#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PLEKHM2	23207	genome.wustl.edu	37	1	16054148	16054148	+	Silent	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:16054148G>T	ENST00000375799.3	+	9	1808	c.1581G>T	c.(1579-1581)ctG>ctT	p.L527L	RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Silent_p.L507L	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	527					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CTCAGGAGCTGGAGGCCCAGC	0.657													ENSG00000116786																																					0													18.0	22.0	21.0					1																	16054148		1977	4155	6132	SO:0001819	synonymous_variant	0			-	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1581G>T	1.37:g.16054148G>T			O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Silent	SNP	pfam_Run,pfam_Pleckstrin_homology,smart_Run,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Run	p.L527	ENST00000375799.3	37	c.1581	CCDS44063.1	1																																																																																			-	PLEKHM2	-	NULL		0.657	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM2	HGNC	protein_coding	OTTHUMT00000008463.1	0	0		36	36		0.00		G	NM_015164		16054148	+1	4		44		tier1	no_errors	ENST00000375799	ensembl	human	known	74_37	silent	8.33		SNP	0.091	T	4	44
MDM2	4193	genome.wustl.edu	37	12	69210612	69210612	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:69210612G>A	ENST00000350057.5	+	2	102	c.102G>A	c.(100-102)caG>caA	p.Q34Q	MDM2_ENST00000544561.1_Silent_p.Q59Q|MDM2_ENST00000478070.1_Intron|MDM2_ENST00000348801.2_Intron|MDM2_ENST00000517852.1_Intron|MDM2_ENST00000356290.4_Intron|MDM2_ENST00000393410.1_Intron|MDM2_ENST00000360430.2_Intron|MDM2_ENST00000545204.1_Intron|MDM2_ENST00000258149.5_Silent_p.Q59Q|MDM2_ENST00000393413.3_Intron|MDM2_ENST00000299252.4_Intron|MDM2_ENST00000393412.3_Intron|MDM2_ENST00000540827.1_Intron|MDM2_ENST00000258148.7_Silent_p.Q65Q|MDM2_ENST00000462284.1_Silent_p.Q65Q|MDM2_ENST00000428863.2_Intron			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	59	Necessary for interaction with USP2.|SWIB.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			ATCTTGGCCAGTATATTATGA	0.289			A		"""sarcoma, glioma, colorectal, other"""								ENSG00000135679																												Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	0													78.0	72.0	74.0					12																	69210612		1800	4073	5873	SO:0001819	synonymous_variant	0			-		CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.102G>A	12.37:g.69210612G>A			A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Silent	SNP	pfam_SWIB_MDM2_domain,pfam_Znf_RanBP2,superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4,pfscan_Znf_RanBP2,pfscan_Znf_RING	p.Q65	ENST00000350057.5	37	c.195		12																																																																																			-	MDM2	-	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,pirsf_p53_neg-reg_MDM_2/4		0.289	MDM2-033	NOVEL	basic|exp_conf	protein_coding	MDM2	HGNC	protein_coding	OTTHUMT00000402665.1	0	0		50	50		0.00		G	NM_006880		69210612	+1	4		41		tier1	no_errors	ENST00000462284	ensembl	human	known	74_37	silent	8.89		SNP	1.000	A	4	41
MTX1	4580	genome.wustl.edu	37	1	155178611	155178611	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:155178611delC	ENST00000368376.3	+	1	122	c.16delC	c.(16-18)cccfs	p.P7fs	THBS3_ENST00000541990.1_5'Flank|RP11-263K19.6_ENST00000455788.1_RNA|THBS3_ENST00000486260.1_Intron|MTX1_ENST00000316721.4_Frame_Shift_Del_p.P7fs|THBS3_ENST00000457183.2_5'Flank|THBS3_ENST00000368378.3_5'Flank|MTX1_ENST00000609421.1_5'Flank	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1	7					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCTCGGGGGACCCCCCCGCAG	0.697													ENSG00000173171																																					0									,	6,13,3813		0,0,6,0,13,1897	6.0	9.0	8.0		,	3.3	1.0	1		8	12,29,7789		1,0,10,2,25,3877	no	codingComplex,codingComplex	MTX1	NM_198883.2,NM_002455.3	,	1,0,16,2,38,5774	A1A1,A1A2,A1R,A2A2,A2R,RR		0.5236,0.4958,0.5145	,	,	155178611	18,42,11602	2069	4174	6243	SO:0001589	frameshift_variant	0					CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708	ENST00000368376.3:c.16delC	1.37:g.155178611delC	ENSP00000357360:p.Pro7fs		B1AVR9|B1AVS0|B2R9P4|Q9BUU3	Frame_Shift_Del	DEL	pfam_Sam37/metaxin,superfamily_Glutathione-S-Trfase_C-like	p.R8fs	ENST00000368376.3	37	c.16	CCDS1100.1	1																																																																																				MTX1	-	NULL		0.697	MTX1-001	KNOWN	basic|CCDS	protein_coding	MTX1	HGNC	protein_coding	OTTHUMT00000086844.1	0	0		13	13		0.00		C	NM_198883		155178611	+1	2		6		tier1	no_errors	ENST00000368376	ensembl	human	known	74_37	frame_shift_del	25.00		DEL	0.998	-	2	6
TNKS2	80351	genome.wustl.edu	37	10	93576932	93576932	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:93576932G>T	ENST00000371627.4	+	3	845	c.466G>T	c.(466-468)Gat>Tat	p.D156Y		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	156					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				CCGAAATACAGATGGAAGGAC	0.403													ENSG00000107854																																					0													95.0	76.0	83.0					10																	93576932		2203	4300	6503	SO:0001583	missense	0			-	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.466G>T	10.37:g.93576932G>T	ENSP00000360689:p.Asp156Tyr		B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.D156Y	ENST00000371627.4	37	c.466	CCDS7417.1	10	.	.	.	.	.	.	.	.	.	.	G	29.4	5.001185	0.93227	.	.	ENSG00000107854	ENST00000371627	T	0.18016	2.24	5.69	5.69	0.88448	Ankyrin repeat-containing domain (3);	0.000000	0.56097	D	0.000038	T	0.40322	0.1112	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.05533	-1.0879	10	0.62326	D	0.03	.	19.8154	0.96566	0.0:0.0:1.0:0.0	.	156	Q9H2K2	TNKS2_HUMAN	Y	156	ENSP00000360689:D156Y	ENSP00000360689:D156Y	D	+	1	0	TNKS2	93566912	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.699000	0.92147	0.655000	0.94253	GAT	-	TNKS2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.403	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1	0	0		29	29		0.00		G	NM_025235		93576932	+1	5		28		tier1	no_errors	ENST00000371627	ensembl	human	known	74_37	missense	15.15		SNP	1.000	T	5	28
