#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TTC39B	158219	genome.wustl.edu	37	9	15211327	15211327	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr9:15211327A>T	ENST00000512701.2	-	5	587	c.551T>A	c.(550-552)tTc>tAc	p.F184Y	TTC39B_ENST00000297615.5_Missense_Mutation_p.F115Y|TTC39B_ENST00000355694.2_Missense_Mutation_p.F118Y|TTC39B_ENST00000541445.1_Missense_Mutation_p.F118Y|TTC39B_ENST00000380850.4_Missense_Mutation_p.F184Y|TTC39B_ENST00000582994.1_5'Flank|TTC39B_ENST00000507285.1_Missense_Mutation_p.F19Y|TTC39B_ENST00000507993.1_Missense_Mutation_p.F19Y			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	184										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						CTGTTGCTCGAAGGTCAGGAC	0.463													ENSG00000155158																																					0													154.0	133.0	141.0					9																	15211327		2203	4300	6503	SO:0001583	missense	0			-	AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.551T>A	9.37:g.15211327A>T	ENSP00000422496:p.Phe184Tyr		A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.F184Y	ENST00000512701.2	37	c.551	CCDS6477.2	9	.	.	.	.	.	.	.	.	.	.	A	34	5.308083	0.95629	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993;ENST00000541445	T;T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39;0.39	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.72518	0.3470	M	0.76328	2.33	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.989;0.989	D;D;D;D;D	0.87578	0.997;0.998;0.996;0.934;0.934	T	0.74278	-0.3717	10	0.51188	T	0.08	-21.6203	15.7917	0.78369	1.0:0.0:0.0:0.0	.	115;184;184;118;118	F5H705;E9PAQ9;E9PE60;A5PLN1;Q5VTQ0	.;.;.;.;TT39B_HUMAN	Y	184;115;118;184;19;19;118	ENSP00000370231:F184Y;ENSP00000297615:F115Y;ENSP00000347920:F118Y;ENSP00000422496:F184Y;ENSP00000426539:F19Y;ENSP00000423392:F19Y;ENSP00000442880:F118Y	ENSP00000297615:F115Y	F	-	2	0	TTC39B	15201327	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	8.930000	0.92872	2.218000	0.71995	0.533000	0.62120	TTC	-	TTC39B	-	pfam_OMP_IML2_mit/TPR_39		0.463	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	0	0	0	46	46	76	0.00	0.00	A	NM_152574		15211327	-1	17	13	29	31	tier1	no_errors	ENST00000512701	ensembl	human	known	74_37	missense	36.96	29.55	SNP	1.000	T	17	29
EIF2AK3	9451	genome.wustl.edu	37	2	88885426	88885426	+	Missense_Mutation	SNP	G	G	A	rs200171164		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:88885426G>A	ENST00000303236.3	-	9	1884	c.1583C>T	c.(1582-1584)aCg>aTg	p.T528M	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.T377M	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	528					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						AAACAAAATCGTTGCAACTAT	0.408													ENSG00000172071																									GBM(138;671 1851 16235 39058 45249)												0													223.0	202.0	209.0					2																	88885426		2203	4300	6503	SO:0001583	missense	0			-	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.1583C>T	2.37:g.88885426G>A	ENSP00000307235:p.Thr528Met		A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T528M	ENST00000303236.3	37	c.1583	CCDS33241.1	2	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001736	0.74932	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.50548	0.74;0.74;0.74	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.68979	0.3060	M	0.68317	2.08	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.63862	-0.6541	10	0.37606	T	0.19	-22.0537	20.3343	0.98733	0.0:0.0:1.0:0.0	.	528	Q9NZJ5	E2AK3_HUMAN	M	377;528;377;407	ENSP00000408325:T377M;ENSP00000307235:T528M;ENSP00000412076:T407M	ENSP00000307235:T528M	T	-	2	0	EIF2AK3	88666541	1.000000	0.71417	0.189000	0.23252	0.585000	0.36419	8.441000	0.90313	2.822000	0.97130	0.650000	0.86243	ACG	rs200171164	EIF2AK3	-	NULL		0.408	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EIF2AK3	HGNC	protein_coding	OTTHUMT00000338233.2	0	0	0	115	115	139	0.00	0.00	G	NM_004836		88885426	-1	25	33	55	71	tier1	no_errors	ENST00000303236	ensembl	human	known	74_37	missense	30.86	31.43	SNP	1.000	A	25	55
TMEM211	255349	genome.wustl.edu	37	22	25331358	25331358	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr22:25331358G>T	ENST00000423535.1	-	3	544	c.545C>A	c.(544-546)aCc>aAc	p.T182N	TMEM211_ENST00000407886.1_Missense_Mutation_p.T111N|TMEM211_ENST00000382744.1_Missense_Mutation_p.T111N			Q6ICI0	TM211_HUMAN	transmembrane protein 211	182						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						GAAGATGATGGTCCTCCCTTG	0.522													ENSG00000206069																																					0													110.0	101.0	104.0					22																	25331358		2203	4300	6503	SO:0001583	missense	0			-		CCDS33624.1	22q11.23	2009-01-12			ENSG00000206069	ENSG00000206069			33725	protein-coding gene	gene with protein product							Standard	NM_001001663		Approved	bA9F11.1	uc003abk.1	Q6ICI0	OTTHUMG00000150790	ENST00000423535.1:c.545C>A	22.37:g.25331358G>T	ENSP00000387813:p.Thr182Asn			Missense_Mutation	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.T182N	ENST00000423535.1	37	c.545		22	.	.	.	.	.	.	.	.	.	.	G	2.384	-0.341496	0.05243	.	.	ENSG00000206069	ENST00000407886;ENST00000423535;ENST00000382744	T;T;T	0.77229	-1.08;-0.65;-1.08	3.72	1.54	0.23209	.	0.962208	0.08543	N	0.930123	T	0.68495	0.3007	L	0.51422	1.61	0.09310	N	1	B	0.33073	0.396	B	0.29176	0.099	T	0.58405	-0.7642	10	0.54805	T	0.06	-26.0238	5.3803	0.16187	0.2838:0.0:0.7162:0.0	.	182	Q6ICI0	TM211_HUMAN	N	111;182;111	ENSP00000385494:T111N;ENSP00000387813:T182N;ENSP00000372192:T111N	ENSP00000372192:T111N	T	-	2	0	TMEM211	23661358	0.444000	0.25649	0.003000	0.11579	0.016000	0.09150	1.071000	0.30666	0.484000	0.27630	0.455000	0.32223	ACC	-	TMEM211	-	NULL		0.522	TMEM211-202	KNOWN	basic|appris_principal	protein_coding	TMEM211	HGNC	protein_coding		0	0	0	34	34	43	0.00	0.00	G	NM_001001663		25331358	-1	6	11	10	13	tier1	no_errors	ENST00000423535	ensembl	human	known	74_37	missense	37.50	45.83	SNP	0.024	T	6	10
BET1	10282	genome.wustl.edu	37	7	93605345	93605345	+	5'UTR	SNP	A	A	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605345A>T	ENST00000471446.1	-	0	124				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			AATGCTGAGGAACAGTCAAAA	0.393													ENSG00000105829																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-411T>A	7.37:g.93605345A>T			Q96EA0	Silent	SNP	pfam_T_SRE_dom,pfscan_T_SRE_dom	p.V101	ENST00000471446.1	37	c.303		7																																																																																			-	BET1	-	NULL		0.393	BET1-006	KNOWN	basic	processed_transcript	BET1	HGNC	protein_coding	OTTHUMT00000341560.1	0	0	0	61	61	86	0.00	0.00	A	NM_005868		93605345	-1	15	12	38	40	tier1	no_errors	ENST00000357520	ensembl	human	known	74_37	silent	28.30	23.08	SNP	0.007	T	15	38
HOOK1	51361	genome.wustl.edu	37	1	60314110	60314110	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:60314110G>C	ENST00000371208.3	+	11	1310	c.1053G>C	c.(1051-1053)atG>atC	p.M351I	HOOK1_ENST00000395561.2_Missense_Mutation_p.M309I|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	351	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TGATGTATATGCATAATACAG	0.348													ENSG00000134709																																					0													85.0	85.0	85.0					1																	60314110		2203	4300	6503	SO:0001583	missense	0			-	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1053G>C	1.37:g.60314110G>C	ENSP00000360252:p.Met351Ile		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin	p.M351I	ENST00000371208.3	37	c.1053	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883153	0.91740	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.18016	2.24;2.24	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.35913	0.0948	L	0.58428	1.81	0.80722	D	1	P	0.51933	0.949	P	0.58331	0.837	T	0.00385	-1.1773	10	0.24483	T	0.36	.	20.2956	0.98549	0.0:0.0:1.0:0.0	.	351	Q9UJC3	HOOK1_HUMAN	I	351;309	ENSP00000360252:M351I;ENSP00000378928:M309I	ENSP00000360252:M351I	M	+	3	0	HOOK1	60086698	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.230000	0.95299	2.805000	0.96524	0.460000	0.39030	ATG	-	HOOK1	-	pfam_Hook-related_fam		0.348	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	0	0	0	55	55	93	0.00	0.00	G	NM_015888		60314110	+1	9	18	28	89	tier1	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	24.32	16.82	SNP	1.000	C	9	28
NXPH3	11248	genome.wustl.edu	37	17	47656469	47656469	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:47656469C>A	ENST00000328741.5	+	2	928	c.566C>A	c.(565-567)tCg>tAg	p.S189*	RP5-1029K10.4_ENST00000503624.1_RNA|NXPH3_ENST00000513748.1_Nonsense_Mutation_p.S189*	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	189	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					CGCCGGACCTCGCTTTGCACC	0.592													ENSG00000182575																																					0													95.0	92.0	93.0					17																	47656469		2203	4300	6503	SO:0001587	stop_gained	0			-	AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575			8077	protein-coding gene	gene with protein product		604636				9570794	Standard	NM_007225		Approved	NPH3	uc002ipa.3	O95157		ENST00000328741.5:c.566C>A	17.37:g.47656469C>A	ENSP00000329295:p.Ser189*		Q8NDC3|Q8TBF6|Q9ULR1	Nonsense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.S189*	ENST00000328741.5	37	c.566	CCDS11550.1	17	.	.	.	.	.	.	.	.	.	.	c	35	5.448163	0.96205	.	.	ENSG00000182575	ENST00000328741;ENST00000513748	.	.	.	4.44	4.44	0.53790	.	0.401030	0.25701	N	0.028873	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-6.4206	12.7421	0.57259	0.0:0.8346:0.1654:0.0	.	.	.	.	X	189	.	ENSP00000329295:S189X	S	+	2	0	NXPH3	45011468	0.011000	0.17503	1.000000	0.80357	0.997000	0.91878	2.034000	0.41145	2.310000	0.77875	0.556000	0.70494	TCG	-	NXPH3	-	pfam_NXPH/NXPE,pirsf_Neurexophilin		0.592	NXPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH3	HGNC	protein_coding	OTTHUMT00000365143.1	0	0	0	34	34	34	0.00	0.00	C			47656469	+1	4	11	22	31	tier1	no_errors	ENST00000328741	ensembl	human	known	74_37	nonsense	15.38	26.19	SNP	0.997	A	4	22
CCT5	22948	genome.wustl.edu	37	5	10261729	10261729	+	Missense_Mutation	SNP	G	G	A	rs140095139	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr5:10261729G>A	ENST00000280326.4	+	8	1471	c.1051G>A	c.(1051-1053)Gag>Aag	p.E351K	CCT5_ENST00000506600.1_Missense_Mutation_p.E258K|CCT5_ENST00000503026.1_Missense_Mutation_p.E330K|CCT5_ENST00000515390.1_Missense_Mutation_p.E296K|CTD-2256P15.4_ENST00000606194.1_RNA|CCT5_ENST00000515676.1_Missense_Mutation_p.E313K	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	351					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						GCTCACAGCCGAGAAGCTGGG	0.517													ENSG00000150753																																					0								G	LYS/GLU	0,4406		0,0,2203	170.0	179.0	176.0		1051	4.5	0.8	5	dbSNP_134	176	2,8598	2.2+/-6.3	0,2,4298	no	missense	CCT5	NM_012073.3	56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	351/542	10261729	2,13004	2203	4300	6503	SO:0001583	missense	0			-	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.1051G>A	5.37:g.10261729G>A	ENSP00000280326:p.Glu351Lys		A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_epsi	p.E351K	ENST00000280326.4	37	c.1051	CCDS3877.1	5	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792887	0.90453	0.0	2.33E-4	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2	5.39	4.5	0.54988	.	0.045357	0.85682	D	0.000000	T	0.78792	0.4339	M	0.65320	2	0.80722	D	1	B;P;B;P;P;P	0.46457	0.232;0.878;0.335;0.839;0.839;0.839	B;P;B;B;B;B	0.45753	0.07;0.492;0.034;0.37;0.37;0.37	T	0.80148	-0.1503	10	0.52906	T	0.07	-37.331	15.0426	0.71803	0.0:0.1428:0.8572:0.0	.	258;296;200;349;351;351	B4DYD8;E7ENZ3;B4DZY9;Q9BU08;A8K2X8;P48643	.;.;.;.;.;TCPE_HUMAN	K	351;330;296;324;313;258	ENSP00000280326:E351K;ENSP00000423318:E330K;ENSP00000426923:E296K;ENSP00000427297:E313K;ENSP00000423052:E258K	ENSP00000280326:E351K	E	+	1	0	CCT5	10314729	1.000000	0.71417	0.839000	0.33178	0.982000	0.71751	9.193000	0.94954	1.234000	0.43709	0.558000	0.71614	GAG	rs140095139	CCT5	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_epsi		0.517	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT5	HGNC	protein_coding	OTTHUMT00000253688.2	0	0	0	56	56	55	0.00	0.00	G			10261729	+1	14	6	60	47	tier1	no_errors	ENST00000280326	ensembl	human	known	74_37	missense	18.92	11.32	SNP	0.999	A	14	60
