#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
NPY4R	5540	genome.wustl.edu	37	10	47087136	47087136	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr10:47087136C>A	ENST00000395716.1	+	2	438	c.353C>A	c.(352-354)gCc>gAc	p.A118D	NPY4R_ENST00000374312.1_Missense_Mutation_p.A118D			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	118					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										AAGATGTCGGCCTTCATCCAG	0.582													ENSG00000204174																																					0													280.0	255.0	263.0					10																	47087136		2203	4300	6503	SO:0001583	missense	0			-		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.353C>A	10.37:g.47087136C>A	ENSP00000379066:p.Ala118Asp		Q13456|Q5ISU3|Q5T2X9|Q6FH06	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY4_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.A118D	ENST00000395716.1	37	c.353	CCDS31193.1	10	.	.	.	.	.	.	.	.	.	.	C	9.317	1.057162	0.19907	.	.	ENSG00000204174	ENST00000374312;ENST00000395716	T;T	0.38077	1.16;1.16	5.0	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	0.245466	0.42053	D	0.000779	T	0.35278	0.0926	M	0.81682	2.555	0.30801	N	0.73983	P	0.34699	0.464	B	0.32928	0.155	T	0.44711	-0.9310	10	0.54805	T	0.06	.	4.8391	0.13481	0.1697:0.65:0.0:0.1803	.	118	P50391	NPY4R_HUMAN	D	118	ENSP00000363431:A118D;ENSP00000379066:A118D	ENSP00000363431:A118D	A	+	2	0	PPYR1	46507142	1.000000	0.71417	0.064000	0.19789	0.030000	0.12068	5.635000	0.67841	0.643000	0.30638	-0.136000	0.14681	GCC	-	NPY4R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM		0.582	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY4R	HGNC	protein_coding	OTTHUMT00000047837.1	0	0	0	41	41	147	0.00	0.00	C			47087136	+1	8	8	33	51	tier1	no_errors	ENST00000374312	ensembl	human	known	74_37	missense	19.51	13.56	SNP	0.979	A	8	33
RELN	5649	genome.wustl.edu	37	7	103183203	103183203	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:103183203G>A	ENST00000428762.1	-	43	6805	c.6646C>T	c.(6646-6648)Cga>Tga	p.R2216*	RELN_ENST00000343529.5_Nonsense_Mutation_p.R2216*|RELN_ENST00000424685.2_Nonsense_Mutation_p.R2216*	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2216					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCAGGTCTCGTGTCATCAAC	0.373													ENSG00000189056																									NSCLC(146;835 1944 15585 22231 52158)												0													119.0	112.0	114.0					7																	103183203		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6646C>T	7.37:g.103183203G>A	ENSP00000392423:p.Arg2216*		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Nonsense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.R2216*	ENST00000428762.1	37	c.6646	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	48	14.610394	0.99803	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	.	.	.	5.93	5.93	0.95920	.	0.220988	0.39909	N	0.001236	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3495	0.98807	0.0:0.0:1.0:0.0	.	.	.	.	X	2216	.	ENSP00000345694:R2216X	R	-	1	2	RELN	102970439	0.808000	0.29022	1.000000	0.80357	0.969000	0.65631	2.586000	0.46119	2.814000	0.96858	0.591000	0.81541	CGA	-	RELN	-	superfamily_Sialidases		0.373	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	0	0	1	58	58	150	0.00	0.66	G	NM_005045		103183203	-1	20	45	44	98	tier1	no_errors	ENST00000424685	ensembl	human	known	74_37	nonsense	31.25	31.47	SNP	0.991	A	20	44
FGD5	152273	genome.wustl.edu	37	3	14960294	14960294	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr3:14960294G>T	ENST00000285046.5	+	13	3633	c.3523G>T	c.(3523-3525)Gct>Tct	p.A1175S	FGD5_ENST00000543601.1_Missense_Mutation_p.A934S|FGD5_ENST00000476851.1_3'UTR|FGD5-AS1_ENST00000430166.1_RNA	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1175	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AGTGCCCTACGCTCTAAAGAT	0.597													ENSG00000154783																																					0													101.0	99.0	100.0					3																	14960294		2045	4193	6238	SO:0001583	missense	0			-	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3523G>T	3.37:g.14960294G>T	ENSP00000285046:p.Ala1175Ser		B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.A1175S	ENST00000285046.5	37	c.3523	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380868	0.42207	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.74842	-0.88;-0.88	3.86	3.86	0.44501	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.280885	0.25025	N	0.033733	T	0.77246	0.4102	L	0.54323	1.7	0.24173	N	0.995611	B;B	0.32620	0.173;0.378	P;P	0.47827	0.558;0.558	T	0.67273	-0.5712	10	0.27082	T	0.32	-18.4664	12.6537	0.56776	0.0:0.0:1.0:0.0	.	934;1175	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	S	1175;934	ENSP00000285046:A1175S;ENSP00000445949:A934S	ENSP00000285046:A1175S	A	+	1	0	FGD5	14935298	0.569000	0.26643	0.319000	0.25293	0.646000	0.38490	3.278000	0.51662	1.988000	0.58038	0.591000	0.81541	GCT	-	FGD5	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.597	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	0	0	0	95	95	85	0.00	0.00	G	NM_152536		14960294	+1	79	59	35	31	tier1	no_errors	ENST00000285046	ensembl	human	known	74_37	missense	69.30	65.56	SNP	0.530	T	79	35
ZNF740	283337	genome.wustl.edu	37	12	53580211	53580211	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr12:53580211G>A	ENST00000416904.3	+	6	855	c.410G>A	c.(409-411)cGt>cAt	p.R137H		NM_001004304.3	NP_001004304.1	Q8NDX6	ZN740_HUMAN	zinc finger protein 740	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)	3						TGTGATATGCGTTTCATCCAG	0.502													ENSG00000139651																																					0													77.0	79.0	78.0					12																	53580211		2036	4182	6218	SO:0001583	missense	0			-	BC053557	CCDS44896.1	12q13.13	2013-01-08				ENSG00000139651		"""Zinc fingers, C2H2-type"""	27465	protein-coding gene	gene with protein product							Standard	NM_001004304		Approved	Zfp740	uc001scb.4	Q8NDX6		ENST00000416904.3:c.410G>A	12.37:g.53580211G>A	ENSP00000409463:p.Arg137His		A8K9M9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R137H	ENST00000416904.3	37	c.410	CCDS44896.1	12	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827887	0.90955	.	.	ENSG00000139651	ENST00000416904	T	0.19938	2.11	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.108925	0.39083	N	0.001468	T	0.44726	0.1307	M	0.73430	2.235	0.49051	D	0.999746	D	0.89917	1.0	D	0.68353	0.957	T	0.33292	-0.9874	10	0.72032	D	0.01	-14.9527	12.4482	0.55664	0.0778:0.0:0.9222:0.0	.	137	Q8NDX6	ZN740_HUMAN	H	137	ENSP00000409463:R137H	ENSP00000409463:R137H	R	+	2	0	ZNF740	51866478	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.419000	0.66435	2.894000	0.99253	0.655000	0.94253	CGT	-	ZNF740	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.502	ZNF740-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF740	HGNC	protein_coding	OTTHUMT00000406890.2	0	0	0	53	53	90	0.00	0.00	G	NM_001004304		53580211	+1	14	9	56	67	tier1	no_errors	ENST00000416904	ensembl	human	known	74_37	missense	20.00	11.84	SNP	1.000	A	14	56
INPP5D	3635	genome.wustl.edu	37	2	234072418	234072418	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:234072418G>A	ENST00000359570.5	+	14	1270	c.1270G>A	c.(1270-1272)Gac>Aac	p.D424N	INPP5D_ENST00000450745.1_Missense_Mutation_p.D188N|INPP5D_ENST00000538935.1_Missense_Mutation_p.D423N|INPP5D_ENST00000455936.2_Missense_Mutation_p.D188N			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	436					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		AAAGACGCGGGACGACTCTGC	0.557													ENSG00000168918																									NSCLC(82;1215 1426 16163 20348 41018)												0													147.0	153.0	151.0					2																	234072418		2055	4187	6242	SO:0001583	missense	0			-	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.1270G>A	2.37:g.234072418G>A	ENSP00000352575:p.Asp424Asn		O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,pfscan_SH2,prints_SH2	p.D424N	ENST00000359570.5	37	c.1270		2	.	.	.	.	.	.	.	.	.	.	G	33	5.214614	0.95104	.	.	ENSG00000168918	ENST00000359570;ENST00000538935;ENST00000450745;ENST00000455936;ENST00000435188;ENST00000415617;ENST00000445964	D;D;D;D;D;D;D	0.97232	-4.28;-4.22;-4.3;-4.3;-4.27;-4.27;-4.27	5.08	5.08	0.68730	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.102976	0.64402	D	0.000004	D	0.98005	0.9343	.	.	.	0.53688	D	0.999977	D;D	0.69078	0.997;0.987	P;P	0.62491	0.903;0.841	D	0.97752	1.0215	9	0.41790	T	0.15	.	18.6649	0.91486	0.0:0.0:1.0:0.0	.	435;436	Q92835-2;Q92835	.;SHIP1_HUMAN	N	424;423;188;188;57;57;57	ENSP00000352575:D424N;ENSP00000441010:D423N;ENSP00000407916:D188N;ENSP00000404610:D188N;ENSP00000400151:D57N;ENSP00000397421:D57N;ENSP00000405338:D57N	ENSP00000352575:D424N	D	+	1	0	INPP5D	233736490	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.203000	0.95033	2.652000	0.90054	0.655000	0.94253	GAC	-	INPP5D	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.557	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	HGNC	protein_coding		0	0	0	59	59	108	0.00	0.00	G	NM_001017915		234072418	+1	14	25	70	91	tier1	no_errors	ENST00000359570	ensembl	human	known	74_37	missense	16.67	21.37	SNP	1.000	A	14	70
CCDC27	148870	genome.wustl.edu	37	1	3679935	3679935	+	Silent	SNP	G	G	A	rs201495912		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:3679935G>A	ENST00000294600.2	+	7	1302	c.1218G>A	c.(1216-1218)tcG>tcA	p.S406S		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	406	Glu-rich.									breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TGGCCGAGTCGTTTGAGGAGG	0.607													ENSG00000162592	G|||	1	0.000199681	0.0	0.0	5008	,	,		18046	0.0		0.001	False		,,,				2504	0.0																0										0,4406		0,0,2203	63.0	63.0	63.0		1218	-5.7	0.0	1		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCDC27	NM_152492.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		406/657	3679935	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1218G>A	1.37:g.3679935G>A			Q5TBV3|Q96M50	Silent	SNP	superfamily_Prefoldin	p.S406	ENST00000294600.2	37	c.1218	CCDS50.1	1																																																																																			rs201495912	CCDC27	-	NULL		0.607	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1	0	0	0	61	61	116	0.00	0.00	G	NM_152492		3679935	+1	24	17	78	100	tier1	no_errors	ENST00000294600	ensembl	human	known	74_37	silent	23.53	14.53	SNP	0.000	A	24	78
