#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
COG8	84342	genome.wustl.edu	37	16	69354710	69354710	+	5'UTR	SNP	C	C	T			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr16:69354710C>T	ENST00000564419.1	-	0	268				VPS4A_ENST00000254950.11_Intron			Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8						protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						CTGGAGGCTTCCTCCCACCAT	0.627													ENSG00000213380																																					0													21.0	23.0	23.0					16																	69354710		2049	4181	6230	SO:0001623	5_prime_UTR_variant	0			-	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000564419.1:c.-668G>A	16.37:g.69354710C>T			Q0VAK2|Q8WVV6|Q9H6F8	R	SNP	-	NULL	ENST00000564419.1	37	NULL		16																																																																																			-	COG8	-	-		0.627	COG8-005	PUTATIVE	basic	processed_transcript	COG8	HGNC	protein_coding	OTTHUMT00000430567.1	0	0	0	13	13	64	0.00	0.00	C	NM_032382		69354710	-1	5	35	9	68	tier1	no_errors	ENST00000564419	ensembl	human	putative	74_37	rna	35.71	33.98	SNP	0.001	T	5	9
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510	C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GMAF=0.0005	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	rs28934576	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	33	33	102	0.00	0.00	C	NM_000546		7577120	-1	17	49	21	78	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	44.74	38.58	SNP	0.864	T	17	21
DPY19L3	147991	genome.wustl.edu	37	19	32954861	32954861	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr19:32954861C>G	ENST00000342179.5	+	14	1747	c.1532C>G	c.(1531-1533)tCa>tGa	p.S511*	DPY19L3_ENST00000586987.1_Nonsense_Mutation_p.S511*|DPY19L3_ENST00000590651.1_3'UTR|DPY19L3_ENST00000392250.2_Nonsense_Mutation_p.S511*	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	511						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					CTTCTGAAGTCAGTCCATCTT	0.408													ENSG00000178904																																					0													213.0	188.0	196.0					19																	32954861		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.1532C>G	19.37:g.32954861C>G	ENSP00000344937:p.Ser511*		Q68DC7|Q6ZTB7|Q6ZTS2	Nonsense_Mutation	SNP	pfam_Dpy-19	p.S511*	ENST00000342179.5	37	c.1532	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.291509	0.97449	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179	.	.	.	4.93	1.59	0.23543	.	0.715338	0.13844	N	0.358858	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.4215	5.2805	0.15673	0.0:0.2636:0.258:0.4783	.	.	.	.	X	511	.	ENSP00000315672:S511X	S	+	2	0	DPY19L3	37646701	0.038000	0.19896	0.039000	0.18376	0.981000	0.71138	0.247000	0.18179	-0.031000	0.13781	0.557000	0.71058	TCA	-	DPY19L3	-	pfam_Dpy-19		0.408	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	HGNC	protein_coding	OTTHUMT00000450311.1	0	0	0	86	86	103	0.00	0.00	C	NM_207325		32954861	+1	35	65	31	71	tier1	no_errors	ENST00000342179	ensembl	human	known	74_37	nonsense	53.03	47.79	SNP	0.002	G	35	31
NOS1	4842	genome.wustl.edu	37	12	117672496	117672496	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr12:117672496G>T	ENST00000338101.4	-	21	3215	c.3211C>A	c.(3211-3213)Cac>Aac	p.H1071N	NOS1_ENST00000317775.6_Missense_Mutation_p.H1037N|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ACACCCAGGTGGTCCCCAGGC	0.587													ENSG00000089250																									Esophageal Squamous(162;1748 2599 51982 52956)												0													45.0	50.0	48.0					12																	117672496		2038	4187	6225	SO:0001583	missense	0			-		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3211C>A	12.37:g.117672496G>T	ENSP00000337459:p.His1071Asn			Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/D-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.H1037N	ENST00000338101.4	37	c.3109	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.270846	0.95429	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.70164	-0.46;-0.46	5.05	5.05	0.67936	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.84456	0.5476	M	0.86953	2.85	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	D	0.87018	0.2127	10	0.72032	D	0.01	-41.9998	18.583	0.91178	0.0:0.0:1.0:0.0	.	1037	P29475	NOS1_HUMAN	N	932;1037;1037;1071	ENSP00000320758:H1037N;ENSP00000337459:H1071N	ENSP00000320758:H1037N	H	-	1	0	NOS1	116156879	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.525000	0.98039	2.615000	0.88500	0.561000	0.74099	CAC	-	NOS1	-	pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase		0.587	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	0	0	0	102	102	39	0.00	0.00	G			117672496	-1	37	33	56	35	tier1	no_errors	ENST00000317775	ensembl	human	known	74_37	missense	39.78	48.53	SNP	1.000	T	37	56
KCNV1	27012	genome.wustl.edu	37	8	110984849	110984849	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr8:110984849C>T	ENST00000524391.1	-	3	1661	c.629G>A	c.(628-630)cGt>cAt	p.R210H	RP11-696P8.2_ENST00000530667.1_RNA|KCNV1_ENST00000297404.1_Missense_Mutation_p.R210H			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	210					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			GCCAAAGATACGGGCAGCTGT	0.517													ENSG00000164794																																					0													93.0	87.0	89.0					8																	110984849		2203	4300	6503	SO:0001583	missense	0			-	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.629G>A	8.37:g.110984849C>T	ENSP00000435954:p.Arg210His		Q9UHJ4	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.R210H	ENST00000524391.1	37	c.629	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314042	0.81358	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.97642	-4.47;-4.47	5.35	5.35	0.76521	.	0.125508	0.47852	D	0.000210	D	0.97374	0.9141	M	0.82923	2.615	0.40274	D	0.97832	D	0.65815	0.995	P	0.51833	0.681	D	0.97730	1.0202	10	0.72032	D	0.01	.	11.5104	0.50490	0.0:0.9183:0.0:0.0817	.	210	Q6PIU1	KCNV1_HUMAN	H	210;210;86	ENSP00000435954:R210H;ENSP00000297404:R210H	ENSP00000297404:R210H	R	-	2	0	KCNV1	111054025	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.552000	0.53705	2.499000	0.84300	0.557000	0.71058	CGT	-	KCNV1	-	prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv4		0.517	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	0	0	0	65	65	69	0.00	0.00	C	NM_014379		110984849	-1	11	47	18	57	tier1	no_errors	ENST00000297404	ensembl	human	known	74_37	missense	37.93	45.19	SNP	1.000	T	11	18
