#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
NRXN1	9378	genome.wustl.edu	37	2	50850699	50850699	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr2:50850699A>C	ENST00000406316.2	-	6	2363	c.887T>G	c.(886-888)tTg>tGg	p.L296W	NRXN1_ENST00000404971.1_Missense_Mutation_p.L329W|NRXN1_ENST00000406859.3_Missense_Mutation_p.L296W|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000402717.3_Missense_Mutation_p.L296W|NRXN1_ENST00000401669.2_Missense_Mutation_p.L296W|NRXN1_ENST00000405472.3_Missense_Mutation_p.L296W	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	296	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GTTTTGAGACAAGTCGTAGCA	0.378													ENSG00000179915																																					0													131.0	121.0	124.0					2																	50850699		1872	4095	5967	SO:0001583	missense	0			-	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.887T>G	2.37:g.50850699A>C	ENSP00000384311:p.Leu296Trp		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.L296W	ENST00000406316.2	37	c.887	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	A	20.7	4.038970	0.75617	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.32;-1.47;-1.32;-1.47	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000001	D	0.89733	0.6800	M	0.81497	2.545	0.46260	D	0.998953	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90626	0.4563	10	0.56958	D	0.05	.	15.4704	0.75437	1.0:0.0:0.0:0.0	.	329;296	Q9ULB1-3;F8WB18	.;.	W	329;296;296;296;330;296;296	ENSP00000385142:L329W;ENSP00000384311:L296W;ENSP00000434015:L296W;ENSP00000385017:L296W;ENSP00000385434:L296W;ENSP00000385681:L296W	ENSP00000385017:L296W	L	-	2	0	NRXN1	50704203	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.139000	0.94554	2.240000	0.73641	0.528000	0.53228	TTG	-	NRXN1	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G		0.378	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	0	0	0	41	41	141	0.00	0.00	A			50850699	-1	14	13	42	79	tier1	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	25.00	14.13	SNP	1.000	C	14	42
HSF2BP	11077	genome.wustl.edu	37	21	44949799	44949799	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr21:44949799C>A	ENST00000291560.2	-	9	1171	c.840G>T	c.(838-840)caG>caT	p.Q280H	HSF2BP_ENST00000542962.1_Missense_Mutation_p.Q205H	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	280					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		GAACCACAGACTGGACAAGCC	0.488													ENSG00000160207																																					0													52.0	52.0	52.0					21																	44949799		2203	4300	6503	SO:0001583	missense	0			-	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.840G>T	21.37:g.44949799C>A	ENSP00000291560:p.Gln280His		B4DX36	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q280H	ENST00000291560.2	37	c.840	CCDS13697.1	21	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627740	0.66901	.	.	ENSG00000160207	ENST00000291560;ENST00000542962	T;T	0.68765	-0.35;0.81	5.57	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80423	0.4620	M	0.76328	2.33	0.58432	D	0.999994	D	0.76494	0.999	D	0.85130	0.997	T	0.82196	-0.0577	10	0.72032	D	0.01	-12.4764	13.5232	0.61580	0.0:0.9242:0.0:0.0758	.	280	O75031	HSF2B_HUMAN	H	280;205	ENSP00000291560:Q280H;ENSP00000443367:Q205H	ENSP00000291560:Q280H	Q	-	3	2	HSF2BP	43774227	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	1.412000	0.34714	2.633000	0.89246	0.563000	0.77884	CAG	-	HSF2BP	-	superfamily_ARM-type_fold		0.488	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	HGNC	protein_coding	OTTHUMT00000195620.1	0	0	0	53	53	102	0.00	0.00	C	NM_007031		44949799	-1	25	26	91	54	tier1	no_errors	ENST00000291560	ensembl	human	known	74_37	missense	21.55	32.50	SNP	1.000	A	25	91
ALPL	249	genome.wustl.edu	37	1	21890674	21890674	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr1:21890674G>A	ENST00000374840.3	+	6	863	c.613G>A	c.(613-615)Gcc>Acc	p.A205T	ALPL_ENST00000540617.1_Missense_Mutation_p.A150T|ALPL_ENST00000468526.1_3'UTR|ALPL_ENST00000374832.1_Missense_Mutation_p.A205T|ALPL_ENST00000425315.2_Missense_Mutation_p.A205T|ALPL_ENST00000539907.1_Missense_Mutation_p.A128T	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	205					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	TAAGGACATCGCCTACCAGCT	0.667													ENSG00000162551																																					0													82.0	74.0	76.0					1																	21890674		2203	4300	6503	SO:0001583	missense	0			-	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.613G>A	1.37:g.21890674G>A	ENSP00000363973:p.Ala205Thr		A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.A205T	ENST00000374840.3	37	c.613	CCDS217.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.688892	0.96784	.	.	ENSG00000162551	ENST00000539907;ENST00000540617;ENST00000374840;ENST00000374832;ENST00000425315	D;D;D;D;D	0.96940	-4.18;-4.18;-4.18;-4.18;-4.18	5.39	5.39	0.77823	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	M	0.85630	2.765	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.987	P;D;P	0.66716	0.681;0.946;0.539	D	0.98948	1.0793	10	0.72032	D	0.01	-28.8682	17.7009	0.88294	0.0:0.0:1.0:0.0	.	128;153;205	B7Z387;B7Z1D1;P05186	.;.;PPBT_HUMAN	T	128;150;205;205;205	ENSP00000437674:A128T;ENSP00000442672:A150T;ENSP00000363973:A205T;ENSP00000363965:A205T;ENSP00000394765:A205T	ENSP00000363965:A205T	A	+	1	0	ALPL	21763261	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.503000	0.81632	2.521000	0.84997	0.561000	0.74099	GCC	-	ALPL	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase		0.667	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALPL	HGNC	protein_coding	OTTHUMT00000008202.1	0	0	0	66	66	51	0.00	0.00	G	NM_000478		21890674	+1	22	10	69	36	tier1	no_errors	ENST00000374832	ensembl	human	known	74_37	missense	23.91	21.74	SNP	1.000	A	22	69
ANO6	196527	genome.wustl.edu	37	12	45741992	45741992	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr12:45741992A>G	ENST00000320560.8	+	5	729	c.527A>G	c.(526-528)aAg>aGg	p.K176R	ANO6_ENST00000441606.2_Missense_Mutation_p.K158R|ANO6_ENST00000423947.3_Missense_Mutation_p.K197R|ANO6_ENST00000425752.2_Missense_Mutation_p.K176R|ANO6_ENST00000435642.1_Missense_Mutation_p.K176R|ANO6_ENST00000426898.2_3'UTR	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	176					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AGCATCATCAAGCCAGAGCAA	0.433													ENSG00000177119																																					0													123.0	126.0	125.0					12																	45741992		2203	4300	6503	SO:0001583	missense	0			-	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.527A>G	12.37:g.45741992A>G	ENSP00000320087:p.Lys176Arg		A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	pfam_Anoctamin	p.K176R	ENST00000320560.8	37	c.527	CCDS31782.1	12	.	.	.	.	.	.	.	.	.	.	A	17.27	3.347702	0.61183	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.18	5.18	0.71444	.	0.247458	0.42294	D	0.000738	T	0.67040	0.2851	L	0.41632	1.29	0.42683	D	0.993553	B;B;D;B	0.54601	0.048;0.014;0.967;0.075	B;B;P;B	0.47864	0.015;0.009;0.559;0.019	T	0.64322	-0.6435	10	0.20046	T	0.44	.	15.749	0.77969	1.0:0.0:0.0:0.0	.	158;197;176;176	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	R	176;197;176;176;158	ENSP00000391417:K176R;ENSP00000409126:K197R;ENSP00000413840:K176R;ENSP00000320087:K176R;ENSP00000413137:K158R	ENSP00000320087:K176R	K	+	2	0	ANO6	44028259	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.173000	0.50839	2.261000	0.74972	0.533000	0.62120	AAG	-	ANO6	-	NULL		0.433	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANO6	HGNC	protein_coding	OTTHUMT00000404822.1	0	0	0	30	30	103	0.00	0.00	A	XM_113743		45741992	+1	22	29	34	43	tier1	no_errors	ENST00000425752	ensembl	human	known	74_37	missense	38.60	39.73	SNP	1.000	G	22	34
TGM7	116179	genome.wustl.edu	37	15	43585021	43585021	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr15:43585021C>T	ENST00000452443.2	-	3	329	c.325G>A	c.(325-327)Gcc>Acc	p.A109T		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	109					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	ACTGCATTGGCTGGTGTGAAA	0.488													ENSG00000159495																																					0													121.0	139.0	133.0					15																	43585021		2201	4299	6500	SO:0001583	missense	0			-	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.325G>A	15.37:g.43585021C>T	ENSP00000389466:p.Ala109Thr			Missense_Mutation	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.A109T	ENST00000452443.2	37	c.325	CCDS32213.1	15	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244165	0.39697	.	.	ENSG00000159495	ENST00000452443	D	0.88431	-2.38	5.32	2.33	0.28932	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.265888	0.36555	N	0.002534	D	0.90494	0.7022	M	0.73962	2.25	0.28398	N	0.918753	P	0.47253	0.892	P	0.53360	0.724	D	0.83639	0.0149	10	0.30078	T	0.28	-15.8396	10.4638	0.44596	0.1411:0.5865:0.2723:0.0	.	109	Q96PF1	TGM7_HUMAN	T	109	ENSP00000389466:A109T	ENSP00000389466:A109T	A	-	1	0	TGM7	41372313	0.839000	0.29477	0.810000	0.32431	0.003000	0.03518	1.326000	0.33735	0.306000	0.22856	-0.305000	0.09177	GCC	-	TGM7	-	pfam_Transglutaminase_N,superfamily_Ig_E-set		0.488	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	HGNC	protein_coding	OTTHUMT00000432489.1	0	0	0	58	58	85	0.00	0.00	C	NM_052955		43585021	-1	48	32	75	62	tier1	no_errors	ENST00000452443	ensembl	human	known	74_37	missense	39.02	34.04	SNP	0.912	T	48	75
DIAPH2	1730	genome.wustl.edu	37	X	96185820	96185820	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chrX:96185820C>G	ENST00000324765.8	+	10	1414	c.1067C>G	c.(1066-1068)tCa>tGa	p.S356*	DIAPH2_ENST00000355827.4_Nonsense_Mutation_p.S356*|DIAPH2_ENST00000373061.3_Nonsense_Mutation_p.S356*|DIAPH2_ENST00000373049.4_Nonsense_Mutation_p.S356*|DIAPH2_ENST00000373054.4_Nonsense_Mutation_p.S352*			O60879	DIAP2_HUMAN	diaphanous-related formin 2	356	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						TTCCTCCGTTCAGGACTAAAA	0.338													ENSG00000147202																																					0													75.0	67.0	70.0					X																	96185820		2203	4299	6502	SO:0001587	stop_gained	0			-	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.1067C>G	X.37:g.96185820C>G	ENSP00000321348:p.Ser356*		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Nonsense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.S356*	ENST00000324765.8	37	c.1067	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	C	41	8.964506	0.99019	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	.	.	.	4.91	4.02	0.46733	.	0.158745	0.40222	N	0.001155	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	13.6849	0.62511	0.0:0.4812:0.5188:0.0	.	.	.	.	X	356;352;356;356;356;363	.	ENSP00000321348:S356X	S	+	2	0	DIAPH2	96072476	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.327000	0.59247	0.955000	0.37878	0.591000	0.81541	TCA	-	DIAPH2	-	pfam_FH3_dom,superfamily_ARM-type_fold		0.338	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	0	0	0	65	65	101	0.00	0.00	C	NM_006729, NM_007309		96185820	+1	46	31	95	60	tier1	no_errors	ENST00000324765	ensembl	human	known	74_37	nonsense	32.62	34.07	SNP	1.000	G	46	95
ZFYVE9	9372	genome.wustl.edu	37	1	52704639	52704639	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr1:52704639C>T	ENST00000371591.1	+	3	1681	c.1550C>T	c.(1549-1551)tCa>tTa	p.S517L	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.S517L|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.S517L	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	517					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GAATGCTACTCAAATATTTAT	0.363													ENSG00000157077																																					0													48.0	50.0	49.0					1																	52704639		2203	4299	6502	SO:0001583	missense	0			-	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.1550C>T	1.37:g.52704639C>T	ENSP00000360647:p.Ser517Leu		Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	pfam_DUF3480,pfam_SARA_Smad-bd,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.S517L	ENST00000371591.1	37	c.1550	CCDS563.1	1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.878298	0.33162	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	T;T;T;T	0.56275	0.97;0.47;0.97;0.97	5.69	2.18	0.27775	.	0.410660	0.19877	N	0.104056	T	0.46151	0.1378	N	0.19112	0.55	0.23076	N	0.998334	P;B;D	0.56521	0.617;0.278;0.976	B;B;P	0.55785	0.242;0.057;0.784	T	0.21965	-1.0230	10	0.54805	T	0.06	.	7.7608	0.28951	0.0:0.5884:0.2361:0.1755	.	517;517;517	O95405-2;O95405;O95405-3	.;ZFYV9_HUMAN;.	L	517	ENSP00000349737:S517L;ENSP00000355358:S517L;ENSP00000287727:S517L;ENSP00000360647:S517L	ENSP00000287727:S517L	S	+	2	0	ZFYVE9	52477227	0.978000	0.34361	1.000000	0.80357	0.997000	0.91878	1.007000	0.29860	1.411000	0.46957	0.655000	0.94253	TCA	-	ZFYVE9	-	pirsf_Znf_FYVE_SARA/endofin		0.363	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE9	HGNC	protein_coding	OTTHUMT00000022083.1	0	0	0	26	26	75	0.00	0.00	C	NM_007324		52704639	+1	11	22	34	51	tier1	no_errors	ENST00000287727	ensembl	human	known	74_37	missense	24.44	29.73	SNP	0.979	T	11	34
CASD1	64921	genome.wustl.edu	37	7	94157518	94157518	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr7:94157518G>A	ENST00000297273.4	+	5	702	c.415G>A	c.(415-417)Gaa>Aaa	p.E139K		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	139						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GTGGCATCCTGAAGTTAATGG	0.289													ENSG00000127995																																					0													144.0	152.0	149.0					7																	94157518		2203	4300	6503	SO:0001583	missense	0			-	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.415G>A	7.37:g.94157518G>A	ENSP00000297273:p.Glu139Lys		B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	pfam_Cas1_AcylTrans_dom,superfamily_Cyclin-like	p.E139K	ENST00000297273.4	37	c.415	CCDS5636.1	7	.	.	.	.	.	.	.	.	.	.	G	28.7	4.945208	0.92593	.	.	ENSG00000127995	ENST00000447923;ENST00000297273	T;T	0.17370	2.28;2.28	4.83	4.83	0.62350	Cyclin-like (1);	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	M	0.68952	2.095	0.80722	D	1	D;D;D	0.69078	0.982;0.997;0.997	P;D;D	0.80764	0.877;0.992;0.994	T	0.28170	-1.0052	10	0.52906	T	0.07	.	18.3072	0.90187	0.0:0.0:1.0:0.0	.	139;139;139	Q8WZ77;Q96PB1;B2RAS9	.;CASD1_HUMAN;.	K	70;139	ENSP00000396261:E70K;ENSP00000297273:E139K	ENSP00000297273:E139K	E	+	1	0	CASD1	93995454	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.677000	0.91203	2.375000	0.81037	0.655000	0.94253	GAA	-	CASD1	-	superfamily_Cyclin-like		0.289	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASD1	HGNC	protein_coding	OTTHUMT00000255216.1	0	0	0	72	72	95	0.00	0.00	G	NM_022900		94157518	+1	61	33	97	63	tier1	no_errors	ENST00000297273	ensembl	human	known	74_37	missense	38.36	34.02	SNP	1.000	A	61	97
