#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
FIG4	9896	genome.wustl.edu	37	6	110059609	110059609	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:110059609A>G	ENST00000230124.3	+	7	852	c.728A>G	c.(727-729)cAt>cGt	p.H243R	FIG4_ENST00000441478.2_Intron|FIG4_ENST00000368941.1_Intron	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	243	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		AGTACTGTGCATCGTGACTGG	0.338													ENSG00000112367																																					0													155.0	156.0	156.0					6																	110059609		2203	4299	6502	SO:0001583	missense	0			-	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.728A>G	6.37:g.110059609A>G	ENSP00000230124:p.His243Arg		Q53H49|Q5TCS6	Missense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.H243R	ENST00000230124.3	37	c.728	CCDS5078.1	6	.	.	.	.	.	.	.	.	.	.	A	15.32	2.797930	0.50208	.	.	ENSG00000112367	ENST00000230124;ENST00000454215	T;T	0.56611	0.45;0.45	5.67	4.52	0.55395	Synaptojanin, N-terminal (2);	0.110613	0.64402	D	0.000009	T	0.40522	0.1120	L	0.42245	1.32	0.80722	D	1	P	0.51057	0.941	P	0.55577	0.779	T	0.27938	-1.0059	10	0.15952	T	0.53	-8.829	11.3622	0.49651	0.9294:0.0:0.0706:0.0	.	243	Q92562	FIG4_HUMAN	R	243;222	ENSP00000230124:H243R;ENSP00000412156:H222R	ENSP00000230124:H243R	H	+	2	0	FIG4	110166302	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.167000	0.77562	0.987000	0.38709	0.533000	0.62120	CAT	-	FIG4	-	pfam_Syja_N,pfscan_Syja_N		0.338	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	HGNC	protein_coding	OTTHUMT00000041768.1	0	0	1	54	54	101	0.00	0.98	A	NM_014845		110059609	+1	15	32	57	75	tier1	no_errors	ENST00000230124	ensembl	human	known	74_37	missense	20.83	29.91	SNP	1.000	G	15	57
ZNF608	57507	genome.wustl.edu	37	5	123973290	123973290	+	3'UTR	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr5:123973290G>A	ENST00000306315.5	-	0	5277				ZNF608_ENST00000504926.1_3'UTR|ZNF608_ENST00000513985.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608								metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TGAGTGGTTTGCGACGTGGCA	0.303													ENSG00000168916																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.*303C>T	5.37:g.123973290G>A			A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	R	SNP	-	NULL	ENST00000306315.5	37	NULL	CCDS34219.1	5																																																																																			-	ZNF608	-	-		0.303	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	0	0	0	102	102	123	0.00	0.00	G	XM_114432		123973290	-1	14	19	76	66	tier1	no_errors	ENST00000513985	ensembl	human	known	74_37	rna	15.56	22.35	SNP	1.000	A	14	76
DNAJC11	55735	genome.wustl.edu	37	1	6696236	6696236	+	Missense_Mutation	SNP	C	C	T	rs558222069		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:6696236C>T	ENST00000377577.5	-	15	1718	c.1595G>A	c.(1594-1596)cGg>cAg	p.R532Q	DNAJC11_ENST00000377573.5_Missense_Mutation_p.R442Q|DNAJC11_ENST00000294401.7_Missense_Mutation_p.R480Q|DNAJC11_ENST00000349363.6_Intron|DNAJC11_ENST00000465508.1_5'UTR|DNAJC11_ENST00000542246.1_Missense_Mutation_p.R494Q	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	532						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGACGCCCCGGAACTGATA	0.557													ENSG00000007923	C|||	1	0.000199681	0.0	0.0	5008	,	,		18357	0.0		0.0	False		,,,				2504	0.001																0													90.0	77.0	82.0					1																	6696236		2203	4300	6503	SO:0001583	missense	0			-	AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.1595G>A	1.37:g.6696236C>T	ENSP00000366800:p.Arg532Gln		Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	pfam_DnaJ-like_C11_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.R532Q	ENST00000377577.5	37	c.1595	CCDS87.1	1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781825	0.90282	.	.	ENSG00000007923	ENST00000377577;ENST00000294401;ENST00000542246;ENST00000377573	T;T;T;T	0.26373	2.37;2.43;2.09;1.74	5.52	4.61	0.57282	DnaJ-like protein C11, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.40322	0.1112	L	0.48935	1.535	0.58432	D	0.999993	D;P;D	0.89917	1.0;0.933;0.978	D;B;P	0.67231	0.95;0.41;0.598	T	0.08868	-1.0701	10	0.27082	T	0.32	-15.5675	13.4422	0.61119	0.0:0.925:0.0:0.075	.	442;480;532	B4DGD5;Q9NVH1-3;Q9NVH1	.;.;DJC11_HUMAN	Q	532;480;494;442	ENSP00000366800:R532Q;ENSP00000294401:R480Q;ENSP00000444020:R494Q;ENSP00000366796:R442Q	ENSP00000294401:R480Q	R	-	2	0	DNAJC11	6618823	1.000000	0.71417	0.893000	0.35052	0.991000	0.79684	7.298000	0.78815	1.329000	0.45376	0.655000	0.94253	CGG	-	DJC11	-	pfam_DnaJ-like_C11_C		0.557	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DJC11	HGNC	protein_coding	OTTHUMT00000004216.3	0	0	0	74	74	83	0.00	0.00	C	NM_018198		6696236	-1	16	14	66	83	tier1	no_errors	ENST00000377577	ensembl	human	known	74_37	missense	19.51	14.43	SNP	0.999	T	16	66
JPH2	57158	genome.wustl.edu	37	20	42789014	42789014	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr20:42789014C>T	ENST00000372980.3	-	2	1285	c.413G>A	c.(412-414)cGc>cAc	p.R138H		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	138	Gly-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GTAGCCATGGCGCATGCCGTT	0.711													ENSG00000149596																																					0													22.0	12.0	15.0					20																	42789014		2086	4080	6166	SO:0001583	missense	0			-	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.413G>A	20.37:g.42789014C>T	ENSP00000362071:p.Arg138His		E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.R138H	ENST00000372980.3	37	c.413	CCDS13325.1	20	.	.	.	.	.	.	.	.	.	.	c	21.3	4.133132	0.77662	.	.	ENSG00000149596	ENST00000372980	T	0.60040	0.22	3.34	3.34	0.38264	.	0.000000	0.85682	U	0.000000	T	0.73032	0.3535	M	0.66439	2.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77981	-0.2383	10	0.87932	D	0	.	14.8586	0.70362	0.0:1.0:0.0:0.0	.	138	Q9BR39	JPH2_HUMAN	H	138	ENSP00000362071:R138H	ENSP00000362071:R138H	R	-	2	0	JPH2	42222428	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	7.241000	0.78201	1.700000	0.51204	0.306000	0.20318	CGC	-	JPH2	-	pfam_MORN,smart_MORN,pirsf_Junctophilin		0.711	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	HGNC	protein_coding	OTTHUMT00000080307.1	0	0	0	90	90	25	0.00	0.00	C			42789014	-1	11	4	73	17	tier1	no_errors	ENST00000372980	ensembl	human	known	74_37	missense	13.10	19.05	SNP	1.000	T	11	73
C14orf39	317761	genome.wustl.edu	37	14	60945104	60945104	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr14:60945104C>T	ENST00000321731.3	-	5	396	c.237G>A	c.(235-237)tgG>tgA	p.W79*		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	79					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		ATGTTGGCTTCCAGCTATAGA	0.264													ENSG00000179008																																					0													55.0	54.0	54.0					14																	60945104		2201	4293	6494	SO:0001587	stop_gained	0			-	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.237G>A	14.37:g.60945104C>T	ENSP00000324920:p.Trp79*		Q08AQ4	Nonsense_Mutation	SNP	NULL	p.W79*	ENST00000321731.3	37	c.237	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	C	11.03	1.518601	0.27211	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	.	.	.	5.56	5.56	0.83823	.	0.090504	0.49916	D	0.000125	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3696	17.3748	0.87389	0.0:1.0:0.0:0.0	.	.	.	.	X	79;50;79	.	ENSP00000324920:W79X	W	-	3	0	C14orf39	60014857	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	4.769000	0.62300	2.771000	0.95319	0.650000	0.86243	TGG	-	C14orf39	-	NULL		0.264	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	HGNC	protein_coding	OTTHUMT00000276948.1	0	0	0	123	123	58	0.00	0.00	C	NM_174978		60945104	-1	48	21	71	49	tier1	no_errors	ENST00000321731	ensembl	human	known	74_37	nonsense	40.34	30.00	SNP	1.000	T	48	71
PMP22	5376	genome.wustl.edu	37	17	15134333	15134333	+	Silent	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:15134333C>T	ENST00000395938.2	-	5	578	c.384G>A	c.(382-384)tcG>tcA	p.S128S	PMP22_ENST00000312280.3_Silent_p.S128S|PMP22_ENST00000494511.1_Missense_Mutation_p.G69R|PMP22_ENST00000395936.1_3'UTR	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	128					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		AGGAGTAATCCGAGTTGAGAT	0.597													ENSG00000109099																																					0													73.0	64.0	67.0					17																	15134333		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.384G>A	17.37:g.15134333C>T			Q8WV01	Missense_Mutation	SNP	NULL	p.G69R	ENST00000395938.2	37	c.205	CCDS11168.1	17																																																																																			-	PMP22	-	NULL		0.597	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP22	HGNC	protein_coding	OTTHUMT00000130378.1	0	0	0	64	64	69	0.00	0.00	C	NM_000304		15134333	-1	11	12	41	71	tier1	no_errors	ENST00000494511	ensembl	human	novel	74_37	missense	21.15	13.95	SNP	0.000	T	11	41
