#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PCDH15	65217	genome.wustl.edu	37	10	55581545	55581545	+	3'UTR	SNP	G	G	A	rs184835185	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr10:55581545G>A	ENST00000320301.6	-	0	6335				PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000395433.1_3'UTR|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395432.2_3'UTR|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395430.1_3'UTR|PCDH15_ENST00000373957.3_3'UTR|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000361849.3_3'UTR|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000463095.1_5'UTR	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTCTTTGACGTTCAAATTTG	0.308										HNSCC(58;0.16)			ENSG00000150275																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.*73C>T	10.37:g.55581545G>A			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	R	SNP	-	NULL	ENST00000320301.6	37	NULL	CCDS7248.1	10																																																																																			-	PCDH15	-	-		0.308	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	0	0	0	48	48	91	0.00	0.00	G	NM_033056		55581545	-1	7	27	18	25	tier1	no_errors	ENST00000463095	ensembl	human	known	74_37	rna	28.00	51.92	SNP	0.158	A	7	18
LPL	4023	genome.wustl.edu	37	8	19811678	19811678	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr8:19811678C>T	ENST00000311322.8	+	5	1059	c.589C>T	c.(589-591)Cgt>Tgt	p.R197C		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	197					chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	AGCCCCGAGTCGTCTTTCTCC	0.463													ENSG00000175445																																					0													133.0	128.0	130.0					8																	19811678		2203	4300	6503	SO:0001583	missense	0			-		CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.589C>T	8.37:g.19811678C>T	ENSP00000309757:p.Arg197Cys		B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_Lipo_Lipase,prints_Lipase,pfscan_PLAT/LH2_dom,tigrfam_Lipo_Lipase	p.R197C	ENST00000311322.8	37	c.589	CCDS6012.1	8	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639105	0.67244	.	.	ENSG00000175445	ENST00000311322;ENST00000538071;ENST00000535763	D	0.93366	-3.21	6.17	6.17	0.99709	Lipase, N-terminal (1);	0.226102	0.47852	D	0.000212	D	0.97476	0.9174	H	0.94306	3.52	0.31507	N	0.664025	D	0.89917	1.0	D	0.76575	0.988	D	0.98183	1.0458	8	.	.	.	-23.5122	13.211	0.59825	0.1589:0.8411:0.0:0.0	.	197	P06858	LIPL_HUMAN	C	197;121;183	ENSP00000309757:R197C	.	R	+	1	0	LPL	19855958	0.992000	0.36948	0.997000	0.53966	0.393000	0.30537	2.861000	0.48380	2.941000	0.99782	0.655000	0.94253	CGT	-	LPL	-	pirsf_Lipoprotein_lipase_LIPH,pfam_Lipase_N,tigrfam_Lipo_Lipase		0.463	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPL	HGNC	protein_coding	OTTHUMT00000089113.3	0	0	0	87	87	78	0.00	0.00	C			19811678	+1	22	35	43	66	tier1	no_errors	ENST00000311322	ensembl	human	known	74_37	missense	33.85	34.65	SNP	0.989	T	22	43
LINC01235	401492	genome.wustl.edu	37	9	13408345	13408345	+	lincRNA	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:13408345C>T	ENST00000604724.1	-	0	361					NR_033863.1																						aatatcccatcaatatcccac	0.428													ENSG00000270547																																					0																																												0			-																													9.37:g.13408345C>T				R	SNP	-	NULL	ENST00000604724.1	37	NULL		9																																																																																			-	RP11-536O18.2	-	-		0.428	RP11-536O18.2-001	KNOWN	basic	lincRNA	FLJ41200	Clone_based_vega_gene	lincRNA	OTTHUMT00000469529.1	0	0	0	64	64	95	0.00	0.00	C			13408345	-1	8	14	32	92	tier1	no_errors	ENST00000604724	ensembl	human	known	74_37	rna	20.00	13.08	SNP	0.000	T	8	32
MS4A14	84689	genome.wustl.edu	37	11	60172032	60172032	+	Intron	SNP	T	T	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:60172032T>G	ENST00000300187.6	+	4	745				MS4A14_ENST00000395005.2_Intron|MS4A14_ENST00000395001.1_Missense_Mutation_p.L49R|MS4A14_ENST00000531787.1_Intron|MS4A14_ENST00000531783.1_Intron	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14							integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						ttcatccttctcactcctcca	0.448													ENSG00000166928																																					0																																										SO:0001627	intron_variant	0			-	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.468+1498T>G	11.37:g.60172032T>G			E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	pfam_CD20-like	p.L161R	ENST00000300187.6	37	c.482	CCDS31569.1	11	.	.	.	.	.	.	.	.	.	.	T	11.57	1.677943	0.29783	.	.	ENSG00000166928	ENST00000395001	.	.	.	2.08	0.919	0.19392	.	.	.	.	.	T	0.37489	0.1005	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37337	-0.9710	5	0.87932	D	0	.	3.9481	0.09356	0.0:0.1861:0.0:0.8139	.	.	.	.	R	49	.	ENSP00000378449:L49R	L	+	2	0	MS4A14	59928608	0.001000	0.12720	0.002000	0.10522	0.073000	0.16967	-0.172000	0.09868	0.265000	0.21872	0.451000	0.29950	CTC	-	MS4A14	-	NULL		0.448	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	HGNC	protein_coding	OTTHUMT00000395383.2	0	0	0	105	105	105	0.00	0.00	T			60172032	+1	8	21	45	95	tier1	no_errors	ENST00000525397	ensembl	human	known	74_37	missense	15.09	18.10	SNP	0.003	G	8	45
ACTL7B	10880	genome.wustl.edu	37	9	111617550	111617550	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:111617550G>A	ENST00000374667.3	-	1	1689	c.661C>T	c.(661-663)Cgc>Tgc	p.R221C		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	221						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)	p.R221S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TAGTCGGCGCGGCTGGTCAGG	0.662													ENSG00000148156																																					1	Substitution - Missense(1)	lung(1)											50.0	40.0	43.0					9																	111617550		2203	4300	6503	SO:0001583	missense	0			-	BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.661C>T	9.37:g.111617550G>A	ENSP00000363799:p.Arg221Cys		B2R9Q2|Q5JSV1	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R221C	ENST00000374667.3	37	c.661	CCDS6771.1	9	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867799	0.51588	.	.	ENSG00000148156	ENST00000374667	D	0.95137	-3.62	4.63	3.74	0.42951	.	0.389949	0.18921	N	0.127476	D	0.95487	0.8534	H	0.95043	3.615	0.50632	D	0.999887	B	0.23540	0.087	B	0.22386	0.039	D	0.94507	0.7715	10	0.87932	D	0	.	10.4648	0.44600	0.0948:0.0:0.9052:0.0	.	221	Q9Y614	ACL7B_HUMAN	C	221	ENSP00000363799:R221C	ENSP00000363799:R221C	R	-	1	0	ACTL7B	110657371	0.920000	0.31207	0.018000	0.16275	0.223000	0.24884	1.915000	0.39976	1.177000	0.42855	0.655000	0.94253	CGC	-	ACTL7B	-	pfam_Actin-related,smart_Actin-related		0.662	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7B	HGNC	protein_coding	OTTHUMT00000053571.1	0	0	0	25	25	19	0.00	0.00	G	NM_006686		111617550	-1	8	7	7	19	tier1	no_errors	ENST00000374667	ensembl	human	known	74_37	missense	53.33	26.92	SNP	0.808	A	8	7
PRTG	283659	genome.wustl.edu	37	15	55965592	55965592	+	Missense_Mutation	SNP	G	G	A	rs373946986		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr15:55965592G>A	ENST00000389286.4	-	10	1876	c.1829C>T	c.(1828-1830)aCg>aTg	p.T610M		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGCTTTGGGCGTCCTATGTGA	0.413													ENSG00000166450																																					0								G	MET/THR	2,3764		0,2,1881	61.0	60.0	60.0		1829	4.7	0.9	15		60	0,8220		0,0,4110	no	missense	PRTG	NM_173814.4	81	0,2,5991	AA,AG,GG		0.0,0.0531,0.0167	probably-damaging	610/1151	55965592	2,11984	1883	4110	5993	SO:0001583	missense	0			-	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.1829C>T	15.37:g.55965592G>A	ENSP00000373937:p.Thr610Met			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T610M	ENST00000389286.4	37	c.1829	CCDS42040.1	15	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389444	0.61956	5.31E-4	0.0	ENSG00000166450	ENST00000389286	T	0.62364	0.03	4.67	4.67	0.58626	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78489	0.4291	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81658	-0.0833	10	0.87932	D	0	-15.0501	16.9427	0.86222	0.0:0.0:1.0:0.0	.	610	Q2VWP7	PRTG_HUMAN	M	610	ENSP00000373937:T610M	ENSP00000373937:T610M	T	-	2	0	PRTG	53752884	1.000000	0.71417	0.865000	0.33974	0.346000	0.29079	9.457000	0.97630	2.306000	0.77630	0.650000	0.86243	ACG	-	PRTG	-	superfamily_Fibronectin_type3		0.413	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTG	HGNC	protein_coding	OTTHUMT00000419357.1	0	0	0	42	42	78	0.00	0.00	G	NM_173814		55965592	-1	7	26	21	80	tier1	no_errors	ENST00000389286	ensembl	human	known	74_37	missense	25.00	24.53	SNP	1.000	A	7	21
SEC16A	9919	genome.wustl.edu	37	9	139336249	139336249	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:139336249C>G	ENST00000371706.3	-	28	6396	c.6363G>C	c.(6361-6363)agG>agC	p.R2121S	INPP5E_ENST00000371712.3_5'Flank|SEC16A_ENST00000313050.7_Missense_Mutation_p.R2344S|SEC16A_ENST00000431893.2_Missense_Mutation_p.R2141S|SEC16A_ENST00000467838.1_5'UTR|SEC16A_ENST00000290037.6_Missense_Mutation_p.R2146S|SEC16A_ENST00000313084.5_Missense_Mutation_p.R372S			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	2166	Required for interaction with SEC23A.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCCTCCCTAGCCTTGAGCTCC	0.612													ENSG00000148396																																					0													62.0	73.0	70.0					9																	139336249		2106	4234	6340	SO:0001583	missense	0			-	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.6363G>C	9.37:g.139336249C>G	ENSP00000360771:p.Arg2121Ser		A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.R2344S	ENST00000371706.3	37	c.7032		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.98|14.98	2.697978|2.697978	0.48307|0.48307	.|.	.|.	ENSG00000148396|ENSG00000148396	ENST00000433860|ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000313084;ENST00000537660;ENST00000290037;ENST00000431893;ENST00000404925;ENST00000398348	.|T;T;T;T;T;T	.|0.71579	.|0.32;-0.58;0.79;1.29;1.1;1.1	5.26|5.26	2.38|2.38	0.29361|0.29361	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80053|0.80053	0.4553|0.4553	M|M	0.66939|0.66939	2.045|2.045	0.33139|0.33139	D|D	0.544082|0.544082	.|D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.997;1.0;0.998;1.0;1.0;0.999;1.0	.|D;D;D;D;D;D;D;D;D	.|0.87578	.|0.997;0.994;0.993;0.998;0.991;0.994;0.996;0.996;0.997	D|D	0.83729|0.83729	0.0197|0.0197	5|10	.|0.87932	.|D	.|0	-29.3916|-29.3916	10.1169|10.1169	0.42596|0.42596	0.0:0.7107:0.0:0.2893|0.0:0.7107:0.0:0.2893	.|.	.|184;2321;2188;2141;1714;2166;721;372;187	.|B4DY06;F1T0I1;O15027-5;O15027-4;A4QN19;O15027;C9JVR0;Q8N9G1;F6VLX6	.|.;.;.;.;.;SC16A_HUMAN;.;.;.	P|S	493|2344;738;1046;2121;372;187;2146;2141;1714;721	.|ENSP00000325827:R2344S;ENSP00000277537:R738S;ENSP00000403525:R1046S;ENSP00000360771:R2121S;ENSP00000290037:R2146S;ENSP00000387583:R2141S	.|ENSP00000277537:R738S	A|R	-|-	1|3	0|2	SEC16A|SEC16A	138456070|138456070	0.220000|0.220000	0.23631|0.23631	0.011000|0.011000	0.14972|0.14972	0.010000|0.010000	0.07245|0.07245	0.634000|0.634000	0.24614|0.24614	0.626000|0.626000	0.30322|0.30322	-0.274000|-0.274000	0.10170|0.10170	GCT|AGG	-	SEC16A	-	NULL		0.612	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	0	0	0	32	32	44	0.00	0.00	C	XM_088459		139336249	-1	12	25	11	17	tier1	no_errors	ENST00000313050	ensembl	human	known	74_37	missense	52.17	59.52	SNP	0.046	G	12	11