FMR1	2332	genome.wustl.edu	37	X	147018109	147018109	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chrX:147018109G>A	ENST00000370475.4	+	10	1095	c.967G>A	c.(967-969)Gag>Aag	p.E323K	FMR1_ENST00000370471.3_Missense_Mutation_p.E323K|FMR1_ENST00000370477.1_Missense_Mutation_p.E323K|FMR1_ENST00000218200.8_Missense_Mutation_p.E323K|FMR1_ENST00000440235.2_5'UTR|FMR1_ENST00000439526.2_Missense_Mutation_p.E321K|FMR1_ENST00000370470.1_Missense_Mutation_p.E323K	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	323					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					GGCTGAAAATGAGAAAAATGT	0.348									Fragile X syndrome				ENSG00000102081																																					0													136.0	126.0	129.0					X																	147018109		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	-	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.967G>A	X.37:g.147018109G>A	ENSP00000359506:p.Glu323Lys		A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,smart_KH_dom,pfscan_KH_dom_type_1	p.E323K	ENST00000370475.4	37	c.967	CCDS14682.1	X	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754960	0.89843	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000439526;ENST00000370470	T;T;T;T;T;T	0.63417	1.05;-0.04;1.09;-0.04;1.09;-0.04	5.53	5.53	0.82687	K Homology (1);K Homology, type 1 (1);	0.178539	0.64402	D	0.000016	T	0.67230	0.2871	L	0.41492	1.28	0.80722	D	1	B;P;P;P	0.39903	0.436;0.609;0.694;0.51	B;P;B;B	0.50378	0.307;0.639;0.189;0.142	T	0.67480	-0.5660	10	0.51188	T	0.08	-22.5075	17.6095	0.88048	0.0:0.0:1.0:0.0	.	323;239;323;321	Q06787;Q59GC1;Q06787-8;G3V0J0	FMR1_HUMAN;.;.;.	K	323;323;323;323;321;323	ENSP00000218200:E323K;ENSP00000359502:E323K;ENSP00000359508:E323K;ENSP00000359506:E323K;ENSP00000395923:E321K;ENSP00000359501:E323K	ENSP00000218200:E323K	E	+	1	0	FMR1	146825801	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.970000	0.88000	2.462000	0.83206	0.529000	0.55759	GAG	-	FMR1	-	smart_KH_dom,pfscan_KH_dom_type_1		0.348	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	HGNC	protein_coding	OTTHUMT00000058655.1	0	0	0	112	112	128	0.00	0.00	G	NM_002024		147018109	+1	60	29	127	80	tier1	no_errors	ENST00000370475	ensembl	human	known	74_37	missense	31.75	26.61	SNP	1.000	A	60	127
CNOT1	23019	genome.wustl.edu	37	16	58592426	58592426	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr16:58592426A>C	ENST00000317147.5	-	18	2615	c.2283T>G	c.(2281-2283)aaT>aaG	p.N761K	CNOT1_ENST00000569732.1_5'UTR|CNOT1_ENST00000441024.2_Missense_Mutation_p.N761K|SNORA50_ENST00000384225.2_RNA|CNOT1_ENST00000569240.1_Missense_Mutation_p.N761K	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	761					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAGTGGTCTGATTGGGGGTTG	0.473													ENSG00000125107																																					0													92.0	82.0	85.0					16																	58592426		2198	4300	6498	SO:0001583	missense	0			-	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2283T>G	16.37:g.58592426A>C	ENSP00000320949:p.Asn761Lys		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.N761K	ENST00000317147.5	37	c.2283	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	A	8.812	0.935425	0.18206	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.42900	0.99;0.96	5.38	4.29	0.51040	.	0.040211	0.85682	D	0.000000	T	0.39226	0.1070	N	0.22421	0.69	0.80722	D	1	D;D;D	0.61080	0.989;0.981;0.989	D;D;D	0.72982	0.979;0.932;0.969	T	0.48479	-0.9032	10	0.05959	T	0.93	.	5.9597	0.19293	0.634:0.0:0.366:0.0	.	761;761;761	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	K	761;190;761;761	ENSP00000320949:N761K;ENSP00000413113:N761K	ENSP00000320949:N761K	N	-	3	2	CNOT1	57149927	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	1.903000	0.39858	0.989000	0.38761	0.533000	0.62120	AAT	-	CNOT1	-	NULL		0.473	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	0	0	0	47	47	130	0.00	0.00	A	NM_016284		58592426	-1	37	30	76	63	tier1	no_errors	ENST00000317147	ensembl	human	known	74_37	missense	32.74	32.26	SNP	1.000	C	37	76
PTPRG	5793	genome.wustl.edu	37	3	62248555	62248555	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr3:62248555T>G	ENST00000474889.1	+	17	3019	c.2642T>G	c.(2641-2643)aTc>aGc	p.I881S	PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000475371.1_RNA|PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000462497.1_RNA|PTPRG_ENST00000295874.10_Missense_Mutation_p.I852S|PTPRG-AS1_ENST00000479018.1_RNA|PTPRG-AS1_ENST00000469148.1_RNA	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	881	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		AACAGATACATCAACATTTTA	0.393													ENSG00000144724																																					0													140.0	126.0	131.0					3																	62248555		2203	4300	6503	SO:0001583	missense	0			-	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.2642T>G	3.37:g.62248555T>G	ENSP00000418112:p.Ile881Ser		B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.I881S	ENST00000474889.1	37	c.2642	CCDS2895.1	3	.	.	.	.	.	.	.	.	.	.	T	16.68	3.189360	0.57909	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	D;D	0.81996	-1.56;-1.56	5.72	5.72	0.89469	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.79493	0.4455	N	0.05592	-0.015	0.80722	D	1	D;B;B	0.54964	0.969;0.149;0.424	P;B;B	0.55222	0.771;0.204;0.235	D	0.84467	0.0597	10	0.87932	D	0	.	16.2962	0.82776	0.0:0.0:0.0:1.0	.	127;852;881	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	S	881;852	ENSP00000418112:I881S;ENSP00000295874:I852S	ENSP00000295874:I852S	I	+	2	0	PTPRG	62223595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.304000	0.77564	0.528000	0.53228	ATC	-	PTPRG	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt		0.393	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRG	HGNC	protein_coding	OTTHUMT00000351674.1	0	0	0	32	32	131	0.00	0.00	T	NM_002841		62248555	+1	14	40	38	59	tier1	no_errors	ENST00000474889	ensembl	human	known	74_37	missense	26.92	40.40	SNP	1.000	G	14	38
MED12L	116931	genome.wustl.edu	37	3	150877791	150877791	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr3:150877791C>T	ENST00000474524.1	+	7	1048	c.1010C>T	c.(1009-1011)cCc>cTc	p.P337L	MED12L_ENST00000309237.4_Missense_Mutation_p.P337L|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000422248.2_Missense_Mutation_p.P337L	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	337						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCTGGCCCCCCCGGCCCTGGC	0.582													ENSG00000144893																																					0													82.0	94.0	90.0					3																	150877791		2203	4300	6503	SO:0001583	missense	0			-	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1010C>T	3.37:g.150877791C>T	ENSP00000417235:p.Pro337Leu		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.P337L	ENST00000474524.1	37	c.1010	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307815	0.81247	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524	T;T;T	0.33654	1.4;1.4;1.4	5.41	5.41	0.78517	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.068461	0.64402	D	0.000008	T	0.39655	0.1086	L	0.47716	1.5	0.80722	D	1	B;B;P	0.35575	0.042;0.034;0.51	B;B;B	0.38428	0.098;0.037;0.273	T	0.35847	-0.9772	10	0.87932	D	0	-18.0086	18.813	0.92065	0.0:1.0:0.0:0.0	.	337;337;337	Q86YW9;Q86YW9-2;Q86YW9-3	MD12L_HUMAN;.;.	L	337	ENSP00000403308:P337L;ENSP00000310760:P337L;ENSP00000417235:P337L	ENSP00000310760:P337L	P	+	2	0	MED12L	152360481	0.058000	0.20735	0.998000	0.56505	0.998000	0.95712	3.484000	0.53201	2.533000	0.85409	0.561000	0.74099	CCC	-	MED12L	-	pfam_Mediator_Med12_LCEWAV		0.582	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	0	0	0	27	27	41	0.00	0.00	C	NM_053002		150877791	+1	5	20	39	27	tier1	no_errors	ENST00000474524	ensembl	human	known	74_37	missense	11.36	42.55	SNP	0.993	T	5	39
OR7C1	26664	genome.wustl.edu	37	19	14910726	14910726	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr19:14910726A>T	ENST00000248073.2	-	1	297	c.223T>A	c.(223-225)Tcc>Acc	p.S75T	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	75					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						ACAGTCGTGGAGGTAAAACAG	0.443													ENSG00000127530																																					0													96.0	87.0	90.0					19																	14910726		2203	4300	6503	SO:0001583	missense	0			-	X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.223T>A	19.37:g.14910726A>T	ENSP00000248073:p.Ser75Thr		Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S75T	ENST00000248073.2	37	c.223	CCDS12317.1	19	.	.	.	.	.	.	.	.	.	.	a	6.137	0.393583	0.11638	.	.	ENSG00000127530	ENST00000248073	T	0.11821	2.74	3.64	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36740	U	0.002428	T	0.09113	0.0225	N	0.25201	0.72	0.25509	N	0.987472	P	0.35307	0.494	B	0.34138	0.176	T	0.23261	-1.0193	10	0.33940	T	0.23	.	10.5226	0.44929	1.0:0.0:0.0:0.0	.	75	O76099	OR7C1_HUMAN	T	75	ENSP00000248073:S75T	ENSP00000248073:S75T	S	-	1	0	OR7C1	14771726	0.000000	0.05858	0.477000	0.27303	0.003000	0.03518	-0.071000	0.11505	1.646000	0.50622	0.443000	0.29094	TCC	-	OR7C1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.443	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	0	0	0	59	59	68	0.00	0.00	A			14910726	-1	41	19	68	42	tier1	no_errors	ENST00000248073	ensembl	human	known	74_37	missense	37.61	31.15	SNP	0.876	T	41	68
PIGF	5281	genome.wustl.edu	37	2	46842277	46842277	+	Silent	SNP	T	T	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr2:46842277T>C	ENST00000281382.6	-	2	197	c.27A>G	c.(25-27)ctA>ctG	p.L9L	PIGF_ENST00000306465.4_Silent_p.L9L|PIGF_ENST00000495933.1_5'UTR|CRIPT_ENST00000238892.3_5'Flank	NM_002643.3	NP_002634.1	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class F	9					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)			breast(1)|endometrium(1)|lung(1)|stomach(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			GGGTATACAGTAGTCTCTTGA	0.338													ENSG00000151665																																					0													153.0	156.0	155.0					2																	46842277		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS1827.1, CCDS1828.1	2p21-p16	2013-02-26	2006-06-28		ENSG00000151665	ENSG00000151665		"""Phosphatidylinositol glycan anchor biosynthesis"""	8962	protein-coding gene	gene with protein product		600153	"""phosphatidylinositol glycan, class F"""			8575782, 8463218	Standard	NM_173074		Approved		uc002rvd.3	Q07326	OTTHUMG00000128816	ENST00000281382.6:c.27A>G	2.37:g.46842277T>C			Q8WW20	Silent	SNP	pfam_GPI_biosynthesis_protein_Pig-F	p.L9	ENST00000281382.6	37	c.27	CCDS1827.1	2																																																																																			-	PIGF	-	NULL		0.338	PIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGF	HGNC	protein_coding	OTTHUMT00000250749.2	0	0	0	47	47	74	0.00	0.00	T	NM_173074		46842277	-1	35	28	51	47	tier1	no_errors	ENST00000281382	ensembl	human	known	74_37	silent	40.70	37.33	SNP	0.236	C	35	51
CASC5	57082	genome.wustl.edu	37	15	40916633	40916633	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr15:40916633C>G	ENST00000346991.5	+	11	4639	c.4249C>G	c.(4249-4251)Ctg>Gtg	p.L1417V	CASC5_ENST00000399668.2_Missense_Mutation_p.L1391V			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1417					acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGATCAAGATCTGATTAAGGA	0.363													ENSG00000137812																																					0													93.0	88.0	90.0					15																	40916633		1864	4099	5963	SO:0001583	missense	0			-	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.4249C>G	15.37:g.40916633C>G	ENSP00000335463:p.Leu1417Val		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.L1417V	ENST00000346991.5	37	c.4249	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	C	2.011	-0.426988	0.04701	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.06294	3.32;3.32	5.12	2.08	0.27032	.	0.645972	0.12791	N	0.438893	T	0.03011	0.0089	N	0.14661	0.345	0.09310	N	1	B;B;B	0.33318	0.194;0.194;0.408	B;B;B	0.26864	0.045;0.045;0.074	T	0.44847	-0.9301	10	0.29301	T	0.29	.	3.746	0.08548	0.3541:0.4338:0.131:0.0811	.	1391;1417;1391	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	V	1417;1391;1391	ENSP00000335463:L1417V;ENSP00000382576:L1391V	ENSP00000260369:L1391V	L	+	1	2	CASC5	38703925	0.000000	0.05858	0.675000	0.29917	0.953000	0.61014	-0.147000	0.10234	0.229000	0.21039	0.603000	0.83216	CTG	-	CASC5	-	NULL		0.363	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	0	0	0	23	23	132	0.00	0.00	C	NM_144508		40916633	+1	14	27	46	57	tier1	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	23.33	32.14	SNP	0.007	G	14	46