EPN3	55040	genome.wustl.edu	37	17	48617655	48617655	+	Silent	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:48617655G>A	ENST00000268933.3	+	6	1518	c.939G>A	c.(937-939)ccG>ccA	p.P313P	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Intron|EPN3_ENST00000537145.1_Silent_p.P341P	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	313						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CCCTGGCCCCGCCCTCCACAC	0.662													ENSG00000049283																																					0													88.0	69.0	76.0					17																	48617655		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.939G>A	17.37:g.48617655G>A			A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.P341	ENST00000268933.3	37	c.1023	CCDS11570.1	17																																																																																			-	EPN3	-	NULL		0.662	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN3	HGNC	protein_coding	OTTHUMT00000367573.1	0	0	0	44	44	50	0.00	0.00	G	NM_017957		48617655	+1	6	19	18	72	tier1	no_errors	ENST00000537145	ensembl	human	known	74_37	silent	25.00	20.65	SNP	0.952	A	6	18
NLGN1	22871	genome.wustl.edu	37	3	173997210	173997210	+	Silent	SNP	G	G	A	rs200258151	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:173997210G>A	ENST00000457714.1	+	6	1848	c.1419G>A	c.(1417-1419)gcG>gcA	p.A473A	NLGN1_ENST00000361589.4_Silent_p.A473A|NLGN1_ENST00000401917.3_Silent_p.A513A|NLGN1_ENST00000545397.1_Silent_p.A473A	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	490					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TAGCCACAGCGGATCTTCACT	0.498													ENSG00000169760	G|||	2	0.000399361	0.0015	0.0	5008	,	,		17609	0.0		0.0	False		,,,				2504	0.0																0								G		1,4405	2.1+/-5.4	0,1,2202	90.0	87.0	88.0		1419	4.9	1.0	3		88	0,8600		0,0,4300	no	coding-synonymous	NLGN1	NM_014932.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		473/824	173997210	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1419G>A	3.37:g.173997210G>A			Q9UPT2	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.A513	ENST00000457714.1	37	c.1539	CCDS3222.1	3																																																																																			rs200258151	NLGN1	-	pfam_CarbesteraseB		0.498	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	0	0	0	44	44	97	0.00	0.00	G	NM_014932		173997210	+1	11	27	27	95	tier1	no_errors	ENST00000401917	ensembl	human	known	74_37	silent	28.21	22.13	SNP	1.000	A	11	27
RRM2	6241	genome.wustl.edu	37	2	10269400	10269400	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:10269400A>G	ENST00000304567.5	+	10	1126	c.1057A>G	c.(1057-1059)Att>Gtt	p.I353V	RRM2_ENST00000360566.2_Missense_Mutation_p.I413V	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2	353					deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	TATGGAGAATATTTCACTGGA	0.393													ENSG00000171848																																					0													82.0	81.0	81.0					2																	10269400		2203	4300	6503	SO:0001583	missense	0			-		CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449	ENST00000304567.5:c.1057A>G	2.37:g.10269400A>G	ENSP00000302955:p.Ile353Val		B2R9B5|J3KP43|Q5WRU7	Missense_Mutation	SNP	pfam_RNR_small,superfamily_Ferritin-like_SF	p.I413V	ENST00000304567.5	37	c.1237	CCDS1669.1	2	.	.	.	.	.	.	.	.	.	.	A	18.84	3.710146	0.68730	.	.	ENSG00000171848	ENST00000360566;ENST00000304567	D;D	0.97731	-4.51;-4.51	5.67	5.67	0.87782	Ferritin/ribonucleotide reductase-like (1);Ribonucleotide reductase-related (1);	0.000000	0.85682	D	0.000000	D	0.97820	0.9284	M	0.92738	3.34	0.80722	D	1	B	0.18863	0.031	B	0.17433	0.018	D	0.96612	0.9453	10	0.87932	D	0	-21.2513	15.92	0.79556	1.0:0.0:0.0:0.0	.	353	P31350	RIR2_HUMAN	V	413;353	ENSP00000353770:I413V;ENSP00000302955:I353V	ENSP00000302955:I353V	I	+	1	0	RRM2	10186851	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.110000	0.94302	2.159000	0.67721	0.455000	0.32223	ATT	-	RRM2	-	superfamily_Ferritin-like_SF		0.393	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	RRM2	HGNC	protein_coding	OTTHUMT00000364902.2	0	0	0	63	63	67	0.00	0.00	A			10269400	+1	28	46	31	42	tier1	no_errors	ENST00000360566	ensembl	human	known	74_37	missense	47.46	52.27	SNP	1.000	G	28	31
TSC1	7248	genome.wustl.edu	37	9	135772703	135772703	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr9:135772703T>C	ENST00000298552.3	-	22	3064	c.2843A>G	c.(2842-2844)tAt>tGt	p.Y948C	TSC1_ENST00000440111.2_Missense_Mutation_p.Y948C|TSC1_ENST00000545250.1_Missense_Mutation_p.Y897C	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	948					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTGAGCCTCATACCTGCTCTC	0.423			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				ENSG00000165699																											yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	1	Unknown(1)	bone(1)											106.0	110.0	109.0					9																	135772703		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	-	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2843A>G	9.37:g.135772703T>C	ENSP00000298552:p.Tyr948Cys		B7Z897|Q5VVN5	Missense_Mutation	SNP	pfam_Hamartin,superfamily_ARM-type_fold	p.Y948C	ENST00000298552.3	37	c.2843	CCDS6956.1	9	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970225	0.53614	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;D	0.87029	-2.2;-2.2;-2.03	5.61	5.61	0.85477	.	0.062767	0.64402	D	0.000003	D	0.84897	0.5574	M	0.62723	1.935	0.80722	D	1	P;P	0.42456	0.78;0.453	B;B	0.37346	0.247;0.159	D	0.85382	0.1120	10	0.42905	T	0.14	-13.3069	14.9826	0.71321	0.0:0.0:0.0:1.0	.	897;948	B7Z897;Q92574	.;TSC1_HUMAN	C	948;948;897	ENSP00000298552:Y948C;ENSP00000394524:Y948C;ENSP00000444017:Y897C	ENSP00000298552:Y948C	Y	-	2	0	TSC1	134762524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.006000	0.63978	2.137000	0.66172	0.528000	0.53228	TAT	-	TSC1	-	NULL		0.423	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	HGNC	protein_coding	OTTHUMT00000054799.1	0	0	0	69	69	71	0.00	0.00	T			135772703	-1	29	29	14	25	tier1	no_errors	ENST00000298552	ensembl	human	known	74_37	missense	67.44	53.70	SNP	1.000	C	29	14
ZNF790	388536	genome.wustl.edu	37	19	37314268	37314268	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr19:37314268G>C	ENST00000356725.4	-	4	268	c.148C>G	c.(148-150)Cag>Gag	p.Q50E	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	50	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GCTTCTGGCTGATAAATGCAA	0.428													ENSG00000197863																																					0													46.0	42.0	44.0					19																	37314268		2203	4300	6503	SO:0001583	missense	0			-	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.148C>G	19.37:g.37314268G>C	ENSP00000349161:p.Gln50Glu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q50E	ENST00000356725.4	37	c.148	CCDS12496.1	19	.	.	.	.	.	.	.	.	.	.	G	8.598	0.886198	0.17540	.	.	ENSG00000197863	ENST00000356725;ENST00000528994;ENST00000525288	T;T;T	0.00784	5.7;5.7;5.7	3.58	-0.421	0.12332	Krueppel-associated box (3);	.	.	.	.	T	0.00608	0.0020	N	0.16266	0.395	0.09310	N	1	P	0.38504	0.634	B	0.33254	0.16	T	0.52895	-0.8514	9	0.62326	D	0.03	.	8.5918	0.33693	0.0:0.0:0.3925:0.6075	.	50	Q6PG37	ZN790_HUMAN	E	50	ENSP00000349161:Q50E;ENSP00000435944:Q50E;ENSP00000433389:Q50E	ENSP00000349161:Q50E	Q	-	1	0	ZNF790	42006108	0.000000	0.05858	0.850000	0.33497	0.481000	0.33189	-0.463000	0.06696	0.251000	0.21505	0.460000	0.39030	CAG	-	ZNF790	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.428	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	HGNC	protein_coding	OTTHUMT00000385341.2	0	0	0	44	44	95	0.00	0.00	G	NM_206894		37314268	-1	16	37	12	43	tier1	no_errors	ENST00000356725	ensembl	human	known	74_37	missense	57.14	46.25	SNP	0.277	C	16	12
SLC4A10	57282	genome.wustl.edu	37	2	162719573	162719573	+	Splice_Site	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:162719573G>T	ENST00000446997.1	+	6	859		c.e6+1		SLC4A10_ENST00000535165.1_Splice_Site|SLC4A10_ENST00000375514.5_Splice_Site|SLC4A10_ENST00000421911.1_Splice_Site|SLC4A10_ENST00000415876.2_Splice_Site|SLC4A10_ENST00000272716.5_Splice_Site|SLC4A10_ENST00000493021.1_Splice_Site	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10						bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GACAAAAATGGTAAATGTTTA	0.323													ENSG00000144290																																					0													68.0	74.0	72.0					2																	162719573		1841	4114	5955	SO:0001630	splice_region_variant	0			-		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.766+1G>T	2.37:g.162719573G>T			B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Splice_Site	SNP	-	e6+1	ENST00000446997.1	37	c.766+1	CCDS54411.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353794	0.82243	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6853	0.95977	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC4A10	162427819	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	9.751000	0.98889	2.759000	0.94783	0.591000	0.81541	.	-	SLC4A10	-	-		0.323	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	HGNC	protein_coding	OTTHUMT00000333090.1	0	0	0	61	61	153	0.00	0.00	G	NM_022058	Intron	162719573	+1	19	43	20	65	tier1	no_errors	ENST00000446997	ensembl	human	known	74_37	splice_site	48.72	39.81	SNP	1.000	T	19	20
ACSL3	2181	genome.wustl.edu	37	2	223806326	223806326	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:223806326A>G	ENST00000357430.3	+	17	2648	c.2117A>G	c.(2116-2118)aAa>aGa	p.K706R	ACSL3_ENST00000392066.3_Missense_Mutation_p.K706R	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	706					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	AAAGAGCTTAAAACACATTAC	0.408			T	ETV1	prostate								ENSG00000123983																												Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	0													105.0	102.0	103.0					2																	223806326		2203	4300	6503	SO:0001583	missense	0			-	D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.2117A>G	2.37:g.223806326A>G	ENSP00000350012:p.Lys706Arg		Q60I92|Q8IUM9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.K706R	ENST00000357430.3	37	c.2117	CCDS2455.1	2	.	.	.	.	.	.	.	.	.	.	A	13.22	2.173437	0.38413	.	.	ENSG00000123983	ENST00000357430;ENST00000392066	T;T	0.20200	2.09;2.09	5.94	5.94	0.96194	.	0.046320	0.85682	D	0.000000	T	0.17746	0.0426	L	0.39514	1.22	0.58432	D	0.999997	B	0.15473	0.013	B	0.19946	0.027	T	0.08371	-1.0725	10	0.13108	T	0.6	-24.4618	12.6022	0.56503	0.8242:0.1758:0.0:0.0	.	706	O95573	ACSL3_HUMAN	R	706	ENSP00000350012:K706R;ENSP00000375918:K706R	ENSP00000350012:K706R	K	+	2	0	ACSL3	223514570	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.794000	0.75135	2.265000	0.75225	0.482000	0.46254	AAA	-	ACSL3	-	NULL		0.408	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL3	HGNC	protein_coding	OTTHUMT00000256862.2	0	0	0	46	46	97	0.00	0.00	A	NM_004457		223806326	+1	10	40	22	43	tier1	no_errors	ENST00000357430	ensembl	human	known	74_37	missense	31.25	48.19	SNP	1.000	G	10	22
