#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
DCAF10	79269	genome.wustl.edu	37	9	37860098	37860098	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr9:37860098A>T	ENST00000377724.3	+	6	1584	c.1219A>T	c.(1219-1221)Agt>Tgt	p.S407C	DCAF10_ENST00000242323.7_Missense_Mutation_p.S370C|RP11-613M10.9_ENST00000540557.1_Intron|DCAF10_ENST00000483167.1_3'UTR	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	407					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						TCTTGGTGAGAGTGACCACGG	0.463													ENSG00000122741																																					0													135.0	113.0	121.0					9																	37860098		2203	4300	6503	SO:0001583	missense	0			-	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.1219A>T	9.37:g.37860098A>T	ENSP00000366953:p.Ser407Cys		A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S407C	ENST00000377724.3	37	c.1219	CCDS6613.2	9	.	.	.	.	.	.	.	.	.	.	A	17.76	3.468965	0.63625	.	.	ENSG00000122741	ENST00000377724;ENST00000242323	T;T	0.73789	-0.4;-0.78	5.9	1.97	0.26223	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.043136	0.85682	D	0.000000	T	0.55909	0.1950	N	0.08118	0	0.24955	N	0.991765	B;B	0.32425	0.03;0.371	B;B	0.35971	0.008;0.215	T	0.55075	-0.8197	10	0.66056	D	0.02	.	12.1536	0.54064	0.5338:0.4661:0.0:0.0	.	370;407	Q5QP82-2;Q5QP82	.;DCA10_HUMAN	C	407;370	ENSP00000366953:S407C;ENSP00000242323:S370C	ENSP00000242323:S370C	S	+	1	0	DCAF10	37850098	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.044000	0.49830	0.448000	0.26722	0.533000	0.62120	AGT	-	DCAF10	-	superfamily_WD40_repeat_dom		0.463	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF10	HGNC	protein_coding	OTTHUMT00000052485.2	0	0	0	44	44	89	0.00	0.00	A	NM_024345		37860098	+1	23	79	11	19	tier1	no_errors	ENST00000377724	ensembl	human	known	74_37	missense	67.65	80.61	SNP	1.000	T	23	11
VPS4A	27183	genome.wustl.edu	37	16	69354619	69354619	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr16:69354619G>A	ENST00000254950.11	+	8	954	c.798G>A	c.(796-798)ctG>ctA	p.L266L	COG8_ENST00000564419.1_5'UTR	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				ATGGGACTCTGGTTCTTGGAG	0.567													ENSG00000132612																																					0													35.0	39.0	38.0					16																	69354619		1981	4162	6143	SO:0001819	synonymous_variant	0			-	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.798G>A	16.37:g.69354619G>A				Silent	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_D_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.L266	ENST00000254950.11	37	c.798	CCDS45517.1	16																																																																																			-	VPS4A	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.567	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000430563.3	0	0	1	32	32	143	0.00	0.69	G	NM_013245		69354619	+1	14	87	1	17	tier1	no_errors	ENST00000254950	ensembl	human	known	74_37	silent	93.33	83.65	SNP	1.000	A	14	1
KIAA0319L	79932	genome.wustl.edu	37	1	35917355	35917355	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:35917355C>T	ENST00000325722.3	-	13	2170	c.1936G>A	c.(1936-1938)Gag>Aag	p.E646K	KIAA0319L_ENST00000485551.1_5'UTR|KIAA0319L_ENST00000373266.4_Missense_Mutation_p.E83K	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	646	PKD 4. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTAGCATTCTCGAGCTGCACC	0.507											OREG0013354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000142687																																					0													128.0	123.0	125.0					1																	35917355		2203	4300	6503	SO:0001583	missense	0			-	AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1936G>A	1.37:g.35917355C>T	ENSP00000318406:p.Glu646Lys	859	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.E646K	ENST00000325722.3	37	c.1936	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976877	0.74360	.	.	ENSG00000142687	ENST00000325722;ENST00000373266;ENST00000426982;ENST00000440579	T;T;T;T	0.70986	3.18;-0.39;3.18;-0.53	5.98	3.89	0.44902	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (1);	0.211885	0.50627	N	0.000111	T	0.56108	0.1963	L	0.27053	0.805	0.80722	D	1	D;P;P	0.58268	0.982;0.716;0.865	P;B;B	0.44518	0.452;0.06;0.294	T	0.50550	-0.8815	10	0.30854	T	0.27	-9.6201	8.0297	0.30457	0.0:0.7285:0.0:0.2715	.	646;646;88	Q8IZA0-2;Q8IZA0;Q8IZA0-3	.;K319L_HUMAN;.	K	646;83;646;646	ENSP00000318406:E646K;ENSP00000362363:E83K;ENSP00000395883:E646K;ENSP00000407576:E646K	ENSP00000318406:E646K	E	-	1	0	KIAA0319L	35689942	0.994000	0.37717	0.619000	0.29118	0.981000	0.71138	3.156000	0.50708	0.672000	0.31204	0.650000	0.86243	GAG	-	KIAA0319L	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom		0.507	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	0	0	0	65	65	74	0.00	0.00	C	NM_024874		35917355	-1	8	16	68	102	tier1	no_errors	ENST00000325722	ensembl	human	known	74_37	missense	10.53	13.56	SNP	0.971	T	8	68
DOCK2	1794	genome.wustl.edu	37	5	169504797	169504797	+	Silent	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:169504797C>T	ENST00000256935.8	+	48	5030	c.4950C>T	c.(4948-4950)tcC>tcT	p.S1650S	DOCK2_ENST00000540750.1_Silent_p.S711S|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Silent_p.S1142S	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1650					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCTGGCTTCCATGAATTCTG	0.597													ENSG00000134516																																					0													123.0	108.0	113.0					5																	169504797		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4950C>T	5.37:g.169504797C>T			Q2M3I0|Q96AK7	Silent	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.S1650	ENST00000256935.8	37	c.4950	CCDS4371.1	5																																																																																			-	DOCK2	-	NULL		0.597	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	0	0	0	29	29	52	0.00	0.00	C	NM_004946		169504797	+1	6	12	13	24	tier1	no_errors	ENST00000256935	ensembl	human	known	74_37	silent	31.58	33.33	SNP	0.999	T	6	13
LHFPL1	340596	genome.wustl.edu	37	X	111914310	111914310	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:111914310G>A	ENST00000371968.3	-	2	548	c.309C>T	c.(307-309)gtC>gtT	p.V103V	LHFPL1_ENST00000478229.1_Intron|LHFPL1_ENST00000536453.1_Silent_p.V103V	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	103						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						AGCAACCCAGGACAGCAGCTA	0.577													ENSG00000182508																																					0													82.0	64.0	70.0					X																	111914310		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.309C>T	X.37:g.111914310G>A			A8K1N1|Q496M9|Q496N0|Q6UXU2	Silent	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.V103	ENST00000371968.3	37	c.309	CCDS14562.1	X																																																																																			-	LHFPL1	-	pfam_Lipome_HGMIC_fus_partner-like		0.577	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL1	HGNC	protein_coding	OTTHUMT00000057947.1	0	0	0	21	21	19	0.00	0.00	G	NM_178175		111914310	-1	11	14	26	33	tier1	no_errors	ENST00000371968	ensembl	human	known	74_37	silent	29.73	29.79	SNP	1.000	A	11	26
ZNRF4	148066	genome.wustl.edu	37	19	5456439	5456439	+	Silent	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:5456439C>T	ENST00000222033.4	+	1	1014	c.937C>T	c.(937-939)Ctg>Ttg	p.L313L		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	313						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		TGCCATCTGCCTGGATGAGTA	0.627													ENSG00000105428																																					0													88.0	100.0	96.0					19																	5456439		2133	4242	6375	SO:0001819	synonymous_variant	0			-	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.937C>T	19.37:g.5456439C>T			A8K886|O75866	Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L313	ENST00000222033.4	37	c.937	CCDS42475.1	19																																																																																			-	ZNRF4	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.627	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF4	HGNC	protein_coding	OTTHUMT00000450924.1	0	0	0	21	21	40	0.00	0.00	C	NM_181710		5456439	+1	3	10	9	15	tier1	no_errors	ENST00000222033	ensembl	human	known	74_37	silent	25.00	40.00	SNP	0.994	T	3	9
SLC22A18	5002	genome.wustl.edu	37	11	2940204	2940204	+	Intron	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr11:2940204C>T	ENST00000380574.1	+	8	1194				SLC22A18_ENST00000347936.2_Intron|SLC22A18_ENST00000312221.5_Intron|SLC22A18_ENST00000449793.2_Intron|SLC22A18_ENST00000441077.1_3'UTR			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18						drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		ggattgcagacgtgaCTTTGA	0.567													ENSG00000110628																																					0																																										SO:0001627	intron_variant	0			-	AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.764-333C>T	11.37:g.2940204C>T			O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	R	SNP	-	NULL	ENST00000380574.1	37	NULL	CCDS7740.1	11																																																																																			-	SLC22A18	-	-		0.567	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC22A18	HGNC	protein_coding	OTTHUMT00000027770.1	0	0	0	26	26	36	0.00	0.00	C	NM_183233		2940204	+1	6	9	20	37	tier1	no_errors	ENST00000441077	ensembl	human	known	74_37	rna	23.08	19.57	SNP	0.000	T	6	20