NUP155	9631	genome.wustl.edu	37	5	37348686	37348686	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr5:37348686C>T	ENST00000231498.3	-	9	1119	c.916G>A	c.(916-918)Gga>Aga	p.G306R	NUP155_ENST00000381843.2_Missense_Mutation_p.G247R|NUP155_ENST00000513532.1_Missense_Mutation_p.G306R	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	306					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCATCTTGTCCCAAATCATAC	0.333													ENSG00000113569																																					0													123.0	111.0	115.0					5																	37348686		2203	4300	6503	SO:0001583	missense	0			-	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.916G>A	5.37:g.37348686C>T	ENSP00000231498:p.Gly306Arg		Q9UBE9|Q9UFL5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N,superfamily_WD40_repeat_dom	p.G306R	ENST00000231498.3	37	c.916	CCDS3921.1	5	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006277	0.93287	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.44482	0.92;0.92;0.92	5.84	5.84	0.93424	Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72550	0.3474	M	0.89353	3.025	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.76558	-0.2915	10	0.72032	D	0.01	-2.2182	20.1535	0.98095	0.0:1.0:0.0:0.0	.	306;306	E9PF10;O75694	.;NU155_HUMAN	R	306;247;268;306	ENSP00000231498:G306R;ENSP00000371265:G247R;ENSP00000422019:G306R	ENSP00000231498:G306R	G	-	1	0	NUP155	37384443	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.073000	0.76784	2.764000	0.94973	0.650000	0.86243	GGA	-	NUP155	-	pfam_Nucleoporin_Nup133/Nup155_N		0.333	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	HGNC	protein_coding	OTTHUMT00000207593.2	0	0	0	20	20	82	0.00	0.00	C	NM_153485, NM_004298		37348686	-1	18	33	29	47	tier1	no_errors	ENST00000231498	ensembl	human	known	74_37	missense	38.30	41.25	SNP	1.000	T	18	29
PCDHA6	56142	genome.wustl.edu	37	5	140208853	140208853	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr5:140208853G>A	ENST00000529310.1	+	1	1291	c.1177G>A	c.(1177-1179)Gtc>Atc	p.V393I	PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.V393I|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	393	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCCTCACGTCCCTTTCAA	0.552													ENSG00000081842																																					0													187.0	172.0	177.0					5																	140208853		2203	4300	6503	SO:0001583	missense	0			-	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1177G>A	5.37:g.140208853G>A	ENSP00000433378:p.Val393Ile		O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V393I	ENST00000529310.1	37	c.1177	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	G	0.189	-1.054897	0.01965	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.51071	0.72;0.72	3.7	2.82	0.32997	Cadherin (4);Cadherin-like (1);	0.244071	0.19921	U	0.103096	T	0.22936	0.0554	N	0.12443	0.215	0.09310	N	1	B;B;P	0.36944	0.099;0.069;0.574	B;B;B	0.26517	0.016;0.042;0.07	T	0.09058	-1.0692	10	0.44086	T	0.13	.	8.0773	0.30724	0.0914:0.1599:0.7487:0.0	.	393;393;393	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	I	393	ENSP00000433378:V393I;ENSP00000434113:V393I	ENSP00000434113:V393I	V	+	1	0	PCDHA6	140189037	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.220000	0.09215	0.882000	0.36016	0.313000	0.20887	GTC	-	PCDHA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.552	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	0	0	0	67	67	26	0.00	0.00	G	NM_018909		140208853	+1	44	11	67	13	tier1	no_errors	ENST00000529310	ensembl	human	known	74_37	missense	39.64	45.83	SNP	0.017	A	44	67
RUVBL2	10856	genome.wustl.edu	37	19	49513277	49513277	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr19:49513277G>C	ENST00000595090.1	+	8	1081	c.617G>C	c.(616-618)gGc>gCc	p.G206A	RUVBL2_ENST00000413176.2_Missense_Mutation_p.G161A|RUVBL2_ENST00000601968.1_Missense_Mutation_p.G161A	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	206					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		TCCAAGCTGGGCCGCTCCTTC	0.657													ENSG00000183207																																					0													59.0	61.0	61.0					19																	49513277		2035	4157	6192	SO:0001583	missense	0			-	AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.617G>C	19.37:g.49513277G>C	ENSP00000473172:p.Gly206Ala		B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Missense_Mutation	SNP	pfam_TIP49_C,pfam_ATPase_AAA_core,pfam_D_helicase_DnaB-like_C,superfamily_P-loop_NTPase,superfamily_-bd_OB-fold,smart_AAA+_ATPase,prints_D_repair_RadA	p.G206A	ENST00000595090.1	37	c.617	CCDS42588.1	19	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739523	0.89573	.	.	ENSG00000183207	ENST00000221413;ENST00000413176	T	0.73897	-0.79	4.2	4.2	0.49525	TIP49, C-terminal (1);Nucleic acid-binding, OB-fold-like (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.91469	0.7307	H	0.99026	4.405	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94481	0.7693	10	0.87932	D	0	-32.8075	14.4287	0.67233	0.0:0.0:1.0:0.0	.	206;206;172	B4DW30;Q9Y230;B3KNL2	.;RUVB2_HUMAN;.	A	206;161	ENSP00000413890:G161A	ENSP00000221413:G206A	G	+	2	0	RUVBL2	54205089	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.469000	0.90395	2.346000	0.79739	0.655000	0.94253	GGC	-	RUVBL2	-	pfam_TIP49_C,superfamily_P-loop_NTPase,superfamily_-bd_OB-fold,smart_AAA+_ATPase,prints_D_repair_RadA		0.657	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL2	HGNC	protein_coding	OTTHUMT00000466235.1	0	0	0	47	47	35	0.00	0.00	G			49513277	+1	18	24	15	14	tier1	no_errors	ENST00000595090	ensembl	human	known	74_37	missense	54.55	61.54	SNP	1.000	C	18	15
KCTD3	51133	genome.wustl.edu	37	1	215749265	215749265	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr1:215749265G>T	ENST00000259154.4	+	4	499	c.205G>T	c.(205-207)Gca>Tca	p.A69S		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	69	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TAGAGATCCAGCAGCATTTGC	0.264													ENSG00000136636																																					0													37.0	39.0	38.0					1																	215749265		2177	4269	6446	SO:0001583	missense	0			-	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.205G>T	1.37:g.215749265G>T	ENSP00000259154:p.Ala69Ser		A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.A69S	ENST00000259154.4	37	c.205	CCDS1515.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.17|14.17	2.456145|2.456145	0.43634|0.43634	.|.	.|.	ENSG00000136636|ENSG00000136636	ENST00000259154;ENST00000366945|ENST00000448333	T|.	0.75821|.	-0.97|.	5.6|5.6	4.69|4.69	0.59074|0.59074	BTB/POZ-like (2);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);|.	0.150335|.	0.64402|.	N|.	0.000015|.	T|T	0.38585|0.38585	0.1046|0.1046	N|N	0.13043|0.13043	0.29|0.29	0.36352|0.36352	D|D	0.860125|0.860125	B;B|.	0.13145|.	0.007;0.004|.	B;B|.	0.12156|.	0.005;0.007|.	T|T	0.38950|0.38950	-0.9637|-0.9637	10|5	0.38643|.	T|.	0.18|.	-25.4176|-25.4176	9.9319|9.9319	0.41528|0.41528	0.1523:0.0:0.8477:0.0|0.1523:0.0:0.8477:0.0	.|.	69;69|.	Q9Y597-2;Q9Y597|.	.;KCTD3_HUMAN|.	S|I	69|41	ENSP00000259154:A69S|.	ENSP00000259154:A69S|.	A|S	+|+	1|2	0|0	KCTD3|KCTD3	213815888|213815888	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.657000|3.657000	0.54474|0.54474	2.655000|2.655000	0.90218|0.90218	0.650000|0.650000	0.86243|0.86243	GCA|AGC	-	KCTD3	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.264	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	0	0	0	43	43	76	0.00	0.00	G	NM_016121		215749265	+1	34	22	62	59	tier1	no_errors	ENST00000259154	ensembl	human	known	74_37	missense	35.42	27.16	SNP	1.000	T	34	62
TP53	7157	genome.wustl.edu	37	17	7573976	7573976	+	Missense_Mutation	SNP	T	T	C	rs141402957		TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr17:7573976T>C	ENST00000269305.4	-	10	1240	c.1051A>G	c.(1051-1053)Aag>Gag	p.K351E	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.K351E|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	351	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K351E(2)|p.I332fs*5(1)|p.L350fs*28(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGCATCCTTGAGTTCCAAG	0.592		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	13	Whole gene deletion(8)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|skin(2)|large_intestine(1)|stomach(1)|urinary_tract(1)											60.0	46.0	51.0					17																	7573976		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1051A>G	17.37:g.7573976T>C	ENSP00000269305:p.Lys351Glu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K351E	ENST00000269305.4	37	c.1051	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	18.65	3.670342	0.67814	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.93133	-3.17;-3.17	5.43	4.35	0.52113	p53, tetramerisation domain (3);	0.488693	0.23008	N	0.052999	D	0.93723	0.7994	M	0.75447	2.3	0.32658	N	0.518472	P	0.38473	0.633	P	0.46389	0.515	D	0.94081	0.7344	10	0.49607	T	0.09	-24.255	9.4463	0.38699	0.0:0.0846:0.0:0.9154	.	351	P04637	P53_HUMAN	E	351;351;340	ENSP00000269305:K351E;ENSP00000391478:K351E	ENSP00000269305:K351E	K	-	1	0	TP53	7514701	0.982000	0.34865	0.862000	0.33874	0.967000	0.64934	0.993000	0.29680	0.900000	0.36469	0.459000	0.35465	AAG	rs141402957	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn		0.592	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	18	18	59	0.00	0.00	T	NM_000546		7573976	-1	17	15	10	11	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	62.96	57.69	SNP	0.959	C	17	10
TMPRSS11E	28983	genome.wustl.edu	37	4	69343294	69343294	+	Silent	SNP	T	T	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr4:69343294T>C	ENST00000305363.4	+	8	979	c.915T>C	c.(913-915)ttT>ttC	p.F305F		NM_014058.3	NP_054777.2	Q9UL52	TM11E_HUMAN	transmembrane protease, serine 11E	305	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cognition (GO:0050890)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|lung(19)|pancreas(1)|skin(3)	24						CCTATGAGTTTCAACCAGGTG	0.398													ENSG00000087128																																					0													259.0	248.0	252.0					4																	69343294		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF064819	CCDS33993.1	4q13.2	2010-04-13			ENSG00000087128	ENSG00000087128		"""Serine peptidases / Transmembrane"""	24465	protein-coding gene	gene with protein product		610399	"""transmembrane protease, serine 11E2"""	TMPRSS11E2		15328353	Standard	NM_014058		Approved	DESC1	uc003hdz.4	Q9UL52	OTTHUMG00000160438	ENST00000305363.4:c.915T>C	4.37:g.69343294T>C			A6NL71|Q14DC8|Q6UW31	Silent	SNP	pfam_Peptidase_S1,pfam_SEA_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_SEA_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.F305	ENST00000305363.4	37	c.915	CCDS33993.1	4																																																																																			-	TMPRSS11E	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_Peptidase_S1		0.398	TMPRSS11E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11E	HGNC	protein_coding	OTTHUMT00000360584.1	0	0	0	39	39	111	0.00	0.00	T	NM_014058		69343294	+1	34	36	85	83	tier1	no_errors	ENST00000305363	ensembl	human	known	74_37	silent	28.57	30.25	SNP	0.000	C	34	85
RASGRF1	5923	genome.wustl.edu	37	15	79324514	79324514	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr15:79324514T>A	ENST00000419573.3	-	7	1377	c.1103A>T	c.(1102-1104)gAc>gTc	p.D368V	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.D368V	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	368	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CTCCTCGCAGTCAGGCTTGGC	0.627													ENSG00000058335																																					0													174.0	104.0	128.0					15																	79324514		2196	4293	6489	SO:0001583	missense	0			-	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1103A>T	15.37:g.79324514T>A	ENSP00000405963:p.Asp368Val		F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.D368V	ENST00000419573.3	37	c.1103	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360178	0.82353	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.62788	0.0	4.62	4.62	0.57501	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.43478	0.1249	N	0.11427	0.14	0.80722	D	1	B;B;B;B	0.29341	0.073;0.242;0.242;0.082	B;B;B;B	0.33254	0.065;0.16;0.16;0.059	T	0.39722	-0.9600	10	0.29301	T	0.29	.	12.0336	0.53412	0.0:0.0:0.0:1.0	.	368;368;368;368	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	V	368	ENSP00000405963:D368V	ENSP00000378224:D368V	D	-	2	0	RASGRF1	77111569	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.981000	0.56902	1.945000	0.56424	0.402000	0.26972	GAC	-	RASGRF1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.627	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	0	0	0	37	37	57	0.00	0.00	T	NM_002891		79324514	-1	29	13	23	30	tier1	no_errors	ENST00000419573	ensembl	human	known	74_37	missense	55.77	30.23	SNP	1.000	A	29	23
CLIC4	25932	genome.wustl.edu	37	1	25167316	25167316	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr1:25167316T>C	ENST00000374379.4	+	6	847	c.650T>C	c.(649-651)aTc>aCc	p.I217T		NM_013943.2	NP_039234.1	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	217	GST C-terminal.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|endothelial cell morphogenesis (GO:0001886)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|keratinocyte differentiation (GO:0030216)|multicellular organism growth (GO:0035264)|negative regulation of cell migration (GO:0030336)|regulation of cytoskeleton organization (GO:0051493)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|vacuolar acidification (GO:0007035)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|microvillus (GO:0005902)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			large_intestine(3)|lung(2)|skin(1)	6		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		ATGACTGGCATCTGGAGATAC	0.388													ENSG00000169504																																					0													126.0	120.0	122.0					1																	25167316		2203	4300	6503	SO:0001583	missense	0			-	AF097330	CCDS256.1	1p	2012-09-26			ENSG00000169504	ENSG00000169504		"""Ion channels / Chloride channels : Intracellular"""	13518	protein-coding gene	gene with protein product		606536				9139710, 10070163	Standard	NM_013943		Approved	DKFZP566G223, CLIC4L, P64H1, H1, huH1, p64H1	uc001bjo.2	Q9Y696	OTTHUMG00000003327	ENST00000374379.4:c.650T>C	1.37:g.25167316T>C	ENSP00000363500:p.Ile217Thr		Q9UFW9|Q9UQJ6	Missense_Mutation	SNP	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.I217T	ENST00000374379.4	37	c.650	CCDS256.1	1	.	.	.	.	.	.	.	.	.	.	T	18.05	3.537519	0.65085	.	.	ENSG00000169504	ENST00000374379	D	0.94723	-3.5	5.86	5.86	0.93980	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.120421	0.64402	D	0.000004	D	0.94238	0.8150	M	0.80847	2.515	0.41164	D	0.986116	P;P	0.41159	0.615;0.74	B;B	0.37731	0.257;0.19	D	0.94746	0.7923	10	0.62326	D	0.03	-18.8529	16.2605	0.82541	0.0:0.0:0.0:1.0	.	197;217	B3KTR3;Q9Y696	.;CLIC4_HUMAN	T	217	ENSP00000363500:I217T	ENSP00000363500:I217T	I	+	2	0	CLIC4	25039903	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	8.040000	0.89188	2.237000	0.73441	0.460000	0.39030	ATC	-	CLIC4	-	superfamily_Glutathione-S-Trfase_C-like,tigrfam_Int_Cl_channel		0.388	CLIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIC4	HGNC	protein_coding	OTTHUMT00000009332.1	0	0	0	24	24	67	0.00	0.00	T	NM_013943		25167316	+1	18	20	27	40	tier1	no_errors	ENST00000374379	ensembl	human	known	74_37	missense	40.00	33.33	SNP	1.000	C	18	27
