330000	0.52068	0.951000	0.37770	0.383000	0.25322	AAG	-	RANGAP1	-	pfam_Ran_GTPase_activating_1_C,superfamily_Ran_GTPase_activating_1_C		0.627	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RANGAP1	HGNC	protein_coding	OTTHUMT00000320606.1	0	0	0	55	55	59	0.00	0.00	T	NM_002883		41642614	-1	12	18	39	125	tier1	no_errors	ENST00000356244	ensembl	human	known	74_37	missense	23.53	12.59	SNP	0.721	C	12	39
STC1	6781	genome.wustl.edu	37	8	23702549	23702549	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:23702549A>T	ENST00000290271.2	-	4	761	c.478T>A	c.(478-480)Tat>Aat	p.Y160N	STC1_ENST00000524323.1_Missense_Mutation_p.Y91N	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	160					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		AGTCTGTTATAGTATCTGCAT	0.522													ENSG00000159167																																					0													103.0	96.0	98.0					8																	23702549		2203	4300	6503	SO:0001583	missense	0			-		CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.478T>A	8.37:g.23702549A>T	ENSP00000290271:p.Tyr160Asn		B4DN22|Q71UE5	Missense_Mutation	SNP	pfam_Stanniocalcin	p.Y160N	ENST00000290271.2	37	c.478	CCDS6043.1	8	.	.	.	.	.	.	.	.	.	.	A	26.5	4.747530	0.89663	.	.	ENSG00000159167	ENST00000290271;ENST00000540277;ENST00000524323	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.78039	0.4221	M	0.68952	2.095	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.79933	-0.1594	9	0.87932	D	0	-9.0847	15.6301	0.76899	1.0:0.0:0.0:0.0	.	160	P52823	STC1_HUMAN	N	160;91;91	.	ENSP00000290271:Y160N	Y	-	1	0	STC1	23758494	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.790000	0.91844	2.367000	0.80283	0.528000	0.53228	TAT	-	STC1	-	pfam_Stanniocalcin		0.522	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STC1	HGNC	protein_coding	OTTHUMT00000215143.1	0	0	0	31	31	30	0.00	0.00	A			23702549	-1	10	35	8	30	tier1	no_errors	ENST00000290271	ensembl	human	known	74_37	missense	55.56	53.85	SNP	1.000	T	10	8
KRTAP24-1	643803	genome.wustl.edu	37	21	31654526	31654526	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr21:31654526C>T	ENST00000340345.4	-	1	750	c.725G>A	c.(724-726)aGg>aAg	p.R242K		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	242	6 X 10 AA repeats of Y-[ILR]-[SVPC]- [NRTS]-[SNTG]-X-[QHRP]-[PSY]-[QSL]-[SRK].					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						GCACAAATACCTCAGAGGTGG	0.448													ENSG00000188694																																					0													92.0	88.0	89.0					21																	31654526		1842	4092	5934	SO:0001583	missense	0			-	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.725G>A	21.37:g.31654526C>T	ENSP00000339238:p.Arg242Lys		Q1XDX0	Missense_Mutation	SNP	pfam_KRTAP_PMG	p.R242K	ENST00000340345.4	37	c.725	CCDS42915.1	21	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091357	0.76756	.	.	ENSG00000188694	ENST00000340345	T	0.32023	1.47	3.75	3.75	0.43078	.	0.460512	0.20990	N	0.082057	T	0.35189	0.0923	L	0.29908	0.895	0.32911	D	0.514527	D	0.76494	0.999	D	0.73708	0.981	T	0.06734	-1.0810	10	0.07030	T	0.85	-10.9873	11.3491	0.49577	0.0:1.0:0.0:0.0	.	242	Q3LI83	KR241_HUMAN	K	242	ENSP00000339238:R242K	ENSP00000339238:R242K	R	-	2	0	KRTAP24-1	30576397	0.995000	0.38212	1.000000	0.80357	0.969000	0.65631	1.628000	0.37060	2.382000	0.81193	0.557000	0.71058	AGG	-	KRTAP24-1	-	NULL		0.448	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP24-1	HGNC	protein_coding	OTTHUMT00000246806.2	0	0	0	45	45	97	0.00	0.00	C	NM_001085455		31654526	-1	6	33	33	101	tier1	no_errors	ENST00000340345	ensembl	human	known	74_37	missense	15.38	24.63	SNP	1.000	T	6	33
CD209	30835	genome.wustl.edu	37	19	7808042	7808042	+	Silent	SNP	G	G	A	rs553008652	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:7808042G>A	ENST00000315599.7	-	7	1120	c.1098C>T	c.(1096-1098)gaC>gaT	p.D366D	CD209_ENST00000354397.6_Silent_p.D360D|CD209_ENST00000593660.1_Silent_p.D296D|CD209_ENST00000602261.1_Silent_p.D274D|CD209_ENST00000315591.8_Silent_p.D342D|CD209_ENST00000301357.8_Silent_p.D230D|CD209_ENST00000601951.1_Silent_p.D342D|CD209_ENST00000204801.8_Silent_p.D322D|CD209_ENST00000593821.1_Silent_p.D230D|CD209_ENST00000394173.4_Silent_p.D205D|CD209_ENST00000394161.5_Silent_p.D130D	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	366	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TACATTTGTCGTCGTTCCAGC	0.522													ENSG00000090659	a|||	2	0.000399361	0.0	0.0	5008	,	,		17546	0.0		0.0	False		,,,				2504	0.002																0													234.0	219.0	224.0					19																	7808042		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.1098C>T	19.37:g.7808042G>A			A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.D366	ENST00000315599.7	37	c.1098	CCDS12186.1	19																																																																																			-	CD209	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII		0.522	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD209	HGNC	protein_coding	OTTHUMT00000462241.1	0	0	0	85	85	93	0.00	0.00	G	NM_021155		7808042	-1	46	64	44	79	tier1	no_errors	ENST00000315599	ensembl	human	known	74_37	silent	51.11	44.44	SNP	0.003	A	46	44
FAM90A27P	646508	genome.wustl.edu	37	19	53786084	53786084	+	RNA	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:53786084G>T	ENST00000599085.1	+	0	60					NR_046365.1		A6NNH2	F90AR_HUMAN	family with sequence similarity 90, member A27, pseudogene								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										GCAGAGCGAAGCTCCGACGCA	0.557													ENSG00000189348																																					0																																												0			-			19q13.42	2014-03-18			ENSG00000189348	ENSG00000189348			43617	pseudogene	pseudogene							Standard	NR_046365		Approved		uc031rmv.1	A6NNH2	OTTHUMG00000182909		19.37:g.53786084G>T				R	SNP	-	NULL	ENST00000599085.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	G	7.667	0.686245	0.14973	.	.	ENSG00000189348	ENST00000338885	.	.	.	2.16	-4.32	0.03688	.	0.481200	0.15557	N	0.256120	T	0.28962	0.0719	.	.	.	0.23406	N	0.99774	.	.	.	.	.	.	T	0.27502	-1.0072	5	0.52906	T	0.07	.	0.8762	0.01224	0.2474:0.2446:0.3491:0.159	.	.	.	.	S	117	.	ENSP00000341223:A117S	A	+	1	0	AC092070.1	58477896	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.082000	0.03400	-1.447000	0.01943	-0.302000	0.09304	GCT	-	FAM90A27P	-	-		0.557	FAM90A27P-002	KNOWN	basic	processed_transcript	FAM90A27P	HGNC	pseudogene	OTTHUMT00000464290.1	0	0	0	84	84	13	0.00	0.00	G	NR_046365		53786084	+1	23	9	82	13	tier1	no_errors	ENST00000599085	ensembl	human	known	74_37	rna	21.90	40.91	SNP	0.000	T	23	82
MYH13	8735	genome.wustl.edu	37	17	10248638	10248638	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:10248638G>C	ENST00000418404.3	-	14	1628	c.1465C>G	c.(1465-1467)Cag>Gag	p.Q489E	MYH13_ENST00000252172.4_Missense_Mutation_p.Q489E			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	489	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TTGAAAAACTGTTGCAGTTTC	0.463													ENSG00000006788																																					0													154.0	138.0	144.0					17																	10248638		2203	4297	6500	SO:0001583	missense	0			-	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.1465C>G	17.37:g.10248638G>C	ENSP00000404570:p.Gln489Glu		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q489E	ENST00000418404.3	37	c.1465	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698000	0.88830	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D;D	0.89196	-2.48;-2.14	4.46	4.46	0.54185	Myosin head, motor domain (2);	.	.	.	.	D	0.96611	0.8894	H	0.95950	3.745	0.49582	D	0.999803	P	0.35481	0.504	P	0.60117	0.869	D	0.97357	0.9967	9	0.87932	D	0	.	17.6701	0.88214	0.0:0.0:1.0:0.0	.	489	Q9UKX3	MYH13_HUMAN	E	489;164	ENSP00000252172:Q489E;ENSP00000404570:Q164E	ENSP00000252172:Q489E	Q	-	1	0	MYH13	10189363	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.450000	0.97607	2.471000	0.83476	0.655000	0.94253	CAG	-	MYH13	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.463	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	0	0	0	154	154	28	0.00	0.00	G	NM_003802		10248638	-1	35	11	287	48	tier1	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	10.87	18.33	SNP	1.000	C	35	287
HKDC1	80201	genome.wustl.edu	37	10	70980216	70980216	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:70980216T>C	ENST00000354624.5	+	1	158	c.25T>C	c.(25-27)Ttt>Ctt	p.F9L	HKDC1_ENST00000395086.2_Missense_Mutation_p.F9L|RP11-227H15.4_ENST00000450995.1_RNA	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	9					carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CTTGATGGCATTTTACTTCAG	0.498													ENSG00000156510																																					0													90.0	81.0	84.0					10																	70980216		2203	4300	6503	SO:0001583	missense	0			-		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.25T>C	10.37:g.70980216T>C	ENSP00000346643:p.Phe9Leu		B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.F9L	ENST00000354624.5	37	c.25	CCDS7288.1	10	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955926	0.73902	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98889	-5.21;-5.21	5.44	5.44	0.79542	.	0.121431	0.56097	D	0.000030	D	0.96824	0.8963	L	0.44542	1.39	0.49687	D	0.99981	B	0.02656	0.0	B	0.04013	0.001	D	0.94924	0.8076	10	0.41790	T	0.15	-4.6952	15.5123	0.75793	0.0:0.0:0.0:1.0	.	9	Q2TB90	HKDC1_HUMAN	L	9	ENSP00000346643:F9L;ENSP00000378521:F9L	ENSP00000346643:F9L	F	+	1	0	HKDC1	70650222	1.000000	0.71417	0.980000	0.43619	0.963000	0.63663	7.546000	0.82137	2.065000	0.61736	0.533000	0.62120	TTT	-	HKDC1	-	NULL		0.498	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	HGNC	protein_coding	OTTHUMT00000048389.1	0	0	0	58	58	106	0.00	0.00	T	NM_025130		70980216	+1	30	69	15	22	tier1	no_errors	ENST00000354624	ensembl	human	known	74_37	missense	66.67	75.82	SNP	0.997	C	30	15
DGAT1	8694	genome.wustl.edu	37	8	145541664	145541664	+	Silent	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:145541664G>C	ENST00000332324.4	-	9	1041	c.768C>G	c.(766-768)ctC>ctG	p.L256L	GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000531896.1_Missense_Mutation_p.L287V|DGAT1_ENST00000527438.1_5'Flank	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	256					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TGGGGGCGAAGAGGAAGTAGT	0.617													ENSG00000185000																																					0													36.0	42.0	40.0					8																	145541664		2203	4295	6498	SO:0001819	synonymous_variant	0			-	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.768C>G	8.37:g.145541664G>C			B2RWQ2|D3DWL6|Q96BB8	Missense_Mutation	SNP	superfamily_PEP-util_enz_mobile_dom	p.L287V	ENST00000332324.4	37	c.859	CCDS6420.1	8	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415904	0.25552	.	.	ENSG00000185000	ENST00000531896	.	.	.	4.68	-2.85	0.05734	.	0.639724	0.15908	N	0.238735	T	0.31888	0.0811	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.30534	-0.9975	6	0.66056	D	0.02	-23.293	2.8497	0.05554	0.144:0.3315:0.4075:0.117	.	.	.	.	V	287	.	ENSP00000432795:L287V	L	-	1	0	DGAT1	145512472	0.882000	0.30256	0.994000	0.49952	0.950000	0.60333	-0.045000	0.12003	-0.171000	0.10797	0.484000	0.47621	CTT	-	DGAT1	-	NULL		0.617	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT1	HGNC	protein_coding	OTTHUMT00000382059.3	0	0	0	19	19	30	0.00	0.00	G	NM_012079		145541664	-1	5	9	11	33	tier1	no_errors	ENST00000531896	ensembl	human	putative	74_37	missense	31.25	21.43	SNP	0.929	C	5	11
NSUN5	55695	genome.wustl.edu	37	7	72717521	72717521	+	3'UTR	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:72717521G>A	ENST00000252594.6	-	0	1377				NSUN5_ENST00000428206.1_3'UTR|NSUN5_ENST00000438747.2_Missense_Mutation_p.A431V|NSUN5_ENST00000310326.8_Splice_Site_p.S429S			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5						rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				GGCCTGTGAGGCTGAGCTAGA	0.587													ENSG00000130305																																					0													122.0	107.0	112.0					7																	72717521		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-	AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.*72C>T	7.37:g.72717521G>A			B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.A431V	ENST00000252594.6	37	c.1292	CCDS5547.1	7	.	.	.	.	.	.	.	.	.	.	.	10.24	1.295606	0.23564	.	.	ENSG00000130305	ENST00000438747	T	0.12147	2.71	4.28	-2.69	0.06022	.	1.499030	0.03680	N	0.245433	T	0.08044	0.0201	.	.	.	0.23542	N	0.997452	B	0.02656	0.0	B	0.08055	0.003	T	0.34179	-0.9839	9	0.27082	T	0.32	.	5.5804	0.17247	0.1586:0.2598:0.5816:0.0	.	431	Q96P11-2	.	V	431	ENSP00000388464:A431V	ENSP00000388464:A431V	A	-	2	0	NSUN5	72355457	0.000000	0.05858	0.008000	0.14137	0.320000	0.28249	-0.249000	0.08842	-0.323000	0.08602	0.289000	0.19496	GCC	-	NSUN5	-	NULL		0.587	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NSUN5	HGNC	protein_coding	OTTHUMT00000252113.1	0	0	0	90	90	38	0.00	0.00	G	NM_148956		72717521	-1	13	25	77	66	tier1	no_errors	ENST00000438747	ensembl	human	known	74_37	missense	14.44	27.47	SNP	0.027	A	13	77
ZMAT1	84460	genome.wustl.edu	37	X	101159271	101159271	+	Missense_Mutation	SNP	G	G	T	rs367645895		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:101159271G>T	ENST00000372782.3	-	3	201	c.154C>A	c.(154-156)Ctt>Att	p.L52I	ZMAT1_ENST00000458570.1_5'UTR|ZMAT1_ENST00000540921.1_Missense_Mutation_p.L52I	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	52						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TCTGTAAAAAGTTCAGCCTTT	0.318													ENSG00000166432																																					0													106.0	97.0	100.0					X																	101159271		2201	4300	6501	SO:0001583	missense	0			-	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.154C>A	X.37:g.101159271G>T	ENSP00000361868:p.Leu52Ile		Q8NDS3|Q96JN6	Missense_Mutation	SNP	superfamily_Asn/Gln_tR_amidoTrfrase-rel,smart_Znf_U1,smart_Znf_C2H2-like	p.L52I	ENST00000372782.3	37	c.154	CCDS35348.1	X	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992989	0.54041	.	.	ENSG00000166432	ENST00000372782;ENST00000540921	T;T	0.15718	2.4;2.4	4.75	0.981	0.19756	.	2.946150	0.01654	N	0.024720	T	0.08447	0.0210	N	0.05383	-0.06	0.09310	N	0.999999	P	0.42827	0.791	B	0.29785	0.107	T	0.29058	-1.0024	10	0.52906	T	0.07	2.3531	7.6487	0.28336	0.3934:0.0:0.6066:0.0	.	52	Q5H9K5	ZMAT1_HUMAN	I	52	ENSP00000361868:L52I;ENSP00000437529:L52I	ENSP00000361868:L52I	L	-	1	0	ZMAT1	101045927	0.805000	0.28982	0.004000	0.12327	0.981000	0.71138	0.744000	0.26245	-0.035000	0.13691	0.590000	0.80494	CTT	-	ZMAT1	-	NULL		0.318	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	HGNC	protein_coding	OTTHUMT00000057598.1	0	0	0	48	48	124	0.00	0.00	G			101159271	-1	21	39	51	130	tier1	no_errors	ENST00000372782	ensembl	human	known	74_37	missense	29.17	23.08	SNP	0.052	T	21	51