PYGO1	26108	genome.wustl.edu	37	15	55838428	55838428	+	Silent	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr15:55838428G>A	ENST00000302000.6	-	3	1147	c.1053C>T	c.(1051-1053)aaC>aaT	p.N351N	PYGO1_ENST00000563719.1_Silent_p.N351N	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	351	Interaction with H3K4me2.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		CCTGATCATCGTTCACCTCGT	0.448													ENSG00000171016																																					0													210.0	185.0	193.0					15																	55838428		2193	4292	6485	SO:0001819	synonymous_variant	0			-	AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.1053C>T	15.37:g.55838428G>A			A7Y2D6	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.N351	ENST00000302000.6	37	c.1053	CCDS10155.1	15																																																																																			-	PYGO1	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger		0.448	PYGO1-001	KNOWN	basic|CCDS	protein_coding	PYGO1	HGNC	protein_coding	OTTHUMT00000254977.2	0	0	0	17	17	96	0.00	0.00	G	NM_015617		55838428	-1	4	16	15	44	tier1	no_errors	ENST00000302000	ensembl	human	known	74_37	silent	21.05	26.67	SNP	0.996	A	4	15
CEP78	84131	genome.wustl.edu	37	9	80879143	80879143	+	Silent	SNP	T	T	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:80879143T>C	ENST00000424347.2	+	13	1825	c.1536T>C	c.(1534-1536)aaT>aaC	p.N512N	CEP78_ENST00000376598.2_Silent_p.N512N|CEP78_ENST00000376597.4_Silent_p.N513N|CEP78_ENST00000487108.2_3'UTR|CEP78_ENST00000415759.2_Silent_p.N513N|CEP78_ENST00000277082.5_Silent_p.N512N			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	512					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						CATTGACAAATATGATCCTGG	0.358													ENSG00000148019																																					0													105.0	98.0	100.0					9																	80879143		1846	4089	5935	SO:0001819	synonymous_variant	0			-	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.1536T>C	9.37:g.80879143T>C			A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.N513	ENST00000424347.2	37	c.1539		9																																																																																			-	CEP78	-	NULL		0.358	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	CEP78	HGNC	protein_coding	OTTHUMT00000052766.2	0	0	0	71	71	88	0.00	0.00	T	XM_095991		80879143	+1	26	25	40	42	tier1	no_errors	ENST00000376597	ensembl	human	known	74_37	silent	39.39	37.31	SNP	0.948	C	26	40
TTLL10	254173	genome.wustl.edu	37	1	1117778	1117778	+	Missense_Mutation	SNP	C	C	T	rs367856945		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:1117778C>T	ENST00000379290.1	+	10	1041	c.868C>T	c.(868-870)Cgc>Tgc	p.R290C	TTLL10_ENST00000379288.3_Missense_Mutation_p.R217C|TTLL10-AS1_ENST00000379317.1_RNA|TTLL10_ENST00000379289.1_Missense_Mutation_p.R290C			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	290	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGAGACCTACCGCCTGGACCT	0.617													ENSG00000162571																																					0									CYS/ARG,CYS/ARG	3,4403	4.2+/-10.8	0,3,2200	119.0	117.0	117.0		868,649	3.2	1.0	1		117	0,8600		0,0,4300	no	missense,missense	TTLL10	NM_001130045.1,NM_153254.2	180,180	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	probably-damaging,probably-damaging	290/674,217/405	1117778	3,13003	2203	4300	6503	SO:0001583	missense	0			-	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.868C>T	1.37:g.1117778C>T	ENSP00000368592:p.Arg290Cys		B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.R290C	ENST00000379290.1	37	c.868	CCDS44036.1	1	.	.	.	.	.	.	.	.	.	.	C	14.21	2.468080	0.43839	6.81E-4	0.0	ENSG00000162571	ENST00000379290;ENST00000379289;ENST00000379288	T;T;T	0.05717	3.4;3.4;3.4	3.16	3.16	0.36331	.	0.581837	0.15621	N	0.252865	T	0.17238	0.0414	L	0.52573	1.65	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.73380	0.97;0.98	T	0.01909	-1.1249	10	0.36615	T	0.2	.	12.1869	0.54245	0.0:1.0:0.0:0.0	.	217;290	Q6ZVT0-3;Q6ZVT0	.;TTL10_HUMAN	C	290;290;217	ENSP00000368592:R290C;ENSP00000368591:R290C;ENSP00000368590:R217C	ENSP00000368590:R217C	R	+	1	0	TTLL10	1107641	1.000000	0.71417	0.968000	0.41197	0.038000	0.13279	6.094000	0.71431	1.793000	0.52555	0.479000	0.44913	CGC	-	TTLL10	-	pfam_TTL/TTLL_fam		0.617	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10	HGNC	protein_coding	OTTHUMT00000002421.3	0	0	0	73	73	103	0.00	0.00	C	NM_153254		1117778	+1	40	52	53	68	tier1	no_errors	ENST00000379289	ensembl	human	known	74_37	missense	43.01	43.33	SNP	1.000	T	40	53
LAMA2	3908	genome.wustl.edu	37	6	129826487	129826487	+	Missense_Mutation	SNP	G	G	A	rs201696115		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:129826487G>A	ENST00000421865.2	+	61	8739	c.8690G>A	c.(8689-8691)cGa>cAa	p.R2897Q		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2897	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TACACTACCCGAAGAATTGGT	0.403													ENSG00000196569																																					0													82.0	83.0	83.0					6																	129826487		2203	4300	6503	SO:0001583	missense	0			-	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.8690G>A	6.37:g.129826487G>A	ENSP00000400365:p.Arg2897Gln		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SRE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.R2897Q	ENST00000421865.2	37	c.8690	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220377	0.79464	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.75821	-0.97	5.78	4.91	0.64330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.102971	0.64402	D	0.000002	T	0.46483	0.1395	L	0.40543	1.245	0.40440	D	0.980034	D;D	0.53312	0.959;0.959	B;B	0.37692	0.256;0.256	T	0.51442	-0.8705	9	.	.	.	.	9.1664	0.37054	0.2165:0.0:0.7835:0.0	.	2898;2897	A6NF00;P24043	.;LAMA2_HUMAN	Q	2897;2896;2897;915	ENSP00000400365:R2897Q	.	R	+	2	0	LAMA2	129868180	0.998000	0.40836	0.759000	0.31340	0.997000	0.91878	2.929000	0.48916	1.448000	0.47680	0.655000	0.94253	CGA	rs201696115	LAMA2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.403	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	0	0	0	71	71	129	0.00	0.00	G			129826487	+1	15	15	54	75	tier1	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	21.74	16.67	SNP	0.985	A	15	54
GSX2	170825	genome.wustl.edu	37	4	54968099	54968099	+	3'UTR	SNP	T	T	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr4:54968099T>C	ENST00000326902.2	+	0	1239				FIP1L1_ENST00000507166.1_Intron|GSX2_ENST00000548609.1_3'UTR|AC110298.1_ENST00000408292.1_RNA|GSX2_ENST00000503800.1_3'UTR	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2						forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			AGGGAGGGCCTCCTCCCTCAC	0.647													ENSG00000180613																																					0													16.0	17.0	16.0					4																	54968099		2201	4293	6494	SO:0001624	3_prime_UTR_variant	0			-		CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.*10T>C	4.37:g.54968099T>C				R	SNP	-	NULL	ENST00000326902.2	37	NULL	CCDS3494.1	4																																																																																			-	GSX2	-	-		0.647	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSX2	HGNC	protein_coding	OTTHUMT00000250595.1	0	0	1	68	68	64	0.00	1.54	T	NM_133267		54968099	+1	10	7	41	36	tier1	no_errors	ENST00000548609	ensembl	human	known	74_37	rna	19.61	16.28	SNP	0.000	C	10	41
KIAA1731	85459	genome.wustl.edu	37	11	93400776	93400776	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:93400776C>T	ENST00000325212.6	+	3	274	c.112C>T	c.(112-114)Cga>Tga	p.R38*	KIAA1731_ENST00000344196.4_5'UTR|KIAA1731_ENST00000411936.1_Nonsense_Mutation_p.R38*			Q9C0D2	K1731_HUMAN	KIAA1731	38						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TCTTTAGGTTCGAGAACAAGA	0.343													ENSG00000166004																																					0													43.0	35.0	37.0					11																	93400776		692	1590	2282	SO:0001587	stop_gained	0			-	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.112C>T	11.37:g.93400776C>T	ENSP00000316681:p.Arg38*		C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Nonsense_Mutation	SNP	NULL	p.R38*	ENST00000325212.6	37	c.112	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.407002	0.96051	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	.	.	.	5.12	2.92	0.33932	.	0.000000	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0702	11.7244	0.51702	0.5922:0.4078:0.0:0.0	.	.	.	.	X	38	.	ENSP00000316681:R38X	R	+	1	2	KIAA1731	93040424	1.000000	0.71417	1.000000	0.80357	0.728000	0.41692	2.101000	0.41787	1.268000	0.44264	-0.182000	0.12963	CGA	-	KIAA1731	-	NULL		0.343	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	0	0	0	96	96	108	0.00	0.00	C	NM_033395		93400776	+1	11	11	29	39	tier1	no_errors	ENST00000411936	ensembl	human	known	74_37	nonsense	27.50	22.00	SNP	1.000	T	11	29