ULK4	54986	genome.wustl.edu	37	3	41723042	41723042	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr3:41723042C>A	ENST00000301831.4	-	29	3397	c.2935G>T	c.(2935-2937)Gac>Tac	p.D979Y		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	979					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		AGATTGCTGTCAGAATCAACA	0.478													ENSG00000168038																																					0													126.0	123.0	124.0					3																	41723042		1989	4154	6143	SO:0001583	missense	0			-	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2935G>T	3.37:g.41723042C>A	ENSP00000301831:p.Asp979Tyr		A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D979Y	ENST00000301831.4	37	c.2935	CCDS43071.1	3	.	.	.	.	.	.	.	.	.	.	c	14.10	2.433556	0.43224	.	.	ENSG00000168038	ENST00000301831	T	0.65364	-0.15	5.75	4.77	0.60923	Armadillo-type fold (1);	0.523011	0.16862	U	0.196497	T	0.41949	0.1181	L	0.29908	0.895	0.80722	D	1	P	0.43701	0.815	B	0.34722	0.188	T	0.48234	-0.9053	10	0.72032	D	0.01	.	3.7858	0.08700	0.0:0.6679:0.0:0.3321	.	979	Q96C45	ULK4_HUMAN	Y	979	ENSP00000301831:D979Y	ENSP00000301831:D979Y	D	-	1	0	ULK4	41698046	1.000000	0.71417	0.605000	0.28930	0.741000	0.42261	2.896000	0.48656	2.716000	0.92895	0.655000	0.94253	GAC	-	ULK4	-	superfamily_ARM-type_fold		0.478	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	0	0	1	36	36	102	0.00	0.97	C	XM_929989		41723042	-1	16	24	48	40	tier1	no_errors	ENST00000301831	ensembl	human	known	74_37	missense	25.00	37.50	SNP	0.997	A	16	48
LAMA2	3908	genome.wustl.edu	37	6	129618898	129618898	+	Silent	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr6:129618898G>A	ENST00000421865.2	+	21	2974	c.2925G>A	c.(2923-2925)aaG>aaA	p.K975K		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	975	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TTGGGTCTAAGTCATTCGACT	0.483													ENSG00000196569																																					0													99.0	89.0	92.0					6																	129618898		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2925G>A	6.37:g.129618898G>A			Q14736|Q5VUM2|Q93022	Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SRE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.K975	ENST00000421865.2	37	c.2925	CCDS5138.1	6																																																																																			-	LAMA2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin		0.483	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	0	0	0	27	27	79	0.00	0.00	G			129618898	+1	20	19	55	49	tier1	no_errors	ENST00000421865	ensembl	human	known	74_37	silent	26.67	27.54	SNP	0.963	A	20	55
RTF1	23168	genome.wustl.edu	37	15	41769421	41769421	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr15:41769421A>T	ENST00000389629.4	+	13	1631	c.1619A>T	c.(1618-1620)aAt>aTt	p.N540I		NM_015138.4	NP_055953.3	Q92541	RTF1_HUMAN	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	540					DNA-templated transcription, initiation (GO:0006352)|endodermal cell fate commitment (GO:0001711)|histone H3-K4 trimethylation (GO:0080182)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	18		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		GATCAACTGAATGAGCTGGAG	0.532													ENSG00000137815																																					0													125.0	131.0	129.0					15																	41769421		2203	4300	6503	SO:0001583	missense	0			-	D87440	CCDS32200.2	15q14	2004-03-03	2005-07-20	2005-07-20	ENSG00000137815	ENSG00000137815			28996	protein-coding gene	gene with protein product		611633	"""KIAA0252"""	KIAA0252		15632063	Standard	NM_015138		Approved		uc001zny.3	Q92541	OTTHUMG00000133744	ENST00000389629.4:c.1619A>T	15.37:g.41769421A>T	ENSP00000374280:p.Asn540Ile		Q96BX6	Missense_Mutation	SNP	pfam_Plus-3,smart_Plus3-dom_subgr	p.N540I	ENST00000389629.4	37	c.1619	CCDS32200.2	15	.	.	.	.	.	.	.	.	.	.	A	18.33	3.599854	0.66332	.	.	ENSG00000137815	ENST00000389629	.	.	.	5.42	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.52805	0.1757	L	0.44542	1.39	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.47674	-0.9099	9	0.38643	T	0.18	-25.9816	11.8087	0.52171	0.8685:0.0:0.0:0.1314	.	540	Q92541	RTF1_HUMAN	I	540	.	ENSP00000374280:N540I	N	+	2	0	RTF1	39556713	1.000000	0.71417	0.940000	0.37924	0.990000	0.78478	8.735000	0.91549	1.050000	0.40346	0.460000	0.39030	AAT	-	RTF1	-	NULL		0.532	RTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTF1	HGNC	protein_coding	OTTHUMT00000258111.1	0	0	0	28	28	75	0.00	0.00	A	NM_015138		41769421	+1	15	26	44	53	tier1	no_errors	ENST00000389629	ensembl	human	known	74_37	missense	25.00	32.91	SNP	1.000	T	15	44
ARSG	22901	genome.wustl.edu	37	17	66339909	66339909	+	Missense_Mutation	SNP	C	C	T	rs201030584		TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr17:66339909C>T	ENST00000448504.2	+	3	1179	c.383C>T	c.(382-384)gCg>gTg	p.A128V	ARSG_ENST00000452479.2_5'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	128					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.A128V(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTGCAGCAGGCGGGTTACGTC	0.562													ENSG00000141337																																					1	Substitution - Missense(1)	large_intestine(1)											67.0	48.0	55.0					17																	66339909		2203	4300	6503	SO:0001583	missense	0			-	AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.383C>T	17.37:g.66339909C>T	ENSP00000407193:p.Ala128Val		Q6UXF2|Q9Y2K4	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.A128V	ENST00000448504.2	37	c.383	CCDS11676.1	17	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061080	0.55432	.	.	ENSG00000141337	ENST00000452479	.	.	.	4.56	3.57	0.40892	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.282399	0.33364	N	0.004981	T	0.66005	0.2746	M	0.67517	2.055	0.58432	D	0.999992	D	0.61697	0.99	P	0.55087	0.768	T	0.65438	-0.6168	9	0.28530	T	0.3	.	14.195	0.65664	0.1503:0.8497:0.0:0.0	.	128	Q96EG1	ARSG_HUMAN	V	128	.	ENSP00000413953:A128V	A	+	2	0	ARSG	63851504	0.991000	0.36638	0.132000	0.22025	0.834000	0.47266	4.815000	0.62634	1.237000	0.43756	0.650000	0.86243	GCG	rs201030584	ARSG	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core		0.562	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSG	HGNC	protein_coding	OTTHUMT00000448369.1	0	0	0	27	27	78	0.00	0.00	C	NM_014960		66339909	+1	13	28	20	73	tier1	no_errors	ENST00000448504	ensembl	human	known	74_37	missense	39.39	27.72	SNP	0.266	T	13	20
LOC100128164	100128164	genome.wustl.edu	37	3	169663318	169663318	+	RNA	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr3:169663318G>A	ENST00000487580.1	-	0	263				RP11-379K17.4_ENST00000483289.2_RNA																							GTGACTACACGGTAGGTCCCA	0.483													ENSG00000239219																																					0																																												0			-																													3.37:g.169663318G>A				R	SNP	-	NULL	ENST00000487580.1	37	NULL		3																																																																																			-	RP11-379K17.4	-	-		0.483	RP11-379K17.4-003	KNOWN	basic|exp_conf	antisense	LOC100128164	Clone_based_vega_gene	antisense	OTTHUMT00000351957.1	0	0	0	9	9	56	0.00	0.00	G			169663318	-1	12	15	6	25	tier1	no_errors	ENST00000483289	ensembl	human	known	74_37	rna	66.67	37.50	SNP	0.005	A	12	6
SGMS1	259230	genome.wustl.edu	37	10	52066985	52066985	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr10:52066985G>C	ENST00000361781.2	-	11	2118	c.1159C>G	c.(1159-1161)Cga>Gga	p.R387G	SGMS1_ENST00000429490.1_Missense_Mutation_p.R218G	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	393					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)	p.R387*(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						TGGTAAGATCGAGGTACAATT	0.493													ENSG00000198964																																					1	Substitution - Nonsense(1)	large_intestine(1)											123.0	107.0	112.0					10																	52066985		2203	4300	6503	SO:0001583	missense	0			-	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.1159C>G	10.37:g.52066985G>C	ENSP00000354829:p.Arg387Gly		Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_P_Acid_Pase_2/haloperoxidase,pfscan_SAM	p.R387G	ENST00000361781.2	37	c.1159	CCDS7240.1	10	.	.	.	.	.	.	.	.	.	.	G	10.84	1.463748	0.26335	.	.	ENSG00000198964	ENST00000412547;ENST00000361781;ENST00000429490	T	0.46451	0.87	5.58	4.68	0.58851	.	0.065062	0.64402	D	0.000007	T	0.50820	0.1638	M	0.71036	2.16	0.80722	D	1	P;D	0.58268	0.87;0.982	B;P	0.55011	0.319;0.766	T	0.49224	-0.8962	10	0.21540	T	0.41	-9.5426	8.6492	0.34025	0.1716:0.0:0.8284:0.0	.	218;393	B4DJU2;Q86VZ5	.;SMS1_HUMAN	G	187;387;218	ENSP00000354829:R387G	ENSP00000354829:R387G	R	-	1	2	SGMS1	51736991	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.287000	0.72671	1.494000	0.48533	0.655000	0.94253	CGA	-	SGMS1	-	NULL		0.493	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SGMS1	HGNC	protein_coding	OTTHUMT00000048074.2	0	0	0	32	32	125	0.00	0.00	G	NM_147156		52066985	-1	25	31	27	36	tier1	no_errors	ENST00000361781	ensembl	human	known	74_37	missense	48.08	45.59	SNP	1.000	C	25	27
FUNDC1	139341	genome.wustl.edu	37	X	44397736	44397736	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chrX:44397736C>G	ENST00000378045.4	-	3	406	c.238G>C	c.(238-240)Ggt>Cgt	p.G80R	FUNDC1_ENST00000483115.1_5'UTR	NM_173794.3	NP_776155.1	Q8IVP5	FUND1_HUMAN	FUN14 domain containing 1	80					mitochondrion degradation (GO:0000422)|response to hypoxia (GO:0001666)	integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)				breast(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	6						AAGCCACCACCTACTGCAGTT	0.373													ENSG00000069509																																					0													112.0	95.0	101.0					X																	44397736		2203	4300	6503	SO:0001583	missense	0			-	BC042813	CCDS14263.1	Xp11.4	2005-09-22			ENSG00000069509	ENSG00000069509			28746	protein-coding gene	gene with protein product		300871				12477932	Standard	NM_173794		Approved	MGC51029	uc004dgc.3	Q8IVP5	OTTHUMG00000021399	ENST00000378045.4:c.238G>C	X.37:g.44397736C>G	ENSP00000367284:p.Gly80Arg			Missense_Mutation	SNP	pfam_FUN14	p.G80R	ENST00000378045.4	37	c.238	CCDS14263.1	X	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463475	0.84425	.	.	ENSG00000069509	ENST00000378045	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.86628	0.5978	H	0.94658	3.565	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	D	0.90821	0.4709	9	0.87932	D	0	-13.4024	17.8993	0.88898	0.0:1.0:0.0:0.0	.	80	Q8IVP5	FUND1_HUMAN	R	80	.	ENSP00000367284:G80R	G	-	1	0	FUNDC1	44282680	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.878000	0.75567	2.246000	0.74042	0.596000	0.82720	GGT	-	FUNDC1	-	pfam_FUN14		0.373	FUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUNDC1	HGNC	protein_coding	OTTHUMT00000056320.1	0	0	0	112	112	126	0.00	0.00	C	NM_173794		44397736	-1	49	25	108	57	tier1	no_errors	ENST00000378045	ensembl	human	known	74_37	missense	31.01	30.49	SNP	1.000	G	49	108
RUNX1T1	862	genome.wustl.edu	37	8	92998487	92998487	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr8:92998487G>C	ENST00000523629.1	-	9	1598	c.1144C>G	c.(1144-1146)Caa>Gaa	p.Q382E	RUNX1T1_ENST00000520724.1_Missense_Mutation_p.Q345E|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.Q382E|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.Q345E|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.Q355E|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.Q345E|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.Q393E|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.Q355E	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	382	Important for oligomerization.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TCTGCTTCTTGACACCGCCTT	0.488													ENSG00000079102																																					0													133.0	132.0	132.0					8																	92998487		2203	4300	6503	SO:0001583	missense	0			-	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1144C>G	8.37:g.92998487G>C	ENSP00000428543:p.Gln382Glu		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.Q393E	ENST00000523629.1	37	c.1177	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.263704	0.95399	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14	5.67	5.67	0.87782	NHR2-like (1);	0.000000	0.85682	D	0.000000	T	0.75946	0.3919	M	0.71581	2.175	0.80722	D	1	P;D;P	0.61697	0.944;0.99;0.93	P;D;P	0.67548	0.599;0.952;0.839	T	0.76782	-0.2832	10	0.62326	D	0.03	-17.5096	19.773	0.96379	0.0:0.0:1.0:0.0	.	393;382;355	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	E	382;355;382;345;345;345;393;355	ENSP00000428543:Q382E;ENSP00000379520:Q355E;ENSP00000265814:Q382E;ENSP00000353504:Q345E;ENSP00000390137:Q345E;ENSP00000428742:Q345E;ENSP00000402257:Q393E;ENSP00000430728:Q355E	ENSP00000265814:Q382E	Q	-	1	0	RUNX1T1	93067663	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.677000	0.91161	0.655000	0.94253	CAA	-	RUNX1T1	-	pfam_NHR2		0.488	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	0	0	0	35	35	53	0.00	0.00	G	NM_004349, NM_175635		92998487	-1	24	13	75	69	tier1	no_errors	ENST00000436581	ensembl	human	known	74_37	missense	24.24	15.85	SNP	1.000	C	24	75