LGALS3BP	3959	genome.wustl.edu	37	17	76967850	76967850	+	Silent	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:76967850G>A	ENST00000262776.3	-	6	1874	c.1566C>T	c.(1564-1566)gcC>gcT	p.A522A	LGALS3BP_ENST00000591778.1_3'UTR	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	522					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AGAGCATCAGGGCTTTGTTTT	0.602											OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000108679																									GBM(89;1105 1755 18102 21513)												0													58.0	57.0	57.0					17																	76967850		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.1566C>T	17.37:g.76967850G>A		1172	Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Silent	SNP	pfam_SRCR,pfam_BACK,superfamily_Srcr_rcpt-rel,superfamily_BTB/POZ_fold,smart_Srcr_rcpt-rel,smart_BACK,pfscan_BTB/POZ-like,pfscan_SRCR,prints_SRCR	p.A522	ENST00000262776.3	37	c.1566	CCDS11759.1	17																																																																																			-	LGALS3BP	-	NULL		0.602	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3BP	HGNC	protein_coding	OTTHUMT00000437785.3	0	0	0	59	59	10	0.00	0.00	G	NM_005567		76967850	-1	12	3	34	22	tier1	no_errors	ENST00000262776	ensembl	human	known	74_37	silent	26.09	12.00	SNP	0.981	A	12	34
GJA9	81025	genome.wustl.edu	37	1	39341869	39341869	+	5'UTR	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:39341869T>A	ENST00000360786.3	-	0	154				RP5-864K19.4_ENST00000456813.1_RNA|GJA9_ENST00000357771.3_Intron|RP5-864K19.4_ENST00000433671.2_RNA|MYCBP_ENST00000489803.1_Intron|RP5-864K19.4_ENST00000443161.1_RNA|GJA9_ENST00000454994.2_Intron|MYCBP_ENST00000397572.2_5'Flank			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa						cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			AGCAAACCTATGGTGAAAATA	0.348													ENSG00000228436																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.-99A>T	1.37:g.39341869T>A			B2R722|B3KVQ2|Q5TA63|Q96KG0	R	SNP	-	NULL	ENST00000360786.3	37	NULL	CCDS432.1	1																																																																																			-	RP5-864K19.4	-	-		0.348	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228436	Clone_based_vega_gene	protein_coding	OTTHUMT00000001205.1	0	0	0	60	60	94	0.00	0.00	T	NM_030772		39341869	+1	16	26	27	43	tier1	no_errors	ENST00000443161	ensembl	human	known	74_37	rna	37.21	37.68	SNP	0.058	A	16	27
ABCA4	24	genome.wustl.edu	37	1	94463415	94463415	+	Splice_Site	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:94463415G>T	ENST00000370225.3	-	48	6816		c.e48+1		ABCA4_ENST00000535881.1_Splice_Site|ABCA4_ENST00000536513.1_Splice_Site	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4						phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGGCCAACTTGCCTGGTCCAG	0.567													ENSG00000198691																																					0													105.0	88.0	94.0					1																	94463415		2203	4300	6503	SO:0001630	splice_region_variant	0			-	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.6729+1C>A	1.37:g.94463415G>T			O15112|O60438|O60915|Q0QD48|Q4LE31	Splice_Site	SNP	-	e48+2	ENST00000370225.3	37	c.6729+2	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948479	0.53186	.	.	ENSG00000198691	ENST00000546054;ENST00000370225;ENST00000536513;ENST00000535881	.	.	.	5.39	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.4966	0.07657	0.3664:0.0:0.6336:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA4	94236003	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	4.651000	0.61447	2.523000	0.85059	0.563000	0.77884	.	-	ABCA4	-	-		0.567	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	0	0	0	40	40	49	0.00	0.00	G	NM_000350	Intron	94463415	-1	5	18	14	33	tier1	no_errors	ENST00000370225	ensembl	human	known	74_37	splice_site	26.32	35.29	SNP	1.000	T	5	14
ABCG5	64240	genome.wustl.edu	37	2	44041643	44041643	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:44041643C>T	ENST00000260645.1	-	12	1874	c.1735G>A	c.(1735-1737)Gag>Aag	p.E579K	ABCG5_ENST00000543989.1_Missense_Mutation_p.E184K|ABCG5_ENST00000405322.1_Missense_Mutation_p.E408K	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	579	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CCGTAGAACTCATTGACTACA	0.308													ENSG00000138075																																					0													77.0	78.0	77.0					2																	44041643		2202	4295	6497	SO:0001583	missense	0			-	T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1735G>A	2.37:g.44041643C>T	ENSP00000260645:p.Glu579Lys		Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E579K	ENST00000260645.1	37	c.1735	CCDS1814.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.074191	0.94000	.	.	ENSG00000138075	ENST00000260645;ENST00000405322;ENST00000543989	T;T;T	0.74002	-0.8;-0.8;-0.8	5.09	5.09	0.68999	ABC-2 type transporter (1);	0.719989	0.12710	N	0.445600	D	0.86981	0.6064	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.991;0.999	D	0.86395	0.1738	10	0.66056	D	0.02	.	18.2993	0.90158	0.0:1.0:0.0:0.0	.	408;579	E7EX35;Q9H222	.;ABCG5_HUMAN	K	579;408;184	ENSP00000260645:E579K;ENSP00000384513:E408K;ENSP00000445107:E184K	ENSP00000260645:E579K	E	-	1	0	ABCG5	43895147	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.683000	0.74533	2.639000	0.89480	0.557000	0.71058	GAG	-	ABCG5	-	pfam_ABC_2_trans		0.308	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG5	HGNC	protein_coding	OTTHUMT00000250675.1	0	0	0	149	149	146	0.00	0.00	C	NM_022436		44041643	-1	41	44	130	160	tier1	no_errors	ENST00000260645	ensembl	human	known	74_37	missense	23.98	21.57	SNP	1.000	T	41	130
BET1	10282	genome.wustl.edu	37	7	93605346	93605346	+	5'UTR	SNP	A	A	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605346A>T	ENST00000471446.1	-	0	123				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			ATGCTGAGGAACAGTCAAAAT	0.388													ENSG00000105829																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-412T>A	7.37:g.93605346A>T			Q96EA0	Missense_Mutation	SNP	pfam_T_SRE_dom,pfscan_T_SRE_dom	p.V101D	ENST00000471446.1	37	c.302		7																																																																																			-	BET1	-	NULL		0.388	BET1-006	KNOWN	basic	processed_transcript	BET1	HGNC	protein_coding	OTTHUMT00000341560.1	0	0	0	62	62	84	0.00	0.00	A	NM_005868		93605346	-1	14	12	39	40	tier1	no_errors	ENST00000357520	ensembl	human	known	74_37	missense	26.42	23.08	SNP	0.005	T	14	39
PTX4	390667	genome.wustl.edu	37	16	1536545	1536545	+	Missense_Mutation	SNP	C	C	T	rs148493506		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:1536545C>T	ENST00000447419.2	-	3	857	c.832G>A	c.(832-834)Gcc>Acc	p.A278T	PTX4_ENST00000293922.1_Missense_Mutation_p.A273T|PTX4_ENST00000440447.2_Silent_p.T129T			Q96A99	PTX4_HUMAN	pentraxin 4, long	278	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CTGGTGGAGGCGTTTGGGAAA	0.647													ENSG00000251692																																					0								C	THR/ALA	1,4397	2.1+/-5.4	0,1,2198	47.0	47.0	47.0		817	-3.1	0.0	16	dbSNP_134	47	0,8600		0,0,4300	no	missense	PTX4	NM_001013658.1	58	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	benign	273/474	1536545	1,12997	2199	4300	6499	SO:0001583	missense	0			-		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.832G>A	16.37:g.1536545C>T	ENSP00000445277:p.Ala278Thr			Missense_Mutation	SNP	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.A278T	ENST00000447419.2	37	c.832		16	.	.	.	.	.	.	.	.	.	.	C	2.204	-0.382340	0.04966	2.27E-4	0.0	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.62105	0.05;0.05	5.58	-3.06	0.05379	.	0.370607	0.26227	N	0.025597	T	0.33000	0.0848	N	0.21508	0.67	0.20638	N	0.999871	B	0.28378	0.209	B	0.22753	0.041	T	0.23726	-1.0180	10	0.11794	T	0.64	.	4.5068	0.11893	0.2312:0.4007:0.0:0.3681	.	273	Q96A99-2	.	T	278;273	ENSP00000445277:A278T;ENSP00000293922:A273T	ENSP00000293922:A273T	A	-	1	0	PTX4	1476546	0.000000	0.05858	0.041000	0.18516	0.004000	0.04260	-2.305000	0.01133	-0.159000	0.11021	-0.841000	0.03054	GCC	rs148493506	PTX4	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.647	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	HGNC	protein_coding	OTTHUMT00000432526.1	0	0	0	12	12	68	0.00	0.00	C	NM_001013658		1536545	-1	6	28	3	86	tier1	no_errors	ENST00000447419	ensembl	human	known	74_37	missense	66.67	24.35	SNP	0.013	T	6	3
SEL1L2	80343	genome.wustl.edu	37	20	13936777	13936777	+	Splice_Site	SNP	G	G	A	rs377357095		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr20:13936777G>A	ENST00000284951.5	-	2	133	c.59C>T	c.(58-60)aCt>aTt	p.T20I	AL117333.1_ENST00000408401.1_RNA|SEL1L2_ENST00000378072.5_Splice_Site_p.T20I|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	20						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						TGCTTTGATAGCTGCAATACA	0.214													ENSG00000101251																																					0													38.0	36.0	37.0					20																	13936777		1781	4030	5811	SO:0001630	splice_region_variant	0			-	AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.59-1C>T	20.37:g.13936777G>A			B4DXX5	Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.T20I	ENST00000284951.5	37	c.59		20	.	.	.	.	.	.	.	.	.	.	G	0.042	-1.282421	0.01398	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.22945	1.93;2.26	4.57	0.926	0.19430	.	0.816969	0.10656	N	0.649244	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	B;B	0.19583	0.037;0.037	B;B	0.18871	0.015;0.023	T	0.38650	-0.9651	10	0.16896	T	0.51	.	5.8104	0.18463	0.0:0.099:0.4404:0.4606	.	20;20	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	I	20	ENSP00000367312:T20I;ENSP00000284951:T20I	ENSP00000284951:T20I	T	-	2	0	SEL1L2	13884777	0.988000	0.35896	0.126000	0.21872	0.031000	0.12232	0.222000	0.17699	0.038000	0.15604	0.462000	0.41574	ACT	-	SEL1L2	-	NULL		0.214	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	0	0	0	129	129	87	0.00	0.00	G	NM_025229	Missense_Mutation	13936777	-1	26	20	63	41	tier1	no_errors	ENST00000284951	ensembl	human	known	74_37	missense	29.21	32.79	SNP	0.440	A	26	63
AHNAK	79026	genome.wustl.edu	37	11	62288755	62288755	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr11:62288755C>T	ENST00000378024.4	-	5	13408	c.13134G>A	c.(13132-13134)atG>atA	p.M4378I	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4378					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCTTGATGTTCATCTCTGGCA	0.473													ENSG00000124942																																					0													146.0	152.0	150.0					11																	62288755		2202	4299	6501	SO:0001583	missense	0			-	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13134G>A	11.37:g.62288755C>T	ENSP00000367263:p.Met4378Ile		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.M4378I	ENST00000378024.4	37	c.13134	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	C	6.448	0.450753	0.12223	.	.	ENSG00000124942	ENST00000378024	T	0.01126	5.3	4.84	2.96	0.34315	.	0.056663	0.64402	D	0.000005	T	0.01695	0.0054	L	0.61218	1.895	0.31043	N	0.716115	B	0.13145	0.007	B	0.12156	0.007	T	0.14008	-1.0488	10	0.21014	T	0.42	.	10.8698	0.46877	0.0:0.8439:0.0:0.1561	.	4378	Q09666	AHNK_HUMAN	I	4378	ENSP00000367263:M4378I	ENSP00000367263:M4378I	M	-	3	0	AHNAK	62045331	0.984000	0.35163	1.000000	0.80357	0.141000	0.21300	1.185000	0.32065	0.562000	0.29204	0.551000	0.68910	ATG	-	AHK	-	NULL		0.473	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK	HGNC	protein_coding	OTTHUMT00000395572.1	0	0	0	106	106	107	0.00	0.00	C	NM_024060		62288755	-1	21	22	49	63	tier1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	30.00	25.88	SNP	1.000	T	21	49