MAGEB5	347541	genome.wustl.edu	37	X	26235472	26235472	+	Silent	SNP	A	A	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:26235472A>G	ENST00000602297.1	+	2	301	c.54A>G	c.(52-54)agA>agG	p.R18R	MAGEB5_ENST00000379029.2_Silent_p.R18R	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	18										lung(1)|ovary(1)	2						CTAACAGTAGAGATGAGGAGT	0.488													ENSG00000188408																																					0																																										SO:0001819	synonymous_variant	0			-	AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.54A>G	X.37:g.26235472A>G				Silent	SNP	pfam_MAGE,pfscan_MAGE	p.R18	ENST00000602297.1	37	c.54		X																																																																																			-	MAGEB5	-	NULL		0.488	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	HGNC	protein_coding	OTTHUMT00000056126.2	0	0	0	70	70	110	0.00	0.00	A	XM_293407		26235472	+1	23	58	28	36	tier1	no_errors	ENST00000379029	ensembl	human	known	74_37	silent	45.10	61.70	SNP	0.000	G	23	28
MAGEB4	4115	genome.wustl.edu	37	X	30260295	30260295	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:30260295C>T	ENST00000378982.2	+	1	239	c.43C>T	c.(43-45)Cgc>Tgc	p.R15C	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	15										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CCGTGAGAAACGCCAGCGGAC	0.567													ENSG00000120289																																					0													99.0	79.0	86.0					X																	30260295		2202	4300	6502	SO:0001583	missense	0			-		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.43C>T	X.37:g.30260295C>T	ENSP00000368266:p.Arg15Cys		B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R15C	ENST00000378982.2	37	c.43	CCDS14221.1	X	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126557	0.37533	.	.	ENSG00000120289	ENST00000378982	T	0.06933	3.24	3.22	-1.76	0.08006	Melanoma associated antigen, MAGE, N-terminal (1);	1.576910	0.05036	U	0.475533	T	0.21062	0.0507	M	0.76574	2.34	0.09310	N	1	D	0.57257	0.979	P	0.56865	0.808	T	0.27706	-1.0066	10	0.44086	T	0.13	.	7.626	0.28212	0.0:0.3504:0.0:0.6496	.	15	O15481	MAGB4_HUMAN	C	15	ENSP00000368266:R15C	ENSP00000368266:R15C	R	+	1	0	MAGEB4	30170216	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.801000	0.01743	-0.647000	0.05444	-0.268000	0.10319	CGC	-	MAGEB4	-	pfam_Melanoma_ass_antigen_N		0.567	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	0	0	0	46	46	55	0.00	0.00	C	NM_002367		30260295	+1	12	43	22	28	tier1	no_errors	ENST00000378982	ensembl	human	known	74_37	missense	35.29	60.56	SNP	0.000	T	12	22
GBA2	57704	genome.wustl.edu	37	9	35740618	35740618	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr9:35740618G>A	ENST00000378103.3	-	6	1557	c.1034C>T	c.(1033-1035)aCc>aTc	p.T345I	GBA2_ENST00000467252.1_5'UTR|GBA2_ENST00000545786.1_Missense_Mutation_p.T351I|GBA2_ENST00000378094.4_Missense_Mutation_p.T345I|GBA2_ENST00000378088.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	345					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGTTACCGTGGTAGCTGCCTG	0.592													ENSG00000070610																																					0													113.0	89.0	97.0					9																	35740618		2203	4300	6503	SO:0001583	missense	0			-	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.1034C>T	9.37:g.35740618G>A	ENSP00000367343:p.Thr345Ile		D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	pfam_Glucosylceramidase,pfam_GBA2_N,superfamily_6-hairpin_glycosidase-like,pirsf_Beta_glucosidase_GBA2-type	p.T351I	ENST00000378103.3	37	c.1052	CCDS6589.1	9	.	.	.	.	.	.	.	.	.	.	G	12.20	1.865930	0.32977	.	.	ENSG00000070610	ENST00000378103;ENST00000378094;ENST00000545786	.	.	.	5.66	5.66	0.87406	Beta-glucosidase, GBA2 type, N-terminal (1);	0.125415	0.64402	D	0.000020	T	0.47414	0.1444	N	0.20766	0.605	0.37578	D	0.919686	P;B;B	0.51537	0.946;0.017;0.175	P;B;B	0.51453	0.67;0.009;0.129	T	0.39440	-0.9614	9	0.12766	T	0.61	-19.5581	16.9097	0.86137	0.0:0.0:1.0:0.0	.	351;345;345	F5H7P6;Q9HCG7-2;Q9HCG7	.;.;GBA2_HUMAN	I	345;345;351	.	ENSP00000367334:T345I	T	-	2	0	GBA2	35730618	0.645000	0.27286	0.996000	0.52242	0.976000	0.68499	2.805000	0.47939	2.676000	0.91093	0.655000	0.94253	ACC	-	GBA2	-	pfam_GBA2_N,pirsf_Beta_glucosidase_GBA2-type		0.592	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GBA2	HGNC	protein_coding	OTTHUMT00000055456.1	0	0	0	42	42	170	0.00	0.00	G	NM_020944		35740618	-1	23	76	3	23	tier1	no_errors	ENST00000545786	ensembl	human	known	74_37	missense	88.46	76.77	SNP	0.798	A	23	3
LINC00686	140865	genome.wustl.edu	37	20	61326511	61326511	+	lincRNA	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr20:61326511C>T	ENST00000435412.1	-	0	196									long intergenic non-protein coding RNA 686																		CTTGGGTGGGCTTTCTGGCTG	0.637													ENSG00000237687																																					0																																												0			-	D80415		20q13.33	2012-10-24	2012-10-24	2012-10-24	ENSG00000237687	ENSG00000237687		"""Long non-coding RNAs"""	16221	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 90"""	C20orf90			Standard			Approved	bA93B14.2			OTTHUMG00000032927		20.37:g.61326511C>T				R	SNP	-	NULL	ENST00000435412.1	37	NULL		20	.	.	.	.	.	.	.	.	.	.	C	2.604	-0.292398	0.05568	.	.	ENSG00000237687	ENST00000435412	.	.	.	0.158	0.158	0.14942	.	.	.	.	.	T	0.53029	0.1771	.	.	.	.	.	.	.	.	.	.	.	.	T	0.62364	-0.6870	3	0.87932	D	0	.	.	.	.	.	.	.	.	N	66	.	ENSP00000414143:S66N	S	-	2	0	C20orf90	60796956	0.003000	0.15002	0.019000	0.16419	0.019000	0.09904	-1.060000	0.03475	0.202000	0.20498	0.205000	0.17691	AGC	-	LINC00686	-	-		0.637	LINC00686-001	KNOWN	basic	lincRNA	LINC00686	HGNC	lincRNA	OTTHUMT00000080056.1	0	0	0	38	38	38	0.00	0.00	C			61326511	-1	20	15	20	24	tier1	no_errors	ENST00000435412	ensembl	human	known	74_37	rna	50.00	38.46	SNP	0.021	T	20	20
DNAH5	1767	genome.wustl.edu	37	5	13829759	13829759	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:13829759G>A	ENST00000265104.4	-	38	6408	c.6304C>T	c.(6304-6306)Cgc>Tgc	p.R2102C		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2102	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2102C(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCCACTGAGCGGAAATTAATC	0.448									Kartagener syndrome				ENSG00000039139																																					1	Substitution - Missense(1)	endometrium(1)											115.0	105.0	108.0					5																	13829759		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6304C>T	5.37:g.13829759G>A	ENSP00000265104:p.Arg2102Cys		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R2102C	ENST00000265104.4	37	c.6304	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159228	0.78226	.	.	ENSG00000039139	ENST00000265104	T	0.15256	2.44	5.46	5.46	0.80206	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.61337	0.2339	H	0.99143	4.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77718	-0.2483	10	0.87932	D	0	.	14.1892	0.65628	0.0:0.0:0.8504:0.1495	.	2102	Q8TE73	DYH5_HUMAN	C	2102	ENSP00000265104:R2102C	ENSP00000265104:R2102C	R	-	1	0	DNAH5	13882759	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.541000	0.67212	2.550000	0.86006	0.655000	0.94253	CGC	-	DH5	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.448	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	0	62	62	120	0.00	0.00	G	NM_001369		13829759	-1	8	15	69	102	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	10.39	12.82	SNP	1.000	A	8	69
TNFAIP1	7126	genome.wustl.edu	37	17	26671442	26671442	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:26671442A>G	ENST00000226225.2	+	7	1034	c.767A>G	c.(766-768)tAt>tGt	p.Y256C	TNFAIP1_ENST00000544907.2_Missense_Mutation_p.Y152C|POLDIP2_ENST00000003607.4_5'Flank|TNFAIP1_ENST00000583213.1_3'UTR	NM_021137.4	NP_066960.1	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1 (endothelial)	256					apoptotic process (GO:0006915)|cell migration (GO:0016477)|DNA replication (GO:0006260)|embryo development (GO:0009790)|immune response (GO:0006955)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleolus (GO:0005730)	GTP-Rho binding (GO:0017049)			endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	12	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		GTCCTACTCTATGAGACTCCC	0.567													ENSG00000109079																																					0													58.0	50.0	53.0					17																	26671442		2203	4300	6503	SO:0001583	missense	0			-		CCDS11227.1	17q22-q23	2013-01-09			ENSG00000109079	ENSG00000109079		"""BTB/POZ domain containing"""	11894	protein-coding gene	gene with protein product		191161		EDP1		2406243, 2233719	Standard	NM_021137		Approved	B61, B12, MGC2317, BTBD34	uc002hay.3	Q13829	OTTHUMG00000132501	ENST00000226225.2:c.767A>G	17.37:g.26671442A>G	ENSP00000226225:p.Tyr256Cys		B7Z6M4|Q5TZQ1	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.Y256C	ENST00000226225.2	37	c.767	CCDS11227.1	17	.	.	.	.	.	.	.	.	.	.	A	17.54	3.415486	0.62511	.	.	ENSG00000109079	ENST00000226225;ENST00000544907	T	0.59224	0.28	5.65	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.78961	-0.1997	10	0.87932	D	0	-13.2031	10.6989	0.45915	0.9266:0.0:0.0734:0.0	.	256	Q13829	BACD2_HUMAN	C	256;152	ENSP00000226225:Y256C	ENSP00000226225:Y256C	Y	+	2	0	TNFAIP1	23695569	1.000000	0.71417	0.875000	0.34327	0.400000	0.30750	5.861000	0.69553	1.165000	0.42670	0.533000	0.62120	TAT	-	TNFAIP1	-	NULL		0.567	TNFAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP1	HGNC	protein_coding	OTTHUMT00000255681.2	0	0	0	51	51	82	0.00	0.00	A	NM_021137		26671442	+1	21	51	4	10	tier1	no_errors	ENST00000226225	ensembl	human	known	74_37	missense	84.00	83.61	SNP	0.995	G	21	4