SRPK2	6733	genome.wustl.edu	37	7	104758460	104758460	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:104758460C>T	ENST00000393651.3	-	16	2012	c.1925G>A	c.(1924-1926)cGa>cAa	p.R642Q	SRPK2_ENST00000489828.1_Missense_Mutation_p.R631Q|SRPK2_ENST00000493638.1_5'Flank|SRPK2_ENST00000357311.3_Missense_Mutation_p.R631Q	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						GGTGATGTGTCGCAGTTCTCC	0.483													ENSG00000135250																																					0													70.0	60.0	64.0					7																	104758460		2203	4300	6503	SO:0001583	missense	0			-	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.1925G>A	7.37:g.104758460C>T	ENSP00000377262:p.Arg642Gln			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R642Q	ENST00000393651.3	37	c.1925	CCDS34724.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.258986|4.258986	0.80246|0.80246	.|.	.|.	ENSG00000135250|ENSG00000135250	ENST00000474770|ENST00000393651;ENST00000357311;ENST00000489828	.|T;T;T	.|0.20332	.|2.08;2.08;2.08	5.76|5.76	5.76|5.76	0.90799|0.90799	.|Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38983|0.38983	0.1061|0.1061	L|L	0.46819|0.46819	1.47|1.47	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|P;P	.|0.59012	.|0.85;0.8	T|T	0.02320|0.02320	-1.1177|-1.1177	5|10	.|0.59425	.|D	.|0.04	-19.5337|-19.5337	20.3242|20.3242	0.98691|0.98691	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|642;631	.|P78362-2;P78362	.|.;SRPK2_HUMAN	N|Q	147|642;631;631	.|ENSP00000377262:R642Q;ENSP00000349863:R631Q;ENSP00000419791:R631Q	.|ENSP00000349863:R631Q	D|R	-|-	1|2	0|0	SRPK2|SRPK2	104545696|104545696	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.920000|0.920000	0.55202|0.55202	6.030000|6.030000	0.70903|0.70903	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GAC|CGA	-	SRPK2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.483	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	HGNC	protein_coding	OTTHUMT00000348723.1	0	0	0	28	28	131	0.00	0.00	C	NM_182691		104758460	-1	19	74	39	102	tier1	no_errors	ENST00000393651	ensembl	human	known	74_37	missense	32.76	42.05	SNP	1.000	T	19	39
VPS4A	27183	genome.wustl.edu	37	16	69353364	69353364	+	Missense_Mutation	SNP	G	G	A	rs573192094		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:69353364G>A	ENST00000254950.11	+	6	694	c.538G>A	c.(538-540)Gtg>Atg	p.V180M	COG8_ENST00000564419.1_5'Flank|RP11-343C2.11_ENST00000570054.2_Missense_Mutation_p.V204M	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				GGCCAAAGCCGTGGCAACAGA	0.582													ENSG00000132612																																					0													55.0	60.0	59.0					16																	69353364		2019	4178	6197	SO:0001583	missense	0			-	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.538G>A	16.37:g.69353364G>A	ENSP00000254950:p.Val180Met			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_D_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.V180M	ENST00000254950.11	37	c.538	CCDS45517.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.208627	0.95069	.	.	ENSG00000132612	ENST00000254950	D	0.95307	-3.67	6.06	6.06	0.98353	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97349	0.9133	M	0.77712	2.385	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.97286	0.9921	10	0.87932	D	0	-29.0773	20.2159	0.98296	0.0:0.0:1.0:0.0	.	180	Q9UN37	VPS4A_HUMAN	M	180	ENSP00000254950:V180M	ENSP00000254950:V180M	V	+	1	0	VPS4A	67910865	1.000000	0.71417	0.983000	0.44433	0.874000	0.50279	9.858000	0.99539	2.882000	0.98803	0.655000	0.94253	GTG	-	VPS4A	-	pfam_ATPase_AAA_core,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_D_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.582	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000430563.3	0	0	0	65	65	71	0.00	0.00	G	NM_013245		69353364	+1	15	27	22	69	tier1	no_errors	ENST00000254950	ensembl	human	known	74_37	missense	40.54	28.12	SNP	1.000	A	15	22
MLH1	4292	genome.wustl.edu	37	3	37070375	37070375	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:37070375A>T	ENST00000231790.2	+	13	1726	c.1510A>T	c.(1510-1512)Act>Tct	p.T504S	MLH1_ENST00000536378.1_Missense_Mutation_p.T263S|MLH1_ENST00000458205.2_Missense_Mutation_p.T263S|MLH1_ENST00000435176.1_Missense_Mutation_p.T406S|MLH1_ENST00000455445.2_Missense_Mutation_p.T263S|MLH1_ENST00000539477.1_Missense_Mutation_p.T263S	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	504	Interaction with EXO1.				ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						CATTAACCTCACTAGTGTTTT	0.493		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome				ENSG00000076242																											yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	1	Whole gene deletion(1)	ovary(1)											225.0	227.0	227.0					3																	37070375		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	-	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1510A>T	3.37:g.37070375A>T	ENSP00000231790:p.Thr504Ser		B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	pfam_D_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_D_mismatch_repair_N	p.T504S	ENST00000231790.2	37	c.1510	CCDS2663.1	3	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914731	0.72983	.	.	ENSG00000076242	ENST00000231790;ENST00000383761;ENST00000421440;ENST00000396438;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000536378;ENST00000450420;ENST00000413740	D;D;D;D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54;-2.54;-2.54;-2.54	5.9	5.9	0.94986	.	0.094616	0.64402	D	0.000001	D	0.93187	0.7830	M	0.62088	1.915	0.58432	D	0.999999	B;B;B;D;B;B;B	0.89917	0.419;0.283;0.419;1.0;0.283;0.263;0.007	B;B;B;D;B;B;B	0.91635	0.083;0.201;0.201;0.999;0.249;0.074;0.014	D	0.91951	0.5571	10	0.31617	T	0.26	-23.6381	16.3245	0.82970	1.0:0.0:0.0:0.0	.	406;406;263;47;263;504;504	E9PCU2;B4DQ11;B7Z821;E9PE33;B4DI13;Q53GX1;P40692	.;.;.;.;.;.;MLH1_HUMAN	S	504;368;47;47;263;263;263;406;263;45;45	ENSP00000231790:T504S;ENSP00000402667:T263S;ENSP00000443665:T263S;ENSP00000398272:T263S;ENSP00000402564:T406S;ENSP00000444286:T263S;ENSP00000393006:T45S;ENSP00000416476:T45S	ENSP00000231790:T504S	T	+	1	0	MLH1	37045379	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.856000	0.75450	2.254000	0.74563	0.460000	0.39030	ACT	-	MLH1	-	NULL		0.493	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	HGNC	protein_coding	OTTHUMT00000253337.2	0	0	0	108	108	119	0.00	0.00	A	NM_000249		37070375	+1	59	66	29	34	tier1	no_errors	ENST00000231790	ensembl	human	known	74_37	missense	67.05	65.35	SNP	1.000	T	59	29
CNTNAP4	85445	genome.wustl.edu	37	16	76513331	76513331	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:76513331C>T	ENST00000476707.1	+	11	1926	c.1787C>T	c.(1786-1788)tCa>tTa	p.S596L	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S544L|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S592L|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S520L|CNTNAP4_ENST00000469589.1_3'UTR			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	593	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TATGAGCAGTCATGTGAAGCC	0.333													ENSG00000152910																																					0													107.0	115.0	112.0					16																	76513331		2198	4298	6496	SO:0001583	missense	0			-	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1787C>T	16.37:g.76513331C>T	ENSP00000417628:p.Ser596Leu		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S592L	ENST00000476707.1	37	c.1775		16	.	.	.	.	.	.	.	.	.	.	C	32	5.158952	0.94686	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.57	5.57	0.84162	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (3);	0.000000	0.33916	N	0.004437	T	0.64182	0.2575	.	.	.	0.80722	D	1	D;P;D;D	0.89917	1.0;0.947;1.0;1.0	D;D;D;D	0.91635	0.999;0.913;0.999;0.999	T	0.65985	-0.6035	9	0.87932	D	0	.	19.3573	0.94420	0.0:1.0:0.0:0.0	.	520;596;568;593	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	L	592;544;520;596	ENSP00000306893:S592L;ENSP00000439733:S544L;ENSP00000418741:S520L;ENSP00000417628:S596L	ENSP00000306893:S592L	S	+	2	0	CNTNAP4	75070832	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.589000	0.82641	2.902000	0.99343	0.650000	0.86243	TCA	-	CNTP4	-	superfamily_Fibrinogen_a/b/g_C_dom		0.333	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTP4	HGNC	protein_coding	OTTHUMT00000348216.1	0	0	0	60	60	87	0.00	0.00	C	NM_033401		76513331	+1	20	28	41	65	tier1	no_errors	ENST00000307431	ensembl	human	known	74_37	missense	32.79	30.11	SNP	1.000	T	20	41
PTAFR	5724	genome.wustl.edu	37	1	28503185	28503185	+	Splice_Site	SNP	C	C	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:28503185C>G	ENST00000539896.1	-	2	215		c.e2-1		PTAFR_ENST00000373857.3_5'UTR|PTAFR_ENST00000305392.3_Intron	NM_001164721.1|NM_001164722.2|NM_001164723.2	NP_001158193.1|NP_001158194.1|NP_001158195.1	P25105	PTAFR_HUMAN	platelet-activating factor receptor						chemotaxis (GO:0006935)|cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|inositol trisphosphate biosynthetic process (GO:0032959)|interferon-gamma-mediated signaling pathway (GO:0060333)|phosphatidylinositol-mediated signaling (GO:0048015)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|phospholipid binding (GO:0005543)|platelet activating factor receptor activity (GO:0004992)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|stomach(1)	15		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		TCTATGCTGTCTGGCAATTGC	0.587													ENSG00000169403																																					0																																										SO:0001630	splice_region_variant	0			-	BC063000	CCDS318.1	1p35-p34.3	2012-08-20			ENSG00000169403	ENSG00000169403		"""GPCR / Class A : Platelet-activating factor receptors"""	9582	protein-coding gene	gene with protein product		173393				1322356	Standard	NM_001164721		Approved		uc001bpl.3	P25105	OTTHUMG00000003953	ENST00000539896.1:c.120-1G>C	1.37:g.28503185C>G			A3KMC8|A8K2H5	Splice_Site	SNP	-	e1-1	ENST00000539896.1	37	c.1-1	CCDS318.1	1																																																																																			-	PTAFR	-	-		0.587	PTAFR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PTAFR	HGNC	protein_coding		0	0	0	42	42	54	0.00	0.00	C	NM_000952	Intron	28503185	-1	21	58	53	67	tier1	no_errors	ENST00000539896	ensembl	human	known	74_37	splice_site	28.38	46.40	SNP	0.930	G	21	53
FAM83B	222584	genome.wustl.edu	37	6	54805724	54805724	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:54805724A>G	ENST00000306858.7	+	5	2071	c.1955A>G	c.(1954-1956)aAg>aGg	p.K652R	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	652										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GAAAATCTAAAGAATCAACAG	0.333													ENSG00000168143																																					0													54.0	57.0	56.0					6																	54805724		2200	4300	6500	SO:0001583	missense	0			-	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1955A>G	6.37:g.54805724A>G	ENSP00000304078:p.Lys652Arg		Q2M1P3|Q96DQ2	Missense_Mutation	SNP	pfam_DUF1669	p.K652R	ENST00000306858.7	37	c.1955	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	A	11.05	1.523887	0.27299	.	.	ENSG00000168143	ENST00000306858	T	0.36878	1.23	5.55	4.39	0.52855	.	0.826156	0.11030	N	0.607374	T	0.16171	0.0389	L	0.59436	1.845	0.09310	N	1	B	0.18310	0.027	B	0.12837	0.008	T	0.25984	-1.0116	10	0.49607	T	0.09	-17.8201	6.6484	0.22949	0.7914:0.0:0.0721:0.1365	.	652	Q5T0W9	FA83B_HUMAN	R	652	ENSP00000304078:K652R	ENSP00000304078:K652R	K	+	2	0	FAM83B	54913683	0.993000	0.37304	0.022000	0.16811	0.965000	0.64279	3.634000	0.54302	1.050000	0.40346	0.533000	0.62120	AAG	-	FAM83B	-	NULL		0.333	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	HGNC	protein_coding	OTTHUMT00000040994.1	0	0	0	61	61	97	0.00	0.00	A	XM_294139		54805724	+1	16	29	51	111	tier1	no_errors	ENST00000306858	ensembl	human	known	74_37	missense	23.88	20.71	SNP	0.089	G	16	51
CTCFL	140690	genome.wustl.edu	37	20	56090832	56090832	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr20:56090832C>A	ENST00000608263.1	-	5	1779	c.1118G>T	c.(1117-1119)tGc>tTc	p.C373F	CTCFL_ENST00000429804.3_Missense_Mutation_p.C373F|CTCFL_ENST00000422869.2_Missense_Mutation_p.C373F|CTCFL_ENST00000539382.1_Missense_Mutation_p.C168F|CTCFL_ENST00000433949.3_Missense_Mutation_p.C168F|CTCFL_ENST00000371196.2_Missense_Mutation_p.C373F|CTCFL_ENST00000502686.2_Missense_Mutation_p.C111F|CTCFL_ENST00000608440.1_Missense_Mutation_p.C373F|CTCFL_ENST00000609232.1_Missense_Mutation_p.C373F|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000243914.3_Missense_Mutation_p.C373F|CTCFL_ENST00000608425.1_Missense_Mutation_p.C373F|CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000608903.1_Missense_Mutation_p.C111F|CTCFL_ENST00000423479.3_Missense_Mutation_p.C373F	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	373					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GCTGCACTGGCAACACTGAAA	0.483													ENSG00000124092																																					0													174.0	165.0	168.0					20																	56090832		2203	4300	6503	SO:0001583	missense	0			-		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1118G>T	20.37:g.56090832C>A	ENSP00000476783:p.Cys373Phe		A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C373F	ENST00000608263.1	37	c.1118	CCDS13459.1	20	.	.	.	.	.	.	.	.	.	.	C	6.200	0.405064	0.11754	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000422109;ENST00000426658;ENST00000539382;ENST00000422869	T;T;T;T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.24	-6.88	0.01665	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.445910	0.04419	N	0.367221	T	0.06735	0.0172	N	0.04746	-0.17	0.09310	N	1	B;P;B;P;P	0.41450	0.244;0.512;0.295;0.75;0.512	B;B;B;B;B	0.42062	0.281;0.173;0.374;0.226;0.171	T	0.14476	-1.0471	10	0.29301	T	0.29	1.9081	1.1248	0.01732	0.1895:0.2307:0.3226:0.2571	.	373;373;373;373;373	A6XGM9;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;CTCFL_HUMAN	F	373;373;373;373;373;111;373;373;168;373	ENSP00000415579:C373F;ENSP00000243914:C373F;ENSP00000360239:C373F;ENSP00000415329:C373F;ENSP00000392034:C373F;ENSP00000437999:C111F;ENSP00000413713:C373F;ENSP00000403369:C373F;ENSP00000439998:C168F;ENSP00000399061:C373F	ENSP00000243914:C373F	C	-	2	0	CTCFL	55524238	0.000000	0.05858	0.000000	0.03702	0.702000	0.40608	-0.214000	0.09292	-1.536000	0.01738	-0.172000	0.13284	TGC	-	CTCFL	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.483	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CTCFL	HGNC	protein_coding	OTTHUMT00000472040.1	0	0	0	64	64	81	0.00	0.00	C	NM_080618		56090832	-1	30	86	55	77	tier1	no_errors	ENST00000423479	ensembl	human	known	74_37	missense	35.29	52.44	SNP	0.001	A	30	55