TDRD1	56165	genome.wustl.edu	37	10	115962849	115962849	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr10:115962849G>A	ENST00000369280.1	+	7	1175	c.715G>A	c.(715-717)Gtt>Att	p.V239I	TDRD1_ENST00000422662.1_5'UTR|TDRD1_ENST00000251864.2_Missense_Mutation_p.V239I|TDRD1_ENST00000369282.1_Missense_Mutation_p.V239I|TDRD1_ENST00000369281.2_Missense_Mutation_p.V239I			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	239					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TCCACTTGGAGTTACTAAGGA	0.373													ENSG00000095627																																					0													95.0	90.0	92.0					10																	115962849		2203	4300	6503	SO:0001583	missense	0			-	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.715G>A	10.37:g.115962849G>A	ENSP00000358286:p.Val239Ile		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.V239I	ENST00000369280.1	37	c.715		10	.	.	.	.	.	.	.	.	.	.	G	4.196	0.035101	0.08148	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000369280	T;T;T;T	0.19532	3.02;3.01;2.14;3.03	5.96	-1.25	0.09405	.	1.045250	0.07480	N	0.903690	T	0.14527	0.0351	L	0.44542	1.39	0.22127	N	0.999347	B;B;B;B	0.14012	0.005;0.005;0.009;0.004	B;B;B;B	0.18561	0.01;0.01;0.022;0.011	T	0.39396	-0.9616	10	0.13853	T	0.58	-1.4698	4.4234	0.11492	0.3932:0.3101:0.2967:0.0	.	239;239;239;239	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	I	239	ENSP00000358288:V239I;ENSP00000251864:V239I;ENSP00000358287:V239I;ENSP00000358286:V239I	ENSP00000251864:V239I	V	+	1	0	TDRD1	115952839	0.877000	0.30153	0.153000	0.22517	0.429000	0.31625	0.018000	0.13422	-0.090000	0.12462	-0.225000	0.12378	GTT	-	TDRD1	-	NULL		0.373	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	HGNC	protein_coding	OTTHUMT00000050457.2	0	0	0	66	66	95	0.00	0.00	G			115962849	+1	40	30	62	59	tier1	no_errors	ENST00000251864	ensembl	human	known	74_37	missense	39.22	33.71	SNP	0.262	A	40	62
ZNF645	158506	genome.wustl.edu	37	X	22291373	22291373	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chrX:22291373G>A	ENST00000323684.1	+	1	309	c.265G>A	c.(265-267)Gga>Aga	p.G89R		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	89					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						TGACAAAGTCGGATATAAAGT	0.403													ENSG00000175809																																					0													73.0	64.0	67.0					X																	22291373		2203	4300	6503	SO:0001583	missense	0			-	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.265G>A	X.37:g.22291373G>A	ENSP00000323348:p.Gly89Arg		A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	pfscan_Znf_RING,pfscan_Znf_C2H2	p.G89R	ENST00000323684.1	37	c.265	CCDS14205.1	X	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267674	0.40095	.	.	ENSG00000175809	ENST00000323684	T	0.33216	1.42	3.49	0.633	0.17712	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.406566	0.23834	U	0.044116	T	0.19604	0.0471	L	0.46157	1.445	0.09310	N	1	D	0.54772	0.968	B	0.39617	0.305	T	0.17077	-1.0381	10	0.45353	T	0.12	.	4.096	0.09991	0.2276:0.0:0.5869:0.1855	.	89	Q8N7E2	ZN645_HUMAN	R	89	ENSP00000323348:G89R	ENSP00000323348:G89R	G	+	1	0	ZNF645	22201294	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.136000	0.15974	0.017000	0.15025	0.436000	0.28706	GGA	-	ZNF645	-	pfscan_Znf_RING		0.403	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF645	HGNC	protein_coding	OTTHUMT00000056037.1	0	0	0	68	68	90	0.00	0.00	G	NM_152577		22291373	+1	13	20	83	97	tier1	no_errors	ENST00000323684	ensembl	human	known	74_37	missense	13.40	17.09	SNP	0.002	A	13	83
FAM204A	63877	genome.wustl.edu	37	10	120070202	120070202	+	3'UTR	SNP	C	C	G			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr10:120070202C>G	ENST00000369183.4	-	0	1128				FAM204A_ENST00000469758.1_5'Flank	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A											kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						TTCAATAGGACAAAGTCCTTA	0.254													ENSG00000165669																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.*167G>C	10.37:g.120070202C>G			D3DRC6|Q5T373|Q9H5V5	R	SNP	-	NULL	ENST00000369183.4	37	NULL	CCDS7605.1	10																																																																																			-	FAM204A	-	-		0.254	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM204A	HGNC	protein_coding	OTTHUMT00000050596.2	0	0	0	11	11	26	0.00	0.00	C	NM_022063		120070202	-1	4	2	12	14	tier1	no_errors	ENST00000491416	ensembl	human	known	74_37	rna	25.00	12.50	SNP	0.001	G	4	12
FSCB	84075	genome.wustl.edu	37	14	44976108	44976108	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr14:44976108G>A	ENST00000340446.4	-	1	374	c.83C>T	c.(82-84)aCc>aTc	p.T28I	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	28						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		AATACGATGGGTAGCTTTGGG	0.428													ENSG00000189139																																					0													243.0	233.0	236.0					14																	44976108		2203	4300	6503	SO:0001583	missense	0			-	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.83C>T	14.37:g.44976108G>A	ENSP00000344579:p.Thr28Ile		Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.T28I	ENST00000340446.4	37	c.83	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382372	0.24944	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.14893	2.47	5.49	1.57	0.23409	.	.	.	.	.	T	0.17959	0.0431	L	0.50333	1.59	0.09310	N	1	P	0.50528	0.936	P	0.46320	0.512	T	0.13361	-1.0512	9	0.72032	D	0.01	-1.5349	4.9021	0.13781	0.2514:0.0:0.5971:0.1515	.	28	Q5H9T9	FSCB_HUMAN	I	28	ENSP00000344579:T28I	ENSP00000344579:T28I	T	-	2	0	FSCB	44045858	0.008000	0.16893	0.029000	0.17559	0.172000	0.22775	0.560000	0.23500	0.379000	0.24794	0.555000	0.69702	ACC	-	FSCB	-	NULL		0.428	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	0	0	0	67	67	117	0.00	0.00	G	NM_032135		44976108	-1	26	20	91	74	tier1	no_errors	ENST00000340446	ensembl	human	known	74_37	missense	22.22	21.05	SNP	0.003	A	26	91
LOC100130331	100130331	genome.wustl.edu	37	1	238090237	238090237	+	RNA	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:238090237G>T	ENST00000450451.1	+	0	1743					NR_027247.2																						TCCATCATTGGGCACCCCCGG	0.602													ENSG00000237250																																					0																																												0			-																													1.37:g.238090237G>T				R	SNP	-	NULL	ENST00000450451.1	37	NULL		1																																																																																			-	RP11-193H5.1	-	-		0.602	RP11-193H5.1-001	KNOWN	basic	antisense	LOC100130331	Clone_based_vega_gene	antisense	OTTHUMT00000095477.1	0	0	0	17	17	26	0.00	0.00	G			238090237	+1	8	4	17	14	tier1	no_errors	ENST00000450451	ensembl	human	known	74_37	rna	32.00	22.22	SNP	1.000	T	8	17
PRPF31	26121	genome.wustl.edu	37	19	54625279	54625279	+	Silent	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:54625279C>T	ENST00000321030.4	+	4	628	c.279C>T	c.(277-279)atC>atT	p.I93I	AC012314.8_ENST00000452097.1_RNA|PRPF31_ENST00000419967.1_Silent_p.I93I|PRPF31_ENST00000391755.1_Silent_p.I93I|PRPF31_ENST00000498612.1_3'UTR	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	93					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					ACCGCGTCATCGTGGATGCCA	0.627													ENSG00000105618																																					0													96.0	65.0	75.0					19																	54625279		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.279C>T	19.37:g.54625279C>T			Q17RB4|Q8N7F9|Q9H271|Q9Y439	Silent	SNP	pfam_Nop_dom,pfam_Prp31_C,pfam_NOSIC,smart_NOSIC	p.I93	ENST00000321030.4	37	c.279	CCDS12879.1	19																																																																																			-	PRPF31	-	pfam_NOSIC,smart_NOSIC		0.627	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF31	HGNC	protein_coding	OTTHUMT00000141417.2	0	0	0	29	29	43	0.00	0.00	C			54625279	+1	11	17	39	60	tier1	no_errors	ENST00000321030	ensembl	human	known	74_37	silent	22.00	22.08	SNP	0.904	T	11	39
SCTR	6344	genome.wustl.edu	37	2	120209612	120209612	+	Missense_Mutation	SNP	G	G	A	rs144810736	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:120209612G>A	ENST00000019103.5	-	9	1162	c.895C>T	c.(895-897)Cgt>Tgt	p.R299C		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	299					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	ACAGGACCACGAATGATCCAC	0.592													ENSG00000080293	G|||	2	0.000399361	0.0	0.0029	5008	,	,		21577	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG	4,4402	8.1+/-20.4	0,4,2199	146.0	104.0	118.0		895	5.3	1.0	2	dbSNP_134	118	33,8567	21.6+/-65.8	0,33,4267	yes	missense	SCTR	NM_002980.2	180	0,37,6466	AA,AG,GG		0.3837,0.0908,0.2845	probably-damaging	299/441	120209612	37,12969	2203	4300	6503	SO:0001583	missense	0			-		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.895C>T	2.37:g.120209612G>A	ENSP00000019103:p.Arg299Cys		Q12961|Q13213|Q53T00	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_secretin_rcpt,prints_GPCR_2_VIP_rcpt_1	p.R299C	ENST00000019103.5	37	c.895	CCDS2127.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168832	0.78339	9.08E-4	0.003837	ENSG00000080293	ENST00000019103	T	0.36520	1.25	5.33	5.33	0.75918	GPCR, family 2-like (1);	0.000000	0.47852	D	0.000206	T	0.64472	0.2601	M	0.86502	2.82	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.69661	-0.5085	10	0.87932	D	0	.	13.6707	0.62422	0.0:0.0:0.8356:0.1644	.	299	P47872	SCTR_HUMAN	C	299	ENSP00000019103:R299C	ENSP00000019103:R299C	R	-	1	0	SCTR	119926082	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.818000	0.55678	2.775000	0.95449	0.655000	0.94253	CGT	rs144810736	SCTR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.592	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCTR	HGNC	protein_coding	OTTHUMT00000254198.2	0	0	0	41	41	96	0.00	0.00	G			120209612	-1	16	18	29	60	tier1	no_errors	ENST00000019103	ensembl	human	known	74_37	missense	35.56	23.08	SNP	1.000	A	16	29
