#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TUBA4B	80086	genome.wustl.edu	37	2	220136303	220136303	+	RNA	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr2:220136303C>T	ENST00000490341.1	+	0	773					NR_003063.1		Q9H853	TBA4B_HUMAN	tubulin, alpha 4b (pseudogene)						microtubule-based process (GO:0007017)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|structural constituent of cytoskeleton (GO:0005200)										TCCTACCTCACATCCACTTCC	0.532													ENSG00000243910																																					0																																												0			-	AK024002		2q35	2014-03-20	2007-03-16	2007-02-12	ENSG00000243910	ENSG00000243910		"""Tubulins"""	18637	pseudogene	pseudogene			"""tubulin, alpha 4"", ""tubulin, alpha 4b"""	TUBA4		3785200	Standard	NR_003063		Approved	FLJ13940	uc002vkv.1	Q9H853	OTTHUMG00000154516		2.37:g.220136303C>T				R	SNP	-	NULL	ENST00000490341.1	37	NULL		2																																																																																			-	TUBA4B	-	-		0.532	TUBA4B-001	KNOWN	basic	processed_transcript	TUBA4B	HGNC	pseudogene	OTTHUMT00000335637.1	1	1	0	114	114	56	0.87	0.00	C	NR_003063		220136303	+1	47	26	56	29	tier1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	45.63	47.27	SNP	1.000	T	47	56
TCHH	7062	genome.wustl.edu	37	1	152085283	152085283	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:152085283C>T	ENST00000368804.1	-	2	409	c.410G>A	c.(409-411)cGc>cAc	p.R137H		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	137					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTCTGCCTGCGTCGTTGCCC	0.572													ENSG00000159450																																					0													251.0	248.0	249.0					1																	152085283		2038	4182	6220	SO:0001583	missense	0			-	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.410G>A	1.37:g.152085283C>T	ENSP00000357794:p.Arg137His		Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.R137H	ENST00000368804.1	37	c.410	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	c	2.759	-0.258258	0.05791	.	.	ENSG00000159450	ENST00000368804	T	0.06371	3.31	5.01	-1.36	0.09085	.	.	.	.	.	T	0.00875	0.0029	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.08055	0.003	T	0.46965	-0.9153	9	0.34782	T	0.22	-0.6981	5.8919	0.18917	0.0:0.3852:0.1359:0.4789	.	137	Q07283	TRHY_HUMAN	H	137	ENSP00000357794:R137H	ENSP00000357794:R137H	R	-	2	0	TCHH	150351907	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.240000	0.08952	-0.153000	0.11137	-1.189000	0.01698	CGC	-	TCHH	-	NULL		0.572	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	0	0	0	51	51	79	0.00	0.00	C	NM_007113		152085283	-1	18	38	15	30	tier1	no_errors	ENST00000368804	ensembl	human	known	74_37	missense	54.55	55.88	SNP	0.000	T	18	15
DERA	51071	genome.wustl.edu	37	12	16189290	16189290	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr12:16189290C>T	ENST00000428559.2	+	8	1087	c.875C>T	c.(874-876)aCt>aTt	p.T292I	DERA_ENST00000526530.1_Missense_Mutation_p.T204I|DERA_ENST00000532964.1_Missense_Mutation_p.T249I	NM_015954.2	NP_057038.2	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase (putative)	292					deoxyribonucleoside catabolic process (GO:0046121)|deoxyribonucleotide catabolic process (GO:0009264)|deoxyribose phosphate catabolic process (GO:0046386)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	deoxyribose-phosphate aldolase activity (GO:0004139)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		Hepatocellular(102;0.121)				GGTGCCAGTACTCTGCTCTCG	0.433													ENSG00000023697																																					0													104.0	101.0	102.0					12																	16189290		1866	4109	5975	SO:0001583	missense	0			-	AF132960	CCDS44838.1, CCDS73451.1	12p12.3	2010-06-24	2010-06-24		ENSG00000023697	ENSG00000023697	4.1.2.4		24269	protein-coding gene	gene with protein product			"""2-deoxyribose-5-phosphate aldolase homolog (C. elegans)"""			12546782	Standard	XM_006719083		Approved	CGI-26, DEOC	uc001rde.3	Q9Y315	OTTHUMG00000165537	ENST00000428559.2:c.875C>T	12.37:g.16189290C>T	ENSP00000416583:p.Thr292Ile		Q53HN9|Q6PHW2	Missense_Mutation	SNP	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC,tigrfam_DeoC	p.T292I	ENST00000428559.2	37	c.875	CCDS44838.1	12	.	.	.	.	.	.	.	.	.	.	C	15.08	2.725937	0.48833	.	.	ENSG00000023697	ENST00000428559;ENST00000532964;ENST00000526530	.	.	.	5.57	4.67	0.58626	Aldolase-type TIM barrel (1);	0.365666	0.32987	N	0.005405	T	0.45236	0.1332	L	0.39245	1.2	0.29389	N	0.862764	B	0.28470	0.213	B	0.34385	0.181	T	0.52253	-0.8600	9	0.87932	D	0	-6.6333	15.6664	0.77234	0.0:0.7016:0.2984:0.0	.	292	Q9Y315	DEOC_HUMAN	I	292;249;204	.	ENSP00000416583:T292I	T	+	2	0	DERA	16080557	0.354000	0.24912	0.251000	0.24312	0.845000	0.48019	3.167000	0.50793	1.337000	0.45525	0.655000	0.94253	ACT	-	DERA	-	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC		0.433	DERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERA	HGNC	protein_coding	OTTHUMT00000384731.1	0	0	0	45	45	83	0.00	0.00	C	NM_015954		16189290	+1	23	25	18	34	tier1	no_errors	ENST00000428559	ensembl	human	known	74_37	missense	56.10	42.37	SNP	0.979	T	23	18