RNASE2	6036	genome.wustl.edu	37	14	21424364	21424364	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr14:21424364G>A	ENST00000304625.2	+	2	524	c.434G>A	c.(433-435)cGa>cAa	p.R145Q		NM_002934.2	NP_002925.1	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)	145					chemotaxis (GO:0006935)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)|ribonuclease activity (GO:0004540)			breast(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	17	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		GATCAACGACGAGACCCTCCA	0.468													ENSG00000169385																																					0													125.0	123.0	124.0					14																	21424364		2203	4300	6503	SO:0001583	missense	0			-	X55988	CCDS9561.1	14q11.2	2014-03-13			ENSG00000169385	ENSG00000169385		"""Ribonucleases, RNase A"""	10045	protein-coding gene	gene with protein product		131410		RNS2		1577491, 2734298	Standard	NM_002934		Approved	EDN	uc001vyl.1	P10153	OTTHUMG00000029607	ENST00000304625.2:c.434G>A	14.37:g.21424364G>A	ENSP00000303276:p.Arg145Gln		Q52M39|Q9H2B7|Q9UCG7	Missense_Mutation	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.R145Q	ENST00000304625.2	37	c.434	CCDS9561.1	14	.	.	.	.	.	.	.	.	.	.	g	1.685	-0.505460	0.04261	.	.	ENSG00000169385	ENST00000304625	T	0.13538	2.58	2.88	-4.08	0.03963	Ribonuclease A, domain (4);	.	.	.	.	T	0.06917	0.0176	L	0.32530	0.975	0.09310	N	1	P	0.36874	0.572	B	0.28991	0.097	T	0.36817	-0.9732	9	0.10377	T	0.69	.	9.2925	0.37795	0.6961:0.0:0.3039:0.0	.	145	P10153	RNAS2_HUMAN	Q	145	ENSP00000303276:R145Q	ENSP00000303276:R145Q	R	+	2	0	RNASE2	20494204	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.672000	0.00843	-1.128000	0.02922	-1.280000	0.01385	CGA	-	RSE2	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain		0.468	RNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSE2	HGNC	protein_coding	OTTHUMT00000073799.2	0	0	0	77	77	25	0.00	0.00	G			21424364	+1	54	8	53	12	tier1	no_errors	ENST00000304625	ensembl	human	known	74_37	missense	50.47	40.00	SNP	0.000	A	54	53
FAM83G	644815	genome.wustl.edu	37	17	18881217	18881217	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:18881217C>T	ENST00000388995.6	-	5	1985	c.1762G>A	c.(1762-1764)Gta>Ata	p.V588I	SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000317977.6_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.V588I|FAM83G_ENST00000345041.4_Missense_Mutation_p.V588I|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000417251.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	588					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CTGAGGGTTACGTAGTCGTCA	0.637													ENSG00000188522																																					0													43.0	50.0	47.0					17																	18881217		2027	4165	6192	SO:0001583	missense	0			-	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.1762G>A	17.37:g.18881217C>T	ENSP00000373647:p.Val588Ile		Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	pfam_DUF1669	p.V588I	ENST00000388995.6	37	c.1762	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	C	8.715	0.912901	0.17907	.	.	ENSG00000188522	ENST00000388995;ENST00000345041	T;T	0.13901	2.55;2.55	5.91	3.81	0.43845	.	0.606625	0.15652	N	0.251339	T	0.12774	0.0310	L	0.55103	1.725	0.30727	N	0.747607	B	0.26708	0.157	B	0.15052	0.012	T	0.18398	-1.0338	10	0.14252	T	0.57	-18.1311	11.2998	0.49298	0.0:0.7548:0.0:0.2452	.	588	A6ND36	FA83G_HUMAN	I	588	ENSP00000373647:V588I;ENSP00000343279:V588I	ENSP00000343279:V588I	V	-	1	0	FAM83G	18821942	0.526000	0.26298	0.663000	0.29738	0.839000	0.47603	0.827000	0.27421	0.344000	0.23847	-0.797000	0.03246	GTA	-	FAM83G	-	NULL		0.637	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	0	0	0	25	25	116	0.00	0.00	C			18881217	-1	7	26	19	65	tier1	no_errors	ENST00000345041	ensembl	human	known	74_37	missense	26.92	28.57	SNP	0.853	T	7	19
HIST1H4C	8364	genome.wustl.edu	37	6	26104193	26104193	+	Silent	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:26104193A>G	ENST00000377803.2	+	1	90	c.18A>G	c.(16-18)aaA>aaG	p.K6K		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	6					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GTCGCGGCAAAGGCGGAAAAG	0.498													ENSG00000197061																																					0													53.0	55.0	54.0					6																	26104193		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.18A>G	6.37:g.26104193A>G			A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.K6	ENST00000377803.2	37	c.18	CCDS4583.1	6																																																																																			-	HIST1H4C	-	superfamily_Histone-fold,prints_Histone_H4		0.498	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4C	HGNC	protein_coding	OTTHUMT00000040092.2	0	0	0	29	29	122	0.00	0.00	A	NM_003542		26104193	+1	11	40	12	51	tier1	no_errors	ENST00000377803	ensembl	human	known	74_37	silent	45.83	43.96	SNP	0.254	G	11	12
PLEKHM2	23207	genome.wustl.edu	37	1	16054813	16054813	+	Missense_Mutation	SNP	G	G	A	rs199779846		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr1:16054813G>A	ENST00000375799.3	+	11	2109	c.1882G>A	c.(1882-1884)Gtg>Atg	p.V628M	RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Missense_Mutation_p.V608M	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	628					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GCTGCTGTACGTGCTGCTCAC	0.642													ENSG00000116786																																					0													39.0	47.0	45.0					1																	16054813		2149	4255	6404	SO:0001583	missense	0			-	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1882G>A	1.37:g.16054813G>A	ENSP00000364956:p.Val628Met		O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.V628M	ENST00000375799.3	37	c.1882	CCDS44063.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570298	0.86542	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.55234	0.54;0.53	5.61	5.61	0.85477	.	0.144546	0.49305	D	0.000154	T	0.53158	0.1779	N	0.24115	0.695	0.54753	D	0.999981	D	0.63880	0.993	P	0.52758	0.708	T	0.57757	-0.7756	10	0.72032	D	0.01	-23.3302	17.8127	0.88620	0.0:0.0:1.0:0.0	.	628	Q8IWE5	PKHM2_HUMAN	M	628;608	ENSP00000364956:V628M;ENSP00000364950:V608M	ENSP00000364950:V608M	V	+	1	0	PLEKHM2	15927400	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.546000	0.73887	2.652000	0.90054	0.655000	0.94253	GTG	rs199779846	PLEKHM2	-	NULL		0.642	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1	0	0	0	41	41	31	0.00	0.00	G	NM_015164		16054813	+1	12	7	21	19	tier1	no_errors	ENST00000375799	ensembl	human	known	74_37	missense	36.36	26.92	SNP	1.000	A	12	21
PPIL6	285755	genome.wustl.edu	37	6	109714072	109714072	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:109714072A>G	ENST00000521072.2	-	8	1473	c.893T>C	c.(892-894)aTa>aCa	p.I298T	PPIL6_ENST00000440797.2_Missense_Mutation_p.I324T|PPIL6_ENST00000424445.2_Missense_Mutation_p.I266T	NM_173672.4	NP_775943.1	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 6	298	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)		peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		ACACATATGTATTGGTCTTTC	0.318													ENSG00000185250																																					0													225.0	204.0	211.0					6																	109714072		2203	4300	6503	SO:0001583	missense	0			-		CCDS5074.1, CCDS47466.1, CCDS47466.2, CCDS69169.1	6q21	2009-11-18			ENSG00000185250	ENSG00000185250			21557	protein-coding gene	gene with protein product	"""radial spoke 12 homolog (Chlamydomonas)"""						Standard	NM_173672		Approved	bA425D10.6, MGC41939, dJ919F19.1, RSPH12	uc010kdp.3	Q8IXY8	OTTHUMG00000036593	ENST00000521072.2:c.893T>C	6.37:g.109714072A>G	ENSP00000427929:p.Ile298Thr		A9NIU0|A9NIU9|E7EX15	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.I298T	ENST00000521072.2	37	c.893	CCDS5074.1	6	.	.	.	.	.	.	.	.	.	.	A	5.536	0.283757	0.10458	.	.	ENSG00000185250	ENST00000424445;ENST00000440797;ENST00000521072	T;T;T	0.41758	0.99;0.99;0.99	5.39	0.0629	0.14346	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.800802	0.11154	N	0.593822	T	0.04182	0.0116	N	0.02985	-0.445	0.09310	N	1	B;B;B	0.12013	0.003;0.003;0.005	B;B;B	0.12156	0.007;0.007;0.007	T	0.42172	-0.9467	10	0.13108	T	0.6	-1.0202	3.422	0.07397	0.504:0.0:0.2207:0.2754	.	324;266;298	A9NIU9;E7EX15;Q8IXY8	.;.;PPIL6_HUMAN	T	266;324;298	ENSP00000407731:I266T;ENSP00000392257:I324T;ENSP00000427929:I298T	ENSP00000407731:I266T	I	-	2	0	PPIL6	109820765	0.002000	0.14202	0.001000	0.08648	0.085000	0.17905	0.709000	0.25734	-0.134000	0.11516	-0.516000	0.04426	ATA	-	PPIL6	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom		0.318	PPIL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL6	HGNC	protein_coding	OTTHUMT00000089003.4	0	0	0	39	39	121	0.00	0.00	A			109714072	-1	5	23	40	98	tier1	no_errors	ENST00000521072	ensembl	human	known	74_37	missense	11.11	19.01	SNP	0.001	G	5	40