ANGPTL4	51129	genome.wustl.edu	37	19	8430863	8430863	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:8430863G>A	ENST00000301455.2	+	2	515	c.344G>A	c.(343-345)aGg>aAg	p.R115K	ANGPTL4_ENST00000541807.1_5'UTR|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.R115K	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	115					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						CAGAACAGCAGGATCCAGCAA	0.552													ENSG00000167772																																					0													76.0	70.0	72.0					19																	8430863		2203	4300	6503	SO:0001583	missense	0			-	AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.344G>A	19.37:g.8430863G>A	ENSP00000301455:p.Arg115Lys		A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.R115K	ENST00000301455.2	37	c.344	CCDS12200.1	19	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816887	0.50633	.	.	ENSG00000167772	ENST00000301455;ENST00000393962	T;T	0.42513	0.97;0.97	4.81	2.61	0.31194	.	2.329500	0.01348	N	0.011810	T	0.27900	0.0687	N	0.12746	0.255	0.80722	D	1	B;B	0.27594	0.182;0.182	B;B	0.27380	0.079;0.079	T	0.07635	-1.0762	10	0.28530	T	0.3	.	6.0619	0.19842	0.2577:0.0:0.7423:0.0	.	115;115	A8MY84;Q9BY76	.;ANGL4_HUMAN	K	115	ENSP00000301455:R115K;ENSP00000377534:R115K	ENSP00000301455:R115K	R	+	2	0	ANGPTL4	8336863	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.835000	0.48175	0.362000	0.24319	0.655000	0.94253	AGG	-	ANGPTL4	-	NULL		0.552	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL4	HGNC	protein_coding	OTTHUMT00000460322.1	0	0	0	49	49	116	0.00	0.00	G	NM_139314		8430863	+1	42	112	54	89	tier1	no_errors	ENST00000301455	ensembl	human	known	74_37	missense	43.30	55.45	SNP	1.000	A	42	54
TNFRSF21	27242	genome.wustl.edu	37	6	47200704	47200704	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr6:47200704C>T	ENST00000296861.2	-	6	2158	c.1765G>A	c.(1765-1767)Gta>Ata	p.V589I		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	589					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			TCCAGGCGTACCTGCCGCAAC	0.532													ENSG00000146072																																					0													75.0	75.0	75.0					6																	47200704		2203	4300	6503	SO:0001583	missense	0			-	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1765G>A	6.37:g.47200704C>T	ENSP00000296861:p.Val589Ile		B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_21	p.V589I	ENST00000296861.2	37	c.1765	CCDS4921.1	6	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752436	0.89753	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.69435	-0.4	5.84	5.84	0.93424	.	0.112081	0.64402	D	0.000010	T	0.67335	0.2882	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.65443	0.935	T	0.71679	-0.4520	10	0.87932	D	0	.	18.3151	0.90218	0.0:1.0:0.0:0.0	.	589	O75509	TNR21_HUMAN	I	589;278	ENSP00000296861:V589I	ENSP00000296861:V589I	V	-	1	0	TNFRSF21	47308663	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.070000	0.71220	2.765000	0.95021	0.655000	0.94253	GTA	-	TNFRSF21	-	superfamily_DEATH-like_dom		0.532	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	HGNC	protein_coding	OTTHUMT00000040814.1	0	0	0	40	40	83	0.00	0.00	C	NM_014452		47200704	-1	22	27	15	14	tier1	no_errors	ENST00000296861	ensembl	human	known	74_37	missense	59.46	65.85	SNP	1.000	T	22	15
TRIM64C	646754	genome.wustl.edu	37	11	49075541	49075541	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:49075541C>A	ENST00000530230.1	-	7	1068	c.1069G>T	c.(1069-1071)Gat>Tat	p.D357Y		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	357	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GTCCTAGAATCTCGACAGACT	0.443													ENSG00000214891																																					0																																										SO:0001583	missense	0			-		CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.1069G>T	11.37:g.49075541C>A	ENSP00000431987:p.Asp357Tyr			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.D357Y	ENST00000530230.1	37	c.1069		11	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372841	0.24857	.	.	ENSG00000214891	ENST00000530230	T	0.62232	0.04	1.55	0.612	0.17591	.	.	.	.	.	T	0.73497	0.3594	M	0.92122	3.275	0.09310	N	1	.	.	.	.	.	.	T	0.65393	-0.6179	7	0.87932	D	0	.	3.8742	0.09050	0.0:0.762:0.0:0.238	.	.	.	.	Y	357	ENSP00000431987:D357Y	ENSP00000431987:D357Y	D	-	1	0	TRIM64C	49032117	0.005000	0.15991	0.002000	0.10522	0.052000	0.14988	0.390000	0.20768	0.242000	0.21303	0.184000	0.17185	GAT	-	TRIM64C	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.443	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	1	1	0	103	103	43	0.96	0.00	C			49075541	-1	37	13	62	19	tier1	no_errors	ENST00000530230	ensembl	human	known	74_37	missense	37.37	40.62	SNP	0.014	A	37	62
IGKC	3514	genome.wustl.edu	37	2	89156778	89156778	+	RNA	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:89156778C>A	ENST00000390237.2	-	0	418				AC096579.7_ENST00000430694.1_RNA|AC096579.13_ENST00000452230.1_RNA			P01834	IGKC_HUMAN	immunoglobulin kappa constant						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										TGGAGGACCGCAATAGGGGTA	0.522													ENSG00000231486																																					0																																												0			-	J00241		2p11.2	2013-01-14			ENSG00000211592	ENSG00000211592		"""Immunoglobulins / IGK locus"""	5716	other	immunoglobulin gene		147200				10354514	Standard	NG_000834		Approved	HCAK1		P01834	OTTHUMG00000151684		2.37:g.89156778C>A				R	SNP	-	NULL	ENST00000390237.2	37	NULL		2																																																																																			-	AC096579.7	-	-		0.522	IGKC-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	ENSG00000231486	Clone_based_vega_gene	IG_C_gene	OTTHUMT00000323482.1	0	0	0	12	12	51	0.00	0.00	C	NG_000834		89156778	-1	6	15	6	29	tier1	no_errors	ENST00000430694	ensembl	human	known	74_37	rna	50.00	34.09	SNP	0.000	A	6	6
NELL1	4745	genome.wustl.edu	37	11	20939733	20939733	+	Silent	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:20939733C>T	ENST00000357134.5	+	6	761	c.609C>T	c.(607-609)atC>atT	p.I203I	NELL1_ENST00000325319.5_Silent_p.I146I|NELL1_ENST00000532434.1_Silent_p.I203I|NELL1_ENST00000298925.5_Silent_p.I231I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	203	Laminin G-like.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TCAAGGGGATCATCCAAGATG	0.378													ENSG00000165973																																					0													145.0	140.0	142.0					11																	20939733		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.609C>T	11.37:g.20939733C>T			B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.I203	ENST00000357134.5	37	c.609	CCDS7855.1	11																																																																																			-	NELL1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.378	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	0	0	0	64	64	105	0.00	0.00	C	NM_006157		20939733	+1	8	11	45	75	tier1	no_errors	ENST00000357134	ensembl	human	known	74_37	silent	15.09	12.64	SNP	0.991	T	8	45
PCDHB17	54661	genome.wustl.edu	37	5	140536443	140536443	+	Silent	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr5:140536443C>A	ENST00000539533.1	+	1	867	c.867C>A	c.(865-867)atC>atA	p.I289I						protocadherin beta 17 pseudogene																		CCAATCAAATCATTCAGGCCT	0.423													ENSG00000255622																																					0																																										SO:0001819	synonymous_variant	0			-	AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.867C>A	5.37:g.140536443C>A				Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I289	ENST00000539533.1	37	c.867		5																																																																																			-	PCDHB17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.423	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000255622	Uniprot_gn	protein_coding		0	0	0	45	45	110	0.00	0.00	C			140536443	+1	24	34	47	90	tier1	no_errors	ENST00000539533	ensembl	human	known	74_37	silent	33.80	27.42	SNP	0.000	A	24	47
FBN3	84467	genome.wustl.edu	37	19	8197971	8197971	+	Silent	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:8197971G>A	ENST00000600128.1	-	14	2025	c.1611C>T	c.(1609-1611)acC>acT	p.T537T	FBN3_ENST00000270509.2_Silent_p.T537T|FBN3_ENST00000601739.1_Silent_p.T537T			Q75N90	FBN3_HUMAN	fibrillin 3	537	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACATGGTGCTGGTGGCACACT	0.642													ENSG00000142449																																					0													53.0	34.0	40.0					19																	8197971		2201	4298	6499	SO:0001819	synonymous_variant	0			-		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.1611C>T	19.37:g.8197971G>A			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.T537	ENST00000600128.1	37	c.1611	CCDS12196.1	19																																																																																			-	FBN3	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.642	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	0	0	0	74	74	38	0.00	0.00	G	NM_032447		8197971	-1	92	20	76	31	tier1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	54.76	39.22	SNP	1.000	A	92	76
IGDCC3	9543	genome.wustl.edu	37	15	65621813	65621813	+	Missense_Mutation	SNP	C	C	T	rs371434447		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr15:65621813C>T	ENST00000327987.4	-	13	2371	c.2120G>A	c.(2119-2121)cGa>cAa	p.R707Q	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	707					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTTCTCGTCTCGGCCCAGCTG	0.662													ENSG00000174498																																					0								C	GLN/ARG	1,4395		0,1,2197	49.0	58.0	55.0		2120	3.3	0.5	15		55	0,8584		0,0,4292	no	missense	IGDCC3	NM_004884.3	43	0,1,6489	TT,TC,CC		0.0,0.0227,0.0077	benign	707/815	65621813	1,12979	2198	4292	6490	SO:0001583	missense	0			-	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2120G>A	15.37:g.65621813C>T	ENSP00000332773:p.Arg707Gln		O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R707Q	ENST00000327987.4	37	c.2120	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	6.655	0.489291	0.12641	2.27E-4	0.0	ENSG00000174498	ENST00000327987	T	0.65549	-0.16	5.29	3.35	0.38373	.	0.946368	0.08825	N	0.888237	T	0.41811	0.1175	N	0.19112	0.55	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.28933	-1.0028	10	0.18710	T	0.47	-0.0428	3.631	0.08131	0.3147:0.4664:0.1365:0.0825	.	707	Q8IVU1	IGDC3_HUMAN	Q	707	ENSP00000332773:R707Q	ENSP00000332773:R707Q	R	-	2	0	IGDCC3	63408866	0.000000	0.05858	0.480000	0.27341	0.003000	0.03518	0.716000	0.25836	0.572000	0.29383	0.655000	0.94253	CGA	-	IGDCC3	-	NULL		0.662	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	0	0	0	70	70	15	0.00	0.00	C	NM_004884		65621813	-1	27	3	108	23	tier1	no_errors	ENST00000327987	ensembl	human	known	74_37	missense	20.00	11.54	SNP	0.003	T	27	108