MCF2L2	23101	genome.wustl.edu	37	3	182994710	182994710	+	Silent	SNP	C	C	T			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr3:182994710C>T	ENST00000328913.3	-	15	2109	c.1812G>A	c.(1810-1812)ggG>ggA	p.G604G	MCF2L2_ENST00000447025.2_Silent_p.G604G|MCF2L2_ENST00000414362.2_Silent_p.G604G|MCF2L2_ENST00000473233.1_Silent_p.G604G	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	604							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GCTCAGGGTTCCCCCTTTCAT	0.517													ENSG00000053524																																					0													29.0	28.0	28.0					3																	182994710		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1812G>A	3.37:g.182994710C>T			O94942|Q6P2B8|Q6ZVJ5|Q8N318	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G604	ENST00000328913.3	37	c.1812	CCDS3243.1	3																																																																																			-	MCF2L2	-	NULL		0.517	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	0	0	0	135	135	50	0.00	0.00	C	NM_015078		182994710	-1	46	33	66	40	tier1	no_errors	ENST00000328913	ensembl	human	known	74_37	silent	41.07	45.21	SNP	0.000	T	46	66
RP11-2H3.6	0	genome.wustl.edu	37	4	410222	410222	+	lincRNA	SNP	G	G	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr4:410222G>A	ENST00000609771.1	-	0	104																											AGAACTGAATGCATTTTTAGA	0.363													ENSG00000272885																																					0																																												0			-																													4.37:g.410222G>A				R	SNP	-	NULL	ENST00000609771.1	37	NULL		4																																																																																			-	RP11-2H3.6	-	-		0.363	RP11-2H3.6-001	KNOWN	basic	lincRNA	ENSG00000272885	Clone_based_vega_gene	lincRNA	OTTHUMT00000472396.1	0	0	0	31	31	42	0.00	0.00	G			410222	-1	6	12	18	20	tier1	no_errors	ENST00000609771	ensembl	human	known	74_37	rna	25.00	37.50	SNP	0.014	A	6	18
DYNC2H1	79659	genome.wustl.edu	37	11	103173848	103173848	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr11:103173848C>G	ENST00000375735.2	+	76	11266	c.11122C>G	c.(11122-11124)Cta>Gta	p.L3708V	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.L3715V|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3708	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCCACTGCCTCTAAATCTCAA	0.308													ENSG00000187240																																					0													53.0	47.0	49.0					11																	103173848		1800	4068	5868	SO:0001583	missense	0			-	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.11122C>G	11.37:g.103173848C>G	ENSP00000364887:p.Leu3708Val		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L3715V	ENST00000375735.2	37	c.11143	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746803	0.30955	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.09445	2.98;2.98	5.35	3.49	0.39957	Dynein heavy chain (1);	0.172959	0.39615	N	0.001303	T	0.15305	0.0369	M	0.69823	2.125	0.53688	D	0.999975	B;B	0.20164	0.042;0.034	B;B	0.28385	0.089;0.079	T	0.02464	-1.1155	10	0.32370	T	0.25	.	11.7772	0.51993	0.0:0.857:0.0:0.143	.	3708;3715	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	V	3708;3715	ENSP00000364887:L3708V;ENSP00000381167:L3715V	ENSP00000364887:L3708V	L	+	1	2	DYNC2H1	102679058	0.998000	0.40836	0.999000	0.59377	0.938000	0.57974	0.655000	0.24933	0.655000	0.30866	-0.136000	0.14681	CTA	-	DYNC2H1	-	pfam_Dynein_heavy_dom		0.308	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	0	0	0	153	153	42	0.00	0.00	C	XM_370652		103173848	+1	69	20	82	33	tier1	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	45.70	37.74	SNP	1.000	G	69	82
DYRK4	8798	genome.wustl.edu	37	12	4708298	4708298	+	Missense_Mutation	SNP	C	C	T	rs371159844		TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr12:4708298C>T	ENST00000540757.2	+	7	825	c.665C>T	c.(664-666)tCg>tTg	p.S222L	DYRK4_ENST00000543431.1_Missense_Mutation_p.S222L|DYRK4_ENST00000010132.5_Missense_Mutation_p.S222L	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	222	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			CAGATGCTTTCGGTAGAGAAA	0.463													ENSG00000010219																																					0								C	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	139.0	127.0	131.0		665	4.2	0.9	12		131	0,8600		0,0,4300	no	missense	DYRK4	NM_003845.1	145	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	222/521	4708298	1,13005	2203	4300	6503	SO:0001583	missense	0			-	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.665C>T	12.37:g.4708298C>T	ENSP00000441755:p.Ser222Leu		A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S222L	ENST00000540757.2	37	c.665	CCDS8530.1	12	.	.	.	.	.	.	.	.	.	.	C	10.28	1.305885	0.23736	2.27E-4	0.0	ENSG00000010219	ENST00000542744;ENST00000540757;ENST00000010132;ENST00000543431	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.29	4.15	0.48705	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.186823	0.47093	D	0.000242	T	0.43765	0.1262	N	0.21373	0.66	0.80722	D	1	B;B;B	0.31351	0.114;0.32;0.008	B;B;B	0.29524	0.024;0.103;0.046	T	0.36114	-0.9761	10	0.51188	T	0.08	.	6.7346	0.23403	0.7582:0.1627:0.0791:0.0	.	337;222;222	F5H6L9;Q9NR20-2;Q9NR20	.;.;DYRK4_HUMAN	L	337;222;222;222	ENSP00000437534:S337L;ENSP00000441755:S222L;ENSP00000010132:S222L;ENSP00000439697:S222L	ENSP00000010132:S222L	S	+	2	0	DYRK4	4578559	1.000000	0.71417	0.950000	0.38849	0.508000	0.34012	4.249000	0.58766	0.856000	0.35383	-0.410000	0.06199	TCG	-	DYRK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.463	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK4	HGNC	protein_coding	OTTHUMT00000398780.2	0	0	0	72	72	70	0.00	0.00	C			4708298	+1	31	44	12	14	tier1	no_errors	ENST00000010132	ensembl	human	known	74_37	missense	72.09	75.86	SNP	0.998	T	31	12