TDRD7	23424	genome.wustl.edu	37	9	100240849	100240849	+	Silent	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:100240849A>G	ENST00000355295.4	+	13	2590	c.2295A>G	c.(2293-2295)ccA>ccG	p.P765P	TDRD7_ENST00000422139.2_Silent_p.P691P|TDRD7_ENST00000540902.1_Silent_p.P85P	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	765					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				TTGCAATACCACCTCAGGTAC	0.413													ENSG00000196116																																					0													98.0	95.0	96.0					9																	100240849		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2295A>G	9.37:g.100240849A>G			A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Silent	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.P765	ENST00000355295.4	37	c.2295	CCDS6725.1	9																																																																																			-	TDRD7	-	pfam_Tudor		0.413	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD7	HGNC	protein_coding	OTTHUMT00000053322.1	0	0	1	74	74	131	0.00	0.76	A	NM_014290		100240849	+1	16	21	69	104	tier1	no_errors	ENST00000355295	ensembl	human	known	74_37	silent	18.60	16.80	SNP	1.000	G	16	69
RNF217	154214	genome.wustl.edu	37	6	125330511	125330511	+	Intron	SNP	C	C	T	rs560259873		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:125330511C>T	ENST00000521654.2	+	2	882				RNF217_ENST00000560949.1_Intron|RNF217_ENST00000368414.2_Intron|RNF217_ENST00000454842.2_Intron|RNF217_ENST00000359704.2_Intron			Q8TC41	RN217_HUMAN	ring finger protein 217						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		CTGTGAAGCCCTCTCACAGAC	0.393													ENSG00000146373																																					0													70.0	58.0	61.0					6																	125330511		692	1591	2283	SO:0001627	intron_variant	0			-	BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.883-35846C>T	6.37:g.125330511C>T			H7C5V4|Q5TCA4|Q9BX48	R	SNP	-	NULL	ENST00000521654.2	37	NULL		6																																																																																			-	RNF217	-	-		0.393	RNF217-002	NOVEL	basic|appris_principal	protein_coding	RNF217	HGNC	protein_coding	OTTHUMT00000042063.3	0	0	1	51	51	113	0.00	0.88	C	NM_152553		125330511	+1	17	23	36	74	tier1	no_errors	ENST00000431104	ensembl	human	known	74_37	rna	32.08	23.71	SNP	0.001	T	17	36
PHKA1	5255	genome.wustl.edu	37	X	71855041	71855041	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chrX:71855041G>A	ENST00000373542.4	-	16	1837	c.1678C>T	c.(1678-1680)Ccc>Tcc	p.P560S	PHKA1_ENST00000541944.1_Missense_Mutation_p.P560S|PHKA1_ENST00000373539.3_Missense_Mutation_p.P560S|PHKA1_ENST00000373545.3_Missense_Mutation_p.P560S|PHKA1_ENST00000339490.3_Missense_Mutation_p.P560S	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	560					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GTGATGGTGGGCTGGCCTGTC	0.498													ENSG00000067177																																					0													120.0	95.0	103.0					X																	71855041		2203	4300	6503	SO:0001583	missense	0			-		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1678C>T	X.37:g.71855041G>A	ENSP00000362643:p.Pro560Ser		B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.P560S	ENST00000373542.4	37	c.1678	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692499	0.68271	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.96365	-3.93;-3.99;-3.87;-3.92;-3.98	4.47	4.47	0.54385	Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.98532	0.9510	H	0.94847	3.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	D	0.99593	1.0976	10	0.87932	D	0	-24.9069	13.9669	0.64213	0.0:0.0:1.0:0.0	.	560;560;560	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	S	560	ENSP00000362646:P560S;ENSP00000362643:P560S;ENSP00000441251:P560S;ENSP00000342469:P560S;ENSP00000362640:P560S	ENSP00000342469:P560S	P	-	1	0	PHKA1	71771766	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	9.705000	0.98719	1.956000	0.56807	0.415000	0.27848	CCC	-	PHKA1	-	pfam_Glyco_hydro_15		0.498	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	0	0	0	33	33	23	0.00	0.00	G			71855041	-1	12	7	38	22	tier1	no_errors	ENST00000373539	ensembl	human	known	74_37	missense	24.00	24.14	SNP	1.000	A	12	38
LINGO1	84894	genome.wustl.edu	37	15	77906924	77906924	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr15:77906924A>G	ENST00000355300.6	-	2	1499	c.1325T>C	c.(1324-1326)gTg>gCg	p.V442A	LINGO1_ENST00000561030.1_Missense_Mutation_p.V436A	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	442	Ig-like C2-type.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						CACAAACTGCACCGTGTGGCC	0.662													ENSG00000169783																																					0													13.0	17.0	15.0					15																	77906924		2084	4170	6254	SO:0001583	missense	0			-	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1325T>C	15.37:g.77906924A>G	ENSP00000347451:p.Val442Ala		D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V442A	ENST00000355300.6	37	c.1325	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	A	13.38	2.220851	0.39201	.	.	ENSG00000169783	ENST00000355300	T	0.32272	1.46	4.55	4.55	0.56014	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.26268	0.0641	N	0.13168	0.305	0.80722	D	1	B	0.33120	0.398	P	0.44860	0.462	T	0.10965	-1.0607	10	0.18710	T	0.47	.	13.8933	0.63753	1.0:0.0:0.0:0.0	.	442	Q96FE5	LIGO1_HUMAN	A	442	ENSP00000347451:V442A	ENSP00000347451:V442A	V	-	2	0	LINGO1	75693979	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.339000	0.96797	1.686000	0.51046	0.379000	0.24179	GTG	-	LINGO1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.662	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	0	0	0	31	31	28	0.00	0.00	A	NM_032808		77906924	-1	5	6	13	16	tier1	no_errors	ENST00000355300	ensembl	human	known	74_37	missense	27.78	27.27	SNP	1.000	G	5	13
MARK4	57787	genome.wustl.edu	37	19	45801209	45801209	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:45801209G>A	ENST00000262891.4	+	15	2205	c.1874G>A	c.(1873-1875)cGa>cAa	p.R625Q	MARK4_ENST00000300843.4_Missense_Mutation_p.R625Q	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	625					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		AAACTGACCCGAAGGTGAGCT	0.677													ENSG00000007047																																					0													4.0	4.0	4.0					19																	45801209		1983	3874	5857	SO:0001583	missense	0			-	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1874G>A	19.37:g.45801209G>A	ENSP00000262891:p.Arg625Gln		Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,pfam_UBA/Ts_N,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.R625Q	ENST00000262891.4	37	c.1874	CCDS56097.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.143308	0.94560	.	.	ENSG00000007047	ENST00000262891;ENST00000300843	T;D	0.82344	0.55;-1.6	4.37	4.37	0.52481	.	0.082600	0.48767	D	0.000163	D	0.88403	0.6427	L	0.55990	1.75	0.58432	D	0.999996	D;D	0.71674	0.997;0.998	D;D	0.75484	0.968;0.986	D	0.89488	0.3755	10	0.72032	D	0.01	.	14.5049	0.67746	0.0:0.0:1.0:0.0	.	625;625	Q96L34;Q96L34-2	MARK4_HUMAN;.	Q	625	ENSP00000262891:R625Q;ENSP00000300843:R625Q	ENSP00000262891:R625Q	R	+	2	0	MARK4	50493049	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.888000	0.92464	2.255000	0.74692	0.454000	0.30748	CGA	-	MARK4	-	NULL		0.677	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK4	HGNC	protein_coding	OTTHUMT00000457537.1	0	0	0	26	26	20	0.00	0.00	G	NM_031417		45801209	+1	5	5	18	23	tier1	no_errors	ENST00000262891	ensembl	human	known	74_37	missense	21.74	17.86	SNP	1.000	A	5	18