PASD1	139135	genome.wustl.edu	37	X	150840783	150840783	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chrX:150840783G>C	ENST00000370357.4	+	14	1811	c.1566G>C	c.(1564-1566)caG>caC	p.Q522H		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	522	Lys-rich.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					agaagctgcaggagcagaaaa	0.547													ENSG00000166049																																					0													39.0	40.0	40.0					X																	150840783		2161	4213	6374	SO:0001583	missense	0			-	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1566G>C	X.37:g.150840783G>C	ENSP00000359382:p.Gln522His		Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	superfamily_PAS,smart_PAS,pfscan_PAS	p.Q522H	ENST00000370357.4	37	c.1566	CCDS35431.1	X	.	.	.	.	.	.	.	.	.	.	G	5.936	0.356749	0.11239	.	.	ENSG00000166049	ENST00000370357	T	0.68624	-0.34	1.01	1.01	0.19927	.	.	.	.	.	T	0.59252	0.2180	N	0.08118	0	0.09310	N	1	D	0.62365	0.991	D	0.69824	0.966	T	0.47328	-0.9126	9	0.52906	T	0.07	.	4.9567	0.14044	0.0:0.0:1.0:0.0	.	522	Q8IV76	PASD1_HUMAN	H	522	ENSP00000359382:Q522H	ENSP00000359382:Q522H	Q	+	3	2	PASD1	150591439	0.000000	0.05858	0.004000	0.12327	0.017000	0.09413	0.176000	0.16782	0.759000	0.33084	0.284000	0.19432	CAG	-	PASD1	-	NULL		0.547	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	0	0	0	48	48	76	0.00	0.00	G	NM_173493		150840783	+1	11	18	26	59	tier1	no_errors	ENST00000370357	ensembl	human	known	74_37	missense	29.73	23.38	SNP	0.004	C	11	26
COL7A1	1294	genome.wustl.edu	37	3	48622990	48622990	+	Splice_Site	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr3:48622990C>T	ENST00000328333.8	-	31	4001	c.3894G>A	c.(3892-3894)agG>agA	p.R1298R	COL7A1_ENST00000454817.1_Splice_Site_p.R1298R	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1298	Interrupted collagenous region.|Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCACACTCACCCTCTCGCCCT	0.572													ENSG00000114270																																					0													59.0	69.0	66.0					3																	48622990		2203	4298	6501	SO:0001630	splice_region_variant	0			-	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.3894+1G>A	3.37:g.48622990C>T			Q14054|Q16507	Silent	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R1298	ENST00000328333.8	37	c.3894	CCDS2773.1	3																																																																																			-	COL7A1	-	pfam_Collagen		0.572	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	0	0	0	57	57	42	0.00	0.00	C	NM_000094	Silent	48622990	-1	13	19	70	50	tier1	no_errors	ENST00000328333	ensembl	human	known	74_37	silent	15.48	27.54	SNP	1.000	T	13	70
EVI5L	115704	genome.wustl.edu	37	19	7916385	7916385	+	Silent	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:7916385G>A	ENST00000270530.4	+	7	1015	c.819G>A	c.(817-819)tcG>tcA	p.S273S	EVI5L_ENST00000538904.2_Silent_p.S273S	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	273	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						TGTATGCCTCGTCCTGGTTCC	0.607													ENSG00000142459																																					0													348.0	234.0	273.0					19																	7916385		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.819G>A	19.37:g.7916385G>A			B9A6I9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S273	ENST00000270530.4	37	c.819	CCDS12188.1	19																																																																																			-	EVI5L	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.607	EVI5L-001	KNOWN	basic|CCDS	protein_coding	EVI5L	HGNC	protein_coding	OTTHUMT00000461347.1	0	0	0	58	58	107	0.00	0.00	G	NM_145245		7916385	+1	42	49	101	139	tier1	no_errors	ENST00000538904	ensembl	human	known	74_37	silent	29.37	26.06	SNP	0.046	A	42	101
PDE1C	5137	genome.wustl.edu	37	7	32109993	32109993	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:32109993T>C	ENST00000396191.1	-	1	468	c.13A>G	c.(13-15)Acc>Gcc	p.T5A	PDE1C_ENST00000396182.2_Missense_Mutation_p.T5A|PDE1C_ENST00000396184.3_Missense_Mutation_p.T5A|PDE1C_ENST00000396193.1_Intron|PDE1C_ENST00000321453.7_Missense_Mutation_p.T5A	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	5					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ATCTCCTTGGTTGGCGACTCC	0.557													ENSG00000154678																																					0													119.0	122.0	121.0					7																	32109993		2203	4300	6503	SO:0001583	missense	0			-	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.13A>G	7.37:g.32109993T>C	ENSP00000379494:p.Thr5Ala		B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.T5A	ENST00000396191.1	37	c.13	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	T	9.163	1.019127	0.19355	.	.	ENSG00000154678	ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182;ENST00000396189	T;T;T;T	0.71103	-0.54;-0.54;-0.51;-0.51	4.94	4.94	0.65067	.	.	.	.	.	T	0.42268	0.1195	N	0.01048	-1.04	0.34891	D	0.745576	B;B	0.19445	0.0;0.036	B;B	0.22152	0.002;0.038	T	0.50457	-0.8826	9	0.17832	T	0.49	.	14.7175	0.69280	0.0:0.0:0.0:1.0	.	5;5	Q14123-2;Q14123	.;PDE1C_HUMAN	A	5	ENSP00000379494:T5A;ENSP00000318105:T5A;ENSP00000379487:T5A;ENSP00000379485:T5A	ENSP00000318105:T5A	T	-	1	0	PDE1C	32076518	1.000000	0.71417	0.949000	0.38748	0.464000	0.32679	7.716000	0.84723	2.186000	0.69663	0.533000	0.62120	ACC	-	PDE1C	-	NULL		0.557	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	0	0	0	63	63	88	0.00	0.00	T			32109993	-1	39	31	110	80	tier1	no_errors	ENST00000321453	ensembl	human	known	74_37	missense	26.17	27.93	SNP	1.000	C	39	110
ARAP2	116984	genome.wustl.edu	37	4	36212251	36212251	+	Silent	SNP	T	T	G			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr4:36212251T>G	ENST00000303965.4	-	6	1737	c.1248A>C	c.(1246-1248)tcA>tcC	p.S416S		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	416					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CTTCTACTGTTGAGTATTCTG	0.363													ENSG00000047365																																					0													115.0	122.0	120.0					4																	36212251		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1248A>C	4.37:g.36212251T>G			Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.S416	ENST00000303965.4	37	c.1248	CCDS3441.1	4																																																																																			-	ARAP2	-	NULL		0.363	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	HGNC	protein_coding	OTTHUMT00000215074.2	0	0	1	69	69	126	0.00	0.79	T	NM_015230		36212251	-1	10	31	40	59	tier1	no_errors	ENST00000303965	ensembl	human	known	74_37	silent	20.00	34.44	SNP	0.988	G	10	40
DSCAM	1826	genome.wustl.edu	37	21	41496170	41496170	+	Silent	SNP	G	G	A	rs201137339	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr21:41496170G>A	ENST00000400454.1	-	20	4125	c.3648C>T	c.(3646-3648)aaC>aaT	p.N1216N		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1216	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGATGATGCCGTTCAGCTTGA	0.572													ENSG00000171587	G|||	4	0.000798722	0.003	0.0	5008	,	,		17417	0.0		0.0	False		,,,				2504	0.0				Melanoma(134;970 1778 1785 21664 32388)												0								G		11,4069		0,11,2029	155.0	164.0	161.0		3648	-3.6	1.0	21		161	0,8370		0,0,4185	no	coding-synonymous	DSCAM	NM_001389.3		0,11,6214	AA,AG,GG		0.0,0.2696,0.0884		1216/2013	41496170	11,12439	2040	4185	6225	SO:0001819	synonymous_variant	0			GMAF=0.0005	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3648C>T	21.37:g.41496170G>A			O60468	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N1216	ENST00000400454.1	37	c.3648	CCDS42929.1	21																																																																																			rs201137339	DSCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.572	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	0	0	0	98	98	130	0.00	0.00	G	NM_001389		41496170	-1	26	18	85	81	tier1	no_errors	ENST00000400454	ensembl	human	known	74_37	silent	23.21	18.18	SNP	0.975	A	26	85
EGFL8	80864	genome.wustl.edu	37	6	32134340	32134340	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr6:32134340C>T	ENST00000395512.1	+	3	272	c.167C>T	c.(166-168)cCa>cTa	p.P56L	AGPAT1_ENST00000490711.1_5'Flank|PPT2-EGFL8_ENST00000422437.1_3'UTR|EGFL8_ENST00000333845.6_Missense_Mutation_p.P56L			Q99944	EGFL8_HUMAN	EGF-like-domain, multiple 8	56	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	10						TACAGCCAACCAGTGTACAAG	0.587													ENSG00000241404																																					0													116.0	102.0	107.0					6																	32134340		1511	2709	4220	SO:0001583	missense	0			-	U89336	CCDS4743.1	6p21	2010-06-25	2003-05-21	2003-05-23	ENSG00000241404	ENSG00000241404			13944	protein-coding gene	gene with protein product		609897	"""chromosome 6 open reading frame 8"""	C6orf8			Standard	NM_030652		Approved	NG3		Q99944	OTTHUMG00000031222	ENST00000395512.1:c.167C>T	6.37:g.32134340C>T	ENSP00000378888:p.Pro56Leu		B0S884|G5E9Q0|Q5JP23|Q5SSX3|Q8IV30	Missense_Mutation	SNP	pfam_EMI_domain,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_EMI_domain	p.P56L	ENST00000395512.1	37	c.167	CCDS4743.1	6	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023256	0.93462	.	.	ENSG00000241404	ENST00000333845;ENST00000395512;ENST00000432129	T;T;T	0.44482	0.92;0.92;0.92	5.93	5.93	0.95920	EMI domain (2);	.	.	.	.	T	0.58119	0.2100	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59506	-0.7442	9	0.66056	D	0.02	-9.0746	15.841	0.78845	0.0:1.0:0.0:0.0	.	56	Q99944	EGFL8_HUMAN	L	56	ENSP00000333380:P56L;ENSP00000378888:P56L;ENSP00000401694:P56L	ENSP00000333380:P56L	P	+	2	0	EGFL8	32242318	0.995000	0.38212	0.942000	0.38095	0.990000	0.78478	5.383000	0.66219	2.814000	0.96858	0.655000	0.94253	CCA	-	EGFL8	-	pfam_EMI_domain,pfscan_EMI_domain		0.587	EGFL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFL8	HGNC	protein_coding	OTTHUMT00000076463.3	0	0	0	55	55	101	0.00	0.00	C	NM_030652		32134340	+1	24	56	27	38	tier1	no_errors	ENST00000333845	ensembl	human	known	74_37	missense	47.06	59.57	SNP	0.997	T	24	27