PCDH11X	27328	genome.wustl.edu	37	X	91642819	91642819	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chrX:91642819G>A	ENST00000373094.1	+	5	4075	c.3230G>A	c.(3229-3231)aGc>aAc	p.S1077N	PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000373097.1_Missense_Mutation_p.S1067N|PCDH11X_ENST00000361655.2_Missense_Mutation_p.S1067N|PCDH11X_ENST00000298274.8_Missense_Mutation_p.S1040N|PCDH11X_ENST00000406881.1_Missense_Mutation_p.S1077N|PCDH11X_ENST00000373088.1_Missense_Mutation_p.S1040N	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1077					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GATGCAGGCAGCCTTACCAGC	0.562													ENSG00000102290																									NSCLC(38;925 1092 2571 38200 45895)												0													173.0	132.0	146.0					X																	91642819		2201	4298	6499	SO:0001583	missense	0			-	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3230G>A	X.37:g.91642819G>A	ENSP00000362186:p.Ser1077Asn		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1077N	ENST00000373094.1	37	c.3230	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664728	0.29604	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.63580	-0.05;0.04;-0.03;0.07;-0.0;-0.03	3.4	2.43	0.29744	.	0.000000	0.53938	U	0.000055	T	0.60586	0.2280	L	0.58810	1.83	0.23776	N	0.99687	P;P;P;P;P	0.48503	0.82;0.911;0.911;0.911;0.856	P;P;P;P;B	0.44990	0.466;0.466;0.466;0.466;0.276	T	0.59236	-0.7492	10	0.87932	D	0	.	12.6145	0.56569	0.0:0.1849:0.8151:0.0	.	1040;1067;1077;1067;1077	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	N	1077;1067;1040;1067;1077;1077;1040	ENSP00000362186:S1077N;ENSP00000362189:S1067N;ENSP00000362180:S1040N;ENSP00000355105:S1067N;ENSP00000384758:S1077N;ENSP00000298274:S1040N	ENSP00000298274:S1040N	S	+	2	0	PCDH11X	91529475	1.000000	0.71417	0.957000	0.39632	0.190000	0.23558	2.941000	0.49011	1.297000	0.44761	0.502000	0.49764	AGC	-	PCDH11X	-	NULL		0.562	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	0	0	0	87	87	63	0.00	0.00	G	NM_032969		91642819	+1	35	48	29	53	tier1	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	54.69	47.52	SNP	0.862	A	35	29
DNAH5	1767	genome.wustl.edu	37	5	13911598	13911598	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr5:13911598A>G	ENST00000265104.4	-	12	1645	c.1541T>C	c.(1540-1542)aTt>aCt	p.I514T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	514	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGTTGCCACAATGCCCTGAAA	0.318									Kartagener syndrome				ENSG00000039139																																					0													93.0	93.0	93.0					5																	13911598		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1541T>C	5.37:g.13911598A>G	ENSP00000265104:p.Ile514Thr		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.I514T	ENST00000265104.4	37	c.1541	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582887	0.46006	.	.	ENSG00000039139	ENST00000265104	T	0.56611	0.45	5.6	5.6	0.85130	Dynein heavy chain, domain-1 (1);	0.161531	0.53938	D	0.000051	T	0.52741	0.1753	M	0.66439	2.03	0.48135	D	0.999599	B	0.12630	0.006	B	0.27715	0.082	T	0.54377	-0.8303	10	0.59425	D	0.04	.	10.4439	0.44481	0.9271:0.0:0.0729:0.0	.	514	Q8TE73	DYH5_HUMAN	T	514	ENSP00000265104:I514T	ENSP00000265104:I514T	I	-	2	0	DNAH5	13964598	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.608000	0.74168	2.264000	0.75181	0.533000	0.62120	ATT	-	DH5	-	pfam_Dynein_heavy_dom-1		0.318	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH5	HGNC	protein_coding	OTTHUMT00000207057.2	0	0	0	111	111	58	0.00	0.00	A	NM_001369		13911598	-1	135	140	45	39	tier1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	75.00	78.21	SNP	1.000	G	135	45
OR5B3	441608	genome.wustl.edu	37	11	58170846	58170846	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr11:58170846G>C	ENST00000309403.2	-	1	36	c.37C>G	c.(37-39)Cta>Gta	p.L13V		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTTAGTCCTAGAAGAATGAAT	0.383													ENSG00000172769																																					0													120.0	117.0	118.0					11																	58170846		2199	4285	6484	SO:0001583	missense	0			-	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.37C>G	11.37:g.58170846G>C	ENSP00000308270:p.Leu13Val		Q6IEV6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L13V	ENST00000309403.2	37	c.37	CCDS31549.1	11	.	.	.	.	.	.	.	.	.	.	g	1.884	-0.457218	0.04540	.	.	ENSG00000172769	ENST00000309403	T	0.00631	6.09	4.05	1.9	0.25705	.	0.000000	0.34067	N	0.004298	T	0.00695	0.0023	L	0.35723	1.085	0.09310	N	1	B	0.16802	0.019	B	0.19666	0.026	T	0.46289	-0.9202	10	0.17832	T	0.49	-4.3513	12.9589	0.58447	0.0:0.305:0.695:0.0	.	13	Q8NH48	OR5B3_HUMAN	V	13	ENSP00000308270:L13V	ENSP00000308270:L13V	L	-	1	2	OR5B3	57927422	0.000000	0.05858	0.243000	0.24186	0.496000	0.33645	-1.406000	0.02490	1.014000	0.39417	0.484000	0.47621	CTA	-	OR5B3	-	NULL		0.383	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B3	HGNC	protein_coding	OTTHUMT00000394886.1	0	0	0	53	53	126	0.00	0.00	G	NM_001005469		58170846	-1	12	68	19	72	tier1	no_errors	ENST00000309403	ensembl	human	known	74_37	missense	38.71	48.57	SNP	0.029	C	12	19
CENPH	64946	genome.wustl.edu	37	5	68490472	68490472	+	Splice_Site	SNP	A	A	C			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr5:68490472A>C	ENST00000283006.2	+	3	277		c.e3-1		CENPH_ENST00000515001.1_Splice_Site	NM_022909.3	NP_075060.1			centromere protein H											kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		ATTTATTTGCAGGTGAAGAAA	0.284													ENSG00000153044																																					0													37.0	42.0	40.0					5																	68490472		2197	4298	6495	SO:0001630	splice_region_variant	0			-	AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.191-1A>C	5.37:g.68490472A>C				Splice_Site	SNP	-	e3-2	ENST00000283006.2	37	c.191-2	CCDS3998.1	5	.	.	.	.	.	.	.	.	.	.	A	11.86	1.763656	0.31228	.	.	ENSG00000153044	ENST00000283006;ENST00000515001;ENST00000502689	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1177	0.48270	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CENPH	68526228	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	4.152000	0.58111	2.194000	0.70268	0.482000	0.46254	.	-	CENPH	-	-		0.284	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPH	HGNC	protein_coding	OTTHUMT00000215083.1	0	0	0	142	142	68	0.00	0.00	A		Intron	68490472	+1	62	51	66	88	tier1	no_errors	ENST00000283006	ensembl	human	known	74_37	splice_site	48.44	36.69	SNP	1.000	C	62	66