GABRR1	2569	genome.wustl.edu	37	6	89907776	89907776	+	Missense_Mutation	SNP	G	G	A	rs201013212		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:89907776G>A	ENST00000454853.2	-	5	645	c.535C>T	c.(535-537)Cgg>Tgg	p.R179W	GABRR1_ENST00000369451.3_Missense_Mutation_p.R92W|GABRR1_ENST00000435811.1_Missense_Mutation_p.R162W	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	179					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GGCTGGACCCGCAACATGACG	0.483													ENSG00000146276																																					0													198.0	172.0	181.0					6																	89907776		2203	4300	6503	SO:0001583	missense	0			-		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.535C>T	6.37:g.89907776G>A	ENSP00000412673:p.Arg179Trp		A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAa_rho1_rcpt,prints_Neur_channel,prints_GABAAa_rho_rcpt,tigrfam_Neur_channel	p.R179W	ENST00000454853.2	37	c.535	CCDS5019.2	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072444	0.76415	.	.	ENSG00000146276	ENST00000454853;ENST00000435811;ENST00000369451;ENST00000436331	T;T;T	0.79247	-1.25;-1.25;-1.25	5.83	4.94	0.65067	Neurotransmitter-gated ion-channel ligand-binding (3);	0.079850	0.64402	D	0.000002	D	0.83848	0.5343	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	D	0.84811	0.0790	9	.	.	.	-26.7525	16.0638	0.80859	0.0:0.0:0.8649:0.1351	.	162;179	P24046-2;P24046	.;GBRR1_HUMAN	W	179;162;92;92	ENSP00000412673:R179W;ENSP00000394687:R162W;ENSP00000358463:R92W	.	R	-	1	2	GABRR1	89964495	1.000000	0.71417	0.992000	0.48379	0.722000	0.41435	3.490000	0.53245	1.405000	0.46838	0.561000	0.74099	CGG	rs201013212	GABRR1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.483	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRR1	HGNC	protein_coding	OTTHUMT00000041479.2	0	0	0	65	65	95	0.00	0.00	G			89907776	-1	64	147	31	106	tier1	no_errors	ENST00000454853	ensembl	human	known	74_37	missense	67.37	57.87	SNP	1.000	A	64	31
KCNJ16	3773	genome.wustl.edu	37	17	68128480	68128480	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:68128480G>A	ENST00000589377.1	+	2	415	c.252G>A	c.(250-252)tcG>tcA	p.S84S	KCNJ16_ENST00000392670.1_Silent_p.S84S|KCNJ16_ENST00000392671.1_Silent_p.S84S|KCNJ16_ENST00000283936.1_Silent_p.S84S|KCNJ16_ENST00000586462.1_Silent_p.S123S|KCNJ16_ENST00000585558.1_Silent_p.S119S	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	84					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					ATATTCTCTCGTGGTTGATAT	0.413													ENSG00000153822																																					0													236.0	207.0	217.0					17																	68128480		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.252G>A	17.37:g.68128480G>A				Silent	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir5,prints_K_chnl_inward-rec_Kir	p.S84	ENST00000589377.1	37	c.252	CCDS11687.1	17																																																																																			-	KCNJ16	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir		0.413	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ16	HGNC	protein_coding	OTTHUMT00000450880.1	0	0	0	60	60	82	0.00	0.00	G	NM_018658		68128480	+1	28	50	12	27	tier1	no_errors	ENST00000283936	ensembl	human	known	74_37	silent	70.00	64.94	SNP	0.794	A	28	12
IGSF1	3547	genome.wustl.edu	37	X	130408805	130408805	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408805G>T	ENST00000361420.3	-	18	3598	c.3519C>A	c.(3517-3519)ttC>ttA	p.F1173L	IGSF1_ENST00000370903.3_Missense_Mutation_p.F1178L|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.F1164L|IGSF1_ENST00000370904.1_Missense_Mutation_p.F1164L			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1173	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCCCTAACTTGAACATGGTGC	0.488													ENSG00000147255																																					0													111.0	116.0	114.0					X																	130408805		2203	4300	6503	SO:0001583	missense	0			-	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3519C>A	X.37:g.130408805G>T	ENSP00000355010:p.Phe1173Leu		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F1178L	ENST00000361420.3	37	c.3534	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	2.470	-0.322222	0.05350	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.08896	3.04;3.04;3.04;3.04	5.03	4.1	0.47936	Immunoglobulin-like fold (1);	0.133656	0.35040	N	0.003494	T	0.10465	0.0256	N	0.05177	-0.1	0.33563	D	0.597671	D;B;D	0.59357	0.979;0.169;0.985	P;B;D	0.72338	0.889;0.262;0.977	T	0.23013	-1.0200	10	0.45353	T	0.12	.	9.7945	0.40726	0.0:0.2043:0.7957:0.0	.	1164;617;1173	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	L	1164;1173;1164;1178	ENSP00000359947:F1164L;ENSP00000355010:F1173L;ENSP00000359941:F1164L;ENSP00000359940:F1178L	ENSP00000355010:F1173L	F	-	3	2	IGSF1	130236486	0.958000	0.32768	1.000000	0.80357	0.408000	0.30992	0.668000	0.25127	2.225000	0.72522	0.594000	0.82650	TTC	-	IGSF1	-	smart_Ig_sub		0.488	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	0	0	1	90	90	113	0.00	0.88	G			130408805	-1	15	39	132	213	tier1	no_errors	ENST00000370903	ensembl	human	known	74_37	missense	10.20	15.35	SNP	1.000	T	15	132
PRSS1	5644	genome.wustl.edu	37	7	142459862	142459862	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:142459862C>T	ENST00000311737.7	+	3	444	c.438C>T	c.(436-438)aaC>aaT	p.N146N	PRSS1_ENST00000486171.1_Silent_p.N160N	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	146	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GCTGGGGCAACACTGCGAGCT	0.572													ENSG00000204983																																					0													70.0	71.0	71.0					7																	142459862		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.438C>T	7.37:g.142459862C>T			A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.N146	ENST00000311737.7	37	c.438	CCDS5872.1	7																																																																																			-	PRSS1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.572	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	HGNC	protein_coding	OTTHUMT00000352538.2	0	0	0	31	31	31	0.00	0.00	C			142459862	+1	27	33	21	55	tier1	no_errors	ENST00000311737	ensembl	human	known	74_37	silent	56.25	37.50	SNP	1.000	T	27	21
GABRD	2563	genome.wustl.edu	37	1	1959608	1959608	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:1959608G>A	ENST00000378585.4	+	6	651	c.568G>A	c.(568-570)Gag>Aag	p.E190K		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	190					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTACTCATCGGAGGACATCGT	0.642													ENSG00000187730																																					0													70.0	58.0	62.0					1																	1959608		2202	4300	6502	SO:0001583	missense	0			-	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.568G>A	1.37:g.1959608G>A	ENSP00000367848:p.Glu190Lys		Q8N4N9	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAd_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.E190K	ENST00000378585.4	37	c.568	CCDS36.1	1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346990	0.61183	.	.	ENSG00000187730	ENST00000378585	T	0.79247	-1.25	3.58	3.58	0.41010	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	N	0.20530	0.585	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.82686	-0.0334	10	0.66056	D	0.02	-16.402	14.7342	0.69404	0.0:0.0:1.0:0.0	.	190	O14764	GBRD_HUMAN	K	190	ENSP00000367848:E190K	ENSP00000367848:E190K	E	+	1	0	GABRD	1949468	1.000000	0.71417	0.870000	0.34147	0.027000	0.11550	9.275000	0.95738	2.031000	0.59945	0.561000	0.74099	GAG	-	GABRD	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.642	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	GABRD	HGNC	protein_coding	OTTHUMT00000098493.1	0	0	0	33	33	14	0.00	0.00	G	NM_000815		1959608	+1	14	17	21	26	tier1	no_errors	ENST00000378585	ensembl	human	known	74_37	missense	40.00	38.64	SNP	1.000	A	14	21
MYOM2	9172	genome.wustl.edu	37	8	2024315	2024315	+	Silent	SNP	G	G	A	rs563008335		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:2024315G>A	ENST00000262113.4	+	11	1356	c.1215G>A	c.(1213-1215)ccG>ccA	p.P405P	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	405	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCTGGAAGCCGCCCAACACCA	0.622													ENSG00000036448	G|||	1	0.000199681	0.0	0.0	5008	,	,		14476	0.001		0.0	False		,,,				2504	0.0																0													50.0	47.0	48.0					8																	2024315		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1215G>A	8.37:g.2024315G>A			Q7Z3Y2	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P405	ENST00000262113.4	37	c.1215	CCDS5957.1	8																																																																																			-	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.622	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	0	0	0	71	71	32	0.00	0.00	G	NM_003970		2024315	+1	31	16	79	30	tier1	no_errors	ENST00000262113	ensembl	human	known	74_37	silent	28.18	34.78	SNP	0.015	A	31	79
ASPH	444	genome.wustl.edu	37	8	62438653	62438653	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:62438653T>C	ENST00000379454.4	-	22	1970	c.1783A>G	c.(1783-1785)Aag>Gag	p.K595E	ASPH_ENST00000541428.1_Missense_Mutation_p.K566E	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	595					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	CGGATTAACTTCCAGTTTCTT	0.453													ENSG00000198363																																					0													83.0	82.0	82.0					8																	62438653		2203	4300	6503	SO:0001583	missense	0			-	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.1783A>G	8.37:g.62438653T>C	ENSP00000368767:p.Lys595Glu		A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K595E	ENST00000379454.4	37	c.1783	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718042	0.48622	.	.	ENSG00000198363	ENST00000541428;ENST00000379454	T;T	0.42513	0.97;0.97	5.68	5.68	0.88126	.	0.054845	0.64402	D	0.000001	T	0.28001	0.0690	N	0.12637	0.245	0.80722	D	1	B;B	0.30763	0.081;0.294	B;B	0.31495	0.017;0.131	T	0.10132	-1.0643	10	0.25106	T	0.35	-24.1086	15.9351	0.79698	0.0:0.0:0.0:1.0	.	566;595	F5H667;Q12797	.;ASPH_HUMAN	E	566;595	ENSP00000437864:K566E;ENSP00000368767:K595E	ENSP00000368767:K595E	K	-	1	0	ASPH	62601207	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.647000	0.67923	2.159000	0.67721	0.528000	0.53228	AAG	-	ASPH	-	pfam_Asp_Arg_b-Hydrxlase		0.453	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	0	0	0	46	46	79	0.00	0.00	T	NM_004318		62438653	-1	11	28	51	95	tier1	no_errors	ENST00000379454	ensembl	human	known	74_37	missense	17.74	22.76	SNP	1.000	C	11	51
DOCK4	9732	genome.wustl.edu	37	7	111617310	111617310	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:111617310G>A	ENST00000437633.1	-	8	834	c.578C>T	c.(577-579)aCc>aTc	p.T193I	DOCK4_ENST00000428084.1_Missense_Mutation_p.T193I|DOCK4_ENST00000476846.1_5'UTR	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	193					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CTGCACCGGGGTGTCTTTCTT	0.498													ENSG00000128512																																					0													65.0	66.0	65.0					7																	111617310		1969	4164	6133	SO:0001583	missense	0			-		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.578C>T	7.37:g.111617310G>A	ENSP00000404179:p.Thr193Ile		O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH3_domain,pfscan_SH3_domain	p.T193I	ENST00000437633.1	37	c.578	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.39|17.39	3.378671|3.378671	0.61735|0.61735	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000445943|ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	.|T;T	.|0.03301	.|3.98;3.98	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.07728|0.07728	0.0194|0.0194	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.26845	.|0.161;0.161;0.161;0.161	.|B;B;B;B	.|0.29598	.|0.067;0.104;0.104;0.104	T|T	0.16482|0.16482	-1.0401|-1.0401	5|10	.|0.46703	.|T	.|0.11	.|.	19.2437|19.2437	0.93893|0.93893	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|193;193;193;193	.|A4D0S8;Q149N6;Q149N5;Q8N1I0	.|.;.;.;DOCK4_HUMAN	S|I	181|181;193;193;181;192	.|ENSP00000410746:T193I;ENSP00000404179:T193I	.|ENSP00000345432:T181I	P|T	-|-	1|2	0|0	DOCK4|DOCK4	111404546|111404546	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.862000|0.862000	0.49288|0.49288	7.581000|7.581000	0.82535|0.82535	2.527000|2.527000	0.85204|0.85204	0.563000|0.563000	0.77884|0.77884	CCC|ACC	-	DOCK4	-	NULL		0.498	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	0	0	0	56	56	65	0.00	0.00	G	NM_014705		111617310	-1	53	43	48	60	tier1	no_errors	ENST00000428084	ensembl	human	known	74_37	missense	52.48	41.75	SNP	1.000	A	53	48
PADI6	353238	genome.wustl.edu	37	1	17707595	17707595	+	RNA	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:17707595C>A	ENST00000434762.2	+	0	539							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TTGTGAATTGCAACCCTGCTG	0.493													ENSG00000256049																																					0													76.0	79.0	78.0					1																	17707595		1946	4144	6090			0			-	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17707595C>A			Q330K5|Q70SX3	R	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			-	PADI6	-	-		0.493	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	0	0	0	26	26	82	0.00	0.00	C	NM_207421		17707595	+1	23	61	37	85	tier1	no_errors	ENST00000358481	ensembl	human	known	74_37	rna	38.33	41.78	SNP	0.017	A	23	37
GPR112	139378	genome.wustl.edu	37	X	135405422	135405422	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:135405422C>A	ENST00000394143.1	+	5	847	c.556C>A	c.(556-558)Caa>Aaa	p.Q186K	GPR112_ENST00000412101.1_Intron|GPR112_ENST00000287534.4_Missense_Mutation_p.Q123K|GPR112_ENST00000394141.1_Intron|GPR112_ENST00000370652.1_Missense_Mutation_p.Q186K	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	186					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GTACTACTTTCAACTCTGGGA	0.443													ENSG00000156920																																					0													171.0	150.0	157.0					X																	135405422		2203	4300	6503	SO:0001583	missense	0			-	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.556C>A	X.37:g.135405422C>A	ENSP00000377699:p.Gln186Lys		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.Q186K	ENST00000394143.1	37	c.556	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916273	0.73098	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000287534	T;T;T	0.62788	-0.0;-0.0;-0.0	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.71324	0.3326	L	0.34521	1.04	0.23056	N	0.998361	D	0.69078	0.997	D	0.83275	0.996	T	0.64997	-0.6275	9	0.59425	D	0.04	.	15.2305	0.73383	0.0:1.0:0.0:0.0	.	186	Q8IZF6	GP112_HUMAN	K	186;186;123	ENSP00000377699:Q186K;ENSP00000359686:Q186K;ENSP00000287534:Q123K	ENSP00000287534:Q123K	Q	+	1	0	GPR112	135233088	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.991000	0.49409	2.349000	0.79799	0.513000	0.50165	CAA	-	GPR112	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.443	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	0	0	0	44	44	93	0.00	0.00	C			135405422	+1	22	36	83	121	tier1	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	20.95	22.93	SNP	1.000	A	22	83