DEC1	50514	genome.wustl.edu	37	9	118068191	118068191	+	5'UTR	SNP	T	T	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr9:118068191T>A	ENST00000374016.1	+	0	374				DEC1_ENST00000477580.1_3'UTR	NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1						negative regulation of cell proliferation (GO:0008285)					kidney(1)|large_intestine(1)|ovary(1)	3						ACAGATTTGATGCTACTGCCA	0.363													ENSG00000173077																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.-146T>A	9.37:g.118068191T>A				R	SNP	-	NULL	ENST00000374016.1	37	NULL	CCDS6812.1	9																																																																																			-	DEC1	-	-		0.363	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEC1	HGNC	protein_coding	OTTHUMT00000053791.1	0	0		58	58		0.00		T	NM_017418		118068191	+1	4		45		tier1	no_errors	ENST00000477580	ensembl	human	known	74_37	rna	8.16		SNP	0.409	A	4	45
ATRX	546	genome.wustl.edu	37	X	76872085	76872086	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chrX:76872085_76872086insA	ENST00000373344.5	-	22	5775_5776	c.5561_5562insT	c.(5560-5562)ttafs	p.L1854fs	ATRX_ENST00000395603.3_Frame_Shift_Ins_p.L1816fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1854					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GTTTACCTGTTAAGTGATCTAA	0.332			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001589	frameshift_variant	0				U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5562dupT	X.37:g.76872087_76872087dupA	ENSP00000362441:p.Leu1854fs		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Ins	INS	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L1854fs	ENST00000373344.5	37	c.5562_5561	CCDS14434.1	X																																																																																				ATRX	-	pfam_SNF2_N,superfamily_P-loop_NTPase		0.332	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0		106	106		0.00		-	NM_000489		76872086	-1	30		35		tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_ins	46.15		INS	1.000:1.000	A	30	35
FAM171A1	221061	genome.wustl.edu	37	10	15256356	15256356	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:15256356G>T	ENST00000378116.4	-	8	1237	c.1231C>A	c.(1231-1233)Cac>Aac	p.H411N	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	411						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						ATGGGGGTGTGCAGGTCCCCT	0.602													ENSG00000148468																																					0													59.0	64.0	62.0					10																	15256356		2203	4300	6503	SO:0001583	missense	0			-	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1231C>A	10.37:g.15256356G>T	ENSP00000367356:p.His411Asn		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.H411N	ENST00000378116.4	37	c.1231	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388848	0.42308	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.30182	1.54	5.14	5.14	0.70334	.	0.104537	0.64402	D	0.000003	T	0.35008	0.0917	L	0.57536	1.79	0.49213	D	0.999762	P	0.47191	0.891	P	0.45753	0.492	T	0.03576	-1.1023	10	0.32370	T	0.25	-35.1655	13.1337	0.59397	0.0762:0.0:0.9238:0.0	.	411	Q5VUB5	F1711_HUMAN	N	411;412	ENSP00000367356:H411N	ENSP00000367356:H411N	H	-	1	0	FAM171A1	15296362	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	5.752000	0.68728	2.667000	0.90743	0.563000	0.77884	CAC	-	FAM171A1	-	pfam_Uncharacterised_FAM171		0.602	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	0	0		40	40		0.00		G	XM_167709		15256356	-1	4		24		tier1	no_errors	ENST00000378116	ensembl	human	known	74_37	missense	14.29		SNP	1.000	T	4	24
TMEM25	84866	genome.wustl.edu	37	11	118402987	118402987	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:118402987T>A	ENST00000313236.5	+	3	246	c.193T>A	c.(193-195)Tgg>Agg	p.W65R	RP11-770J1.3_ENST00000528578.1_RNA|TMEM25_ENST00000359862.4_Missense_Mutation_p.W65R|TMEM25_ENST00000411589.2_Missense_Mutation_p.W65R|TMEM25_ENST00000442938.2_Missense_Mutation_p.W65R|TMEM25_ENST00000529001.1_3'UTR|TMEM25_ENST00000544878.1_Missense_Mutation_p.W65R|RP11-770J1.3_ENST00000532597.1_RNA|TMEM25_ENST00000354064.7_Intron|RP11-770J1.3_ENST00000554407.1_RNA|TMEM25_ENST00000524725.1_Missense_Mutation_p.W65R|TMEM25_ENST00000533102.1_Missense_Mutation_p.W65R|RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000556583.1_RNA|TMEM25_ENST00000354284.4_Missense_Mutation_p.W65R	NM_032780.3	NP_116169.2	Q86YD3	TMM25_HUMAN	transmembrane protein 25	65	Ig-like.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		CAGATTGGCCTGGTATCTGGA	0.637													ENSG00000149582																																					0													43.0	47.0	46.0					11																	118402987		2200	4295	6495	SO:0001583	missense	0			-	AK075437	CCDS8398.1, CCDS44745.1, CCDS44746.1, CCDS44747.1, CCDS44748.1	11q23.3	2013-01-11			ENSG00000149582	ENSG00000149582		"""Immunoglobulin superfamily / C2-set domain containing"""	25890	protein-coding gene	gene with protein product		613934				15254712, 12975309	Standard	NM_001144034		Approved	FLJ14399	uc010rye.2	Q86YD3	OTTHUMG00000166339	ENST00000313236.5:c.193T>A	11.37:g.118402987T>A	ENSP00000315635:p.Trp65Arg		A8K8J4|B0YJA6|B0YJA7|B0YJA9|G5E9U4|Q6UW89|Q86UA7|Q8NBL5|Q96KA6|Q96MW9	Missense_Mutation	SNP	pfam_CD80_C2-set,pfscan_Ig-like_dom	p.W65R	ENST00000313236.5	37	c.193	CCDS8398.1	11	.	.	.	.	.	.	.	.	.	.	T	23.8	4.454520	0.84209	.	.	ENSG00000149582	ENST00000411589;ENST00000442938;ENST00000359862;ENST00000528373;ENST00000544878;ENST00000354284;ENST00000533137;ENST00000532762;ENST00000533102;ENST00000313236;ENST00000527267;ENST00000524725;ENST00000533689	D;D;D;D;D;D;D;D;D;D;T;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;-3.03;0.22;-3.03;-3.03	5.07	5.07	0.68467	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92815	0.7715	L	0.29908	0.895	0.40023	D	0.975439	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.998;0.998;0.999;0.997	D	0.93813	0.7112	10	0.87932	D	0	-3.5696	12.2076	0.54361	0.0:0.0:0.0:1.0	.	