BET1	10282	genome.wustl.edu	37	7	93605343	93605343	+	5'UTR	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605343G>A	ENST00000471446.1	-	0	126				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			CAAATGCTGAGGAACAGTCAA	0.398													ENSG00000105829																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-409C>T	7.37:g.93605343G>A			Q96EA0	Missense_Mutation	SNP	pfam_T_SRE_dom,pfscan_T_SRE_dom	p.P102L	ENST00000471446.1	37	c.305		7																																																																																			-	BET1	-	NULL		0.398	BET1-006	KNOWN	basic	processed_transcript	BET1	HGNC	protein_coding	OTTHUMT00000341560.1	0	0	0	62	62	87	0.00	0.00	G	NM_005868		93605343	-1	16	14	39	40	tier1	no_errors	ENST00000357520	ensembl	human	known	74_37	missense	29.09	25.93	SNP	0.017	A	16	39
OR5H14	403273	genome.wustl.edu	37	3	97868430	97868430	+	Silent	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:97868430T>A	ENST00000437310.1	+	1	261	c.201T>A	c.(199-201)gcT>gcA	p.A67A	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGAATTTAGCTTTTGTGGATG	0.398													ENSG00000236032																																					0													310.0	313.0	312.0					3																	97868430		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.201T>A	3.37:g.97868430T>A			B9EH15	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A67	ENST00000437310.1	37	c.201	CCDS33798.1	3																																																																																			-	OR5H14	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.398	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H14	HGNC	protein_coding	OTTHUMT00000359112.1	0	0	0	95	95	69	0.00	0.00	T			97868430	+1	20	17	26	20	tier1	no_errors	ENST00000437310	ensembl	human	known	74_37	silent	43.48	45.95	SNP	0.000	A	20	26
TRPC5	7224	genome.wustl.edu	37	X	111090651	111090651	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:111090651C>T	ENST00000262839.2	-	6	2309	c.1391G>A	c.(1390-1392)cGt>cAt	p.R464H		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	464					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTCCCTTGGACGAGAACCATT	0.428													ENSG00000072315																																					0													75.0	63.0	67.0					X																	111090651		2203	4300	6503	SO:0001583	missense	0			-	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1391G>A	X.37:g.111090651C>T	ENSP00000262839:p.Arg464His		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R464H	ENST00000262839.2	37	c.1391	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	12.97	2.098511	0.37048	.	.	ENSG00000072315	ENST00000262839	T	0.70869	-0.52	5.51	5.51	0.81932	Ion transport (1);	0.058084	0.64402	D	0.000003	T	0.55321	0.1913	N	0.25485	0.75	0.49687	D	0.999811	B;B	0.15930	0.006;0.015	B;B	0.15870	0.009;0.014	T	0.50972	-0.8764	10	0.15066	T	0.55	-5.5772	12.0125	0.53295	0.0:0.9192:0.0:0.0808	.	465;464	Q59G51;Q9UL62	.;TRPC5_HUMAN	H	464	ENSP00000262839:R464H	ENSP00000262839:R464H	R	-	2	0	TRPC5	110977307	0.055000	0.20627	1.000000	0.80357	0.998000	0.95712	1.489000	0.35562	2.325000	0.78763	0.529000	0.55759	CGT	-	TRPC5	-	pfam_Ion_trans_dom,tigrfam_TRP_channel		0.428	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	0	0	0	38	38	93	0.00	0.00	C	NM_012471		111090651	-1	13	37	18	81	tier1	no_errors	ENST00000262839	ensembl	human	known	74_37	missense	41.94	31.09	SNP	1.000	T	13	18
SDK2	54549	genome.wustl.edu	37	17	71382003	71382003	+	Missense_Mutation	SNP	C	C	A	rs562611295	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:71382003C>A	ENST00000392650.3	-	32	4552	c.4552G>T	c.(4552-4554)Gtg>Ttg	p.V1518L	SDK2_ENST00000388726.3_Missense_Mutation_p.V1518L	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1518	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CGGATTAGCACGGAGGTGGTG	0.637													ENSG00000069188																																					0													76.0	65.0	68.0					17																	71382003		2203	4299	6502	SO:0001583	missense	0			-	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4552G>T	17.37:g.71382003C>A	ENSP00000376421:p.Val1518Leu		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1518L	ENST00000392650.3	37	c.4552	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707220	0.89018	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.53857	0.6;0.6;0.6	4.57	4.57	0.56435	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.55577	0.1929	N	0.20881	0.62	0.58432	D	0.999996	D;P;D	0.69078	0.997;0.929;0.994	D;P;D	0.64687	0.928;0.79;0.928	T	0.49390	-0.8945	10	0.15066	T	0.55	.	17.3082	0.87201	0.0:1.0:0.0:0.0	.	1518;1518;1518	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	L	1142;1518;1518;694;1518	ENSP00000376421:V1518L;ENSP00000373378:V1518L;ENSP00000407098:V694L	ENSP00000324967:V1518L	V	-	1	0	SDK2	68893598	1.000000	0.71417	0.995000	0.50966	0.945000	0.59286	7.046000	0.76592	2.248000	0.74166	0.655000	0.94253	GTG	-	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.637	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	0	0	0	26	26	46	0.00	0.00	C	NM_019064		71382003	-1	15	30	24	43	tier1	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	38.46	41.10	SNP	1.000	A	15	24
DAPP1	27071	genome.wustl.edu	37	4	100756843	100756843	+	Silent	SNP	C	C	T	rs554960188		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr4:100756843C>T	ENST00000512369.1	+	2	233	c.165C>T	c.(163-165)gaC>gaT	p.D55D	DAPP1_ENST00000296414.7_Silent_p.D55D	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	55	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		ATGGATGTGACGGCAGCTACC	0.547													ENSG00000070190																																					0													130.0	127.0	128.0					4																	100756843		2072	4203	6275	SO:0001819	synonymous_variant	0			-	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.165C>T	4.37:g.100756843C>T			Q8TCK5|Q9UHF2	Silent	SNP	pfam_SH2,pfam_Pleckstrin_homology,smart_SH2,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH2,prints_SH2	p.D55	ENST00000512369.1	37	c.165	CCDS47112.1	4																																																																																			-	DAPP1	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2		0.547	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAPP1	HGNC	protein_coding	OTTHUMT00000363215.1	0	0	0	41	41	59	0.00	0.00	C			100756843	+1	10	31	12	32	tier1	no_errors	ENST00000512369	ensembl	human	known	74_37	silent	45.45	49.21	SNP	0.976	T	10	12
MAP2K4	6416	genome.wustl.edu	37	17	12013743	12013743	+	Splice_Site	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr17:12013743G>A	ENST00000353533.5	+	6	748	c.685G>A	c.(685-687)Gat>Aat	p.D229N	MAP2K4_ENST00000415385.3_Splice_Site_p.D240N|MAP2K4_ENST00000581941.1_3'UTR	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	229	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TATTCACAGAGGTGGGTATGG	0.313			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""								ENSG00000065559																												Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)											89.0	90.0	89.0					17																	12013743		2203	4299	6502	SO:0001630	splice_region_variant	0			-	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.685+1G>A	17.37:g.12013743G>A			B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D240N	ENST00000353533.5	37	c.718	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315198	0.60524	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	D;D	0.92965	-3.14;-3.14	5.32	5.32	0.75619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97204	0.9086	M	0.93507	3.425	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.99;0.997;0.998	D	0.98021	1.0371	10	0.87932	D	0	.	18.1455	0.89653	0.0:0.0:1.0:0.0	.	101;240;229	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	N	229;240;206;101	ENSP00000262445:D229N;ENSP00000410402:D240N	ENSP00000262445:D229N	D	+	1	0	MAP2K4	11954468	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.110000	0.94302	2.639000	0.89480	0.557000	0.71058	GAT	-	MAP2K4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.313	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1	0	0	0	148	148	152	0.00	0.00	G		Missense_Mutation	12013743	+1	19	44	40	55	tier1	no_errors	ENST00000415385	ensembl	human	known	74_37	missense	32.20	44.44	SNP	1.000	A	19	40
MYBPC1	4604	genome.wustl.edu	37	12	102008351	102008351	+	Intron	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr12:102008351A>G	ENST00000550270.1	+	2	61				MYBPC1_ENST00000441232.1_Intron|MYBPC1_ENST00000547509.1_Intron|MYBPC1_ENST00000360610.2_Intron|MYBPC1_ENST00000361685.2_Intron|MYBPC1_ENST00000541119.1_Intron|MYBPC1_ENST00000547405.1_Intron|MYBPC1_ENST00000361466.2_Intron|MYBPC1_ENST00000553190.1_Intron|MYBPC1_ENST00000392934.3_Intron|MYBPC1_ENST00000551300.1_Intron|MYBPC1_ENST00000452455.2_Intron|MYBPC1_ENST00000549145.1_Intron|MYBPC1_ENST00000550501.1_3'UTR|MYBPC1_ENST00000545503.2_Intron|MYBPC1_ENST00000536007.1_Intron			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type						cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						GGCTGCAAATACAGAGGGTCC	0.502													ENSG00000196091																																					0													54.0	47.0	50.0					12																	102008351		2203	4300	6503	SO:0001627	intron_variant	0			-		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.61+42A>G	12.37:g.102008351A>G			B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	R	SNP	-	NULL	ENST00000550270.1	37	NULL	CCDS9085.1	12																																																																																			-	MYBPC1	-	-		0.502	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	0	0	0	62	62	145	0.00	0.00	A			102008351	+1	6	45	32	63	tier1	no_errors	ENST00000550501	ensembl	human	known	74_37	rna	15.79	41.67	SNP	0.003	G	6	32
RP11-1166P10.1	0	genome.wustl.edu	37	16	31993452	31993452	+	RNA	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:31993452G>T	ENST00000568570.1	+	0	262																											GCTGAGGACCGGGATGACATG	0.662													ENSG00000260628																																					0																																												0			-																													16.37:g.31993452G>T				R	SNP	-	NULL	ENST00000568570.1	37	NULL		16																																																																																			-	RP11-1166P10.1	-	-		0.662	RP11-1166P10.1-002	KNOWN	basic	processed_transcript	ENSG00000260628	Clone_based_vega_gene	pseudogene	OTTHUMT00000432457.1	0	0	0	66	66	15	0.00	0.00	G			31993452	+1	9	6	33	19	tier1	no_errors	ENST00000568570	ensembl	human	known	74_37	rna	20.93	24.00	SNP	1.000	T	9	33