FAM83F	113828	genome.wustl.edu	37	22	40391373	40391373	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:40391373C>T	ENST00000333407.6	+	1	421	c.327C>T	c.(325-327)ccC>ccT	p.P109P	FAM83F_ENST00000488874.1_3'UTR	NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	109										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						CCTACTGGCCCGACCGTTCCG	0.731													ENSG00000133477																																					0													4.0	6.0	5.0					22																	40391373		1635	3605	5240	SO:0001819	synonymous_variant	0			-		CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.327C>T	22.37:g.40391373C>T			Q96FD6	Silent	SNP	pfam_DUF1669	p.P109	ENST00000333407.6	37	c.327	CCDS14000.2	22																																																																																			-	FAM83F	-	pfam_DUF1669		0.731	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83F	HGNC	protein_coding	OTTHUMT00000319624.3	0	0	0	17	17	22	0.00	0.00	C	NM_138435		40391373	+1	15	24	23	23	tier1	no_errors	ENST00000333407	ensembl	human	known	74_37	silent	39.47	51.06	SNP	0.983	T	15	23
OPALIN	93377	genome.wustl.edu	37	10	98109509	98109509	+	Silent	SNP	T	T	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:98109509T>G	ENST00000371172.3	-	4	552	c.147A>C	c.(145-147)ctA>ctC	p.L49L	OPALIN_ENST00000393870.2_Silent_p.L38L|OPALIN_ENST00000419479.1_Silent_p.L39L|OPALIN_ENST00000393871.1_Silent_p.L26L|OPALIN_ENST00000536387.1_Silent_p.L39L	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	49						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TCAAAGTAAATAGTAAAGCCA	0.507													ENSG00000197430																																					0													71.0	69.0	69.0					10																	98109509		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.147A>C	10.37:g.98109509T>G			A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Silent	SNP	NULL	p.L49	ENST00000371172.3	37	c.147	CCDS7448.1	10																																																																																			-	OPALIN	-	NULL		0.507	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	HGNC	protein_coding	OTTHUMT00000049606.1	0	0	0	36	36	54	0.00	0.00	T	NM_033207		98109509	-1	18	55	13	17	tier1	no_errors	ENST00000371172	ensembl	human	known	74_37	silent	58.06	76.39	SNP	0.000	G	18	13
OR12D3	81797	genome.wustl.edu	37	6	29342525	29342525	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:29342525C>T	ENST00000396806.3	-	1	543	c.540G>A	c.(538-540)aaG>aaA	p.K180K	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						CTAAGAGCGGCTTGACATCGT	0.448													ENSG00000112462																																					0													93.0	94.0	94.0					6																	29342525		1510	2708	4218	SO:0001819	synonymous_variant	0			-		CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.540G>A	6.37:g.29342525C>T			A2BDZ1|Q5SQI8|Q6IF23	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K180	ENST00000396806.3	37	c.540	CCDS4658.1	6																																																																																			-	OR12D3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.448	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D3	HGNC	protein_coding	OTTHUMT00000076056.3	0	0	0	20	20	89	0.00	0.00	C			29342525	-1	4	29	17	96	tier1	no_errors	ENST00000396806	ensembl	human	known	74_37	silent	19.05	23.20	SNP	0.071	T	4	17
LMTK2	22853	genome.wustl.edu	37	7	97823854	97823854	+	Silent	SNP	C	C	T	rs560743982		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:97823854C>T	ENST00000297293.5	+	11	4370	c.4077C>T	c.(4075-4077)ttC>ttT	p.F1359F		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1359					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TCACGTTTTTCGATGATGTCA	0.483													ENSG00000164715																																					0													94.0	77.0	83.0					7																	97823854		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4077C>T	7.37:g.97823854C>T			A4D272|Q75MG7|Q9UPS3	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F1359	ENST00000297293.5	37	c.4077	CCDS5654.1	7																																																																																			-	LMTK2	-	NULL		0.483	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	0	0	0	34	34	109	0.00	0.00	C	NM_014916		97823854	+1	27	57	36	96	tier1	no_errors	ENST00000297293	ensembl	human	known	74_37	silent	42.19	37.01	SNP	0.635	T	27	36
OR7C1	26664	genome.wustl.edu	37	19	14910160	14910160	+	Silent	SNP	T	T	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:14910160T>C	ENST00000248073.2	-	1	863	c.789A>G	c.(787-789)gcA>gcG	p.A263A	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	263					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						ATGGTGTGGCTGCAGAACTGA	0.542													ENSG00000127530																																					0													89.0	82.0	84.0					19																	14910160		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.789A>G	19.37:g.14910160T>C			Q15621|Q6IFP2|Q96R94	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A263	ENST00000248073.2	37	c.789	CCDS12317.1	19																																																																																			-	OR7C1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	0	0	0	49	49	38	0.00	0.00	T			14910160	-1	32	32	25	40	tier1	no_errors	ENST00000248073	ensembl	human	known	74_37	silent	56.14	44.44	SNP	0.000	C	32	25
CALCR	799	genome.wustl.edu	37	7	93106949	93106949	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:93106949C>A	ENST00000394441.1	-	4	552	c.237G>T	c.(235-237)tgG>tgT	p.W79C	CALCR_ENST00000426151.1_Missense_Mutation_p.W79C|CALCR_ENST00000360249.4_Missense_Mutation_p.W79C|CALCR_ENST00000359558.2_Missense_Mutation_p.W97C|CALCR_ENST00000421592.1_Missense_Mutation_p.W79C	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	97					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CCCAGCACAGCCATCCATCCC	0.423													ENSG00000004948																																					0													93.0	78.0	83.0					7																	93106949		2203	4300	6503	SO:0001583	missense	0			-	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.237G>T	7.37:g.93106949C>A	ENSP00000377959:p.Trp79Cys		A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_secretin-like,prints_GPCR_2_calcitonin_rcpt	p.W97C	ENST00000394441.1	37	c.291	CCDS5631.1	7	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927608	0.73327	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000535783;ENST00000394441;ENST00000426151	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	4.06	4.06	0.47325	.	.	.	.	.	D	0.84275	0.5436	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.88882	0.3340	9	0.72032	D	0.01	.	16.1994	0.82060	0.0:1.0:0.0:0.0	.	97;79	F5H605;A4D1G6	.;.	C	97;79;79;79;79;79	ENSP00000352561:W97C;ENSP00000353385:W79C;ENSP00000399552:W79C;ENSP00000377959:W79C;ENSP00000389295:W79C	ENSP00000352561:W97C	W	-	3	0	CALCR	92944885	1.000000	0.71417	0.977000	0.42913	0.994000	0.84299	7.123000	0.77176	2.544000	0.85801	0.557000	0.71058	TGG	-	CALCR	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.423	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CALCR	HGNC	protein_coding	OTTHUMT00000254661.2	0	0	0	34	34	91	0.00	0.00	C	NM_001742		93106949	-1	15	29	41	93	tier1	no_errors	ENST00000359558	ensembl	human	known	74_37	missense	26.79	23.58	SNP	1.000	A	15	41
MET	4233	genome.wustl.edu	37	7	116340033	116340033	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr7:116340033A>T	ENST00000318493.6	+	2	1082	c.895A>T	c.(895-897)Att>Ttt	p.I299F	MET_ENST00000436117.2_Missense_Mutation_p.I299F|MET_ENST00000397752.3_Missense_Mutation_p.I299F			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TCTGGAGTGTATTCTCACAGA	0.423			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)				ENSG00000105976																												Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													76.0	72.0	73.0					7																	116340033		1840	4092	5932	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.895A>T	7.37:g.116340033A>T	ENSP00000317272:p.Ile299Phe		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.I299F	ENST00000318493.6	37	c.895	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	A	13.60	2.285649	0.40394	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.11063	2.81;2.81;2.81	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.047093	0.85682	D	0.000000	T	0.39145	0.1067	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.952;1.0;0.995;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;0.999;0.999	T	0.21449	-1.0245	10	0.48119	T	0.1	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	299;299;299;299;299;299;299;299;299;299;299;299;299	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	F	299	ENSP00000380860:I299F;ENSP00000317272:I299F;ENSP00000410980:I299F	ENSP00000317272:I299F	I	+	1	0	MET	116127269	1.000000	0.71417	0.998000	0.56505	0.009000	0.06853	6.976000	0.76135	2.371000	0.80710	0.533000	0.62120	ATT	-	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.423	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	0	0	0	31	31	78	0.00	0.00	A			116340033	+1	7	13	47	109	tier1	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	12.96	10.66	SNP	1.000	T	7	47
CAMTA1	23261	genome.wustl.edu	37	1	7796530	7796530	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:7796530G>A	ENST00000303635.7	+	13	3400	c.3193G>A	c.(3193-3195)Gga>Aga	p.G1065R	CAMTA1_ENST00000439411.2_Missense_Mutation_p.G1065R	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1065					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GACTTTCCGCGGAATGACCCT	0.592			T	WWTR1	epitheliod hemangioendothelioma								ENSG00000171735																												Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													132.0	120.0	124.0					1																	7796530		2203	4300	6503	SO:0001583	missense	0			-	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3193G>A	1.37:g.7796530G>A	ENSP00000306522:p.Gly1065Arg		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.G1065R	ENST00000303635.7	37	c.3193	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474081	0.84640	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	T;T	0.49720	0.77;0.77	5.58	5.58	0.84498	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.72566	0.3476	M	0.81497	2.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	T	0.75789	-0.3194	10	0.87932	D	0	-13.6807	19.5825	0.95473	0.0:0.0:1.0:0.0	.	1065;152;21;1065	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	R	1065;1065;152;21	ENSP00000306522:G1065R;ENSP00000402561:G1065R	ENSP00000306522:G1065R	G	+	1	0	CAMTA1	7719117	1.000000	0.71417	0.341000	0.25589	0.535000	0.34838	9.793000	0.99091	2.624000	0.88883	0.655000	0.94253	GGA	-	CAMTA1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.592	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	0	0	0	43	43	86	0.00	0.00	G	NM_015215		7796530	+1	6	18	37	124	tier1	no_errors	ENST00000303635	ensembl	human	known	74_37	missense	13.64	12.68	SNP	1.000	A	6	37
OBSL1	23363	genome.wustl.edu	37	2	220424007	220424007	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:220424007C>T	ENST00000404537.1	-	9	3222	c.3166G>A	c.(3166-3168)Ggg>Agg	p.G1056R	OBSL1_ENST00000265318.4_Missense_Mutation_p.G1056R|OBSL1_ENST00000373876.1_Missense_Mutation_p.G1056R|OBSL1_ENST00000603926.1_Missense_Mutation_p.G1056R|OBSL1_ENST00000265317.5_Missense_Mutation_p.G47R|RP11-256I23.2_ENST00000597192.1_RNA	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1056	Ig-like 8.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		AACTCGCCCCCGTCCTCGGGC	0.612													ENSG00000124006																																					0																																										SO:0001583	missense	0			-	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.3166G>A	2.37:g.220424007C>T	ENSP00000385636:p.Gly1056Arg		A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G1056R	ENST00000404537.1	37	c.3166	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	11.47	1.649218	0.29336	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000265317	T;T;T;T	0.41065	2.63;2.63;2.63;1.01	4.34	4.34	0.51931	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55909	0.1950	M	0.68593	2.085	0.09310	N	1	P;D;D;D	0.89917	0.937;1.0;1.0;1.0	P;D;D;D	0.97110	0.603;1.0;1.0;0.997	T	0.49943	-0.8885	9	0.41790	T	0.15	.	3.8349	0.08889	0.2368:0.6191:0.0:0.1441	.	47;1057;1056;47	B7Z5P5;A4KVA4;O75147;E7ER99	.;.;OBSL1_HUMAN;.	R	1056;1056;1056;47	ENSP00000265318:G1056R;ENSP00000385636:G1056R;ENSP00000362983:G1056R;ENSP00000265317:G47R	ENSP00000265317:G47R	G	-	1	0	OBSL1	220132251	0.000000	0.05858	0.945000	0.38365	0.088000	0.18126	-0.115000	0.10741	2.256000	0.74724	0.491000	0.48974	GGG	-	OBSL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.612	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	0	0	0	20	20	44	0.00	0.00	C			220424007	-1	4	37	4	12	tier1	no_errors	ENST00000404537	ensembl	human	known	74_37	missense	50.00	75.51	SNP	0.044	T	4	4
SLC2A6	11182	genome.wustl.edu	37	9	136343454	136343454	+	Silent	SNP	T	T	C	rs199947289	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr9:136343454T>C	ENST00000371899.4	-	2	254	c.177A>G	c.(175-177)acA>acG	p.T59T	SLC2A6_ENST00000371897.4_Silent_p.T59T|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	59					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		TGACAGGGGATGTGTAGACCA	0.587													ENSG00000160326	T|||	2	0.000399361	0.0	0.0	5008	,	,		18451	0.002		0.0	False		,,,				2504	0.0																0													165.0	159.0	161.0					9																	136343454		2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.177A>G	9.37:g.136343454T>C			A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.T59	ENST00000371899.4	37	c.177	CCDS6975.1	9																																																																																			rs199947289	SLC2A6	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.587	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A6	HGNC	protein_coding	OTTHUMT00000054909.1	0	0	0	97	97	67	0.00	0.00	T	NM_017585		136343454	-1	21	25	50	53	tier1	no_errors	ENST00000371899	ensembl	human	known	74_37	silent	29.58	32.05	SNP	0.323	C	21	50
ADSL	158	genome.wustl.edu	37	22	40762509	40762509	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:40762509G>A	ENST00000216194.7	+	13	1494	c.1438G>A	c.(1438-1440)Gca>Aca	p.A480T	ADSL_ENST00000342312.6_Missense_Mutation_p.A421T|ADSL_ENST00000454266.2_Missense_Mutation_p.A494T	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	480					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						GAAGGTGAAAGCAGAATTATG	0.373													ENSG00000239900																									Colon(4;65 130 1097 1516)												0													124.0	119.0	120.0					22																	40762509		2203	4300	6503	SO:0001583	missense	0			-	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.1438G>A	22.37:g.40762509G>A	ENSP00000216194:p.Ala480Thr		B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	pfam_Fumarate_lyase_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase_fam,tigrfam_Pur_lyase	p.A494T	ENST00000216194.7	37	c.1480	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540772	0.65085	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	D;D;D	0.96104	-3.91;-3.91;-3.65	5.47	5.47	0.80525	.	0.159160	0.56097	D	0.000040	D	0.93409	0.7898	M	0.70595	2.14	0.31195	N	0.700425	B;B;B;B	0.23540	0.087;0.02;0.046;0.046	B;B;B;B	0.26094	0.066;0.034;0.031;0.031	D	0.88752	0.3251	9	.	.	.	-10.9115	8.1622	0.31204	0.1601:0.0:0.8399:0.0	.	494;421;480;480	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	T	480;494;300;421	ENSP00000216194:A480T;ENSP00000390107:A494T;ENSP00000341429:A421T	.	A	+	1	0	ADSL	39092455	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.930000	0.56522	2.853000	0.98044	0.655000	0.94253	GCA	-	ADSL	-	NULL		0.373	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	0	0	0	74	74	90	0.00	0.00	G	NM_000026		40762509	+1	41	88	54	104	tier1	no_errors	ENST00000454266	ensembl	human	known	74_37	missense	43.16	45.83	SNP	1.000	A	41	54