MARCH7	64844	genome.wustl.edu	37	2	160604560	160604560	+	Missense_Mutation	SNP	C	C	G	rs375346228		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:160604560C>G	ENST00000259050.4	+	5	881	c.759C>G	c.(757-759)atC>atG	p.I253M	MARCH7_ENST00000409175.1_Missense_Mutation_p.I253M|MARCH7_ENST00000409591.1_Missense_Mutation_p.I215M|MARCH7_ENST00000539065.1_Missense_Mutation_p.I197M|MARCH7_ENST00000473749.1_3'UTR	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	253	Ser-rich.				protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						AAGCCCCAATCATAAGCAATT	0.398													ENSG00000136536																																					0													43.0	42.0	43.0					2																	160604560		2203	4300	6503	SO:0001583	missense	0			-	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.759C>G	2.37:g.160604560C>G	ENSP00000259050:p.Ile253Met		A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.I253M	ENST00000259050.4	37	c.759	CCDS2210.1	2	.	.	.	.	.	.	.	.	.	.	C	9.329	1.060078	0.19987	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591	T;T;T;T	0.11821	2.75;2.75;2.75;2.74	5.87	1.38	0.22167	.	0.613165	0.17128	N	0.185927	T	0.05318	0.0141	N	0.08118	0	0.09310	N	0.999995	B;B;B	0.30709	0.017;0.291;0.291	B;B;B	0.28232	0.002;0.087;0.054	T	0.31558	-0.9939	10	0.45353	T	0.12	-14.5264	2.1867	0.03889	0.1254:0.2899:0.1233:0.4614	.	197;215;253	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	M	253;197;253;215	ENSP00000386830:I253M;ENSP00000442992:I197M;ENSP00000259050:I253M;ENSP00000387238:I215M	ENSP00000259050:I253M	I	+	3	3	MARCH7	160312806	0.222000	0.23652	0.540000	0.28089	0.804000	0.45430	-0.171000	0.09883	-0.081000	0.12662	0.650000	0.86243	ATC	-	MARCH7	-	NULL		0.398	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH7	HGNC	protein_coding	OTTHUMT00000255040.3	0	0	0	74	74	69	0.00	0.00	C	NM_022826		160604560	+1	8	28	22	38	tier1	no_errors	ENST00000259050	ensembl	human	known	74_37	missense	26.67	42.42	SNP	0.655	G	8	22
CUBN	8029	genome.wustl.edu	37	10	16942707	16942707	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr10:16942707G>T	ENST00000377833.4	-	53	8392	c.8327C>A	c.(8326-8328)tCc>tAc	p.S2776Y		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2776	CUB 20. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGCTGATTGGAACCTGACTG	0.448													ENSG00000107611																																					0													197.0	165.0	175.0					10																	16942707		2203	4300	6503	SO:0001583	missense	0			-	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8327C>A	10.37:g.16942707G>T	ENSP00000367064:p.Ser2776Tyr		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.S2776Y	ENST00000377833.4	37	c.8327	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316170	0.60524	.	.	ENSG00000107611	ENST00000377833	T	0.24723	1.84	5.59	5.59	0.84812	CUB (5);	0.000000	0.44097	D	0.000500	T	0.57873	0.2083	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.61337	-0.7083	10	0.72032	D	0.01	.	19.961	0.97250	0.0:0.0:1.0:0.0	.	2776	O60494	CUBN_HUMAN	Y	2776	ENSP00000367064:S2776Y	ENSP00000367064:S2776Y	S	-	2	0	CUBN	16982713	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	9.150000	0.94667	2.783000	0.95769	0.655000	0.94253	TCC	-	CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	0	0	0	78	78	84	0.00	0.00	G	NM_001081		16942707	-1	15	37	19	43	tier1	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	44.12	46.25	SNP	1.000	T	15	19
BRF1	2972	genome.wustl.edu	37	14	105678473	105678473	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:105678473C>T	ENST00000546474.1	-	16	16760	c.1801G>A	c.(1801-1803)Gca>Aca	p.A601T	BRF1_ENST00000379937.2_Missense_Mutation_p.A574T|BRF1_ENST00000392557.4_Missense_Mutation_p.A397T|BRF1_ENST00000379932.4_Intron|BRF1_ENST00000446501.2_Missense_Mutation_p.A363T|BRF1_ENST00000547530.1_Missense_Mutation_p.A127T|BRF1_ENST00000327359.3_Missense_Mutation_p.A486T|BRF1_ENST00000551787.1_Intron|BRF1_ENST00000440513.3_Missense_Mutation_p.A508T	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	601					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		ACCTTCTTTGCTGGCTGCGTA	0.627													ENSG00000185024																																					0													94.0	74.0	81.0					14																	105678473		2202	4299	6501	SO:0001583	missense	0			-	U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1801G>A	14.37:g.105678473C>T	ENSP00000448323:p.Ala601Thr		B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	pfam_TFIIB_cyclin,pfam_BRF1_TBP-bd,pfam_Znf_TFIIB,superfamily_Cyclin-like,smart_Cyclin-like,pfscan_Znf_TFIIB,prints_TFIIB	p.A601T	ENST00000546474.1	37	c.1801	CCDS10001.1	14	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592632	0.28357	.	.	ENSG00000185024	ENST00000392557;ENST00000379937;ENST00000546474;ENST00000547530;ENST00000446501;ENST00000327359;ENST00000440513	.	.	.	3.93	3.03	0.35002	.	0.228496	0.36066	N	0.002813	T	0.30417	0.0764	L	0.40543	1.245	0.09310	N	0.999993	B;P;P;B	0.35174	0.043;0.488;0.478;0.054	B;B;B;B	0.33254	0.054;0.079;0.16;0.034	T	0.17684	-1.0361	9	0.51188	T	0.08	.	7.972	0.30132	0.0:0.8797:0.0:0.1203	.	508;160;574;601	F5H5Z7;Q6ZV39;Q92994-5;Q92994	.;.;.;TF3B_HUMAN	T	397;574;601;127;363;486;508	.	ENSP00000329029:A486T	A	-	1	0	BRF1	104749518	0.035000	0.19736	0.157000	0.22605	0.559000	0.35586	0.588000	0.23924	0.926000	0.37118	0.430000	0.28490	GCA	-	BRF1	-	NULL		0.627	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF1	HGNC	protein_coding	OTTHUMT00000074548.4	0	0	0	80	80	68	0.00	0.00	C	NM_001519		105678473	-1	21	8	51	38	tier1	no_errors	ENST00000546474	ensembl	human	known	74_37	missense	28.77	17.39	SNP	0.033	T	21	51
PRIM2	5558	genome.wustl.edu	37	6	57498984	57498984	+	3'UTR	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:57498984G>T	ENST00000389488.2	+	0	1335				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATTTAGTAAAGGGGACACATT	0.299													ENSG00000146143																																					0													88.0	80.0	83.0					6																	57498984		1839	4083	5922	SO:0001624	3_prime_UTR_variant	0			-		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1332G>T	6.37:g.57498984G>T			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	R	SNP	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	PRIM2	-	-		0.299	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3	0	0	1	165	165	211	0.00	0.47	G	NM_000947		57498984	+1	18	21	106	141	tier1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	14.52	12.96	SNP	0.983	T	18	106
MAPKAP1	79109	genome.wustl.edu	37	9	128434681	128434681	+	Missense_Mutation	SNP	T	T	G	rs559227539		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:128434681T>G	ENST00000373498.1	-	1	241	c.173A>C	c.(172-174)aAt>aCt	p.N58T	MAPKAP1_ENST00000373511.2_Missense_Mutation_p.N58T|MAPKAP1_ENST00000373503.3_Intron|MAPKAP1_ENST00000350766.3_Missense_Mutation_p.N58T|MAPKAP1_ENST00000265960.3_Missense_Mutation_p.N58T|MAPKAP1_ENST00000394063.1_Intron|MAPKAP1_ENST00000394060.3_Missense_Mutation_p.N58T			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	58	Interaction with MAP3K2.|Interaction with NBN.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						AGTCTCACCATTGCTTCCCTG	0.438													ENSG00000119487																																					0													150.0	109.0	123.0					9																	128434681		2203	4300	6503	SO:0001583	missense	0			-	M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.173A>C	9.37:g.128434681T>G	ENSP00000362597:p.Asn58Thr		A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	pfam_SIN1	p.N58T	ENST00000373498.1	37	c.173	CCDS35140.1	9	.	.	.	.	.	.	.	.	.	.	T	8.392	0.839938	0.16891	.	.	ENSG00000119487	ENST00000373511;ENST00000350766;ENST00000373498;ENST00000265960;ENST00000373505;ENST00000394060;ENST00000373496;ENST00000433483	.	.	.	5.71	-0.554	0.11811	.	0.405452	0.32357	N	0.006216	T	0.36963	0.0986	N	0.22421	0.69	0.80722	D	1	B;B;B;B	0.24675	0.082;0.011;0.011;0.109	B;B;B;B	0.30943	0.023;0.014;0.013;0.122	T	0.06127	-1.0844	9	0.13470	T	0.59	-3.1463	8.6113	0.33804	0.0:0.4826:0.1154:0.402	.	58;58;58;58	Q9BPZ7-5;Q9BPZ7-3;Q9BPZ7-2;Q9BPZ7	.;.;.;SIN1_HUMAN	T	58;58;58;58;13;58;58;58	.	ENSP00000265960:N58T	N	-	2	0	MAPKAP1	127474502	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	0.844000	0.27654	-0.126000	0.11682	0.533000	0.62120	AAT	-	MAPKAP1	-	pfam_SIN1		0.438	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	MAPKAP1	HGNC	protein_coding	OTTHUMT00000054092.1	0	0	0	50	50	71	0.00	0.00	T			128434681	-1	17	16	35	76	tier1	no_errors	ENST00000265960	ensembl	human	known	74_37	missense	32.69	17.39	SNP	0.988	G	17	35
B3GNTL1	146712	genome.wustl.edu	37	17	80919003	80919003	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:80919003C>T	ENST00000320865.3	-	8	668	c.655G>A	c.(655-657)Gtc>Atc	p.V219I	B3GNTL1_ENST00000576599.1_Missense_Mutation_p.V108I|B3GNTL1_ENST00000571954.1_5'UTR	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	219							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			ACGCGGATGACGCCGCCGCCC	0.697													ENSG00000175711																																					0													36.0	32.0	33.0					17																	80919003		2203	4300	6503	SO:0001583	missense	0			-	AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.655G>A	17.37:g.80919003C>T	ENSP00000319979:p.Val219Ile		Q6GV30|Q8WUT3	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.V219I	ENST00000320865.3	37	c.655	CCDS32778.1	17	.	.	.	.	.	.	.	.	.	.	C	6.049	0.377366	0.11466	.	.	ENSG00000175711	ENST00000320865	T	0.47177	0.85	5.21	1.83	0.25207	.	0.195596	0.43747	D	0.000534	T	0.36248	0.0960	L	0.37630	1.12	0.09310	N	0.999994	B	0.20780	0.048	B	0.20384	0.029	T	0.21245	-1.0251	9	.	.	.	-32.6517	14.347	0.66672	0.0:0.577:0.423:0.0	.	219	Q67FW5	B3GNL_HUMAN	I	219	ENSP00000319979:V219I	.	V	-	1	0	B3GNTL1	78512292	0.035000	0.19736	0.008000	0.14137	0.041000	0.13682	1.447000	0.35101	0.676000	0.31285	0.650000	0.86243	GTC	-	B3GNTL1	-	NULL		0.697	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNTL1	HGNC	protein_coding	OTTHUMT00000438949.1	0	0	0	30	30	26	0.00	0.00	C	NM_001009905		80919003	-1	7	5	20	21	tier1	no_errors	ENST00000320865	ensembl	human	known	74_37	missense	25.93	19.23	SNP	0.056	T	7	20
MUC16	94025	genome.wustl.edu	37	19	9087836	9087836	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr19:9087836T>C	ENST00000397910.4	-	1	4182	c.3979A>G	c.(3979-3981)Act>Gct	p.T1327A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1327	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGATCCGTAGTGGTGATGTAG	0.517													ENSG00000181143																																					0													148.0	148.0	148.0					19																	9087836		2158	4260	6418	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.3979A>G	19.37:g.9087836T>C	ENSP00000381008:p.Thr1327Ala		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T1327A	ENST00000397910.4	37	c.3979	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	3.926	-0.017107	0.07681	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	1.48	-2.96	0.05547	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	.	.	.	B	0.27594	0.182	B	0.21708	0.036	T	0.45760	-0.9239	8	0.87932	D	0	.	2.5182	0.04674	0.4482:0.0:0.2307:0.3211	.	1327	B5ME49	.	A	1327	ENSP00000381008:T1327A	ENSP00000381008:T1327A	T	-	1	0	MUC16	8948836	0.000000	0.05858	0.000000	0.03702	0.248000	0.25809	-0.433000	0.06948	-1.160000	0.02804	0.254000	0.18369	ACT	-	MUC16	-	NULL		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	62	62	95	0.00	0.00	T	NM_024690		9087836	-1	7	34	46	119	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	13.21	22.22	SNP	0.000	C	7	46
E2F7	144455	genome.wustl.edu	37	12	77440013	77440013	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:77440013G>A	ENST00000322886.7	-	5	869	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W	E2F7_ENST00000416496.2_Missense_Mutation_p.R212W	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	212					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AGGCTGTGCCGTCCATGCCAG	0.517													ENSG00000165891																																					0													104.0	99.0	101.0					12																	77440013		2203	4300	6503	SO:0001583	missense	0			-	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.634C>T	12.37:g.77440013G>A	ENSP00000323246:p.Arg212Trp		A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	pfam_E2F_TDP	p.R212W	ENST00000322886.7	37	c.634	CCDS9016.1	12	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682816	0.88542	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669	T;T;T	0.21361	2.27;2.01;2.01	6.17	4.31	0.51392	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.103999	0.64402	D	0.000002	T	0.46580	0.1400	M	0.76002	2.32	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.44283	-0.9338	10	0.48119	T	0.1	-12.9512	14.932	0.70923	0.0:0.0:0.7388:0.2612	.	212;212	F8VSE7;Q96AV8	.;E2F7_HUMAN	W	212	ENSP00000323246:R212W;ENSP00000393639:R212W;ENSP00000448245:R212W	ENSP00000323246:R212W	R	-	1	2	E2F7	75964144	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	5.733000	0.68571	0.893000	0.36288	0.655000	0.94253	CGG	-	E2F7	-	NULL		0.517	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	HGNC	protein_coding	OTTHUMT00000406716.1	0	0	0	31	31	68	0.00	0.00	G	XM_084871		77440013	-1	9	25	14	34	tier1	no_errors	ENST00000322886	ensembl	human	known	74_37	missense	39.13	41.67	SNP	1.000	A	9	14