65;65;65;65;65;65;65;65	F5H294;Q86YD3;B7Z4E4;Q8NBL5;G5E9U4;Q86YD3-4;E9PKP3;Q86YD3-2	.;TMM25_HUMAN;.;.;.;.;.;.	R	65;65;65;65;65;65;33;65;65;65;33;65;65	ENSP00000411882:W65R;ENSP00000416071:W65R;ENSP00000352924:W65R;ENSP00000432040:W65R;ENSP00000439408:W65R;ENSP00000346237:W65R;ENSP00000433938:W33R;ENSP00000433906:W65R;ENSP00000431548:W65R;ENSP00000315635:W65R;ENSP00000435446:W33R;ENSP00000431205:W65R;ENSP00000436746:W65R	ENSP00000315635:W65R	W	+	1	0	TMEM25	117908197	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.968000	0.70413	1.904000	0.55121	0.459000	0.35465	TGG	-	TMEM25	-	pfam_CD80_C2-set,pfscan_Ig-like_dom		0.637	TMEM25-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM25	HGNC	protein_coding	OTTHUMT00000389266.1	0	0		33	33		0.00		T	NM_032780		118402987	+1	4		33		tier1	no_errors	ENST00000533102	ensembl	human	known	74_37	missense	10.81		SNP	1.000	A	4	33
PLG	5340	genome.wustl.edu	37	6	161139335	161139335	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr6:161139335C>A	ENST00000308192.9	+	8	860	c.797C>A	c.(796-798)cCa>cAa	p.P266Q		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	266					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GCAACACCTCCACCATCTTCT	0.507													ENSG00000122194																																					0													102.0	94.0	96.0					6																	161139335		2203	4300	6503	SO:0001583	missense	0			-	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.797C>A	6.37:g.161139335C>A	ENSP00000308938:p.Pro266Gln		Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1	p.P266Q	ENST00000308192.9	37	c.797	CCDS5279.1	6	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247179	0.39697	.	.	ENSG00000122194	ENST00000308192	T	0.62364	0.03	5.11	4.24	0.50183	Kringle-like fold (1);	0.000000	0.39083	U	0.001471	T	0.52322	0.1727	M	0.76433	2.335	0.47737	D	0.999509	P	0.44380	0.834	B	0.41917	0.37	T	0.62263	-0.6891	10	0.72032	D	0.01	.	12.7007	0.57032	0.0:0.918:0.0:0.082	.	266	P00747	PLMN_HUMAN	Q	266	ENSP00000308938:P266Q	ENSP00000308938:P266Q	P	+	2	0	PLG	161059325	0.969000	0.33509	0.010000	0.14722	0.199000	0.23934	2.188000	0.42612	1.275000	0.44379	0.591000	0.81541	CCA	-	PLG	-	pirsf_Pept_S1A_plasmin,superfamily_Kringle-like		0.507	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	0	0		31	31		0.00		C	NM_000301		161139335	+1	6		39		tier1	no_errors	ENST00000308192	ensembl	human	known	74_37	missense	13.33		SNP	0.475	A	6	39
SNURF	8926	genome.wustl.edu	37	15	25226996	25226996	+	3'UTR	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr15:25226996G>T	ENST00000551312.2	+	0	596				SNHG14_ENST00000551631.2_RNA|SNHG14_ENST00000551361.1_RNA|SNHG14_ENST00000459433.1_RNA			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame							nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		GCTAAAATTTGATGTGTCGTC	0.378													ENSG00000224078																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000551312.2:c.*365G>T	15.37:g.25226996G>T			A6NCW2	R	SNP	-	NULL	ENST00000551312.2	37	NULL	CCDS10016.1	15																																																																																			-	SNHG14	-	-		0.378	SNURF-002	KNOWN	basic|appris_candidate_longest|readthrough_transcript|CCDS	nonsense_mediated_decay	SNHG14	HGNC	protein_coding	OTTHUMT00000413842.1	0	0		9	9		0.00		G	NM_005678		25226996	+1	4		5		tier1	no_errors	ENST00000551631	ensembl	human	known	74_37	rna	44.44		SNP	0.007	T	4	5
TMEM246	84302	genome.wustl.edu	37	9	104238794	104238794	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr9:104238794C>A	ENST00000374851.1	-	4	1728	c.581G>T	c.(580-582)tGc>tTc	p.C194F	RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.C194F|RP11-490D19.6_ENST00000431507.1_RNA|RP11-490D19.6_ENST00000425734.1_RNA|RP11-490D19.6_ENST00000424154.1_RNA|TMEM246_ENST00000374847.1_Missense_Mutation_p.C194F			Q9BRR3	TM246_HUMAN	transmembrane protein 246	194						integral component of membrane (GO:0016021)											TGACTCCAGGCAATAGACATA	0.502													ENSG00000165152																																					0													99.0	79.0	86.0					9																	104238794		2203	4300	6503	SO:0001583	missense	0			-	BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.581G>T	9.37:g.104238794C>A	ENSP00000363984:p.Cys194Phe		Q49AQ4	Missense_Mutation	SNP	NULL	p.C194F	ENST00000374851.1	37	c.581	CCDS6757.1	9	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187044	0.78789	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77948	0.4207	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77720	-0.2482	9	0.66056	D	0.02	-26.8896	19.3614	0.94440	0.0:1.0:0.0:0.0	.	194	Q9BRR3	CI125_HUMAN	F	194	.	ENSP00000363980:C194F	C	-	2	0	C9orf125	103278615	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.541000	0.82084	2.809000	0.96659	0.650000	0.86243	TGC	-	TMEM246	-	NULL		0.502	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM246	HGNC	protein_coding	OTTHUMT00000053444.1	0	0		34	34		0.00		C	NM_032342		104238794	-1	4		40		tier1	no_errors	ENST00000374847	ensembl	human	known	74_37	missense	8.89		SNP	1.000	A	4	40
CAMK4	814	genome.wustl.edu	37	5	110560133	110560134	+	5'UTR	INS	-	-	GGCAGCGGCGGC			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr5:110560133_110560134insGGCAGCGGCGGC	ENST00000282356.4	+	0	350_351				CAMK4_ENST00000512453.1_5'UTR	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV						activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		CTTCTCGCTCGggcagcggcgg	0.752													ENSG00000152495																																					0																																										SO:0001623	5_prime_UTR_variant	0				D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.-48->GGCAGCGGCGGC	5.37:g.110560133_110560134insGGCAGCGGCGGC			D3DSZ7	R	INS	-	NULL	ENST00000282356.4	37	NULL	CCDS4103.1	5																																																																																				CAMK4	-	-		0.752	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK4	HGNC	protein_coding	OTTHUMT00000250719.2									-	NM_001744		110560134	+1					tier1	no_errors	ENST00000509408	ensembl	human	known	74_37	rna			INS	0.033:0.224	GGCAGCGGCGGC		