AEBP2	121536	genome.wustl.edu	37	12	19667686	19667686	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr12:19667686T>A	ENST00000398864.3	+	7	1475	c.1449T>A	c.(1447-1449)gaT>gaA	p.D483E	AEBP2_ENST00000541908.1_Missense_Mutation_p.D254E|AEBP2_ENST00000360995.4_Missense_Mutation_p.D267E|AEBP2_ENST00000266508.9_Missense_Mutation_p.D483E	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	483	Interaction with SUZ12.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					TACCCAAAGATACTGCCTTGC	0.323													ENSG00000139154																																					0													78.0	75.0	76.0					12																	19667686		1821	4079	5900	SO:0001583	missense	0			-		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.1449T>A	12.37:g.19667686T>A	ENSP00000381840:p.Asp483Glu		Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D483E	ENST00000398864.3	37	c.1449	CCDS44841.1	12	.	.	.	.	.	.	.	.	.	.	T	17.30	3.354879	0.61293	.	.	ENSG00000139154	ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995;ENST00000512223;ENST00000398731	T;T;T;T	0.69926	-0.25;-0.33;-0.44;-0.19	5.79	2.09	0.27110	.	.	.	.	.	T	0.70666	0.3250	L	0.39898	1.24	0.40415	D	0.979782	D	0.64830	0.994	D	0.72625	0.978	T	0.66685	-0.5861	9	0.37606	T	0.19	.	9.825	0.40905	0.0:0.2504:0.0:0.7496	.	483	Q6ZN18	AEBP2_HUMAN	E	254;483;417;483;267;93;81	ENSP00000437983:D254E;ENSP00000381840:D483E;ENSP00000266508:D483E;ENSP00000354267:D267E	ENSP00000266508:D483E	D	+	3	2	AEBP2	19558953	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.670000	0.46833	0.454000	0.26884	0.524000	0.50904	GAT	-	AEBP2	-	NULL		0.323	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AEBP2	HGNC	protein_coding	OTTHUMT00000401575.1	0	0	0	72	72	135	0.00	0.00	T	NM_153207		19667686	+1	15	43	13	70	tier1	no_errors	ENST00000398864	ensembl	human	known	74_37	missense	53.57	38.05	SNP	1.000	A	15	13
TBC1D22B	55633	genome.wustl.edu	37	6	37247153	37247153	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr6:37247153G>T	ENST00000373491.3	+	3	333	c.187G>T	c.(187-189)Gca>Tca	p.A63S		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	63							Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			TCATGAGTTTGCACGGAATAC	0.418													ENSG00000065491																																					0													151.0	142.0	145.0					6																	37247153		2203	4300	6503	SO:0001583	missense	0			-	AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.187G>T	6.37:g.37247153G>T	ENSP00000362590:p.Ala63Ser		A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A63S	ENST00000373491.3	37	c.187	CCDS4832.1	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983741	0.74474	.	.	ENSG00000065491	ENST00000373491	D	0.88431	-2.38	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.82522	0.5055	M	0.62723	1.935	0.80722	D	1	B	0.32051	0.354	B	0.29353	0.101	T	0.80612	-0.1305	10	0.21540	T	0.41	.	18.6505	0.91429	0.0:0.0:1.0:0.0	.	63	Q9NU19	TB22B_HUMAN	S	63	ENSP00000362590:A63S	ENSP00000362590:A63S	A	+	1	0	TBC1D22B	37355131	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.416000	0.97383	2.766000	0.95052	0.655000	0.94253	GCA	-	TBC1D22B	-	NULL		0.418	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22B	HGNC	protein_coding	OTTHUMT00000040402.1	0	0	0	62	62	118	0.00	0.00	G	NM_017772		37247153	+1	11	33	39	85	tier1	no_errors	ENST00000373491	ensembl	human	known	74_37	missense	22.00	27.97	SNP	1.000	T	11	39
SYPL2	284612	genome.wustl.edu	37	1	110019410	110019410	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:110019410C>T	ENST00000369872.3	+	4	483	c.267C>T	c.(265-267)atC>atT	p.I89I	SYPL2_ENST00000401021.3_Silent_p.I89I|SYPL2_ENST00000475497.1_3'UTR	NM_001040709.1	NP_001035799.1	Q5VXT5	SYPL2_HUMAN	synaptophysin-like 2	89	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular calcium ion homeostasis (GO:0006874)|substantia nigra development (GO:0021762)	integral component of synaptic vesicle membrane (GO:0030285)	transporter activity (GO:0005215)	p.I89I(2)		breast(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0436)|READ - Rectum adenocarcinoma(129;0.0698)|Epithelial(280;0.0808)|all cancers(265;0.0869)|LUSC - Lung squamous cell carcinoma(189;0.231)		TGCACCGGATCCAATATGAGA	0.592													ENSG00000143028																																					2	Substitution - coding silent(2)	lung(2)											56.0	60.0	59.0					1																	110019410		2031	4184	6215	SO:0001819	synonymous_variant	0			-	AK131459	CCDS41365.1	1p13.3	2008-02-05			ENSG00000143028	ENSG00000143028			27638	protein-coding gene	gene with protein product	"""mitsugumin-29"""					12975309	Standard	NM_001040709		Approved	Mg29	uc001dxp.3	Q5VXT5	OTTHUMG00000010969	ENST00000369872.3:c.267C>T	1.37:g.110019410C>T			A8K0E8|A8KAL7|I0IT67|Q6ZMX1	Silent	SNP	pfam_Marvel,prints_Synaptophysin/porin	p.I89	ENST00000369872.3	37	c.267	CCDS41365.1	1																																																																																			-	SYPL2	-	pfam_Marvel		0.592	SYPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYPL2	HGNC	protein_coding	OTTHUMT00000030191.1	0	0	0	18	18	48	0.00	0.00	C	NM_001006603		110019410	+1	10	14	23	18	tier1	no_errors	ENST00000369872	ensembl	human	known	74_37	silent	30.30	43.75	SNP	0.927	T	10	23
MYO3A	53904	genome.wustl.edu	37	10	26463350	26463350	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:26463350T>C	ENST00000265944.5	+	30	4323	c.4157T>C	c.(4156-4158)gTa>gCa	p.V1386A	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1386					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CCAACAGAAGTAGCAAGAAAC	0.388													ENSG00000095777																																					0													141.0	132.0	135.0					10																	26463350		2203	4300	6503	SO:0001583	missense	0			-	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.4157T>C	10.37:g.26463350T>C	ENSP00000265944:p.Val1386Ala		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.V1386A	ENST00000265944.5	37	c.4157	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	T	7.436	0.639771	0.14386	.	.	ENSG00000095777	ENST00000265944	T	0.76060	-0.99	5.94	-3.72	0.04411	.	0.872750	0.10166	N	0.707700	T	0.51415	0.1673	N	0.22421	0.69	0.24330	N	0.995003	B	0.02656	0.0	B	0.04013	0.001	T	0.39603	-0.9606	10	0.09338	T	0.73	.	7.6591	0.28392	0.0:0.381:0.4178:0.2012	.	1386	Q8NEV4	MYO3A_HUMAN	A	1386	ENSP00000265944:V1386A	ENSP00000265944:V1386A	V	+	2	0	MYO3A	26503356	0.006000	0.16342	0.018000	0.16275	0.400000	0.30750	-0.524000	0.06222	-0.677000	0.05231	-0.376000	0.06991	GTA	-	MYO3A	-	NULL		0.388	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	0	0	0	60	60	126	0.00	0.00	T	NM_017433		26463350	+1	13	21	40	71	tier1	no_errors	ENST00000265944	ensembl	human	known	74_37	missense	24.53	22.83	SNP	0.063	C	13	40
BET1	10282	genome.wustl.edu	37	7	93605300	93605300	+	5'UTR	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:93605300G>A	ENST00000471446.1	-	0	169				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			AGATGGCACTGAAAGTAAGCC	0.388													ENSG00000105829																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-366C>T	7.37:g.93605300G>A			Q96EA0	Silent	SNP	pfam_T_SRE_dom,pfscan_T_SRE_dom	p.F116	ENST00000471446.1	37	c.348		7																																																																																			-	BET1	-	NULL		0.388	BET1-006	KNOWN	basic	processed_transcript	BET1	HGNC	protein_coding	OTTHUMT00000341560.1	0	0	0	59	59	82	0.00	0.00	G	NM_005868		93605300	-1	31	18	34	33	tier1	no_errors	ENST00000357520	ensembl	human	known	74_37	silent	47.69	35.29	SNP	0.136	A	31	34
MET	4233	genome.wustl.edu	37	7	116339237	116339237	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:116339237C>T	ENST00000318493.6	+	2	286	c.99C>T	c.(97-99)tcC>tcT	p.S33S	MET_ENST00000397752.3_Silent_p.S33S|MET_ENST00000436117.2_Silent_p.S33S			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TAGCAAAGTCCGAGATGAATG	0.498			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)				ENSG00000105976																												Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													91.0	90.0	90.0					7																	116339237		1964	4165	6129	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.99C>T	7.37:g.116339237C>T			A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.S33	ENST00000318493.6	37	c.99	CCDS47689.1	7																																																																																			-	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfscan_Semap_dom		0.498	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	0	0	0	70	70	120	0.00	0.00	C			116339237	+1	38	101	33	63	tier1	no_errors	ENST00000318493	ensembl	human	known	74_37	silent	53.52	61.59	SNP	0.005	T	38	33
IGFN1	91156	genome.wustl.edu	37	1	201181230	201181230	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:201181230G>T	ENST00000335211.4	+	12	7339	c.7209G>T	c.(7207-7209)aaG>aaT	p.K2403N	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CGAACTCCAAGGATGGTCCAG	0.592													ENSG00000163395																																					0													31.0	28.0	29.0					1																	201181230		692	1591	2283	SO:0001583	missense	0			-	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.7209G>T	1.37:g.201181230G>T	ENSP00000334714:p.Lys2403Asn		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K2403N	ENST00000335211.4	37	c.7209	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	g	13.08	2.129812	0.37630	.	.	ENSG00000163395	ENST00000335211	T	0.59224	0.28	2.73	-0.748	0.11087	.	.	.	.	.	T	0.31638	0.0803	N	0.08118	0	0.09310	N	0.999999	.	.	.	.	.	.	T	0.23440	-1.0188	6	.	.	.	.	7.3829	0.26866	0.4783:0.0:0.5217:0.0	.	.	.	.	N	2403	ENSP00000334714:K2403N	.	K	+	3	2	IGFN1	199447853	0.001000	0.12720	0.000000	0.03702	0.082000	0.17680	0.348000	0.20031	-0.112000	0.11979	0.298000	0.19748	AAG	-	IGFN1	-	NULL		0.592	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		0	0	0	28	28	72	0.00	0.00	G	NM_178275		201181230	+1	12	41	6	23	tier1	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	66.67	63.08	SNP	0.000	T	12	6
OPN1SW	611	genome.wustl.edu	37	7	128415802	128415802	+	Missense_Mutation	SNP	T	T	G	rs200504235		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:128415802T>G	ENST00000249389.2	-	1	42	c.43A>C	c.(43-45)Atc>Ctc	p.I15L		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	15					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						ACTGAAGAGATATTTTTGAAC	0.522													ENSG00000128617	T|||	1	0.000199681	0.0008	0.0	5008	,	,		17509	0.0		0.0	False		,,,				2504	0.0																0								T	LEU/ILE	1,4405	2.1+/-5.4	0,1,2202	55.0	60.0	59.0		43	-0.3	0.4	7		59	0,8600		0,0,4300	yes	missense	OPN1SW	NM_001708.2	5	0,1,6502	GG,GT,TT		0.0,0.0227,0.0077	benign	15/349	128415802	1,13005	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.43A>C	7.37:g.128415802T>G	ENSP00000249389:p.Ile15Leu		Q13877	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_blue,prints_GPCR_Rhodpsn,prints_Opsin	p.I15L	ENST00000249389.2	37	c.43	CCDS5806.1	7	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	5.561	0.288291	0.10513	2.27E-4	0.0	ENSG00000128617	ENST00000249389	T	0.36157	1.27	4.87	-0.303	0.12792	.	0.716386	0.14218	N	0.333594	T	0.23926	0.0579	L	0.44542	1.39	0.27052	N	0.963752	B	0.02656	0.0	B	0.06405	0.002	T	0.18999	-1.0319	10	0.26408	T	0.33	.	4.7141	0.12887	0.0:0.2685:0.3506:0.3809	.	15	P03999	OPSB_HUMAN	L	15	ENSP00000249389:I15L	ENSP00000249389:I15L	I	-	1	0	OPN1SW	128203038	0.999000	0.42202	0.433000	0.26760	0.019000	0.09904	0.546000	0.23284	-0.188000	0.10499	-0.648000	0.03929	ATC	rs200504235	OPN1SW	-	prints_Opsin_blue		0.522	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1SW	HGNC	protein_coding	OTTHUMT00000350655.1	0	0	0	59	59	97	0.00	0.00	T	NM_001708		128415802	-1	28	65	80	141	tier1	no_errors	ENST00000249389	ensembl	human	known	74_37	missense	25.93	31.55	SNP	0.972	G	28	80