CHL1	10752	genome.wustl.edu	37	3	403486	403486	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr3:403486G>A	ENST00000256509.2	+	13	2053	c.1411G>A	c.(1411-1413)Gtg>Atg	p.V471M	CHL1-AS1_ENST00000608098.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.V455M|CHL1-AS1_ENST00000417612.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.V471M(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TGAGGCAGTCGTGTCCTGGTA	0.438													ENSG00000134121																																					1	Substitution - Missense(1)	large_intestine(1)											176.0	161.0	166.0					3																	403486		2203	4300	6503	SO:0001583	missense	0			-	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1411G>A	3.37:g.403486G>A	ENSP00000256509:p.Val471Met		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V471M	ENST00000256509.2	37	c.1411	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109991	0.56398	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.76968	-1.06;-1.06	5.06	3.93	0.45458	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.234344	0.37219	N	0.002188	D	0.88028	0.6327	M	0.88241	2.94	0.40075	D	0.976063	D;D;D	0.89917	1.0;1.0;0.991	D;D;D	0.76071	0.987;0.987;0.918	D	0.89456	0.3733	10	0.87932	D	0	.	10.1345	0.42697	0.1355:0.0:0.8645:0.0	.	455;455;471	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	M	471;455	ENSP00000256509:V471M;ENSP00000380628:V455M	ENSP00000256509:V471M	V	+	1	0	CHL1	378486	0.944000	0.32072	0.941000	0.38009	0.691000	0.40173	2.202000	0.42743	2.490000	0.84030	0.563000	0.77884	GTG	-	CHL1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.438	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	0	0	1	82	82	101	0.00	0.98	G	NM_006614		403486	+1	39	71	35	70	tier1	no_errors	ENST00000256509	ensembl	human	known	74_37	missense	52.70	50.35	SNP	0.627	A	39	35
TIMP2	7077	genome.wustl.edu	37	17	76867051	76867051	+	Missense_Mutation	SNP	T	T	C	rs374979973		TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr17:76867051T>C	ENST00000262768.7	-	3	567	c.269A>G	c.(268-270)tAc>tGc	p.Y90C	TIMP2_ENST00000536189.2_Missense_Mutation_p.Y13C|TIMP2_ENST00000585421.1_Missense_Mutation_p.Y13C|TIMP2_ENST00000586057.1_Missense_Mutation_p.Y13C	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2	90	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			GGGGGCCGTGTAGATAAACTC	0.532													ENSG00000035862																																					0													106.0	100.0	102.0					17																	76867051		2203	4300	6503	SO:0001583	missense	0			-		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.269A>G	17.37:g.76867051T>C	ENSP00000262768:p.Tyr90Cys		Q16121|Q93006|Q9UDF7	Missense_Mutation	SNP	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain	p.Y90C	ENST00000262768.7	37	c.269	CCDS11758.1	17	.	.	.	.	.	.	.	.	.	.	T	16.75	3.210619	0.58343	.	.	ENSG00000035862	ENST00000262768;ENST00000536189	D;D	0.93859	-3.3;-3.3	4.88	2.43	0.29744	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.215756	0.41001	D	0.000963	D	0.95912	0.8669	M	0.87456	2.885	0.33159	D	0.546782	D	0.89917	1.0	D	0.71414	0.973	D	0.95361	0.8455	10	0.87932	D	0	.	6.814	0.23820	0.1502:0.0:0.1563:0.6935	.	90	P16035	TIMP2_HUMAN	C	90;13	ENSP00000262768:Y90C;ENSP00000441724:Y13C	ENSP00000262768:Y90C	Y	-	2	0	TIMP2	74378646	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	0.571000	0.23669	0.686000	0.31488	0.358000	0.22013	TAC	-	TIMP2	-	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain		0.532	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMP2	HGNC	protein_coding	OTTHUMT00000335662.1	0	0	0	57	57	45	0.00	0.00	T	NM_003255		76867051	-1	37	51	23	36	tier1	no_errors	ENST00000262768	ensembl	human	known	74_37	missense	61.67	58.62	SNP	1.000	C	37	23
PORCN	64840	genome.wustl.edu	37	X	48372971	48372971	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chrX:48372971G>T	ENST00000326194.6	+	9	947	c.904G>T	c.(904-906)Gtc>Ttc	p.V302F	PORCN_ENST00000361988.3_Missense_Mutation_p.V291F|PORCN_ENST00000359882.4_Missense_Mutation_p.V296F|PORCN_ENST00000355961.4_Missense_Mutation_p.V297F|PORCN_ENST00000355092.3_Missense_Mutation_p.V296F|PORCN_ENST00000537758.1_Missense_Mutation_p.V302F|PORCN_ENST00000367574.4_Missense_Mutation_p.V220F	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	302					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGTGGAAGTTGTCACAAGCTG	0.502													ENSG00000102312																																					0													120.0	83.0	96.0					X																	48372971		2203	4300	6503	SO:0001583	missense	0			-	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.904G>T	X.37:g.48372971G>T	ENSP00000322304:p.Val302Phe		B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	pfam_MBOAT_fam	p.V302F	ENST00000326194.6	37	c.904	CCDS14299.1	X	.	.	.	.	.	.	.	.	.	.	G	26.5	4.741158	0.89573	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.87951	0.6307	M	0.87381	2.88	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;1.0	D	0.89949	0.4078	10	0.87932	D	0	-20.4692	15.8854	0.79244	0.0:0.0:1.0:0.0	.	296;302;220;291;297	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	F	296;302;220;297;291;302;296	ENSP00000352946:V296F;ENSP00000446401:V302F;ENSP00000356546:V220F;ENSP00000348233:V297F;ENSP00000354978:V291F;ENSP00000322304:V302F;ENSP00000347207:V296F	ENSP00000322304:V302F	V	+	1	0	PORCN	48257915	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.023000	0.93683	2.350000	0.79820	0.529000	0.55759	GTC	-	PORCN	-	pfam_MBOAT_fam		0.502	PORCN-011	KNOWN	basic|CCDS	protein_coding	PORCN	HGNC	protein_coding	OTTHUMT00000356990.1	0	0	0	110	110	96	0.00	0.00	G	NM_022825		48372971	+1	40	56	75	101	tier1	no_errors	ENST00000326194	ensembl	human	known	74_37	missense	34.78	35.44	SNP	1.000	T	40	75
CMC1	152100	genome.wustl.edu	37	3	28364646	28364646	+	3'UTR	SNP	G	G	T			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr3:28364646G>T	ENST00000466830.1	+	0	4046				AZI2_ENST00000479665.1_3'UTR|AZI2_ENST00000295748.3_5'UTR	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						CAATTTAGAAGCTGCTCTACA	0.313													ENSG00000163512																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.*3526G>T	3.37:g.28364646G>T			Q68DJ7	R	SNP	-	NULL	ENST00000466830.1	37	NULL	CCDS33722.1	3																																																																																			-	AZI2	-	-		0.313	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000341087.1	0	0	0	23	23	43	0.00	0.00	G	NM_182523		28364646	-1	9	28	11	40	tier1	no_errors	ENST00000295748	ensembl	human	known	74_37	rna	45.00	41.18	SNP	0.517	T	9	11
SYT16	83851	genome.wustl.edu	37	14	62542040	62542040	+	Silent	SNP	G	G	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr14:62542040G>A	ENST00000430451.2	+	3	1121	c.924G>A	c.(922-924)gaG>gaA	p.E308E	SYT16_ENST00000446982.2_Silent_p.E308E|RP11-355I22.5_ENST00000553990.1_lincRNA	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	308					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TGGAGATGGAGACAGCTTTTA	0.502													ENSG00000139973																																					0													114.0	115.0	114.0					14																	62542040		1956	4145	6101	SO:0001819	synonymous_variant	0			-	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.924G>A	14.37:g.62542040G>A			B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Silent	SNP	NULL	p.E308	ENST00000430451.2	37	c.924	CCDS45121.1	14																																																																																			-	SYT16	-	NULL		0.502	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	HGNC	protein_coding	OTTHUMT00000411700.1	0	0	0	35	35	68	0.00	0.00	G	NM_031914		62542040	+1	20	35	28	46	tier1	no_errors	ENST00000446982	ensembl	human	known	74_37	silent	41.67	43.21	SNP	0.982	A	20	28