Unknown	0	genome.wustl.edu	37	16	21531204	21531204	+	IGR	SNP	G	G	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr16:21531204G>C								MIR3680-1 (13748 upstream) : SCARNA6 (67743 downstream)																							GGCAGGTGGGGAAGAGCGGCT	0.667													ENSG00000180747																																					0																																										SO:0001628	intergenic_variant	0			-																													16.37:g.21531204G>C				R	SNP	-	NULL		37	NULL		16																																																																																			-	CTD-2547E10.2	-	-	0	0.667					LOC101060604	Clone_based_vega_gene			0	0		161	161		0.00		G			21531204	-1	32		137		tier1	no_errors	ENST00000435197	ensembl	human	known	74_37	rna	18.93		SNP	1.000	C	32	137
DGCR8	54487	genome.wustl.edu	37	22	20077333	20077333	+	Splice_Site	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr22:20077333G>T	ENST00000351989.3	+	4	1451	c.1022G>T	c.(1021-1023)cGg>cTg	p.R341L	DGCR8_ENST00000407755.1_Splice_Site_p.R341L|DGCR8_ENST00000383024.2_Splice_Site_p.R341L	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	341	Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with NCL.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GGAAGCATACGGGTAGGGGAG	0.542													ENSG00000128191																																					0													138.0	125.0	130.0					22																	20077333		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.1023+1G>T	22.37:g.20077333G>T			B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	pfam_dsR-bd_dom,superfamily_WW_dom,smart_WW_dom,smart_dsR-bd_dom,pfscan_WW_dom,pfscan_dsR-bd_dom	p.R341L	ENST00000351989.3	37	c.1022	CCDS13773.1	22	.	.	.	.	.	.	.	.	.	.	G	35	5.589108	0.96590	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.53206	0.69;0.63;0.63	5.68	5.68	0.88126	.	0.048535	0.85682	D	0.000000	T	0.73040	0.3536	M	0.82823	2.61	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.79108	0.992;0.923	T	0.76380	-0.2980	10	0.87932	D	0	-10.7924	19.3812	0.94536	0.0:0.0:1.0:0.0	.	341;341	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	L	341	ENSP00000263209:R341L;ENSP00000372488:R341L;ENSP00000384726:R341L	ENSP00000263209:R341L	R	+	2	0	DGCR8	18457333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.972000	0.93424	2.677000	0.91161	0.650000	0.86243	CGG	-	DGCR8	-	NULL		0.542	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR8	HGNC	protein_coding	OTTHUMT00000318654.1	0	0		32	32		0.00		G		Missense_Mutation	20077333	+1	4		31		tier1	no_errors	ENST00000351989	ensembl	human	known	74_37	missense	11.43		SNP	1.000	T	4	31
DENND4B	9909	genome.wustl.edu	37	1	153913520	153913520	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:153913520C>T	ENST00000361217.4	-	9	1604	c.1186G>A	c.(1186-1188)Gcc>Acc	p.A396T		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	396	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGGAAGCTGGCACCACTGCAG	0.642													ENSG00000198837																																					0													12.0	15.0	14.0					1																	153913520		2017	4148	6165	SO:0001583	missense	0			-	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.1186G>A	1.37:g.153913520C>T	ENSP00000354597:p.Ala396Thr		Q5T4K0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.A396T	ENST00000361217.4	37	c.1186	CCDS44228.1	1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914016	0.92178	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.11604	2.76;2.76	4.11	4.11	0.48088	DENN (3);	0.135216	0.49305	D	0.000158	T	0.17066	0.0410	L	0.49513	1.565	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	T	0.01042	-1.1471	10	0.45353	T	0.12	-15.7731	15.6194	0.76793	0.0:1.0:0.0:0.0	.	396	O75064	DEN4B_HUMAN	T	396;407	ENSP00000354597:A396T;ENSP00000357635:A407T	ENSP00000354597:A396T	A	-	1	0	DENND4B	152180144	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.540000	0.82074	2.294000	0.77228	0.462000	0.41574	GCC	-	DENND4B	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom		0.642	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	0	0		25	25		0.00		C	XM_375806		153913520	-1	4		38		tier1	no_errors	ENST00000361217	ensembl	human	known	74_37	missense	9.52		SNP	1.000	T	4	38
ATMIN	23300	genome.wustl.edu	37	16	81078150	81078150	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr16:81078150G>A	ENST00000299575.4	+	4	2071	c.2047G>A	c.(2047-2049)Gct>Act	p.A683T	ATMIN_ENST00000539819.1_3'UTR|ATMIN_ENST00000564241.1_Missense_Mutation_p.A527T|ATMIN_ENST00000566488.1_Missense_Mutation_p.A527T	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	683					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						AGATACCTCTGCTCAGTCCTA	0.458													ENSG00000166454																																					0													103.0	111.0	108.0					16																	81078150		2202	4300	6502	SO:0001583	missense	0			-	BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.2047G>A	16.37:g.81078150G>A	ENSP00000299575:p.Ala683Thr		A8K4H8|Q68DC9	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.A683T	ENST00000299575.4	37	c.2047	CCDS32494.1	16	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347916	0.24426	.	.	ENSG00000166454	ENST00000299575;ENST00000539819	T	0.30448	1.53	5.49	3.41	0.39046	.	0.475431	0.26173	N	0.025919	T	0.14743	0.0356	N	0.16130	0.375	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.18147	-1.0346	10	0.18276	T	0.48	-4.8447	6.7907	0.23697	0.2947:0.0:0.7053:0.0	.	683	O43313	ATMIN_HUMAN	T	683;454	ENSP00000299575:A683T	ENSP00000299575:A683T	A	+	1	0	ATMIN	79635651	0.012000	0.17670	0.988000	0.46212	0.922000	0.55478	0.597000	0.24059	1.533000	0.49186	0.655000	0.94253	GCT	-	ATMIN	-	NULL		0.458	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATMIN	HGNC	protein_coding	OTTHUMT00000432140.1	0	0		36	36		0.00		G	NM_015251		81078150	+1	3		19		tier1	no_errors	ENST00000299575	ensembl	human	known	74_37	missense	13.64		SNP	0.156	A	3	19