LYRM2	57226	genome.wustl.edu	37	6	90347454	90347454	+	Intron	SNP	T	T	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:90347454T>A	ENST00000523377.1	-	2	223				LYRM2_ENST00000520441.1_Missense_Mutation_p.T65S|LYRM2_ENST00000517396.1_5'UTR|LYRM2_ENST00000520318.1_Missense_Mutation_p.T65S	NM_020466.4	NP_065199.1	Q9NU23	LYRM2_HUMAN	LYR motif containing 2							mitochondrion (GO:0005739)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		CATGATTTTGTTCTCACCTCT	0.383													ENSG00000083099																																					0													162.0	156.0	158.0					6																	90347454		2203	4300	6503	SO:0001627	intron_variant	0			-	BC009782	CCDS5023.1	6q15	2006-09-19			ENSG00000083099	ENSG00000083099		"""LYR motif containing"""	25229	protein-coding gene	gene with protein product						12477932	Standard	NM_020466		Approved	DJ122O8.2	uc003pnm.3	Q9NU23	OTTHUMG00000015203	ENST00000523377.1:c.186+6A>T	6.37:g.90347454T>A			B2R4U2|E1P517	Missense_Mutation	SNP	pfam_Complex1_LYR	p.T65S	ENST00000523377.1	37	c.193	CCDS5023.1	6	.	.	.	.	.	.	.	.	.	.	T	7.189	0.591129	0.13812	.	.	ENSG00000083099	ENST00000520441;ENST00000520318	T;T	0.70986	-0.53;-0.53	4.4	0.849	0.18972	.	.	.	.	.	T	0.47303	0.1438	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.48958	-0.8988	6	0.72032	D	0.01	.	4.3605	0.11199	0.0:0.1986:0.189:0.6124	.	.	.	.	S	65	ENSP00000427859:T65S;ENSP00000428207:T65S	ENSP00000428207:T65S	T	-	1	0	LYRM2	90404175	0.962000	0.33011	0.254000	0.24359	0.130000	0.20726	1.558000	0.36309	0.152000	0.19188	-0.490000	0.04691	ACA	-	LYRM2	-	NULL		0.383	LYRM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYRM2	HGNC	protein_coding	OTTHUMT00000041498.2	0	0	0	75	75	133	0.00	0.00	T	NM_020466		90347454	-1	35	26	24	43	tier1	no_errors	ENST00000520441	ensembl	human	putative	74_37	missense	59.32	37.14	SNP	0.192	A	35	24
SNX33	257364	genome.wustl.edu	37	15	75942421	75942421	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr15:75942421C>G	ENST00000308527.5	+	1	2175	c.978C>G	c.(976-978)taC>taG	p.Y326*	IMP3_ENST00000314852.2_5'Flank|IMP3_ENST00000565349.1_5'Flank	NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	326	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						TCTCCCAGTACGAAGGCTTCC	0.592													ENSG00000173548																																					0													84.0	88.0	86.0					15																	75942421		2197	4294	6491	SO:0001587	stop_gained	0			-	AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.978C>G	15.37:g.75942421C>G	ENSP00000311427:p.Tyr326*		B1NM17	Nonsense_Mutation	SNP	pfam_Sorting_nexin_WASP-bd-dom,pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,smart_Phox,pirsf_Snx9,pfscan_Phox,pfscan_SH3_domain	p.Y326*	ENST00000308527.5	37	c.978	CCDS10283.1	15	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559099	0.45590	.	.	ENSG00000173548	ENST00000308527	.	.	.	5.68	-11.4	0.00090	.	0.263771	0.38548	N	0.001644	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-23.63	14.0861	0.64957	0.0783:0.6398:0.0:0.2819	.	.	.	.	X	326	.	ENSP00000311427:Y326X	Y	+	3	2	SNX33	73729476	0.001000	0.12720	0.513000	0.27749	0.838000	0.47535	-1.442000	0.02407	-2.234000	0.00715	-1.193000	0.01689	TAC	-	SNX33	-	pfam_Phox,superfamily_Phox,smart_Phox,pirsf_Snx9,pfscan_Phox		0.592	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX33	HGNC	protein_coding	OTTHUMT00000286471.1	0	0	0	68	68	57	0.00	0.00	C	NM_153271		75942421	+1	17	16	19	20	tier1	no_errors	ENST00000308527	ensembl	human	known	74_37	nonsense	45.95	44.44	SNP	0.267	G	17	19
GPM6A	2823	genome.wustl.edu	37	4	176556169	176556169	+	Missense_Mutation	SNP	C	C	A	rs1049820	byFrequency	TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr4:176556169C>A	ENST00000280187.7	-	8	769	c.724G>T	c.(724-726)Gtg>Ttg	p.V242L	GPM6A_ENST00000515090.1_Missense_Mutation_p.V235L|GPM6A_ENST00000393658.2_Missense_Mutation_p.V242L|GPM6A_ENST00000506894.1_Missense_Mutation_p.V231L|GPM6A_ENST00000506219.1_5'UTR	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	242			V -> L (in dbSNP:rs1049820).		neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		GCGTCTTTCACATAGGCCCAG	0.438													ENSG00000150625																																					0													83.0	77.0	79.0					4																	176556169		2203	4300	6503	SO:0001583	missense	0			-		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.724G>T	4.37:g.176556169C>A	ENSP00000280187:p.Val242Leu		B7Z642|E9PHI5|Q92602	Missense_Mutation	SNP	pfam_Myelin_PLP,smart_Myelin_PLP,prints_Myelin_PLP	p.V242L	ENST00000280187.7	37	c.724	CCDS3824.1	4	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566063	0.27915	.	.	ENSG00000150625	ENST00000280187;ENST00000393658;ENST00000506894;ENST00000515090	D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	N	0.00771	-1.2	0.80722	D	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.12837	0.007;0.007;0.008	D	0.89068	0.3467	10	0.02654	T	1	-19.8899	20.3627	0.98863	0.0:1.0:0.0:0.0	rs1049820;rs1803466;rs3189995;rs1049820	235;231;242	B7Z642;E9PHI5;P51674	.;.;GPM6A_HUMAN	L	242;242;231;235	ENSP00000280187:V242L;ENSP00000377268:V242L;ENSP00000421578:V231L;ENSP00000423984:V235L	ENSP00000280187:V242L	V	-	1	0	GPM6A	176793163	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.445000	0.80570	2.885000	0.99019	0.655000	0.94253	GTG	rs1049820	GPM6A	-	pfam_Myelin_PLP		0.438	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPM6A	HGNC	protein_coding	OTTHUMT00000362163.1	0	0	0	20	20	52	0.00	0.00	C			176556169	-1	9	31	3	50	tier1	no_errors	ENST00000280187	ensembl	human	known	74_37	missense	75.00	38.27	SNP	1.000	A	9	3
TMEM74	157753	genome.wustl.edu	37	8	109797134	109797134	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr8:109797134G>A	ENST00000297459.3	-	2	372	c.194C>T	c.(193-195)gCa>gTa	p.A65V	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	65					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			GGAGGGGGATGCTGGAGAAGA	0.512													ENSG00000164841																																					0													122.0	122.0	122.0					8																	109797134		2203	4300	6503	SO:0001583	missense	0			-	AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.194C>T	8.37:g.109797134G>A	ENSP00000297459:p.Ala65Val			Missense_Mutation	SNP	NULL	p.A65V	ENST00000297459.3	37	c.194	CCDS6310.1	8	.	.	.	.	.	.	.	.	.	.	G	2.063	-0.414932	0.04766	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.9	2.01	0.26516	.	0.562189	0.19115	N	0.122338	T	0.24624	0.0597	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.14952	-1.0454	9	0.45353	T	0.12	-1.7759	5.026	0.14385	0.199:0.0:0.5558:0.2452	.	65	Q96NL1	TMM74_HUMAN	V	65	.	ENSP00000297459:A65V	A	-	2	0	TMEM74	109866310	0.004000	0.15560	0.029000	0.17559	0.241000	0.25554	1.203000	0.32284	0.086000	0.17137	-0.136000	0.14681	GCA	-	TMEM74	-	NULL		0.512	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM74	HGNC	protein_coding	OTTHUMT00000380755.1	0	0	0	72	72	113	0.00	0.00	G	NM_153015		109797134	-1	34	36	44	45	tier1	no_errors	ENST00000297459	ensembl	human	known	74_37	missense	43.59	44.44	SNP	0.000	A	34	44