SLC12A5	57468	genome.wustl.edu	37	20	44669254	44669254	+	Splice_Site	SNP	G	G	A	rs142641765		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr20:44669254G>A	ENST00000454036.2	+	7	972		c.e7+1		SLC12A5_ENST00000243964.3_Splice_Site|SLC12A5_ENST00000372315.1_Silent_p.P285P	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5						cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCAACTTCCCGTGAGTGCTGC	0.567													ENSG00000124140																																					0								G	,	0,4406		0,0,2203	183.0	151.0	162.0		,	5.0	1.0	20	dbSNP_134	162	1,8599	1.2+/-3.3	0,1,4299	no	splice-5,splice-5	SLC12A5	NM_001134771.1,NM_020708.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	,	44669254	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.923+1G>A	20.37:g.44669254G>A			A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Splice_Site	SNP	-	e7+1	ENST00000454036.2	37	c.923+1	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693747	0.88735	0.0	1.16E-4	ENSG00000124140	ENST00000454036;ENST00000243964	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3986	0.87453	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC12A5	44102661	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.657000	0.98554	2.572000	0.86782	0.655000	0.94253	.	rs142641765	SLC12A5	-	-		0.567	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	0	0	0	20	20	79	0.00	0.00	G		Intron	44669254	+1	17	26	38	65	tier1	no_errors	ENST00000454036	ensembl	human	known	74_37	splice_site	30.91	28.57	SNP	1.000	A	17	38
USH2A	7399	genome.wustl.edu	37	1	216500945	216500945	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:216500945G>T	ENST00000307340.3	-	5	1222	c.836C>A	c.(835-837)gCa>gAa	p.A279E	USH2A_ENST00000366942.3_Missense_Mutation_p.A279E|USH2A_ENST00000366943.2_Missense_Mutation_p.A279E	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	279	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTTGTAAGTGCCACTTGGTA	0.353										HNSCC(13;0.011)			ENSG00000042781																																					0													154.0	147.0	150.0					1																	216500945		2203	4300	6503	SO:0001583	missense	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.836C>A	1.37:g.216500945G>T	ENSP00000305941:p.Ala279Glu		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.A279E	ENST00000307340.3	37	c.836	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043913	0.93685	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.80994	-1.44;-1.44;-1.44	5.76	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin, N-terminal (2);	0.183135	0.25839	U	0.027978	D	0.86806	0.6021	M	0.61703	1.905	0.38266	D	0.942013	D;D	0.69078	0.997;0.993	P;D	0.63192	0.904;0.912	D	0.89237	0.3581	10	0.66056	D	0.02	.	14.6527	0.68808	0.0696:0.0:0.9304:0.0	.	279;279	O75445-2;O75445	.;USH2A_HUMAN	E	279	ENSP00000305941:A279E;ENSP00000355910:A279E;ENSP00000355909:A279E	ENSP00000305941:A279E	A	-	2	0	USH2A	214567568	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.137000	0.77295	1.441000	0.47550	0.563000	0.77884	GCA	-	USH2A	-	superfamily_ConA-like_lec_gl_sf,smart_LamG-like,smart_Laminin_N,pfscan_Laminin_N		0.353	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	58	58	139	0.00	0.00	G	NM_007123		216500945	-1	22	19	41	75	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	34.92	20.00	SNP	1.000	T	22	41
GIMAP8	155038	genome.wustl.edu	37	7	150174830	150174830	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:150174830G>A	ENST00000307271.3	+	5	2534	c.1960G>A	c.(1960-1962)Gaa>Aaa	p.E654K		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	654						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GTCCCAAGCCGAAAAACTCCT	0.463													ENSG00000171115																																					0													43.0	48.0	46.0					7																	150174830		2165	4288	6453	SO:0001583	missense	0			-	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1960G>A	7.37:g.150174830G>A	ENSP00000305107:p.Glu654Lys			Missense_Mutation	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.E654K	ENST00000307271.3	37	c.1960	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.568140	0.00133	.	.	ENSG00000171115	ENST00000307271	T	0.05319	3.46	3.5	-6.99	0.01605	AIG1 (1);	1.518970	0.04492	N	0.379769	T	0.01661	0.0053	N	0.01109	-1.01	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23691	-1.0181	10	0.17369	T	0.5	.	1.1102	0.01702	0.3935:0.0925:0.2347:0.2792	.	654	Q8ND71	GIMA8_HUMAN	K	654	ENSP00000305107:E654K	ENSP00000305107:E654K	E	+	1	0	GIMAP8	149805763	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.873000	0.01637	-5.955000	0.00008	-1.384000	0.01168	GAA	-	GIMAP8	-	pfam_AIG1		0.463	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	0	0	0	131	131	193	0.00	0.00	G	NM_175571		150174830	+1	82	99	124	108	tier1	no_errors	ENST00000307271	ensembl	human	known	74_37	missense	39.61	47.83	SNP	0.000	A	82	124
OR8D1	283159	genome.wustl.edu	37	11	124179847	124179847	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr11:124179847C>A	ENST00000357821.2	-	1	886	c.816G>T	c.(814-816)aaG>aaT	p.K272N		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		CAGAGGACACCTTCTCCTGGT	0.463													ENSG00000196341																																					0													109.0	104.0	106.0					11																	124179847		2201	4299	6500	SO:0001583	missense	0			-	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.816G>T	11.37:g.124179847C>A	ENSP00000350474:p.Lys272Asn		B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K272N	ENST00000357821.2	37	c.816	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	c	8.692	0.907606	0.17833	.	.	ENSG00000196341	ENST00000357821	T	0.00207	8.55	4.29	-2.53	0.06326	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38436	U	0.001689	T	0.00496	0.0016	M	0.92077	3.27	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.48456	-0.9034	10	0.59425	D	0.04	.	4.2567	0.10721	0.2431:0.3836:0.0:0.3732	.	272	Q8WZ84	OR8D1_HUMAN	N	272	ENSP00000350474:K272N	ENSP00000350474:K272N	K	-	3	2	OR8D1	123685057	0.000000	0.05858	0.266000	0.24541	0.005000	0.04900	-2.707000	0.00820	-0.105000	0.12132	-0.363000	0.07495	AAG	-	OR8D1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.463	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	HGNC	protein_coding	OTTHUMT00000387285.1	0	0	0	79	79	171	0.00	0.00	C	NM_001002917		124179847	-1	24	28	46	61	tier1	no_errors	ENST00000357821	ensembl	human	known	74_37	missense	34.29	31.46	SNP	0.000	A	24	46
ASTN2	23245	genome.wustl.edu	37	9	119204815	119204815	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr9:119204815A>G	ENST00000313400.4	-	21	3615	c.3515T>C	c.(3514-3516)gTg>gCg	p.V1172A	ASTN2_ENST00000361477.3_Missense_Mutation_p.V224A|ASTN2_ENST00000373996.3_Missense_Mutation_p.V1168A|ASTN2_ENST00000288520.5_Missense_Mutation_p.V273A|ASTN2_ENST00000341734.4_Missense_Mutation_p.V224A|ASTN2_ENST00000361209.2_Missense_Mutation_p.V1121A			O75129	ASTN2_HUMAN	astrotactin 2	1172	Fibronectin type-III.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TCGTGTATCCACAGCATACAG	0.537													ENSG00000148219																																					0													152.0	126.0	135.0					9																	119204815		2203	4300	6503	SO:0001583	missense	0			-	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3515T>C	9.37:g.119204815A>G	ENSP00000314038:p.Val1172Ala		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.V1172A	ENST00000313400.4	37	c.3515		9	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950882	0.73787	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477	T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.43	5.43	0.79202	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.59689	0.2212	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D;D	0.64830	0.99;0.99;0.971;0.994;0.966;0.99;0.99	D;D;P;D;P;D;D	0.73380	0.971;0.971;0.761;0.97;0.872;0.971;0.98	T	0.63373	-0.6652	10	0.87932	D	0	-20.342	15.5086	0.75760	1.0:0.0:0.0:0.0	.	224;224;1121;1172;1168;224;273	B7ZKP4;B7ZKP5;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;ASTN2_HUMAN;.;.;.	A	1172;1168;273;224;895;1121;224	ENSP00000314038:V1172A;ENSP00000363108:V1168A;ENSP00000288520:V273A;ENSP00000339925:V224A;ENSP00000363098:V895A;ENSP00000354504:V1121A;ENSP00000355116:V224A	ENSP00000288520:V273A	V	-	2	0	ASTN2	118244636	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.150000	0.94667	2.061000	0.61500	0.533000	0.62120	GTG	-	ASTN2	-	superfamily_Fibronectin_type3		0.537	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		0	0	0	47	47	67	0.00	0.00	A	NM_014010		119204815	-1	10	8	82	67	tier1	no_errors	ENST00000313400	ensembl	human	known	74_37	missense	10.87	10.67	SNP	1.000	G	10	82
EPOR	2057	genome.wustl.edu	37	19	11489388	11489388	+	Silent	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:11489388G>A	ENST00000222139.6	-	7	998	c.894C>T	c.(892-894)acC>acT	p.T298T	EPOR_ENST00000592375.2_Silent_p.T298T	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	298					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CCTTGTGGGTGGTGAAGAGGC	0.537													ENSG00000187266																																					0													109.0	100.0	103.0					19																	11489388		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.894C>T	19.37:g.11489388G>A			B2RCG4|Q15443|Q2M205	Silent	SNP	pirsf_Erythropoietin_rcpt,pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T298	ENST00000222139.6	37	c.894	CCDS12260.1	19																																																																																			-	EPOR	-	pirsf_Erythropoietin_rcpt		0.537	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	0	0	1	52	52	98	0.00	1.01	G			11489388	-1	22	41	85	131	tier1	no_errors	ENST00000222139	ensembl	human	known	74_37	silent	20.56	23.84	SNP	1.000	A	22	85