RASA4CP	401331	genome.wustl.edu	37	7	44073723	44073723	+	RNA	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr7:44073723C>T	ENST00000446874.1	-	0	389									RAS p21 protein activator 4C, pseudogene																		GCCAGAGGCCCGATCTCGCAG	0.617													ENSG00000228903																																					0																																												0			-			7p13	2012-07-04			ENSG00000228903	ENSG00000228903			44185	pseudogene	pseudogene							Standard	NR_024116		Approved		uc011kbk.1		OTTHUMG00000155354		7.37:g.44073723C>T				R	SNP	-	NULL	ENST00000446874.1	37	NULL		7																																																																																			-	RASA4CP	-	-		0.617	RASA4CP-003	KNOWN	basic	processed_transcript	RASA4CP	HGNC	pseudogene	OTTHUMT00000339613.1	0	0		110	110		0.00		C	NR_024116		44073723	-1	10		97		tier1	no_errors	ENST00000425524	ensembl	human	known	74_37	rna	9.35		SNP	0.001	T	10	97
SCN4B	6330	genome.wustl.edu	37	11	118006825	118006826	+	3'UTR	INS	-	-	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:118006825_118006826insA	ENST00000324727.4	-	0	1749_1750				SCN4B_ENST00000423160.2_5'UTR	NM_001142349.1|NM_174934.3	NP_001135821.1|NP_777594.1	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta subunit						AV node cell to bundle of His cell communication (GO:0086067)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|voltage-gated sodium channel complex (GO:0001518)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)	Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGCAGGGGAGAGCTGGGCTCA	0.698													ENSG00000177098																																					0																																										SO:0001624	3_prime_UTR_variant	0				AY149967	CCDS8389.1, CCDS44744.1	11q23.3	2014-09-17	2012-02-28		ENSG00000177098	ENSG00000177098		"""Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10592	protein-coding gene	gene with protein product		608256	"""sodium channel, voltage-gated, type IV, beta"""				Standard	NM_174934		Approved	LQT10	uc001pse.3	Q8IWT1	OTTHUMG00000166994	ENST00000324727.4:c.*917->T	11.37:g.118006826_118006826dupA			E9PPT5|Q6PIG5	R	INS	-	NULL	ENST00000324727.4	37	NULL	CCDS8389.1	11																																																																																				SCN4B	-	-		0.698	SCN4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN4B	HGNC	protein_coding	OTTHUMT00000392326.1	0	0		11	11		0.00		-			118006826	-1	4		6		tier1	no_errors	ENST00000423160	ensembl	human	known	74_37	rna	40.00		INS	0.000:0.000	A	4	6
TSIX	9383	genome.wustl.edu	37	X	73044010	73044010	+	lincRNA	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chrX:73044010G>T	ENST00000604411.1	+	0	31971				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		CAATAAAGATGgtttatcttt	0.363													ENSG00000229807																																					0													4.0	4.0	4.0					X																	73044010		803	1826	2629			0			-			Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73044010G>T				R	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			-	XIST	-	-		0.363	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	0	0		24	24		0.00		G	NR_003255		73044010	-1	4		15		tier1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	21.05		SNP	0.053	T	4	15
CAPN2	824	genome.wustl.edu	37	1	223963659	223963659	+	3'UTR	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:223963659C>T	ENST00000295006.5	+	0	3512				CAPN2_ENST00000474026.1_3'UTR|CAPN2_ENST00000433674.2_3'UTR	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit						blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TTCATGTATTCAAAGGAAAAG	0.358													ENSG00000162909																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.*1100C>T	1.37:g.223963659C>T			A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	R	SNP	-	NULL	ENST00000295006.5	37	NULL	CCDS31035.1	1																																																																																			-	CAPN2	-	-		0.358	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN2	HGNC	protein_coding	OTTHUMT00000090973.1	0	0		20	20		0.00		C	NM_001748		223963659	+1	3		13		tier1	no_errors	ENST00000463997	ensembl	human	known	74_37	rna	18.75		SNP	0.003	T	3	13
ABCC8	6833	genome.wustl.edu	37	11	17427096	17427096	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:17427096G>A	ENST00000389817.3	-	27	3412	c.3344C>T	c.(3343-3345)aCg>aTg	p.T1115M	ABCC8_ENST00000302539.4_Missense_Mutation_p.T1116M			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1115	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CCCAAGGGGCGTGGTCTCAAA	0.453													ENSG00000006071																																					0													154.0	152.0	153.0					11																	17427096		2200	4293	6493	SO:0001583	missense	0			-	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3344C>T	11.37:g.17427096G>A	ENSP00000374467:p.Thr1115Met		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.T1116M	ENST00000389817.3	37	c.3347	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.061870	0.93846	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.89939	-2.59;-2.59	6.17	6.17	0.99709	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96352	0.8810	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.96269	0.9197	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1115	Q09428	ABCC8_HUMAN	M	1115;1116	ENSP00000374467:T1115M;ENSP00000303960:T1116M	ENSP00000303960:T1116M	T	-	2	0	ABCC8	17383672	1.000000	0.71417	0.981000	0.43875	0.991000	0.79684	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	ACG	-	ABCC8	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom		0.453	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	0	0		31	31		0.00		G	NM_000352		17427096	-1	16		17		tier1	no_errors	ENST00000302539	ensembl	human	known	74_37	missense	48.48		SNP	1.000	A	16	17