GAB1	2549	genome.wustl.edu	37	4	144346345	144346345	+	Intron	SNP	T	T	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr4:144346345T>A	ENST00000262994.4	+	3	669				GAB1_ENST00000505913.1_Intron|RP11-58H15.1_ENST00000494591.1_RNA|GAB1_ENST00000262995.4_Intron	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1						activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					GCATCTACATTATAAATCTGA	0.453													ENSG00000243175																																					0																																										SO:0001627	intron_variant	0			-	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.368-8299T>A	4.37:g.144346345T>A			A8K152|Q4W5G2|Q6P1W2	R	SNP	-	NULL	ENST00000262994.4	37	NULL	CCDS3759.1	4																																																																																			-	RP11-58H15.1	-	-		0.453	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000243175	Clone_based_vega_gene	protein_coding	OTTHUMT00000364998.1	0	0	0	25	25	10	0.00	0.00	T	NM_002039		144346345	+1	16	3	13	18	tier1	no_errors	ENST00000494591	ensembl	human	known	74_37	rna	55.17	14.29	SNP	1.000	A	16	13
CEP290	80184	genome.wustl.edu	37	12	88457822	88457822	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr12:88457822G>A	ENST00000552810.1	-	45	6549	c.6206C>T	c.(6205-6207)tCa>tTa	p.S2069L	CEP290_ENST00000397838.3_Missense_Mutation_p.S1129L|CEP290_ENST00000309041.7_Missense_Mutation_p.S2071L|CEP290_ENST00000547691.2_Missense_Mutation_p.S1129L	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	2069					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ATTTTCAGATGACAACTTCAA	0.313													ENSG00000198707																																					0													46.0	42.0	43.0					12																	88457822		1809	4064	5873	SO:0001583	missense	0			-	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.6206C>T	12.37:g.88457822G>A	ENSP00000448012:p.Ser2069Leu		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.S2071L	ENST00000552810.1	37	c.6212	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.129897	0.94473	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.66460	0.38;-0.21;-0.21;0.38	5.68	5.68	0.88126	.	0.128054	0.53938	D	0.000044	T	0.76133	0.3945	M	0.65975	2.015	0.50039	D	0.999846	D	0.56968	0.978	P	0.53954	0.738	T	0.72880	-0.4158	10	0.30854	T	0.27	.	19.7964	0.96487	0.0:0.0:1.0:0.0	.	2069	O15078	CE290_HUMAN	L	1129;2069;2071;1129	ENSP00000446905:S1129L;ENSP00000448012:S2069L;ENSP00000308021:S2071L;ENSP00000380938:S1129L	ENSP00000308021:S2071L	S	-	2	0	CEP290	86981953	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.084000	0.94076	2.683000	0.91414	0.555000	0.69702	TCA	-	CEP290	-	NULL		0.313	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1	1	1	0	145	145	85	0.68	0.00	G	NM_025114		88457822	-1	64	33	82	66	tier1	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	43.84	33.33	SNP	1.000	A	64	82
GOLM1	51280	genome.wustl.edu	37	9	88650294	88650294	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr9:88650294G>C	ENST00000388712.3	-	8	1172	c.1004C>G	c.(1003-1005)gCt>gGt	p.A335G	GOLM1_ENST00000388711.3_Missense_Mutation_p.A335G|GOLM1_ENST00000257504.6_5'Flank	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	335					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						TTCCCCGGCAGCTTCCTGCTC	0.622											OREG0019278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000135052																																					0													56.0	64.0	62.0					9																	88650294		2203	4300	6503	SO:0001583	missense	0			-	AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.1004C>G	9.37:g.88650294G>C	ENSP00000373364:p.Ala335Gly	1261	Q6IAF4|Q9NRB9	Missense_Mutation	SNP	NULL	p.A335G	ENST00000388712.3	37	c.1004	CCDS35054.1	9	.	.	.	.	.	.	.	.	.	.	G	13.37	2.218386	0.39201	.	.	ENSG00000135052	ENST00000388712;ENST00000388711	T;T	0.47869	0.83;0.83	4.13	2.11	0.27256	.	1.256360	0.05284	N	0.519803	T	0.40067	0.1102	L	0.50333	1.59	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.22765	-1.0207	10	0.21540	T	0.41	-5.916	5.3166	0.15858	0.1137:0.2076:0.6787:0.0	.	335	Q8NBJ4	GOLM1_HUMAN	G	335	ENSP00000373364:A335G;ENSP00000373363:A335G	ENSP00000373363:A335G	A	-	2	0	GOLM1	87840114	0.003000	0.15002	0.003000	0.11579	0.298000	0.27526	1.304000	0.33482	1.105000	0.41606	0.456000	0.33151	GCT	-	GOLM1	-	NULL		0.622	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLM1	HGNC	protein_coding	OTTHUMT00000052904.2	0	0	0	58	58	56	0.00	0.00	G	NM_177937		88650294	-1	24	45	31	52	tier1	no_errors	ENST00000388711	ensembl	human	known	74_37	missense	43.64	46.39	SNP	0.001	C	24	31
TP53	7157	genome.wustl.edu	37	17	7578242	7578242	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr17:7578242C>A	ENST00000269305.4	-	6	796	c.607G>T	c.(607-609)Gtg>Ttg	p.V203L	TP53_ENST00000413465.2_Missense_Mutation_p.V203L|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.V203L|TP53_ENST00000445888.2_Missense_Mutation_p.V203L|TP53_ENST00000420246.2_Missense_Mutation_p.V203L|TP53_ENST00000455263.2_Missense_Mutation_p.V203L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	203	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).|V -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|VE -> LV (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(5)|p.V203L(3)|p.V203fs*44(2)|p.V203M(2)|p.N200fs*4(1)|p.V203_E204>LV(1)|p.G199fs*42(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAATACTCCACACGCAAATTT	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	23	Whole gene deletion(8)|Substitution - Missense(5)|Unknown(5)|Deletion - Frameshift(4)|Complex - compound substitution(1)	biliary_tract(5)|oesophagus(4)|bone(4)|central_nervous_system(2)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|urinary_tract(1)|breast(1)|ovary(1)											131.0	116.0	121.0					17																	7578242		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.607G>T	17.37:g.7578242C>A	ENSP00000269305:p.Val203Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V203L	ENST00000269305.4	37	c.607	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695281	0.48202	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99758	-6.65;-6.65;-6.65;-6.65;-6.65;-6.65;-6.65;-6.65	5.41	3.39	0.38822	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110322	0.64402	D	0.000011	D	0.98779	0.9589	L	0.38175	1.15	0.29926	N	0.822297	B;B;B;B;B;B;B	0.27140	0.169;0.0;0.002;0.009;0.0;0.0;0.14	B;B;B;B;B;B;B	0.32762	0.152;0.002;0.014;0.003;0.002;0.002;0.051	D	0.99978	1.2320	10	0.87932	D	0	-2.4908	9.8126	0.40833	0.0:0.7818:0.1399:0.0784	.	