ABCB4	5244	genome.wustl.edu	37	7	87104780	87104780	+	Start_Codon_SNP	SNP	A	A	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr7:87104780A>G	ENST00000265723.4	-	2	113	c.2T>C	c.(1-3)aTg>aCg	p.M1T	ABCB4_ENST00000359206.3_Start_Codon_SNP_p.M1T|ABCB4_ENST00000545634.1_Start_Codon_SNP_p.M1T|ABCB4_ENST00000453593.1_Start_Codon_SNP_p.M1T|ABCB4_ENST00000358400.3_Start_Codon_SNP_p.M1T	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	1					cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CTCAAGATCCATCTCAGCCTG	0.667													ENSG00000005471																																					0													59.0	55.0	56.0					7																	87104780		2203	4300	6503	SO:0001582	initiator_codon_variant	0			-	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2T>C	7.37:g.87104780A>G	ENSP00000265723:p.Met1Thr		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.M1T	ENST00000265723.4	37	c.2	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	A	16.98	3.270468	0.59540	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634;ENST00000417608	D;D;D;D;D	0.86432	-2.05;-2.12;-2.09;-2.12;-2.05	3.85	3.85	0.44370	.	.	.	.	.	D	0.89743	0.6803	.	.	.	0.80722	D	1	P;P;P;P	0.50156	0.932;0.826;0.814;0.717	P;B;P;P	0.55391	0.775;0.255;0.774;0.599	D	0.89962	0.4087	8	0.87932	D	0	-7.1163	8.9687	0.35892	1.0:0.0:0.0:0.0	.	1;1;1;1	Q6PJ81;A4D1D5;P21439-2;P21439	.;.;.;MDR3_HUMAN	T	1	ENSP00000352135:M1T;ENSP00000351172:M1T;ENSP00000265723:M1T;ENSP00000392983:M1T;ENSP00000437465:M1T	ENSP00000265723:M1T	M	-	2	0	ABCB4	86942716	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	3.659000	0.54489	1.615000	0.50252	0.519000	0.50382	ATG	-	ABCB4	-	NULL		0.667	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	0	0	0	122	122	57	0.00	0.00	A	NM_000443	Missense_Mutation	87104780	-1	26	5	71	42	tier1	no_errors	ENST00000265723	ensembl	human	known	74_37	missense	26.80	10.64	SNP	1.000	G	26	71
ZNF229	7772	genome.wustl.edu	37	19	44933794	44933794	+	Nonsense_Mutation	SNP	G	G	A	rs377446964		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:44933794G>A	ENST00000588931.1	-	6	1595	c.1162C>T	c.(1162-1164)Cga>Tga	p.R388*	CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000291187.4_Nonsense_Mutation_p.R382*|ZNF229_ENST00000591289.1_Intron	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TTTGAACTTCGACCAAATGCC	0.478													ENSG00000167383																																					0													102.0	112.0	108.0					19																	44933794		2198	4299	6497	SO:0001587	stop_gained	0			-	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1162C>T	19.37:g.44933794G>A	ENSP00000466519:p.Arg388*		B2RWN3|Q59FV2|Q86WL9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R388*	ENST00000588931.1	37	c.1162	CCDS42574.1	19	.	.	.	.	.	.	.	.	.	.	G	42	9.345153	0.99143	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.86	1.55	0.23275	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	6.8977	0.24265	0.0981:0.0:0.7298:0.1721	.	.	.	.	X	388	.	ENSP00000291187:R388X	R	-	1	2	ZNF229	49625634	0.000000	0.05858	0.001000	0.08648	0.946000	0.59487	-0.041000	0.12084	0.604000	0.29930	0.609000	0.83330	CGA	-	ZNF229	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.478	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	HGNC	protein_coding	OTTHUMT00000460833.1	0	0	0	98	98	128	0.00	0.00	G	NM_014518		44933794	-1	77	136	24	50	tier1	no_errors	ENST00000588931	ensembl	human	known	74_37	nonsense	76.24	73.12	SNP	0.004	A	77	24
ATP13A5	344905	genome.wustl.edu	37	3	193028437	193028437	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr3:193028437G>C	ENST00000342358.4	-	21	2632	c.2515C>G	c.(2515-2517)Cag>Gag	p.Q839E	ATP13A5-AS1_ENST00000414634.1_RNA|ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	839						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TTTAATTTCTGAAATTCTTCA	0.363													ENSG00000187527																																					0													117.0	106.0	110.0					3																	193028437		2203	4300	6503	SO:0001583	missense	0			-	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2515C>G	3.37:g.193028437G>C	ENSP00000341942:p.Gln839Glu		Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.Q839E	ENST00000342358.4	37	c.2515	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994461	0.74703	.	.	ENSG00000187527	ENST00000342358	T	0.58358	0.34	5.78	5.78	0.91487	HAD-like domain (2);	0.000000	0.64402	D	0.000001	T	0.77498	0.4139	M	0.89534	3.04	0.43729	D	0.996215	D	0.60575	0.988	D	0.65573	0.936	T	0.81145	-0.1066	10	0.72032	D	0.01	-12.3617	17.8559	0.88762	0.0:0.0:1.0:0.0	.	839	Q4VNC0	AT135_HUMAN	E	839	ENSP00000341942:Q839E	ENSP00000341942:Q839E	Q	-	1	0	ATP13A5	194511131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.088000	0.71371	2.894000	0.99253	0.655000	0.94253	CAG	-	ATP13A5	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase		0.363	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	0	0	0	46	46	108	0.00	0.00	G	NM_198505		193028437	-1	12	13	42	59	tier1	no_errors	ENST00000342358	ensembl	human	known	74_37	missense	22.22	18.06	SNP	1.000	C	12	42
NELL1	4745	genome.wustl.edu	37	11	20699519	20699519	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:20699519G>A	ENST00000357134.5	+	2	249	c.97G>A	c.(97-99)Gtc>Atc	p.V33I	NELL1_ENST00000298925.5_Missense_Mutation_p.V61I|NELL1_ENST00000325319.5_Missense_Mutation_p.V33I|NELL1_ENST00000532434.1_Missense_Mutation_p.V33I	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	33					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GATGGATATCGTCACCGAGCT	0.473													ENSG00000165973																																					0													179.0	163.0	168.0					11																	20699519		2203	4300	6503	SO:0001583	missense	0			-	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.97G>A	11.37:g.20699519G>A	ENSP00000349654:p.Val33Ile		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.V33I	ENST00000357134.5	37	c.97	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	A	0.035	-1.310797	0.01342	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.01933	4.55;4.55;4.55;4.55	6.11	1.11	0.20524	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.138090	0.46758	N	0.000266	T	0.00580	0.0019	N	0.00197	-1.87	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.46610	-0.9179	10	0.11794	T	0.64	-7.2337	6.934	0.24457	0.6621:0.1117:0.2262:0.0	.	33;61;33;33	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	I	61;33;33;33	ENSP00000298925:V61I;ENSP00000349654:V33I;ENSP00000317837:V33I;ENSP00000437170:V33I	ENSP00000298925:V61I	V	+	1	0	NELL1	20656095	0.910000	0.30920	0.004000	0.12327	0.274000	0.26718	1.521000	0.35910	-0.296000	0.08947	-2.261000	0.00279	GTC	-	NELL1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.473	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	0	0	0	52	52	119	0.00	0.00	G	NM_006157		20699519	+1	24	41	27	55	tier1	no_errors	ENST00000357134	ensembl	human	known	74_37	missense	47.06	42.27	SNP	0.660	A	24	27
TRIM51HP	440041	genome.wustl.edu	37	11	55063041	55063041	+	RNA	SNP	T	T	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:55063041T>G	ENST00000526016.1	-	0	596					NR_038174.2				tripartite motif-containing 51H, pseudogene																		TTTCATTGAGTTGCTGAAAAA	0.423													ENSG00000166007																																					0																																												0			-			11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55063041T>G				R	SNP	-	NULL	ENST00000526016.1	37	NULL		11																																																																																			-	TRIM51HP	-	-		0.423	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	TRIM51HP	HGNC	pseudogene	OTTHUMT00000391438.1	0	0	0	196	196	31	0.00	0.00	T			55063041	-1	39	4	155	14	tier1	no_errors	ENST00000526016	ensembl	human	putative	74_37	rna	20.00	22.22	SNP	0.155	G	39	155
SLC8A2	6543	genome.wustl.edu	37	19	47969082	47969082	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr19:47969082C>G	ENST00000236877.6	-	2	974	c.579G>C	c.(577-579)aaG>aaC	p.K193N	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	193					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CTCTCAGGTGCTTGATCTTGC	0.562													ENSG00000118160																																					0													70.0	48.0	55.0					19																	47969082		2203	4300	6503	SO:0001583	missense	0			-	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.579G>C	19.37:g.47969082C>G	ENSP00000236877:p.Lys193Asn		B4DYQ9	Missense_Mutation	SNP	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.K193N	ENST00000236877.6	37	c.579	CCDS33065.1	19	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537919	0.65085	.	.	ENSG00000118160	ENST00000391903;ENST00000236877	T	0.64438	-0.1	4.04	4.04	0.47022	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.76033	0.3931	M	0.64080	1.96	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.971	T	0.79688	-0.1699	10	0.87932	D	0	.	15.1426	0.72623	0.0:1.0:0.0:0.0	.	21;193	E9PGS7;Q9UPR5	.;NAC2_HUMAN	N	21;193	ENSP00000236877:K193N	ENSP00000236877:K193N	K	-	3	2	SLC8A2	52660894	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	0.600000	0.24104	2.098000	0.63641	0.462000	0.41574	AAG	-	SLC8A2	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex		0.562	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	HGNC	protein_coding	OTTHUMT00000466997.1	0	0	0	53	53	81	0.00	0.00	C			47969082	-1	8	7	31	47	tier1	no_errors	ENST00000236877	ensembl	human	known	74_37	missense	20.51	12.96	SNP	1.000	G	8	31