STARD8	9754	genome.wustl.edu	37	X	67939184	67939184	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:67939184G>A	ENST00000252336.6	+	6	1965	c.1593G>A	c.(1591-1593)ctG>ctA	p.L531L	STARD8_ENST00000374597.3_Silent_p.L531L|STARD8_ENST00000374599.3_Silent_p.L611L	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	531					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GCTCACTGCTGCGGCTTACCG	0.602													ENSG00000130052																																					0													81.0	50.0	60.0					X																	67939184		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1593G>A	X.37:g.67939184G>A			A8K6T2|D3DVT9|Q5JST0|Q68DG7	Silent	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.L611	ENST00000252336.6	37	c.1833	CCDS14390.1	X																																																																																			-	STARD8	-	NULL		0.602	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	0	0	0	90	90	44	0.00	0.00	G	NM_014725		67939184	+1	53	15	29	10	tier1	no_errors	ENST00000374599	ensembl	human	known	74_37	silent	64.63	60.00	SNP	0.998	A	53	29
GJD2	57369	genome.wustl.edu	37	15	35045464	35045464	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr15:35045464C>A	ENST00000290374.4	-	2	657	c.181G>T	c.(181-183)Ggc>Tgc	p.G61C	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	61					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TGGTTACAGCCGGGCTGCAGG	0.547													ENSG00000159248																																					0													92.0	82.0	85.0					15																	35045464		2201	4298	6499	SO:0001583	missense	0			-	AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.181G>T	15.37:g.35045464C>A	ENSP00000290374:p.Gly61Cys		Q2M241|Q9P2R0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin36	p.G61C	ENST00000290374.4	37	c.181	CCDS10040.1	15	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823427	0.71143	.	.	ENSG00000159248	ENST00000290374	D	0.99814	-6.89	5.09	5.09	0.68999	Connexin, conserved site (1);Connexin, N-terminal (2);	0.000000	0.64402	D	0.000015	D	0.99837	0.9926	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96897	0.9657	10	0.87932	D	0	.	18.6722	0.91516	0.0:1.0:0.0:0.0	.	61	Q9UKL4	CXD2_HUMAN	C	61	ENSP00000290374:G61C	ENSP00000290374:G61C	G	-	1	0	GJD2	32832756	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.651000	0.83577	2.648000	0.89879	0.555000	0.69702	GGC	-	GJD2	-	pfam_Connexin_N,smart_Connexin_N,prints_Connexin		0.547	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD2	HGNC	protein_coding	OTTHUMT00000251875.2	0	0	0	44	44	93	0.00	0.00	C			35045464	-1	10	27	16	60	tier1	no_errors	ENST00000290374	ensembl	human	known	74_37	missense	38.46	31.03	SNP	1.000	A	10	16
FGD3	89846	genome.wustl.edu	37	9	95796885	95796885	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr9:95796885C>T	ENST00000375482.3	+	17	2344	c.1848C>T	c.(1846-1848)agC>agT	p.S616S	FGD3_ENST00000337352.6_Silent_p.S616S|FGD3_ENST00000416701.2_Silent_p.S615S|FGD3_ENST00000538555.1_Silent_p.S219S	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	616	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						TGTCAGAGAGCGGTGAGACCT	0.672													ENSG00000127084																																					0													40.0	48.0	45.0					9																	95796885		2013	4173	6186	SO:0001819	synonymous_variant	0			-	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1848C>T	9.37:g.95796885C>T			F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S616	ENST00000375482.3	37	c.1848	CCDS43849.1	9																																																																																			-	FGD3	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.672	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	HGNC	protein_coding	OTTHUMT00000055493.1	0	0	0	40	40	11	0.00	0.00	C	NM_033086		95796885	+1	27	11	44	13	tier1	no_errors	ENST00000337352	ensembl	human	known	74_37	silent	38.03	45.83	SNP	0.000	T	27	44
SGK223	157285	genome.wustl.edu	37	8	8234395	8234395	+	Silent	SNP	G	G	A	rs200101338		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:8234395G>A	ENST00000520004.1	-	3	1788	c.1524C>T	c.(1522-1524)tcC>tcT	p.S508S	SGK223_ENST00000330777.4_Silent_p.S508S			Q86YV5	SG223_HUMAN		510							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CACCTACCTCGGAGTTCTGGC	0.652													ENSG00000182319																									GBM(34;731 755 10259 33573 33867)												0								G		2,4184		0,2,2091	21.0	24.0	23.0		1524	-7.4	0.0	8		23	4,8426		0,4,4211	no	coding-synonymous	SGK223	NM_001080826.1		0,6,6302	AA,AG,GG		0.0474,0.0478,0.0476		508/1403	8234395	6,12610	2093	4215	6308	SO:0001819	synonymous_variant	0			-																												ENST00000520004.1:c.1524C>T	8.37:g.8234395G>A			Q8N3N5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.S508	ENST00000520004.1	37	c.1524	CCDS43706.1	8																																																																																			rs200101338	SGK223	-	NULL		0.652	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	0	0	0	55	55	43	0.00	0.00	G			8234395	-1	13	10	57	61	tier1	no_errors	ENST00000330777	ensembl	human	known	74_37	silent	18.57	14.08	SNP	0.001	A	13	57
CPAMD8	27151	genome.wustl.edu	37	19	17040028	17040028	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:17040028G>A	ENST00000443236.1	-	24	3040	c.3009C>T	c.(3007-3009)ccC>ccT	p.P1003P		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	956						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CATACTTGTTGGGGGTGGAGA	0.572													ENSG00000160111																																					0													51.0	57.0	55.0					19																	17040028		2072	4216	6288	SO:0001819	synonymous_variant	0			-	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3009C>T	19.37:g.17040028G>A			Q8NC09|Q9ULD7	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.P1003	ENST00000443236.1	37	c.3009	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	9.355	1.066460	0.20067	.	.	ENSG00000160111	ENST00000443236	T	0.35236	1.32	3.39	-1.86	0.07760	.	0.000000	0.64402	U	0.000011	T	0.34600	0.0903	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29671	-1.0004	7	0.87932	D	0	.	1.5758	0.02624	0.1761:0.334:0.3229:0.167	.	.	.	.	L	1014	ENSP00000402505:P1014L	ENSP00000402505:P1014L	P	-	2	0	CPAMD8	16901028	1.000000	0.71417	0.973000	0.42090	0.973000	0.67179	0.868000	0.27982	0.405000	0.25532	-0.182000	0.12963	CCA	-	CPAMD8	-	NULL		0.572	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	0	0	0	63	63	62	0.00	0.00	G	NM_015692		17040028	-1	14	26	47	44	tier1	no_errors	ENST00000443236	ensembl	human	known	74_37	silent	22.95	37.14	SNP	0.999	A	14	47
SEC14L6	730005	genome.wustl.edu	37	22	30925097	30925097	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:30925097C>T	ENST00000402034.2	-	8	640	c.641G>A	c.(640-642)cGc>cAc	p.R214H		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	214	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						CACCTTCCTGCGTGTCTCTTC	0.567													ENSG00000214491																																					0																																										SO:0001583	missense	0			-		CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.641G>A	22.37:g.30925097C>T	ENSP00000385695:p.Arg214His			Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.R214H	ENST00000402034.2	37	c.641	CCDS54518.1	22	.	.	.	.	.	.	.	.	.	.	.	19.72	3.879558	0.72294	.	.	ENSG00000214491	ENST00000402034	T	0.79352	-1.26	3.96	1.76	0.24704	.	.	.	.	.	D	0.83599	0.5289	M	0.85777	2.775	0.58432	D	0.999993	.	.	.	.	.	.	T	0.81391	-0.0954	7	0.66056	D	0.02	-7.7704	7.0451	0.25040	0.0:0.7284:0.1742:0.0974	.	.	.	.	H	214	ENSP00000385695:R214H	ENSP00000385695:R214H	R	-	2	0	SEC14L6	29255097	0.003000	0.15002	0.002000	0.10522	0.341000	0.28922	1.472000	0.35376	0.246000	0.21394	0.430000	0.28490	CGC	-	SEC14L6	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran		0.567	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	SEC14L6	HGNC	protein_coding	OTTHUMT00000322022.2	0	0	0	31	31	13	0.00	0.00	C			30925097	-1	7	22	3	14	tier1	no_errors	ENST00000402034	ensembl	human	novel	74_37	missense	70.00	61.11	SNP	0.571	T	7	3
TGS1	96764	genome.wustl.edu	37	8	56698829	56698829	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:56698829A>G	ENST00000260129.5	+	4	849	c.372A>G	c.(370-372)atA>atG	p.I124M		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	124					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AAGTTAAAATAAAAAAGAAAA	0.259													ENSG00000137574																									Esophageal Squamous(34;275 823 4842 34837 48447)												0													14.0	14.0	14.0					8																	56698829		2141	4265	6406	SO:0001583	missense	0			-	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.372A>G	8.37:g.56698829A>G	ENSP00000260129:p.Ile124Met		A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	pfam_R_cap_Gua-N2-MeTrfase,pfam_R_methylase_dom,pfam_tR_Trfase_Trm5/Tyw2	p.I124M	ENST00000260129.5	37	c.372	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	A	9.682	1.149508	0.21288	.	.	ENSG00000137574	ENST00000260129	T	0.17370	2.28	5.36	-6.02	0.02192	.	1.088660	0.07112	N	0.842302	T	0.09024	0.0223	L	0.35723	1.085	0.09310	N	1	B;P	0.45283	0.07;0.855	B;B	0.39027	0.01;0.288	T	0.22417	-1.0217	10	0.46703	T	0.11	0.0087	0.0728	0.00024	0.2689:0.1931:0.2305:0.3075	.	124;124	B2RBJ7;Q96RS0	.;TGS1_HUMAN	M	124	ENSP00000260129:I124M	ENSP00000260129:I124M	I	+	3	3	TGS1	56861383	0.000000	0.05858	0.052000	0.19188	0.532000	0.34746	-1.654000	0.01984	-0.598000	0.05806	-0.258000	0.10820	ATA	-	TGS1	-	NULL		0.259	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	0	0	0	36	36	30	0.00	0.00	A	NM_024831		56698829	+1	13	6	21	30	tier1	no_errors	ENST00000260129	ensembl	human	known	74_37	missense	38.24	16.22	SNP	0.006	G	13	21
HMCN1	83872	genome.wustl.edu	37	1	186151337	186151337	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr1:186151337T>G	ENST00000271588.4	+	105	16561	c.16332T>G	c.(16330-16332)caT>caG	p.H5444Q	HMCN1_ENST00000367492.2_Missense_Mutation_p.H5327Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5444	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCTGCCAGCATGAGTGTAAGA	0.423													ENSG00000143341																																					0													148.0	142.0	144.0					1																	186151337		2203	4300	6503	SO:0001583	missense	0			-	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16332T>G	1.37:g.186151337T>G	ENSP00000271588:p.His5444Gln		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.H5444Q	ENST00000271588.4	37	c.16332	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.687510	0.48097	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.86769	-2.17;-2.17;-2.17	5.53	1.86	0.25419	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.86410	0.5926	N	0.25485	0.75	0.39772	D	0.972175	D	0.55800	0.973	D	0.66196	0.942	D	0.83659	0.0160	10	0.46703	T	0.11	.	9.5339	0.39211	0.0:0.2949:0.0:0.7051	.	5444	Q96RW7	HMCN1_HUMAN	Q	5444;5327;119	ENSP00000271588:H5444Q;ENSP00000356462:H5327Q;ENSP00000406205:H119Q	ENSP00000271588:H5444Q	H	+	3	2	HMCN1	184417960	0.599000	0.26891	0.999000	0.59377	0.992000	0.81027	-0.242000	0.08928	0.055000	0.16094	-0.371000	0.07208	CAT	-	HMCN1	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	0	0	0	24	24	56	0.00	0.00	T	NM_031935		186151337	+1	20	41	30	64	tier1	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	40.00	39.05	SNP	0.999	G	20	30
TARS	6897	genome.wustl.edu	37	5	33463875	33463875	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:33463875C>T	ENST00000265112.3	+	17	2164	c.1853C>T	c.(1852-1854)cCt>cTt	p.P618L	TARS_ENST00000502553.1_Missense_Mutation_p.P618L|TARS_ENST00000509410.1_3'UTR|TARS_ENST00000455217.2_Missense_Mutation_p.P651L|TARS_ENST00000414361.2_Missense_Mutation_p.P497L|TARS_ENST00000541634.1_Missense_Mutation_p.P514L	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	618					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	TGGCTGTCCCCTCGCCAGGTA	0.398													ENSG00000113407																																					0													112.0	97.0	102.0					5																	33463875		2203	4300	6503	SO:0001583	missense	0			-	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.1853C>T	5.37:g.33463875C>T	ENSP00000265112:p.Pro618Leu		A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	pfam_aa-tR-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tR_SAD,superfamily_Thr/Ala-tR-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tR_SAD,prints_Thr-tR-ligase_IIa,pfscan_aa-tR-synth_II,tigrfam_Thr-tR-ligase_IIa	p.P618L	ENST00000265112.3	37	c.1853	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.194284	0.94960	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T	0.75260	-0.9;-0.9;-0.92	5.86	5.86	0.93980	Anticodon-binding (2);	0.000000	0.85682	D	0.000000	D	0.93268	0.7855	H	0.99746	4.745	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.99;0.999	D;D;D;D	0.72625	0.978;0.933;0.914;0.933	D	0.95818	0.8847	10	0.87932	D	0	-8.7674	20.2019	0.98263	0.0:1.0:0.0:0.0	.	497;651;514;618	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	L	618;618;514;651;497	ENSP00000424387:P618L;ENSP00000265112:P618L;ENSP00000387710:P651L	ENSP00000265112:P618L	P	+	2	0	TARS	33499632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.568000	0.82369	2.776000	0.95493	0.655000	0.94253	CCT	-	TARS	-	superfamily_Anticodon-bd,prints_Thr-tR-ligase_IIa,tigrfam_Thr-tR-ligase_IIa		0.398	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	0	0	0	61	61	95	0.00	0.00	C	NM_152295		33463875	+1	23	58	15	23	tier1	no_errors	ENST00000265112	ensembl	human	known	74_37	missense	58.97	71.60	SNP	1.000	T	23	15
ZNF225	7768	genome.wustl.edu	37	19	44622636	44622636	+	Splice_Site	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:44622636G>T	ENST00000262894.6	+	4	424	c.144G>T	c.(142-144)ggG>ggT	p.G48G	ZNF225_ENST00000592780.1_Splice_Site_p.G48G|ZNF225_ENST00000590612.1_Splice_Site_p.G48G	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	48	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				CGTTCACAGGGCATCAATCAC	0.383													ENSG00000256294																																					0													86.0	83.0	84.0					19																	44622636		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.143-1G>T	19.37:g.44622636G>T			A8K8S2|Q53F12|Q9NS46|Q9UID8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G48	ENST00000262894.6	37	c.144	CCDS46100.1	19																																																																																			-	ZNF225	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.383	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	HGNC	protein_coding	OTTHUMT00000460581.1	0	0	0	90	90	57	0.00	0.00	G		Silent	44622636	+1	12	24	44	86	tier1	no_errors	ENST00000262894	ensembl	human	known	74_37	silent	21.43	21.82	SNP	0.001	T	12	44