SEMA6A	57556	genome.wustl.edu	37	5	115822489	115822489	+	Silent	SNP	G	G	A	rs201133760	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:115822489G>A	ENST00000343348.6	-	10	1705	c.918C>T	c.(916-918)aaC>aaT	p.N306N	CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000503962.1_5'Flank|CTB-118N6.3_ENST00000510682.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000257414.8_Silent_p.N306N|SEMA6A_ENST00000510263.1_Silent_p.N306N	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	306	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CATCACGCCCGTTGATACGAA	0.473													ENSG00000092421	G|||	3	0.000599042	0.0	0.0014	5008	,	,		17603	0.0		0.002	False		,,,				2504	0.0																0													140.0	136.0	137.0					5																	115822489		1998	4195	6193	SO:0001819	synonymous_variant	0			GMAF=0	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.918C>T	5.37:g.115822489G>A			Q9P2H9	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.N306	ENST00000343348.6	37	c.918	CCDS47256.1	5																																																																																			rs201133760	SEMA6A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.473	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	0	0	0	126	126	118	0.00	0.00	G	NM_020796		115822489	-1	34	31	54	69	tier1	no_errors	ENST00000257414	ensembl	human	known	74_37	silent	38.64	31.00	SNP	0.994	A	34	54
ZNF730	100129543	genome.wustl.edu	37	19	23329315	23329315	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:23329315G>C	ENST00000597761.2	+	4	1668	c.1469G>C	c.(1468-1470)aGg>aCg	p.R490T		NM_001277403.1	NP_001264332.1	Q6ZMV8	ZN730_HUMAN	zinc finger protein 730	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|pancreas(1)|stomach(2)|urinary_tract(1)	16						AAAGCCTTTAGGCGGTTCTCA	0.358													ENSG00000183850																																					0																																										SO:0001583	missense	0			-	AK131472	CCDS59371.1	19p12	2013-01-08			ENSG00000183850	ENSG00000183850		"""Zinc fingers, C2H2-type"", ""-"""	32470	protein-coding gene	gene with protein product							Standard	NM_001277403		Approved		uc031rkc.1	Q6ZMV8		ENST00000597761.2:c.1469G>C	19.37:g.23329315G>C	ENSP00000472959:p.Arg490Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R490T	ENST00000597761.2	37	c.1469	CCDS59371.1	19	.	.	.	.	.	.	.	.	.	.	g	0.009	-1.798836	0.00617	.	.	ENSG00000183850	ENST00000327867	.	.	.	0.926	-1.85	0.07784	.	.	.	.	.	T	0.18635	0.0447	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21211	-1.0252	5	0.21014	T	0.42	.	3.0182	0.06066	0.4072:0.2334:0.3594:0.0	.	.	.	.	T	490	.	ENSP00000329365:R490T	R	+	2	0	ZNF730	23121155	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.448000	0.06820	-1.763000	0.01307	-1.740000	0.00687	AGG	-	ZNF730	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF730-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF730	HGNC	protein_coding	OTTHUMT00000465737.2	0	0	0	134	134	80	0.00	0.00	G	XM_001719792		23329315	+1	43	48	35	35	tier1	no_errors	ENST00000597761	ensembl	human	known	74_37	missense	55.13	57.83	SNP	0.040	C	43	35
LOC100631378	100631378	genome.wustl.edu	37	19	38324091	38324091	+	lincRNA	SNP	C	C	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:38324091C>A	ENST00000443870.1	+	0	5214				AC016582.2_ENST00000592640.1_lincRNA																							TGGTGAGACTCCCGGTATAGA	0.438													ENSG00000225868																																					0																																												0			-																													19.37:g.38324091C>A				R	SNP	-	NULL	ENST00000443870.1	37	NULL		19																																																																																			-	AC016582.2	-	-		0.438	CTD-2554C21.3-001	KNOWN	basic	lincRNA	LOC100631378	Clone_based_vega_gene	lincRNA	OTTHUMT00000459795.1	0	0	0	74	74	111	0.00	0.00	C			38324091	-1	15	37	49	81	tier1	no_errors	ENST00000433142	ensembl	human	known	74_37	rna	23.44	31.36	SNP	0.047	A	15	49
PTPRZ1	5803	genome.wustl.edu	37	7	121623806	121623806	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr7:121623806C>A	ENST00000393386.2	+	7	1118	c.707C>A	c.(706-708)aCa>aAa	p.T236K	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.T236K	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	236	Alpha-carbonic anhydrase.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GGCTCATTGACATCTCCTCCC	0.378													ENSG00000106278																																					0													173.0	155.0	161.0					7																	121623806		2203	4300	6503	SO:0001583	missense	0			-	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.707C>A	7.37:g.121623806C>A	ENSP00000377047:p.Thr236Lys		A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.T236K	ENST00000393386.2	37	c.707	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891087	0.91889	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.78126	-1.15;-1.15	5.62	5.62	0.85841	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.074260	0.56097	D	0.000037	D	0.92414	0.7592	H	0.96430	3.82	0.42913	D	0.994264	D;D	0.89917	1.0;1.0	D;D	0.76071	0.973;0.987	D	0.94216	0.7463	10	0.87932	D	0	.	20.011	0.97449	0.0:1.0:0.0:0.0	.	236;236	C9JFM0;P23471	.;PTPRZ_HUMAN	K	236	ENSP00000377047:T236K;ENSP00000410000:T236K	ENSP00000377047:T236K	T	+	2	0	PTPRZ1	121411042	1.000000	0.71417	0.959000	0.39883	0.977000	0.68977	7.256000	0.78350	2.813000	0.96785	0.543000	0.68304	ACA	-	PTPRZ1	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.378	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	0	0	0	69	69	108	0.00	0.00	C	NM_002851		121623806	+1	39	59	31	72	tier1	no_errors	ENST00000393386	ensembl	human	known	74_37	missense	55.71	45.04	SNP	1.000	A	39	31
TMEM71	137835	genome.wustl.edu	37	8	133759251	133759251	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:133759251G>A	ENST00000356838.3	-	5	509	c.367C>T	c.(367-369)Cca>Tca	p.P123S	TMEM71_ENST00000517538.1_5'Flank|TMEM71_ENST00000523829.1_Missense_Mutation_p.P142S|TMEM71_ENST00000377901.4_Missense_Mutation_p.P142S	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	142						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TCTTCACTTGGAGAAGAGTTG	0.418													ENSG00000165071																																					0													144.0	126.0	132.0					8																	133759251		2203	4300	6503	SO:0001583	missense	0			-	AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.367C>T	8.37:g.133759251G>A	ENSP00000349296:p.Pro123Ser		Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	NULL	p.P123S	ENST00000356838.3	37	c.367	CCDS6366.1	8	.	.	.	.	.	.	.	.	.	.	G	8.067	0.769343	0.15983	.	.	ENSG00000165071	ENST00000523829;ENST00000356838;ENST00000377901;ENST00000522334	.	.	.	5.46	0.351	0.16042	.	0.682520	0.14718	N	0.302536	T	0.33235	0.0856	M	0.67953	2.075	0.09310	N	1	B;B;B	0.27351	0.176;0.176;0.176	B;B;B	0.26202	0.046;0.046;0.067	T	0.23691	-1.0181	9	0.18710	T	0.47	0.0158	4.7591	0.13099	0.3245:0.1518:0.5237:0.0	.	142;142;123	Q6P5X7;Q6P5X7-3;Q6P5X7-2	TMM71_HUMAN;.;.	S	142;123;142;45	.	ENSP00000349296:P123S	P	-	1	0	TMEM71	133828433	0.038000	0.19896	0.001000	0.08648	0.136000	0.21042	0.480000	0.22244	0.037000	0.15575	0.313000	0.20887	CCA	-	TMEM71	-	NULL		0.418	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM71	HGNC	protein_coding	OTTHUMT00000379591.1	0	0	0	139	139	167	0.00	0.00	G	NM_144649		133759251	-1	132	162	80	98	tier1	no_errors	ENST00000356838	ensembl	human	known	74_37	missense	61.97	62.31	SNP	0.002	A	132	80
GRIK5	2901	genome.wustl.edu	37	19	42567637	42567637	+	Intron	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:42567637C>T	ENST00000262895.3	-	3	244				GRIK5_ENST00000301218.4_Intron|GRIK5_ENST00000593562.1_Intron	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5						cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				ctgatgcaggccttggggagt	0.522													ENSG00000105737																																					0																																										SO:0001627	intron_variant	0			-		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.245-630G>A	19.37:g.42567637C>T			Q8WWG8	Silent	SNP	NULL	p.R95	ENST00000262895.3	37	c.285	CCDS12595.1	19																																																																																			-	GRIK5	-	NULL		0.522	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	0	0	0	14	14	135	0.00	0.00	C			42567637	-1	15	56	3	35	tier1	no_errors	ENST00000594528	ensembl	human	known	74_37	silent	83.33	61.54	SNP	0.020	T	15	3