CACFD1	11094	genome.wustl.edu	37	9	136330517	136330517	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr9:136330517G>T	ENST00000316948.4	+	3	348	c.268G>T	c.(268-270)Gcg>Tcg	p.A90S	CACFD1_ENST00000291722.7_Intron|CACFD1_ENST00000540581.1_Missense_Mutation_p.A90S|CACFD1_ENST00000542192.1_Intron|CACFD1_ENST00000489519.1_3'UTR	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	90					synaptic vesicle endocytosis (GO:0048488)	integral component of synaptic vesicle membrane (GO:0030285)	calcium channel activity (GO:0005262)										AAACACAGTGGCGGAGAAGGT	0.602													ENSG00000160325																																					0													121.0	112.0	115.0					9																	136330517		2203	4300	6503	SO:0001583	missense	0			-		CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325			1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7		19737521	Standard	NM_001242370		Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.268G>T	9.37:g.136330517G>T	ENSP00000317121:p.Ala90Ser		B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	Missense_Mutation	SNP	pfam_TVP18/Ca-channel_flower	p.A90S	ENST00000316948.4	37	c.268	CCDS6974.1	9	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696898	0.30142	.	.	ENSG00000160325	ENST00000535514;ENST00000316948;ENST00000540581;ENST00000444798	T;T;T	0.42900	0.96;0.96;0.96	5.35	3.42	0.39159	Membrane protein, Golgi apparatus TVP18/Calcium channel flower (1);	0.172324	0.50627	N	0.000102	T	0.26048	0.0635	N	0.21448	0.665	0.80722	D	1	B;B	0.29136	0.234;0.022	B;B	0.26202	0.067;0.023	T	0.03231	-1.1058	10	0.09590	T	0.72	-20.7265	13.2976	0.60307	0.0:0.0:0.4677:0.5323	.	90;90	F5GXX4;Q9UGQ2	.;FLOWR_HUMAN	S	80;90;90;62	ENSP00000317121:A90S;ENSP00000440832:A90S;ENSP00000414495:A62S	ENSP00000317121:A90S	A	+	1	0	C9orf7	135320338	1.000000	0.71417	0.594000	0.28785	0.974000	0.67602	3.296000	0.51802	0.568000	0.29311	0.491000	0.48974	GCG	-	CACFD1	-	pfam_TVP18/Ca-channel_flower		0.602	CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACFD1	HGNC	protein_coding	OTTHUMT00000054915.1	0	0		32	32		0.00		G	NM_017586		136330517	+1	5		28		tier1	no_errors	ENST00000540581	ensembl	human	known	74_37	missense	15.15		SNP	0.969	T	5	28
ENAH	55740	genome.wustl.edu	37	1	225754957	225754957	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:225754957G>T	ENST00000366844.3	-	2	616	c.165C>A	c.(163-165)gaC>gaA	p.D55E	ENAH_ENST00000391874.2_5'UTR|ENAH_ENST00000284563.6_Missense_Mutation_p.D55E|ENAH_ENST00000366843.2_Missense_Mutation_p.D55E	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	55	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)			NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		TTACCTGATGGTCCTGAATCT	0.393													ENSG00000154380																																					0													237.0	217.0	224.0					1																	225754957		2203	4300	6503	SO:0001583	missense	0			-	AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.165C>A	1.37:g.225754957G>T	ENSP00000355809:p.Asp55Glu		D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pfscan_WH1/EVH1	p.D55E	ENST00000366844.3	37	c.165	CCDS31041.1	1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117678	0.56505	.	.	ENSG00000154380	ENST00000366844;ENST00000366843;ENST00000284563;ENST00000538194	D;D;T	0.98717	-5.09;-5.09;1.48	5.41	3.52	0.40303	EVH1 (3);Pleckstrin homology-type (1);Ran binding protein 1 (1);	0.000000	0.85682	D	0.000000	D	0.98814	0.9600	M	0.87758	2.905	0.58432	D	0.999999	P;P	0.50156	0.917;0.932	P;D	0.65773	0.897;0.938	D	0.99651	1.0991	10	0.87932	D	0	-20.2985	5.5071	0.16860	0.3772:0.0:0.6227:0.0	.	55;55	Q8N8S7-2;Q8N8S7	.;ENAH_HUMAN	E	55;55;55;54	ENSP00000355809:D55E;ENSP00000355808:D55E;ENSP00000284563:D55E	ENSP00000284563:D55E	D	-	3	2	ENAH	223821580	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.176000	0.31957	1.417000	0.47077	-0.140000	0.14226	GAC	-	EH	-	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1		0.393	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	EH	HGNC	protein_coding	OTTHUMT00000357426.2	0	0		52	52		0.00		G	NM_018212		225754957	-1	4		35		tier1	no_errors	ENST00000366844	ensembl	human	known	74_37	missense	10.26		SNP	1.000	T	4	35
CD300LB	124599	genome.wustl.edu	37	17	72521968	72521968	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:72521968C>A	ENST00000392621.1	-	2	404	c.400G>T	c.(400-402)Gat>Tat	p.D134Y	CD300LB_ENST00000314401.3_Missense_Mutation_p.D134Y	NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	97					cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						TCTGCGTCATCTCGCCTGAGC	0.507													ENSG00000178789																																					0													245.0	220.0	229.0					17																	72521968		2203	4300	6503	SO:0001583	missense	0			-	AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.400G>T	17.37:g.72521968C>A	ENSP00000376397:p.Asp134Tyr		Q1EG73|Q8IX40|Q8N6D1	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.D134Y	ENST00000392621.1	37	c.400	CCDS11700.1	17	.	.	.	.	.	.	.	.	.	.	C	5.219	0.225888	0.09916	.	.	ENSG00000178789	ENST00000392621;ENST00000314401	T	0.04917	3.53	5.17	-0.594	0.11664	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.155110	0.06495	N	0.735307	T	0.28234	0.0697	M	0.88450	2.955	0.09310	N	1	D;D	0.59357	0.967;0.985	P;D	0.67231	0.903;0.95	T	0.19386	-1.0307	10	0.87932	D	0	-16.8791	10.4168	0.44327	0.0:0.6555:0.0:0.3445	.	134;97	B4DQ71;A8K4G0	.;CLM7_HUMAN	Y	97;134	ENSP00000317337:D134Y	ENSP00000317337:D134Y	D	-	1	0	CD300LB	70033563	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.626000	0.02035	-0.241000	0.09681	-1.305000	0.01319	GAT	-	CD300LB	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.507	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD300LB	HGNC	protein_coding	OTTHUMT00000145082.2	0	0		71	71		0.00		C	NM_174892		72521968	-1	7		36		tier1	no_errors	ENST00000392621	ensembl	human	known	74_37	missense	16.28		SNP	0.000	A	7	36