NLRP9	338321	genome.wustl.edu	37	19	56220321	56220321	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:56220321G>C	ENST00000332836.2	-	9	2960	c.2933C>G	c.(2932-2934)cCt>cGt	p.P978R	CTD-2611O12.6_ENST00000600582.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA|CTD-2611O12.7_ENST00000597680.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	978						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		GTCAATCCAAGGTCCATGTGA	0.478													ENSG00000185792																																					0													105.0	101.0	102.0					19																	56220321		2203	4300	6503	SO:0001583	missense	0			-	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2933C>G	19.37:g.56220321G>C	ENSP00000331857:p.Pro978Arg		B2RN12|Q86W27	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.P978R	ENST00000332836.2	37	c.2933	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	G	9.598	1.127819	0.20959	.	.	ENSG00000185792	ENST00000332836	T	0.72942	-0.7	2.65	-1.06	0.10002	.	.	.	.	.	T	0.56366	0.1980	L	0.29908	0.895	0.09310	N	0.999998	P	0.51351	0.944	P	0.44860	0.462	T	0.50065	-0.8871	9	0.52906	T	0.07	.	5.6222	0.17463	0.4372:0.0:0.5628:0.0	.	978	Q7RTR0	NALP9_HUMAN	R	978	ENSP00000331857:P978R	ENSP00000331857:P978R	P	-	2	0	NLRP9	60912133	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.298000	0.19120	-0.143000	0.11334	-0.150000	0.13652	CCT	-	NLRP9	-	NULL		0.478	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	0	0	0	56	56	136	0.00	0.00	G	NM_176820		56220321	-1	19	25	62	106	tier1	no_errors	ENST00000332836	ensembl	human	known	74_37	missense	23.46	19.08	SNP	0.000	C	19	62
IGSF1	3547	genome.wustl.edu	37	X	130409008	130409008	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130409008G>T	ENST00000361420.3	-	17	3516	c.3437C>A	c.(3436-3438)tCa>tAa	p.S1146*	IGSF1_ENST00000370903.3_Nonsense_Mutation_p.S1151*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.S1137*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.S1137*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1146	Ig-like C2-type 11.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ACTGTGATTTGAAGCTGCAAA	0.468													ENSG00000147255																																					0													166.0	160.0	162.0					X																	130409008		2203	4300	6503	SO:0001587	stop_gained	0			-	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3437C>A	X.37:g.130409008G>T	ENSP00000355010:p.Ser1146*		B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S1151*	ENST00000361420.3	37	c.3452	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	41	8.601538	0.98881	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	5.35	4.48	0.54585	.	2.260420	0.01731	N	0.028871	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1551	0.31165	0.1092:0.0:0.8908:0.0	.	.	.	.	X	1137;1146;1137;1151	.	ENSP00000355010:S1146X	S	-	2	0	IGSF1	130236689	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	2.987000	0.49378	2.376000	0.81061	0.594000	0.82650	TCA	-	IGSF1	-	smart_Ig_sub		0.468	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	0	0	0	60	60	80	0.00	0.00	G			130409008	-1	16	24	66	155	tier1	no_errors	ENST00000370903	ensembl	human	known	74_37	nonsense	19.51	13.41	SNP	0.857	T	16	66
NF2	4771	genome.wustl.edu	37	22	30032860	30032860	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:30032860A>T	ENST00000338641.4	+	2	676	c.235A>T	c.(235-237)Aag>Tag	p.K79*	NF2_ENST00000347330.5_Intron|NF2_ENST00000361452.4_Nonsense_Mutation_p.K79*|NF2_ENST00000403999.3_Nonsense_Mutation_p.K79*|NF2_ENST00000413209.2_Nonsense_Mutation_p.K79*|NF2_ENST00000361166.4_Nonsense_Mutation_p.K79*|NF2_ENST00000353887.4_Intron|NF2_ENST00000403435.1_Nonsense_Mutation_p.K79*|NF2_ENST00000397789.3_Nonsense_Mutation_p.K79*|NF2_ENST00000334961.7_Intron|NF2_ENST00000361676.4_Intron	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	79	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.		K -> E (in vestibular schwannoma). {ECO:0000269|PubMed:7951231}.		actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.M39_K80del(3)|p.?(3)|p.K79E(1)|p.K76fs*5(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CAAAATGGACAAGAAGGTTGG	0.542			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2				ENSG00000186575																											yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	8	Unknown(3)|Deletion - In frame(3)|Substitution - Missense(1)|Deletion - Frameshift(1)	soft_tissue(4)|meninges(1)|stomach(1)|large_intestine(1)|lung(1)											109.0	103.0	105.0					22																	30032860		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	-	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.235A>T	22.37:g.30032860A>T	ENSP00000344666:p.Lys79*		O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,prints_Tropomyosin	p.K79*	ENST00000338641.4	37	c.235	CCDS13861.1	22	.	.	.	.	.	.	.	.	.	.	A	40	8.300822	0.98750	.	.	ENSG00000186575	ENST00000413209;ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000397789;ENST00000361166	.	.	.	6.02	6.02	0.97574	.	0.047341	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	.	.	.	X	79	.	.	K	+	1	0	NF2	28362860	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.435000	0.80391	2.311000	0.77944	0.533000	0.62120	AAG	-	NF2	-	pirsf_ERM,pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain		0.542	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NF2	HGNC	protein_coding	OTTHUMT00000075615.3	0	0	0	54	54	75	0.00	0.00	A	NM_000268		30032860	+1	33	69	11	33	tier1	no_errors	ENST00000338641	ensembl	human	known	74_37	nonsense	73.33	67.65	SNP	1.000	T	33	11
ERVH48-1	90625	genome.wustl.edu	37	21	44339204	44339207	+	lincRNA	DEL	CAGA	CAGA	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	CAGA	CAGA	CAGA	-	CAGA	CAGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr21:44339204_44339207delCAGA	ENST00000447535.1	-	0	495_498							M5A8F1	SUPYN_HUMAN	endogenous retrovirus group 48, member 1						syncytium formation (GO:0006949)	extracellular space (GO:0005615)											GAAATTGGCCCAGACAAACACTTA	0.456													ENSG00000233056																																					0																																												0				BC005107, CR591419		21q22.3	2011-06-16	2011-05-05	2011-05-05	ENSG00000233056	ENSG00000233056			17216	other	endogenous retrovirus			"""chromosome 21 open reading frame 105"", ""NDUFV3 antisense RNA 1 (non-protein coding)"""	C21orf105, NDUFV3-AS1		21542922	Standard			Approved			M5A8F1	OTTHUMG00000086835		21.37:g.44339204_44339207delCAGA				R	DEL	-	NULL	ENST00000447535.1	37	NULL		21																																																																																				ERVH48-1	-	-		0.456	ERVH48-1-001	KNOWN	basic	lincRNA	ERVH48-1	HGNC	lincRNA	OTTHUMT00000195540.1	0	0	0	25	25	75	0.00	0.00	CAGA			44339207	-1	5	17	8	53	tier1	no_errors	ENST00000447535	ensembl	human	known	74_37	rna	38.46	24.29	DEL	0.012:0.014:0.015:0.016	-	5	8
PNISR	25957	genome.wustl.edu	37	6	99873377	99873377	+	5'Flank	DEL	T	T	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:99873377delT	ENST00000369239.5	-	0	0				RP11-98I9.4_ENST00000418945.1_RNA|PNISR_ENST00000438806.1_5'Flank|PNISR_ENST00000466057.1_5'Flank	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TGCACGTTACTTTTTAACGTA	0.458													ENSG00000228506																																					0																																										SO:0001631	upstream_gene_variant	0				AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262		6.37:g.99873377delT	Exception_encountered		A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	R	DEL	-	NULL	ENST00000369239.5	37	NULL	CCDS5043.1	6																																																																																				RP11-98I9.4	-	-		0.458	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228506	Clone_based_vega_gene	protein_coding	OTTHUMT00000041598.1	0	0	0	14	14	77	0.00	0.00	T	NM_032870		99873377	+1	7	25	26	199	tier1	no_errors	ENST00000418945	ensembl	human	known	74_37	rna	21.21	11.16	DEL	0.000	-	7	26
ARHGAP27	201176	genome.wustl.edu	37	17	43472842	43472842	+	Frame_Shift_Del	DEL	C	C	-	rs547059220	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:43472842delC	ENST00000428638.1	-	17	2649	c.2650delG	c.(2650-2652)gacfs	p.D884fs	ARHGAP27_ENST00000532891.2_Frame_Shift_Del_p.D862fs|ARHGAP27_ENST00000528384.1_Frame_Shift_Del_p.D516fs|CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000582826.1_5'Flank|ARHGAP27_ENST00000442348.1_Frame_Shift_Del_p.D857fs|ARHGAP27_ENST00000376922.2_Frame_Shift_Del_p.D543fs|ARHGAP27_ENST00000532038.1_Frame_Shift_Del_p.D662fs|ARHGAP27_ENST00000455881.1_Frame_Shift_Del_p.D543fs			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	884	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					GGGAAGATGTCCGCGCACTGC	0.692											OREG0024481	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000159314																																					0													25.0	20.0	22.0					17																	43472842		2183	4272	6455	SO:0001589	frameshift_variant	0				AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.2650delG	17.37:g.43472842delC	ENSP00000403323:p.Asp884fs	916	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.D884fs	ENST00000428638.1	37	c.2650		17																																																																																				ARHGAP27	-	superfamily_Rho_GTPase_activation_prot,pfscan_RhoGAP_dom		0.692	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	HGNC	protein_coding		0	0	0	30	30	11	0.00	0.00	C	NM_199282		43472842	-1	17	6	20	17	tier1	no_errors	ENST00000428638	ensembl	human	known	74_37	frame_shift_del	45.95	26.09	DEL	0.234	-	17	20
SMARCA5	8467	genome.wustl.edu	37	4	144442729	144442731	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	AAC	AAC	AAC	-	AAC	AAC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:144442729_144442731delAAC	ENST00000283131.3	+	3	862_864	c.400_402delAAC	c.(400-402)aacdel	p.N134del		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	134					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TGAGAAGCAGAACTTACTATCCG	0.374													ENSG00000153147																																					0																																										SO:0001651	inframe_deletion	0				AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.400_402delAAC	4.37:g.144442729_144442731delAAC	ENSP00000283131:p.Asn134del			In_Frame_Del	DEL	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N134in_frame_del	ENST00000283131.3	37	c.400_402	CCDS3761.1	4																																																																																				SMARCA5	-	superfamily_P-loop_NTPase		0.374	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCA5	HGNC	protein_coding	OTTHUMT00000365077.3	0	0	0	85	85	119	0.00	0.00	AAC			144442731	+1	38	60	92	140	tier1	no_errors	ENST00000283131	ensembl	human	known	74_37	in_frame_del	29.23	30.00	DEL	1.000:1.000:1.000	-	38	92
ASMT	438	genome.wustl.edu	37	X	1743283	1743283	+	Silent	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:1743283C>T	ENST00000381229.4	+	3	402	c.366C>T	c.(364-366)gaC>gaT	p.D122D	ASMT_ENST00000381241.3_Silent_p.D122D|ASMT_ENST00000381233.3_Silent_p.D122D			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	122					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	ACCTGGCAGACGCCGTGAGGT	0.672													ENSG00000196433	c|||	2	0.000399361	0.0015	0.0	5008	,	,		18650	0.0		0.0	False		,,,				2504	0.0																0									,,	3,4403		0,3,2200	82.0	75.0	77.0		366,366,366	-1.5	0.0	X	dbSNP_134	77	1,8591		0,1,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	ASMT	NM_001171038.1,NM_001171039.1,NM_004043.2	,,	0,4,6495	TT,TC,CC		0.0116,0.0681,0.0308	,,	122/374,122/299,122/374	1743283	4,12994	2203	4296	6499	SO:0001819	synonymous_variant	0			-	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.366C>T	X.37:g.1743283C>T			B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	pfam_O_MeTrfase_2,pirsf_COMT	p.D122	ENST00000381229.4	37	c.366		X																																																																																			-	ASMT	-	pfam_O_MeTrfase_2,pirsf_COMT		0.672	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	HGNC	protein_coding	OTTHUMT00000055612.1	0	0	0	78	78	7	0.00	0.00	C	NM_004043		1743283	+1	57	23	13	4	tier1	no_errors	ENST00000381241	ensembl	human	known	74_37	silent	80.28	85.19	SNP	0.452	T	57	13
FOSB	2354	genome.wustl.edu	37	19	45974168	45974168	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr19:45974168delC	ENST00000353609.3	+	2	1000	c.408delC	c.(406-408)cgcfs	p.R136fs	FOSB_ENST00000443841.2_Intron|FOSB_ENST00000417353.2_Frame_Shift_Del_p.R136fs|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000585836.1_Frame_Shift_Del_p.R97fs|FOSB_ENST00000591858.1_Frame_Shift_Del_p.R97fs|FOSB_ENST00000592436.1_Frame_Shift_Del_p.R136fs|FOSB_ENST00000586615.1_Frame_Shift_Del_p.R87fs|FOSB_ENST00000590335.1_Frame_Shift_Del_p.R136fs|FOSB_ENST00000592811.1_Frame_Shift_Del_p.R87fs	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	136					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		GGCCTGCCCGCCCAGCCCGAG	0.647													ENSG00000125740																																					0													35.0	42.0	40.0					19																	45974168		2203	4298	6501	SO:0001589	frameshift_variant	0					CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.408delC	19.37:g.45974168delC	ENSP00000245919:p.Arg136fs		A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Frame_Shift_Del	DEL	pfam_bZIP,superfamily_TF_D-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.P137fs	ENST00000353609.3	37	c.408	CCDS12664.1	19																																																																																				FOSB	-	NULL		0.647	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSB	HGNC	protein_coding	OTTHUMT00000459561.1	0	0	0	12	12	9	0.00	0.00	C	NM_006732		45974168	+1	6	4	15	9	tier1	no_errors	ENST00000353609	ensembl	human	known	74_37	frame_shift_del	28.57	30.77	DEL	1.000	-	6	15
JAKMIP3	282973	genome.wustl.edu	37	10	133976760	133976760	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:133976760G>T	ENST00000298622.4	+	19	2400	c.2262G>T	c.(2260-2262)gaG>gaT	p.E754D	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	754						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGCAGCAGGAGGCCGGGGCTA	0.627													ENSG00000188385																																					0													49.0	39.0	42.0					10																	133976760		2194	4290	6484	SO:0001583	missense	0			-	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.2262G>T	10.37:g.133976760G>T	ENSP00000298622:p.Glu754Asp		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.E754D	ENST00000298622.4	37	c.2262	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878711	0.33162	.	.	ENSG00000188385	ENST00000298622	T	0.26957	1.7	3.97	-1.33	0.09172	.	.	.	.	.	T	0.15825	0.0381	L	0.31664	0.95	0.30296	N	0.789881	P;B	0.35507	0.506;0.02	B;B	0.36134	0.218;0.019	T	0.33650	-0.9860	9	0.17369	T	0.5	.	9.1058	0.36696	0.5803:0.0:0.4197:0.0	.	191;754	Q5VZ66-2;Q5VZ66	.;JKIP3_HUMAN	D	754	ENSP00000298622:E754D	ENSP00000298622:E754D	E	+	3	2	JAKMIP3	133826750	0.972000	0.33761	0.733000	0.30861	0.823000	0.46562	0.034000	0.13776	-0.124000	0.11724	-0.384000	0.06662	GAG	-	JAKMIP3	-	NULL		0.627	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	0	0	0	45	45	17	0.00	0.00	G	NM_194303		133976760	+1	40	9	12	4	tier1	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	76.92	69.23	SNP	0.686	T	40	12