NOMO2	283820	genome.wustl.edu	37	16	18554998	18554998	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:18554998C>G	ENST00000381474.3	-	7	741	c.676G>C	c.(676-678)Gat>Cat	p.D226H	NOMO2_ENST00000543392.1_Missense_Mutation_p.D59H|NOMO2_ENST00000330537.6_Missense_Mutation_p.D226H	NM_001004060.1	NP_001004060.1	Q5JPE7	NOMO2_HUMAN	NODAL modulator 2	226						endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(4)|kidney(1)|large_intestine(2)|liver(3)|lung(5)|ovary(3)|prostate(1)|skin(1)	20						GGCTCCCCATCACTTCGGACA	0.473													ENSG00000185164																																					0													175.0	140.0	152.0					16																	18554998		2196	4298	6494	SO:0001583	missense	0			-	AL512687	CCDS10570.1, CCDS32394.1	16p12.3	2008-02-05			ENSG00000185164	ENSG00000185164			22652	protein-coding gene	gene with protein product		609158				15257293	Standard	NM_001004060		Approved	NOMO, PM5	uc002dfe.3	Q5JPE7	OTTHUMG00000131366	ENST00000381474.3:c.676G>C	16.37:g.18554998C>G	ENSP00000370883:p.Asp226His		Q4G177	Missense_Mutation	SNP	pfam_DUF2012,superfamily_Carb-bd-like_fold,superfamily_CarboxyPept-like_regulatory,superfamily_Collagen-bd_Cna_B-typ_dom	p.D226H	ENST00000381474.3	37	c.676	CCDS32394.1	16	.	.	.	.	.	.	.	.	.	.	.	19.92	3.915677	0.73098	.	.	ENSG00000185164	ENST00000330537;ENST00000381474;ENST00000543392	T;T;T	0.04275	3.68;3.67;3.66	3.24	3.24	0.37175	Carboxypeptidase-like, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.17874	0.0429	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.999;0.991	P;P	0.61800	0.894;0.747	T	0.02371	-1.1169	10	0.56958	D	0.05	-25.9319	13.9357	0.64023	0.0:1.0:0.0:0.0	.	59;226	Q4G177;Q5JPE7	.;NOMO2_HUMAN	H	226;226;59	ENSP00000331851:D226H;ENSP00000370883:D226H;ENSP00000439970:D59H	ENSP00000331851:D226H	D	-	1	0	NOMO2	18462499	1.000000	0.71417	0.992000	0.48379	0.961000	0.63080	6.814000	0.75236	1.781000	0.52344	0.400000	0.26472	GAT	-	NOMO2	-	superfamily_CarboxyPept-like_regulatory		0.473	NOMO2-002	KNOWN	basic|CCDS	protein_coding	NOMO2	HGNC	protein_coding	OTTHUMT00000435858.1	0	0	0	156	156	50	0.00	0.00	C	NM_001004060		18554998	-1	18	8	133	55	tier1	no_errors	ENST00000381474	ensembl	human	known	74_37	missense	11.92	12.70	SNP	1.000	G	18	133
GRAP2	9402	genome.wustl.edu	37	22	40351885	40351885	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr22:40351885C>T	ENST00000344138.4	+	3	404	c.141C>T	c.(139-141)ccC>ccT	p.P47P	GRAP2_ENST00000543252.1_Silent_p.P47P|GRAP2_ENST00000399090.2_Intron|GRAP2_ENST00000478445.1_3'UTR|GRAP2_ENST00000544756.1_Intron|GRAP2_ENST00000407075.3_Silent_p.P47P|GRAP2_ENST00000540310.1_Intron	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	47	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						GATATGTGCCCAAGAATTTCA	0.463													ENSG00000100351																																					0													109.0	96.0	100.0					22																	40351885		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.141C>T	22.37:g.40351885C>T			B7Z8I3|O43726|Q9NRB7	Silent	SNP	pfam_SH3_domain,pfam_SH2,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.P47	ENST00000344138.4	37	c.141	CCDS13999.1	22																																																																																			-	GRAP2	-	pfam_SH3_domain,pfam_SH3_2,smart_SH3_domain,pfscan_SH3_domain		0.463	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP2	HGNC	protein_coding	OTTHUMT00000321295.1	0	0	0	62	62	111	0.00	0.00	C	NM_004810		40351885	+1	40	49	18	53	tier1	no_errors	ENST00000344138	ensembl	human	known	74_37	silent	68.97	48.04	SNP	1.000	T	40	18
PKD1L2	114780	genome.wustl.edu	37	16	81208264	81208264	+	RNA	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:81208264C>T	ENST00000527937.1	-	0	720				PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000531391.1_RNA|PKD1L2_ENST00000337114.4_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AATGGCCGCACGCAGACCCTG	0.597													ENSG00000166473																																					0																																												0			-	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81208264C>T			Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	superfamily_Coatomer/clathrin_app_Ig-like,pfscan_REJ-like	p.V203M	ENST00000527937.1	37	c.607		16	.	.	.	.	.	.	.	.	.	.	c	9.443	1.088556	0.20390	.	.	ENSG00000166473	ENST00000527937	T	0.23147	1.92	2.64	-4.09	0.03951	.	.	.	.	.	T	0.15305	0.0369	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.06405	0.002	T	0.33240	-0.9876	8	0.87932	D	0	.	4.3139	0.10984	0.0:0.2101:0.1819:0.608	.	203	Q7Z442-6	.	M	203	ENSP00000432818:V203M	ENSP00000432818:V203M	V	-	1	0	PKD1L2	79765765	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.205000	0.01232	-0.593000	0.05844	-1.027000	0.02421	GTG	-	PKD1L2	-	pfscan_REJ-like		0.597	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387978.1	0	0	0	53	53	84	0.00	0.00	C			81208264	-1	13	16	29	75	tier1	no_errors	ENST00000527937	ensembl	human	known	74_37	missense	30.95	17.58	SNP	0.000	T	13	29
GPR158	57512	genome.wustl.edu	37	10	25891039	25891039	+	3'UTR	DEL	A	A	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:25891039delA	ENST00000376351.3	+	0	6843				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TGGTTCTCCTAAAACTATTAT	0.363													ENSG00000151025																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*2836A>-	10.37:g.25891039delA			Q6QR81|Q9ULT3	R	DEL	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																				GPR158	-	-		0.363	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	0	0	0	49	49	149	0.00	0.00	A	XM_166110		25891039	+1	12	37	21	66	tier1	no_errors	ENST00000490549	ensembl	human	known	74_37	rna	36.36	35.92	DEL	0.994	-	12	21
ZNF335	63925	genome.wustl.edu	37	20	44578874	44578876	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	TGT	TGT	TGT	-	TGT	TGT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr20:44578874_44578876delTGT	ENST00000322927.2	-	22	3569_3571	c.3469_3471delACA	c.(3469-3471)acadel	p.T1157del	ZNF335_ENST00000426788.1_In_Frame_Del_p.T1002del	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1157					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GGGTGGCCAGTGTTTCGTCATCA	0.626													ENSG00000198026																																					0																																										SO:0001651	inframe_deletion	0				AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3469_3471delACA	20.37:g.44578874_44578876delTGT	ENSP00000325326:p.Thr1157del		B4DLG7|Q548D0|Q9H684	In_Frame_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1157in_frame_del	ENST00000322927.2	37	c.3471_3469	CCDS13389.1	20																																																																																				ZNF335	-	NULL		0.626	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	0	0	0	35	35	59	0.00	0.00	TGT	NM_022095		44578876	-1	5	16	30	75	tier1	no_errors	ENST00000322927	ensembl	human	known	74_37	in_frame_del	14.29	17.58	DEL	0.141:0.993:0.993	-	5	30
SLC9A8	23315	genome.wustl.edu	37	20	48467301	48467301	+	Intron	DEL	T	T	-	rs564652819		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr20:48467301delT	ENST00000361573.2	+	7	576				SLC9A8_ENST00000417961.1_Frame_Shift_Del_p.G179fs|SLC9A8_ENST00000541138.1_Intron|SLC9A8_ENST00000539601.1_Intron			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8						ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TTCTCCAGGGTTTTTTTTTTG	0.333													ENSG00000197818																																					0										105,169,3990		0,0,105,2,165,1860	46.0	46.0	46.0			3.5	0.9	20		47	200,298,7756		0,0,200,6,286,3635	no	intron	SLC9A8	NM_015266.1		0,0,305,8,451,5495	A1A1,A1A2,A1R,A2A2,A2R,RR		6.0334,6.4259,6.1671			48467301	305,467,11746	2203	4300	6503	SO:0001627	intron_variant	0				AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.535-46T>-	20.37:g.48467301delT			B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Frame_Shift_Del	DEL	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F182fs	ENST00000361573.2	37	c.537	CCDS13421.1	20																																																																																				SLC9A8	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.333	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	HGNC	protein_coding	OTTHUMT00000106483.3	0	0	0	19	19	45	0.00	0.00	T	XM_030524		48467301	+1	6	10	15	50	tier1	no_errors	ENST00000417961	ensembl	human	known	74_37	frame_shift_del	28.57	16.67	DEL	0.189	-	6	15
PTTG1IP	754	genome.wustl.edu	37	21	46276273	46276276	+	Frame_Shift_Del	DEL	AAGT	AAGT	-			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	AAGT	AAGT	AAGT	-	AAGT	AAGT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr21:46276273_46276276delAAGT	ENST00000330938.3	-	4	501_504	c.281_284delACTT	c.(280-285)aactttfs	p.NF94fs	PTTG1IP_ENST00000494690.1_5'UTR|PTTG1IP_ENST00000397887.3_Intron|PTTG1IP_ENST00000397886.3_Frame_Shift_Del_p.NF73fs|PTTG1IP_ENST00000445724.2_Intron	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	94					multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)			ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		CAGCGCCTCAAAGTTCACTGGAGA	0.613													ENSG00000183255																																					0																																										SO:0001589	frameshift_variant	0				AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.281_284delACTT	21.37:g.46276273_46276276delAAGT	ENSP00000328325:p.Asn94fs		B2RDP7|D3DSL9|Q9NS09	Frame_Shift_Del	DEL	smart_Plexin-like_fold	p.N94fs	ENST00000330938.3	37	c.284_281	CCDS13715.1	21																																																																																				PTTG1IP	-	NULL		0.613	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG1IP	HGNC	protein_coding	OTTHUMT00000206553.1	0	0	0	45	45	121	0.00	0.00	AAGT			46276276	-1	3	21	20	52	tier1	no_errors	ENST00000330938	ensembl	human	known	74_37	frame_shift_del	13.04	28.77	DEL	0.995:1.000:1.000:1.000	-	3	20
ADIRF	10974	genome.wustl.edu	37	10	88728453	88728453	+	Intron	SNP	T	T	A	rs368836654	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:88728453T>A	ENST00000372013.3	+	1	414				ADIRF-AS1_ENST00000609111.1_RNA|ADIRF-AS1_ENST00000418273.2_RNA|RP11-96C23.5_ENST00000433214.2_RNA|ADIRF-AS1_ENST00000440490.1_RNA|RP11-96C23.15_ENST00000609363.1_RNA	NM_006829.2	NP_006820.1	Q15847	ADIRF_HUMAN	adipogenesis regulatory factor						cell differentiation (GO:0030154)|cellular response to cisplatin (GO:0072719)|cellular response to radiation (GO:0071478)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of response to drug (GO:2001023)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CGCAAGTTCCTGGACCGGCAG	0.701													ENSG00000272734																																					0																																										SO:0001627	intron_variant	0			-	BC004471	CCDS7381.1	10q23.31	2013-02-20	2013-02-20	2013-02-20	ENSG00000148671	ENSG00000148671			24043	protein-coding gene	gene with protein product	"""adipose specific 2"", ""adipose most abundant gene transcript 2"", ""adipogenesis factor rich in obesity"""		"""chromosome 10 open reading frame 116"""	C10orf116		8619847, 23239344	Standard	NM_006829		Approved	APM2, AFRO	uc001ked.2	Q15847	OTTHUMG00000018668	ENST00000372013.3:c.61+91T>A	10.37:g.88728453T>A				R	SNP	-	NULL	ENST00000372013.3	37	NULL	CCDS7381.1	10																																																																																			-	ADIRF-AS1	-	-		0.701	ADIRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADIRF-AS1	HGNC	protein_coding	OTTHUMT00000049194.1	0	0	0	13	13	19	0.00	0.00	T	NM_006829		88728453	-1	7	3	1	5	tier1	no_errors	ENST00000609111	ensembl	human	known	74_37	rna	87.50	33.33	SNP	0.000	A	7	1