EPHA3	2042	genome.wustl.edu	37	3	89259542	89259542	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr3:89259542C>T	ENST00000336596.2	+	3	911	c.686C>T	c.(685-687)tCt>tTt	p.S229F	EPHA3_ENST00000452448.2_Missense_Mutation_p.S229F|EPHA3_ENST00000494014.1_Missense_Mutation_p.S229F	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	229	Cys-rich.		S -> Y (in a lung large cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.S229Y(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTTAGAGGGTCTTGTGTCAAC	0.483										TSP Lung(6;0.00050)			ENSG00000044524																																					1	Substitution - Missense(1)	lung(1)											156.0	150.0	152.0					3																	89259542		2203	4300	6503	SO:0001583	missense	0			-	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.686C>T	3.37:g.89259542C>T	ENSP00000337451:p.Ser229Phe		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S229F	ENST00000336596.2	37	c.686	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617573	0.87359	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.73789	-0.76;2.68;-0.78	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.87853	0.6282	M	0.83223	2.63	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.74023	0.982;0.965	D	0.87250	0.2272	9	.	.	.	.	20.3465	0.98790	0.0:1.0:0.0:0.0	.	229;229	P29320;P29320-2	EPHA3_HUMAN;.	F	229	ENSP00000337451:S229F;ENSP00000399926:S229F;ENSP00000419190:S229F	.	S	+	2	0	EPHA3	89342232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.072000	0.71238	2.798000	0.96311	0.655000	0.94253	TCT	-	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt		0.483	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	0	0	0	55	55	117	0.00	0.00	C	NM_005233		89259542	+1	18	66	28	100	tier1	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	39.13	39.29	SNP	1.000	T	18	28
RGS6	9628	genome.wustl.edu	37	14	72924986	72924986	+	Silent	SNP	A	A	C	rs540336961		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr14:72924986A>C	ENST00000553530.1	+	5	450	c.243A>C	c.(241-243)gcA>gcC	p.A81A	RGS6_ENST00000434263.2_Silent_p.A12A|RGS6_ENST00000407322.4_Silent_p.A81A|RGS6_ENST00000404301.2_Silent_p.A81A|RGS6_ENST00000553525.1_Silent_p.A81A|RGS6_ENST00000553690.1_3'UTR|RGS6_ENST00000402788.2_Silent_p.A81A|RGS6_ENST00000355512.6_Silent_p.A81A|RGS6_ENST00000556437.1_Silent_p.A81A|RGS6_ENST00000343854.6_Silent_p.A81A|RGS6_ENST00000554782.1_5'Flank|RGS6_ENST00000555571.1_Silent_p.A81A|RGS6_ENST00000406236.4_Silent_p.A81A	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	81	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CAGTTGAAGCAATACACTTGG	0.453													ENSG00000182732																									Ovarian(143;1926 2468 21071 48641)												0													124.0	103.0	110.0					14																	72924986		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.243A>C	14.37:g.72924986A>C			C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Silent	SNP	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.A81	ENST00000553530.1	37	c.243	CCDS9808.1	14																																																																																			-	RGS6	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom		0.453	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	RGS6	HGNC	protein_coding	OTTHUMT00000413033.2	0	0	0	68	68	114	0.00	0.00	A			72924986	+1	14	27	39	85	tier1	no_errors	ENST00000553525	ensembl	human	known	74_37	silent	26.42	24.11	SNP	1.000	C	14	39
SCN4A	6329	genome.wustl.edu	37	17	62018305	62018305	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:62018305C>G	ENST00000435607.1	-	24	5413	c.5337G>C	c.(5335-5337)atG>atC	p.M1779I	SCN4A_ENST00000578147.1_Missense_Mutation_p.M1779I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1779					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CGTGGCCATACATCTTGCTCA	0.637													ENSG00000007314																																					0													57.0	62.0	60.0					17																	62018305		2145	4242	6387	SO:0001583	missense	0			-	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.5337G>C	17.37:g.62018305C>G	ENSP00000396320:p.Met1779Ile		Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.M1779I	ENST00000435607.1	37	c.5337	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	C	1.152	-0.646433	0.03531	.	.	ENSG00000007314	ENST00000435607	D	0.95756	-3.8	4.23	4.23	0.50019	.	0.483231	0.21618	N	0.071684	D	0.87184	0.6114	N	0.08118	0	0.29296	N	0.868999	B	0.02656	0.0	B	0.01281	0.0	T	0.79727	-0.1682	10	0.54805	T	0.06	.	6.1881	0.20508	0.0:0.7077:0.1911:0.1012	.	1779	P35499	SCN4A_HUMAN	I	1779	ENSP00000396320:M1779I	ENSP00000396320:M1779I	M	-	3	0	SCN4A	59372037	0.996000	0.38824	1.000000	0.80357	0.105000	0.19272	0.377000	0.20552	2.352000	0.79861	0.561000	0.74099	ATG	-	SCN4A	-	NULL		0.637	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		0	0	0	23	23	51	0.00	0.00	C	NM_000334		62018305	-1	13	18	22	27	tier1	no_errors	ENST00000435607	ensembl	human	known	74_37	missense	37.14	40.00	SNP	1.000	G	13	22
LILRB5	10990	genome.wustl.edu	37	19	54760408	54760408	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:54760408T>G	ENST00000316219.5	-	3	406	c.299A>C	c.(298-300)tAt>tCt	p.Y100S	LILRB5_ENST00000345866.6_Missense_Mutation_p.Y100S|LILRB5_ENST00000450632.1_Missense_Mutation_p.Y100S|LILRB5_ENST00000449561.2_Missense_Mutation_p.Y100S	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	100	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGGGTCTCATAGTAGCAGCG	0.632													ENSG00000105609																																					0													166.0	161.0	163.0					19																	54760408		2203	4300	6503	SO:0001583	missense	0			-	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.299A>C	19.37:g.54760408T>G	ENSP00000320390:p.Tyr100Ser		Q8N760	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Y100S	ENST00000316219.5	37	c.299	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	T	6.517	0.463591	0.12402	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.13307	2.6;2.6;2.6;2.6	3.29	-1.67	0.08238	Immunoglobulin-like fold (1);	1.897590	0.02347	N	0.075545	T	0.27697	0.0681	L	0.55743	1.74	0.09310	N	1	P;B;B;D;D	0.67145	0.896;0.314;0.452;0.996;0.965	D;P;P;D;D	0.80764	0.953;0.693;0.558;0.994;0.991	T	0.19910	-1.0291	10	0.62326	D	0.03	.	1.0339	0.01544	0.1539:0.2114:0.154:0.4807	.	100;91;100;100;100	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	S	100	ENSP00000320390:Y100S;ENSP00000414225:Y100S;ENSP00000406478:Y100S;ENSP00000263430:Y100S	ENSP00000320390:Y100S	Y	-	2	0	LILRB5	59452220	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.176000	0.09811	-1.130000	0.02914	-2.085000	0.00377	TAT	-	LILRB5	-	smart_Ig_sub,smart_Ig_sub2		0.632	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	0	0	0	52	52	57	0.00	0.00	T			54760408	-1	14	19	39	50	tier1	no_errors	ENST00000450632	ensembl	human	known	74_37	missense	26.42	27.54	SNP	0.000	G	14	39
KIF4B	285643	genome.wustl.edu	37	5	154394598	154394598	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:154394598G>A	ENST00000435029.4	+	1	1339	c.1179G>A	c.(1177-1179)caG>caA	p.Q393Q		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	393					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGAAGAATCAGTCCCTGGTAG	0.463													ENSG00000226650																																					0													127.0	128.0	128.0					5																	154394598		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.1179G>A	5.37:g.154394598G>A				Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q393	ENST00000435029.4	37	c.1179	CCDS47324.1	5																																																																																			-	KIF4B	-	NULL		0.463	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	0	0	0	82	82	52	0.00	0.00	G			154394598	+1	20	6	48	37	tier1	no_errors	ENST00000435029	ensembl	human	known	74_37	silent	29.41	13.95	SNP	0.065	A	20	48
SCN2A	6326	genome.wustl.edu	37	2	166243439	166243439	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr2:166243439G>A	ENST00000375437.2	+	26	5025	c.4735G>A	c.(4735-4737)Gtg>Atg	p.V1579M	SCN2A_ENST00000283256.6_Missense_Mutation_p.V1579M|SCN2A_ENST00000357398.3_Missense_Mutation_p.V1579M|SCN2A_ENST00000375427.2_Missense_Mutation_p.V1579M	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1579					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGGAGAATGTGTGCTGAAACT	0.393													ENSG00000136531																																					0													251.0	228.0	236.0					2																	166243439		2203	4300	6503	SO:0001583	missense	0			-	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4735G>A	2.37:g.166243439G>A	ENSP00000364586:p.Val1579Met		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.V1579M	ENST00000375437.2	37	c.4735	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	15.75	2.926066	0.52759	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98889	-5.21;-5.21;-5.21;-5.21	5.17	5.17	0.71159	Ion transport (1);	0.079198	0.52532	D	0.000080	D	0.98940	0.9640	M	0.78223	2.4	0.45662	D	0.998588	P;P	0.46277	0.467;0.875	B;P	0.58266	0.237;0.836	D	0.99869	1.1094	10	0.87932	D	0	.	18.6724	0.91516	0.0:0.0:1.0:0.0	.	1579;1579	Q99250-2;Q99250	.;SCN2A_HUMAN	M	1579	ENSP00000364586:V1579M;ENSP00000349973:V1579M;ENSP00000283256:V1579M;ENSP00000364576:V1579M	ENSP00000283256:V1579M	V	+	1	0	SCN2A	165951685	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.734000	0.55037	2.418000	0.82041	0.650000	0.86243	GTG	-	SCN2A	-	pfam_Ion_trans_dom		0.393	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	0	0	0	70	70	133	0.00	0.00	G	NM_021007		166243439	+1	25	53	3	12	tier1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	89.29	81.54	SNP	1.000	A	25	3