PTGIR	5739	genome.wustl.edu	37	19	47124905	47124905	+	Missense_Mutation	SNP	C	C	T	rs200508770		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr19:47124905C>T	ENST00000291294.2	-	3	926	c.793G>A	c.(793-795)Gcc>Acc	p.A265T	PTGIR_ENST00000594275.1_Missense_Mutation_p.A22T|PTGIR_ENST00000597185.1_5'UTR|PTGIR_ENST00000598865.1_Missense_Mutation_p.A53T	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	265					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CTGTCAGGGGCGACAGCCTGG	0.642													ENSG00000160013																																					0													36.0	32.0	33.0					19																	47124905		2159	4229	6388	SO:0001583	missense	0			-		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.793G>A	19.37:g.47124905C>T	ENSP00000291294:p.Ala265Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt,prints_Prostanoid_rcpt,prints_Thbox_rcpt	p.A265T	ENST00000291294.2	37	c.793	CCDS12686.1	19	.	.	.	.	.	.	.	.	.	.	C	6.984	0.551608	0.13374	.	.	ENSG00000160013	ENST00000291294	T	0.72167	-0.63	4.39	-0.764	0.11027	GPCR, rhodopsin-like superfamily (1);	0.739442	0.12672	N	0.448680	T	0.41743	0.1172	N	0.12182	0.205	0.09310	N	1	B	0.16166	0.016	B	0.20184	0.028	T	0.22521	-1.0214	10	0.09590	T	0.72	-16.2589	2.6653	0.05046	0.349:0.3006:0.0:0.3504	.	265	P43119	PI2R_HUMAN	T	265	ENSP00000291294:A265T	ENSP00000291294:A265T	A	-	1	0	PTGIR	51816745	0.020000	0.18652	0.980000	0.43619	0.336000	0.28762	-0.688000	0.05150	0.066000	0.16515	-0.367000	0.07326	GCC	rs200508770	PTGIR	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt		0.642	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIR	HGNC	protein_coding	OTTHUMT00000466581.1	0	0	0	59	59	73	0.00	0.00	C			47124905	-1	13	10	93	86	tier1	no_errors	ENST00000291294	ensembl	human	known	74_37	missense	12.15	10.20	SNP	0.008	T	13	93
SOX30	11063	genome.wustl.edu	37	5	157065660	157065660	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr5:157065660C>A	ENST00000265007.6	-	4	1799	c.1458G>T	c.(1456-1458)caG>caT	p.Q486H	SOX30_ENST00000519442.1_Missense_Mutation_p.Q181H|SOX30_ENST00000311371.5_Intron	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	486					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGACGCTGGGCTGGAAAAGTG	0.527													ENSG00000039600																									Esophageal Squamous(31;525 799 19355 21125 41744)												0													60.0	61.0	61.0					5																	157065660		2203	4300	6503	SO:0001583	missense	0			-	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1458G>T	5.37:g.157065660C>A	ENSP00000265007:p.Gln486His		O94995|Q8IYX6	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Q486H	ENST00000265007.6	37	c.1458	CCDS4339.1	5	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404460	0.62288	.	.	ENSG00000039600	ENST00000265007;ENST00000519442	D;D	0.97959	-4.36;-4.63	5.49	3.46	0.39613	.	0.111699	0.40728	N	0.001040	D	0.96244	0.8775	N	0.24115	0.695	0.26855	N	0.968072	D;D	0.65815	0.976;0.995	P;P	0.62885	0.556;0.908	D	0.91147	0.4950	10	0.34782	T	0.22	.	9.1802	0.37136	0.0:0.7288:0.0:0.2712	.	181;486	B4DXW7;O94993	.;SOX30_HUMAN	H	486;181	ENSP00000265007:Q486H;ENSP00000427984:Q181H	ENSP00000265007:Q486H	Q	-	3	2	SOX30	156998238	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.265000	0.33027	1.329000	0.45376	-0.142000	0.14014	CAG	-	SOX30	-	NULL		0.527	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SOX30	HGNC	protein_coding	OTTHUMT00000252571.2	0	0	0	41	41	90	0.00	0.00	C	NM_007017		157065660	-1	18	12	86	99	tier1	no_errors	ENST00000265007	ensembl	human	known	74_37	missense	17.31	10.81	SNP	0.997	A	18	86
PGM5	5239	genome.wustl.edu	37	9	71080114	71080114	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr9:71080114C>A	ENST00000396396.1	+	7	1378	c.1149C>A	c.(1147-1149)agC>agA	p.S383R	PGM5_ENST00000396392.1_Missense_Mutation_p.S383R	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	383	Substrate binding. {ECO:0000250|UniProtKB:P00949}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						GGGAAGAGAGCTTTGGCACTG	0.478													ENSG00000154330																																					0													210.0	190.0	197.0					9																	71080114		2203	4300	6503	SO:0001583	missense	0			-	L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.1149C>A	9.37:g.71080114C>A	ENSP00000379678:p.Ser383Arg		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.S383R	ENST00000396396.1	37	c.1149	CCDS6622.2	9	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795843	0.70452	.	.	ENSG00000154330	ENST00000396396;ENST00000396392	T;T	0.68479	-0.33;-0.33	5.87	1.83	0.25207	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (1);	0.000000	0.85682	D	0.000000	D	0.87857	0.6283	H	0.99487	4.59	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.88725	0.3232	10	0.87932	D	0	.	10.2516	0.43372	0.0:0.6944:0.0:0.3056	.	383	Q15124	PGM5_HUMAN	R	383	ENSP00000379678:S383R;ENSP00000379674:S383R	ENSP00000379674:S383R	S	+	3	2	PGM5	70269934	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.201000	0.32259	0.438000	0.26450	0.655000	0.94253	AGC	-	PGM5	-	pfam_A-D-PHexomutase_a/b/a-III,superfamily_A-D-PHexomutase_a/b/a-I/II/III		0.478	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2	0	0	0	50	50	103	0.00	0.00	C	NM_021965		71080114	+1	22	41	37	67	tier1	no_errors	ENST00000396396	ensembl	human	known	74_37	missense	37.29	37.96	SNP	1.000	A	22	37
HDAC5	10014	genome.wustl.edu	37	17	42158226	42158226	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr17:42158226G>C	ENST00000393622.2	-	21	2963	c.2632C>G	c.(2632-2634)Cag>Gag	p.Q878E	HDAC5_ENST00000225983.6_Missense_Mutation_p.Q879E|HDAC5_ENST00000336057.5_Missense_Mutation_p.Q793E|HDAC5_ENST00000586802.1_Missense_Mutation_p.Q878E	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	878	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		AACGCCTGCTGGGTGCCATTG	0.542													ENSG00000108840																																					0													138.0	116.0	124.0					17																	42158226		2203	4300	6503	SO:0001583	missense	0			-	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.2632C>G	17.37:g.42158226G>C	ENSP00000377244:p.Gln878Glu		C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.Q879E	ENST00000393622.2	37	c.2635	CCDS45696.1	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778695	0.90195	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.69806	-0.43;-0.43;-0.43	4.63	4.63	0.57726	Histone deacetylase domain (2);	0.000000	0.64402	D	0.000001	T	0.77850	0.4192	M	0.66297	2.02	0.80722	D	1	P;P;D	0.54964	0.472;0.933;0.969	B;P;P	0.59889	0.115;0.664;0.865	T	0.80663	-0.1282	10	0.66056	D	0.02	-15.3658	16.4039	0.83651	0.0:0.0:1.0:0.0	.	793;879;878	Q9UQL6-2;Q9UQL6-3;Q9UQL6	.;.;HDAC5_HUMAN	E	879;878;793	ENSP00000225983:Q879E;ENSP00000377244:Q878E;ENSP00000337290:Q793E	ENSP00000225983:Q879E	Q	-	1	0	HDAC5	39513752	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.630000	0.98420	2.411000	0.81874	0.563000	0.77884	CAG	-	HDAC5	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse		0.542	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	HGNC	protein_coding	OTTHUMT00000457686.1	0	0	0	65	65	95	0.00	0.00	G	NM_001015053		42158226	-1	15	28	75	71	tier1	no_errors	ENST00000225983	ensembl	human	known	74_37	missense	16.67	28.28	SNP	1.000	C	15	75
GPR114	221188	genome.wustl.edu	37	16	57609003	57609003	+	Splice_Site	SNP	C	C	T	rs370635864		TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr16:57609003C>T	ENST00000340339.4	+	11	2008	c.1485C>T	c.(1483-1485)taC>taT	p.Y495Y	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Splice_Site_p.Y495Y	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	495					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						ACTCGCTCTACGGTAGGGCTG	0.597													ENSG00000159618	C|||	1	0.000199681	0.0	0.0	5008	,	,		18969	0.0		0.0	False		,,,				2504	0.001																0								C		0,4396		0,0,2198	68.0	60.0	63.0		1485	-3.3	1.0	16		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous-near-splice	GPR114	NM_153837.1		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		495/529	57609003	1,12995	2198	4300	6498	SO:0001630	splice_region_variant	0			-	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.1486+1C>T	16.37:g.57609003C>T			B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.Y495	ENST00000340339.4	37	c.1485	CCDS10785.1	16																																																																																			-	GPR114	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.597	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR114	HGNC	protein_coding	OTTHUMT00000257336.3	0	0	0	40	40	54	0.00	0.00	C	NM_153837	Silent	57609003	+1	8	11	28	40	tier1	no_errors	ENST00000340339	ensembl	human	known	74_37	silent	22.22	21.57	SNP	0.931	T	8	28
ZNF12	7559	genome.wustl.edu	37	7	6732294	6732294	+	Silent	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:6732294C>T	ENST00000405858.1	-	5	820	c.279G>A	c.(277-279)caG>caA	p.Q93Q	AC073343.2_ENST00000577401.1_RNA|AC073343.13_ENST00000366167.2_RNA|ZNF12_ENST00000342651.5_Silent_p.Q93Q|ZNF12_ENST00000404360.1_Silent_p.Q57Q	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	93					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		TTTCCTCTTCCTGGATTCTCT	0.348													ENSG00000164631																																					0													124.0	124.0	124.0					7																	6732294		1821	4087	5908	SO:0001819	synonymous_variant	0			-	X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.279G>A	7.37:g.6732294C>T			A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q93	ENST00000405858.1	37	c.279	CCDS47538.1	7																																																																																			-	ZNF12	-	NULL		0.348	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF12	HGNC	protein_coding	OTTHUMT00000324373.2	0	0	0	48	48	132	0.00	0.00	C	NM_016265		6732294	-1	8	22	78	122	tier1	no_errors	ENST00000405858	ensembl	human	known	74_37	silent	9.30	15.28	SNP	0.000	T	8	78