OTOA	146183	genome.wustl.edu	37	16	21716518	21716518	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:21716518G>A	ENST00000286149.4	+	11	1052	c.1051G>A	c.(1051-1053)Gac>Aac	p.D351N	OTOA_ENST00000388957.3_Missense_Mutation_p.D13N|OTOA_ENST00000388958.3_Missense_Mutation_p.D337N|OTOA_ENST00000388956.4_Missense_Mutation_p.D258N|OTOA_ENST00000569064.1_3'UTR			Q7RTW8	OTOAN_HUMAN	otoancorin	351					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		TTTCTACAATGACCTGGAATT	0.537													ENSG00000155719																																					0													107.0	100.0	102.0					16																	21716518		2199	4300	6499	SO:0001583	missense	0			-	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1051G>A	16.37:g.21716518G>A	ENSP00000286149:p.Asp351Asn		A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	NULL	p.D351N	ENST00000286149.4	37	c.1051		16	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257204	0.59321	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957	T;T;T;T	0.78003	2.67;-1.14;2.67;-1.14	5.3	5.3	0.74995	.	0.233267	0.43110	D	0.000618	T	0.71651	0.3365	L	0.47716	1.5	0.35084	D	0.763723	P;B;P	0.36909	0.573;0.214;0.573	B;B;B	0.34991	0.193;0.098;0.193	T	0.77419	-0.2595	10	0.30078	T	0.28	-8.938	16.4606	0.84044	0.0:0.0:1.0:0.0	.	258;13;337	B3KWU3;Q7RTW8-2;E9PF51	.;.;.	N	337;351;258;13	ENSP00000373610:D337N;ENSP00000286149:D351N;ENSP00000373608:D258N;ENSP00000373609:D13N	ENSP00000286149:D351N	D	+	1	0	OTOA	21624019	1.000000	0.71417	0.975000	0.42487	0.982000	0.71751	3.636000	0.54317	2.480000	0.83734	0.561000	0.74099	GAC	-	OTOA	-	NULL		0.537	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	0	0	0	69	69	73	0.00	0.00	G			21716518	+1	5	9	54	62	tier1	no_errors	ENST00000286149	ensembl	human	known	74_37	missense	8.47	12.50	SNP	1.000	A	5	54
SPP2	6694	genome.wustl.edu	37	2	234959657	234959657	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:234959657C>T	ENST00000168148.3	+	2	216	c.128C>T	c.(127-129)gCc>gTc	p.A43V	SPP2_ENST00000492481.1_3'UTR|SPP2_ENST00000373368.1_Missense_Mutation_p.A43V	NM_006944.2	NP_008875.1	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa	43					bone remodeling (GO:0046849)|negative regulation of endopeptidase activity (GO:0010951)|protein complex assembly (GO:0006461)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	endopeptidase inhibitor activity (GO:0004866)			breast(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		TTAAGGGATGCCCTCAGTGCC	0.493													ENSG00000072080																																					0													135.0	112.0	120.0					2																	234959657		2203	4300	6503	SO:0001583	missense	0			-		CCDS2511.1	2q37.1	2012-08-14	2002-08-29		ENSG00000072080	ENSG00000072080			11256	protein-coding gene	gene with protein product		602637	"""secreted phosphoprotein 2, 24kD"""			9533032	Standard	XM_005246102		Approved	SPP24	uc002vvk.1	Q13103	OTTHUMG00000059208	ENST00000168148.3:c.128C>T	2.37:g.234959657C>T	ENSP00000168148:p.Ala43Val		A4QMV3|Q3B892|Q546M5	Missense_Mutation	SNP	pfam_Spp-24,pfam_Prot_inh_cystat	p.A43V	ENST00000168148.3	37	c.128	CCDS2511.1	2	.	.	.	.	.	.	.	.	.	.	C	13.88	2.370472	0.42003	.	.	ENSG00000072080	ENST00000373368;ENST00000168148	T;T	0.69561	-0.41;-0.41	5.38	4.5	0.54988	.	0.142998	0.47455	N	0.000221	T	0.63745	0.2537	M	0.69823	2.125	0.30839	N	0.735835	P	0.52316	0.952	B	0.40636	0.335	T	0.71583	-0.4549	10	0.87932	D	0	-18.5772	10.4176	0.44331	0.0:0.9091:0.0:0.0909	.	43	Q13103	SPP24_HUMAN	V	43	ENSP00000362466:A43V;ENSP00000168148:A43V	ENSP00000168148:A43V	A	+	2	0	SPP2	234624396	0.978000	0.34361	0.108000	0.21378	0.544000	0.35116	2.283000	0.43470	1.261000	0.44149	0.650000	0.86243	GCC	-	SPP2	-	pfam_Prot_inh_cystat		0.493	SPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPP2	HGNC	protein_coding	OTTHUMT00000131313.3	0	0	0	39	39	79	0.00	0.00	C	NM_006944		234959657	+1	9	28	27	51	tier1	no_errors	ENST00000168148	ensembl	human	known	74_37	missense	25.00	35.44	SNP	0.383	T	9	27
RAG2	5897	genome.wustl.edu	37	11	36615530	36615530	+	Silent	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:36615530A>T	ENST00000311485.3	-	2	350	c.189T>A	c.(187-189)tcT>tcA	p.S63S	C11orf74_ENST00000347206.4_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000446510.2_5'Flank|C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000534635.1_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	63					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				AGGAATCCTTAGAGAAAATTG	0.468									Familial Hemophagocytic Lymphohistiocytosis				ENSG00000175097																																					0													132.0	137.0	135.0					11																	36615530		2202	4298	6500	SO:0001819	synonymous_variant	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	-	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.189T>A	11.37:g.36615530A>T			A8K9E9|Q8TBL4	Silent	SNP	pfam_RAG2,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_Znf_FYVE_PHD	p.S63	ENST00000311485.3	37	c.189	CCDS7903.1	11																																																																																			-	RAG2	-	pfam_RAG2,superfamily_Gal_Oxase/kelch_b-propeller		0.468	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG2	HGNC	protein_coding	OTTHUMT00000389536.1	0	0	0	96	96	117	0.00	0.00	A	NM_000536		36615530	-1	26	33	23	55	tier1	no_errors	ENST00000311485	ensembl	human	known	74_37	silent	53.06	37.08	SNP	0.411	T	26	23
SYTL3	94120	genome.wustl.edu	37	6	159178331	159178331	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:159178331G>A	ENST00000297239.9	+	13	1420	c.1226G>A	c.(1225-1227)gGa>gAa	p.G409E	SYTL3_ENST00000360448.3_Missense_Mutation_p.G341E|SYTL3_ENST00000367081.3_Missense_Mutation_p.G135E			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	409	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		GTGTTTCTTGGAGAAGTGATC	0.602													ENSG00000164674																																					0													80.0	68.0	72.0					6																	159178331		2203	4300	6503	SO:0001583	missense	0			-	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1226G>A	6.37:g.159178331G>A	ENSP00000297239:p.Gly409Glu		Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.G409E	ENST00000297239.9	37	c.1226	CCDS56458.1	6	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905204	0.92035	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	T;T;T	0.70516	-0.49;-0.49;-0.49	5.07	5.07	0.68467	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.058667	0.64402	D	0.000002	D	0.90287	0.6962	H	0.98901	4.365	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.989;0.993;0.999	D	0.94345	0.7574	10	0.87932	D	0	-5.9275	18.4301	0.90622	0.0:0.0:1.0:0.0	.	135;409;341	F8W7H4;Q4VX76;Q4VX76-2	.;SYTL3_HUMAN;.	E	341;409;409;135	ENSP00000353631:G341E;ENSP00000297239:G409E;ENSP00000356048:G135E	ENSP00000297239:G409E	G	+	2	0	SYTL3	159098319	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.712000	0.91403	2.356000	0.79943	0.491000	0.48974	GGA	-	SYTL3	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.602	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL3	HGNC	protein_coding	OTTHUMT00000042876.1	0	0	0	80	80	25	0.00	0.00	G			159178331	+1	19	9	35	15	tier1	no_errors	ENST00000297239	ensembl	human	known	74_37	missense	35.19	37.50	SNP	1.000	A	19	35
LOC100129345	100129345	genome.wustl.edu	37	14	98099864	98099864	+	lincRNA	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:98099864A>T	ENST00000355909.3	-	0	789					NR_033943.1																						ATGTTCTAGAACTGTACACCT	0.483													ENSG00000197176																																					0																																												0			-																													14.37:g.98099864A>T				R	SNP	-	NULL	ENST00000355909.3	37	NULL		14																																																																																			-	RP11-76E12.1	-	-		0.483	RP11-76E12.1-001	KNOWN	basic	lincRNA	LOC100129345	Clone_based_vega_gene	lincRNA	OTTHUMT00000413543.2	0	0	0	64	64	89	0.00	0.00	A			98099864	-1	16	12	75	83	tier1	no_errors	ENST00000355909	ensembl	human	known	74_37	rna	17.58	12.63	SNP	0.482	T	16	75
LPCAT2	54947	genome.wustl.edu	37	16	55559550	55559550	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:55559550G>T	ENST00000262134.5	+	2	486	c.302G>T	c.(301-303)gGt>gTt	p.G101V		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	101					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						CCAATAACTGGTTGGAGGAGG	0.323													ENSG00000087253																																					0													71.0	66.0	68.0					16																	55559550		2198	4300	6498	SO:0001583	missense	0			-	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.302G>T	16.37:g.55559550G>T	ENSP00000262134:p.Gly101Val		A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G101V	ENST00000262134.5	37	c.302	CCDS10753.1	16	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545044	0.27652	.	.	ENSG00000087253	ENST00000262134	T	0.27890	1.64	5.33	3.29	0.37713	.	0.098557	0.64402	D	0.000001	T	0.35624	0.0938	M	0.79805	2.47	0.80722	D	1	P	0.40302	0.712	B	0.41374	0.355	T	0.09952	-1.0651	10	0.33141	T	0.24	-3.8214	8.9079	0.35535	0.1684:0.0:0.8316:0.0	.	101	Q7L5N7	PCAT2_HUMAN	V	101	ENSP00000262134:G101V	ENSP00000262134:G101V	G	+	2	0	LPCAT2	54117051	1.000000	0.71417	0.839000	0.33178	0.922000	0.55478	1.522000	0.35921	0.637000	0.30526	0.591000	0.81541	GGT	-	LPCAT2	-	NULL		0.323	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT2	HGNC	protein_coding	OTTHUMT00000256977.2	0	0	0	82	82	99	0.00	0.00	G	NM_017839		55559550	+1	21	22	26	51	tier1	no_errors	ENST00000262134	ensembl	human	known	74_37	missense	44.68	30.14	SNP	0.986	T	21	26
KRT86	3892	genome.wustl.edu	37	12	52648079	52648079	+	Intron	SNP	C	C	T	rs541182091	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr12:52648079C>T	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCAGGAAGTCGATCTCCTGG	0.542													ENSG00000135477	C|||	2	0.000399361	0.0	0.0014	5008	,	,		19823	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001627	intron_variant	0			-	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+4867C>T	12.37:g.52648079C>T			P78387	R	SNP	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			-	KRT121P	-	-		0.542	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	HGNC	protein_coding		0	0	0	105	105	45	0.00	0.00	C	NM_002284		52648079	-1	27	17	39	32	tier1	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	40.91	34.69	SNP	0.834	T	27	39
SCN1A	6323	genome.wustl.edu	37	2	166854568	166854568	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:166854568A>T	ENST00000303395.4	-	23	4455	c.4456T>A	c.(4456-4458)Ttc>Atc	p.F1486I	SCN1A_ENST00000409050.1_Missense_Mutation_p.F1458I|SCN1A_ENST00000423058.2_Missense_Mutation_p.F1486I|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.F1475I			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1486					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTGGTTGAAATTATCTATG	0.333													ENSG00000144285																																					0													74.0	69.0	70.0					2																	166854568		2202	4295	6497	SO:0001583	missense	0			-	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4456T>A	2.37:g.166854568A>T	ENSP00000303540:p.Phe1486Ile		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.F1486I	ENST00000303395.4	37	c.4456	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	A	32	5.188809	0.94923	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.99269	0.9745	H	0.98351	4.21	0.58432	D	0.999998	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.91635	0.991;0.981;0.999	D	0.98614	1.0664	10	0.87932	D	0	.	14.9581	0.71135	1.0:0.0:0.0:0.0	.	1475;1458;1486	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	I	1486;1486;1475;1458	ENSP00000407030:F1486I;ENSP00000303540:F1486I;ENSP00000364554:F1475I;ENSP00000386312:F1458I	ENSP00000303540:F1486I	F	-	1	0	SCN1A	166562814	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.204000	0.95041	1.934000	0.56057	0.383000	0.25322	TTC	-	SCN1A	-	NULL		0.333	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	0	0	0	142	142	104	0.00	0.00	A	NM_006920		166854568	-1	42	56	18	22	tier1	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	70.00	70.89	SNP	1.000	T	42	18