MYO15A	51168	genome.wustl.edu	37	17	18023164	18023164	+	Silent	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:18023164C>T	ENST00000205890.5	+	2	1388	c.1050C>T	c.(1048-1050)gaC>gaT	p.D350D		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	350					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CGCCGTACGACGCGCCATACC	0.607													ENSG00000091536																																					0													82.0	93.0	89.0					17																	18023164		2034	4177	6211	SO:0001819	synonymous_variant	0			-	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1050C>T	17.37:g.18023164C>T			B4DFC7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.D350	ENST00000205890.5	37	c.1050	CCDS42271.1	17																																																																																			-	MYO15A	-	NULL		0.607	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	0	0	0	86	86	123	0.00	0.00	C	NM_016239		18023164	+1	45	57	7	18	tier1	no_errors	ENST00000205890	ensembl	human	known	74_37	silent	86.54	76.00	SNP	0.000	T	45	7
MAD1L1	8379	genome.wustl.edu	37	7	1887286	1887286	+	Intron	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr7:1887286C>T	ENST00000406869.1	-	19	2556				AC110781.3_ENST00000480694.1_3'UTR|MAD1L1_ENST00000399654.2_Intron|AC110781.3_ENST00000318959.3_Silent_p.L176L|MAD1L1_ENST00000265854.7_Intron|MAD1L1_ENST00000402746.1_Intron|AC110781.3_ENST00000402221.1_Silent_p.L177L			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CAGCTGCCCTCGGCCCATCTC	0.667													ENSG00000176349																																					0																																										SO:0001627	intron_variant	0			-	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1999-31422G>A	7.37:g.1887286C>T			B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Silent	SNP	NULL	p.L176	ENST00000406869.1	37	c.528	CCDS43539.1	7																																																																																			-	AC110781.3	-	NULL		0.667	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100128374	Clone_based_vega_gene	protein_coding	OTTHUMT00000322871.1	0	0	0	30	30	24	0.00	0.00	C	NM_003550		1887286	+1	8	4	17	24	tier1	no_errors	ENST00000318959	ensembl	human	known	74_37	silent	32.00	14.29	SNP	0.000	T	8	17
SMURF2	64750	genome.wustl.edu	37	17	62552085	62552085	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:62552085C>T	ENST00000262435.9	-	14	1650	c.1463G>A	c.(1462-1464)cGa>cAa	p.R488Q		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	488	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			TCCCATTATTCGTCCAACAAA	0.333													ENSG00000108854																																					0													79.0	69.0	72.0					17																	62552085		2203	4300	6503	SO:0001583	missense	0			-	AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.1463G>A	17.37:g.62552085C>T	ENSP00000262435:p.Arg488Gln		Q52LL1|Q9H260	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.R488Q	ENST00000262435.9	37	c.1463	CCDS32707.1	17	.	.	.	.	.	.	.	.	.	.	C	18.48	3.633616	0.67015	.	.	ENSG00000108854	ENST00000262435	T	0.58506	0.33	5.62	5.62	0.85841	HECT (4);	0.000000	0.85682	D	0.000000	T	0.80237	0.4586	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82764	-0.0296	10	0.87932	D	0	.	19.6588	0.95855	0.0:1.0:0.0:0.0	.	488	Q9HAU4	SMUF2_HUMAN	Q	488	ENSP00000262435:R488Q	ENSP00000262435:R488Q	R	-	2	0	SMURF2	59982547	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.770000	0.85390	2.648000	0.89879	0.563000	0.77884	CGA	-	SMURF2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.333	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMURF2	HGNC	protein_coding	OTTHUMT00000445227.1	1	1	0	165	165	117	0.60	0.00	C	NM_022739		62552085	-1	85	62	72	56	tier1	no_errors	ENST00000262435	ensembl	human	known	74_37	missense	54.14	52.54	SNP	1.000	T	85	72
PCDHAC2	56134	genome.wustl.edu	37	5	140347582	140347582	+	Missense_Mutation	SNP	C	C	G	rs551685820		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr5:140347582C>G	ENST00000289269.5	+	1	1763	c.1231C>G	c.(1231-1233)Cga>Gga	p.R411G	PCDHAC1_ENST00000253807.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTGCCTTTCCGACTGAATGG	0.572													ENSG00000243232	C|||	1	0.000199681	0.0008	0.0	5008	,	,		21228	0.0		0.0	False		,,,				2504	0.0				Melanoma(190;638 2083 3390 11909 52360)												0													90.0	86.0	87.0					5																	140347582		2203	4300	6503	SO:0001583	missense	0			-	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1231C>G	5.37:g.140347582C>G	ENSP00000289269:p.Arg411Gly		Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R411G	ENST00000289269.5	37	c.1231	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	C	1.096	-0.662629	0.03454	.	.	ENSG00000243232	ENST00000289269	T	0.55234	0.53	5.82	0.486	0.16836	Cadherin (4);Cadherin-like (1);	0.000000	0.34725	N	0.003724	T	0.40015	0.1100	L	0.46741	1.465	0.20196	N	0.99993	B;B	0.16166	0.004;0.016	B;B	0.17722	0.013;0.019	T	0.32025	-0.9922	10	0.54805	T	0.06	.	6.2459	0.20818	0.5929:0.2398:0.0981:0.0691	.	411;411	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	G	411	ENSP00000289269:R411G	ENSP00000289269:R411G	R	+	1	2	PCDHAC2	140327766	0.993000	0.37304	0.944000	0.38274	0.015000	0.08874	1.894000	0.39768	0.055000	0.16094	-0.140000	0.14226	CGA	-	PCDHAC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.572	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	0	0	0	26	26	76	0.00	0.00	C	NM_018899		140347582	+1	16	43	10	20	tier1	no_errors	ENST00000289269	ensembl	human	known	74_37	missense	61.54	68.25	SNP	0.143	G	16	10
SH3BGRL	6451	genome.wustl.edu	37	X	80532631	80532631	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:80532631T>C	ENST00000373212.5	+	2	452	c.194T>C	c.(193-195)cTg>cCg	p.L65P	SH3BGRL_ENST00000481106.1_3'UTR	NM_003022.2	NP_003013.1	O75368	SH3L1_HUMAN	SH3 domain binding glutamate-rich protein like	65					positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|ovary(1)	4		all_lung(315;5.94e-05)				GGTTACCCCCTGCCACCTCAG	0.378													ENSG00000131171																																					0													58.0	55.0	56.0					X																	80532631		2203	4300	6503	SO:0001583	missense	0			-	AF042081	CCDS14449.1	Xq13.3	2014-02-19	2014-02-19		ENSG00000131171	ENSG00000131171			10823	protein-coding gene	gene with protein product		300190	"""SH3 domain binding glutamic acid-rich protein like"""			9642120	Standard	NM_003022		Approved	MGC117402	uc004eef.3	O75368	OTTHUMG00000021910	ENST00000373212.5:c.194T>C	X.37:g.80532631T>C	ENSP00000362308:p.Leu65Pro		Q3SYL1|Q5JT50|Q6FIE8|Q9H0N8	Missense_Mutation	SNP	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	p.L65P	ENST00000373212.5	37	c.194	CCDS14449.1	X	.	.	.	.	.	.	.	.	.	.	T	14.80	2.644981	0.47258	.	.	ENSG00000131171	ENST00000373212	T	0.77750	-1.12	5.7	4.52	0.55395	Thioredoxin-like fold (2);	0.069891	0.56097	D	0.000022	D	0.88448	0.6439	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.979;0.998;0.996	D	0.88761	0.3257	10	0.87932	D	0	-3.3786	11.2759	0.49165	0.0:0.0:0.1509:0.8491	.	17;64;65	B0AZV6;D3DTE6;O75368	.;.;SH3L1_HUMAN	P	65	ENSP00000362308:L65P	ENSP00000362308:L65P	L	+	2	0	SH3BGRL	80419287	1.000000	0.71417	0.734000	0.30879	0.289000	0.27227	7.384000	0.79751	0.760000	0.33108	-0.369000	0.07265	CTG	-	SH3BGRL	-	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold		0.378	SH3BGRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGRL	HGNC	protein_coding	OTTHUMT00000057350.1	0	0	0	237	237	120	0.00	0.00	T	NM_003022		80532631	+1	80	44	148	82	tier1	no_errors	ENST00000373212	ensembl	human	known	74_37	missense	35.09	34.38	SNP	0.903	C	80	148
OAS3	4940	genome.wustl.edu	37	12	113401152	113401152	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr12:113401152A>G	ENST00000228928.7	+	10	2298	c.2119A>G	c.(2119-2121)Aac>Gac	p.N707D	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	707	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						TCCCACCTGGAACGTGGGCCA	0.652													ENSG00000111331																																					0													13.0	15.0	14.0					12																	113401152		1945	4119	6064	SO:0001583	missense	0			-	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.2119A>G	12.37:g.113401152A>G	ENSP00000228928:p.Asn707Asp		Q2HJ14|Q9H3P5	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.N707D	ENST00000228928.7	37	c.2119	CCDS44981.1	12	.	.	.	.	.	.	.	.	.	.	A	14.59	2.581617	0.46006	.	.	ENSG00000111331	ENST00000228928;ENST00000323881	T	0.55052	0.54	4.39	3.25	0.37280	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	.	.	.	.	T	0.42154	0.1190	L	0.28115	0.83	0.80722	D	1	B	0.26577	0.153	B	0.37304	0.246	T	0.34551	-0.9824	9	0.59425	D	0.04	.	6.3665	0.21457	0.8868:0.0:0.1132:0.0	.	707	Q9Y6K5	OAS3_HUMAN	D	707;706	ENSP00000228928:N707D	ENSP00000228928:N707D	N	+	1	0	OAS3	111885535	0.999000	0.42202	0.999000	0.59377	0.895000	0.52256	1.870000	0.39529	0.731000	0.32448	0.460000	0.39030	AAC	-	OAS3	-	pfam_2-5-oligoAdlate_synth_1_dom2/C		0.652	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	HGNC	protein_coding	OTTHUMT00000405920.1	0	0	0	23	23	17	0.00	0.00	A			113401152	+1	12	9	25	20	tier1	no_errors	ENST00000228928	ensembl	human	known	74_37	missense	32.43	31.03	SNP	0.998	G	12	25