ACOX2	8309	genome.wustl.edu	37	3	58514611	58514611	+	Nonsense_Mutation	SNP	A	A	C			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr3:58514611A>C	ENST00000302819.5	-	9	1356	c.1065T>G	c.(1063-1065)taT>taG	p.Y355*	ACOX2_ENST00000459701.2_Nonsense_Mutation_p.Y341*	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	355					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		AATGGAAGGCATAACTGATGG	0.507													ENSG00000168306																																					0													135.0	128.0	130.0					3																	58514611		2203	4300	6503	SO:0001587	stop_gained	0			-	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.1065T>G	3.37:g.58514611A>C	ENSP00000307697:p.Tyr355*		A6NF16|B2R8U5	Nonsense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase_NM_dom,pirsf_Acyl-CoA_oxidase	p.Y355*	ENST00000302819.5	37	c.1065	CCDS33775.1	3	.	.	.	.	.	.	.	.	.	.	A	38	6.732831	0.97796	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	.	.	.	5.08	-5.89	0.02282	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.2052	15.3923	0.74755	0.4504:0.0:0.5496:0.0	.	.	.	.	X	341;355	.	ENSP00000307697:Y355X	Y	-	3	2	ACOX2	58489651	0.055000	0.20627	0.388000	0.26195	0.945000	0.59286	-0.855000	0.04295	-1.009000	0.03400	-0.441000	0.05720	TAT	-	ACOX2	-	superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase		0.507	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOX2	HGNC	protein_coding	OTTHUMT00000353541.1	0	0	0	97	97	134	0.00	0.00	A			58514611	-1	33	45	29	56	tier1	no_errors	ENST00000302819	ensembl	human	known	74_37	nonsense	53.23	44.12	SNP	0.874	C	33	29
PDE4DIP	9659	genome.wustl.edu	37	1	144868067	144868067	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:144868067C>G	ENST00000369354.3	-	33	5561	c.5372G>C	c.(5371-5373)aGg>aCg	p.R1791T	PDE4DIP_ENST00000369356.4_Missense_Mutation_p.R1791T|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R1927T|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.R1876T|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.R1685T			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1791					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TATGGTGCCCCTTGGAGGAGA	0.557			T	PDGFRB	MPD								ENSG00000178104																												Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													184.0	192.0	189.0					1																	144868067		2203	4296	6499	SO:0001583	missense	0			-	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5372G>C	1.37:g.144868067C>G	ENSP00000358360:p.Arg1791Thr		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.R1791T	ENST00000369354.3	37	c.5372	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	C	0.820	-0.748914	0.03065	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01584	4.75;4.85;4.85;4.84;4.85	5.44	4.52	0.55395	.	.	.	.	.	T	0.00724	0.0024	L	0.46157	1.445	0.34958	D	0.751949	B;B	0.09022	0.001;0.002	B;B	0.09377	0.003;0.004	T	0.38200	-0.9672	9	0.08599	T	0.76	.	12.0401	0.53448	0.0:0.8268:0.1732:0.0	.	1685;1791	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	T	1685;1791;1791;1876;1927	ENSP00000327209:R1685T;ENSP00000358360:R1791T;ENSP00000358363:R1791T;ENSP00000435654:R1876T;ENSP00000358366:R1927T	ENSP00000327209:R1685T	R	-	2	0	PDE4DIP	143579424	0.010000	0.17322	0.009000	0.14445	0.010000	0.07245	1.701000	0.37825	1.508000	0.48769	0.650000	0.86243	AGG	-	PDE4DIP	-	NULL		0.557	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	0	0	1	153	153	108	0.00	0.90	C	NM_022359		144868067	-1	27	27	118	76	tier1	no_errors	ENST00000369356	ensembl	human	known	74_37	missense	18.62	26.21	SNP	0.013	G	27	118
OR10C1	442194	genome.wustl.edu	37	6	29408456	29408456	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:29408456G>T	ENST00000444197.2	+	1	1374	c.664G>T	c.(664-666)Gtt>Ttt	p.V222F	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCGTATCCTCGTTACCATCTT	0.587													ENSG00000206474																																					0													206.0	222.0	216.0					6																	29408456		1511	2709	4220	SO:0001583	missense	0			-		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.664G>T	6.37:g.29408456G>T	ENSP00000419119:p.Val222Phe		Q5SUN7|Q96R18	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.V222F	ENST00000444197.2	37	c.664	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	G	0.290	-0.980684	0.02197	.	.	ENSG00000206474	ENST00000444197	T	0.37235	1.21	3.49	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.408635	0.17808	N	0.161305	T	0.10121	0.0248	L	0.38692	1.165	0.09310	N	1	B	0.11235	0.004	B	0.18871	0.023	T	0.32241	-0.9914	10	0.19147	T	0.46	.	8.7036	0.34340	0.199:0.0:0.801:0.0	.	222	Q96KK4	O10C1_HUMAN	F	222	ENSP00000419119:V222F	ENSP00000419119:V222F	V	+	1	0	OR10C1	29516435	0.000000	0.05858	0.008000	0.14137	0.003000	0.03518	-1.396000	0.02513	0.680000	0.31366	-0.216000	0.12614	GTT	-	OR10C1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.587	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	HGNC	protein_coding	OTTHUMT00000076415.2	0	0	0	61	61	73	0.00	0.00	G			29408456	+1	22	32	18	50	tier1	no_errors	ENST00000444197	ensembl	human	known	74_37	missense	55.00	39.02	SNP	0.005	T	22	18