CBR3	874	genome.wustl.edu	37	21	37518768	37518768	+	Silent	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr21:37518768A>T	ENST00000290354.5	+	3	1073	c.792A>T	c.(790-792)ccA>ccT	p.P264P	CBR3-AS1_ENST00000453159.1_RNA|CBR3-AS1_ENST00000608690.1_RNA|CBR3-AS1_ENST00000608622.1_RNA|CBR3-AS1_ENST00000608632.1_RNA|CBR3-AS1_ENST00000427491.1_RNA|CBR3-AS1_ENST00000608641.1_RNA|CBR3-AS1_ENST00000413862.1_RNA	NM_001236.3	NP_001227.1	O75828	CBR3_HUMAN	carbonyl reductase 3	264					cognition (GO:0050890)|phylloquinone catabolic process (GO:0042376)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	3-keto sterol reductase activity (GO:0000253)|carbonyl reductase (NADPH) activity (GO:0004090)|NADPH binding (GO:0070402)			kidney(1)|large_intestine(1)|lung(1)	3					Doxorubicin(DB00997)	CCACTGAGCCACAAGGCCAGT	0.498													ENSG00000159231																																					0													69.0	68.0	69.0					21																	37518768		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB004854	CCDS13642.1	21q22.2	2011-09-14			ENSG00000159231	ENSG00000159231	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	1549	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 21C, member 2"""	603608				9740676, 19027726	Standard	NM_001236		Approved	SDR21C2	uc002yve.3	O75828	OTTHUMG00000086617	ENST00000290354.5:c.792A>T	21.37:g.37518768A>T			Q6FHP2	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.P264	ENST00000290354.5	37	c.792	CCDS13642.1	21																																																																																			-	CBR3	-	NULL		0.498	CBR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBR3	HGNC	protein_coding	OTTHUMT00000194632.1	0	0	0	48	48	80	0.00	0.00	A			37518768	+1	7	17	37	73	tier1	no_errors	ENST00000290354	ensembl	human	known	74_37	silent	15.91	18.68	SNP	0.996	T	7	37
RB1	5925	genome.wustl.edu	37	13	49037972	49037972	+	Splice_Site	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:49037972G>A	ENST00000267163.4	+	21	2349		c.e21+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGTTCAGGAGGTAGGTAATTT	0.303		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	25	Whole gene deletion(15)|Unknown(10)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	GRCh37	CS013111|CS022882|CS040295	RB1	S							82.0	84.0	84.0					13																	49037972		2203	4291	6494	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2211+1G>A	13.37:g.49037972G>A			A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	-	e21+1	ENST00000267163.4	37	c.2211+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006365	0.93287	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47935973	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.281000	0.95811	2.941000	0.99782	0.655000	0.94253	.	-	RB1	-	-		0.303	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	32	32	85	0.00	0.00	G		Intron	49037972	+1	16	24	13	28	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	splice_site	55.17	46.15	SNP	1.000	A	16	13
CCDC18	343099	genome.wustl.edu	37	1	93730316	93730316	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:93730316C>T	ENST00000343253.7	+	27	4242	c.3740C>T	c.(3739-3741)tCt>tTt	p.S1247F	RP4-717I23.3_ENST00000602488.1_RNA|RP4-717I23.3_ENST00000442860.1_RNA|RP4-717I23.3_ENST00000457025.1_RNA|CCDC18_ENST00000334652.5_3'UTR|RP4-717I23.3_ENST00000415150.1_RNA|RP4-717I23.3_ENST00000446528.2_RNA|RP4-717I23.3_ENST00000455474.1_RNA|RP4-717I23.3_ENST00000414430.1_RNA|RP4-717I23.3_ENST00000413606.1_RNA|RP4-717I23.3_ENST00000424517.3_RNA|RP4-717I23.3_ENST00000427669.1_RNA|RP4-717I23.3_ENST00000451302.2_RNA|RP4-717I23.3_ENST00000429859.1_RNA|RP4-717I23.3_ENST00000447577.1_RNA|CCDC18_ENST00000557479.1_Missense_Mutation_p.S1366F|CCDC18_ENST00000401026.3_Missense_Mutation_p.S1248F|CCDC18_ENST00000338949.4_3'UTR			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	1247										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TCTCAAAAGTCTTCTGTTCAG	0.353													ENSG00000122483																																					0													91.0	85.0	86.0					1																	93730316		1856	4099	5955	SO:0001583	missense	0			-			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.3740C>T	1.37:g.93730316C>T	ENSP00000343377:p.Ser1247Phe		Q6ZU17	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tR-bd_arm	p.S1366F	ENST00000343253.7	37	c.4097		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.80|12.80	2.045600|2.045600	0.36085|0.36085	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000370276|ENST00000343253;ENST00000401026;ENST00000557479	.|.	.|.	.|.	5.77|5.77	3.84|3.84	0.44239|0.44239	.|.	.|0.550760	.|0.19223	.|N	.|0.119626	T|T	0.31295|0.31295	0.0792|0.0792	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	.|P;B	.|0.50617	.|0.937;0.384	.|P;B	.|0.53809	.|0.735;0.405	T|T	0.13442|0.13442	-1.0509|-1.0509	5|9	.|0.33141	.|T	.|0.24	.|.	12.839|12.839	0.57790|0.57790	0.0:0.6865:0.3135:0.0|0.0:0.6865:0.3135:0.0	.|.	.|166;1366	.|Q5T9S4;G3V388	.|.;.	F|F	1301|1247;1248;1366	.|.	.|ENSP00000343377:S1247F	L|S	+|+	1|2	0|0	CCDC18|CCDC18	93502904|93502904	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.981000|0.981000	0.71138|0.71138	0.985000|0.985000	0.29578|0.29578	0.748000|0.748000	0.32831|0.32831	0.591000|0.591000	0.81541|0.81541	CTT|TCT	-	CCDC18	-	superfamily_tR-bd_arm		0.353	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	HGNC	protein_coding	OTTHUMT00000382327.1	0	0	0	78	78	87	0.00	0.00	C	NM_206886		93730316	+1	10	26	37	58	tier1	no_errors	ENST00000557479	ensembl	human	known	74_37	missense	21.28	30.95	SNP	0.998	T	10	37
TTC1	7265	genome.wustl.edu	37	5	159492027	159492027	+	Silent	SNP	C	C	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:159492027C>G	ENST00000231238.5	+	8	944	c.834C>G	c.(832-834)ggC>ggG	p.G278G	TTC1_ENST00000520274.1_3'UTR|TTC1_ENST00000522793.1_Silent_p.G278G	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	278					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		CCTCTACCGGCTCGTACTCCA	0.383													ENSG00000113312																																					0													62.0	64.0	63.0					5																	159492027		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.834C>G	5.37:g.159492027C>G			B2RCT2|D3DQJ8|Q9BVT3	Silent	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G278	ENST00000231238.5	37	c.834	CCDS4348.1	5																																																																																			-	TTC1	-	NULL		0.383	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC1	HGNC	protein_coding	OTTHUMT00000252675.3	0	0	0	51	51	141	0.00	0.00	C	NM_003314		159492027	+1	17	86	9	59	tier1	no_errors	ENST00000231238	ensembl	human	known	74_37	silent	65.38	59.31	SNP	1.000	G	17	9
GPR34	2857	genome.wustl.edu	37	X	41555919	41555919	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chrX:41555919C>T	ENST00000378142.4	+	3	1317	c.1033C>T	c.(1033-1035)Cga>Tga	p.R345*	CASK_ENST00000421587.2_Intron|CASK_ENST00000378163.1_Intron|GPR34_ENST00000378138.5_Nonsense_Mutation_p.R345*|CASK_ENST00000442742.2_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000378166.4_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	345					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						TCTTTTTAGACGATTTCAAGG	0.393													ENSG00000171659																																					0													82.0	70.0	74.0					X																	41555919		2203	4300	6503	SO:0001587	stop_gained	0			-	AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.1033C>T	X.37:g.41555919C>T	ENSP00000367384:p.Arg345*		O95853	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R345*	ENST00000378142.4	37	c.1033	CCDS14258.1	X	.	.	.	.	.	.	.	.	.	.	C	34	5.320000	0.95682	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	.	.	.	5.83	0.889	0.19212	.	0.173984	0.36854	N	0.002369	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7513	11.9899	0.53169	0.5419:0.3766:0.0815:0.0	.	.	.	.	X	345;345;298	.	ENSP00000367378:R345X	R	+	1	2	GPR34	41440863	0.954000	0.32549	0.992000	0.48379	0.990000	0.78478	0.083000	0.14871	0.097000	0.17492	0.591000	0.81541	CGA	-	GPR34	-	NULL		0.393	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR34	HGNC	protein_coding	OTTHUMT00000056264.1	0	0	1	28	28	67	0.00	1.47	C	NM_005300		41555919	+1	28	95	3	10	tier1	no_errors	ENST00000378138	ensembl	human	known	74_37	nonsense	90.32	90.48	SNP	0.933	T	28	3
SIDT1	54847	genome.wustl.edu	37	3	113325932	113325932	+	Silent	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:113325932C>T	ENST00000264852.4	+	15	2175	c.1449C>T	c.(1447-1449)ttC>ttT	p.F483F	SIDT1_ENST00000463226.1_Intron|SIDT1_ENST00000393830.3_Silent_p.F483F	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	483					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						ACTACAACTTCCTCTGTGCTC	0.488													ENSG00000072858																																					0													144.0	116.0	126.0					3																	113325932		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1449C>T	3.37:g.113325932C>T			Q17RR4	Silent	SNP	NULL	p.F483	ENST00000264852.4	37	c.1449	CCDS2974.1	3																																																																																			-	SIDT1	-	NULL		0.488	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	0	0	0	104	104	134	0.00	0.00	C	NM_017699		113325932	+1	13	40	44	108	tier1	no_errors	ENST00000393830	ensembl	human	known	74_37	silent	22.81	27.03	SNP	1.000	T	13	44
CCDC40	55036	genome.wustl.edu	37	17	78073483	78073483	+	Missense_Mutation	SNP	G	G	A	rs368814379		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:78073483G>A	ENST00000397545.4	+	20	3365	c.3338G>A	c.(3337-3339)cGc>cAc	p.R1113H	GAA_ENST00000302262.3_5'Flank|GAA_ENST00000390015.3_5'Flank	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	1113					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ATCCTGGACCGCGTGCGGGAC	0.652													ENSG00000141519																																					0								G	HIS/ARG	0,4124		0,0,2062	42.0	48.0	46.0		3338	-0.3	0.0	17		46	1,8403		0,1,4201	no	missense	CCDC40	NM_017950.3	29	0,1,6263	AA,AG,GG		0.0119,0.0,0.0080	benign	1113/1143	78073483	1,12527	2062	4202	6264	SO:0001583	missense	0			-	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.3338G>A	17.37:g.78073483G>A	ENSP00000380679:p.Arg1113His		A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	pfam_E3_ubiquit_lig_BRE1	p.R1113H	ENST00000397545.4	37	c.3338	CCDS42395.1	17	.	.	.	.	.	.	.	.	.	.	G	7.263	0.605513	0.14002	0.0	1.19E-4	ENSG00000141519	ENST00000397545	T	0.45668	0.89	4.76	-0.311	0.12761	.	.	.	.	.	T	0.18800	0.0451	N	0.04297	-0.235	0.18873	N	0.999985	B;B	0.22276	0.008;0.067	B;B	0.13407	0.004;0.009	T	0.22906	-1.0203	9	0.22109	T	0.4	-13.0511	10.0461	0.42188	0.6186:0.0:0.3814:0.0	.	1113;896	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	H	1113	ENSP00000380679:R1113H	ENSP00000380679:R1113H	R	+	2	0	CCDC40	75688078	0.000000	0.05858	0.001000	0.08648	0.054000	0.15201	-0.114000	0.10757	-0.137000	0.11455	-0.290000	0.09829	CGC	-	CCDC40	-	NULL		0.652	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	0	0	0	76	76	22	0.00	0.00	G	XM_371082		78073483	+1	15	6	37	22	tier1	no_errors	ENST00000397545	ensembl	human	known	74_37	missense	28.85	21.43	SNP	0.107	A	15	37