SHC4	399694	genome.wustl.edu	37	15	49170547	49170552	+	Intron	DEL	GGAGGA	GGAGGA	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	GGAGGA	GGAGGA	GGAGGA	-	GGAGGA	GGAGGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr15:49170547_49170552delGGAGGA	ENST00000332408.4	-	4	1269				EID1_ENST00000560490.1_In_Frame_Del_p.EE39del|EID1_ENST00000558295.1_Intron|SHC4_ENST00000396535.3_5'Flank|SHC4_ENST00000537958.1_5'Flank|EID1_ENST00000530028.2_In_Frame_Del_p.EE61del	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		AAGGCCCAATGGAGGAGGAGGAGGCC	0.694													ENSG00000255302																																					0																																										SO:0001627	intron_variant	0				AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.840+5892TCCTCC>-	15.37:g.49170553_49170558delGGAGGA			Q6UXQ3|Q8IYW3	In_Frame_Del	DEL	NULL	p.EE61in_frame_del	ENST00000332408.4	37	c.174_179	CCDS10130.1	15																																																																																				EID1	-	NULL		0.694	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EID1	HGNC	protein_coding	OTTHUMT00000254371.1	0	0	0	25	25	25	0.00	0.00	GGAGGA	NM_203349		49170552	+1	3	3	20	20	tier1	no_errors	ENST00000530028	ensembl	human	known	74_37	in_frame_del	13.04	13.04	DEL	0.957:0.993:0.998:1.000:1.000:1.000	-	3	20
CTNNA3	29119	genome.wustl.edu	37	10	68280512	68280512	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr10:68280512delG	ENST00000433211.2	-	11	1568	c.1394delC	c.(1393-1395)gctfs	p.A465fs	CTNNA3_ENST00000373744.4_Frame_Shift_Del_p.A465fs	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TGCAGCCAAAGCAAGTGCAGC	0.403													ENSG00000183230																																					0													129.0	113.0	118.0					10																	68280512		2203	4300	6503	SO:0001589	frameshift_variant	0				AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1394delC	10.37:g.68280512delG	ENSP00000389714:p.Ala465fs			Frame_Shift_Del	DEL	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.A465fs	ENST00000433211.2	37	c.1394	CCDS7269.1	10																																																																																				CTN3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.403	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTN3	HGNC	protein_coding	OTTHUMT00000048282.2	0	0	1	57	57	83	0.00	1.19	G	NM_013266		68280512	-1	16	42	4	11	tier1	no_errors	ENST00000373744	ensembl	human	known	74_37	frame_shift_del	80.00	79.25	DEL	1.000	-	16	4
FLNC	2318	genome.wustl.edu	37	7	128486157	128486160	+	Frame_Shift_Del	DEL	ACCT	ACCT	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	ACCT	ACCT	ACCT	-	ACCT	ACCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr7:128486157_128486160delACCT	ENST00000325888.8	+	22	4165_4168	c.3904_3907delACCT	c.(3904-3909)acctatfs	p.TY1302fs	FLNC_ENST00000346177.6_Frame_Shift_Del_p.TY1302fs	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1302					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CAAGACAGACACCTATGTGACAGA	0.627													ENSG00000128591																																					0																																										SO:0001589	frameshift_variant	0				AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3904_3907delACCT	7.37:g.128486157_128486160delACCT	ENSP00000327145:p.Thr1302fs		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Frame_Shift_Del	DEL	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T1302fs	ENST00000325888.8	37	c.3904_3907	CCDS43644.1	7																																																																																				FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.627	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	0	0	0	33	33	39	0.00	0.00	ACCT			128486160	+1	8	11	33	30	tier1	no_errors	ENST00000325888	ensembl	human	known	74_37	frame_shift_del	19.51	26.83	DEL	1.000:1.000:0.980:0.983	-	8	33
KIF13B	23303	genome.wustl.edu	37	8	28974507	28974507	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:28974507G>A	ENST00000524189.1	-	31	3716	c.3678C>T	c.(3676-3678)tcC>tcT	p.S1226S	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1226					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CGGAGTCCCAGGAGGCTTCTG	0.582													ENSG00000197892																																					0													52.0	55.0	54.0					8																	28974507		1941	4147	6088	SO:0001819	synonymous_variant	0			-	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3678C>T	8.37:g.28974507G>A			B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1226	ENST00000524189.1	37	c.3678	CCDS55217.1	8																																																																																			-	KIF13B	-	pfam_Kinesin-like		0.582	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	HGNC	protein_coding	OTTHUMT00000376878.1	0	0	0	17	17	34	0.00	0.00	G			28974507	-1	7	12	5	4	tier1	no_errors	ENST00000524189	ensembl	human	known	74_37	silent	58.33	75.00	SNP	0.804	A	7	5
RHOXF2	84528	genome.wustl.edu	37	X	119293221	119293221	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chrX:119293221G>A	ENST00000371388.3	+	2	570	c.380G>A	c.(379-381)gGg>gAg	p.G127E		NM_032498.1	NP_115887.1	Q9BQY4	RHXF2_HUMAN	Rhox homeobox family, member 2	127					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(2)	8						GCCGTCGGGGGGCTGGAGCCT	0.662													ENSG00000131721																																					0													9.0	11.0	10.0					X																	119293221		2162	4212	6374	SO:0001583	missense	0			-		CCDS14594.1	Xq24	2012-12-20			ENSG00000131721	ENSG00000131721		"""Homeoboxes / PRD class"""	30011	protein-coding gene	gene with protein product	"""cancer/testis antigen 107"""	300447				12490318	Standard	NM_032498		Approved	THG1, PEPP-2, PEPP2, CT107		Q9BQY4	OTTHUMG00000022296	ENST00000371388.3:c.380G>A	X.37:g.119293221G>A	ENSP00000360441:p.Gly127Glu		Q9BR00	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G127E	ENST00000371388.3	37	c.380	CCDS14594.1	X	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839375	0.32513	.	.	ENSG00000131721	ENST00000371388	D	0.92397	-3.03	1.92	-1.78	0.07957	Homeodomain-related (1);Homeodomain-like (1);	.	.	.	.	D	0.84465	0.5478	N	0.19112	0.55	0.09310	N	1	P	0.41232	0.743	B	0.40602	0.334	T	0.74979	-0.3479	9	0.62326	D	0.03	-0.2643	9.2156	0.37344	0.0:0.6616:0.3384:0.0	.	127	Q9BQY4	RHXF2_HUMAN	E	127	ENSP00000360441:G127E	ENSP00000360441:G127E	G	+	2	0	RHOXF2	119177249	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.069000	0.14552	-0.617000	0.05664	-0.545000	0.04230	GGG	-	RHOXF2	-	superfamily_Homeodomain-like		0.662	RHOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF2	HGNC	protein_coding	OTTHUMT00000411977.1	0	0	0	57	57	20	0.00	0.00	G	NM_032498		119293221	+1	29	6	64	6	tier1	no_errors	ENST00000371388	ensembl	human	known	74_37	missense	31.18	50.00	SNP	0.000	A	29	64
RP1L1	94137	genome.wustl.edu	37	8	10469906	10469906	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:10469906C>T	ENST00000382483.3	-	4	1925	c.1702G>A	c.(1702-1704)Gcc>Acc	p.A568T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	568					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCCTCGCTGGCCTCCTGCTGA	0.657													ENSG00000183638																																					0													56.0	66.0	63.0					8																	10469906		2116	4236	6352	SO:0001583	missense	0			-	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1702G>A	8.37:g.10469906C>T	ENSP00000371923:p.Ala568Thr		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.A568T	ENST00000382483.3	37	c.1702	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448533	0.43429	.	.	ENSG00000183638	ENST00000382483	T	0.06528	3.29	4.34	-0.551	0.11822	.	3.538250	0.01140	N	0.006183	T	0.05090	0.0136	N	0.24115	0.695	0.09310	N	1	B	0.25486	0.127	B	0.23852	0.049	T	0.38001	-0.9681	10	0.62326	D	0.03	0.8502	1.8857	0.03237	0.3486:0.3592:0.1841:0.1081	.	568	A6NKC6	.	T	568	ENSP00000371923:A568T	ENSP00000371923:A568T	A	-	1	0	RP1L1	10507316	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.756000	0.04777	0.012000	0.14892	0.455000	0.32223	GCC	-	RP1L1	-	NULL		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	0	0	0	71	71	11	0.00	0.00	C			10469906	-1	25	5	12	3	tier1	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	67.57	62.50	SNP	0.000	T	25	12
VPS54	51542	genome.wustl.edu	37	2	64193060	64193060	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr2:64193060G>A	ENST00000272322.4	-	6	687	c.533C>T	c.(532-534)aCt>aTt	p.T178I	VPS54_ENST00000409558.4_Missense_Mutation_p.T166I|VPS54_ENST00000354504.3_Missense_Mutation_p.T61I			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	178					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TGAATTAAAAGTTAAGGAATC	0.313													ENSG00000143952																																					0													57.0	62.0	60.0					2																	64193060		2203	4300	6503	SO:0001583	missense	0			-	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.533C>T	2.37:g.64193060G>A	ENSP00000272322:p.Thr178Ile		Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	pfam_Vps54,pfam_Vacuolar_sorting-assoc_54	p.T178I	ENST00000272322.4	37	c.533	CCDS33208.1	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221044	0.79464	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.39997	1.15;1.05;1.05	5.47	4.57	0.56435	.	0.045974	0.85682	D	0.000000	T	0.64527	0.2606	M	0.73962	2.25	0.80722	D	1	P;D;D	0.89917	0.692;1.0;1.0	P;D;D	0.87578	0.711;0.998;0.997	T	0.67421	-0.5675	10	0.49607	T	0.09	.	15.4953	0.75643	0.0:0.0:0.8605:0.1395	.	61;178;166	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	I	61;178;166;166;178	ENSP00000346499:T61I;ENSP00000272322:T178I;ENSP00000386980:T166I	ENSP00000272322:T178I	T	-	2	0	VPS54	64046564	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.855000	0.75445	1.274000	0.44362	0.467000	0.42956	ACT	-	VPS54	-	NULL		0.313	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS54	HGNC	protein_coding	OTTHUMT00000327062.2	0	0	0	188	188	136	0.00	0.00	G	NM_016516		64193060	-1	8	6	92	89	tier1	no_errors	ENST00000272322	ensembl	human	known	74_37	missense	8.00	6.25	SNP	1.000	A	8	92