RB1	5925	genome.wustl.edu	37	13	48941691	48941691	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr13:48941691G>T	ENST00000267163.4	+	10	1139	c.1001G>T	c.(1000-1002)aGa>aTa	p.R334I		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	334					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(7)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTAGATGCAAGATTATTTTTG	0.289		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	22	Whole gene deletion(15)|Unknown(7)	bone(11)|breast(5)|adrenal_gland(1)|eye(1)|soft_tissue(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)											71.0	85.0	80.0					13																	48941691		2193	4288	6481	SO:0001583	missense	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1001G>T	13.37:g.48941691G>T	ENSP00000267163:p.Arg334Ile		A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R334I	ENST00000267163.4	37	c.1001	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526119	0.85600	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.97209	-4.29	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.98046	0.9356	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.65684	0.937	D	0.98908	1.0779	10	0.72032	D	0.01	.	18.8309	0.92139	0.0:0.0:1.0:0.0	.	334	P06400	RB_HUMAN	I	313;334	ENSP00000267163:R334I	ENSP00000267163:R334I	R	+	2	0	RB1	47839692	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.100000	0.76989	2.521000	0.84997	0.591000	0.81541	AGA	-	RB1	-	NULL		0.289	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	26	26	51	0.00	0.00	G			48941691	+1	16	19	13	20	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	missense	55.17	48.72	SNP	1.000	T	16	13
THADA	63892	genome.wustl.edu	37	2	43520007	43520007	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr2:43520007G>A	ENST00000405006.4	-	32	5135	c.4784C>T	c.(4783-4785)gCc>gTc	p.A1595V	THADA_ENST00000405975.2_Missense_Mutation_p.A1595V|THADA_ENST00000415080.2_Missense_Mutation_p.A1276V|THADA_ENST00000330266.7_Intron	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1595										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TTCCTTCATGGCCAACAATAA	0.498													ENSG00000115970																																					0													52.0	51.0	52.0					2																	43520007		1974	4152	6126	SO:0001583	missense	0			-	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.4784C>T	2.37:g.43520007G>A	ENSP00000385995:p.Ala1595Val		A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	p.A1595V	ENST00000405006.4	37	c.4784	CCDS46268.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.82|13.82	2.349789|2.349789	0.41599|0.41599	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006|ENST00000407351	T;T;T|.	0.68903|.	-0.36;-0.36;-0.36|.	5.76|5.76	3.98|3.98	0.46160|0.46160	.|.	0.413822|.	0.25792|.	N|.	0.028273|.	T|T	0.30355|0.30355	0.0762|0.0762	N|N	0.19112|0.19112	0.55|0.55	0.30133|0.30133	N|N	0.804653|0.804653	P;B|.	0.36027|.	0.533;0.004|.	B;B|.	0.37833|.	0.259;0.006|.	T|T	0.23619|0.23619	-1.0183|-1.0183	10|5	0.16420|.	T|.	0.52|.	.|.	9.9259|9.9259	0.41492|0.41492	0.1587:0.0:0.8413:0.0|0.1587:0.0:0.8413:0.0	.|.	1522;1595|.	B6ZDQ0;Q6YHU6|.	.;THADA_HUMAN|.	V|S	1595;1522;1276;1595|835	ENSP00000386088:A1595V;ENSP00000416048:A1276V;ENSP00000385995:A1595V|.	ENSP00000349464:A1522V|.	A|P	-|-	2|1	0|0	THADA|THADA	43373511|43373511	0.991000|0.991000	0.36638|0.36638	0.515000|0.515000	0.27774|0.27774	0.799000|0.799000	0.45148|0.45148	2.289000|2.289000	0.43523|0.43523	0.803000|0.803000	0.34113|0.34113	0.650000|0.650000	0.86243|0.86243	GCC|CCA	-	THADA	-	superfamily_ARM-type_fold		0.498	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3	0	0	0	34	34	112	0.00	0.00	G	NM_022065		43520007	-1	34	38	59	61	tier1	no_errors	ENST00000405006	ensembl	human	known	74_37	missense	36.56	38.38	SNP	0.802	A	34	59
SGTB	54557	genome.wustl.edu	37	5	64976603	64976603	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr5:64976603C>A	ENST00000381007.4	-	7	733	c.498G>T	c.(496-498)ttG>ttT	p.L166F		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	166										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		CAAATTTATTCAAGGCAGTGA	0.358													ENSG00000197860																																					0													89.0	87.0	87.0					5																	64976603		2203	4300	6503	SO:0001583	missense	0			-	AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.498G>T	5.37:g.64976603C>A	ENSP00000370395:p.Leu166Phe			Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L166F	ENST00000381007.4	37	c.498	CCDS3988.1	5	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097535	0.76870	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	T;T	0.70986	-0.53;-0.53	5.31	4.41	0.53225	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.229885	0.50627	N	0.000104	T	0.80428	0.4621	M	0.88310	2.945	0.26816	N	0.968887	P	0.40909	0.732	P	0.47470	0.548	T	0.76438	-0.2959	10	0.87932	D	0	-17.9997	13.1153	0.59297	0.0:0.9195:0.0:0.0805	.	166	Q96EQ0	SGTB_HUMAN	F	166	ENSP00000370395:L166F;ENSP00000421447:L166F	ENSP00000370395:L166F	L	-	3	2	SGTB	65012359	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.761000	0.68801	1.182000	0.42928	0.557000	0.71058	TTG	-	SGTB	-	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.358	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGTB	HGNC	protein_coding	OTTHUMT00000215057.2	0	0	0	21	21	102	0.00	0.00	C	NM_019072		64976603	-1	21	19	37	43	tier1	no_errors	ENST00000381007	ensembl	human	known	74_37	missense	36.21	30.65	SNP	1.000	A	21	37
MAP9	79884	genome.wustl.edu	37	4	156273880	156273880	+	Splice_Site	SNP	C	C	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr4:156273880C>T	ENST00000311277.4	-	13	1952	c.1689G>A	c.(1687-1689)tgG>tgA	p.W563*	AC097467.2_ENST00000599555.2_RNA|AC097467.2_ENST00000609716.1_RNA|AC097467.2_ENST00000608544.1_RNA|AC097467.2_ENST00000609254.1_RNA|AC097467.2_ENST00000608092.1_RNA|AC097467.2_ENST00000595229.1_RNA|AC097467.2_ENST00000417474.1_RNA|AC097467.2_ENST00000593387.2_RNA|AC097467.2_ENST00000608762.1_RNA|MAP9_ENST00000515654.1_Splice_Site_p.W539*|AC097467.2_ENST00000597939.1_RNA|AC097467.2_ENST00000601977.1_RNA|AC097467.2_ENST00000608463.1_RNA|AC097467.2_ENST00000610249.1_RNA|AC097467.2_ENST00000608406.1_RNA|AC097467.2_ENST00000609486.1_RNA|AC097467.2_ENST00000598252.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	563					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TTTTTTCATTCCTATAGAGCA	0.279													ENSG00000164114																																					0													60.0	61.0	61.0					4																	156273880		2200	4291	6491	SO:0001630	splice_region_variant	0			-	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.1689-1G>A	4.37:g.156273880C>T			Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Nonsense_Mutation	SNP	NULL	p.W563*	ENST00000311277.4	37	c.1689	CCDS35493.1	4	.	.	.	.	.	.	.	.	.	.	C	38	7.154566	0.98099	.	.	ENSG00000164114	ENST00000311277;ENST00000515654	.	.	.	5.24	5.24	0.73138	.	0.353403	0.31624	N	0.007328	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6784	0.68998	0.0:1.0:0.0:0.0	.	.	.	.	X	563;539	.	ENSP00000310593:W563X	W	-	3	0	MAP9	156493330	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	2.242000	0.43106	2.586000	0.87340	0.650000	0.86243	TGG	-	MAP9	-	NULL		0.279	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP9	HGNC	protein_coding	OTTHUMT00000257771.3	0	0	0	19	19	23	0.00	0.00	C	NM_001039580	Nonsense_Mutation	156273880	-1	17	13	31	61	tier1	no_errors	ENST00000311277	ensembl	human	known	74_37	nonsense	35.42	17.57	SNP	1.000	T	17	31
SPRY3	10251	genome.wustl.edu	37	X	155003891	155003891	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chrX:155003891G>A	ENST00000302805.2	+	2	789	c.358G>A	c.(358-360)Ggg>Agg	p.G120R		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	120					multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACCTGGAGCAGGGGTCCACCC	0.562													ENSG00000168939																																					0													96.0	97.0	97.0					X																	155003891		2203	4296	6499	SO:0001583	missense	0			-	AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.358G>A	X.37:g.155003891G>A	ENSP00000302978:p.Gly120Arg		A8K0H8	Missense_Mutation	SNP	pfam_Sprouty	p.G120R	ENST00000302805.2	37	c.358	CCDS14769.4	X	.	.	.	.	.	.	.	.	.	.	G	8.982	0.975533	0.18736	.	.	ENSG00000168939	ENST00000302805	T	0.54071	0.59	3.05	3.05	0.35203	.	0.141221	0.47093	D	0.000252	T	0.60818	0.2298	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.51036	-0.8756	9	0.16896	T	0.51	-7.6868	11.2005	0.48739	0.0:0.0:1.0:0.0	.	120	O43610	SPY3_HUMAN	R	120	ENSP00000302978:G120R	ENSP00000302978:G120R	G	+	1	0	SPRY3	154657085	0.999000	0.42202	0.997000	0.53966	0.538000	0.34931	4.980000	0.63812	1.552000	0.49463	0.279000	0.19357	GGG	-	SPRY3	-	NULL		0.562	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY3	HGNC	protein_coding	OTTHUMT00000058823.2	0	0	0	57	57	83	0.00	0.00	G	NM_005840		155003891	+1	38	30	51	45	tier1	no_errors	ENST00000302805	ensembl	human	known	74_37	missense	42.70	40.00	SNP	0.387	A	38	51
OR5AP2	338675	genome.wustl.edu	37	11	56409135	56409135	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr11:56409135T>A	ENST00000302981.1	-	1	780	c.781A>T	c.(781-783)Atc>Ttc	p.I261F	OR5AP2_ENST00000544374.1_Missense_Mutation_p.I262F	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						ATGAAGAGGATTGTTCCAAAG	0.463													ENSG00000172464																																					0													115.0	99.0	105.0					11																	56409135		2201	4296	6497	SO:0001583	missense	0			-	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.781A>T	11.37:g.56409135T>A	ENSP00000303111:p.Ile261Phe		B2RNM8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I262F	ENST00000302981.1	37	c.784	CCDS31534.1	11	.	.	.	.	.	.	.	.	.	.	T	16.12	3.033749	0.54896	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.00188	8.59;8.59	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.130715	0.34676	N	0.003761	T	0.00412	0.0013	M	0.69823	2.125	0.09310	N	1	D	0.67145	0.996	D	0.66084	0.941	T	0.47711	-0.9096	10	0.72032	D	0.01	.	7.4617	0.27300	0.1402:0.0:0.146:0.7139	.	261	Q8NGF4	O5AP2_HUMAN	F	262;261	ENSP00000442701:I262F;ENSP00000303111:I261F	ENSP00000303111:I261F	I	-	1	0	OR5AP2	56165711	0.000000	0.05858	0.988000	0.46212	0.940000	0.58332	-0.776000	0.04674	2.090000	0.63153	0.519000	0.50382	ATC	-	OR5AP2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.463	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OR5AP2	HGNC	protein_coding	OTTHUMT00000391613.1	0	0	0	28	28	87	0.00	0.00	T	NM_001002925		56409135	-1	17	25	25	57	tier1	no_errors	ENST00000544374	ensembl	human	known	74_37	missense	40.48	30.12	SNP	0.019	A	17	25
TMEM132C	92293	genome.wustl.edu	37	12	129153983	129153983	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr12:129153983G>A	ENST00000435159.2	+	5	1327	c.1327G>A	c.(1327-1329)Gcc>Acc	p.A443T	TMEM132C_ENST00000315208.8_Missense_Mutation_p.A59T|AC107020.1_ENST00000408822.1_RNA	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	443						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						TCTGAACACCGCCGTACTCAC	0.493													ENSG00000181234																																					0													110.0	98.0	102.0					12																	129153983		692	1591	2283	SO:0001583	missense	0			-	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1327G>A	12.37:g.129153983G>A	ENSP00000410852:p.Ala443Thr		Q69YX8	Missense_Mutation	SNP	NULL	p.A443T	ENST00000435159.2	37	c.1327		12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072495	0.76415	.	.	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.32023	1.47;1.47	5.01	5.01	0.66863	.	0.000000	0.56097	D	0.000039	T	0.61776	0.2374	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69420	-0.5150	10	0.87932	D	0	.	17.9249	0.88980	0.0:0.0:1.0:0.0	.	443	Q8N3T6	T132C_HUMAN	T	443;59	ENSP00000410852:A443T;ENSP00000324458:A59T	ENSP00000324458:A59T	A	+	1	0	TMEM132C	127719936	1.000000	0.71417	0.484000	0.27391	0.160000	0.22226	8.859000	0.92264	2.311000	0.77944	0.655000	0.94253	GCC	-	TMEM132C	-	NULL		0.493	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		0	0	0	55	55	88	0.00	0.00	G	XM_044062		129153983	+1	26	36	46	73	tier1	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	36.11	33.03	SNP	1.000	A	26	46
PPFIA1	8500	genome.wustl.edu	37	11	70184503	70184503	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr11:70184503A>T	ENST00000253925.7	+	13	1730	c.1515A>T	c.(1513-1515)gaA>gaT	p.E505D	PPFIA1_ENST00000389547.3_Missense_Mutation_p.E505D|AP000487.6_ENST00000528607.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	505					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TAAACATTGAAGCACTGAGGG	0.408													ENSG00000131626																																					0													142.0	134.0	137.0					11																	70184503		2200	4294	6494	SO:0001583	missense	0			-	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.1515A>T	11.37:g.70184503A>T	ENSP00000253925:p.Glu505Asp		A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E505D	ENST00000253925.7	37	c.1515	CCDS31627.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.936|7.936	0.741828|0.741828	0.15642|0.15642	.|.	.|.	ENSG00000131626|ENSG00000131626	ENST00000253925;ENST00000389547|ENST00000530798	T;T|.	0.73363|.	-0.74;-0.74|.	4.45|4.45	1.92|1.92	0.25849|0.25849	.|.	0.066276|.	0.64402|.	U|.	0.000015|.	T|T	0.33469|0.33469	0.0864|0.0864	N|N	0.20574|0.20574	0.59|0.59	0.39213|0.39213	D|D	0.963358|0.963358	B;B|.	0.12013|.	0.005;0.004|.	B;B|.	0.18263|.	0.021;0.015|.	T|T	0.10847|0.10847	-1.0612|-1.0612	10|5	0.39692|.	T|.	0.17|.	.|.	2.5297|2.5297	0.04700|0.04700	0.5259:0.256:0.0862:0.1319|0.5259:0.256:0.0862:0.1319	.|.	505;505|.	Q13136;Q13136-2|.	LIPA1_HUMAN;.|.	D|C	505|57	ENSP00000253925:E505D;ENSP00000374198:E505D|.	ENSP00000253925:E505D|.	E|S	+|+	3|1	2|0	PPFIA1|PPFIA1	69862151|69862151	0.991000|0.991000	0.36638|0.36638	0.518000|0.518000	0.27811|0.27811	0.067000|0.067000	0.16453|0.16453	0.653000|0.653000	0.24902|0.24902	0.698000|0.698000	0.31739|0.31739	0.533000|0.533000	0.62120|0.62120	GAA|AGC	-	PPFIA1	-	NULL		0.408	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	HGNC	protein_coding	OTTHUMT00000393905.1	0	0	0	27	27	69	0.00	0.00	A	NM_003626		70184503	+1	24	21	25	46	tier1	no_errors	ENST00000253925	ensembl	human	known	74_37	missense	48.98	31.34	SNP	0.714	T	24	25