ALMS1	7840	genome.wustl.edu	37	2	73827825	73827825	+	Missense_Mutation	SNP	G	G	A	rs187887110		TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:73827825G>A	ENST00000264448.6	+	18	11797	c.11686G>A	c.(11686-11688)Ggt>Agt	p.G3896S	ALMS1_ENST00000409009.1_Missense_Mutation_p.G3854S	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3896					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GATTGTGAACGGTGCCAAAAA	0.458													ENSG00000116127	G|||	1	0.000199681	0.0008	0.0	5008	,	,		19532	0.0		0.0	False		,,,				2504	0.0																0								G	SER/GLY	2,4152		0,2,2075	61.0	61.0	61.0		11686	4.2	0.2	2		61	0,8478		0,0,4239	no	missense	ALMS1	NM_015120.4	56	0,2,6314	AA,AG,GG		0.0,0.0481,0.0158	probably-damaging	3896/4168	73827825	2,12630	2077	4239	6316	SO:0001583	missense	0			GMAF=0.0005	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.11686G>A	2.37:g.73827825G>A	ENSP00000264448:p.Gly3896Ser		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.G3896S	ENST00000264448.6	37	c.11686	CCDS42697.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.43	3.621324	0.66787	4.81E-4	0.0	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.06849	3.26;3.25	5.2	4.25	0.50352	.	0.214042	0.33477	N	0.004873	T	0.16385	0.0394	L	0.46157	1.445	0.26659	N	0.971945	D;D	0.76494	0.999;0.999	D;P	0.67548	0.952;0.903	T	0.03761	-1.1006	10	0.46703	T	0.11	.	6.224	0.20698	0.1932:0.0:0.8068:0.0	.	3854;3896	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	S	3854;3896	ENSP00000386627:G3854S;ENSP00000264448:G3896S	ENSP00000264448:G3896S	G	+	1	0	ALMS1	73681333	0.990000	0.36364	0.232000	0.24009	0.820000	0.46376	2.265000	0.43311	2.718000	0.92993	0.650000	0.86243	GGT	rs187887110	ALMS1	-	NULL		0.458	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	0	0	0	95	95	112	0.00	0.00	G	NM_015120		73827825	+1	37	39	7	6	tier1	no_errors	ENST00000264448	ensembl	human	known	74_37	missense	84.09	86.67	SNP	0.127	A	37	7
LINC01159	102682016	genome.wustl.edu	37	2	105484676	105484676	+	RNA	SNP	C	C	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr2:105484676C>G	ENST00000433433.1	-	0	381				AC018730.3_ENST00000434764.1_RNA|RP11-13J10.1_ENST00000598623.1_RNA|AC018730.4_ENST00000454183.1_RNA																							GTGGGAGAGGCGCTGCTCTGG	0.652													ENSG00000229743																																					0																																												0			-																													2.37:g.105484676C>G				R	SNP	-	NULL	ENST00000433433.1	37	NULL		2																																																																																			-	AC018730.3	-	-		0.652	AC018730.3-001	KNOWN	basic	antisense	ENSG00000229743	Clone_based_vega_gene	antisense	OTTHUMT00000329325.1	0	0	0	50	50	24	0.00	0.00	C			105484676	-1	17	9	14	7	tier1	no_errors	ENST00000433433	ensembl	human	known	74_37	rna	54.84	56.25	SNP	0.002	G	17	14
KNDC1	85442	genome.wustl.edu	37	10	134980985	134980985	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr10:134980985G>C	ENST00000304613.3	+	2	224	c.203G>C	c.(202-204)aGc>aCc	p.S68T	KNDC1_ENST00000530127.1_3'UTR|KNDC1_ENST00000368571.2_Missense_Mutation_p.S3T|KNDC1_ENST00000368572.2_Missense_Mutation_p.S68T			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	68	KIND 1. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TCCATGCGGAGCGTGGCCCAC	0.657													ENSG00000171798																																					0													43.0	33.0	36.0					10																	134980985		2199	4298	6497	SO:0001583	missense	0			-	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.203G>C	10.37:g.134980985G>C	ENSP00000304437:p.Ser68Thr		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.S68T	ENST00000304613.3	37	c.203	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	.	13.72	2.322190	0.41096	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.73575	-0.76;-0.76;1.0	4.05	3.14	0.36123	KIND (2);	0.140304	0.44483	D	0.000444	T	0.81498	0.4835	M	0.62723	1.935	0.40708	D	0.982546	D;D	0.71674	0.998;0.996	D;D	0.70935	0.971;0.966	T	0.82002	-0.0673	10	0.87932	D	0	-9.6631	9.4479	0.38708	0.1089:0.0:0.8911:0.0	.	3;68	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	T	68;68;3	ENSP00000304437:S68T;ENSP00000357561:S68T;ENSP00000357560:S3T	ENSP00000304437:S68T	S	+	2	0	KNDC1	134830975	1.000000	0.71417	0.123000	0.21794	0.016000	0.09150	9.236000	0.95360	0.826000	0.34661	0.313000	0.20887	AGC	-	KNDC1	-	smart_KIND		0.657	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	0	0	0	56	56	9	0.00	0.00	G	NM_152643		134980985	+1	15	3	21	5	tier1	no_errors	ENST00000368572	ensembl	human	known	74_37	missense	41.67	37.50	SNP	1.000	C	15	21
PCDH20	64881	genome.wustl.edu	37	13	61987993	61987994	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr13:61987993_61987994insC	ENST00000409186.1	-	5	2343_2344	c.238_239insG	c.(238-240)gtgfs	p.V80fs	PCDH20_ENST00000409204.4_Frame_Shift_Ins_p.V80fs			Q8N6Y1	PCD20_HUMAN	protocadherin 20	80	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GCCGATGAGCACCCCCGCGGGT	0.663													ENSG00000197991																																					0																																										SO:0001589	frameshift_variant	0				AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.239dupG	13.37:g.61987998_61987998dupC	ENSP00000386653:p.Val80fs		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Frame_Shift_Ins	INS	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V80fs	ENST00000409186.1	37	c.239_238	CCDS9442.2	13																																																																																				PCDH20	-	pfscan_Cadherin		0.663	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2	0	0	0	18	18	20	0.00	0.00	-	NM_022843		61987994	-1	3	4	8	6	tier1	no_errors	ENST00000409186	ensembl	human	known	74_37	frame_shift_ins	27.27	40.00	INS	1.000:0.994	C	3	8
PCDH7	5099	genome.wustl.edu	37	4	30723421	30723421	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr4:30723421T>A	ENST00000361762.2	+	1	1385	c.377T>A	c.(376-378)cTg>cAg	p.L126Q	PCDH7_ENST00000543491.1_Missense_Mutation_p.L126Q	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	126	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGGGTGGACCTGTTTGAGGGT	0.622													ENSG00000169851																																					0													56.0	44.0	48.0					4																	30723421		2203	4300	6503	SO:0001583	missense	0			-	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.377T>A	4.37:g.30723421T>A	ENSP00000355243:p.Leu126Gln		O60246|O60247|Q4W5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L126Q	ENST00000361762.2	37	c.377	CCDS33971.1	4	.	.	.	.	.	.	.	.	.	.	T	18.10	3.549501	0.65311	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.59224	0.3;0.28	5.24	5.24	0.73138	Cadherin (3);	.	.	.	.	T	0.76176	0.3951	M	0.78456	2.415	0.52099	D	0.999948	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.79557	-0.1754	9	0.66056	D	0.02	.	14.8227	0.70085	0.0:0.0:0.0:1.0	.	126;126;126	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	Q	126	ENSP00000355243:L126Q;ENSP00000441802:L126Q	ENSP00000330302:L126Q	L	+	2	0	PCDH7	30332519	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	7.943000	0.87716	1.984000	0.57885	0.374000	0.22700	CTG	-	PCDH7	-	smart_Cadherin,pfscan_Cadherin		0.622	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1	0	0	0	61	61	60	0.00	0.00	T	NM_032457, NM_002589		30723421	+1	10	21	5	5	tier1	no_errors	ENST00000543491	ensembl	human	known	74_37	missense	66.67	80.77	SNP	1.000	A	10	5
TMEM132A	54972	genome.wustl.edu	37	11	60704165	60704165	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr11:60704165G>A	ENST00000453848.2	+	11	3016	c.2858G>A	c.(2857-2859)cGa>cAa	p.R953Q	TMEM132A_ENST00000005286.4_Missense_Mutation_p.R954Q			Q24JP5	T132A_HUMAN	transmembrane protein 132A	953	Confers cellular localization similar to full-length form. {ECO:0000250}.					endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						ACCCTGGCCCGAAAGGAGGCT	0.697													ENSG00000006118																																					0													10.0	14.0	13.0					11																	60704165		2179	4278	6457	SO:0001583	missense	0			-	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.2858G>A	11.37:g.60704165G>A	ENSP00000405823:p.Arg953Gln		Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	NULL	p.R954Q	ENST00000453848.2	37	c.2861	CCDS44618.1	11	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250416	0.59212	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	T;T	0.05925	3.37;3.37	4.55	4.55	0.56014	.	0.250281	0.28047	N	0.016809	T	0.09992	0.0245	L	0.53249	1.67	0.29495	N	0.85534	P;P	0.52061	0.95;0.95	B;B	0.42798	0.398;0.398	T	0.02661	-1.1127	10	0.87932	D	0	-20.3357	15.6405	0.76997	0.0:0.0:1.0:0.0	.	953;954	Q24JP5;Q24JP5-2	T132A_HUMAN;.	Q	704;953;954	ENSP00000405823:R953Q;ENSP00000005286:R954Q	ENSP00000005286:R954Q	R	+	2	0	TMEM132A	60460741	0.943000	0.32029	0.992000	0.48379	0.953000	0.61014	2.611000	0.46334	2.537000	0.85549	0.655000	0.94253	CGA	-	TMEM132A	-	NULL		0.697	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	TMEM132A	HGNC	protein_coding	OTTHUMT00000396352.1	0	0	0	41	41	20	0.00	0.00	G	NM_017870		60704165	+1	6	2	22	8	tier1	no_errors	ENST00000005286	ensembl	human	known	74_37	missense	21.43	20.00	SNP	0.905	A	6	22
KIAA2022	340533	genome.wustl.edu	37	X	73961334	73961334	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:73961334C>A	ENST00000055682.6	-	3	3669	c.3058G>T	c.(3058-3060)Gat>Tat	p.D1020Y		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1020					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GTGATATCATCATCGCCATCC	0.473													ENSG00000050030																																					0													78.0	71.0	74.0					X																	73961334		2203	4300	6503	SO:0001583	missense	0			-		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3058G>T	X.37:g.73961334C>A	ENSP00000055682:p.Asp1020Tyr		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.D1020Y	ENST00000055682.6	37	c.3058	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230222	0.79688	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.37584	1.19;1.19	5.58	5.58	0.84498	.	0.264036	0.42548	D	0.000691	T	0.50017	0.1591	L	0.47716	1.5	0.80722	D	1	P	0.45212	0.853	P	0.54026	0.74	T	0.50136	-0.8863	10	0.87932	D	0	-1.8784	18.6356	0.91378	0.0:1.0:0.0:0.0	.	1020	Q5QGS0	K2022_HUMAN	Y	1020	ENSP00000362567:D1020Y;ENSP00000055682:D1020Y	ENSP00000055682:D1020Y	D	-	1	0	KIAA2022	73878059	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.344000	0.79699	0.600000	0.82982	GAT	-	KIAA2022	-	NULL		0.473	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	0	0	0	37	37	127	0.00	0.00	C	NM_001008537		73961334	-1	3	9	14	83	tier1	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	17.65	9.78	SNP	1.000	A	3	14
TUBGCP5	114791	genome.wustl.edu	37	15	22851033	22851033	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr15:22851033G>T	ENST00000283645.4	+	11	1425	c.1295G>T	c.(1294-1296)cGg>cTg	p.R432L	TUBGCP5_ENST00000559846.1_3'UTR|TUBGCP5_ENST00000453949.2_Missense_Mutation_p.R432L	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	432					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.R432L(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		AATGTCGTCCGGGCCTCTCAC	0.478													ENSG00000153575																																					1	Substitution - Missense(1)	lung(1)											162.0	153.0	156.0					15																	22851033		2203	4300	6503	SO:0001583	missense	0			-	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.1295G>T	15.37:g.22851033G>T	ENSP00000283645:p.Arg432Leu		E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	pfam_TUBGCP	p.R432L	ENST00000283645.4	37	c.1295	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	.	19.13	3.767084	0.69878	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.08546	3.08;3.08	5.62	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.16300	0.0392	L	0.56769	1.78	0.80722	D	1	P;P	0.48834	0.916;0.916	P;P	0.49502	0.613;0.613	T	0.00446	-1.1734	10	0.39692	T	0.17	-23.5634	16.3335	0.83051	0.0:0.132:0.868:0.0	.	432;432	Q96RT8;E9PB12	GCP5_HUMAN;.	L	432	ENSP00000283645:R432L;ENSP00000409217:R432L	ENSP00000283645:R432L	R	+	2	0	TUBGCP5	20402474	1.000000	0.71417	0.992000	0.48379	0.887000	0.51463	7.332000	0.79203	2.795000	0.96236	0.655000	0.94253	CGG	-	TUBGCP5	-	pfam_TUBGCP		0.478	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	HGNC	protein_coding	OTTHUMT00000250998.2	0	0	0	47	47	150	0.00	0.00	G	NM_052903		22851033	+1	7	9	23	86	tier1	no_errors	ENST00000283645	ensembl	human	known	74_37	missense	23.33	9.47	SNP	1.000	T	7	23