SNORD3C	780853	genome.wustl.edu	37	17	19091392	19091392	+	lincRNA	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:19091392G>A	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		tgaacgtgtagagcaccgaaa	0.488													ENSG00000263934																																					0													26.0	17.0	20.0					17																	19091392		870	1968	2838			0			-			17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091392G>A				R	SNP	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			-	SNORD3A	-	-		0.488	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	HGNC	lincRNA		0	0	0	711	711	434	0.00	0.00	G	NR_006881		19091392	+1	53	30	587	367	tier1	no_errors	ENST00000365494	ensembl	human	known	74_37	rna	8.27	7.56	SNP	0.996	A	53	587
MUC16	94025	genome.wustl.edu	37	19	9026241	9026241	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:9026241G>A	ENST00000397910.4	-	14	36948	c.36745C>T	c.(36745-36747)Cgc>Tgc	p.R12249C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12251	SEA 2. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCCAGTGCGACGCATGTCC	0.552													ENSG00000181143																																					0													244.0	223.0	230.0					19																	9026241		2076	4214	6290	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36745C>T	19.37:g.9026241G>A	ENSP00000381008:p.Arg12249Cys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.R12249C	ENST00000397910.4	37	c.36745	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	6.444	0.450006	0.12223	.	.	ENSG00000181143	ENST00000397910	T	0.39056	1.1	2.58	0.112	0.14623	.	.	.	.	.	T	0.29524	0.0736	M	0.71581	2.175	.	.	.	P	0.46277	0.875	B	0.28553	0.091	T	0.39121	-0.9629	8	0.87932	D	0	.	3.3118	0.07020	0.1519:0.0:0.5975:0.2506	.	12249	B5ME49	.	C	12249	ENSP00000381008:R12249C	ENSP00000381008:R12249C	R	-	1	0	MUC16	8887241	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.995000	0.01472	0.109000	0.17891	0.195000	0.17529	CGC	-	MUC16	-	pfam_SEA_dom,smart_SEA_dom		0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	78	78	21	0.00	0.00	G	NM_024690		9026241	-1	9	1	48	9	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	15.79	10.00	SNP	0.000	A	9	48
SEZ6	124925	genome.wustl.edu	37	17	27284100	27284100	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:27284100delG	ENST00000317338.12	-	13	3083	c.2655delC	c.(2653-2655)cccfs	p.P885fs	PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000360295.9_Frame_Shift_Del_p.P885fs|SEZ6_ENST00000335960.6_Intron|SEZ6_ENST00000442608.3_Frame_Shift_Del_p.P885fs			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	885	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			TCCAATGCGAGGGGTGCCCAG	0.617													ENSG00000063015																																					0													22.0	24.0	23.0					17																	27284100		2050	4181	6231	SO:0001589	frameshift_variant	0				AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.2655delC	17.37:g.27284100delG	ENSP00000312942:p.Pro885fs		B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Frame_Shift_Del	DEL	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_CUB_dom,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S886fs	ENST00000317338.12	37	c.2655	CCDS45639.1	17																																																																																				SEZ6	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.617	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	HGNC	protein_coding	OTTHUMT00000397475.3	0	0	0	19	19	15	0.00	0.00	G			27284100	-1	2	0	14	9	tier1	no_errors	ENST00000317338	ensembl	human	known	74_37	frame_shift_del	12.50	0.00	DEL	0.714	-	2	14
TPTEP1	387590	genome.wustl.edu	37	22	17178547	17178547	+	IGR	SNP	G	G	A	rs543869229		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr22:17178547G>A								KB-7G2.8 (3009 upstream) : AC005301.8 (49211 downstream)																							CGGGACATCCGTTGGGGCTCC	0.582													ENSG00000100181																																					0																																										SO:0001628	intergenic_variant	0			-																													22.37:g.17178547G>A				R	SNP	-	NULL		37	NULL		22																																																																																			-	TPTEP1	-	-	0	0.582					TPTEP1	HGNC			0	0	0	63	63	8	0.00	0.00	G			17178547	+1	8	0	37	6	tier1	no_errors	ENST00000558085	ensembl	human	known	74_37	rna	17.78	0.00	SNP	0.098	A	8	37
CFAP46	54777	genome.wustl.edu	37	10	134628237	134628237	+	Missense_Mutation	SNP	C	C	T	rs375364632		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr10:134628237C>T	ENST00000368586.5	-	52	7302	c.7202G>A	c.(7201-7203)cGg>cAg	p.R2401Q	TTC40_ENST00000263170.5_Missense_Mutation_p.R562Q	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGGGATGGTCCGGGGGATGCT	0.657													ENSG00000171811																																					0								C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	39.0	38.0	39.0		2138	4.3	0.1	10		39	0,8600		0,0,4300	no	missense	C10orf92	NM_001200049.1	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	713/1028	134628237	2,13004	2203	4300	6503	SO:0001583	missense	0			-																												ENST00000368586.5:c.7202G>A	10.37:g.134628237C>T	ENSP00000357575:p.Arg2401Gln			Missense_Mutation	SNP	NULL	p.R562Q	ENST00000368586.5	37	c.1685	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239983	0.58995	4.54E-4	0.0	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.33654	1.4;1.4	4.32	4.32	0.51571	.	0.121359	0.35013	N	0.003503	T	0.53769	0.1817	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.64144	0.922	T	0.57682	-0.7769	10	0.62326	D	0.03	.	12.3296	0.55031	0.0:1.0:0.0:0.0	.	562	Q8IYW2	CJ092_HUMAN	Q	2401;562	ENSP00000357575:R2401Q;ENSP00000263170:R562Q	ENSP00000263170:R562Q	R	-	2	0	C10orf93	134478227	0.320000	0.24616	0.083000	0.20561	0.003000	0.03518	1.881000	0.39638	1.959000	0.56917	0.591000	0.81541	CGG	-	TTC40	-	NULL		0.657	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	0	0	0	80	80	13	0.00	0.00	C			134628237	-1	19	1	20	6	tier1	no_errors	ENST00000263170	ensembl	human	known	74_37	missense	48.72	14.29	SNP	0.289	T	19	20
SCPEP1	59342	genome.wustl.edu	37	17	55062464	55062465	+	Intron	INS	-	-	GAAAA	rs34242828|rs397829366|rs3056052|rs573491470	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr17:55062464_55062465insGAAAA	ENST00000262288.3	+	3	280				RP5-1107A17.4_ENST00000572877.1_RNA|SCPEP1_ENST00000571898.1_Intron	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1						negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					agactctgtctgaaaagaaaag	0.475													ENSG00000263120																																					0																																										SO:0001627	intron_variant	0				AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.226-274->GAAAA	17.37:g.55062470_55062474dupGAAAA			Q96A94|Q9H3F0	R	INS	-	NULL	ENST00000262288.3	37	NULL	CCDS11593.1	17																																																																																				RP5-1107A17.4	-	-		0.475	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263120	Clone_based_vega_gene	protein_coding	OTTHUMT00000440622.1	0	0	0	0	0	0	0.00	0.00	-	NM_021626		55062465	+1	0	0	0	0	tier1	no_errors	ENST00000572877	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.001:0.001	GAAAA	0	0
FOXD2	2306	genome.wustl.edu	37	1	47904668	47904669	+	In_Frame_Ins	INS	-	-	CCGCAC	rs113438724|rs3046924|rs71053113	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr1:47904668_47904669insCCGCAC	ENST00000334793.5	+	1	2980_2981	c.861_862insCCGCAC	c.(862-864)ccg>CCGCACccg	p.288_288P>PHP		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	288	Ala-rich.|Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		cggccccgcatccgcacccgca	0.787													ENSG00000186564		4830	0.964457	0.9107	0.9827	5008	,	,		7050	0.9881		0.992	False		,,,				2504	0.9714																0										161,17		80,1,8						-2.5	0.2		dbSNP_102	1	364,38		182,0,19	no	coding	FOXD2	NM_004474.3		262,1,27	A1A1,A1R,RR		9.4527,9.5506,9.4828				525,55				SO:0001652	inframe_insertion	0				AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.874_879dupCCGCAC	1.37:g.47904669_47904674dupCCGCAC	ENSP00000335493:p.HisPro292dup		Q5SVZ3	In_Frame_Ins	INS	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.291in_frame_insPH	ENST00000334793.5	37	c.861_862	CCDS30708.1	1																																																																																				FOXD2	-	NULL		0.787	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD2	HGNC	protein_coding	OTTHUMT00000021831.1	0	0	0	1	1	1	0.00	0.00	-	NM_004474		47904669	+1	1	1	0	0	tier1	no_errors	ENST00000334793	ensembl	human	known	74_37	in_frame_ins	100.00	100.00	INS	0.056:0.602	CCGCAC	1	0