GABBR1	2550	genome.wustl.edu	37	6	29550086	29550086	+	Intron	SNP	C	C	G	rs112412437		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:29550086C>G	ENST00000355973.3	-	18	2784				SNORD32B_ENST00000364460.1_RNA			Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	ATGAGACCAACCCCATGCACT	0.423													ENSG00000201330																																					0													58.0	54.0	56.0					6																	29550086		876	1991	2867	SO:0001627	intron_variant	0			-	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000355973.3:c.2532+21231G>C	6.37:g.29550086C>G			B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	R	SNP	-	NULL	ENST00000355973.3	37	NULL	CCDS4665.1	6																																																																																			-	SNORD32B	-	-		0.423	GABBR1-002	KNOWN	basic|CCDS	protein_coding	SNORD32B	HGNC	protein_coding	OTTHUMT00000194822.3	0	0	0	196	196	56	0.00	0.00	C			29550086	+1	56	22	72	36	tier1	no_errors	ENST00000364460	ensembl	human	known	74_37	rna	43.75	37.93	SNP	0.997	G	56	72
KIAA0195	9772	genome.wustl.edu	37	17	73484164	73484164	+	Silent	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr17:73484164C>T	ENST00000314256.7	+	6	955	c.561C>T	c.(559-561)atC>atT	p.I187I	KIAA0195_ENST00000583795.1_3'UTR|KIAA0195_ENST00000579208.1_Intron|KIAA0195_ENST00000375248.5_Silent_p.I197I	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	187						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			AAGGAGACATCATAGCTTTGA	0.557													ENSG00000177728																																					0													133.0	105.0	115.0					17																	73484164		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.561C>T	17.37:g.73484164C>T			O75536|Q86XF1	Silent	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.I187	ENST00000314256.7	37	c.561	CCDS32732.1	17																																																																																			-	KIAA0195	-	NULL		0.557	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	0	0	0	84	84	80	0.00	0.00	C	NM_014738		73484164	+1	37	34	45	39	tier1	no_errors	ENST00000314256	ensembl	human	known	74_37	silent	45.12	45.95	SNP	1.000	T	37	45
RXFP2	122042	genome.wustl.edu	37	13	32356836	32356836	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr13:32356836G>T	ENST00000298386.2	+	11	952	c.881G>T	c.(880-882)gGt>gTt	p.G294V	RXFP2_ENST00000380314.1_Intron	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	294					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		AATCAAATTGGTTTTGTTCCA	0.388													ENSG00000133105																																					0													82.0	80.0	80.0					13																	32356836		2203	4300	6503	SO:0001583	missense	0			-	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.881G>T	13.37:g.32356836G>T	ENSP00000298386:p.Gly294Val		B1ALE9|Q3KU23	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.G294V	ENST00000298386.2	37	c.881	CCDS9342.1	13	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494376	0.26774	.	.	ENSG00000133105	ENST00000298386	T	0.57273	0.41	5.6	1.68	0.24146	.	0.571237	0.19519	N	0.112325	T	0.36826	0.0981	N	0.17345	0.48	0.80722	D	1	B	0.19583	0.037	B	0.34346	0.18	T	0.07693	-1.0759	10	0.32370	T	0.25	.	7.9229	0.29857	0.6665:0.0:0.3335:0.0	.	294	Q8WXD0	RXFP2_HUMAN	V	294	ENSP00000298386:G294V	ENSP00000298386:G294V	G	+	2	0	RXFP2	31254836	0.961000	0.32948	1.000000	0.80357	0.995000	0.86356	1.005000	0.29834	0.101000	0.17610	-0.290000	0.09829	GGT	-	RXFP2	-	smart_Leu-rich_rpt_typical-subtyp		0.388	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RXFP2	HGNC	protein_coding	OTTHUMT00000044399.1	0	0	0	75	75	75	0.00	0.00	G	NM_130806		32356836	+1	26	45	38	48	tier1	no_errors	ENST00000298386	ensembl	human	known	74_37	missense	40.62	48.39	SNP	1.000	T	26	38
LAMB1	3912	genome.wustl.edu	37	7	107601660	107601660	+	Silent	SNP	C	C	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr7:107601660C>T	ENST00000222399.6	-	17	2330	c.2100G>A	c.(2098-2100)ctG>ctA	p.L700L	LAMB1_ENST00000393561.1_Silent_p.L724L|LAMB1_ENST00000393560.1_Silent_p.L700L	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	700	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CAGAATCGATCAGCGTGTAGG	0.552													ENSG00000091136																																					0													120.0	108.0	112.0					7																	107601660		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2100G>A	7.37:g.107601660C>T			Q14D91	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SRE,superfamily_P-loop_NTPase,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L700	ENST00000222399.6	37	c.2100	CCDS5750.1	7																																																																																			-	LAMB1	-	pfscan_Laminin_IV		0.552	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	0	0	0	81	81	51	0.00	0.00	C	NM_002291		107601660	-1	19	17	35	41	tier1	no_errors	ENST00000222399	ensembl	human	known	74_37	silent	35.19	29.31	SNP	0.963	T	19	35