CYP4A11	1579	genome.wustl.edu	37	1	47400674	47400674	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:47400674G>C	ENST00000310638.4	-	6	819	c.788C>G	c.(787-789)aCa>aGa	p.T263R	CYP4A11_ENST00000371904.4_Missense_Mutation_p.T263R|CYP4A11_ENST00000462347.1_Intron|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000457840.2_Intron|CYP4A11_ENST00000371905.1_Missense_Mutation_p.T263R	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	263					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	GACAGAACCTGTGTGCTGATG	0.582													ENSG00000187048																																					0													117.0	115.0	116.0					1																	47400674		2203	4300	6503	SO:0001583	missense	0			-	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.788C>G	1.37:g.47400674G>C	ENSP00000311095:p.Thr263Arg		Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.T263R	ENST00000310638.4	37	c.788	CCDS543.1	1	.	.	.	.	.	.	.	.	.	.	N	23.1	4.373327	0.82573	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.70045	-0.45;-0.34;-0.45	5.13	5.13	0.70059	.	0.053373	0.64402	D	0.000001	D	0.85230	0.5649	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88034	0.2777	10	0.87932	D	0	.	18.9327	0.92572	0.0:0.0:1.0:0.0	.	263	Q02928	CP4AB_HUMAN	R	263	ENSP00000311095:T263R;ENSP00000360971:T263R;ENSP00000360972:T263R	ENSP00000311095:T263R	T	-	2	0	CYP4A11	47173261	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	8.032000	0.88838	2.551000	0.86045	0.650000	0.86243	ACA	-	CYP4A11	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.582	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4A11	HGNC	protein_coding	OTTHUMT00000022022.1	0	0	0	56	56	20	0.00	0.00	G	NM_000778		47400674	-1	4	3	38	14	tier1	no_errors	ENST00000371904	ensembl	human	known	74_37	missense	9.52	17.65	SNP	1.000	C	4	38
ARHGAP31	57514	genome.wustl.edu	37	3	119133384	119133384	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:119133384A>T	ENST00000264245.4	+	12	3140	c.2608A>T	c.(2608-2610)Atc>Ttc	p.I870F		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	870					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GGAGGTTGAGATCGTCTCACA	0.507													ENSG00000031081																									Pancreas(7;176 297 5394 51128 51241)												0													91.0	94.0	93.0					3																	119133384		2046	4200	6246	SO:0001583	missense	0			-		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2608A>T	3.37:g.119133384A>T	ENSP00000264245:p.Ile870Phe		Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.I870F	ENST00000264245.4	37	c.2608	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	A	13.03	2.115588	0.37339	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.08896	3.04	4.66	-4.97	0.03029	.	1.287970	0.05227	N	0.509661	T	0.04952	0.0133	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43572	-0.9383	10	0.62326	D	0.03	.	2.0635	0.03597	0.4031:0.1316:0.3374:0.1279	.	870	Q2M1Z3	RHG31_HUMAN	F	870	ENSP00000264245:I870F	ENSP00000264245:I870F	I	+	1	0	ARHGAP31	120616074	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.536000	0.02208	-0.767000	0.04633	-0.366000	0.07423	ATC	-	ARHGAP31	-	NULL		0.507	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	0	0	0	71	71	99	0.00	0.00	A			119133384	+1	25	79	31	61	tier1	no_errors	ENST00000264245	ensembl	human	known	74_37	missense	44.64	55.63	SNP	0.000	T	25	31
PPP1R13B	23368	genome.wustl.edu	37	14	104202499	104202499	+	Silent	SNP	C	C	T	rs375070779		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:104202499C>T	ENST00000202556.9	-	16	3354	c.3072G>A	c.(3070-3072)gcG>gcA	p.A1024A	PPP1R13B_ENST00000423488.2_Missense_Mutation_p.V388I|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	1024	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				ACAGAGCATACGCCACACCTT	0.607													ENSG00000088808																																					0								C		0,4316		0,0,2158	142.0	145.0	144.0		3072	-0.1	0.6	14		144	1,8503		0,1,4251	no	coding-synonymous	PPP1R13B	NM_015316.2		0,1,6409	TT,TC,CC		0.0118,0.0,0.0078		1024/1091	104202499	1,12819	2158	4252	6410	SO:0001819	synonymous_variant	0			-	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.3072G>A	14.37:g.104202499C>T			B2RMX5|O94870	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V388I	ENST00000202556.9	37	c.1162	CCDS41997.1	14	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353459	0.61293	0.0	1.18E-4	ENSG00000088808	ENST00000423488	T	0.53640	0.61	5.39	-0.0717	0.13742	.	.	.	.	.	T	0.28797	0.0714	.	.	.	0.21184	N	0.999764	.	.	.	.	.	.	T	0.28235	-1.0050	6	0.16420	T	0.52	.	7.3741	0.26818	0.0:0.4407:0.3602:0.199	.	.	.	.	I	388	ENSP00000395213:V388I	ENSP00000395213:V388I	V	-	1	0	PPP1R13B	103272252	0.995000	0.38212	0.635000	0.29338	0.951000	0.60555	0.527000	0.22987	0.230000	0.21059	0.555000	0.69702	GTA	-	PPP1R13B	-	NULL		0.607	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R13B	HGNC	protein_coding	OTTHUMT00000414591.1	0	0	1	80	80	82	0.00	1.20	C	NM_015316		104202499	-1	21	45	32	39	tier1	no_errors	ENST00000423488	ensembl	human	known	74_37	missense	39.62	53.57	SNP	1.000	T	21	32
ITGAV	3685	genome.wustl.edu	37	2	187529902	187529902	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr2:187529902A>C	ENST00000261023.3	+	21	2397	c.2123A>C	c.(2122-2124)cAg>cCg	p.Q708P	AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000433736.2_Missense_Mutation_p.Q662P|ITGAV_ENST00000374907.3_Missense_Mutation_p.Q672P	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	708					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CAAACTCGCCAGGTGGTATGT	0.353													ENSG00000138448																									Melanoma(58;108 1995 6081)												0													74.0	75.0	74.0					2																	187529902		2203	4300	6503	SO:0001583	missense	0			-		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.2123A>C	2.37:g.187529902A>C	ENSP00000261023:p.Gln708Pro		A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.Q708P	ENST00000261023.3	37	c.2123	CCDS2292.1	2	.	.	.	.	.	.	.	.	.	.	A	16.02	3.003951	0.54254	.	.	ENSG00000138448	ENST00000261023;ENST00000374907;ENST00000433736	T;T;T	0.46819	0.86;0.86;0.86	5.89	5.89	0.94794	Integrin alpha-2 (1);	0.276884	0.40222	N	0.001159	T	0.37320	0.0999	N	0.19112	0.55	0.32286	N	0.567009	P;P;P	0.46784	0.884;0.817;0.884	B;P;B	0.45343	0.377;0.477;0.377	T	0.54043	-0.8352	10	0.72032	D	0.01	.	9.7992	0.40753	0.7446:0.0:0.0:0.2554	.	662;672;708	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	P	708;672;662	ENSP00000261023:Q708P;ENSP00000364042:Q672P;ENSP00000404291:Q662P	ENSP00000261023:Q708P	Q	+	2	0	ITGAV	187238147	0.954000	0.32549	1.000000	0.80357	0.998000	0.95712	2.298000	0.43602	2.250000	0.74265	0.477000	0.44152	CAG	-	ITGAV	-	pfam_Integrin_alpha-2		0.353	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	0	0	1	74	74	86	0.00	1.15	A	NM_002210		187529902	+1	5	29	35	43	tier1	no_errors	ENST00000261023	ensembl	human	known	74_37	missense	12.50	40.28	SNP	0.990	C	5	35
ADCYAP1R1	117	genome.wustl.edu	37	7	31124408	31124408	+	Silent	SNP	C	C	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr7:31124408C>G	ENST00000304166.4	+	8	784	c.495C>G	c.(493-495)ctC>ctG	p.L165L	ADCYAP1R1_ENST00000409489.1_Silent_p.L165L|ADCYAP1R1_ENST00000409363.1_Silent_p.L144L|ADCYAP1R1_ENST00000396211.2_Silent_p.L165L	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	165					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						GCACATCCCTCGTCACCCTCA	0.557													ENSG00000078549																									Ovarian(44;225 1186 2158 11092)												0													296.0	218.0	245.0					7																	31124408		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.495C>G	7.37:g.31124408C>G			A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_PACAP_1_rcpt,prints_GPCR_2_secretin-like	p.L165	ENST00000304166.4	37	c.495	CCDS5433.1	7																																																																																			-	ADCYAP1R1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.557	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADCYAP1R1	HGNC	protein_coding	OTTHUMT00000215041.3	0	0	0	76	76	92	0.00	0.00	C	NM_001118		31124408	+1	13	20	54	98	tier1	no_errors	ENST00000304166	ensembl	human	known	74_37	silent	19.40	16.95	SNP	0.304	G	13	54
OR5AC2	81050	genome.wustl.edu	37	3	97806244	97806244	+	Silent	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:97806244A>C	ENST00000358642.2	+	1	228	c.228A>C	c.(226-228)tcA>tcC	p.S76S		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	76					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						CTTGTACTTCAACCTCTATAA	0.428													ENSG00000196578																																					0													232.0	225.0	227.0					3																	97806244		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.228A>C	3.37:g.97806244A>C				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S76	ENST00000358642.2	37	c.228	CCDS33796.1	3																																																																																			-	OR5AC2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.428	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AC2	HGNC	protein_coding	OTTHUMT00000359116.1	0	0	0	60	60	110	0.00	0.00	A			97806244	+1	8	24	46	98	tier1	no_errors	ENST00000358642	ensembl	human	known	74_37	silent	14.81	19.67	SNP	0.001	C	8	46
BTG4	54766	genome.wustl.edu	37	11	111369380	111369380	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:111369380G>C	ENST00000356018.2	-	2	321	c.122C>G	c.(121-123)aCa>aGa	p.T41R	BTG4_ENST00000525791.1_Missense_Mutation_p.T41R	NM_017589.3	NP_060059.1	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4	41					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|neuron differentiation (GO:0030182)					large_intestine(2)|upper_aerodigestive_tract(1)	3		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		ACTTCTGTATGTTTCAAACAA	0.413													ENSG00000137707																																					0													129.0	111.0	117.0					11																	111369380		2201	4297	6498	SO:0001583	missense	0			-	AJ271351	CCDS8346.1	11q23	2008-05-27				ENSG00000137707			13862	protein-coding gene	gene with protein product		605673				10995567	Standard	NM_017589		Approved	PC3B	uc001plj.3	Q9NY30		ENST00000356018.2:c.122C>G	11.37:g.111369380G>C	ENSP00000348300:p.Thr41Arg		Q8NEH7	Missense_Mutation	SNP	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.T41R	ENST00000356018.2	37	c.122	CCDS8346.1	11	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635100	0.29068	.	.	ENSG00000137707	ENST00000356018;ENST00000525791;ENST00000456861	.	.	.	5.47	4.48	0.54585	Anti-proliferative protein (3);	0.243504	0.46758	D	0.000278	T	0.14227	0.0344	N	0.01668	-0.77	0.27557	N	0.950305	B;B	0.22003	0.002;0.063	B;B	0.22152	0.01;0.038	T	0.17501	-1.0367	9	0.14656	T	0.56	.	12.7162	0.57117	0.0:0.0:0.445:0.555	.	41;41	Q8NEH7;Q9NY30	.;BTG4_HUMAN	R	41	.	ENSP00000348300:T41R	T	-	2	0	BTG4	110874590	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	3.754000	0.55189	1.103000	0.41568	0.591000	0.81541	ACA	-	BTG4	-	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn		0.413	BTG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTG4	HGNC	protein_coding	OTTHUMT00000391177.1	0	0	0	68	68	54	0.00	0.00	G			111369380	-1	5	11	38	42	tier1	no_errors	ENST00000356018	ensembl	human	known	74_37	missense	11.63	20.37	SNP	0.974	C	5	38
KAT7	11143	genome.wustl.edu	37	17	47869337	47869337	+	Silent	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:47869337A>C	ENST00000259021.4	+	2	385	c.105A>C	c.(103-105)acA>acC	p.T35T	KAT7_ENST00000424009.2_Silent_p.T35T|KAT7_ENST00000510819.1_Silent_p.T35T|FAM117A_ENST00000514018.1_5'Flank|KAT7_ENST00000509773.1_Silent_p.T35T|KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000454930.2_Silent_p.T35T|KAT7_ENST00000503935.2_5'UTR	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	35	Ser-rich.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GTGATGGCACATCCCGACGAT	0.478													ENSG00000136504																																					0													134.0	120.0	125.0					17																	47869337		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.105A>C	17.37:g.47869337A>C			B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Silent	SNP	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.T35	ENST00000259021.4	37	c.105	CCDS11554.1	17																																																																																			-	KAT7	-	NULL		0.478	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	HGNC	protein_coding	OTTHUMT00000366032.1	0	0	0	101	101	56	0.00	0.00	A	NM_007067		47869337	+1	15	21	50	42	tier1	no_errors	ENST00000259021	ensembl	human	known	74_37	silent	23.08	33.33	SNP	0.112	C	15	50