OR4M1	441670	genome.wustl.edu	37	14	20249201	20249201	+	Silent	SNP	C	C	G			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr14:20249201C>G	ENST00000315957.4	+	1	801	c.720C>G	c.(718-720)tcC>tcG	p.S240S		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GGGCCATGTCCACCTGCTATT	0.458													ENSG00000176299																																					0													270.0	236.0	247.0					14																	20249201		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.720C>G	14.37:g.20249201C>G			B9EH18|Q6IFA3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S240	ENST00000315957.4	37	c.720	CCDS32021.1	14																																																																																			-	OR4M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.458	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	HGNC	protein_coding	OTTHUMT00000409770.1	0	0	0	202	202	144	0.00	0.00	C			20249201	+1	27	15	163	116	tier1	no_errors	ENST00000315957	ensembl	human	known	74_37	silent	14.21	11.45	SNP	0.994	G	27	163
RALYL	138046	genome.wustl.edu	37	8	85686863	85686863	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr8:85686863C>A	ENST00000521268.1	+	3	1411	c.306C>A	c.(304-306)aaC>aaA	p.N102K	RALYL_ENST00000521376.1_Missense_Mutation_p.N29K|RALYL_ENST00000521695.1_Missense_Mutation_p.N102K|RALYL_ENST00000522455.1_Missense_Mutation_p.N102K|RALYL_ENST00000518566.1_Missense_Mutation_p.N102K|RALYL_ENST00000523850.1_Missense_Mutation_p.N29K|RALYL_ENST00000517638.1_Missense_Mutation_p.N115K	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	102							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						AACCTGGAAACAAGAGGCCCC	0.358													ENSG00000184672																																					0													63.0	63.0	63.0					8																	85686863		1830	4095	5925	SO:0001583	missense	0			-		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.306C>A	8.37:g.85686863C>A	ENSP00000430367:p.Asn102Lys		B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.N102K	ENST00000521268.1	37	c.306	CCDS55253.1	8	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658367	0.47467	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.16457	2.98;2.98;2.98;2.95;2.96;2.6;2.34	5.78	2.95	0.34219	Nucleotide-binding, alpha-beta plait (1);	0.425662	0.27031	N	0.021273	T	0.07773	0.0195	N	0.08118	0	0.24736	N	0.993064	B;B;B;B;B	0.32467	0.002;0.354;0.372;0.051;0.354	B;B;B;B;B	0.30943	0.005;0.09;0.114;0.122;0.09	T	0.27297	-1.0078	10	0.35671	T	0.21	-11.917	7.7059	0.28650	0.0:0.7268:0.0:0.2732	.	102;102;29;115;102	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	K	102;102;102;102;115;29;29	ENSP00000430394:N102K;ENSP00000428667:N102K;ENSP00000430367:N102K;ENSP00000430065:N102K;ENSP00000430128:N115K;ENSP00000428807:N29K;ENSP00000428310:N29K	ENSP00000430128:N115K	N	+	3	2	RALYL	85849418	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.797000	0.26999	0.325000	0.23359	0.655000	0.94253	AAC	-	RALYL	-	pirsf_hnRNP_C_Raly		0.358	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	HGNC	protein_coding	OTTHUMT00000379448.1	0	0	1	88	88	141	0.00	0.70	C			85686863	+1	13	21	38	63	tier1	no_errors	ENST00000521268	ensembl	human	known	74_37	missense	25.49	25.00	SNP	1.000	A	13	38
HSPA1B	3304	genome.wustl.edu	37	6	31797299	31797299	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr6:31797299G>T	ENST00000375650.3	+	1	1788	c.1572G>T	c.(1570-1572)aaG>aaT	p.K524N	HSPA1B_ENST00000545241.1_Missense_Mutation_p.K433N	NM_005346.4	NP_005337.2	P08107	HSP71_HUMAN	heat shock 70kDa protein 1B	524					ATP catabolic process (GO:0006200)|cellular heat acclimation (GO:0070370)|cellular response to heat (GO:0034605)|gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of erythrocyte differentiation (GO:0045648)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)	aggresome (GO:0016235)|blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|protein N-terminus binding (GO:0047485)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|virus receptor activity (GO:0001618)			breast(1)|large_intestine(1)|prostate(1)	3						AGGCGGAGAAGTACAAAGCGG	0.617													ENSG00000204388																																					0													10.0	7.0	8.0					6																	31797299		1588	3164	4752	SO:0001583	missense	0			-		CCDS34415.1	6p21.3	2011-09-02	2002-08-29		ENSG00000204388	ENSG00000204388		"""Heat shock proteins / HSP70"""	5233	protein-coding gene	gene with protein product		603012	"""heat shock 70kD protein 1B"""			1700760	Standard	NM_005346		Approved	HSP70-2	uc003nxk.2	P08107	OTTHUMG00000031202	ENST00000375650.3:c.1572G>T	6.37:g.31797299G>T	ENSP00000364801:p.Lys524Asn		B4E3B6|P19790|Q5JQI4|Q5SP17|Q9UQL9|Q9UQM0	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.K524N	ENST00000375650.3	37	c.1572	CCDS34415.1	6	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285485	0.23478	.	.	ENSG00000204388	ENST00000542758;ENST00000375650;ENST00000545429;ENST00000545241	T;T	0.05855	3.38;3.38	4.2	2.28	0.28536	.	0.000000	0.40064	N	0.001186	T	0.05227	0.0139	.	.	.	0.48288	D	0.999622	.	.	.	.	.	.	T	0.17561	-1.0365	7	0.72032	D	0.01	-19.9116	4.772	0.13160	0.2063:0.2056:0.5881:0.0	.	.	.	.	N	591;524;507;433	ENSP00000364801:K524N;ENSP00000442789:K433N	ENSP00000364801:K524N	K	+	3	2	HSPA1B	31905278	0.065000	0.20965	0.994000	0.49952	0.980000	0.70556	-0.066000	0.11598	0.823000	0.34589	0.467000	0.42956	AAG	-	HSPA1B	-	pfam_Hsp_70_fam		0.617	HSPA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA1B	HGNC	protein_coding	OTTHUMT00000076402.2	0	0	0	46	46	13	0.00	0.00	G			31797299	+1	4	2	24	11	tier1	no_errors	ENST00000375650	ensembl	human	known	74_37	missense	14.29	15.38	SNP	0.991	T	4	24
GCSAM	257144	genome.wustl.edu	37	3	111849243	111849243	+	Intron	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr3:111849243G>A	ENST00000308910.4	-	2	283				GCSAM_ENST00000484193.1_Intron|C3orf52_ENST00000467942.2_3'UTR	NM_001190259.1|NM_001190260.1|NM_152785.4	NP_001177188.1|NP_001177189.1|NP_689998.1	Q8N6F7	GCSAM_HUMAN	germinal center-associated, signaling and motility						negative regulation of lymphocyte migration (GO:2000402)|regulation of B cell receptor signaling pathway (GO:0050855)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|myosin II binding (GO:0045159)|protein kinase binding (GO:0019901)										GACATACTTCGTTCTCCTTGG	0.478													ENSG00000114529																																					0													155.0	157.0	156.0					3																	111849243		2203	4300	6503	SO:0001627	intron_variant	0			-	BC030506	CCDS2964.1, CCDS54621.1, CCDS54622.1	3q13.13	2012-09-03	2012-08-23	2012-08-23	ENSG00000174500	ENSG00000174500			20253	protein-coding gene	gene with protein product	"""human germinal center-associated lymphoma"""	607792	"""germinal center expressed transcript 2"""	GCET2			Standard	NM_152785		Approved	MGC40441, HGAL	uc021xcl.1	Q8N6F7	OTTHUMG00000159231	ENST00000308910.4:c.98+48C>T	3.37:g.111849243G>A			C9JD17|C9JUG6	R	SNP	-	NULL	ENST00000308910.4	37	NULL	CCDS2964.1	3																																																																																			-	C3orf52	-	-		0.478	GCSAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353967.2	0	0	0	72	72	125	0.00	0.00	G	NM_152785		111849243	+1	18	24	65	96	tier1	no_errors	ENST00000467942	ensembl	human	known	74_37	rna	21.69	20.00	SNP	0.000	A	18	65