TP53	7157	genome.wustl.edu	37	17	7577074	7577075	+	Frame_Shift_Ins	INS	-	-	TTCTC			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-	-	TTCTC	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr17:7577074_7577075insTTCTC	ENST00000269305.4	-	8	1052_1053	c.863_864insGAGAA	c.(862-864)aatfs	p.N288fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Ins_p.N288fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.N288fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.N288fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.N288fs|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	288	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N288fs*13(17)|p.0?(8)|p.N288S(6)|p.E286fs*17(2)|p.?(2)|p.N288fs*18(2)|p.R283fs*16(2)|p.N288fs*17(1)|p.L265_K305del41(1)|p.N288fs*15(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.N288K(1)|p.E285fs*13(1)|p.N288fs*57(1)|p.E287fs*17(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTTGCGGAGATTCTCTTCCTC	0.569		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Deletion - Frameshift(27)|Whole gene deletion(8)|Substitution - Missense(7)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)	upper_aerodigestive_tract(22)|breast(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|liver(3)|large_intestine(2)|stomach(2)|central_nervous_system(2)|urinary_tract(2)|ovary(2)|biliary_tract(1)|lung(1)|oesophagus(1)|prostate(1)																																								SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.859_863dupGAGAA	17.37:g.7577075_7577079dupTTCTC	ENSP00000269305:p.Asn288fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N288fs	ENST00000269305.4	37	c.864_863	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_D-bd		0.569	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	121	121	121	0.00	0.00	-	NM_000546		7577075	-1	72	72	68	68	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_ins	51.43	51.43	INS	0.990:0.994	TTCTC	72	68
LINC00577	100113403	genome.wustl.edu	37	6	105388066	105388084	+	lincRNA	DEL	GTTCGGAATGATGTCCAGG	GTTCGGAATGATGTCCAGG	-	rs145567994	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	GTTCGGAATGATGTCCAGG	GTTCGGAATGATGTCCAGG	GTTCGGAATGATGTCCAGG	-	GTTCGGAATGATGTCCAGG	GTTCGGAATGATGTCCAGG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr6:105388066_105388084delGTTCGGAATGATGTCCAGG	ENST00000369123.3	-	0	154_172					NR_046407.1				long intergenic non-protein coding RNA 577																		GAATTGTGCTGTTCGGAATGATGTCCAGGGCATCTGTAG	0.429													ENSG00000203809																																					0																																												0				AW612153, BF223582		6q21	2012-10-12	2012-03-01	2012-03-01	ENSG00000203809	ENSG00000203809		"""Long non-coding RNAs"""	21553	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 220"""	C6orf220			Standard	NR_046407		Approved	dJ439I14.1	uc031spf.1		OTTHUMG00000015289		6.37:g.105388066_105388084delGTTCGGAATGATGTCCAGG				R	DEL	-	NULL	ENST00000369123.3	37	NULL		6																																																																																				LINC00577	-	-		0.429	LINC00577-001	KNOWN	basic	lincRNA	LINC00577	HGNC	lincRNA	OTTHUMT00000041645.2	0	0	0	99	99	99	0.00	0.00	GTTCGGAATGATGTCCAGG			105388084	-1	9	9	45	45	tier1	no_errors	ENST00000369123	ensembl	human	known	74_37	rna	16.67	16.67	DEL	0.000:0.000:0.000:0.000:0.005:0.004:0.004:0.005:0.001:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-	9	45
PIP5K1B	8395	genome.wustl.edu	37	9	71437582	71437583	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr9:71437582_71437583insA	ENST00000265382.3	+	4	357_358	c.52_53insA	c.(52-54)gaafs	p.E18fs	PIP5K1B_ENST00000541509.1_Frame_Shift_Ins_p.E18fs|RP11-203L2.4_ENST00000442103.1_RNA	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta	18					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		ACAAAATGAAGAAAAAACCTAT	0.386													ENSG00000107242																																					0																																										SO:0001589	frameshift_variant	0				U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.58dupA	9.37:g.71437588_71437588dupA	ENSP00000265382:p.Glu18fs		A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Frame_Shift_Ins	INS	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.T20fs	ENST00000265382.3	37	c.52_53	CCDS6624.1	9																																																																																				PIP5K1B	-	NULL		0.386	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP5K1B	HGNC	protein_coding	OTTHUMT00000052561.2	0	0	0	56	56	125	0.00	0.00	-	NM_003558		71437583	+1	27	28	51	70	tier1	no_errors	ENST00000478500	ensembl	human	known	74_37	frame_shift_ins	34.62	28.57	INS	1.000:1.000	A	27	51
SORD2P	653381	genome.wustl.edu	37	15	45123755	45123756	+	RNA	INS	-	-	C	rs11429544	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr15:45123755_45123756insC	ENST00000561384.2	-	0	871_872																											GGAGGCCTCTGCCCCGTGCACT	0.574													ENSG00000259479	CCCCC|CCCC|CCCCC|deletion	185	0.0369409	0.0756	0.0303	5008	,	,		16468	0.0407		0.002	False		,,,				2504	0.0215																0																																												0																																15.37:g.45123759_45123759dupC				R	INS	-	NULL	ENST00000561384.2	37	NULL		15																																																																																				CTD-2008A1.2	-	-		0.574	CTD-2008A1.2-002	PUTATIVE	basic	processed_transcript	ENSG00000259479	Clone_based_vega_gene	pseudogene	OTTHUMT00000416181.2	0	0	0	47	47	11	0.00	0.00	-			45123756	-1	5	2	29	9	tier1	no_errors	ENST00000561384	ensembl	human	putative	74_37	rna	14.71	18.18	INS	0.632:0.983	C	5	29
P2RY4	5030	genome.wustl.edu	37	X	69479428	69479428	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chrX:69479428G>T	ENST00000374519.2	-	1	226	c.47C>A	c.(46-48)cCa>cAa	p.P16Q		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	16					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						GCCAGGACCTGGGCTGAGGCC	0.582													ENSG00000186912	g|||	1	0.000264901	0.0	0.0	3775	,	,		15531	0.001		0.0	False		,,,				2504	0.0																0													27.0	24.0	25.0					X																	69479428		2203	4299	6502	SO:0001583	missense	0			-	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.47C>A	X.37:g.69479428G>T	ENSP00000363643:p.Pro16Gln		Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y4_rcpt,prints_GPCR_Rhodpsn,prints_P2Y2_rcpt	p.P16Q	ENST00000374519.2	37	c.47	CCDS14398.1	X	.	.	.	.	.	.	.	.	.	.	g	7.879	0.729757	0.15507	.	.	ENSG00000186912	ENST00000374519	T	0.71579	-0.58	3.71	2.81	0.32909	.	1.715750	0.03496	U	0.217294	T	0.53626	0.1808	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.08055	0.003	T	0.44982	-0.9292	10	0.51188	T	0.08	.	7.8855	0.29648	0.1005:0.0:0.7405:0.1591	.	16	P51582	P2RY4_HUMAN	Q	16	ENSP00000363643:P16Q	ENSP00000363643:P16Q	P	-	2	0	P2RY4	69396153	0.003000	0.15002	0.001000	0.08648	0.039000	0.13416	0.672000	0.25187	0.237000	0.21200	-1.355000	0.01225	CCA	-	P2RY4	-	prints_P2Y4_rcpt		0.582	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY4	HGNC	protein_coding	OTTHUMT00000057058.2	0	0	0	70	70	84	0.00	0.00	G	NM_002565		69479428	-1	12	18	124	170	tier1	no_errors	ENST00000374519	ensembl	human	known	74_37	missense	8.82	9.42	SNP	0.001	T	12	124
KIZ-AS1	101929591	genome.wustl.edu	37	20	21142511	21142511	+	RNA	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr20:21142511G>A	ENST00000591761.1	-	0	5142				RP5-872K7.7_ENST00000425746.2_RNA|PLK1S1_ENST00000457464.1_RNA																							TGGTGTTGCAGGTTGCAGTGC	0.408													ENSG00000088970																																					0													59.0	53.0	55.0					20																	21142511		1895	4105	6000			0			-																													20.37:g.21142511G>A				Splice_Site	SNP	-	NULL	ENST00000591761.1	37	c.NULL		20																																																																																			-	PLK1S1	-	-		0.408	RP4-777D9.2-002	KNOWN	basic	antisense	PLK1S1	HGNC	antisense	OTTHUMT00000078258.2	0	0	0	79	79	93	0.00	0.00	G			21142511	+1	11	8	77	72	tier1	no_errors	ENST00000246027	ensembl	human	known	74_37	splice_site	12.50	9.76	SNP	0.991	A	11	77
TPTE	7179	genome.wustl.edu	37	21	11020842	11020842	+	5'UTR	SNP	A	A	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr21:11020842A>T	ENST00000415664.2	-	0	416				BAGE2_ENST00000470054.1_RNA			P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GGATGGTAACACTGACCACAC	0.363													ENSG00000166157																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000415664.2:c.-2920T>A	21.37:g.11020842A>T			B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	R	SNP	-	NULL	ENST00000415664.2	37	NULL		21																																																																																			-	TPTE	-	-		0.363	TPTE-006	KNOWN	basic	processed_transcript	TPTE	HGNC	protein_coding	OTTHUMT00000340030.1	1	1	0	219	219	107	0.45	0.00	A			11020842	-1	22	7	245	88	tier1	no_errors	ENST00000415664	ensembl	human	known	74_37	rna	8.24	7.37	SNP	1.000	T	22	245
THSD7A	221981	genome.wustl.edu	37	7	11633081	11633081	+	Silent	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr7:11633081G>T	ENST00000423059.4	-	3	1322	c.1071C>A	c.(1069-1071)atC>atA	p.I357I		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	357					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ACTCTTTGGTGATCACACAGG	0.488										HNSCC(18;0.044)			ENSG00000005108																																					0													114.0	112.0	113.0					7																	11633081		1946	4141	6087	SO:0001819	synonymous_variant	0			-		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1071C>A	7.37:g.11633081G>T				Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.I357	ENST00000423059.4	37	c.1071	CCDS47543.1	7																																																																																			-	THSD7A	-	NULL		0.488	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	0	0	0	23	23	115	0.00	0.00	G	XM_928187.2		11633081	-1	8	11	38	114	tier1	no_errors	ENST00000423059	ensembl	human	known	74_37	silent	17.39	8.80	SNP	0.422	T	8	38