HS3ST1	9957	genome.wustl.edu	37	4	11401252	11401252	+	Silent	SNP	C	C	T	rs190695013		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr4:11401252C>T	ENST00000002596.5	-	2	1552	c.378G>A	c.(376-378)tcG>tcA	p.S126S		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	126					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						GCACTTTGGGCGACGTGAAAT	0.607													ENSG00000002587																																					0													65.0	64.0	65.0					4																	11401252		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.378G>A	4.37:g.11401252C>T			B3KUA6|Q6PEY8	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S126	ENST00000002596.5	37	c.378	CCDS3408.1	4																																																																																			-	HS3ST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.607	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST1	HGNC	protein_coding	OTTHUMT00000207073.3	0	0	0	68	68	42	0.00	0.00	C	NM_005114		11401252	-1	10	19	26	54	tier1	no_errors	ENST00000002596	ensembl	human	known	74_37	silent	27.78	26.03	SNP	0.988	T	10	26
ABCA4	24	genome.wustl.edu	37	1	94497568	94497568	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:94497568G>A	ENST00000370225.3	-	27	3980	c.3894C>T	c.(3892-3894)aaC>aaT	p.N1298N		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1298					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGTGTCGGGGGTTGACGTTTT	0.527													ENSG00000198691																																					0													61.0	69.0	66.0					1																	94497568		2203	4299	6502	SO:0001819	synonymous_variant	0			-	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3894C>T	1.37:g.94497568G>A			O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.N1298	ENST00000370225.3	37	c.3894	CCDS747.1	1																																																																																			-	ABCA4	-	tigrfam_Rim_ABC_transpt		0.527	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	0	0	0	111	111	50	0.00	0.00	G	NM_000350		94497568	-1	46	35	30	27	tier1	no_errors	ENST00000370225	ensembl	human	known	74_37	silent	60.53	56.45	SNP	0.000	A	46	30
CAPN8	388743	genome.wustl.edu	37	1	223718162	223718162	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:223718162G>A	ENST00000366872.5	-	17	1817	c.1818C>T	c.(1816-1818)caC>caT	p.H606H				A6NHC0	CAN8_HUMAN	calpain 8	628	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						TCCTCATCTCGTGGGCATCGA	0.478													ENSG00000203697																																					0													105.0	91.0	96.0					1																	223718162		692	1591	2283	SO:0001819	synonymous_variant	0			-		CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1818C>T	1.37:g.223718162G>A			B2RXL2	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.H606	ENST00000366872.5	37	c.1818		1																																																																																			-	CAPN8	-	NULL		0.478	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	HGNC	protein_coding		0	0	0	89	89	68	0.00	0.00	G	NM_001143962		223718162	-1	15	16	44	43	tier1	no_errors	ENST00000366872	ensembl	human	known	74_37	silent	25.42	27.12	SNP	0.534	A	15	44
TKTL1	8277	genome.wustl.edu	37	X	153537746	153537746	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chrX:153537746G>T	ENST00000369915.3	+	3	491	c.302G>T	c.(301-303)gGa>gTa	p.G101V	TKTL1_ENST00000369912.2_Missense_Mutation_p.G45V|TKTL1_ENST00000217905.7_Intron	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	101					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAAGGACTGGGAGTTGCATGT	0.532													ENSG00000007350																																					0													329.0	278.0	296.0					X																	153537746		2203	4300	6503	SO:0001583	missense	0			-	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.302G>T	X.37:g.153537746G>T	ENSP00000358931:p.Gly101Val		A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.G101V	ENST00000369915.3	37	c.302	CCDS35448.1	X	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152625	0.57259	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000426989;ENST00000369912	T;T;T	0.30981	1.51;1.51;1.51	4.88	4.88	0.63580	Transketolase, N-terminal (1);	0.055419	0.64402	D	0.000001	T	0.63153	0.2487	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71189	-0.4666	10	0.59425	D	0.04	-25.6937	16.0378	0.80642	0.0:0.0:1.0:0.0	.	95;101	B7Z7I0;P51854	.;TKTL1_HUMAN	V	101;45;101;45	ENSP00000358931:G101V;ENSP00000401111:G101V;ENSP00000358928:G45V	ENSP00000358928:G45V	G	+	2	0	TKTL1	153190940	1.000000	0.71417	0.842000	0.33263	0.027000	0.11550	9.275000	0.95738	2.391000	0.81399	0.600000	0.82982	GGA	-	TKTL1	-	pfam_Transketolase_N,pfam_DH_E1		0.532	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL1	HGNC	protein_coding	OTTHUMT00000058923.1	0	0	0	47	47	52	0.00	0.00	G	NM_012253		153537746	+1	25	33	5	12	tier1	no_errors	ENST00000369915	ensembl	human	known	74_37	missense	83.33	73.33	SNP	0.998	T	25	5
ZNF688	146542	genome.wustl.edu	37	16	30582409	30582409	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:30582409T>C	ENST00000223459.6	-	2	1336	c.232A>G	c.(232-234)Atg>Gtg	p.M78V	ZNF688_ENST00000395219.1_Missense_Mutation_p.M64V|AC002310.7_ENST00000486926.1_RNA|ZNF688_ENST00000567855.1_Missense_Mutation_p.M78V|ZNF688_ENST00000563707.1_Intron|AC002310.7_ENST00000492040.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	78	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						TCCTGTTCCATCCAAGAGATG	0.632													ENSG00000229809																																					0													37.0	39.0	38.0					16																	30582409		2197	4300	6497	SO:0001583	missense	0			-	AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.232A>G	16.37:g.30582409T>C	ENSP00000223459:p.Met78Val		A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M78V	ENST00000223459.6	37	c.232	CCDS10684.1	16	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638833	0.29157	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.03413	3.94;5.79	5.2	2.98	0.34508	Krueppel-associated box (3);	.	.	.	.	T	0.01254	0.0041	N	0.01352	-0.895	0.29501	N	0.854958	B;B	0.17852	0.012;0.024	B;B	0.15052	0.004;0.012	T	0.41360	-0.9513	9	0.07030	T	0.85	.	6.2962	0.21087	0.0:0.1893:0.0:0.8107	.	78;64	P0C7X2;A8MV39	ZN688_HUMAN;.	V	64;78	ENSP00000378645:M64V;ENSP00000223459:M78V	ENSP00000223459:M78V	M	-	1	0	ZNF688	30489910	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.227000	0.32576	1.100000	0.41517	0.533000	0.62120	ATG	-	ZNF688	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.632	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF688	HGNC	protein_coding	OTTHUMT00000255544.2	0	0	1	156	156	54	0.00	1.82	T	NM_145271		30582409	-1	25	12	72	56	tier1	no_errors	ENST00000223459	ensembl	human	known	74_37	missense	25.77	17.65	SNP	1.000	C	25	72
LINC00577	100113403	genome.wustl.edu	37	6	105388262	105388262	+	lincRNA	SNP	G	G	A	rs369618674|rs200408621	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:105388262G>A	ENST00000369123.3	-	0	140					NR_046407.1				long intergenic non-protein coding RNA 577																		CGCTGCGCGCGGAGAGCCGGG	0.706													ENSG00000203809																																					0																																												0			-	AW612153, BF223582		6q21	2012-10-12	2012-03-01	2012-03-01	ENSG00000203809	ENSG00000203809		"""Long non-coding RNAs"""	21553	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 220"""	C6orf220			Standard	NR_046407		Approved	dJ439I14.1	uc031spf.1		OTTHUMG00000015289		6.37:g.105388262G>A				R	SNP	-	NULL	ENST00000369123.3	37	NULL		6																																																																																			-	LINC00577	-	-		0.706	LINC00577-001	KNOWN	basic	lincRNA	LINC00577	HGNC	lincRNA	OTTHUMT00000041645.2	0	0	0	60	60	8	0.00	0.00	G			105388262	-1	18	5	17	11	tier1	no_errors	ENST00000369123	ensembl	human	known	74_37	rna	51.43	31.25	SNP	0.008	A	18	17
LPCAT2	54947	genome.wustl.edu	37	16	55559549	55559549	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr16:55559549G>T	ENST00000262134.5	+	2	485	c.301G>T	c.(301-303)Ggt>Tgt	p.G101C		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	101					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						CCCAATAACTGGTTGGAGGAG	0.323													ENSG00000087253																																					0													72.0	66.0	68.0					16																	55559549		2198	4300	6498	SO:0001583	missense	0			-	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.301G>T	16.37:g.55559549G>T	ENSP00000262134:p.Gly101Cys		A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G101C	ENST00000262134.5	37	c.301	CCDS10753.1	16	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395408	0.62066	.	.	ENSG00000087253	ENST00000262134	T	0.29655	1.56	5.33	4.36	0.52297	.	0.098557	0.64402	D	0.000001	T	0.47764	0.1463	M	0.79805	2.47	0.58432	D	0.99999	D	0.54397	0.966	P	0.52309	0.695	T	0.54754	-0.8246	10	0.52906	T	0.07	-3.8214	13.8217	0.63325	0.0753:0.0:0.9247:0.0	.	101	Q7L5N7	PCAT2_HUMAN	C	101	ENSP00000262134:G101C	ENSP00000262134:G101C	G	+	1	0	LPCAT2	54117050	1.000000	0.71417	0.818000	0.32626	0.931000	0.56810	4.846000	0.62860	1.358000	0.45922	0.591000	0.81541	GGT	-	LPCAT2	-	NULL		0.323	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT2	HGNC	protein_coding	OTTHUMT00000256977.2	0	0	0	82	82	99	0.00	0.00	G	NM_017839		55559549	+1	21	22	26	50	tier1	no_errors	ENST00000262134	ensembl	human	known	74_37	missense	44.68	30.56	SNP	0.969	T	21	26
PPP2R5B	5526	genome.wustl.edu	37	11	64695300	64695300	+	Silent	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:64695300G>A	ENST00000164133.2	+	4	1045	c.423G>A	c.(421-423)ctG>ctA	p.L141L		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	141					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						TCCGGACTCTGCCGCCCAGTG	0.522													ENSG00000068971																																					0													81.0	81.0	81.0					11																	64695300		2201	4297	6498	SO:0001819	synonymous_variant	0			-	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.423G>A	11.37:g.64695300G>A			Q13853	Silent	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.L141	ENST00000164133.2	37	c.423	CCDS8085.1	11																																																																																			-	PPP2R5B	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.522	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	HGNC	protein_coding	OTTHUMT00000385465.1	0	0	0	75	75	90	0.00	0.00	G	NM_006244		64695300	+1	16	20	43	68	tier1	no_errors	ENST00000164133	ensembl	human	known	74_37	silent	27.12	22.47	SNP	0.968	A	16	43
CATSPER1	117144	genome.wustl.edu	37	11	65788571	65788571	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:65788571A>C	ENST00000312106.5	-	5	1914	c.1777T>G	c.(1777-1779)Tgc>Ggc	p.C593G		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	593					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						ATACAGAGGCAGGTAAACATG	0.662													ENSG00000175294																																					0													49.0	36.0	40.0					11																	65788571		2200	4295	6495	SO:0001583	missense	0			-	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1777T>G	11.37:g.65788571A>C	ENSP00000309052:p.Cys593Gly		Q96P76	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.C593G	ENST00000312106.5	37	c.1777	CCDS8127.1	11	.	.	.	.	.	.	.	.	.	.	A	18.43	3.622201	0.66787	.	.	ENSG00000175294	ENST00000312106	D	0.98567	-5.0	4.95	3.81	0.43845	Ion transport (1);	0.210019	0.24229	N	0.040370	D	0.96858	0.8974	N	0.25789	0.76	0.35241	D	0.777809	D	0.58268	0.982	P	0.58780	0.845	D	0.97241	0.9891	10	0.72032	D	0.01	-33.289	8.0064	0.30327	0.8187:0.0:0.0:0.1813	.	593	Q8NEC5	CTSR1_HUMAN	G	593	ENSP00000309052:C593G	ENSP00000309052:C593G	C	-	1	0	CATSPER1	65545147	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.622000	0.67750	0.718000	0.32166	0.459000	0.35465	TGC	-	CATSPER1	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel		0.662	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	HGNC	protein_coding	OTTHUMT00000391055.1	0	0	0	244	244	37	0.00	0.00	A	NM_053054		65788571	-1	95	26	93	15	tier1	no_errors	ENST00000312106	ensembl	human	known	74_37	missense	50.53	63.41	SNP	1.000	C	95	93