MMP24	10893	genome.wustl.edu	37	20	33851599	33851599	+	Missense_Mutation	SNP	G	G	A	rs376734021		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr20:33851599G>A	ENST00000246186.6	+	5	908	c.823G>A	c.(823-825)Gac>Aac	p.D275N	MMP24-AS1_ENST00000453892.1_RNA|MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000438751.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	275					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	CACAGGGAACGACCTCTTCCT	0.627													ENSG00000125966																																					0													18.0	19.0	19.0					20																	33851599		2202	4299	6501	SO:0001583	missense	0			-	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.823G>A	20.37:g.33851599G>A	ENSP00000246186:p.Asp275Asn		B7ZBG8|Q9H440	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.D275N	ENST00000246186.6	37	c.823	CCDS46593.1	20	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936445	0.92458	.	.	ENSG00000125966	ENST00000246186;ENST00000540655	T	0.21191	2.02	5.05	5.05	0.67936	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.29389	0.0732	N	0.17838	0.53	0.80722	D	1	D	0.63880	0.993	P	0.61592	0.891	T	0.03000	-1.1084	10	0.38643	T	0.18	.	17.547	0.87865	0.0:0.0:1.0:0.0	.	275	Q9Y5R2	MMP24_HUMAN	N	275;223	ENSP00000246186:D275N	ENSP00000246186:D275N	D	+	1	0	MMP24	33315015	1.000000	0.71417	0.995000	0.50966	0.934000	0.57294	6.481000	0.73608	2.606000	0.88127	0.655000	0.94253	GAC	-	MMP24	-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo		0.627	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP24	HGNC	protein_coding	OTTHUMT00000078851.4	0	0	0	36	36	42	0.00	0.00	G	NM_006690		33851599	+1	7	5	39	25	tier1	no_errors	ENST00000246186	ensembl	human	known	74_37	missense	15.22	16.67	SNP	1.000	A	7	39
CLK1	1195	genome.wustl.edu	37	2	201726031	201726035	+	Frame_Shift_Del	DEL	CTACC	CTACC	-			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	CTACC	CTACC	CTACC	-	CTACC	CTACC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr2:201726031_201726035delCTACC	ENST00000321356.4	-	3	451_455	c.316_320delGGTAG	c.(316-321)ggtagafs	p.GR106fs	CLK1_ENST00000492793.1_5'UTR|Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000434813.2_Frame_Shift_Del_p.GR148fs	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	106					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TCTTCCACTTCTACCAGAAGACTTG	0.405													ENSG00000013441																																					0																																										SO:0001589	frameshift_variant	0				L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.316_320delGGTAG	2.37:g.201726031_201726035delCTACC	ENSP00000326830:p.Gly106fs		B4DFW7|Q0P694|Q8N5V8	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G106fs	ENST00000321356.4	37	c.320_316	CCDS2331.1	2																																																																																				CLK1	-	NULL		0.405	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK1	HGNC	protein_coding	OTTHUMT00000256192.2	0	0	0	127	127	127	0.00	0.00	CTACC			201726035	-1	24	24	57	57	tier1	no_errors	ENST00000321356	ensembl	human	known	74_37	frame_shift_del	29.63	29.63	DEL	1.000:0.999:0.997:1.000:1.000	-	24	57
TP53	7157	genome.wustl.edu	37	17	7579328	7579329	+	Frame_Shift_Ins	INS	-	-	TAAG	rs121912658		TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	-	-	-	TAAG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:7579328_7579329insTAAG	ENST00000269305.4	-	4	547_548	c.358_359insCTTA	c.(358-360)aagfs	p.K120fs	TP53_ENST00000359597.4_Frame_Shift_Ins_p.K120fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.K120fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	120	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.	Interaction with DNA.	K -> E (in sporadic cancers; somatic mutation).|K -> M (in sporadic cancers; somatic mutation).|K -> Q (in a sporadic cancer; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K120M(5)|p.K120E(3)|p.G59fs*23(3)|p.K120fs*3(2)|p.K120R(2)|p.K120*(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.T118fs*27(1)|p.H115fs*27(1)|p.Y107fs*44(1)|p.K120Q(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGTCACAGACTTGGCTGTCCCA	0.564		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	34	Substitution - Missense(11)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(2)|Substitution - Nonsense(2)	upper_aerodigestive_tract(5)|urinary_tract(5)|bone(5)|lung(4)|breast(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|soft_tissue(1)|liver(1)|ovary(1)|pancreas(1)|prostate(1)	GRCh37	CM921039	TP53	M	rs121912658																																			SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.358_359insCTTA	17.37:g.7579328_7579329insTAAG	ENSP00000269305:p.Lys120fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K120fs	ENST00000269305.4	37	c.359_358	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.564	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	126	126	98	0.00	0.00	-	NM_000546		7579329	-1	60	29	88	46	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_ins	40.54	38.67	INS	1.000:1.000	TAAG	60	88
VCX2	51480	genome.wustl.edu	37	X	8138101	8138101	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chrX:8138101A>T	ENST00000317103.4	-	3	698	c.392T>A	c.(391-393)tTt>tAt	p.F131Y		NM_016378.2	NP_057462.2	Q9H322	VCX2_HUMAN	variable charge, X-linked 2	131										endometrium(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GACAGGGGAAAAGCTGGCCAT	0.572													ENSG00000177504																																					0													105.0	100.0	101.0					X																	8138101		2201	4283	6484	SO:0001583	missense	0			-	AF159127	CCDS35200.1	Xp22.32	2008-02-05			ENSG00000177504	ENSG00000177504			18158	protein-coding gene	gene with protein product		300532				10607842	Standard	NM_016378		Approved	VCX-2r, VCX-2R	uc004csb.3	Q9H322	OTTHUMG00000021105	ENST00000317103.4:c.392T>A	X.37:g.8138101A>T	ENSP00000321309:p.Phe131Tyr		A3KPB6|Q4V9T2|Q9P0H5	Missense_Mutation	SNP	NULL	p.F131Y	ENST00000317103.4	37	c.392	CCDS35200.1	X	.	.	.	.	.	.	.	.	.	.	T	4.936	0.173830	0.09391	.	.	ENSG00000177504	ENST00000317103	T	0.15718	2.4	.	.	.	.	.	.	.	.	T	0.06690	0.0171	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46091	-0.9216	7	0.02654	T	1	.	.	.	.	.	131	Q9H322	VCX2_HUMAN	Y	131	ENSP00000321309:F131Y	ENSP00000321309:F131Y	F	-	2	0	VCX2	8098101	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.906000	0.04071	-2.269000	0.00684	-2.333000	0.00248	TTT	-	VCX2	-	NULL		0.572	VCX2-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	VCX2	HGNC	protein_coding	OTTHUMT00000055690.1	0	0	0	70	70	13	0.00	0.00	A	NM_016378		8138101	-1	37	6	20	2	tier1	no_errors	ENST00000317103	ensembl	human	known	74_37	missense	64.91	75.00	SNP	0.000	T	37	20
ALDH1L1	10840	genome.wustl.edu	37	3	125855695	125855695	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr3:125855695C>T	ENST00000393434.2	-	11	1605	c.1256G>A	c.(1255-1257)cGc>cAc	p.R419H	ALDH1L1_ENST00000393431.2_Missense_Mutation_p.R419H|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.R419H|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.R318H|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.R429H	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	419	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GTGGGGCATGCGGACAGTGCG	0.577													ENSG00000144908																																					0													97.0	83.0	88.0					3																	125855695		2203	4300	6503	SO:0001583	missense	0			-	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1256G>A	3.37:g.125855695C>T	ENSP00000377083:p.Arg419His		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.R419H	ENST00000393434.2	37	c.1256	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	C	3.901	-0.022104	0.07634	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431	T;T;T;T;T	0.08008	3.14;3.14;3.14;3.14;3.21	3.67	-7.34	0.01427	Acyl carrier protein-like (1);Aldehyde/histidinol dehydrogenase (1);	1.411540	0.04478	N	0.377306	T	0.07234	0.0183	L	0.28400	0.85	0.09310	N	1	B;B;B	0.15719	0.014;0.009;0.004	B;B;B	0.06405	0.002;0.002;0.001	T	0.26155	-1.0111	10	0.44086	T	0.13	.	13.8719	0.63624	0.0:0.2998:0.0:0.7002	.	318;471;419	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	H	429;419;318;419;419	ENSP00000273450:R429H;ENSP00000420293:R419H;ENSP00000395881:R318H;ENSP00000377083:R419H;ENSP00000377081:R419H	ENSP00000273450:R429H	R	-	2	0	ALDH1L1	127338385	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.418000	0.02462	-1.781000	0.01277	-0.483000	0.04790	CGC	-	ALDH1L1	-	superfamily_Ald_DH/histidinol_DH,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH		0.577	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	0	0	0	36	36	65	0.00	0.00	C	NM_012190		125855695	-1	4	4	35	63	tier1	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	10.26	5.88	SNP	0.001	T	4	35