SLC26A6	65010	genome.wustl.edu	37	3	48667882	48667882	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr3:48667882C>A	ENST00000395550.2	-	11	1362	c.1315G>T	c.(1315-1317)Gac>Tac	p.D439Y	SLC26A6_ENST00000455886.2_Missense_Mutation_p.D403Y|SLC26A6_ENST00000383733.3_Missense_Mutation_p.D439Y|SLC26A6_ENST00000337000.8_Missense_Mutation_p.D332Y|SLC26A6_ENST00000482282.1_5'Flank|SLC26A6_ENST00000358747.6_Missense_Mutation_p.D418Y|SLC26A6_ENST00000420764.2_Missense_Mutation_p.D439Y			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	439					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TTGGGCAGGTCATGGAAGAGT	0.587													ENSG00000225697																									NSCLC(13;369 479 28271 30152 44026)												0													46.0	53.0	51.0					3																	48667882		1973	4123	6096	SO:0001583	missense	0			-	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.1315G>T	3.37:g.48667882C>A	ENSP00000378920:p.Asp439Tyr		B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.D439Y	ENST00000395550.2	37	c.1315	CCDS43087.1	3	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988187	0.35036	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886;ENST00000421649	D;D;D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87;-2.87;-2.87	5.6	2.67	0.31697	Sulphate transporter (1);	.	.	.	.	D	0.89815	0.6824	N	0.25647	0.755	0.09310	N	0.999999	D;B;D;P;D;D;P	0.67145	0.996;0.045;0.981;0.896;0.98;0.958;0.81	D;B;D;P;D;D;B	0.71184	0.972;0.029;0.935;0.745;0.935;0.935;0.34	T	0.79313	-0.1855	9	0.66056	D	0.02	.	5.3201	0.15876	0.1377:0.5228:0.2667:0.0728	.	403;452;332;439;439;439;3844	B4DMZ1;Q86YZ4;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;.;S26A6_HUMAN;.	Y	439;439;439;332;452;418;403;247	ENSP00000404684:D439Y;ENSP00000378920:D439Y;ENSP00000373239:D439Y;ENSP00000337648:D332Y;ENSP00000351597:D418Y;ENSP00000401066:D403Y;ENSP00000389922:D247Y	ENSP00000337648:D332Y	D	-	1	0	SLC26A6	48642886	0.201000	0.23410	0.453000	0.27007	0.345000	0.29048	0.608000	0.24223	0.694000	0.31654	0.655000	0.94253	GAC	-	SLC26A6	-	pfam_Sulph_transpt,tigrfam_SulP_transpt		0.587	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC26A6	HGNC	protein_coding	OTTHUMT00000345040.1	0	0	0	92	92	106	0.00	0.00	C	NM_022911		48667882	-1	29	41	35	45	tier1	no_errors	ENST00000395550	ensembl	human	known	74_37	missense	45.31	47.67	SNP	0.079	A	29	35
PRR14L	253143	genome.wustl.edu	37	22	32108558	32108558	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr22:32108558G>A	ENST00000327423.6	-	4	5456	c.5267C>T	c.(5266-5268)cCg>cTg	p.P1756L	PRR14L_ENST00000434485.1_Missense_Mutation_p.P1756L|PRR14L_ENST00000397493.2_Missense_Mutation_p.P1756L	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1756										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						AGGTTGAGACGGGCACTGGAG	0.552													ENSG00000183530																																					0													34.0	36.0	35.0					22																	32108558		692	1591	2283	SO:0001583	missense	0			-	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.5267C>T	22.37:g.32108558G>A	ENSP00000331845:p.Pro1756Leu		Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NULL	p.P1756L	ENST00000327423.6	37	c.5267	CCDS13900.2	22	.	.	.	.	.	.	.	.	.	.	G	7.781	0.709431	0.15239	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.07216	3.21;3.23;3.21	5.81	-0.139	0.13460	.	0.724111	0.12900	N	0.429849	T	0.03263	0.0095	N	0.12182	0.205	0.09310	N	1	B;B;B	0.28667	0.219;0.219;0.219	B;B;B	0.20184	0.028;0.028;0.028	T	0.41288	-0.9517	10	0.30078	T	0.28	0.7532	1.7142	0.02898	0.2907:0.1276:0.45:0.1317	.	1756;1756;1756	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	L	1756	ENSP00000380630:P1756L;ENSP00000331845:P1756L;ENSP00000388314:P1756L	ENSP00000331845:P1756L	P	-	2	0	PRR14L	30438558	0.322000	0.24634	0.016000	0.15963	0.182000	0.23217	0.781000	0.26774	-0.156000	0.11079	-0.182000	0.12963	CCG	-	PRR14L	-	NULL		0.552	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	0	0	0	32	32	48	0.00	0.00	G	NM_173566		32108558	-1	14	18	13	40	tier1	no_errors	ENST00000397493	ensembl	human	known	74_37	missense	51.85	31.03	SNP	0.001	A	14	13
NPAS4	266743	genome.wustl.edu	37	11	66192048	66192048	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr11:66192048G>A	ENST00000311034.2	+	7	1863	c.1687G>A	c.(1687-1689)Gcc>Acc	p.A563T		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	563					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						GACTTACTTTGCCCAGGAGGG	0.587													ENSG00000174576																																					0													102.0	111.0	108.0					11																	66192048		2200	4295	6495	SO:0001583	missense	0			-	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.1687G>A	11.37:g.66192048G>A	ENSP00000311196:p.Ala563Thr		B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.A563T	ENST00000311034.2	37	c.1687	CCDS8138.1	11	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506066	0.26949	.	.	ENSG00000174576	ENST00000311034	T	0.50277	0.75	4.69	1.5	0.22942	.	0.364605	0.23893	N	0.043534	T	0.18593	0.0446	N	0.08118	0	0.27821	N	0.941798	B	0.33694	0.421	B	0.30029	0.11	T	0.05084	-1.0907	10	0.30078	T	0.28	-3.1907	1.0957	0.01672	0.2215:0.1828:0.4295:0.1662	.	563	Q8IUM7	NPAS4_HUMAN	T	563	ENSP00000311196:A563T	ENSP00000311196:A563T	A	+	1	0	NPAS4	65948624	0.993000	0.37304	0.995000	0.50966	0.973000	0.67179	0.560000	0.23500	0.542000	0.28846	0.655000	0.94253	GCC	-	NPAS4	-	NULL		0.587	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	0	0	0	39	39	164	0.00	0.00	G	NM_178864		66192048	+1	18	51	18	83	tier1	no_errors	ENST00000311034	ensembl	human	known	74_37	missense	50.00	38.06	SNP	0.933	A	18	18
CACNA1A	773	genome.wustl.edu	37	19	13410084	13410084	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr19:13410084G>C	ENST00000360228.5	-	19	2362	c.2363C>G	c.(2362-2364)gCc>gGc	p.A788G	CACNA1A_ENST00000573710.2_Missense_Mutation_p.A789G	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	789					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCCCGGCTGGCCAGCAAGTT	0.597													ENSG00000141837																																					0													74.0	81.0	78.0					19																	13410084		2073	4202	6275	SO:0001583	missense	0			-	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2363C>G	19.37:g.13410084G>C	ENSP00000353362:p.Ala788Gly		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.A788G	ENST00000360228.5	37	c.2363	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	9.636	1.137807	0.21123	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96300	-3.97	4.0	4.0	0.46444	.	0.635417	0.11828	U	0.525526	D	0.93838	0.8029	L	0.47190	1.495	0.26200	N	0.979463	B;P;P	0.37864	0.255;0.571;0.61	B;B;B	0.37550	0.038;0.121;0.253	D	0.89669	0.3882	10	0.72032	D	0.01	.	10.4237	0.44365	0.0:0.0:0.8044:0.1956	.	789;792;788	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	G	788;792;789;789	ENSP00000353362:A788G	ENSP00000317661:A789G	A	-	2	0	CACNA1A	13271084	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	7.358000	0.79466	2.073000	0.62155	0.561000	0.74099	GCC	-	CAC1A	-	NULL		0.597	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CAC1A	HGNC	protein_coding	OTTHUMT00000104062.2	0	0	0	73	73	35	0.00	0.00	G	NM_000068		13410084	-1	30	12	33	18	tier1	no_errors	ENST00000360228	ensembl	human	known	74_37	missense	47.62	40.00	SNP	1.000	C	30	33