OR11L1	391189	genome.wustl.edu	37	1	248005032	248005032	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:248005032T>C	ENST00000355784.2	-	1	222	c.167A>G	c.(166-168)cAc>cGc	p.H56R		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	56						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CATAGGGGAGTGCAGTCGCAG	0.557													ENSG00000197591																																					0													75.0	66.0	69.0					1																	248005032		2203	4300	6503	SO:0001583	missense	0			-	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.167A>G	1.37:g.248005032T>C	ENSP00000348033:p.His56Arg			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.H56R	ENST00000355784.2	37	c.167	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	T	8.565	0.878660	0.17395	.	.	ENSG00000197591	ENST00000355784	T	0.15952	2.38	4.2	1.45	0.22620	GPCR, rhodopsin-like superfamily (1);	0.198503	0.24532	N	0.037718	T	0.17492	0.0420	L	0.61036	1.89	0.20563	N	0.999885	B	0.20780	0.048	B	0.25614	0.062	T	0.19910	-1.0291	10	0.62326	D	0.03	.	7.435	0.27150	0.0:0.2296:0.0:0.7704	.	56	Q8NGX0	O11L1_HUMAN	R	56	ENSP00000348033:H56R	ENSP00000348033:H56R	H	-	2	0	OR11L1	246071655	0.800000	0.28916	0.217000	0.23759	0.500000	0.33767	1.225000	0.32551	0.161000	0.19458	0.443000	0.29094	CAC	-	OR11L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.557	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	0	0	0	74	74	72	0.00	0.00	T	NM_001001959		248005032	-1	12	14	29	67	tier1	no_errors	ENST00000355784	ensembl	human	known	74_37	missense	29.27	17.28	SNP	0.663	C	12	29
TTC3	7267	genome.wustl.edu	37	21	38461127	38461127	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr21:38461127A>G	ENST00000399017.2	+	5	3114	c.367A>G	c.(367-369)Aag>Gag	p.K123E	TTC3_ENST00000540756.1_Intron|TTC3_ENST00000355666.1_Missense_Mutation_p.K123E|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000354749.2_Missense_Mutation_p.K123E|TTC3_ENST00000399010.1_Missense_Mutation_p.K123E	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	123					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GATAAATTTGAAGAAACTACA	0.328													ENSG00000182670																									Ovarian(38;194 1649 35661)												0													70.0	69.0	70.0					21																	38461127		2203	4300	6503	SO:0001583	missense	0			-	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.367A>G	21.37:g.38461127A>G	ENSP00000381981:p.Lys123Glu		A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like_dom,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.K123E	ENST00000399017.2	37	c.367	CCDS13651.1	21	.	.	.	.	.	.	.	.	.	.	A	14.12	2.440676	0.43326	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000399010;ENST00000399017;ENST00000354749	T;T;T;T;T;T	0.53423	2.43;0.62;2.39;2.74;2.74;2.74	4.85	3.7	0.42460	.	0.209144	0.32836	N	0.005598	T	0.39708	0.1088	M	0.61703	1.905	0.80722	D	1	B	0.30741	0.293	B	0.26517	0.07	T	0.28202	-1.0051	10	0.49607	T	0.09	-1.9079	5.6629	0.17678	0.7539:0.0:0.2461:0.0	.	123	P53804	TTC3_HUMAN	E	123	ENSP00000403943:K123E;ENSP00000408456:K123E;ENSP00000391891:K123E;ENSP00000347889:K123E;ENSP00000381981:K123E;ENSP00000346791:K123E	ENSP00000346791:K123E	K	+	1	0	TTC3	37382997	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.650000	0.46665	0.733000	0.32492	0.454000	0.30748	AAG	-	TTC3	-	NULL		0.328	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	0	0	0	84	84	29	0.00	0.00	A			38461127	+1	22	12	53	20	tier1	no_errors	ENST00000354749	ensembl	human	known	74_37	missense	29.33	37.50	SNP	1.000	G	22	53
RB1	5925	genome.wustl.edu	37	13	49037932	49037933	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	TG	TG	TG	-	TG	TG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr13:49037932_49037933delTG	ENST00000267163.4	+	21	2310_2311	c.2172_2173delTG	c.(2170-2175)attgtafs	p.V725fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	725	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)|p.I703_E737del(2)|p.C712_A727del(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCAAAATCATTGTAACAGCATA	0.302		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	28	Whole gene deletion(15)|Unknown(10)|Deletion - In frame(3)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|ovary(1)|prostate(1)|liver(1)																																								SO:0001589	frameshift_variant	0	Familial Cancer Database			M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2172_2173delTG	13.37:g.49037932_49037933delTG	ENSP00000267163:p.Val725fs		A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.V725fs	ENST00000267163.4	37	c.2172_2173	CCDS31973.1	13																																																																																				RB1	-	pfam_RB_B,superfamily_Cyclin-like,smart_Cyclin-like		0.302	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	34	34	93	0.00	0.00	TG			49037933	+1	7	9	19	44	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	26.92	16.98	DEL	0.997:1.000	-	7	19
CELSR3	1951	genome.wustl.edu	37	3	48700023	48700023	+	Silent	SNP	C	C	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:48700023C>A	ENST00000164024.4	-	1	325	c.45G>T	c.(43-45)tcG>tcT	p.S15S	CELSR3_ENST00000544264.1_Silent_p.S15S|RP11-148G20.1_ENST00000421275.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	15					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTATGGGGGTCGACCGTCCCC	0.741													ENSG00000008300																																					0													5.0	7.0	6.0					3																	48700023		1994	4057	6051	SO:0001819	synonymous_variant	0			-	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.45G>T	3.37:g.48700023C>A			O75092	Silent	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S15	ENST00000164024.4	37	c.45	CCDS2775.1	3																																																																																			-	CELSR3	-	NULL		0.741	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	0	0	0	22	22	6	0.00	0.00	C	NM_001407		48700023	-1	7	3	11	5	tier1	no_errors	ENST00000544264	ensembl	human	known	74_37	silent	38.89	37.50	SNP	0.009	A	7	11
DNAH9	1770	genome.wustl.edu	37	17	11833231	11833231	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr17:11833231G>C	ENST00000262442.4	+	63	11994	c.11926G>C	c.(11926-11928)Gag>Cag	p.E3976Q	DNAH9_ENST00000454412.2_Intron|DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000608377.1_Missense_Mutation_p.E288Q	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3976	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GAAGAAGCTGGAGGAGCACAG	0.587													ENSG00000007174																																					0													74.0	57.0	63.0					17																	11833231		2203	4300	6503	SO:0001583	missense	0			-	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11926G>C	17.37:g.11833231G>C	ENSP00000262442:p.Glu3976Gln		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E3976Q	ENST00000262442.4	37	c.11926	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029954	0.93575	.	.	ENSG00000007174	ENST00000262442;ENST00000396001	T;T	0.09817	2.94;2.94	5.19	5.19	0.71726	Dynein heavy chain (1);	0.053068	0.64402	D	0.000001	T	0.43897	0.1268	M	0.91249	3.19	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.54241	-0.8323	10	0.72032	D	0.01	.	18.9079	0.92471	0.0:0.0:1.0:0.0	.	3976	Q9NYC9	DYH9_HUMAN	Q	3976;288	ENSP00000262442:E3976Q;ENSP00000379323:E288Q	ENSP00000262442:E3976Q	E	+	1	0	DNAH9	11773956	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.601000	0.98297	2.699000	0.92147	0.563000	0.77884	GAG	-	DH9	-	pfam_Dynein_heavy_dom		0.587	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH9	HGNC	protein_coding	OTTHUMT00000252756.2	0	0	0	55	55	77	0.00	0.00	G	NM_001372		11833231	+1	15	25	130	232	tier1	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	10.34	9.73	SNP	1.000	C	15	130
ODF3	113746	genome.wustl.edu	37	11	198465	198465	+	Splice_Site	DEL	C	C	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:198465delC	ENST00000325113.4	+	5	731	c.414delC	c.(412-414)ggc>gg	p.G138fs	ODF3_ENST00000525282.1_Splice_Site_p.G138fs|BET1L_ENST00000410108.1_Intron	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	138					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)				biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		ACCCTGCAGGCCCCGCTGCGT	0.672													ENSG00000177947																																					0													47.0	47.0	47.0					11																	198465		2203	4300	6503	SO:0001630	splice_region_variant	0				AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.413-1C>-	11.37:g.198465delC			B7ZLT0|Q69YX0	Frame_Shift_Del	DEL	pfam_SHIPPO-rpt	p.A140fs	ENST00000325113.4	37	c.414	CCDS7688.1	11																																																																																				ODF3	-	NULL		0.672	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3	HGNC	protein_coding	OTTHUMT00000239287.1	0	0	0	63	63	11	0.00	0.00	C		Frame_Shift_Del	198465	+1	2	0	16	4	tier1	no_errors	ENST00000325113	ensembl	human	known	74_37	frame_shift_del	11.11	0.00	DEL	0.960	-	2	16
ZMYND19	116225	genome.wustl.edu	37	9	140481430	140481430	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr9:140481430delG	ENST00000298585.2	-	4	574	c.348delC	c.(346-348)tccfs	p.S117fs	ZMYND19_ENST00000471957.1_5'Flank	NM_138462.2	NP_612471.1	Q96E35	ZMY19_HUMAN	zinc finger, MYND-type containing 19	117						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synapse (GO:0045202)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		TCTGCTTGCTGGAGGTCTCTT	0.627													ENSG00000165724																																					0													48.0	45.0	46.0					9																	140481430		2203	4300	6503	SO:0001589	frameshift_variant	0				BC012948	CCDS7048.1	9q34.3	2008-02-05			ENSG00000165724	ENSG00000165724		"""Zinc fingers, MYND-type"""	21146	protein-coding gene	gene with protein product		611424					Standard	NM_138462		Approved	MIZIP	uc004cno.1	Q96E35	OTTHUMG00000020992	ENST00000298585.2:c.348delC	9.37:g.140481430delG	ENSP00000298585:p.Ser117fs		Q5T366	Frame_Shift_Del	DEL	pfam_Znf_MYND,pfscan_Znf_MYND	p.S117fs	ENST00000298585.2	37	c.348	CCDS7048.1	9																																																																																				ZMYND19	-	NULL		0.627	ZMYND19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND19	HGNC	protein_coding	OTTHUMT00000055356.1	0	0	0	96	96	20	0.00	0.00	G	NM_138462		140481430	-1	3	0	19	6	tier1	no_errors	ENST00000298585	ensembl	human	known	74_37	frame_shift_del	13.64	0.00	DEL	1.000	-	3	19
BRINP2	57795	genome.wustl.edu	37	1	177250848	177250848	+	3'UTR	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr1:177250848G>A	ENST00000361539.4	+	0	2848				BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GTGCGTGCGCGcacgcataca	0.522													ENSG00000198797																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.*184G>A	1.37:g.177250848G>A			O95560|Q6ZWC1|Q7LCZ9|Q8N360	R	SNP	-	NULL	ENST00000361539.4	37	NULL	CCDS1320.1	1																																																																																			-	BRINP2	-	-		0.522	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	HGNC	protein_coding	OTTHUMT00000084599.1	0	0	0	54	54	2	0.00	0.00	G	NM_021165		177250848	+1	8	0	27	6	tier1	no_errors	ENST00000478325	ensembl	human	known	74_37	rna	22.86	0.00	SNP	0.000	A	8	27
MN1	4330	genome.wustl.edu	37	22	28194934	28194936	+	In_Frame_Del	DEL	TGC	TGC	-	rs34890218|rs45480998|rs45597040	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr22:28194934_28194936delTGC	ENST00000302326.4	-	1	2550_2552	c.1596_1598delGCA	c.(1594-1599)cagcaa>caa	p.532_533QQ>Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	532	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q532Q(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ctgctgctgttgctgctgctgct	0.65			T	ETV6	"""AML, meningioma"""								ENSG00000169184																												Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	1	Substitution - coding silent(1)	prostate(1)								226,138,2110		41,6,138,37,58,957						-0.4	1.0		dbSNP_126	5	429,825,4222		34,24,337,178,445,1720	no	codingComplex	MN1	NM_002430.2		75,30,475,215,503,2677	A1A1,A1A2,A1R,A2A2,A2R,RR		22.8999,14.713,20.3522				655,963,6332				SO:0001651	inframe_deletion	0				X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1596_1598delGCA	22.37:g.28194943_28194945delTGC	ENSP00000304956:p.Gln550del		A9Z1V9	In_Frame_Del	DEL	NULL	p.Q536in_frame_del	ENST00000302326.4	37	c.1598_1596	CCDS42998.1	22																																																																																				MN1	-	NULL		0.650	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1	0	0	0	51	51	1	0.00	0.00	TGC	NM_002430		28194936	-1	3	0	30	5	tier1	no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	9.09	0.00	DEL	1.000:1.000:0.998	-	3	30