PTCHD4	442213	genome.wustl.edu	37	6	47846497	47846497	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr6:47846497T>C	ENST00000339488.4	-	3	2116	c.2083A>G	c.(2083-2085)Att>Gtt	p.I695V		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	695						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										CCCAGCTCAATTGAGGTGACG	0.448													ENSG00000244694																																					0													89.0	86.0	87.0					6																	47846497		2203	4300	6503	SO:0001583	missense	0			-		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2083A>G	6.37:g.47846497T>C	ENSP00000341914:p.Ile695Val		B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.I695V	ENST00000339488.4	37	c.2083	CCDS34473.2	6	.	.	.	.	.	.	.	.	.	.	T	0.758	-0.770348	0.02974	.	.	ENSG00000244694	ENST00000339488	D	0.88818	-2.43	5.91	5.91	0.95273	.	0.056242	0.64402	D	0.000002	T	0.74627	0.3741	N	0.17278	0.47	0.80722	D	1	B	0.14012	0.009	B	0.25405	0.06	T	0.71163	-0.4673	10	0.32370	T	0.25	.	16.35	0.83199	0.0:0.0:0.0:1.0	.	695	Q6ZW05	CF138_HUMAN	V	695	ENSP00000341914:I695V	ENSP00000341914:I695V	I	-	1	0	C6orf138	47954456	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.533000	0.60615	2.270000	0.75569	0.528000	0.53228	ATT	-	PTCHD4	-	pfam_Patched		0.448	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	0	0	0	27	27	68	0.00	0.00	T	NM_001013732		47846497	-1	10	30	9	12	tier1	no_errors	ENST00000339488	ensembl	human	known	74_37	missense	52.63	71.43	SNP	1.000	C	10	9
PLA2G5	5322	genome.wustl.edu	37	1	20416375	20416375	+	Silent	SNP	C	C	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr1:20416375C>T	ENST00000375108.3	+	4	547	c.279C>T	c.(277-279)ggC>ggT	p.G93G	PLA2G5_ENST00000486277.1_3'UTR	NM_000929.2	NP_000920.1	P39877	PA2G5_HUMAN	phospholipase A2, group V	93					arachidonic acid secretion (GO:0050482)|glycerophospholipid biosynthetic process (GO:0046474)|leukotriene biosynthetic process (GO:0019370)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|heparin binding (GO:0008201)	p.G93G(2)		NS(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		TCGCGTGGGGCGTGGTCACCT	0.582													ENSG00000127472																																					2	Substitution - coding silent(2)	lung(2)											95.0	78.0	84.0					1																	20416375		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U03090	CCDS202.1	1p36-p34	2008-09-19			ENSG00000127472	ENSG00000127472	3.1.1.4		9038	protein-coding gene	gene with protein product		601192				8838795, 8300559	Standard	NM_000929		Approved		uc001bcy.3	P39877	OTTHUMG00000002698	ENST00000375108.3:c.279C>T	1.37:g.20416375C>T			Q8N435	Silent	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.G93	ENST00000375108.3	37	c.279	CCDS202.1	1																																																																																			-	PLA2G5	-	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2		0.582	PLA2G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G5	HGNC	protein_coding	OTTHUMT00000007668.1	0	0	0	35	35	80	0.00	0.00	C	NM_000929		20416375	+1	20	24	50	41	tier1	no_errors	ENST00000375108	ensembl	human	known	74_37	silent	28.57	36.92	SNP	0.390	T	20	50
ZCCHC8	55596	genome.wustl.edu	37	12	122966188	122966188	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr12:122966188C>G	ENST00000336229.4	-	10	1029	c.899G>C	c.(898-900)gGt>gCt	p.G300A	ZCCHC8_ENST00000536306.1_Missense_Mutation_p.G62A|ZCCHC8_ENST00000543897.1_Missense_Mutation_p.G62A	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	300					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		GTCTGTCACACCTAGTGCATC	0.408													ENSG00000033030																																					0													69.0	67.0	67.0					12																	122966188		1832	4082	5914	SO:0001583	missense	0			-	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.899G>C	12.37:g.122966188C>G	ENSP00000337313:p.Gly300Ala		Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	pfam_PSP,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_PSP,pfscan_Znf_CCHC	p.G300A	ENST00000336229.4	37	c.899		12	.	.	.	.	.	.	.	.	.	.	C	31	5.070779	0.93950	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000544054;ENST00000536663	T;T;T	0.70164	-0.24;-0.24;-0.46	5.47	5.47	0.80525	PSP, proline-rich (2);	0.000000	0.85682	D	0.000000	D	0.86306	0.5901	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88920	0.3365	10	0.72032	D	0.01	-18.3053	19.3314	0.94291	0.0:1.0:0.0:0.0	.	300	Q6NZY4	ZCHC8_HUMAN	A	62;62;300;62;62	ENSP00000441423:G62A;ENSP00000438993:G62A;ENSP00000337313:G300A	ENSP00000337313:G300A	G	-	2	0	ZCCHC8	121532141	1.000000	0.71417	0.994000	0.49952	0.901000	0.52897	5.475000	0.66787	2.573000	0.86826	0.455000	0.32223	GGT	-	ZCCHC8	-	pfam_PSP,smart_PSP		0.408	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	ZCCHC8	HGNC	protein_coding		0	0	1	34	34	69	0.00	1.43	C	NM_017612		122966188	-1	24	27	45	48	tier1	no_errors	ENST00000336229	ensembl	human	known	74_37	missense	34.29	36.00	SNP	1.000	G	24	45
FAM214B	80256	genome.wustl.edu	37	9	35108025	35108025	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr9:35108025G>T	ENST00000378561.1	-	2	3302	c.247C>A	c.(247-249)Cct>Act	p.P83T	FAM214B_ENST00000605392.1_5'Flank|FAM214B_ENST00000322813.5_Missense_Mutation_p.P83T|FAM214B_ENST00000603301.1_Missense_Mutation_p.P83T|FAM214B_ENST00000378566.1_Intron|FAM214B_ENST00000378557.1_Missense_Mutation_p.P83T|FAM214B_ENST00000378554.2_Missense_Mutation_p.P83T|FAM214B_ENST00000488109.2_Missense_Mutation_p.P83T|FAM214B_ENST00000605244.1_Missense_Mutation_p.P83T			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	83						nucleus (GO:0005634)											CCCAGCCCAGGGCCTCTCTTC	0.637													ENSG00000005238																																					0													35.0	36.0	36.0					9																	35108025		2203	4297	6500	SO:0001583	missense	0			-	AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.247C>A	9.37:g.35108025G>T	ENSP00000367823:p.Pro83Thr		B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	NULL	p.P83T	ENST00000378561.1	37	c.247	CCDS6578.1	9	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861812	0.51482	.	.	ENSG00000005238	ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	4.71	4.71	0.59529	.	0.179123	0.39834	N	0.001248	T	0.55721	0.1938	L	0.58101	1.795	0.27600	N	0.949002	D	0.89917	1.0	D	0.83275	0.996	T	0.51505	-0.8697	9	0.72032	D	0.01	-3.1149	7.2757	0.26283	0.0934:0.2307:0.6759:0.0	.	83	Q7L5A3	K1539_HUMAN	T	83	.	ENSP00000319897:P83T	P	-	1	0	KIAA1539	35098025	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.862000	0.56009	2.455000	0.83008	0.555000	0.69702	CCT	-	FAM214B	-	NULL		0.637	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214B	HGNC	protein_coding	OTTHUMT00000052261.1	0	0	0	97	97	41	0.00	0.00	G	NM_025182		35108025	-1	60	18	128	35	tier1	no_errors	ENST00000322813	ensembl	human	known	74_37	missense	31.75	33.96	SNP	1.000	T	60	128
PKP4	8502	genome.wustl.edu	37	2	159533343	159533343	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr2:159533343A>T	ENST00000389759.3	+	20	3332	c.3220A>T	c.(3220-3222)Agc>Tgc	p.S1074C	PKP4_ENST00000389757.3_Intron|AC005042.4_ENST00000442666.1_RNA|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	1074					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GTATTACAATAGCCAAGGGGA	0.532										HNSCC(62;0.18)			ENSG00000144283																																					0													113.0	104.0	107.0					2																	159533343		2203	4300	6503	SO:0001583	missense	0			-	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.3220A>T	2.37:g.159533343A>T	ENSP00000374409:p.Ser1074Cys		Q86W91	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.S1074C	ENST00000389759.3	37	c.3220	CCDS33305.1	2	.	.	.	.	.	.	.	.	.	.	A	18.07	3.541094	0.65085	.	.	ENSG00000144283	ENST00000389759	T	0.75050	-0.9	6.17	6.17	0.99709	.	0.239148	0.50627	D	0.000107	T	0.66528	0.2798	N	0.22421	0.69	0.41020	D	0.985078	P;P	0.39624	0.681;0.681	B;B	0.39971	0.221;0.315	T	0.70978	-0.4725	10	0.62326	D	0.03	-15.7282	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1029;1074	Q4W5T8;Q99569	.;PKP4_HUMAN	C	1074	ENSP00000374409:S1074C	ENSP00000374409:S1074C	S	+	1	0	PKP4	159241589	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.650000	0.74368	2.371000	0.80710	0.533000	0.62120	AGC	-	PKP4	-	NULL		0.532	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	0	0	1	62	62	101	0.00	0.98	A			159533343	+1	57	38	91	82	tier1	no_errors	ENST00000389759	ensembl	human	known	74_37	missense	38.51	31.67	SNP	1.000	T	57	91
ABCB11	8647	genome.wustl.edu	37	2	169826677	169826677	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr2:169826677G>A	ENST00000263817.6	-	15	1811	c.1687C>T	c.(1687-1689)Cag>Tag	p.Q563*		NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11	563	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CTTTGTTTCTGGCCACCACTC	0.498													ENSG00000073734																																					0													119.0	117.0	117.0					2																	169826677		1991	4199	6190	SO:0001587	stop_gained	0			-	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.1687C>T	2.37:g.169826677G>A	ENSP00000263817:p.Gln563*		Q53TL2|Q9UNB2	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.Q563*	ENST00000263817.6	37	c.1687	CCDS46444.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.339420	0.98767	.	.	ENSG00000073734	ENST00000263817	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9291	0.92558	0.0:0.0:1.0:0.0	.	.	.	.	X	563	.	ENSP00000263817:Q563X	Q	-	1	0	ABCB11	169534923	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.869000	0.99810	2.461000	0.83175	0.655000	0.94253	CAG	-	ABCB11	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.498	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB11	HGNC	protein_coding	OTTHUMT00000333616.2	0	0	0	39	39	92	0.00	0.00	G	NM_003742		169826677	-1	15	17	65	70	tier1	no_errors	ENST00000263817	ensembl	human	known	74_37	nonsense	18.75	19.32	SNP	1.000	A	15	65
PCLO	27445	genome.wustl.edu	37	7	82545961	82545961	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr7:82545961G>A	ENST00000333891.9	-	7	11678	c.11341C>T	c.(11341-11343)Cga>Tga	p.R3781*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.R3781*|PCLO_ENST00000437081.1_Nonsense_Mutation_p.R501*	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.R3781*(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGTTTCTTTCGAAGTTTTGCA	0.443													ENSG00000186472																																					2	Substitution - Nonsense(2)	cervix(2)											126.0	113.0	117.0					7																	82545961		1904	4134	6038	SO:0001587	stop_gained	0			-	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11341C>T	7.37:g.82545961G>A	ENSP00000334319:p.Arg3781*			Nonsense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.R3781*	ENST00000333891.9	37	c.11341	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324827	0.81580	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	.	.	.	6.04	0.584	0.17422	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.497	0.87720	0.0:0.0:0.6521:0.3479	.	.	.	.	X	3781;3781;501	.	ENSP00000334319:R3781X	R	-	1	2	PCLO	82383897	0.976000	0.34144	0.808000	0.32385	0.966000	0.64601	1.593000	0.36686	0.140000	0.18849	-0.375000	0.07067	CGA	-	PCLO	-	NULL		0.443	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	0	0	0	21	21	110	0.00	0.00	G	NM_014510		82545961	-1	18	27	28	70	tier1	no_errors	ENST00000333891	ensembl	human	known	74_37	nonsense	39.13	27.84	SNP	0.768	A	18	28
RNASE12	493901	genome.wustl.edu	37	14	21058865	21058865	+	Silent	SNP	T	T	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr14:21058865T>A	ENST00000556526.1	-	1	117	c.18A>T	c.(16-18)atA>atT	p.I6I	RP11-14J7.6_ENST00000554006.1_RNA|RP11-14J7.6_ENST00000554993.1_RNA|RNASE11_ENST00000610205.1_5'Flank|RP11-14J7.6_ENST00000554529.1_RNA|RNASE11_ENST00000432835.2_5'Flank|RNASE11_ENST00000398008.2_5'Flank|RNASE11_ENST00000398009.2_5'Flank|RNASE11_ENST00000555841.1_5'Flank|RNASE11_ENST00000553849.1_5'Flank|RNASE11_ENST00000555283.1_Silent_p.I6I|RP11-14J7.6_ENST00000556487.1_RNA|RP11-14J7.6_ENST00000553604.1_RNA	NM_001024822.2	NP_001019993.1	Q5GAN4	RNS12_HUMAN	ribonuclease, RNase A family, 12 (non-active)	6						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			kidney(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.013)		CCAAGAAAATTATCACCATTA	0.408													ENSG00000258436																																					0													127.0	119.0	122.0					14																	21058865		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS32037.1	14q11.1	2012-10-05			ENSG00000258436	ENSG00000258436		"""Ribonucleases, RNase A"""	24211	protein-coding gene	gene with protein product							Standard	NM_001024822		Approved		uc001vxt.3	Q5GAN4	OTTHUMG00000170991	ENST00000556526.1:c.18A>T	14.37:g.21058865T>A				Silent	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.I6	ENST00000556526.1	37	c.18	CCDS32037.1	14																																																																																			-	RSE12	-	NULL		0.408	RNASE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSE12	HGNC	protein_coding	OTTHUMT00000411107.1	0	0	0	18	18	94	0.00	0.00	T			21058865	-1	11	25	24	55	tier1	no_errors	ENST00000556526	ensembl	human	known	74_37	silent	31.43	30.86	SNP	0.000	A	11	24