SNHG14	104472715	genome.wustl.edu	37	15	25460742	25460742	+	RNA	SNP	C	C	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr15:25460742C>T	ENST00000424208.1	+	0	2739				SNORD115-24_ENST00000363528.1_RNA|SNHG14_ENST00000424333.1_RNA|SNORD115-25_ENST00000362619.1_RNA|SNHG14_ENST00000453082.2_RNA|SNHG14_ENST00000450809.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		ACTTAAAAATCATGCCCAATA	0.488													ENSG00000199489																																					0													457.0	456.0	456.0					15																	25460742		876	1991	2867			0			-			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25460742C>T				R	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			-	SNORD115-25	-	-		0.488	SNHG14-002	KNOWN	basic	antisense	SNORD115-25	HGNC	processed_transcript	OTTHUMT00000126729.2	0	0	0	71	71	0	0.00	0.00	C			25460742	+1	41	1	32	0	tier1	no_errors	ENST00000362619	ensembl	human	known	74_37	rna	56.16	100.00	SNP	0.940	T	41	32
USP17L2	377630	genome.wustl.edu	37	8	11995025	11995025	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:11995025G>A	ENST00000333796.3	-	1	1561	c.1245C>T	c.(1243-1245)ctC>ctT	p.L415L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	415	Mediates interaction with SUDS3.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						CGGGTGCCTGGAGGCAGGGGT	0.572													ENSG00000223443																																					0													54.0	60.0	58.0					8																	11995025		1659	3714	5373	SO:0001819	synonymous_variant	0			-	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1245C>T	8.37:g.11995025G>A				Silent	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.L415	ENST00000333796.3	37	c.1245	CCDS43713.1	8																																																																																			-	USP17L2	-	pfam_HABP4_PAIRBP1-bd		0.572	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	0	0	0	130	130	0	0.00	0.00	G	NM_201402		11995025	-1	61	0	36	0	tier1	no_errors	ENST00000333796	ensembl	human	known	74_37	silent	62.24	0.00	SNP	0.003	A	61	36
USP17L2	377630	genome.wustl.edu	37	8	11995433	11995433	+	Silent	SNP	G	G	T	rs75180221		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:11995433G>T	ENST00000333796.3	-	1	1153	c.837C>A	c.(835-837)gtC>gtA	p.V279V	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	279	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						ATCTCTTCAAGACAAGGATGA	0.488													ENSG00000223443																																					0													28.0	31.0	30.0					8																	11995433		1227	2812	4039	SO:0001819	synonymous_variant	0			-	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.837C>A	8.37:g.11995433G>T				Silent	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.V279	ENST00000333796.3	37	c.837	CCDS43713.1	8																																																																																			rs75180221	USP17L2	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.488	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	0	0	0	124	124	3	0.00	0.00	G	NM_201402		11995433	-1	37	1	50	1	tier1	no_errors	ENST00000333796	ensembl	human	known	74_37	silent	42.53	50.00	SNP	0.021	T	37	50
USP17L2	377630	genome.wustl.edu	37	8	11995496	11995496	+	Silent	SNP	G	G	C			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr8:11995496G>C	ENST00000333796.3	-	1	1090	c.774C>G	c.(772-774)ctC>ctG	p.L258L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	258	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						GCGCCCTCTGGAGACAAAGAC	0.498													ENSG00000223443																																					0													17.0	22.0	20.0					8																	11995496		1033	2414	3447	SO:0001819	synonymous_variant	0			-	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.774C>G	8.37:g.11995496G>C				Silent	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.L258	ENST00000333796.3	37	c.774	CCDS43713.1	8																																																																																			-	USP17L2	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.498	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	0	0	0	101	101	2	0.00	0.00	G	NM_201402		11995496	-1	38	0	45	1	tier1	no_errors	ENST00000333796	ensembl	human	known	74_37	silent	45.78	0.00	SNP	0.003	C	38	45
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000382968.5_Intron|RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619													ENSG00000178222																																					0																																										SO:0001627	intron_variant	0				AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC			C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																				RNF212	-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	HGNC	protein_coding	OTTHUMT00000359124.2	0	0	0	3	3	3	0.00	0.00	-	NM_194439		1087328	-1	2	2	3	3	tier1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	40.00	40.00	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC	2	3
DGKD	8527	genome.wustl.edu	37	2	234343069	234343069	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr2:234343069G>T	ENST00000264057.2	+	4	404	c.392G>T	c.(391-393)aGa>aTa	p.R131I	DGKD_ENST00000409813.3_Missense_Mutation_p.R87I	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	131	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GCTGATAACAGAAAAGAAATG	0.408													ENSG00000077044																																					0													163.0	163.0	163.0					2																	234343069		2203	4300	6503	SO:0001583	missense	0			-	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.392G>T	2.37:g.234343069G>T	ENSP00000264057:p.Arg131Ile		Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,pfam_Pleckstrin_homology,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R131I	ENST00000264057.2	37	c.392	CCDS2504.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917261	0.92249	.	.	ENSG00000077044	ENST00000264057;ENST00000427930;ENST00000447484;ENST00000409813	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	4.89	4.89	0.63831	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.066582	0.64402	D	0.000018	T	0.54695	0.1874	M	0.64404	1.975	0.80722	D	1	D;D	0.76494	0.999;0.992	D;D	0.83275	0.996;0.961	T	0.54695	-0.8255	10	0.56958	D	0.05	.	18.6329	0.91366	0.0:0.0:1.0:0.0	.	87;131	Q16760-2;Q16760	.;DGKD_HUMAN	I	131;67;101;87	ENSP00000264057:R131I;ENSP00000407938:R67I;ENSP00000395530:R101I;ENSP00000386455:R87I	ENSP00000264057:R131I	R	+	2	0	DGKD	234007808	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	9.108000	0.94275	2.717000	0.92951	0.563000	0.77884	AGA	-	DGKD	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.408	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	0	0	0	80	80	112	0.00	0.00	G	NM_003648		234343069	+1	4	2	37	64	tier1	no_errors	ENST00000264057	ensembl	human	known	74_37	missense	9.76	3.03	SNP	1.000	T	4	37
CCDC170	80129	genome.wustl.edu	37	6	151869452	151869452	+	Missense_Mutation	SNP	G	G	A	rs200538059		TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr6:151869452G>A	ENST00000239374.7	+	5	701	c.602G>A	c.(601-603)cGc>cAc	p.R201H	CCDC170_ENST00000367290.5_Missense_Mutation_p.R201H	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	201								p.R201H(1)									AGAGACCTGCGCAAAGAAAAT	0.353													ENSG00000120262																																					1	Substitution - Missense(1)	lung(1)						G	HIS/ARG	0,3670		0,0,1835	59.0	54.0	56.0		602	3.3	1.0	6		56	1,8157		0,1,4078	yes	missense	C6orf97	NM_025059.3	29	0,1,5913	AA,AG,GG		0.0123,0.0,0.0085	benign	201/716	151869452	1,11827	1835	4079	5914	SO:0001583	missense	0			-	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.602G>A	6.37:g.151869452G>A	ENSP00000239374:p.Arg201His		Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.R201H	ENST00000239374.7	37	c.602	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	G	7.695	0.691904	0.15039	0.0	1.23E-4	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.10099	2.91;2.91	5.48	3.32	0.38043	.	0.552403	0.19336	N	0.116789	T	0.01156	0.0038	N	0.02011	-0.69	0.18873	N	0.999987	B	0.02656	0.0	B	0.01281	0.0	T	0.48364	-0.9042	10	0.15499	T	0.54	1.1149	10.969	0.47428	0.2274:0.0:0.7726:0.0	.	201	Q8IYT3	CF097_HUMAN	H	201	ENSP00000239374:R201H;ENSP00000356259:R201H	ENSP00000239374:R201H	R	+	2	0	C6orf97	151911145	1.000000	0.71417	0.993000	0.49108	0.723000	0.41478	1.873000	0.39558	1.271000	0.44313	0.585000	0.79938	CGC	rs200538059	CCDC170	-	NULL		0.353	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	0	0	0	106	106	121	0.00	0.00	G	NM_025059		151869452	+1	5	2	52	104	tier1	no_errors	ENST00000367290	ensembl	human	known	74_37	missense	8.77	1.89	SNP	0.998	A	5	52
MAP3K10	4294	genome.wustl.edu	37	19	40721091	40721091	+	Silent	SNP	G	G	A			TCGA-DX-A6YX-01A-11D-A417-09	TCGA-DX-A6YX-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	292eef9c-c947-4841-99cc-5f5d183e2f1c	1ca46aad-e03c-417b-9dca-178b183c93c1	g.chr19:40721091G>A	ENST00000253055.3	+	10	3045	c.2757G>A	c.(2755-2757)ccG>ccA	p.P919P		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	919					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CAGACACTCCGGAGAGCCCTG	0.692													ENSG00000130758																																					0													9.0	9.0	9.0					19																	40721091		2164	4272	6436	SO:0001819	synonymous_variant	0			-	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.2757G>A	19.37:g.40721091G>A			Q12761|Q14871	Silent	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.P919	ENST00000253055.3	37	c.2757	CCDS12549.1	19																																																																																			-	MAP3K10	-	pirsf_MAPKKK9/10/11		0.692	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	0	0	0	52	52	16	0.00	0.00	G	NM_002446		40721091	+1	9	2	28	23	tier1	no_errors	ENST00000253055	ensembl	human	known	74_37	silent	24.32	8.00	SNP	0.001	A	9	28