OR7E14P	10819	genome.wustl.edu	37	11	17073884	17073884	+	RNA	SNP	G	G	A			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr11:17073884G>A	ENST00000530490.1	+	0	676				AC116533.2_ENST00000583154.1_RNA					olfactory receptor, family 7, subfamily E, member 14 pseudogene																		TCTCCTATGCGGGCTGCCTGA	0.512													ENSG00000184669																																					0																																												0			-	AF065856		11p15.1	2012-08-09			ENSG00000184669	ENSG00000184669		"""GPCR / Class A : Olfactory receptors"""	8385	pseudogene	pseudogene				OR7E151P		9787077	Standard	NR_045002		Approved	OR11-5	uc021qeh.1		OTTHUMG00000165955		11.37:g.17073884G>A				R	SNP	-	NULL	ENST00000530490.1	37	NULL		11																																																																																			-	OR7E14P	-	-		0.512	OR7E14P-002	KNOWN	basic	processed_transcript	OR7E14P	HGNC	pseudogene	OTTHUMT00000387319.1	1	1	0	100	100	0	0.99	0.00	G			17073884	+1	7	0	67	2	tier1	no_errors	ENST00000530490	ensembl	human	known	74_37	rna	9.46	0.00	SNP	0.003	A	7	67
PBX2P1	5088	genome.wustl.edu	37	3	142897154	142897154	+	RNA	SNP	A	A	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr3:142897154A>T	ENST00000560287.1	+	0	2028									pre-B-cell leukemia homeobox 2 pseudogene 1																		ttttttttttAAAGAAAGAAA	0.348													ENSG00000244171																																					0																																												0			-			3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142897154A>T				R	SNP	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			-	PBX2P1	-	-		0.348	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	0	0	0	122	122	0	0.00	0.00	A	NG_002434		142897154	+1	8	0	82	1	tier1	no_errors	ENST00000560287	ensembl	human	known	74_37	rna	8.89	0.00	SNP	0.993	T	8	82
PDCD6	10016	genome.wustl.edu	37	5	271858	271869	+	In_Frame_Del	DEL	CCGGCCCTGGGG	CCGGCCCTGGGG	-	rs529816592|rs147793210|rs201564379	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	CCGGCCCTGGGG	CCGGCCCTGGGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:271858_271869delCCGGCCCTGGGG	ENST00000264933.4	+	1	123_134	c.23_34delCCGGCCCTGGGG	c.(22-36)cccggccctggggcc>ccc	p.GPGA9del	PDCD6_ENST00000509581.1_In_Frame_Del_p.GPGA9del|PDCD6_ENST00000507528.1_In_Frame_Del_p.GPGA9del|CTD-2083E4.6_ENST00000512642.1_RNA|PDCD6_ENST00000505221.1_In_Frame_Del_p.GPGA9del	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.A12_G15delAGPG(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCTTACCGCCCCGGCCCTGGGGCCGGCCCTGG	0.741													ENSG00000249915		513	0.102436	0.1316	0.1657	5008	,	,		10520	0.0546		0.0905	False		,,,				2504	0.0798																2	Deletion - In frame(2)	breast(2)								265,2557		60,145,1206						2.2	1.0		dbSNP_126	6	779,5791		158,463,2664	no	coding	PDCD6	NM_013232.3		218,608,3870	A1A1,A1R,RR		11.8569,9.3905,11.1158				1044,8348				SO:0001651	inframe_deletion	0				AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.23_34delCCGGCCCTGGGG	5.37:g.271858_271869delCCGGCCCTGGGG	ENSP00000264933:p.Gly9_Ala12del		B2RD16|E7ESR3|Q2YDC2|Q5TZS0	In_Frame_Del	DEL	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.AGPG12in_frame_del	ENST00000264933.4	37	c.23_34	CCDS3854.1	5																																																																																				PDCD6	-	NULL		0.741	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDCD6	HGNC	protein_coding	OTTHUMT00000206609.2	0	0	0	0	0	0	0.00	0.00	CCGGCCCTGGGG	NM_013232		271869	+1	0	0	0	0	tier1	no_errors	ENST00000264933	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.730:0.549:0.748:0.757:0.746:0.751:0.779:0.760:0.906:0.916:0.892:0.925	-	0	0
TBCA	6902	genome.wustl.edu	37	5	77072041	77072041	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:77072041C>T	ENST00000380377.4	-	1	144	c.41G>A	c.(40-42)gGc>gAc	p.G14D	TBCA_ENST00000306388.6_Missense_Mutation_p.G14D|TBCA_ENST00000522370.1_Intron|TBCA_ENST00000520039.1_Missense_Mutation_p.G14D|TBCA_ENST00000520361.1_Missense_Mutation_p.G14D|TBCA_ENST00000518338.2_Missense_Mutation_p.G14D	NM_004607.2	NP_004598.1	O75347	TBCA_HUMAN	tubulin folding cofactor A	14					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	chaperone binding (GO:0051087)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_lung(232;0.000511)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.02e-49)|Epithelial(54;1.05e-44)|all cancers(79;4.08e-40)		CTTCACCACGCCGGTCTTGAT	0.701													ENSG00000171530																																					0													31.0	28.0	29.0					5																	77072041		2192	4289	6481	SO:0001583	missense	0			-	AF038952	CCDS4040.1, CCDS75263.1	5q14.1	2008-02-05	2006-11-21		ENSG00000171530	ENSG00000171530			11579	protein-coding gene	gene with protein product		610058	"""tubulin-specific chaperone a"""			9653160, 8706133	Standard	XM_005248586		Approved		uc003kfh.1	O75347	OTTHUMG00000102173	ENST00000380377.4:c.41G>A	5.37:g.77072041C>T	ENSP00000369736:p.Gly14Asp		B4DT30	Missense_Mutation	SNP	pfam_CofA_tubulin-bd,superfamily_CofA_tubulin-bd	p.G14D	ENST00000380377.4	37	c.41	CCDS4040.1	5	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872930	0.91664	.	.	ENSG00000171530	ENST00000380377;ENST00000306388;ENST00000520361;ENST00000520039	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.73329	0.3573	M	0.78916	2.43	0.31051	N	0.715268	D;P	0.89917	1.0;0.956	D;P	0.76575	0.988;0.869	T	0.76080	-0.3090	9	0.54805	T	0.06	-2.2089	17.6639	0.88199	0.0:1.0:0.0:0.0	.	14;14	B4DT30;O75347	.;TBCA_HUMAN	D	14	.	ENSP00000306362:G14D	G	-	2	0	TBCA	77107797	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.472000	0.60189	2.319000	0.78375	0.555000	0.69702	GGC	-	TBCA	-	pfam_CofA_tubulin-bd,superfamily_CofA_tubulin-bd		0.701	TBCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCA	HGNC	protein_coding	OTTHUMT00000220021.3	0	0	0	54	54	0	0.00	0.00	C	NM_004607		77072041	-1	4	0	37	5	tier1	no_errors	ENST00000380377	ensembl	human	known	74_37	missense	9.76	0.00	SNP	1.000	T	4	37
THOC3	84321	genome.wustl.edu	37	5	175395009	175395009	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:175395009C>T	ENST00000265097.4	-	1	293	c.203G>A	c.(202-204)cGt>cAt	p.R68H	THOC3_ENST00000510300.1_5'Flank|THOC3_ENST00000513482.1_Missense_Mutation_p.R68H|THOC3_ENST00000514861.1_Intron	NM_032361.2	NP_115737.1	Q96J01	THOC3_HUMAN	THO complex 3	68					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)	4	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		GGCTAGGCGACGCCCGTCGCA	0.672													ENSG00000051596																																					0													11.0	12.0	12.0					5																	175395009		1939	3876	5815	SO:0001583	missense	0			-	BC006849	CCDS4397.1	5q35.3	2013-02-11			ENSG00000051596	ENSG00000051596		"""WD repeat domain containing"", ""THO complex subunits"""	19072	protein-coding gene	gene with protein product		606929				11979277	Standard	NM_032361		Approved	TEX1, MGC5469	uc003mdg.5	Q96J01	OTTHUMG00000130658	ENST00000265097.4:c.203G>A	5.37:g.175395009C>T	ENSP00000265097:p.Arg68His		Q6NZ53	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF_beta_prop-like,pfam_PD40,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R68H	ENST00000265097.4	37	c.203	CCDS4397.1	5	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183255	0.78677	.	.	ENSG00000051596	ENST00000265097;ENST00000513482	T;T	0.60171	0.21;0.21	3.97	3.97	0.46021	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.207319	0.36778	N	0.002415	T	0.67135	0.2861	L	0.53249	1.67	0.58432	D	0.999997	P;P	0.51933	0.949;0.868	P;P	0.57244	0.816;0.475	T	0.72093	-0.4394	10	0.72032	D	0.01	-4.2286	15.2133	0.73244	0.0:1.0:0.0:0.0	.	68;68	Q6NZ53;Q96J01	.;THOC3_HUMAN	H	68	ENSP00000265097:R68H;ENSP00000422243:R68H	ENSP00000265097:R68H	R	-	2	0	THOC3	175327615	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.246000	0.58740	2.027000	0.59764	0.511000	0.50034	CGT	-	THOC3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.672	THOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC3	HGNC	protein_coding	OTTHUMT00000253148.1	0	0	0	64	64	1	0.00	0.00	C			175395009	-1	4	0	29	5	tier1	no_errors	ENST00000265097	ensembl	human	known	74_37	missense	12.12	0.00	SNP	1.000	T	4	29
UFL1	23376	genome.wustl.edu	37	6	96969559	96969578	+	5'Flank	DEL	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC	-	rs3841018|rs112373805|rs67707404	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	AACCCCCAGCGCCGCGGTAC	AACCCCCAGCGCCGCGGTAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr6:96969559_96969578delAACCCCCAGCGCCGCGGTAC	ENST00000369278.4	+	0	0				UFL1_ENST00000461673.1_3'UTR|UFL1-AS1_ENST00000430796.1_RNA	NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1						negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										CGCCGGGAGGAACCCCCAGCGCCGCGGTACAACCACGGCA	0.7													ENSG00000014123		677	0.135184	0.1036	0.1772	5008	,	,		14561	0.0387		0.2157	False		,,,				2504	0.1646																0																																										SO:0001631	upstream_gene_variant	0				BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238		6.37:g.96969559_96969578delAACCCCCAGCGCCGCGGTAC	Exception_encountered		A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	R	DEL	-	NULL	ENST00000369278.4	37	NULL	CCDS5034.1	6																																																																																				UFL1	-	-		0.700	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	0	0	0	2	2	2	0.00	0.00	AACCCCCAGCGCCGCGGTAC	NM_015323		96969578	+1	0	0	2	2	tier1	no_errors	ENST00000461673	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.000:0.001:0.001:0.003:0.006:0.006:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-	0	2
LPCAT1	79888	genome.wustl.edu	37	5	1461841	1461842	+	3'UTR	INS	-	-	T	rs200268743		TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr5:1461841_1461842insT	ENST00000283415.3	-	0	3661_3662				LPCAT1_ENST00000503252.1_5'UTR	NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1						cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TTTATCAGAGATTTTTTTTTCT	0.441													ENSG00000153395																																					0																																										SO:0001624	3_prime_UTR_variant	0				BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.*1925->A	5.37:g.1461850_1461850dupT			Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	R	INS	-	NULL	ENST00000283415.3	37	NULL	CCDS3864.1	5																																																																																				LPCAT1	-	-		0.441	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	HGNC	protein_coding	OTTHUMT00000304032.1	0	0	0	90	90	114	0.00	0.00	-	NM_024830		1461842	-1	4	3	45	119	tier1	no_errors	ENST00000503252	ensembl	human	known	74_37	rna	8.16	2.46	INS	0.665:0.773	T	4	45
GALC	2581	genome.wustl.edu	37	14	88454869	88454870	+	Splice_Site	INS	-	-	A	rs561184126	byFrequency	TCGA-DX-A7EM-01A-11D-A36J-09	TCGA-DX-A7EM-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	de108904-cf45-4b19-9a45-e00f2a196711	da54443c-60f6-47cc-972a-f0a18afcf190	g.chr14:88454869_88454870insA	ENST00000261304.2	-	2	302		c.e2-2		GALC_ENST00000554916.1_Splice_Site|GALC_ENST00000544807.2_Splice_Site|GALC_ENST00000393568.4_Intron|GALC_ENST00000393569.2_Splice_Site	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase						carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGAGGTTGCCTAAAAAAAAAAG	0.351													ENSG00000054983																																					0																																										SO:0001630	splice_region_variant	0				L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.196-2->T	14.37:g.88454879_88454879dupA			B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Splice_Site	INS	-	e2-2	ENST00000261304.2	37	c.196-3_196-2	CCDS9878.2	14																																																																																				GALC	-	-		0.351	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALC	HGNC	protein_coding	OTTHUMT00000071559.2	0	0	0	29	29	70	0.00	0.00	-		Intron	88454870	-1	4	2	20	62	tier1	no_errors	ENST00000261304	ensembl	human	known	74_37	splice_site_ins	16.67	3.12	INS	1.000:0.945	A	4	20