NPIPB11	728888	genome.wustl.edu	37	16	29394893	29394895	+	In_Frame_Del	DEL	TAT	TAT	-			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	TAT	TAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr16:29394893_29394895delTAT	ENST00000524087.1	-	8	1432_1434	c.1358_1360delATA	c.(1357-1362)aatatc>atc	p.N453del	SNX29P2_ENST00000398878.3_lincRNA			E5RHQ5	NPB11_HUMAN	nuclear pore complex interacting protein family, member B11	453	Pro-rich.					integral component of membrane (GO:0016021)											GGTGTCTTGATATTATCATCTGC	0.591													ENSG00000254206																																					0																																										SO:0001651	inframe_deletion	0						16p11.2	2013-06-11			ENSG00000254206	ENSG00000254206			37453	protein-coding gene	gene with protein product							Standard	XM_006721110		Approved			E5RHQ5	OTTHUMG00000170467	ENST00000524087.1:c.1358_1360delATA	16.37:g.29394896_29394898delTAT	ENSP00000430853:p.Asn453del			In_Frame_Del	DEL	NULL	p.N453in_frame_del	ENST00000524087.1	37	c.1360_1358		16																																																																																				NPIPB11	-	NULL		0.591	NPIPB11-001	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal	protein_coding	NPIPB11	HGNC	protein_coding	OTTHUMT00000374094.1	0	0	0	12	12	0	0.00	0.00	TAT	XM_002343430		29394895	-1	8	0	9	0	tier1	no_errors	ENST00000524087	ensembl	human	putative	74_37	in_frame_del	47.06	0.00	DEL	0.023:0.025:0.027	-	8	9
CDH15	1013	genome.wustl.edu	37	16	89251598	89251598	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr16:89251598G>T	ENST00000289746.2	+	5	585	c.520G>T	c.(520-522)Gca>Tca	p.A174S		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	174	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		TGTGACCAGGGCAGAGGCCAC	0.677													ENSG00000129910																																					0													35.0	35.0	35.0					16																	89251598		2188	4294	6482	SO:0001583	missense	0			-	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.520G>T	16.37:g.89251598G>T	ENSP00000289746:p.Ala174Ser			Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A174S	ENST00000289746.2	37	c.520	CCDS10976.1	16	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404156	0.83230	.	.	ENSG00000129910	ENST00000289746	T	0.51817	0.69	4.76	4.76	0.60689	Cadherin (5);Cadherin-like (1);	0.114099	0.37136	N	0.002225	T	0.60894	0.2304	L	0.47190	1.495	0.42157	D	0.99158	D	0.61080	0.989	D	0.64144	0.922	T	0.65701	-0.6104	10	0.87932	D	0	.	16.5411	0.84385	0.0:0.0:1.0:0.0	.	174	P55291	CAD15_HUMAN	S	174	ENSP00000289746:A174S	ENSP00000289746:A174S	A	+	1	0	CDH15	87779099	0.898000	0.30612	0.962000	0.40283	0.548000	0.35241	2.558000	0.45879	2.187000	0.69744	0.462000	0.41574	GCA	-	CDH15	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.677	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	HGNC	protein_coding	OTTHUMT00000269920.1	0	0	0	55	55	10	0.00	0.00	G	NM_004933		89251598	+1	4	0	38	7	tier1	no_errors	ENST00000289746	ensembl	human	known	74_37	missense	9.30	0.00	SNP	1.000	T	4	38
RASD1	51655	genome.wustl.edu	37	17	17398573	17398578	+	In_Frame_Del	DEL	CGCCGC	CGCCGC	-	rs551947598|rs200956285|rs146717971	byFrequency	TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	CGCCGC	CGCCGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr17:17398573_17398578delCGCCGC	ENST00000225688.3	-	2	918_923	c.707_712delGCGGCG	c.(706-714)ggcggcgac>gac	p.GG236del	RASD1_ENST00000579152.1_3'UTR	NM_001199989.1|NM_016084.4	NP_001186918.1|NP_057168.1	Q9Y272	RASD1_HUMAN	RAS, dexamethasone-induced 1	236					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of transcription, DNA-templated (GO:0045892)|nitric oxide mediated signal transduction (GO:0007263)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	4						TCGCCCGGGTcgccgccgccgccgcc	0.704													ENSG00000108551		17	0.00339457	0.0076	0.0014	5008	,	,		14973	0.004		0.001	False		,,,				2504	0.001																0									,	5,17,25,3003		2,0,0,1,3,0,11,5,15,1488					,	2.4	0.9			5	1,12,99,6120		0,0,0,1,4,0,4,10,79,3018	no	codingComplex,utr-3	RASD1	NM_016084.4,NM_001199989.1	,	2,0,0,2,7,0,15,15,94,4506	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		1.7972,1.541,1.713	,	,		6,29,124,9123				SO:0001651	inframe_deletion	0				AF069506	CCDS11185.1, CCDS58519.1	17p11.2	2014-05-09			ENSG00000108551	ENSG00000108551			15828	protein-coding gene	gene with protein product	"""ras-related protein"", ""dexamethasone-induced ras-related protein 1"", ""activator of G protein signaling"""	605550				10947988	Standard	NM_001199989		Approved	DEXRAS1, AGS1	uc002gri.3	Q9Y272	OTTHUMG00000059292	ENST00000225688.3:c.707_712delGCGGCG	17.37:g.17398579_17398584delCGCCGC	ENSP00000225688:p.Gly236_Gly237del		B2R709|B4DFF4|Q9NYB4	In_Frame_Del	DEL	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.GG236in_frame_del	ENST00000225688.3	37	c.712_707	CCDS11185.1	17																																																																																				RASD1	-	smart_Ran_GTPase		0.704	RASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASD1	HGNC	protein_coding	OTTHUMT00000131668.1	0	0	0	2	2	2	0.00	0.00	CGCCGC	NM_016084		17398578	-1	0	0	0	0	tier1	no_errors	ENST00000225688	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.406:0.464:0.573:0.575:0.556:0.538	-	0	0
ROBO3	64221	genome.wustl.edu	37	11	124738935	124738935	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr11:124738935G>A	ENST00000397801.1	+	2	590	c.398G>A	c.(397-399)cGc>cAc	p.R133H	ROBO3_ENST00000538940.1_Missense_Mutation_p.R111H	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	133	Ig-like C2-type 1.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CACGGGCGCCGCGCGCGGCCG	0.701													ENSG00000154134																																					0													10.0	12.0	12.0					11																	124738935		1909	4097	6006	SO:0001583	missense	0			-	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.398G>A	11.37:g.124738935G>A	ENSP00000380903:p.Arg133His			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R133H	ENST00000397801.1	37	c.398	CCDS44755.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.301445	0.95601	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.65178	-0.14;-0.13	5.03	4.12	0.48240	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.177399	0.27406	N	0.019506	T	0.67287	0.2877	N	0.25647	0.755	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69194	-0.5209	10	0.56958	D	0.05	.	12.8358	0.57771	0.0801:0.0:0.9199:0.0	.	133	Q96MS0	ROBO3_HUMAN	H	133;111	ENSP00000380903:R133H;ENSP00000441797:R111H	ENSP00000380903:R133H	R	+	2	0	ROBO3	124244145	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.627000	0.67784	1.124000	0.41980	0.462000	0.41574	CGC	-	ROBO3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.701	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1	0	0	0	36	36	0	0.00	0.00	G	XM_370663		124738935	+1	8	0	12	0	tier1	no_errors	ENST00000397801	ensembl	human	known	74_37	missense	40.00	0.00	SNP	1.000	A	8	12
SARDH	1757	genome.wustl.edu	37	9	136535785	136535785	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7ET-01A-11D-A36J-09	TCGA-DX-A7ET-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a1ae916d-acc8-4d6b-a887-073d27e808bf	d67007dd-9b20-44e4-9926-6d7cc9543082	g.chr9:136535785G>A	ENST00000371872.4	-	19	2673	c.2416C>T	c.(2416-2418)Ccc>Tcc	p.P806S	SARDH_ENST00000422262.2_Missense_Mutation_p.P638S|SARDH_ENST00000439388.1_Missense_Mutation_p.P806S|SARDH_ENST00000371868.1_Missense_Mutation_p.P234S	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	806					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CCCAGGAAGGGCACCGGCGAC	0.701													ENSG00000123453																																					0													13.0	13.0	13.0					9																	136535785		2175	4273	6448	SO:0001583	missense	0			-		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.2416C>T	9.37:g.136535785G>A	ENSP00000360938:p.Pro806Ser		B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.P806S	ENST00000371872.4	37	c.2416	CCDS6978.1	9	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266732	0.59540	.	.	ENSG00000123453	ENST00000371872;ENST00000371868;ENST00000439388;ENST00000422262	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.01	4.1	0.47936	.	0.000000	0.85682	D	0.000000	D	0.85522	0.5716	L	0.52206	1.635	0.80722	D	1	P;P	0.43750	0.814;0.816	P;P	0.52343	0.696;0.688	D	0.86070	0.1537	10	0.56958	D	0.05	-23.641	15.5165	0.75828	0.0:0.1386:0.8614:0.0	.	806;234	Q9UL12;Q5SYV2	SARDH_HUMAN;.	S	806;234;806;638	ENSP00000360938:P806S;ENSP00000360934:P234S;ENSP00000403084:P806S;ENSP00000415537:P638S	ENSP00000360934:P234S	P	-	1	0	SARDH	135525606	1.000000	0.71417	0.959000	0.39883	0.246000	0.25737	7.494000	0.81503	1.084000	0.41184	0.585000	0.79938	CCC	-	SARDH	-	NULL		0.701	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1	0	0	0	76	76	1	0.00	0.00	G			136535785	-1	6	1	50	4	tier1	no_errors	ENST00000371872	ensembl	human	known	74_37	missense	10.71	20.00	SNP	1.000	A	6	50