PLXNA3	55558	genome.wustl.edu	37	X	153692617	153692617	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:153692617C>T	ENST00000369682.3	+	8	1964	c.1789C>T	c.(1789-1791)Ccc>Tcc	p.P597S		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	597					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGCCCCTCACCCTCCCTCCA	0.697													ENSG00000130827																																					0													23.0	23.0	23.0					X																	153692617		2199	4293	6492	SO:0001583	missense	0			-	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1789C>T	X.37:g.153692617C>T	ENSP00000358696:p.Pro597Ser		Q5HY36	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P597S	ENST00000369682.3	37	c.1789	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235506	0.39498	.	.	ENSG00000130827	ENST00000369682	T	0.01209	5.17	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.04092	0.0114	M	0.80616	2.505	0.80722	D	1	P	0.50819	0.939	P	0.46825	0.528	T	0.22556	-1.0213	10	0.87932	D	0	.	17.0691	0.86568	0.0:1.0:0.0:0.0	.	597	P51805	PLXA3_HUMAN	S	597	ENSP00000358696:P597S	ENSP00000358696:P597S	P	+	1	0	PLXNA3	153345811	0.141000	0.22595	0.200000	0.23457	0.036000	0.12997	1.286000	0.33273	2.295000	0.77249	0.597000	0.82753	CCC	-	PLX3	-	NULL		0.697	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLX3	HGNC	protein_coding	OTTHUMT00000081634.1	0	0	0	21	21	22	0.00	0.00	C	NM_017514		153692617	+1	4	3	17	5	tier1	no_errors	ENST00000369682	ensembl	human	known	74_37	missense	19.05	37.50	SNP	0.999	T	4	17
MYH4	4622	genome.wustl.edu	37	17	10351814	10351814	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr17:10351814G>T	ENST00000255381.2	-	33	4665	c.4555C>A	c.(4555-4557)Caa>Aaa	p.Q1519K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1519					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TCTGCAATTTGCTCTGTCAGG	0.363													ENSG00000264424																																					0													103.0	98.0	99.0					17																	10351814		2202	4300	6502	SO:0001583	missense	0			-		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.4555C>A	17.37:g.10351814G>T	ENSP00000255381:p.Gln1519Lys			Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1519K	ENST00000255381.2	37	c.4555	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645060	0.87859	.	.	ENSG00000141048	ENST00000255381	D	0.83163	-1.69	5.49	5.49	0.81192	Myosin tail (1);	0.224065	0.22179	U	0.063533	D	0.93736	0.7998	H	0.95712	3.71	0.54753	D	0.999983	D	0.63046	0.992	D	0.63113	0.911	D	0.95044	0.8181	10	0.87932	D	0	.	19.7383	0.96217	0.0:0.0:1.0:0.0	.	1519	Q9Y623	MYH4_HUMAN	K	1519	ENSP00000255381:Q1519K	ENSP00000255381:Q1519K	Q	-	1	0	MYH4	10292539	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.784000	0.99039	2.742000	0.94016	0.655000	0.94253	CAA	-	MYH4	-	pfam_Myosin_tail,superfamily_tR-bd_arm		0.363	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	0	0	0	34	34	93	0.00	0.00	G	NM_017533		10351814	-1	17	24	72	227	tier1	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	19.10	9.49	SNP	1.000	T	17	72
UCP1	7350	genome.wustl.edu	37	4	141489848	141489848	+	Silent	SNP	G	G	T	rs555213120		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr4:141489848G>T	ENST00000262999.3	-	1	111	c.36C>A	c.(34-36)acC>acA	p.T12T		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	12					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					GGACCCCCAGGGTCGGGTGTA	0.622													ENSG00000109424	g|||	1	0.000199681	0.0008	0.0	5008	,	,		15945	0.0		0.0	False		,,,				2504	0.0																0													36.0	31.0	33.0					4																	141489848		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.36C>A	4.37:g.141489848G>T			Q13218|Q4KMZ3|Q68G66	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.T12	ENST00000262999.3	37	c.36	CCDS3753.1	4																																																																																			-	UCP1	-	superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.622	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP1	HGNC	protein_coding	OTTHUMT00000257273.1	0	0	0	41	41	33	0.00	0.00	G			141489848	-1	12	4	41	56	tier1	no_errors	ENST00000262999	ensembl	human	known	74_37	silent	22.64	6.56	SNP	1.000	T	12	41
PCDHA4	56144	genome.wustl.edu	37	5	140187880	140187880	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr5:140187880G>A	ENST00000530339.1	+	1	1108	c.1108G>A	c.(1108-1110)Gcc>Acc	p.A370T	PCDHA4_ENST00000356878.4_Missense_Mutation_p.A370T|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.A370T|PCDHA1_ENST00000504120.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	370	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A370S(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACAGTCATCGCCCTGATCAG	0.493													ENSG00000204967																																					2	Substitution - Missense(2)	lung(2)											97.0	94.0	95.0					5																	140187880		2203	4300	6503	SO:0001583	missense	0			-	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1108G>A	5.37:g.140187880G>A	ENSP00000435300:p.Ala370Thr		O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A370T	ENST00000530339.1	37	c.1108	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	14.66	2.600395	0.46423	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52754	0.65;0.65;0.65	4.72	4.72	0.59763	Cadherin (3);Cadherin-like (1);	0.000000	0.40302	U	0.001121	T	0.59810	0.2221	M	0.64567	1.98	0.29498	N	0.855113	P;D;D	0.57257	0.853;0.963;0.979	B;P;P	0.53518	0.322;0.728;0.728	T	0.61787	-0.6991	10	0.59425	D	0.04	.	18.0295	0.89278	0.0:0.0:1.0:0.0	.	370;370;370	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	T	370	ENSP00000423470:A370T;ENSP00000349344:A370T;ENSP00000435300:A370T	ENSP00000349344:A370T	A	+	1	0	PCDHA4	140168064	1.000000	0.71417	0.553000	0.28255	0.264000	0.26372	4.379000	0.59575	2.341000	0.79615	0.591000	0.81541	GCC	-	PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.493	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	0	0	0	55	55	65	0.00	0.00	G	NM_018907		140187880	+1	6	10	69	99	tier1	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	8.00	9.17	SNP	0.882	A	6	69
IGSF1	3547	genome.wustl.edu	37	X	130408707	130408707	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chrX:130408707G>C	ENST00000361420.3	-	18	3696	c.3617C>G	c.(3616-3618)tCa>tGa	p.S1206*	IGSF1_ENST00000370903.3_Nonsense_Mutation_p.S1211*|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Nonsense_Mutation_p.S1197*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.S1197*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1206	Ig-like C2-type 12.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCCATCCTCTGAAAACTGCTG	0.498													ENSG00000147255																																					0													217.0	206.0	210.0					X																	130408707		2203	4300	6503	SO:0001587	stop_gained	0			-	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3617C>G	X.37:g.130408707G>C	ENSP00000355010:p.Ser1206*		B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S1211*	ENST00000361420.3	37	c.3632	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	40	8.435862	0.98810	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	5.35	4.47	0.54385	.	0.931858	0.08884	N	0.879565	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	9.3694	0.38246	0.1063:0.0:0.8937:0.0	.	.	.	.	X	1197;1206;1197;1211	.	ENSP00000355010:S1206X	S	-	2	0	IGSF1	130236388	0.182000	0.23173	0.997000	0.53966	0.958000	0.62258	1.220000	0.32491	2.376000	0.81061	0.594000	0.82650	TCA	-	IGSF1	-	smart_Ig_sub,smart_Ig_sub2		0.498	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	0	0	0	45	45	117	0.00	0.00	G			130408707	-1	10	20	76	188	tier1	no_errors	ENST00000370903	ensembl	human	known	74_37	nonsense	11.63	9.62	SNP	0.957	C	10	76
ZCRB1	85437	genome.wustl.edu	37	12	42706971	42706971	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr12:42706971delT	ENST00000266529.3	-	8	735	c.552delA	c.(550-552)aaafs	p.K184fs	ZCRB1_ENST00000552673.1_Frame_Shift_Del_p.K143fs|PPHLN1_ENST00000549190.1_Intron	NM_033114.3	NP_149105.3	Q8TBF4	ZCRB1_HUMAN	zinc finger CCHC-type and RNA binding motif 1	184					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)	8	all_cancers(12;0.000348)|Breast(8;0.221)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0689)		TGGGTTTCCATTTTTTTTGTT	0.328													ENSG00000139168																																					0													123.0	112.0	116.0					12																	42706971		2203	4300	6503	SO:0001589	frameshift_variant	0				BC022543	CCDS8740.1	12q12	2013-02-12				ENSG00000139168		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	29620	protein-coding gene	gene with protein product	"""U11/U12 snRNP 31K"""	610750				15146077, 16959469	Standard	NM_033114		Approved	MADP-1, MADP1, RBM36, ZCCHC19, SNRNP31	uc001rmz.3	Q8TBF4	OTTHUMG00000169382	ENST00000266529.3:c.552delA	12.37:g.42706971delT	ENSP00000266529:p.Lys184fs		Q6PJX0|Q96TA6	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_RRM_dom_euk,smart_RRM_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_RRM_dom	p.K184fs	ENST00000266529.3	37	c.552	CCDS8740.1	12																																																																																				ZCRB1	-	NULL		0.328	ZCRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCRB1	HGNC	protein_coding	OTTHUMT00000403813.1	0	0	0	54	54	78	0.00	0.00	T	NM_033114		42706971	-1	4	4	35	72	tier1	no_errors	ENST00000266529	ensembl	human	known	74_37	frame_shift_del	10.26	5.26	DEL	0.732	-	4	35
SRGAP3	9901	genome.wustl.edu	37	3	9034675	9034675	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:9034675G>T	ENST00000383836.3	-	20	2900	c.2473C>A	c.(2473-2475)Ctg>Atg	p.L825M	SRGAP3_ENST00000360413.3_Missense_Mutation_p.L801M	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	825					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TTGTCATCCAGCAATGGCCCA	0.587			T	RAF1	pilocytic astrocytoma								ENSG00000196220																												Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													80.0	68.0	72.0					3																	9034675		2203	4300	6503	SO:0001583	missense	0			-	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2473C>A	3.37:g.9034675G>T	ENSP00000373347:p.Leu825Met		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L825M	ENST00000383836.3	37	c.2473	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203102	0.58234	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.26810	1.71;2.12	5.41	3.28	0.37604	Src homology-3 domain (1);	0.000000	0.64402	D	0.000002	T	0.38241	0.1033	L	0.40543	1.245	0.52099	D	0.999948	D;D	0.69078	0.997;0.995	D;D	0.75484	0.986;0.969	T	0.06463	-1.0825	10	0.31617	T	0.26	.	12.607	0.56529	0.1614:0.0:0.8386:0.0	.	801;825	O43295-2;O43295	.;SRGP2_HUMAN	M	825;801	ENSP00000373347:L825M;ENSP00000353587:L801M	ENSP00000353587:L801M	L	-	1	2	SRGAP3	9009675	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.160000	0.42348	1.281000	0.44480	-0.218000	0.12543	CTG	-	SRGAP3	-	superfamily_SH3_domain		0.587	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	0	0	1	38	38	34	0.00	2.86	G			9034675	-1	7	14	39	58	tier1	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	15.22	19.44	SNP	1.000	T	7	39
BCR	613	genome.wustl.edu	37	22	23523835	23523835	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:23523835C>A	ENST00000305877.8	+	1	1439	c.688C>A	c.(688-690)Cct>Act	p.P230T	BCR_ENST00000398512.5_Missense_Mutation_p.P230T|BCR_ENST00000359540.3_Missense_Mutation_p.P230T	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	230	Binding to ABL SH2-domain.|Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	ATCCAGGCCCCCTTACCGGGG	0.677			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								ENSG00000186716																												Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													28.0	30.0	29.0					22																	23523835		2184	4268	6452	SO:0001583	missense	0			-		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.688C>A	22.37:g.23523835C>A	ENSP00000303507:p.Pro230Thr		P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_dom,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RhoGAP_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.P230T	ENST00000305877.8	37	c.688	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	C	0.670	-0.802250	0.02841	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000398512;ENST00000290956;ENST00000292697;ENST00000420248	T;T;T	0.40756	1.84;1.84;1.02	4.15	-3.16	0.05217	.	1.311420	0.05240	N	0.511983	T	0.14356	0.0347	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.14727	-1.0462	10	0.07644	T	0.81	.	1.9737	0.03412	0.1264:0.1647:0.3778:0.331	.	230;230	P11274-2;P11274	.;BCR_HUMAN	T	230	ENSP00000303507:P230T;ENSP00000352535:P230T;ENSP00000381524:P230T	ENSP00000290956:P230T	P	+	1	0	BCR	21853835	0.418000	0.25440	0.000000	0.03702	0.002000	0.02628	0.414000	0.21164	-0.619000	0.05648	-1.109000	0.02080	CCT	-	BCR	-	NULL		0.677	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	0	0	0	37	37	6	0.00	0.00	C	NM_004327		23523835	+1	4	0	31	4	tier1	no_errors	ENST00000305877	ensembl	human	known	74_37	missense	11.11	0.00	SNP	0.000	A	4	31
ELMSAN1	91748	genome.wustl.edu	37	14	74205954	74205956	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr14:74205954_74205956delTGC	ENST00000286523.5	-	2	1538_1540	c.756_758delGCA	c.(754-759)cagcaa>caa	p.252_253QQ>Q	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_In_Frame_Del_p.252_253QQ>Q	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	252	Gln-rich.|Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										ctgctgtggttgctgctgctgct	0.645													ENSG00000156030																																					0																																										SO:0001651	inframe_deletion	0				BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.756_758delGCA	14.37:g.74205963_74205965delTGC	ENSP00000286523:p.Gln253del		Q6PK13|Q6PK59|Q6ZS23	In_Frame_Del	DEL	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.Q253in_frame_del	ENST00000286523.5	37	c.758_756	CCDS9819.1	14																																																																																				ELMSAN1	-	NULL		0.645	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	HGNC	protein_coding	OTTHUMT00000317793.1	0	0	0	39	39	9	0.00	0.00	TGC	NM_194278		74205956	-1	5	0	40	5	tier1	no_errors	ENST00000286523	ensembl	human	known	74_37	in_frame_del	11.11	0.00	DEL	0.074:0.180:0.001	-	5	40