NRXN3	9369	genome.wustl.edu	37	14	80327536	80327536	+	Silent	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr14:80327536G>A	ENST00000557594.1	+	6	2096	c.1143G>A	c.(1141-1143)gcG>gcA	p.A381A	NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000281127.7_Intron|NRXN3_ENST00000428277.2_Intron|NRXN3_ENST00000556003.1_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	381					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CCTCTGAGGCGGGGTTACCTT	0.532													ENSG00000021645																																					0																																										SO:0001819	synonymous_variant	0			-	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1143G>A	14.37:g.80327536G>A			A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Neurexin-like,pfscan_Laminin_G	p.A381	ENST00000557594.1	37	c.1143		14																																																																																			-	NRXN3	-	NULL		0.532	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	0	0	0	47	47	63	0.00	0.00	G	NM_001105250		80327536	+1	34	22	28	13	tier1	no_errors	ENST00000557594	ensembl	human	novel	74_37	silent	54.84	62.86	SNP	1.000	A	34	28
SSFA2	6744	genome.wustl.edu	37	2	182786788	182786788	+	Silent	SNP	A	A	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr2:182786788A>G	ENST00000431877.2	+	16	3503	c.3324A>G	c.(3322-3324)caA>caG	p.Q1108Q	SSFA2_ENST00000467172.2_3'UTR|SSFA2_ENST00000428267.2_Silent_p.Q933Q|SSFA2_ENST00000409136.1_Silent_p.Q617Q|SSFA2_ENST00000320370.7_Silent_p.Q1108Q|SSFA2_ENST00000409001.1_Silent_p.Q1086Q	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	1108				QAT -> KQR (in Ref. 8; AAB00773). {ECO:0000305}.		cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TTTTTTCCCAAGCAACATCAG	0.458													ENSG00000138434																																					0													95.0	98.0	97.0					2																	182786788		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.3324A>G	2.37:g.182786788A>G			A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Silent	SNP	NULL	p.Q1108	ENST00000431877.2	37	c.3324	CCDS46467.1	2																																																																																			-	SSFA2	-	NULL		0.458	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2	0	0	0	34	34	122	0.00	0.00	A	NM_006751		182786788	+1	25	30	62	60	tier1	no_errors	ENST00000431877	ensembl	human	known	74_37	silent	28.74	32.97	SNP	0.772	G	25	62
PTPRZ1	5803	genome.wustl.edu	37	7	121624027	121624028	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr7:121624027_121624028insT	ENST00000393386.2	+	8	1195_1196	c.784_785insT	c.(784-786)gttfs	p.V262fs	PTPRZ1_ENST00000449182.1_Frame_Shift_Ins_p.V262fs	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	262	Alpha-carbonic anhydrase.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TCAGTTGGCTGTTTTTTGTGAA	0.317													ENSG00000106278																																					0																																										SO:0001589	frameshift_variant	0				M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.790dupT	7.37:g.121624033_121624033dupT	ENSP00000377047:p.Val262fs		A4D0W5|C9JFM0|O76043|Q9UDR6	Frame_Shift_Ins	INS	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.C264fs	ENST00000393386.2	37	c.784_785	CCDS34740.1	7																																																																																				PTPRZ1	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.317	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	0	0	0	28	28	118	0.00	0.00	-	NM_002851		121624028	+1	10	33	56	68	tier1	no_errors	ENST00000393386	ensembl	human	known	74_37	frame_shift_ins	15.15	32.67	INS	0.999:1.000	T	10	56
MTR	4548	genome.wustl.edu	37	1	237044109	237044109	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr1:237044109delC	ENST00000366577.5	+	25	3043	c.2649delC	c.(2647-2649)gtcfs	p.V883fs	MTR_ENST00000535889.1_Frame_Shift_Del_p.V832fs	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	883	B12-binding. {ECO:0000255|PROSITE- ProRule:PRU00666}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TAATCCATGTCCTGGACGCGT	0.428													ENSG00000116984																																					0													175.0	171.0	173.0					1																	237044109		2203	4300	6503	SO:0001589	frameshift_variant	0				U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2649delC	1.37:g.237044109delC	ENSP00000355536:p.Val883fs		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Frame_Shift_Del	DEL	pfam_S_MeTrfase,pfam_VitB12-dep_Met_synth_activ_dom,pfam_Pterin-binding,pfam_Cbl-bd_cap,pfam_Cobalamin-bd,superfamily_VitB12-dep_Met_synth_activ_dom,superfamily_S_MeTrfase,superfamily_Dihydropteroate_synth-like,superfamily_Cobalamin-bd,superfamily_Cbl-bd_cap,pirsf_MetH,pfscan_VitB12-dep_Met_synth_activ_dom,pfscan_S_MeTrfase,pfscan_Pterin-binding,tigrfam_MetH	p.L884fs	ENST00000366577.5	37	c.2649	CCDS1614.1	1																																																																																				MTR	-	superfamily_Cobalamin-bd,pirsf_MetH,tigrfam_MetH		0.428	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	HGNC	protein_coding	OTTHUMT00000096632.2	0	0	0	34	34	115	0.00	0.00	C	NM_000254		237044109	+1	22	37	42	65	tier1	no_errors	ENST00000366577	ensembl	human	known	74_37	frame_shift_del	34.38	36.27	DEL	1.000	-	22	42
LAMA5	3911	genome.wustl.edu	37	20	60908645	60908645	+	Missense_Mutation	SNP	C	C	T	rs563915762	byFrequency	TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr20:60908645C>T	ENST00000252999.3	-	24	3062	c.2996G>A	c.(2995-2997)cGt>cAt	p.R999H	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	999	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGCCTCCACACGCAGGGCCCA	0.706													ENSG00000130702	a|||	2	0.000399361	0.0008	0.0014	5008	,	,		9933	0.0		0.0	False		,,,				2504	0.0																0													10.0	11.0	10.0					20																	60908645		2170	4270	6440	SO:0001583	missense	0			-	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.2996G>A	20.37:g.60908645C>T	ENSP00000252999:p.Arg999His		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.R999H	ENST00000252999.3	37	c.2996	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	a	11.93	1.785289	0.31593	.	.	ENSG00000130702	ENST00000252999	T	0.18657	2.2	4.26	4.26	0.50523	.	0.368950	0.27193	N	0.020484	T	0.11623	0.0283	N	0.08118	0	0.22240	N	0.999266	B	0.14012	0.009	B	0.04013	0.001	T	0.21042	-1.0257	10	0.66056	D	0.02	.	10.9037	0.47067	0.8418:0.1582:0.0:0.0	.	999	O15230	LAMA5_HUMAN	H	999	ENSP00000252999:R999H	ENSP00000252999:R999H	R	-	2	0	LAMA5	60342040	0.545000	0.26449	0.891000	0.34965	0.206000	0.24218	3.636000	0.54317	0.500000	0.27991	-0.374000	0.07098	CGT	-	LAMA5	-	NULL		0.706	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	0	0	0	12	12	6	0.00	0.00	C	NM_005560		60908645	-1	7	7	21	5	tier1	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	25.00	58.33	SNP	0.078	T	7	21
NYAP2	57624	genome.wustl.edu	37	2	226447647	226447647	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr2:226447647G>A	ENST00000272907.6	+	4	1927	c.1514G>A	c.(1513-1515)cGg>cAg	p.R505Q	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	505					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												TCCCGGTCCCGGACACCCACG	0.697													ENSG00000144460																																					0													14.0	18.0	17.0					2																	226447647		1910	4114	6024	SO:0001583	missense	0			-	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1514G>A	2.37:g.226447647G>A	ENSP00000272907:p.Arg505Gln		A2RRN4|Q96NL2	Missense_Mutation	SNP	NULL	p.R505Q	ENST00000272907.6	37	c.1514	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812455	0.32053	.	.	ENSG00000144460	ENST00000272907	T	0.36520	1.25	5.63	5.63	0.86233	.	0.114876	0.56097	D	0.000028	T	0.55386	0.1917	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79784	0.982;0.993	T	0.47156	-0.9139	10	0.38643	T	0.18	-21.3187	19.7096	0.96089	0.0:0.0:1.0:0.0	.	19;505	Q9P242-3;Q9P242	.;K1486_HUMAN	Q	505	ENSP00000272907:R505Q	ENSP00000272907:R505Q	R	+	2	0	KIAA1486	226155891	1.000000	0.71417	0.066000	0.19879	0.011000	0.07611	6.127000	0.71642	2.652000	0.90054	0.655000	0.94253	CGG	-	NYAP2	-	NULL		0.697	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1	0	0	0	36	36	6	0.00	0.00	G	NM_020864		226447647	+1	19	2	41	0	tier1	no_errors	ENST00000272907	ensembl	human	known	74_37	missense	31.67	100.00	SNP	0.991	A	19	41
SLC6A10P	386757	genome.wustl.edu	37	16	32893375	32893375	+	RNA	SNP	C	C	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr16:32893375C>A	ENST00000330048.5	-	0	1439					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		CCCCTGGCACCTCCAGTCCCC	0.617													ENSG00000214617																																					0																																												0			-	U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32893375C>A				R	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			-	SLC6A10P	-	-		0.617	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	0	0	0	12	12	7	0.00	0.00	C			32893375	-1	8	2	11	2	tier1	no_errors	ENST00000330048	ensembl	human	known	74_37	rna	42.11	50.00	SNP	1.000	A	8	11
TRAF3	7187	genome.wustl.edu	37	14	103369714	103369714	+	Silent	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr14:103369714G>A	ENST00000560371.1	+	10	1300	c.1083G>A	c.(1081-1083)gtG>gtA	p.V361V	TRAF3_ENST00000539721.1_Silent_p.V278V|TRAF3_ENST00000347662.4_Silent_p.V336V|TRAF3_ENST00000392745.2_Silent_p.V361V|TRAF3_ENST00000351691.5_Silent_p.V336V	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	361					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		AGAACCGCGTGACCGAGCTGG	0.652													ENSG00000131323																																					0													73.0	71.0	72.0					14																	103369714		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1083G>A	14.37:g.103369714G>A			B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Silent	SNP	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.V361	ENST00000560371.1	37	c.1083	CCDS9975.1	14																																																																																			-	TRAF3	-	pirsf_TNF_rcpt--assoc_TRAF		0.652	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF3	HGNC	protein_coding	OTTHUMT00000415735.1	0	0	0	22	22	15	0.00	0.00	G	NM_145725		103369714	+1	18	9	8	9	tier1	no_errors	ENST00000392745	ensembl	human	known	74_37	silent	69.23	50.00	SNP	1.000	A	18	8
TAF1	6872	genome.wustl.edu	37	X	70711917	70711917	+	Intron	SNP	G	G	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chrX:70711917G>A	ENST00000461764.1	+	9	1008				INGX_ENST00000489074.2_RNA|Y_RNA_ENST00000362881.1_RNA			P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CTCACTATTAGACGCATGTCC	0.418													ENSG00000243468																																					0																																										SO:0001627	intron_variant	0			-		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000461764.1:c.1008+31264G>A	X.37:g.70711917G>A			A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	R	SNP	-	NULL	ENST00000461764.1	37	NULL		X																																																																																			-	INGX	-	-		0.418	TAF1-021	KNOWN	mRNA_end_NF|basic	processed_transcript	INGX	HGNC	protein_coding	OTTHUMT00000081821.1	0	0	0	45	45	140	0.00	0.00	G	NM_004606		70711917	-1	6	6	58	114	tier1	no_errors	ENST00000489074	ensembl	human	known	74_37	rna	9.38	4.96	SNP	0.008	A	6	58
CUL4B	8450	genome.wustl.edu	37	X	119691849	119691849	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chrX:119691849T>G	ENST00000404115.3	-	4	1057	c.656A>C	c.(655-657)aAa>aCa	p.K219T	CUL4B_ENST00000336592.6_Missense_Mutation_p.K206T|CUL4B_ENST00000371322.5_Missense_Mutation_p.K201T	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	219					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TTCTTTCAGTTTTTGCCAGGT	0.338													ENSG00000158290																																					0													185.0	154.0	165.0					X																	119691849		2203	4299	6502	SO:0001583	missense	0			-	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.656A>C	X.37:g.119691849T>G	ENSP00000384109:p.Lys219Thr		B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.K219T	ENST00000404115.3	37	c.656	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	T	20.6	4.020938	0.75275	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115;ENST00000371323	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81	5.54	5.54	0.83059	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.043692	0.85682	D	0.000000	D	0.82393	0.5027	L	0.58810	1.83	0.80722	D	1	D;D	0.62365	0.991;0.989	D;D	0.68039	0.955;0.925	T	0.82295	-0.0528	9	.	.	.	-17.698	13.7592	0.62954	0.0:0.0:0.0:1.0	.	219;201	Q13620;Q13620-1	CUL4B_HUMAN;.	T	201;206;219;23	ENSP00000360373:K201T;ENSP00000338919:K206T;ENSP00000384109:K219T;ENSP00000360374:K23T	.	K	-	2	0	CUL4B	119575877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.008000	0.88588	1.846000	0.53633	0.477000	0.44152	AAA	-	CUL4B	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom		0.338	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	0	0	0	30	30	116	0.00	0.00	T	NM_003588		119691849	-1	12	11	48	100	tier1	no_errors	ENST00000404115	ensembl	human	known	74_37	missense	20.00	9.91	SNP	1.000	G	12	48
CEP350	9857	genome.wustl.edu	37	1	180062224	180062233	+	Frame_Shift_Del	DEL	GTTGAAAGAG	GTTGAAAGAG	-			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	GTTGAAAGAG	GTTGAAAGAG	GTTGAAAGAG	-	GTTGAAAGAG	GTTGAAAGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr1:180062224_180062233delGTTGAAAGAG	ENST00000367607.3	+	34	7402_7411	c.6984_6993delGTTGAAAGAG	c.(6982-6993)atgttgaaagagfs	p.MLKE2328fs	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2328					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GTGAGGAAATGTTGAAAGAGAGACAGTCAG	0.338													ENSG00000135837																																					0																																										SO:0001589	frameshift_variant	0				AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.6984_6993delGTTGAAAGAG	1.37:g.180062224_180062233delGTTGAAAGAG	ENSP00000356579:p.Met2328fs		O75068|Q8TDK3|Q8WY20	Frame_Shift_Del	DEL	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.M2328fs	ENST00000367607.3	37	c.6984_6993	CCDS1336.1	1																																																																																				CEP350	-	NULL		0.338	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	0	0	0	86	86	86	0.00	0.00	GTTGAAAGAG	NM_014810		180062233	+1	4	4	64	64	tier1	no_errors	ENST00000367607	ensembl	human	known	74_37	frame_shift_del	5.88	5.88	DEL	0.000:0.000:0.001:0.004:0.066:0.121:0.165:0.206:0.221:0.109	-	4	64