TMEM14B	81853	genome.wustl.edu	37	6	10750123	10750123	+	Intron	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr6:10750123G>T	ENST00000379542.5	+	3	267				TMEM14B_ENST00000491103.1_Intron|TMEM14B_ENST00000481240.1_Intron|TMEM14B_ENST00000475942.1_Intron|TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000379530.3_Intron|RP11-421M1.8_ENST00000606522.1_lincRNA|TMEM14B_ENST00000473276.1_Intron|RNA5SP203_ENST00000410451.1_RNA|TMEM14B_ENST00000461342.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				GCTGAGCCAGGCCTCTTGTGG	0.483													ENSG00000137210																																					0																																										SO:0001627	intron_variant	0			-	AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.100+192G>T	6.37:g.10750123G>T			Q5THN7|Q5THN8|Q96IX7|Q9BVN8	R	SNP	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			-	TMEM14B	-	-		0.483	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	0	0	0	11	11	74	0.00	0.00	G	NM_030969		10750123	+1	8	22	2	28	tier1	no_errors	ENST00000492297	ensembl	human	known	74_37	rna	80.00	44.00	SNP	0.002	T	8	2
ROBO2	6092	genome.wustl.edu	37	3	77614263	77614263	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr3:77614263G>A	ENST00000461745.1	+	12	2741	c.1841G>A	c.(1840-1842)cGc>cAc	p.R614H	ROBO2_ENST00000332191.8_Missense_Mutation_p.R614H|ROBO2_ENST00000487694.3_Missense_Mutation_p.R630H	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	614	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.R614H(1)|p.R630H(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GATCCTGTGCGCACACAAGGT	0.468													ENSG00000185008																																					2	Substitution - Missense(2)	endometrium(2)											127.0	125.0	126.0					3																	77614263		1967	4155	6122	SO:0001583	missense	0			-	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1841G>A	3.37:g.77614263G>A	ENSP00000417164:p.Arg614His		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R614H	ENST00000461745.1	37	c.1841	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.323084	0.95708	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	D;D;D	0.82711	-1.64;-1.64;-1.64	6.02	6.02	0.97574	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.46145	D	0.000320	D	0.91287	0.7253	M	0.71581	2.175	0.40145	D	0.976884	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.90917	0.4780	9	0.72032	D	0.01	.	20.5373	0.99239	0.0:0.0:1.0:0.0	.	630;614;614	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	H	630;630;634;614;614;335	ENSP00000417335:R630H;ENSP00000417164:R614H;ENSP00000327536:R614H	ENSP00000327536:R614H	R	+	2	0	ROBO2	77696953	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.857000	0.98124	0.650000	0.86243	CGC	-	ROBO2	-	superfamily_Fibronectin_type3		0.468	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	0	0	0	97	97	119	0.00	0.00	G	XM_031246		77614263	+1	45	29	32	63	tier1	no_errors	ENST00000461745	ensembl	human	known	74_37	missense	58.44	31.52	SNP	1.000	A	45	32
COLGALT1	79709	genome.wustl.edu	37	19	17679325	17679325	+	Missense_Mutation	SNP	A	A	G	rs375611652		TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr19:17679325A>G	ENST00000252599.4	+	5	752	c.632A>G	c.(631-633)tAc>tGc	p.Y211C	COLGALT1_ENST00000601354.1_3'UTR	NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	211					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										CAGGGCTACTACAAGCGCACA	0.597													ENSG00000130309																																					0								A	CYS/TYR	0,4406		0,0,2203	93.0	76.0	82.0		632	4.8	1.0	19		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	GLT25D1	NM_024656.2	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	211/623	17679325	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.632A>G	19.37:g.17679325A>G	ENSP00000252599:p.Tyr211Cys		Q8NC64	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.Y211C	ENST00000252599.4	37	c.632	CCDS12363.1	19	.	.	.	.	.	.	.	.	.	.	A	20.7	4.038684	0.75617	0.0	1.16E-4	ENSG00000130309	ENST00000252599	T	0.24908	1.83	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.59542	0.2201	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70417	-0.4877	10	0.87932	D	0	-9.8249	12.1992	0.54315	1.0:0.0:0.0:0.0	.	211	Q8NBJ5	GT251_HUMAN	C	211	ENSP00000252599:Y211C	ENSP00000252599:Y211C	Y	+	2	0	GLT25D1	17540325	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.156000	0.94705	1.788000	0.52465	0.402000	0.26972	TAC	-	COLGALT1	-	NULL		0.597	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT1	HGNC	protein_coding	OTTHUMT00000464216.1	0	0	0	44	44	93	0.00	0.00	A	NM_024656		17679325	+1	22	26	22	44	tier1	no_errors	ENST00000252599	ensembl	human	known	74_37	missense	50.00	37.14	SNP	1.000	G	22	22