164;203;203;110;203;203;203	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	203;203;203;203;203;203;192;110;71;110;71	ENSP00000410739:V203L;ENSP00000352610:V203L;ENSP00000269305:V203L;ENSP00000398846:V203L;ENSP00000391127:V203L;ENSP00000391478:V203L;ENSP00000425104:V71L;ENSP00000423862:V110L	ENSP00000269305:V203L	V	-	1	0	TP53	7518967	0.437000	0.25593	0.001000	0.08648	0.018000	0.09664	1.249000	0.32839	0.752000	0.32923	0.655000	0.94253	GTG	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	1	69	69	84	0.00	1.18	C	NM_000546		7578242	-1	36	63	37	77	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	49.32	45.00	SNP	0.809	A	36	37
RP11-2H3.6	0	genome.wustl.edu	37	4	410242	410242	+	lincRNA	SNP	G	G	C			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr4:410242G>C	ENST00000609771.1	-	0	84																											AAGAAATTTTGGTAGATAAAT	0.363													ENSG00000272885																																					0													20.0	15.0	16.0					4																	410242		692	1584	2276			0			-																													4.37:g.410242G>C				R	SNP	-	NULL	ENST00000609771.1	37	NULL		4																																																																																			-	RP11-2H3.6	-	-		0.363	RP11-2H3.6-001	KNOWN	basic	lincRNA	ENSG00000272885	Clone_based_vega_gene	lincRNA	OTTHUMT00000472396.1	0	0	0	39	39	39	0.00	0.00	G			410242	-1	13	13	18	19	tier1	no_errors	ENST00000609771	ensembl	human	known	74_37	rna	41.94	40.62	SNP	0.245	C	13	18
PHACTR1	221692	genome.wustl.edu	37	6	12753947	12753947	+	Intron	SNP	T	T	C			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr6:12753947T>C	ENST00000379350.1	+	3	379				PHACTR1_ENST00000379348.2_Intron|PHACTR1_ENST00000332995.7_Intron|AL354680.1_ENST00000411359.1_RNA			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1						actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TTCACTGGTCTCTTTCACCCT	0.438													ENSG00000223291																																					0																																										SO:0001627	intron_variant	0			-	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.250+3925T>C	6.37:g.12753947T>C			A8K1V2|Q3MJ93|Q5JSJ2	R	SNP	-	NULL	ENST00000379350.1	37	NULL		6																																																																																			-	AL354680.1	-	-		0.438	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	ENSG00000223291	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000039876.1	0	0	0	96	96	96	0.00	0.00	T	XM_166420		12753947	+1	33	68	24	79	tier1	no_errors	ENST00000411359	ensembl	human	novel	74_37	rna	57.89	46.26	SNP	0.038	C	33	24
OR2J3	442186	genome.wustl.edu	37	6	29080103	29080103	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr6:29080103C>G	ENST00000377169.1	+	1	436	c.436C>G	c.(436-438)Ctg>Gtg	p.L146V		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						TTTCTGCCACCTGCTGGCTGT	0.512													ENSG00000204701																																					0													350.0	373.0	365.0					6																	29080103		1385	2625	4010	SO:0001583	missense	0			-		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.436C>G	6.37:g.29080103C>G	ENSP00000366374:p.Leu146Val		B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L146V	ENST00000377169.1	37	c.436	CCDS43433.1	6	.	.	.	.	.	.	.	.	.	.	C	3.296	-0.143811	0.06627	.	.	ENSG00000204701	ENST00000377169	T	0.00069	8.77	2.78	-3.44	0.04796	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	L	0.55103	1.725	0.09310	N	1	B	0.17852	0.024	B	0.29077	0.098	T	0.34354	-0.9832	9	0.17369	T	0.5	.	0.4174	0.00451	0.2991:0.3116:0.1473:0.2419	.	146	O76001	OR2J3_HUMAN	V	146	ENSP00000366374:L146V	ENSP00000366374:L146V	L	+	1	2	OR2J3	29188082	0.000000	0.05858	0.008000	0.14137	0.914000	0.54420	-1.425000	0.02446	-1.066000	0.03164	0.436000	0.28706	CTG	-	OR2J3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.512	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J3	HGNC	protein_coding	OTTHUMT00000076132.2	0	0	0	54	54	58	0.00	0.00	C			29080103	+1	34	53	29	45	tier1	no_errors	ENST00000377169	ensembl	human	known	74_37	missense	53.97	54.08	SNP	0.000	G	34	29
RB1	5925	genome.wustl.edu	37	13	49033886	49033886	+	Nonsense_Mutation	SNP	G	G	T	rs137853295		TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr13:49033886G>T	ENST00000267163.4	+	20	2161	c.2023G>T	c.(2023-2025)Gaa>Taa	p.E675*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	675	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGAGCACCCAGAATTAGAACA	0.423		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			ENSG00000139687																											yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(11)	bone(10)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	GRCh37	CM920604	RB1	M	rs137853295						113.0	110.0	111.0					13																	49033886		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database		-	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2023G>T	13.37:g.49033886G>T	ENSP00000267163:p.Glu675*		A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.E675*	ENST00000267163.4	37	c.2023	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	40	8.237438	0.98719	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.7	5.7	0.88788	.	0.183316	0.47093	D	0.000258	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-20.9984	19.8339	0.96646	0.0:0.0:1.0:0.0	.	.	.	.	X	654;675	.	ENSP00000267163:E675X	E	+	1	0	RB1	47931887	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.476000	0.97823	2.698000	0.92095	0.585000	0.79938	GAA	rs137853295	RB1	-	pfam_RB_B,superfamily_Cyclin-like,smart_Cyclin-like		0.423	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	0	0	0	123	123	116	0.00	0.00	G			49033886	+1	37	52	3	1	tier1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	92.50	98.11	SNP	1.000	T	37	3