RHBG	57127	genome.wustl.edu	37	1	156354347	156354348	+	Frame_Shift_Ins	INS	-	-	C	rs71591938|rs11303415|rs587735548	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:156354347_156354348insC	ENST00000368249.1	+	9	1302_1303	c.1264_1265insC	c.(1264-1266)tccfs	p.S422fs	RHBG_ENST00000368246.2_Splice_Site|RHBG_ENST00000494874.1_Intron|RHBG_ENST00000255013.3_Frame_Shift_Ins_p.S353fs|RHBG_ENST00000400992.2_Frame_Shift_Ins_p.S390fs	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	422	Interaction with ANK3.				ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)	p.R425fs*>17(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CTTTCTGGACTCCCCCCCCAGA	0.634											OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000132677																																					1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0				AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.1272dupC	1.37:g.156354355_156354355dupC	ENSP00000357232:p.Ser422fs	1777	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Frame_Shift_Ins	INS	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.R393fs	ENST00000368249.1	37	c.1168_1169		1																																																																																				RHBG	-	superfamily_NH4_transpt_AmtB-like_dom		0.634	RHBG-001	NOVEL	basic	protein_coding	RHBG	HGNC	protein_coding	OTTHUMT00000060589.2	0	0	2	71	71	114	0.00	1.72	-	NM_001256395		156354348	+1	21	18	97	91	tier1	no_errors	ENST00000400992	ensembl	human	known	74_37	frame_shift_ins	17.80	16.51	INS	0.006:0.723	C	21	97
LPIN1	23175	genome.wustl.edu	37	2	11955338	11955338	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:11955338C>T	ENST00000256720.2	+	17	2359	c.2266C>T	c.(2266-2268)Ccc>Tcc	p.P756S	LPIN1_ENST00000449576.2_Missense_Mutation_p.P841S|LPIN1_ENST00000396099.1_Missense_Mutation_p.P798S|LPIN1_ENST00000425416.2_Missense_Mutation_p.P762S|LPIN1_ENST00000396097.1_Missense_Mutation_p.P486S|LPIN1_ENST00000404113.2_Missense_Mutation_p.P257S	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	756	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		GCTGCTGAGTCCCAGCAGCCT	0.637													ENSG00000134324																																					0													26.0	29.0	28.0					2																	11955338		2203	4300	6503	SO:0001583	missense	0			-	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.2266C>T	2.37:g.11955338C>T	ENSP00000256720:p.Pro756Ser		A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,superfamily_WD40_repeat_dom,smart_LNS2	p.P841S	ENST00000256720.2	37	c.2521	CCDS1682.1	2	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610375	0.66558	.	.	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113	D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	4.94	4.05	0.47172	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.051910	0.85682	D	0.000000	D	0.93180	0.7828	M	0.89163	3.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.97	D;D;D	0.97110	1.0;1.0;0.992	D	0.94287	0.7525	10	0.87932	D	0	-23.1896	15.2248	0.73342	0.0:0.8586:0.1414:0.0	.	257;841;756	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	S	841;798;762;756;486;257	ENSP00000397908:P841S;ENSP00000379406:P798S;ENSP00000401522:P762S;ENSP00000256720:P756S;ENSP00000379404:P486S;ENSP00000386120:P257S	ENSP00000256720:P756S	P	+	1	0	LPIN1	11872789	1.000000	0.71417	0.992000	0.48379	0.458000	0.32498	7.338000	0.79269	1.061000	0.40601	-0.310000	0.09108	CCC	-	LPIN1	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2		0.637	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN1	HGNC	protein_coding	OTTHUMT00000239296.3	0	0	0	33	33	9	0.00	0.00	C	NM_145693		11955338	+1	4	0	32	4	tier1	no_errors	ENST00000449576	ensembl	human	known	74_37	missense	11.11	0.00	SNP	1.000	T	4	32
SCN11A	11280	genome.wustl.edu	37	3	38948824	38948843	+	Intron	DEL	TGTGTGTGTGTATATATCTA	TGTGTGTGTGTATATATCTA	-	rs138466233|rs371006611|rs200809384|rs62242293	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	TGTGTGTGTGTATATATCTA	TGTGTGTGTGTATATATCTA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr3:38948824_38948843delTGTGTGTGTGTATATATCTA	ENST00000302328.3	-	10	1672				SCN11A_ENST00000456224.3_Intron|SCN11A_ENST00000444237.2_Intron|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000450244.1_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	tgtgtgtgtgtgtgtgtgtgtATATATCTATATATacaca	0.386													ENSG00000215941																																					0																																										SO:0001627	intron_variant	0				AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+596TAGATATATACACACACACA>-	3.37:g.38948824_38948843delTGTGTGTGTGTATATATCTA			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	R	DEL	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																				AC116038.1	-	-		0.386	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000109746.4	0	0	0	0	0	0	0.00	0.00	TGTGTGTGTGTATATATCTA	NM_014139		38948843	+1	0	0	0	0	tier1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.137:0.126:0.125:0.119:0.107:0.069:0.062:0.049:0.028:0.020:0.007:0.002:0.001:0.001:0.002:0.002:0.002:0.001:0.001:0.001	-	0	0
AK5	26289	genome.wustl.edu	37	1	77857160	77857161	+	Intron	INS	-	-	TGTGTA			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr1:77857160_77857161insTGTGTA	ENST00000354567.2	+	7	1154				AK5_ENST00000344720.5_Intron|AC095030.1_ENST00000408737.1_RNA	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						acacatatgtgtgtgtgtatgt	0.233													ENSG00000221664																																					0																																										SO:0001627	intron_variant	0				AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.892-19505->TGTGTA	1.37:g.77857160_77857161insTGTGTA			Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	R	INS	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																				AC095030.1	-	-		0.233	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221664	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000026993.4	0	0	0	0	0	0	0.00	0.00	-	NM_174858		77857161	-1	0	0	0	0	tier1	no_errors	ENST00000408737	ensembl	human	novel	74_37	rna	0.00	0.00	INS	0.993:0.992	TGTGTA	0	0
GALNT6	11226	genome.wustl.edu	37	12	51785401	51785402	+	5'Flank	INS	-	-	AGCCGC	rs143011477	byFrequency	TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr12:51785401_51785402insAGCCGC	ENST00000356317.3	-	0	0				GALNT6_ENST00000603203.1_5'UTR|SLC4A8_ENST00000535225.2_Intron	NM_007210.3	NP_009141.2	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGCCGAGGCAAAGCCGCAGCCG	0.757													ENSG00000139629		1258	0.251198	0.0234	0.245	5008	,	,		9662	0.2897		0.4155	False		,,,				2504	0.3548																0																																										SO:0001631	upstream_gene_variant	0				Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4			12.37:g.51785402_51785407dupAGCCGC	Exception_encountered		Q8IYH4|Q9H6G2|Q9UIV5	R	INS	-	NULL	ENST00000356317.3	37	NULL	CCDS8813.1	12																																																																																				GALNT6	-	-		0.757	GALNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT6	HGNC	protein_coding	OTTHUMT00000469736.1	0	0	0	0	0	0	0.00	0.00	-	NM_007210		51785402	-1	1	1	2	2	tier1	no_errors	ENST00000603203	ensembl	human	known	74_37	rna	33.33	33.33	INS	0.021:0.127	AGCCGC	1	2
GOLGA8I	283796	genome.wustl.edu	37	15	23259867	23259867	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr15:23259867G>T	ENST00000450802.3	+	8	635	c.537G>T	c.(535-537)gaG>gaT	p.E179D		NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	179						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											GTAAAGGAGAGTTAGAGAGTG	0.527													ENSG00000153666																																					0																																										SO:0001583	missense	0			-	AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.537G>T	15.37:g.23259867G>T	ENSP00000399637:p.Glu179Asp			Missense_Mutation	SNP	NULL	p.E179D	ENST00000450802.3	37	c.537		15	.	.	.	.	.	.	.	.	.	.	.	12.79	2.044941	0.36085	.	.	ENSG00000153666	ENST00000450802	T	0.20069	2.1	0.83	0.83	0.18854	.	.	.	.	.	T	0.39835	0.1093	.	.	.	.	.	.	D	0.89917	1.0	D	0.83275	0.996	T	0.50866	-0.8777	7	0.56958	D	0.05	.	7.6315	0.28243	0.0:0.0:1.0:0.0	.	98	Q8NA68	.	D	179	ENSP00000399637:E179D	ENSP00000399637:E179D	E	+	3	2	GOLGA8IP	20811308	0.989000	0.36119	0.011000	0.14972	0.365000	0.29674	-0.217000	0.09253	0.775000	0.33450	0.064000	0.15345	GAG	-	GOLGA8I	-	NULL		0.527	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8I	HGNC	protein_coding	OTTHUMT00000251213.2	0	0	0	111	111	0	0.00	0.00	G	NR_024074		23259867	+1	37	0	137	0	tier1	no_errors	ENST00000450802	ensembl	human	known	74_37	missense	21.26	0.00	SNP	0.696	T	37	137
RGPD3	653489	genome.wustl.edu	37	2	107069174	107069174	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z0-01A-13D-A36J-09	TCGA-DX-A6Z0-10B-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40a2fa11-0adf-4577-9f91-f6b4f9f2e6b8	784eea3d-4146-483c-baf7-ceb206185ee1	g.chr2:107069174G>A	ENST00000409886.3	-	5	701	c.614C>T	c.(613-615)tCg>tTg	p.S205L	RGPD3_ENST00000304514.7_Missense_Mutation_p.S205L	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	205					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TACAACACACGAATTCCACTC	0.428													ENSG00000153165																																					0													1.0	1.0	1.0					2																	107069174		105	218	323	SO:0001583	missense	0			-		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.614C>T	2.37:g.107069174G>A	ENSP00000386588:p.Ser205Leu		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.S205L	ENST00000409886.3	37	c.614	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	3.687	-0.064302	0.07273	.	.	ENSG00000153165	ENST00000409886;ENST00000304514;ENST00000440524	T;T	0.32753	1.44;1.44	2.69	1.75	0.24633	.	.	.	.	.	T	0.30479	0.0766	M	0.66939	2.045	0.21105	N	0.999783	B	0.09022	0.002	B	0.04013	0.001	T	0.28202	-1.0051	9	0.56958	D	0.05	-2.8542	7.9075	0.29771	0.1378:0.0:0.8622:0.0	.	205	A6NKT7	RGPD3_HUMAN	L	205;205;148	ENSP00000386588:S205L;ENSP00000303659:S205L	ENSP00000303659:S205L	S	-	2	0	RGPD3	106435606	0.948000	0.32251	0.996000	0.52242	0.210000	0.24377	1.390000	0.34464	0.416000	0.25844	0.186000	0.17326	TCG	-	RGPD3	-	NULL		0.428	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	0	0	0	27	27	0	0.00	0.00	G	XM_929931		107069174	-1	13	0	45	0	tier1	no_errors	ENST00000304514	ensembl	human	known	74_37	missense	22.41	0.00	SNP	0.946	A	13	45