MT-CO1	4512	genome.wustl.edu	37	M	6327	6327	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chrM:6327T>A	ENST00000361624.2	+	1	424	c.424T>A	c.(424-426)Tcc>Acc	p.S142T	MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	142			S -> F (in MT-C4D; significant decrease in enzyme activity). {ECO:0000269|PubMed:16284789}.		aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACCCTGGAGCCTCCGTAGACC	0.507													ENSG00000198804																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.424T>A	M.37:g.6327T>A	ENSP00000354499:p.Ser142Thr		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.S142T	ENST00000361624.2	37	c.424		MT																																																																																			-	MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom		0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		0	0	0	636	636	6	0.00	0.00	T	YP_003024028		6327	+1	2	0	10	0	tier1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	16.67	0.00	SNP	NULL	A	2	10
SLC25A22	79751	genome.wustl.edu	37	11	799456	799456	+	5'Flank	SNP	G	G	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr11:799456G>T	ENST00000531214.1	-	0	0				PIDD_ENST00000347755.5_Silent_p.R862R|PIDD_ENST00000411829.2_Silent_p.R845R	NM_001191060.1	NP_001177989.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22						L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACGTCCTGCCGGTCACTCTGC	0.682													ENSG00000177595																									Colon(93;848 1468 3270 23355 49636)												0													52.0	52.0	52.0					11																	799456		2202	4292	6494	SO:0001631	upstream_gene_variant	0			-	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310		11.37:g.799456G>T	Exception_encountered		A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Silent	SNP	pfam_Peptidase_S68_pidd,pfam_Death_domain,pfam_Leu-rich_rpt,pfam_ZU5,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Death_domain,pfscan_Death_domain,pfscan_ZU5	p.R862	ENST00000531214.1	37	c.2584	CCDS7715.1	11																																																																																			-	PIDD	-	pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain		0.682	SLC25A22-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIDD	HGNC	protein_coding	OTTHUMT00000384124.1	0	0	0	43	43	11	0.00	0.00	G			799456	-1	4	0	33	2	tier1	no_errors	ENST00000347755	ensembl	human	known	74_37	silent	10.81	0.00	SNP	1.000	T	4	33
UBC	7316	genome.wustl.edu	37	12	125396494	125396494	+	Silent	SNP	C	C	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr12:125396494C>T	ENST00000538617.1	-	4	1000	c.684G>A	c.(682-684)ggG>ggA	p.G228G	UBC_ENST00000546120.1_Silent_p.G532G|UBC_ENST00000339647.5_Silent_p.G608G|UBC_ENST00000536769.1_Silent_p.G608G|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	608	Ubiquitin-like 3. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		AGATTTGCATCCCACCTCTGA	0.527													ENSG00000150991																																					0													124.0	75.0	92.0					12																	125396494		2201	4285	6486	SO:0001819	synonymous_variant	0			-		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.684G>A	12.37:g.125396494C>T			P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.G608	ENST00000538617.1	37	c.1824		12																																																																																			-	UBC	-	pfscan_Ubiquitin_supergroup		0.527	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400179.1	0	0	0	28	28	6	0.00	0.00	C	NM_021009		125396494	-1	26	1	28	5	tier1	no_errors	ENST00000339647	ensembl	human	known	74_37	silent	48.15	16.67	SNP	0.620	T	26	28
DNM1P47	100216544	genome.wustl.edu	37	15	102294648	102294648	+	RNA	SNP	T	T	C			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr15:102294648T>C	ENST00000561463.1	+	0	2694									DNM1 pseudogene 47																		TTCTCAGAGCTGCTGTCCAAC	0.587													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294648T>C				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	55	55	0	0.00	0.00	T	NG_009149		102294648	+1	7	0	68	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	9.33	0.00	SNP	0.999	C	7	68
DNM1P47	100216544	genome.wustl.edu	37	15	102294651	102294651	+	RNA	SNP	T	T	G			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr15:102294651T>G	ENST00000561463.1	+	0	2697									DNM1 pseudogene 47																		TCAGAGCTGCTGTCCAACCTG	0.587													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294651T>G				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	55	55	0	0.00	0.00	T	NG_009149		102294651	+1	7	0	69	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	9.21	0.00	SNP	0.999	G	7	69
AC136188.1	0	genome.wustl.edu	37	12	74293692	74293701	+	RNA	DEL	ATACACATAC	ATACACATAC	-	rs146159159|rs199815745|rs11179832|rs375254855|rs61932864|rs61932865|rs199501745|rs370436341|rs142009105	byFrequency	TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	ATACACATAC	ATACACATAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr12:74293692_74293701delATACACATAC	ENST00000606199.1	+	0	43_52																											atatatatatatacacatacacacacacac	0.281													ENSG00000272231																																					0																																												0																																12.37:g.74293692_74293701delATACACATAC				R	DEL	-	NULL	ENST00000606199.1	37	NULL		12																																																																																				AC136188.1	-	-		0.281	AC136188.1-201	NOVEL	basic	miRNA	ENSG00000272231	Clone_based_ensembl_gene	miRNA		0	0	0	0	0	0	0.00	0.00	ATACACATAC			74293701	+1	0	0	0	0	tier1	no_errors	ENST00000606199	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.002:0.002:0.002:0.002:0.004:0.007:0.009:0.010:0.011:0.011	-	0	0
FAM230A	653203	genome.wustl.edu	37	22	20710080	20710080	+	Silent	SNP	G	G	A	rs537050826	byFrequency	TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr22:20710080G>A	ENST00000434783.3	+	8	1996	c.1812G>A	c.(1810-1812)tcG>tcA	p.S604S	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		TAACGAGGTCGCCGCCCAGGG	0.692													ENSG00000188280																																					0																																										SO:0001819	synonymous_variant	0			-	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.1812G>A	22.37:g.20710080G>A				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.S604	ENST00000434783.3	37	c.1812		22																																																																																			-	FAM230A	-	superfamily_Kinase-like_dom		0.692	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	0	0	0	52	52	1	0.00	0.00	G			20710080	+1	22	0	45	0	tier1	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	32.84	0.00	SNP	0.061	A	22	45
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				KRTAP10-9_ENST00000484861.1_3'UTR|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693													ENSG00000221837		1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0																																										SO:0001624	3_prime_UTR_variant	0				AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT			A2RRG1|A6NIR9|Q70LJ1	R	INS	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																				KRTAP10-9	-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	0	0	0	0	0	0	0.00	0.00	-			46048197	+1	0	0	0	0	tier1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.001:0.001	CGCTGGT	0	0
KRTAP2-2	728279	genome.wustl.edu	37	17	39211139	39211140	+	In_Frame_Ins	INS	-	-	GCAGGGGGGCCGGCA	rs9674636		TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr17:39211139_39211140insGCAGGGGGGCCGGCA	ENST00000398477.1	-	1	342_343	c.324_325insTGCCGGCCCCCCTGC	c.(322-327)tgcggc>tgcTGCCGGCCCCCCTGCggc	p.107_108insCCRPP	KRTAP2-2_ENST00000542910.1_In_Frame_Ins_p.107_108insCCRPP	NM_033032.2	NP_149021.2	Q9BYT5	KRA22_HUMAN	keratin associated protein 2-2	107	11 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GTCGGCTGGCCGCAGGGGGACT	0.703													ENSG00000214518																																					0										369,641		167,35,303						3.3	1.0			2	525,2849		188,149,1350	no	coding	KRTAP2-2	NM_033032.2		355,184,1653	A1A1,A1R,RR		15.5602,36.5347,20.3923				894,3490				SO:0001652	inframe_insertion	0				AJ302536	CCDS32648.1, CCDS54122.1	17q21.2	2013-06-25			ENSG00000214518	ENSG00000214518		"""Keratin associated proteins"""	18905	protein-coding gene	gene with protein product							Standard	NM_033032		Approved	KAP2.2	uc010cxj.3	Q9BYT5	OTTHUMG00000133593	ENST00000398477.1:c.324_325insTGCCGGCCCCCCTGC	17.37:g.39211139_39211140insGCAGGGGGGCCGGCA	ENSP00000381494:p.Pro107_Cys108insCysCysArgProPro		A8MTN3|A8MXM4	In_Frame_Ins	INS	pfam_Keratin-assoc	p.108in_frame_insCRPPC	ENST00000398477.1	37	c.325_324	CCDS54122.1	17																																																																																				KRTAP2-2	-	NULL		0.703	KRTAP2-2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRTAP2-2	HGNC	protein_coding	OTTHUMT00000257697.1	0	0	0	1	1	1	0.00	0.00	-			39211140	-1	0	0	0	0	tier1	no_errors	ENST00000542910	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	1.000:1.000	GCAGGGGGGCCGGCA	0	0
LOC100190940	100190940	genome.wustl.edu	37	12	130521234	130521235	+	lincRNA	INS	-	-	A	rs386378253|rs386378254|rs34472041|rs200802994	byFrequency	TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr12:130521234_130521235insA	ENST00000567788.1	-	0	1466_1467				RP11-474D1.4_ENST00000561864.1_lincRNA																							gactctgtctcaaaaaaaaaag	0.431													ENSG00000214039																																					0																																												0																																12.37:g.130521244_130521244dupA				R	INS	-	NULL	ENST00000567788.1	37	NULL		12																																																																																				RP11-474D1.3	-	-		0.431	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	Clone_based_vega_gene	lincRNA	OTTHUMT00000399498.1	0	0	0	8	8	1	0.00	0.00	-			130521235	-1	3	0	22	3	tier1	no_errors	ENST00000291374	ensembl	human	known	74_37	rna	12.00	0.00	INS	0.029:0.046	A	3	22
GOLGA6L10	647042	genome.wustl.edu	37	15	82637166	82637167	+	Frame_Shift_Ins	INS	-	-	CCCTCTCC			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr15:82637166_82637167insCCCTCTCC	ENST00000439287.4	-	6	1018_1019	c.919_920insGGAGAGGG	c.(919-921)gagfs	p.E307fs		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	307										endometrium(1)|kidney(4)	5						CAGCAGCCTCTCCCTCTCCAGC	0.634													ENSG00000205281																																					0																																										SO:0001589	frameshift_variant	0					CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.912_919dupGGAGAGGG	15.37:g.82637167_82637174dupCCCTCTCC	ENSP00000388606:p.Glu307fs			Frame_Shift_Ins	INS	NULL	p.E307fs	ENST00000439287.4	37	c.920_919	CCDS45325.1	15																																																																																				GOLGA6L10	-	NULL		0.634	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927601	Uniprot_gn	protein_coding	OTTHUMT00000419403.2	0	0	0	0	0	0	0.00	0.00	-	NM_001164465		82637167	-1	0	0	0	0	tier1	no_errors	ENST00000439287	ensembl	human	known	74_37	frame_shift_ins	0.00	0.00	INS	0.989:0.976	CCCTCTCC	0	0
LOC644794	644794	genome.wustl.edu	37	7	66369212	66369213	+	lincRNA	INS	-	-	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr7:66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC	ENST00000610177.1	+	0	1369_1370																											TGCCTCGTGGCGGCCTTCCCCG	0.738													ENSG00000273142																																					0																																												0																																7.37:g.66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC				R	INS	-	NULL	ENST00000610177.1	37	NULL		7																																																																																				RP11-458F8.4	-	-		0.738	RP11-458F8.4-001	KNOWN	basic	lincRNA	LOC644794	Clone_based_vega_gene	lincRNA	OTTHUMT00000472525.1	0	0	0	3	3	3	0.00	0.00	-			66369213	+1	0	0	1	1	tier1	no_errors	ENST00000610177	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.293:0.454	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC	0	1
ZBTB11	27107	genome.wustl.edu	37	3	101390763	101390763	+	Intron	SNP	G	G	T			TCGA-DX-A6Z2-01A-12D-A36J-09	TCGA-DX-A6Z2-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4035ea7d-e77b-4637-afb9-5be5411d0a38	4269113e-908e-4959-b1f2-6cfd8a779d59	g.chr3:101390763G>T	ENST00000312938.4	-	2	1127				ZBTB11_ENST00000461821.1_Missense_Mutation_p.A202D	NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AGTCACCAAGGCTGCAAATAC	0.368													ENSG00000066422																																					0																																										SO:0001627	intron_variant	0			-	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.546+58C>A	3.37:g.101390763G>T			Q2NKP9	Missense_Mutation	SNP	NULL	p.A202D	ENST00000312938.4	37	c.605	CCDS2943.1	3	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728522	0.30593	.	.	ENSG00000066422	ENST00000461821	T	0.36878	1.23	5.0	-10.0	0.00425	.	.	.	.	.	T	0.16428	0.0395	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24977	-1.0145	8	0.52906	T	0.07	.	0.9852	0.01444	0.1495:0.1964:0.2439:0.4102	.	202	C9J2L2	.	D	202	ENSP00000417369:A202D	ENSP00000417369:A202D	A	-	2	0	ZBTB11	102873453	0.000000	0.05858	0.000000	0.03702	0.388000	0.30384	0.003000	0.13083	-2.031000	0.00928	-0.345000	0.07892	GCC	-	ZBTB11	-	NULL		0.368	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB11	HGNC	protein_coding	OTTHUMT00000353441.2	0	0	0	36	36	123	0.00	0.00	G	NM_014415		101390763	-1	4	2	34	134	tier1	no_errors	ENST00000461821	ensembl	human	putative	74_37	missense	10.53	1.47	SNP	0.000	T	4	34