NLRP4	147945	genome.wustl.edu	37	19	56369983	56369983	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:56369983G>A	ENST00000301295.6	+	3	1646	c.1224G>A	c.(1222-1224)tgG>tgA	p.W408*	NLRP4_ENST00000346986.5_Nonsense_Mutation_p.W408*|NLRP4_ENST00000587891.1_Nonsense_Mutation_p.W333*	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	408	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AGGGTATGTGGACAGACACAT	0.567													ENSG00000160505																																					0													90.0	91.0	91.0					19																	56369983		2203	4300	6503	SO:0001587	stop_gained	0			-	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1224G>A	19.37:g.56369983G>A	ENSP00000301295:p.Trp408*		Q86W87|Q96AY6	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.W408*	ENST00000301295.6	37	c.1224	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	G	40	8.038787	0.98624	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1952	0.65667	0.0:0.0:1.0:0.0	.	.	.	.	X	408	.	ENSP00000301295:W408X	W	+	3	0	NLRP4	61061795	0.985000	0.35326	0.977000	0.42913	0.392000	0.30506	1.829000	0.39121	2.273000	0.75805	0.650000	0.86243	TGG	-	NLRP4	-	NULL		0.567	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	0	0		68	68		0.00		G	NM_134444		56369983	+1	8		53		tier1	no_errors	ENST00000301295	ensembl	human	known	74_37	nonsense	13.11		SNP	0.998	A	8	53
WRB	7485	genome.wustl.edu	37	21	40763742	40763742	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr21:40763742G>T	ENST00000333781.5	+	3	457	c.316G>T	c.(316-318)Gtc>Ttc	p.V106F	WRB_ENST00000466787.1_3'UTR|WRB_ENST00000398753.1_Missense_Mutation_p.V72F|WRB_ENST00000380708.1_Missense_Mutation_p.V72F|WRB_ENST00000541890.1_Missense_Mutation_p.V106F	NM_004627.4	NP_004618.2	O00258	WRB_HUMAN	tryptophan rich basic protein	106					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(3)	3		Prostate(19;1.2e-06)				GGTGATAAGTGTCGCTTTCTA	0.463													ENSG00000182093																																					0													124.0	118.0	120.0					21																	40763742		2203	4300	6503	SO:0001583	missense	0			-		CCDS13664.1, CCDS54485.1	21q22.3	2007-10-04			ENSG00000182093	ENSG00000182093			12790	protein-coding gene	gene with protein product		602915				9544840	Standard	NM_004627		Approved	CHD5	uc002yxs.3	O00258	OTTHUMG00000066250	ENST00000333781.5:c.316G>T	21.37:g.40763742G>T	ENSP00000327716:p.Val106Phe		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	NULL	p.V106F	ENST00000333781.5	37	c.316	CCDS13664.1	21	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890512	0.33348	.	.	ENSG00000182093	ENST00000333781;ENST00000541890;ENST00000398753;ENST00000380713;ENST00000380708	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.33	4.33	0.51752	.	0.052759	0.64402	D	0.000001	T	0.25531	0.0621	N	0.08118	0	0.46437	D	0.999045	D;P	0.56287	0.975;0.611	P;B	0.53062	0.717;0.234	T	0.18524	-1.0334	10	0.10111	T	0.7	-20.5952	3.9712	0.09454	0.2691:0.0:0.7309:0.0	.	106;106	B4DRG4;O00258	.;WRB_HUMAN	F	106;106;72;72;72	ENSP00000327716:V106F;ENSP00000445363:V106F;ENSP00000381737:V72F;ENSP00000370089:V72F;ENSP00000370084:V72F	ENSP00000327716:V106F	V	+	1	0	WRB	39685612	1.000000	0.71417	0.403000	0.26384	0.310000	0.27922	6.511000	0.73733	2.480000	0.83734	0.650000	0.86243	GTC	-	WRB	-	NULL		0.463	WRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRB	HGNC	protein_coding	OTTHUMT00000141745.3	0	0		31	31		0.00		G			40763742	+1	7		30		tier1	no_errors	ENST00000333781	ensembl	human	known	74_37	missense	18.92		SNP	1.000	T	7	30
PELI3	246330	genome.wustl.edu	37	11	66243176	66243176	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:66243176G>A	ENST00000320740.7	+	8	1108	c.948G>A	c.(946-948)aaG>aaA	p.K316K	PELI3_ENST00000531856.1_Intron|PELI3_ENST00000349459.6_Silent_p.K292K|CTD-3074O7.5_ENST00000527092.1_RNA|CTD-3074O7.5_ENST00000527274.2_RNA|CTD-3074O7.5_ENST00000533502.1_RNA|CTD-3074O7.5_ENST00000602951.1_RNA|CTD-3074O7.5_ENST00000525142.1_RNA	NM_001243136.1|NM_145065.2	NP_001230065.1|NP_659502.2	Q8N2H9	PELI3_HUMAN	pellino E3 ubiquitin protein ligase family member 3	316					defense response to Gram-negative bacterium (GO:0050829)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Toll signaling pathway (GO:0045751)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon production (GO:0032480)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|protein K63-linked ubiquitination (GO:0070534)|regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070428)|Toll signaling pathway (GO:0008063)	cytosol (GO:0005829)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	15						CCACACTGAAGCAACTGGAGG	0.701													ENSG00000174516																																					0													20.0	22.0	22.0					11																	66243176		2172	4245	6417	SO:0001819	synonymous_variant	0			-	AL834395	CCDS31615.1, CCDS41675.1, CCDS73328.1	11q13.2	2012-02-23	2012-02-23		ENSG00000174516	ENSG00000174516		"""Pellino homologs"""	30010	protein-coding gene	gene with protein product		609827	"""pellino homolog 3 (Drosophila)"""			12874243, 15917247	Standard	NM_145065		Approved	MGC35521	uc001oic.4	Q8N2H9	OTTHUMG00000167109	ENST00000320740.7:c.948G>A	11.37:g.66243176G>A			Q8N3E1|Q8N9Q6|Q8TAW7|Q8TED5	Silent	SNP	pfam_Pellino_fam	p.K316	ENST00000320740.7	37	c.948	CCDS31615.1	11																																																																																			-	PELI3	-	pfam_Pellino_fam		0.701	PELI3-001	KNOWN	basic|CCDS	protein_coding	PELI3	HGNC	protein_coding	OTTHUMT00000393226.1	0	0		12	12		0.00		G	NM_145065		66243176	+1	4		12		tier1	no_errors	ENST00000320740	ensembl	human	known	74_37	silent	25.00		SNP	1.000	A	4	12
SOS2	6655	genome.wustl.edu	37	14	50623782	50623782	+	Silent	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr14:50623782G>T	ENST00000216373.5	-	12	2266	c.1992C>A	c.(1990-1992)ggC>ggA	p.G664G	SOS2_ENST00000555794.1_5'UTR|SOS2_ENST00000543680.1_Silent_p.G631G	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	664	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					TTGGCTGCTCGCCTTTCTCTA	0.358													ENSG00000100485																																					0													88.0	77.0	81.0					14																	50623782		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.1992C>A	14.37:g.50623782G>T			B7ZKT6|D3DSB4|Q15503|Q17RN1	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.G664	ENST00000216373.5	37	c.1992	CCDS9697.1	14																																																																																			-	SOS2	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N		0.358	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	HGNC	protein_coding	OTTHUMT00000276878.2	0	0		57	57		0.00		G			50623782	-1	4		45		tier1	no_errors	ENST00000216373	ensembl	human	known	74_37	silent	8.16		SNP	0.954	T	4	45