OR13A1	79290	genome.wustl.edu	37	10	45799437	45799437	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr10:45799437C>A	ENST00000553795.1	-	4	742	c.434G>T	c.(433-435)tGc>tTc	p.C145F	OR13A1_ENST00000536058.1_Missense_Mutation_p.C145F|OR13A1_ENST00000374401.2_Missense_Mutation_p.C145F	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						CAGCGGGTGGCAGATGGCTGC	0.627													ENSG00000256574																																					0													32.0	26.0	28.0					10																	45799437		2203	4300	6503	SO:0001583	missense	0			-	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.434G>T	10.37:g.45799437C>A	ENSP00000451950:p.Cys145Phe		Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C145F	ENST00000553795.1	37	c.434	CCDS31188.1	10	.	.	.	.	.	.	.	.	.	.	c	22.0	4.223670	0.79576	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.34472	1.36;1.36;1.36	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000083	T	0.72526	0.3471	H	0.95260	3.645	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.80856	-0.1195	10	0.87932	D	0	-77.0753	17.5765	0.87950	0.0:1.0:0.0:0.0	.	145	Q8NGR1	O13A1_HUMAN	F	145	ENSP00000451950:C145F;ENSP00000438657:C145F;ENSP00000363522:C145F	ENSP00000311379:C145F	C	-	2	0	OR13A1	45119443	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	5.604000	0.67626	2.724000	0.93272	0.650000	0.86243	TGC	-	OR13A1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.627	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR13A1	HGNC	protein_coding	OTTHUMT00000047779.2	0	0	0	18	18	7	0.00	0.00	C	NM_001004297		45799437	-1	7	1	5	9	tier1	no_errors	ENST00000374401	ensembl	human	known	74_37	missense	58.33	10.00	SNP	1.000	A	7	5
SFTPB	6439	genome.wustl.edu	37	2	85895264	85895266	+	In_Frame_Del	DEL	GCA	GCA	-	rs147057701		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:85895264_85895266delGCA	ENST00000519937.2	-	1	60_62	c.41_43delTGC	c.(40-45)ctgccc>ccc	p.L14del	SFTPB_ENST00000393822.3_In_Frame_Del_p.L26del|SFTPB_ENST00000342375.3_In_Frame_Del_p.L14del|SFTPB_ENST00000409383.1_In_Frame_Del_p.L26del			P07988	PSPB_HUMAN	surfactant protein B	14					organ morphogenesis (GO:0009887)|respiratory gaseous exchange (GO:0007585)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)	16						CAGAGCGTGGGCAGCAGCAGCAG	0.64													ENSG00000168878																																					0									,	56,3532		3,50,1741					,	3.5	0.8		dbSNP_134	24	135,6753		12,111,3321	no	coding,coding	SFTPB	NM_198843.2,NM_000542.3	,	15,161,5062	A1A1,A1R,RR		1.9599,1.5608,1.8232	,	,		191,10285				SO:0001651	inframe_deletion	0				J02761	CCDS1983.1, CCDS1983.2	2p12-p11.2	2008-08-26	2008-08-26		ENSG00000168878	ENSG00000168878			10801	protein-coding gene	gene with protein product		178640	"""surfactant, pulmonary-associated protein B"""	SFTP3		2924687, 1346779	Standard	NM_198843		Approved	SP-B	uc002sqh.3	P07988	OTTHUMG00000130181	ENST00000519937.2:c.41_43delTGC	2.37:g.85895273_85895275delGCA	ENSP00000428719:p.Leu14del		Q96R04	In_Frame_Del	DEL	pfam_SapB_2,pfam_SapA,pfam_SapB_1,superfamily_Saposin-like,smart_SapA,smart_SaposinB,pfscan_SapA,pfscan_SaposinB,prints_Saposin	p.L26in_frame_del	ENST00000519937.2	37	c.79_77		2																																																																																				SFTPB	-	NULL		0.640	SFTPB-001	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	SFTPB	HGNC	protein_coding	OTTHUMT00000252499.3	0	0	0	18	18	12	0.00	0.00	GCA	NM_198843		85895266	-1	2	1	15	5	tier1	no_errors	ENST00000393822	ensembl	human	known	74_37	in_frame_del	11.76	16.67	DEL	0.966:0.981:0.990	-	2	15
POTEJ	653781	genome.wustl.edu	37	2	131369279	131369279	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr2:131369279G>T	ENST00000409602.1	+	1	226	c.174G>T	c.(172-174)agG>agT	p.R58S		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	58					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						AGACACTCAGGAGCAAGATGG	0.632													ENSG00000222038																																					0																																										SO:0001583	missense	0			-		CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.174G>T	2.37:g.131369279G>T	ENSP00000387176:p.Arg58Ser			Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.R58S	ENST00000409602.1	37	c.174	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	4.701	0.130310	0.08981	.	.	ENSG00000222038	ENST00000409602	D	0.83837	-1.77	0.418	-0.836	0.10770	.	.	.	.	.	T	0.80276	0.4593	L	0.58101	1.795	0.09310	N	1	.	.	.	.	.	.	T	0.70992	-0.4721	6	0.87932	D	0	.	.	.	.	.	.	.	.	S	58	ENSP00000387176:R58S	ENSP00000387176:R58S	R	+	3	2	POTEJ	131085749	0.234000	0.23783	0.009000	0.14445	0.040000	0.13550	-0.132000	0.10467	-0.507000	0.06549	-1.207000	0.01640	AGG	-	POTEJ	-	NULL		0.632	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEJ	HGNC	protein_coding	OTTHUMT00000333665.1	0	0	0	37	37	8	0.00	0.00	G	XM_929706		131369279	+1	2	0	10	7	tier1	no_errors	ENST00000409602	ensembl	human	novel	74_37	missense	16.67	0.00	SNP	0.012	T	2	10
CEP97	79598	genome.wustl.edu	37	3	101481976	101481976	+	Intron	SNP	C	C	T			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr3:101481976C>T	ENST00000341893.3	+	10	2645				CEP97_ENST00000494050.1_Intron|CEP97_ENST00000327230.4_Silent_p.P639P			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa						cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						ccatattgcccaggccggtct	0.378													ENSG00000182504																																					0																																										SO:0001627	intron_variant	0			-	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1893+572C>T	3.37:g.101481976C>T			B5MDY8|Q8NA71|Q9H5T9	Silent	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.P639	ENST00000341893.3	37	c.1917	CCDS2944.1	3																																																																																			-	CEP97	-	NULL		0.378	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP97	HGNC	protein_coding	OTTHUMT00000353597.2	0	0	0	74	74	0	0.00	0.00	C	NM_024548		101481976	+1	26	0	48	0	tier1	no_errors	ENST00000327230	ensembl	human	known	74_37	silent	35.14	0.00	SNP	0.008	T	26	48
FAM230B	642633	genome.wustl.edu	37	22	21537771	21537771	+	RNA	SNP	G	G	C	rs63749487		TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr22:21537771G>C	ENST00000451257.1	+	0	757									family with sequence similarity 230, member B (non-protein coding)																		ACGCCGCCCAGGGCATCGCCA	0.716													ENSG00000215498																																					0																																												0			-	BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21537771G>C				R	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			rs63749487	FAM230B	-	-		0.716	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	0	0	0	37	37	4	0.00	0.00	G	NR_108107		21537771	+1	3	0	14	2	tier1	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	17.65	0.00	SNP	0.022	C	3	14
PKD1	5310	genome.wustl.edu	37	16	2153897	2153897	+	Splice_Site	SNP	C	C	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr16:2153897C>A	ENST00000262304.4	-	23	8370		c.e23-1		PKD1_ENST00000423118.1_Splice_Site|PKD1_ENST00000561991.1_Splice_Site	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)						anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ATGAGGTCTCCTGCAGACATG	0.662													ENSG00000008710																																					0													10.0	9.0	10.0					16																	2153897		2139	4244	6383	SO:0001630	splice_region_variant	0			-	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8162-1G>T	16.37:g.2153897C>A			Q15140|Q15141	Splice_Site	SNP	-	e23-1	ENST00000262304.4	37	c.8162-1	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	.	12.57	1.977743	0.34848	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9217	0.86166	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PKD1	2093898	1.000000	0.71417	0.495000	0.27527	0.117000	0.20001	4.137000	0.58010	2.207000	0.71202	0.484000	0.47621	.	-	PKD1	-	-		0.662	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	0	0	0	41	41	0	0.00	0.00	C		Intron	2153897	-1	4	0	35	0	tier1	no_errors	ENST00000262304	ensembl	human	known	74_37	splice_site	10.26	0.00	SNP	0.998	A	4	35
RNASET2	8635	genome.wustl.edu	37	6	167369655	167369655	+	Missense_Mutation	SNP	G	G	T	rs11557915	byFrequency	TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:167369655G>T	ENST00000508775.1	-	1	535	c.16C>A	c.(16-18)Ctg>Atg	p.L6M	RNASET2_ENST00000476238.2_Missense_Mutation_p.L6M|RP11-514O12.4_ENST00000507747.1_5'Flank|RNASET2_ENST00000366855.6_De_novo_Start_OutOfFrame	NM_003730.4	NP_003721.2	O00584	RNT2_HUMAN	ribonuclease T2	6					RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	ribonuclease activity (GO:0004540)|ribonuclease T2 activity (GO:0033897)|RNA binding (GO:0003723)			large_intestine(4)|lung(4)	8		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		GCCCCGCGCAGGGCTGCAGGG	0.687													ENSG00000026297																																					0													9.0	9.0	9.0					6																	167369655		1980	3815	5795	SO:0001583	missense	0			-	AJ419866	CCDS5295.1	6q27	2014-05-20			ENSG00000026297	ENSG00000026297			21686	protein-coding gene	gene with protein product		612944				9192857	Standard	NM_003730		Approved	RNASE6PL, FLJ10907, bA514O12.3	uc003qve.3	O00584	OTTHUMG00000016009	ENST00000508775.1:c.16C>A	6.37:g.167369655G>T	ENSP00000426455:p.Leu6Met		B2RDA7|E1P5C3|Q5T8Q0|Q8TCU2|Q9BZ46|Q9BZ47	Missense_Mutation	SNP	pfam_RNase_T2-like,superfamily_RNase_T2-like	p.L6M	ENST00000508775.1	37	c.16	CCDS5295.1	6	.	.	.	.	.	.	.	.	.	.	G	11.78	1.739892	0.30865	.	.	ENSG00000026297	ENST00000508775;ENST00000428859;ENST00000476238;ENST00000478180;ENST00000310843;ENST00000425007	T;T;T	0.65364	-0.15;-0.15;-0.15	2.81	-5.07	0.02938	.	7.083910	0.00906	U	0.002418	T	0.16514	0.0397	N	0.14661	0.345	0.09310	N	1	B	0.31227	0.314	B	0.17979	0.02	T	0.03060	-1.1077	9	.	.	.	-8.0963	8.1328	0.31037	0.0:0.5807:0.262:0.1573	.	6	O00584	RNT2_HUMAN	M	6	ENSP00000426455:L6M;ENSP00000422846:L6M;ENSP00000426059:L6M	.	L	-	1	2	RNASET2	167289645	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-1.058000	0.03482	-1.220000	0.02594	0.313000	0.20887	CTG	-	RSET2	-	NULL		0.687	RNASET2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSET2	HGNC	protein_coding	OTTHUMT00000043089.2	0	0	0	39	39	2	0.00	0.00	G	NM_003730		167369655	-1	5	0	40	2	tier1	no_errors	ENST00000476238	ensembl	human	known	74_37	missense	11.11	0.00	SNP	0.000	T	5	40
TBP	6908	genome.wustl.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542													ENSG00000112592																																					0													43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q60	ENST00000392092.2	37	c.180	CCDS5315.1	6																																																																																			-	TBP	-	NULL		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	0	0	0	43	43	0	0.00	0.00	G	NM_003194		170871004	+1	11	0	43	3	tier1	no_errors	ENST00000230354	ensembl	human	known	74_37	silent	20.37	0.00	SNP	0.991	A	11	43
UNC93B6	255620	genome.wustl.edu	37	11	71314423	71314423	+	Intron	SNP	G	G	A			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr11:71314423G>A	ENST00000343767.3	-	3	2876				KRTAP5-11_ENST00000526239.1_5'Flank|UNC93B6_ENST00000525262.2_RNA																							TGCCACGCCCGGTGCCCCTCG	0.662													ENSG00000255562																																					0																																										SO:0001627	intron_variant	0			-																												ENST00000343767.3:c.436-12C>T	11.37:g.71314423G>A				R	SNP	-	NULL	ENST00000343767.3	37	NULL		11																																																																																			-	UNC93B6	-	-		0.662	AP000867.1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B6	HGNC	protein_coding		0	0	0	115	115	0	0.00	0.00	G			71314423	+1	60	0	61	0	tier1	no_errors	ENST00000525262	ensembl	human	known	74_37	rna	49.59	0.00	SNP	0.996	A	60	61
USP17L2	377630	genome.wustl.edu	37	8	11995398	11995398	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr8:11995398A>G	ENST00000333796.3	-	1	1188	c.872T>C	c.(871-873)cTt>cCt	p.L291P	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	291	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						ATTCTTGGCAAGTTTGTTGCC	0.502													ENSG00000223443																																					0													22.0	26.0	25.0					8																	11995398		1355	3008	4363	SO:0001583	missense	0			-	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.872T>C	8.37:g.11995398A>G	ENSP00000333329:p.Leu291Pro			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.L291P	ENST00000333796.3	37	c.872	CCDS43713.1	8	.	.	.	.	.	.	.	.	.	.	A	9.055	0.993040	0.19043	.	.	ENSG00000223443	ENST00000333796	T	0.07216	3.21	0.745	0.745	0.18359	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.555420	0.14724	N	0.302170	T	0.23133	0.0559	M	0.86805	2.84	0.21355	N	0.999716	P	0.39748	0.686	P	0.55455	0.776	T	0.09143	-1.0688	10	0.87932	D	0	.	3.6197	0.08090	0.5857:0.4142:0.0:1.0E-4	.	291	Q6R6M4	U17L2_HUMAN	P	291	ENSP00000333329:L291P	ENSP00000333329:L291P	L	-	2	0	USP17L2	12032807	0.009000	0.17119	0.002000	0.10522	0.003000	0.03518	1.678000	0.37586	0.611000	0.30052	0.386000	0.25728	CTT	-	USP17L2	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.502	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	0	0	0	98	98	3	0.00	0.00	A	NM_201402		11995398	-1	29	1	83	8	tier1	no_errors	ENST00000333796	ensembl	human	known	74_37	missense	25.89	11.11	SNP	0.001	G	29	83
POTEG	404785	genome.wustl.edu	37	14	19559063	19559063	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YQ-01A-12D-A33E-09	TCGA-DX-A6YQ-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a7be76f9-2aaa-4fbe-95d0-7a1a304f48e8	d69e4b21-e6ab-4164-9ba6-809891a82b67	g.chr14:19559063G>C	ENST00000409832.3	+	3	761	c.709G>C	c.(709-711)Gag>Cag	p.E237Q		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	237										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						TATTCCAGATGAGTATGGAAA	0.393													ENSG00000222036																																					0													47.0	51.0	50.0					14																	19559063		1266	2814	4080	SO:0001583	missense	0			-		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.709G>C	14.37:g.19559063G>C	ENSP00000386971:p.Glu237Gln		A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E237Q	ENST00000409832.3	37	c.709	CCDS32018.1	14	.	.	.	.	.	.	.	.	.	.	g	10.34	1.323315	0.24080	.	.	ENSG00000222036	ENST00000409832	T	0.53640	0.61	1.87	-2.81	0.05805	Ankyrin repeat-containing domain (3);	3.877450	0.00775	N	0.001236	T	0.54647	0.1871	L	0.48260	1.515	0.09310	N	1	D	0.55800	0.973	P	0.58266	0.836	T	0.50224	-0.8853	10	0.44086	T	0.13	.	6.539	0.22370	0.6634:0.0:0.3366:0.0	.	237	Q6S5H5	POTEG_HUMAN	Q	237	ENSP00000386971:E237Q	ENSP00000386971:E237Q	E	+	1	0	POTEG	18629063	0.000000	0.05858	0.000000	0.03702	0.116000	0.19942	-2.861000	0.00726	-0.873000	0.04032	0.184000	0.17185	GAG	-	POTEG	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.393	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEG	HGNC	protein_coding	OTTHUMT00000408579.1	0	0	0	258	258	37	0.00	0.00	G	NM_001005356		19559063	+1	35	3	241	29	tier1	no_errors	ENST00000409832	ensembl	human	known	74_37	missense	12.68	9.38	SNP	0.000	C	35	241