PANK4	55229	genome.wustl.edu	37	1	2453358	2453358	+	Intron	DEL	G	G	-			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:2453358delG	ENST00000378466.3	-	2	137				PANK4_ENST00000435556.3_Intron|PANK4_ENST00000491212.1_Intron	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4						coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TGAGGGGTTTGGGGCTACTGG	0.522													ENSG00000157881																																					0																																										SO:0001627	intron_variant	0				AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.125-119C>-	1.37:g.2453358delG			B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Frame_Shift_Del	DEL	NULL	p.K50fs	ENST00000378466.3	37	c.147	CCDS42.1	1																																																																																				PANK4	-	NULL		0.522	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	HGNC	protein_coding	OTTHUMT00000002082.1	0	0	0	52	52	130	0.00	0.00	G			2453358	-1	12	58	16	53	tier1	no_errors	ENST00000502770	ensembl	human	known	74_37	frame_shift_del	42.86	52.25	DEL	0.000	-	12	16
PCDH11Y	83259	genome.wustl.edu	37	Y	4925493	4925493	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chrY:4925493T>A	ENST00000333703.4	+	4	1109	c.596T>A	c.(595-597)cTa>cAa	p.L199Q	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.L210Q|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.L210Q	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						AACTACGAACTAATTAAGGTG	0.318													ENSG00000099715																																					0																																										SO:0001583	missense	0			-	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.596T>A	Y.37:g.4925493T>A	ENSP00000330552:p.Leu199Gln		Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L210Q	ENST00000333703.4	37	c.629	CCDS14776.1	Y																																																																																			-	PCDH11Y	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.318	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH11Y	HGNC	protein_coding	OTTHUMT00000084979.2	0	0	0	107	107	51	0.00	0.00	T	NM_032973		4925493	+1	98	62	1	5	tier1	no_errors	ENST00000215473	ensembl	human	known	74_37	missense	98.99	91.18	SNP	1.000	A	98	1
TRPC7	57113	genome.wustl.edu	37	5	135692561	135692561	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr5:135692561G>A	ENST00000513104.1	-	2	797	c.515C>T	c.(514-516)gCg>gTg	p.A172V	TRPC7_ENST00000426057.2_Missense_Mutation_p.A172V|TRPC7_ENST00000355180.3_Missense_Mutation_p.A172V	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	172					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGGCAGTGCGCCGCCAGGAT	0.632													ENSG00000069018																																					0													128.0	137.0	134.0					5																	135692561		2203	4300	6503	SO:0001583	missense	0			-	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.515C>T	5.37:g.135692561G>A	ENSP00000426070:p.Ala172Val		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.A172V	ENST00000513104.1	37	c.515	CCDS47267.2	5	.	.	.	.	.	.	.	.	.	.	G	34	5.335741	0.95758	.	.	ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	T;T;T	0.72725	-0.68;-0.68;-0.68	5.26	5.26	0.73747	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	D	0.85225	0.5648	M	0.80616	2.505	0.47737	D	0.999508	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.75020	0.97;0.985;0.965;0.965	D	0.86781	0.1979	10	0.87932	D	0	-16.9024	19.0783	0.93171	0.0:0.0:1.0:0.0	.	172;172;172;172	Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.;.;.;TRPC7_HUMAN	V	172	ENSP00000347312:A172V;ENSP00000441628:A172V;ENSP00000426070:A172V	ENSP00000265193:A172V	A	-	2	0	TRPC7	135720460	1.000000	0.71417	0.980000	0.43619	0.988000	0.76386	9.657000	0.98554	2.731000	0.93534	0.650000	0.86243	GCG	-	TRPC7	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,tigrfam_TRP_channel		0.632	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1	0	0	1	27	27	23	0.00	4.17	G	NM_020389		135692561	-1	9	10	13	12	tier1	no_errors	ENST00000513104	ensembl	human	known	74_37	missense	40.91	45.45	SNP	1.000	A	9	13
OBSCN	84033	genome.wustl.edu	37	1	228494137	228494137	+	Silent	SNP	C	C	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:228494137C>A	ENST00000422127.1	+	44	11768	c.11724C>A	c.(11722-11724)acC>acA	p.T3908T	OBSCN_ENST00000366707.4_Silent_p.T1542T|OBSCN_ENST00000570156.2_Silent_p.T4865T|OBSCN_ENST00000284548.11_Silent_p.T3908T|OBSCN_ENST00000366709.4_Silent_p.T1027T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3908	Ig-like 40.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCACGGCCACCCTGCAGTGTG	0.687													ENSG00000154358																																					0													15.0	17.0	17.0					1																	228494137		1927	4095	6022	SO:0001819	synonymous_variant	0			-	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11724C>A	1.37:g.228494137C>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.T3908	ENST00000422127.1	37	c.11724	CCDS58065.1	1																																																																																			-	OBSCN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.687	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		0	0	0	24	24	7	0.00	0.00	C	NM_052843		228494137	+1	8	1	6	3	tier1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	57.14	25.00	SNP	0.006	A	8	6