RIPK4	54101	genome.wustl.edu	37	21	43161219	43161219	+	Missense_Mutation	SNP	C	C	T	rs199540981		TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr21:43161219C>T	ENST00000352483.2	-	9	2342	c.2278G>A	c.(2278-2280)Gcc>Acc	p.A760T	RIPK4_ENST00000542057.1_Missense_Mutation_p.A649T|RIPK4_ENST00000544709.1_Missense_Mutation_p.A649T|AP001615.9_ENST00000423276.1_RNA|RIPK4_ENST00000332512.3_Missense_Mutation_p.A712T			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	760					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TGCCCGTGGGCGGCAGCCAGG	0.687													ENSG00000183421	C|||	1	0.000199681	0.0	0.0	5008	,	,		16448	0.001		0.0	False		,,,				2504	0.0																0													54.0	61.0	58.0					21																	43161219		2203	4298	6501	SO:0001583	missense	0			GMAF=0.0005	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.2278G>A	21.37:g.43161219C>T	ENSP00000330161:p.Ala760Thr		Q96KH0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A760T	ENST00000352483.2	37	c.2278		21	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.75	1.439558	0.25900	.	.	ENSG00000183421	ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	4.61	4.61	0.57282	.	0.137225	0.33650	N	0.004689	T	0.58652	0.2137	L	0.49350	1.555	0.09310	N	1	D	0.56287	0.975	P	0.46975	0.533	T	0.53165	-0.8477	10	0.22706	T	0.39	-28.7062	12.4094	0.55459	0.0:0.8305:0.1695:0.0	.	712	P57078-2	.	T	712;760;649;649	ENSP00000332454:A712T;ENSP00000330161:A760T;ENSP00000441754:A649T;ENSP00000442901:A649T	ENSP00000332454:A712T	A	-	1	0	RIPK4	42034288	0.576000	0.26700	0.140000	0.22221	0.193000	0.23685	2.352000	0.44080	2.116000	0.64780	0.650000	0.86243	GCC	rs199540981	RIPK4	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.687	RIPK4-201	KNOWN	basic	protein_coding	RIPK4	HGNC	protein_coding		0	0	0	37	37	7	0.00	0.00	C	NM_020639		43161219	-1	23	10	10	7	tier1	no_errors	ENST00000352483	ensembl	human	known	74_37	missense	69.70	58.82	SNP	0.024	T	23	10
SEC61A2	55176	genome.wustl.edu	37	10	12203044	12203044	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr10:12203044A>G	ENST00000298428.9	+	10	1180	c.1091A>G	c.(1090-1092)tAt>tGt	p.Y364C	SEC61A2_ENST00000304267.8_Missense_Mutation_p.Y364C|SEC61A2_ENST00000379033.3_Missense_Mutation_p.Y342C|SEC61A2_ENST00000379020.4_Missense_Mutation_p.Y298C|SEC61A2_ENST00000495368.1_3'UTR	NM_018144.3	NP_060614.2	Q9H9S3	S61A2_HUMAN	Sec61 alpha 2 subunit (S. cerevisiae)	364					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ribosome binding (GO:0043022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Renal(717;0.228)				GTCGTTGTTTATATCATCTTC	0.443													ENSG00000065665																																					0													224.0	174.0	191.0					10																	12203044		2203	4300	6503	SO:0001583	missense	0			-	AF346603	CCDS7088.1, CCDS44358.1, CCDS44359.1	10p14	2004-01-06			ENSG00000065665	ENSG00000065665			17702	protein-coding gene	gene with protein product							Standard	NM_018144		Approved	FLJ10578	uc001ile.2	Q9H9S3	OTTHUMG00000017679	ENST00000298428.9:c.1091A>G	10.37:g.12203044A>G	ENSP00000298428:p.Tyr364Cys		A8K8D0|B4DX72|F8W773	Missense_Mutation	SNP	pfam_SecY/SEC61-alpha,pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha	p.Y364C	ENST00000298428.9	37	c.1091	CCDS7088.1	10	.	.	.	.	.	.	.	.	.	.	A	20.8	4.043108	0.75732	.	.	ENSG00000065665	ENST00000379033;ENST00000298428;ENST00000304267;ENST00000379020;ENST00000426560	.	.	.	5.54	5.54	0.83059	SecY subunit domain (2);	0.000000	0.64402	D	0.000011	D	0.90314	0.6970	H	0.98407	4.225	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.91635	0.994;0.999;0.999	D	0.93886	0.7175	9	0.87932	D	0	-8.1598	15.1606	0.72782	1.0:0.0:0.0:0.0	.	342;364;364	F8W773;Q9H9S3-2;Q9H9S3	.;.;S61A2_HUMAN	C	342;364;364;298;112	.	ENSP00000298428:Y364C	Y	+	2	0	SEC61A2	12243050	1.000000	0.71417	0.983000	0.44433	0.753000	0.42808	9.287000	0.95975	2.230000	0.72887	0.528000	0.53228	TAT	-	SEC61A2	-	pfam_SecY/SEC61-alpha,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha		0.443	SEC61A2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A2	HGNC	protein_coding	OTTHUMT00000046795.1	0	0	0	48	48	100	0.00	0.00	A	NM_018144		12203044	+1	24	53	0	1	tier1	no_errors	ENST00000298428	ensembl	human	known	74_37	missense	100.00	98.15	SNP	1.000	G	24	0
ZDHHC8P1	150244	genome.wustl.edu	37	22	23742153	23742153	+	RNA	SNP	G	G	T			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr22:23742153G>T	ENST00000255890.4	-	0	1056									zinc finger, DHHC-type containing 8 pseudogene 1																		TAGGAGCTGGGAGCATCATAG	0.632													ENSG00000133519																																					0													46.0	52.0	50.0					22																	23742153		692	1591	2283			0			-			22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23742153G>T				R	SNP	-	NULL	ENST00000255890.4	37	NULL		22																																																																																			-	ZDHHC8P1	-	-		0.632	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	HGNC	pseudogene	OTTHUMT00000319397.1	0	0	0	43	43	17	0.00	0.00	G	NR_003950		23742153	-1	37	8	29	5	tier1	no_errors	ENST00000255890	ensembl	human	known	74_37	rna	56.06	61.54	SNP	0.957	T	37	29
LAG3	3902	genome.wustl.edu	37	12	6882880	6882880	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr12:6882880delC	ENST00000203629.2	+	3	557	c.224delC	c.(223-225)gccfs	p.A75fs	LAG3_ENST00000441671.2_Frame_Shift_Del_p.A75fs	NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	75	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						CCCGCTGCCGCCCCCGGCCAT	0.741													ENSG00000089692																																					0													3.0	5.0	4.0					12																	6882880		1170	2425	3595	SO:0001589	frameshift_variant	0					CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.224delC	12.37:g.6882880delC	ENSP00000203629:p.Ala75fs		A8K7T9|Q7Z643	Frame_Shift_Del	DEL	smart_Ig_sub,pfscan_Ig-like_dom	p.G77fs	ENST00000203629.2	37	c.224	CCDS8561.1	12																																																																																				LAG3	-	smart_Ig_sub		0.741	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAG3	HGNC	protein_coding	OTTHUMT00000402846.1	0	0	0	16	16	19	0.00	0.00	C			6882880	+1	2	0	7	6	tier1	no_errors	ENST00000203629	ensembl	human	known	74_37	frame_shift_del	22.22	0.00	DEL	0.000	-	2	7