JUN	3725	genome.wustl.edu	37	1	59248443	59248443	+	Silent	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:59248443G>A	ENST00000371222.2	-	1	1342	c.300C>T	c.(298-300)ccC>ccT	p.P100P	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	100					aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	TCACGTTCTTGGGGCACAGGA	0.672			A		sarcoma								ENSG00000177606																												Dom	yes		1	1p32-p31	3725	jun oncogene		M	0													75.0	82.0	80.0					1																	59248443		2203	4297	6500	SO:0001819	synonymous_variant	0			-	AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.300C>T	1.37:g.59248443G>A			Q6FHM7|Q96G93	Silent	SNP	pfam_JNK,pfam_bZIP,superfamily_TF_D-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.P100	ENST00000371222.2	37	c.300	CCDS610.1	1																																																																																			-	JUN	-	pfam_JNK		0.672	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUN	HGNC	protein_coding	OTTHUMT00000023042.1	0	0	0	43	43	34	0.00	0.00	G	NM_002228		59248443	-1	14	11	119	144	tier1	no_errors	ENST00000371222	ensembl	human	known	74_37	silent	10.53	7.10	SNP	1.000	A	14	119
COL19A1	1310	genome.wustl.edu	37	6	70909399	70909399	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr6:70909399A>C	ENST00000322773.4	+	49	3284	c.3182A>C	c.(3181-3183)aAg>aCg	p.K1061T	COL19A1_ENST00000393344.1_Missense_Mutation_p.K683T	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	1061	Triple-helical region 6 (COL6).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CCACCAGGGAAGGATGGGTTG	0.488													ENSG00000082293																																					0													67.0	71.0	69.0					6																	70909399		2203	4300	6503	SO:0001583	missense	0			-		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.3182A>C	6.37:g.70909399A>C	ENSP00000316030:p.Lys1061Thr		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.K1061T	ENST00000322773.4	37	c.3182	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	A	16.20	3.055660	0.55325	.	.	ENSG00000082293	ENST00000322773;ENST00000393344;ENST00000393333	D;D	0.93488	-3.23;-3.23	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.95098	0.8412	M	0.81497	2.545	0.47153	D	0.999336	D	0.89917	1.0	D	0.66084	0.941	D	0.93867	0.7159	10	0.15952	T	0.53	.	16.3469	0.83138	1.0:0.0:0.0:0.0	.	1061	Q14993	COJA1_HUMAN	T	1061;683;136	ENSP00000316030:K1061T;ENSP00000377013:K683T	ENSP00000316030:K1061T	K	+	2	0	COL19A1	70966120	1.000000	0.71417	0.993000	0.49108	0.774000	0.43823	6.372000	0.73123	2.263000	0.75096	0.528000	0.53228	AAG	-	COL19A1	-	NULL		0.488	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	0	0	0	86	86	90	0.00	0.00	A			70909399	+1	5	6	48	79	tier1	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	9.43	7.06	SNP	1.000	C	5	48
SLC13A4	26266	genome.wustl.edu	37	7	135366355	135366355	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr7:135366355A>G	ENST00000354042.4	-	16	2526	c.1837T>C	c.(1837-1839)Tac>Cac	p.Y613H	C7orf73_ENST00000422968.1_Intron|SLC13A4_ENST00000491630.1_5'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	613					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						CATGCTGGGTAAGTGTCCAGG	0.542													ENSG00000164707																																					0													188.0	139.0	156.0					7																	135366355		2203	4300	6503	SO:0001583	missense	0			-	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1837T>C	7.37:g.135366355A>G	ENSP00000297282:p.Tyr613His		A4D1Q4|Q8N631	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.Y613H	ENST00000354042.4	37	c.1837	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	A	16.03	3.008063	0.54361	.	.	ENSG00000164707	ENST00000354042	T	0.68765	-0.35	5.11	5.11	0.69529	.	0.111999	0.64402	D	0.000008	T	0.65954	0.2741	M	0.63843	1.955	0.31021	N	0.718109	D;P	0.57571	0.98;0.856	B;B	0.44278	0.445;0.328	T	0.74144	-0.3760	10	0.62326	D	0.03	.	12.9197	0.58224	1.0:0.0:0.0:0.0	.	482;613	Q59HF0;Q9UKG4	.;S13A4_HUMAN	H	613	ENSP00000297282:Y613H	ENSP00000297282:Y613H	Y	-	1	0	SLC13A4	135016895	1.000000	0.71417	0.981000	0.43875	0.408000	0.30992	9.103000	0.94232	2.160000	0.67779	0.454000	0.30748	TAC	-	SLC13A4	-	NULL		0.542	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	0	0	0	66	66	130	0.00	0.00	A	NM_012450		135366355	-1	18	24	146	485	tier1	no_errors	ENST00000354042	ensembl	human	known	74_37	missense	10.98	4.71	SNP	1.000	G	18	146
RP1-241P17.4	0	genome.wustl.edu	37	X	114953402	114953402	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chrX:114953402G>A	ENST00000449327.1	-	1	267	c.148C>T	c.(148-150)Cga>Tga	p.R50*																								AATCCCTGTCGTTCACAATAG	0.443													ENSG00000228532																																					0																																										SO:0001587	stop_gained	0			-																												ENST00000449327.1:c.148C>T	X.37:g.114953402G>A	ENSP00000391266:p.Arg50*			Nonsense_Mutation	SNP	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.R50*	ENST00000449327.1	37	c.148		X	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028590	0.35797	.	.	ENSG00000228532	ENST00000449327	.	.	.	1.79	-0.197	0.13228	.	0.127827	0.30285	U	0.009973	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4677	0.11698	0.1615:0.2279:0.6106:0.0	.	.	.	.	X	50	.	ENSP00000391266:R50X	R	-	1	2	RP1-241P17.4	114859658	0.991000	0.36638	0.338000	0.25549	0.422000	0.31414	0.406000	0.21032	-0.099000	0.12263	-0.583000	0.04132	CGA	-	RP1-241P17.4	-	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup		0.443	RP1-241P17.4-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000228532	Clone_based_vega_gene	protein_coding	OTTHUMT00000057980.1	0	0	0	96	96	0	0.00	0.00	G			114953402	-1	25	0	27	0	tier1	no_errors	ENST00000449327	ensembl	human	novel	74_37	nonsense	48.08	0.00	SNP	0.673	A	25	27
MUC4	4585	genome.wustl.edu	37	3	195506473	195506473	+	Missense_Mutation	SNP	A	A	G	rs201922637	byFrequency	TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr3:195506473A>G	ENST00000463781.3	-	2	12437	c.11978T>C	c.(11977-11979)gTa>gCa	p.V3993A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V3993A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.592													ENSG00000145113	.|||	1598	0.319089	0.6029	0.2147	5008	,	,		8683	0.0952		0.3479	False		,,,				2504	0.2106																0													10.0	7.0	8.0					3																	195506473		636	1378	2014	SO:0001583	missense	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11978T>C	3.37:g.195506473A>G	ENSP00000417498:p.Val3993Ala		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V3993A	ENST00000463781.3	37	c.11978	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	0.517	-0.863910	0.02590	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35605	1.44;1.3	0.481	-0.963	0.10330	.	0.000000	0.24912	N	0.034619	T	0.13030	0.0316	N	0.08118	0	0.80722	P	0.0	B	0.14805	0.011	B	0.06405	0.002	T	0.21655	-1.0239	8	.	.	.	.	3.3255	0.07066	0.247:0.2672:0.4857:0.0	.	3865	E7ESK3	.	A	3993	ENSP00000417498:V3993A;ENSP00000420243:V3993A	.	V	-	2	0	MUC4	196991252	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-0.813000	0.04491	-1.477000	0.01872	0.055000	0.15244	GTA	rs201922637	MUC4	-	NULL		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	14	14	0	0.00	0.00	A	NM_018406		195506473	-1	4	0	5	0	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	44.44	0.00	SNP	0.000	G	4	5
PRAMEF11	440560	genome.wustl.edu	37	1	12887523	12887523	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr1:12887523C>T	ENST00000535591.1	-	3	529	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	112					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						AGCCAAAGTTCTACAAACACA	0.498													ENSG00000204513																																					0																																										SO:0001583	missense	0			-	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.334G>A	1.37:g.12887523C>T	ENSP00000439551:p.Glu112Lys			Missense_Mutation	SNP	NULL	p.E112K	ENST00000535591.1	37	c.334	CCDS53268.1	1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.397443	0.25205	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.14022	2.54;2.54	1.48	1.48	0.22813	.	0.522608	0.16108	N	0.229234	T	0.11239	0.0274	L	0.45352	1.415	0.09310	N	1	B	0.27679	0.185	B	0.27380	0.079	T	0.21518	-1.0243	10	0.87932	D	0	.	6.4564	0.21932	0.0:1.0:0.0:0.0	.	112	O60813	PRA11_HUMAN	K	112;153;112	ENSP00000439551:E112K;ENSP00000391839:E112K	ENSP00000328783:E153K	E	-	1	0	PRAMEF11	12810110	0.000000	0.05858	0.018000	0.16275	0.012000	0.07955	0.131000	0.15870	1.137000	0.42214	0.400000	0.26472	GAA	-	PRAMEF11	-	NULL		0.498	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		0	0	0	240	240	0	0.00	0.00	C	XM_496341		12887523	-1	71	0	83	0	tier1	no_errors	ENST00000535591	ensembl	human	known	74_37	missense	46.10	0.00	SNP	0.020	T	71	83
SSTR3	6753	genome.wustl.edu	37	22	37603369	37603369	+	Silent	SNP	C	C	T			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr22:37603369C>T	ENST00000328544.3	-	2	1007	c.474G>A	c.(472-474)ccG>ccA	p.P158P	SSTR3_ENST00000402501.1_Silent_p.P158P	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	158					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	TGCGGGCCACCGGAGCTGTGC	0.682													ENSG00000183473																																					0													50.0	48.0	49.0					22																	37603369		2203	4298	6501	SO:0001819	synonymous_variant	0			-		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.474G>A	22.37:g.37603369C>T			A8K550|Q53ZR7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Somatstn_rcpt_3,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Somatstn_rcpt_5,prints_Neuropept_B/W_rcpt	p.P158	ENST00000328544.3	37	c.474	CCDS13944.1	22																																																																																			-	SSTR3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM		0.682	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR3	HGNC	protein_coding	OTTHUMT00000318802.1	0	0	0	18	18	2	0.00	0.00	C			37603369	-1	12	0	7	0	tier1	no_errors	ENST00000328544	ensembl	human	known	74_37	silent	63.16	0.00	SNP	0.000	T	12	7
RP11-105C19.2	0	genome.wustl.edu	37	16	22623130	22623130	+	lincRNA	SNP	G	G	A			TCGA-DX-A7EF-01A-11D-A33E-09	TCGA-DX-A7EF-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1c5c19d-3879-4216-ab2b-b4ab3be9ca98	c66e0b91-0c95-4208-90c7-39a8f030fff1	g.chr16:22623130G>A	ENST00000567401.1	-	0	387				RP11-105C19.1_ENST00000566098.1_lincRNA																							ACATAGGTGAGCTACAGATGG	0.393													ENSG00000260973																																					0																																												0			-																													16.37:g.22623130G>A				R	SNP	-	NULL	ENST00000567401.1	37	NULL		16																																																																																			-	RP11-105C19.2	-	-		0.393	RP11-105C19.2-001	KNOWN	basic	lincRNA	ENSG00000260973	Clone_based_vega_gene	lincRNA	OTTHUMT00000434000.1	0	0	0	49	49	37	0.00	0.00	G			22623130	-1	7	2	34	30	tier1	no_errors	ENST00000567401	ensembl	human	known	74_37	rna	17.07	6.25	SNP	0.395	A	7	34