KCNB1	3745	genome.wustl.edu	37	20	48098845	48098845	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr20:48098845C>A	ENST00000371741.4	-	1	339	c.173G>T	c.(172-174)gGc>gTc	p.G58V		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	58					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	GCGGAGCTTGCCCAGCCGCGT	0.692													ENSG00000158445																																					0													16.0	16.0	16.0					20																	48098845		2189	4264	6453	SO:0001583	missense	0			-	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.173G>T	20.37:g.48098845C>A	ENSP00000360806:p.Gly58Val		Q14193	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.1,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.G58V	ENST00000371741.4	37	c.173	CCDS13418.1	20	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958852	0.92726	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.78816	-1.21	4.86	4.86	0.63082	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.92018	0.7471	H	0.96142	3.775	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.94474	0.7687	10	0.87932	D	0	.	17.8086	0.88609	0.0:1.0:0.0:0.0	.	58	Q14721	KCNB1_HUMAN	V	58;13	ENSP00000360806:G58V	ENSP00000360806:G58V	G	-	2	0	KCNB1	47532252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.646000	0.83445	2.528000	0.85240	0.563000	0.77884	GGC	-	KCNB1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv9		0.692	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB1	HGNC	protein_coding	OTTHUMT00000080374.3	0	0	0	31	31	4	0.00	0.00	C	NM_004975		48098845	-1	4	0	17	9	tier1	no_errors	ENST00000371741	ensembl	human	known	74_37	missense	19.05	0.00	SNP	1.000	A	4	17
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGG	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr1:153233991_153233992insCTCTGGCGGCGG	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGG	c.(565-570)tactct>taCTCTGGCGGCGGctct	p.194_195insGGGS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	194					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743													ENSG00000203782		3247	0.648363	0.6664	0.7954	5008	,	,		5032	0.4563		0.7147	False		,,,				2504	0.6493																0										178,190		86,6,92						-7.1	0.0		dbSNP_120	1	749,435		350,49,193	no	coding	LOR	NM_000427.2		436,55,285	A1A1,A1R,RR		36.7399,48.3696,40.2706				927,625				SO:0001652	inframe_insertion	0				M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.567_578dupCTCTGGCGGCGG	1.37:g.153233991_153233992insCTCTGGCGGCGG	ENSP00000357731:p.Gly191_Ser194dup		Q5T869|Q5XKF8	In_Frame_Ins	INS	NULL	p.193in_frame_insGSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																				LOR	-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	HGNC	protein_coding	OTTHUMT00000039107.1	0	0	0	1	1	1	0.00	0.00	-	NM_000427		153233992	+1	0	0	0	0	tier1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.014:0.200	CTCTGGCGGCGG	0	0
RALGAPA1	253959	genome.wustl.edu	37	14	36277946	36277946	+	Silent	SNP	G	G	T			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr14:36277946G>T	ENST00000389698.3	-	1	486	c.96C>A	c.(94-96)cgC>cgA	p.R32R	RALGAPA1_ENST00000307138.6_Silent_p.R32R|AL162311.1_ENST00000582013.1_RNA|RALGAPA1_ENST00000382366.3_Silent_p.R32R|RALGAPA1_ENST00000258840.6_Silent_p.R32R	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	32					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGATGACGATGCGCAGGTGCT	0.647													ENSG00000174373																																					0													78.0	54.0	62.0					14																	36277946		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.96C>A	14.37:g.36277946G>T			A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Silent	SNP	pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.R32	ENST00000389698.3	37	c.96	CCDS32065.1	14																																																																																			-	RALGAPA1	-	NULL		0.647	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	RALGAPA1	HGNC	protein_coding	OTTHUMT00000409829.1	0	0	0	55	55	0	0.00	0.00	G	XM_210022		36277946	-1	4	0	37	0	tier1	no_errors	ENST00000258840	ensembl	human	known	74_37	silent	9.76	0.00	SNP	1.000	T	4	37
MED21	9412	genome.wustl.edu	37	12	27179393	27179418	+	Frame_Shift_Del	DEL	AATGTGGTCCTCCTGCCTCTTTCAAT	AATGTGGTCCTCCTGCCTCTTTCAAT	-			TCGA-DX-A7ER-01A-11D-A36J-09	TCGA-DX-A7ER-10A-01D-A36M-09	AATGTGGTCCTCCTGCCTCTTTCAAT	AATGTGGTCCTCCTGCCTCTTTCAAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3fe739b3-f74d-4241-ad59-41d70c6e190f	e9334f05-85a9-45d3-b341-aacb77034f08	g.chr12:27179393_27179418delAATGTGGTCCTCCTGCCTCTTTCAAT	ENST00000282892.3	+	2	113_138	c.83_108delAATGTGGTCCTCCTGCCTCTTTCAAT	c.(82-108)caatgtggtcctcctgcctctttcaatfs	p.QCGPPASFN28fs	MED21_ENST00000536503.1_Intron|MED21_ENST00000546323.1_Frame_Shift_Del_p.QCGPPASFN28fs	NM_001271811.1|NM_004264.3	NP_001258740.1|NP_004255.2	Q13503	MED21_HUMAN	mediator complex subunit 21	28					blastocyst development (GO:0001824)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)	DNA-directed RNA polymerase activity (GO:0003899)|transcription coactivator activity (GO:0003713)					Colorectal(261;0.0847)					GTATTGCAGCAATGTGGTCCTCCTGCCTCTTTCAATAATATTCAGA	0.372													ENSG00000152944																																					0																																										SO:0001589	frameshift_variant	0				U46837	CCDS8711.1	12p12	2007-07-30	2007-07-30	2007-07-30		ENSG00000152944			11473	protein-coding gene	gene with protein product		603800	"""SRB7 (suppressor of RNA polymerase B, yeast) homolog"", ""SRB7 suppressor of RNA polymerase B homolog (yeast)"""	SURB7		8598913	Standard	NM_004264		Approved	SRB7	uc001rhp.2	Q13503		ENST00000282892.3:c.83_108delAATGTGGTCCTCCTGCCTCTTTCAAT	12.37:g.27179393_27179418delAATGTGGTCCTCCTGCCTCTTTCAAT	ENSP00000282892:p.Gln28fs		B2R4I3|Q6IB05|Q92811	Frame_Shift_Del	DEL	pfam_Mediator_Med21	p.C29fs	ENST00000282892.3	37	c.83_108	CCDS8711.1	12																																																																																				MED21	-	pfam_Mediator_Med21		0.372	MED21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED21	HGNC	protein_coding	OTTHUMT00000403262.1	0	0	0	50	50	50	0.00	0.00	AATGTGGTCCTCCTGCCTCTTTCAAT	NM_004264		27179418	+1	2	2	30	30	tier1	no_errors	ENST00000282892	ensembl	human	known	74_37	frame_shift_del	6.25	6.25	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.995:0.686:1.000:1.000:0.944:1.000:1.000:0.985:1.000:1.000:0.995:1.000:1.000:0.994:1.000:1.000:0.997:1.000:1.000:1.000	-	2	30