BRD7	29117	genome.wustl.edu	37	16	50402555	50402555	+	Intron	SNP	C	C	A			TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr16:50402555C>A	ENST00000394688.3	-	1	209				BRD7_ENST00000401491.3_Intron|RP11-21B23.1_ENST00000568427.1_RNA|BRD7_ENST00000394689.2_Intron			Q9NPI1	BRD7_HUMAN	bromodomain containing 7						cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				GGGCCCCGGGCCGCCCCGGAG	0.781													ENSG00000261393																																					0																																										SO:0001627	intron_variant	0			-	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.49+81G>T	16.37:g.50402555C>A			Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	R	SNP	-	NULL	ENST00000394688.3	37	NULL	CCDS10742.1	16																																																																																			-	RP11-21B23.1	-	-		0.781	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000261393	Clone_based_vega_gene	protein_coding	OTTHUMT00000256874.3	0	0	0	26	26	0	0.00	0.00	C	NM_013263		50402555	+1	14	0	4	0	tier1	no_errors	ENST00000568427	ensembl	human	known	74_37	rna	73.68	0.00	SNP	0.005	A	14	4
INF2	64423	genome.wustl.edu	37	14	105173863	105173874	+	In_Frame_Del	DEL	CCCCACCCCCAC	CCCCACCCCCAC	-	rs573567814|rs553174468	byFrequency	TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	CCCCACCCCCAC	CCCCACCCCCAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr14:105173863_105173874delCCCCACCCCCAC	ENST00000392634.4	+	8	1371_1382	c.1259_1270delCCCCACCCCCAC	c.(1258-1272)accccacccccaccc>acc	p.PPPP425del	INF2_ENST00000330634.7_In_Frame_Del_p.PPPP425del	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	425	Pro-rich.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.P427_P428delPP(1)		large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CAGGCGTCCAccccacccccacccccaccccc	0.712													ENSG00000203485		802	0.160144	0.0613	0.1686	5008	,	,		3151	0.126		0.2614	False		,,,				2504	0.2188																1	Deletion - In frame(1)	skin(1)							,	32,140,1168		15,1,1,53,33,567					,	-6.6	0.0		dbSNP_107	5	65,790,2431		28,5,4,309,167,1130	no	codingComplex,codingComplex	INF2	NM_022489.3,NM_001031714.3	,	43,6,5,362,200,1697	A1A1,A1A2,A1R,A2A2,A2R,RR		26.0195,12.8358,22.2006	,	,		97,930,3599				SO:0001651	inframe_deletion	0				AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.1259_1270delCCCCACCCCCAC	14.37:g.105173863_105173874delCCCCACCCCCAC	ENSP00000376410:p.Pro425_Pro428del		Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	In_Frame_Del	DEL	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_WH2_dom,superfamily_ARM-type_fold,smart_FH2_Formin,pfscan_WH2_dom	p.PPPP424in_frame_del	ENST00000392634.4	37	c.1259_1270	CCDS9989.2	14																																																																																				INF2	-	NULL		0.712	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	HGNC	protein_coding	OTTHUMT00000074371.4	0	0	0	1	1	1	0.00	0.00	CCCCACCCCCAC	NM_022489		105173874	+1	0	0	1	1	tier1	no_errors	ENST00000392634	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.431:0.313:0.918:0.874:0.812:0.982:0.976:0.941:0.992:0.945:0.221:0.238	-	0	1
LOC101927060	101927060	genome.wustl.edu	37	17	45177320	45177321	+	IGR	INS	-	-	CGGCCC	rs71354656|rs11283220|rs143602867	byFrequency	TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr17:45177320_45177321insCGGCCC								RP11-156P1.3 (32417 upstream) : CDC27 (17747 downstream)																							gcccccggccgcggccccggcc	0.757													ENSG00000262879		2232	0.445687	0.2821	0.5245	5008	,	,		8276	0.2927		0.6441	False		,,,				2504	0.5644																0																																										SO:0001628	intergenic_variant	0																																17.37:g.45177321_45177326dupCGGCCC				R	INS	-	NULL		37	NULL		17																																																																																				RP11-156P1.3	-	-	0	0.757					LOC101927060	Clone_based_vega_gene			0	0	0	0	0	0	0.00	0.00	-			45177321	-1	1	1	3	3	tier1	no_errors	ENST00000571665	ensembl	human	known	74_37	rna	25.00	25.00	INS	0.380:0.408	CGGCCC	1	3
POTEB2	100287399	genome.wustl.edu	37	15	21038172	21038172	+	IGR	SNP	C	C	G	rs370569866		TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr15:21038172C>G	ENST00000454856.4	-	0	1687				MIR3118-4_ENST00000584700.1_RNA	NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2																		caccgtgtgactgcattatga	0.408													ENSG00000265322																																					0																																										SO:0001628	intergenic_variant	0			-		CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829		15.37:g.21038172C>G				R	SNP	-	NULL	ENST00000454856.4	37	NULL	CCDS59248.1	15																																																																																			-	MIR3118-4	-	-		0.408	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3118-4	HGNC	protein_coding	OTTHUMT00000471435.1	0	0	0	19	19	3	0.00	0.00	C			21038172	+1	4	0	10	0	tier1	no_errors	ENST00000584700	ensembl	human	known	74_37	rna	28.57	0.00	SNP	0.000	G	4	10
CEL	1056	genome.wustl.edu	37	9	135946015	135946015	+	Missense_Mutation	SNP	T	T	C	rs77696629	byFrequency	TCGA-DX-A7EN-01A-11D-A38Z-09	TCGA-DX-A7EN-11A-11D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0a84adb8-cf08-4b90-87b1-f83b1bfd708d	80559ba7-da24-409e-83d1-cb19b30cd06f	g.chr9:135946015T>C	ENST00000372080.4	+	10	1479	c.1463T>C	c.(1462-1464)aTc>aCc	p.I488T	CEL_ENST00000351304.7_Intron	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	485					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		AAGGCCATGATCGCCTACTGG	0.612													ENSG00000170835																																					0													76.0	86.0	83.0					9																	135946015		2018	4177	6195	SO:0001583	missense	0			-	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1463T>C	9.37:g.135946015T>C	ENSP00000361151:p.Ile488Thr		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.I488T	ENST00000372080.4	37	c.1463	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	T	22.0	4.234627	0.79800	.	.	ENSG00000170835	ENST00000372080;ENST00000303626	T	0.68025	-0.3	5.72	4.57	0.56435	Carboxylesterase, type B (1);	0.094910	0.64402	D	0.000001	T	0.72993	0.3530	L	0.38175	1.15	0.80722	D	1	D	0.54047	0.964	D	0.75020	0.985	T	0.74463	-0.3657	10	0.87932	D	0	.	11.5416	0.50669	0.134:0.0:0.0:0.866	.	485	P19835	CEL_HUMAN	T	488;487	ENSP00000361151:I488T	ENSP00000304021:I487T	I	+	2	0	CEL	134935836	1.000000	0.71417	0.959000	0.39883	0.951000	0.60555	7.622000	0.83099	0.976000	0.38417	0.391000	0.25812	ATC	rs77696629	CEL	-	pfam_CarbesteraseB		0.612	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	0	0	0	45	45	64	0.00	0.00	T			135946015	+1	8	3	49	77	tier1	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	14.04	3.75	SNP	1.000	C	8	49