UPF2	26019	genome.wustl.edu	37	10	11997274	11997274	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:11997274C>T	ENST00000356352.2	-	13	3280	c.2807G>A	c.(2806-2808)gGt>gAt	p.G936D	UPF2_ENST00000397053.2_Missense_Mutation_p.G936D|UPF2_ENST00000357604.5_Missense_Mutation_p.G936D			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	936	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				TTTACTGGAACCTCTGTCAAA	0.388													ENSG00000151461																																					0													61.0	55.0	57.0					10																	11997274		2203	4300	6503	SO:0001583	missense	0			-	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2807G>A	10.37:g.11997274C>T	ENSP00000348708:p.Gly936Asp		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.G936D	ENST00000356352.2	37	c.2807	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661096	0.88154	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000397053	T;T;T	0.20881	2.04;2.04;2.04	4.6	4.6	0.57074	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.52853	0.1760	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.62186	-0.6907	10	0.56958	D	0.05	.	17.764	0.88471	0.0:1.0:0.0:0.0	.	936	Q9HAU5	RENT2_HUMAN	D	936	ENSP00000348708:G936D;ENSP00000350221:G936D;ENSP00000380244:G936D	ENSP00000348708:G936D	G	-	2	0	UPF2	12037280	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.445000	0.80570	2.263000	0.75096	0.591000	0.81541	GGT	-	UPF2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3		0.388	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	0	0		76	76		0.00		C			11997274	-1	4		29		tier1	no_errors	ENST00000356352	ensembl	human	known	74_37	missense	12.12		SNP	1.000	T	4	29
BTBD17	388419	genome.wustl.edu	37	17	72357877	72357877	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:72357877C>T	ENST00000375366.3	-	1	208	c.82G>A	c.(82-84)Gca>Aca	p.A28T		NM_001080466.1	NP_001073935.1	A6NE02	BTBDH_HUMAN	BTB (POZ) domain containing 17	28					negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|lung(4)	6						CGCTCACCTGCATGGGTGACC	0.692													ENSG00000204347																																					0													51.0	40.0	44.0					17																	72357877		2203	4300	6503	SO:0001583	missense	0			-		CCDS32719.1	17q25.1	2013-01-08			ENSG00000204347	ENSG00000204347		"""BTB/POZ domain containing"""	33758	protein-coding gene	gene with protein product	"""transport and golgi organization 10 homolog A (Drosophila)"""						Standard	NM_001080466		Approved	LGALS3BPL, BTBD17A, TANGO10A	uc002jkn.2	A6NE02	OTTHUMG00000178580	ENST00000375366.3:c.82G>A	17.37:g.72357877C>T	ENSP00000364515:p.Ala28Thr			Missense_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.A28T	ENST00000375366.3	37	c.82	CCDS32719.1	17	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870590	0.33069	.	.	ENSG00000204347	ENST00000375366	T	0.77877	-1.13	4.85	2.85	0.33270	.	0.261963	0.30949	N	0.008545	T	0.60287	0.2257	N	0.17082	0.46	0.34215	D	0.674745	B	0.15473	0.013	B	0.12837	0.008	T	0.63028	-0.6728	10	0.44086	T	0.13	.	8.9509	0.35788	0.0:0.8285:0.0:0.1715	.	28	A6NE02	BTBDH_HUMAN	T	28	ENSP00000364515:A28T	ENSP00000364515:A28T	A	-	1	0	BTBD17	69869472	0.651000	0.27340	0.986000	0.45419	0.201000	0.24016	0.909000	0.28558	1.056000	0.40484	0.558000	0.71614	GCA	-	BTBD17	-	NULL		0.692	BTBD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD17	HGNC	protein_coding	OTTHUMT00000442542.1	0	0		57	57		0.00		C	NM_001080466		72357877	-1	5		52		tier1	no_errors	ENST00000375366	ensembl	human	known	74_37	missense	8.77		SNP	0.993	T	5	52
C1orf86	199990	genome.wustl.edu	37	1	2118644	2118644	+	IGR	SNP	G	G	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:2118644G>C	ENST00000378546.4	-	0	729				RP11-181G12.2_ENST00000444529.1_RNA|AL590822.2_ENST00000597060.1_5'Flank|C1orf86_ENST00000400919.3_5'UTR|C1orf86_ENST00000487186.1_5'Flank	NM_182533.2	NP_872339	Q6NZ36	FAP20_HUMAN	chromosome 1 open reading frame 86						cellular response to DNA damage stimulus (GO:0006974)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	cell junction (GO:0030054)|chromosome (GO:0005694)|Fanconi anaemia nuclear complex (GO:0043240)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)			central_nervous_system(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		ATCCATGAAAGACTTTAATGG	0.433													ENSG00000162585																																					0													30.0	34.0	33.0					1																	2118644		692	1591	2283	SO:0001628	intergenic_variant	0			-	AK126870	CCDS38.2, CCDS57965.1, CCDS72686.1, CCDS72687.1	1p36.33	2013-05-22			ENSG00000162585	ENSG00000162585			26428	protein-coding gene	gene with protein product		615183				14702039	Standard	NM_182533		Approved	FLJ31031, FAAP20	uc031pkt.1	Q6NZ36	OTTHUMG00000001404		1.37:g.2118644G>C			A6PW39|A6PW40|A6PW41|A8MQT6|F2Z2L4|Q6ZT64|Q71M24|Q96ND7	Missense_Mutation	SNP	NULL	p.L181V	ENST00000378546.4	37	c.541	CCDS38.2	1																																																																																			-	C1orf86	-	NULL		0.433	C1orf86-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf86	HGNC	protein_coding	OTTHUMT00000316541.1	0	0		47	47		0.00		G	NM_182533		2118644	-1	10		66		tier1	no_errors	ENST00000414253	ensembl	human	known	74_37	missense	13.16		SNP	1.000	C	10	66
DAB1	1600	genome.wustl.edu	37	1	57535064	57535064	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:57535064C>T	ENST00000371231.1	-	7	666	c.632G>A	c.(631-633)cGt>cAt	p.R211H	DAB1_ENST00000439789.2_Intron|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371236.2_Missense_Mutation_p.R211H|DAB1_ENST00000371234.4_Missense_Mutation_p.R211H|DAB1_ENST00000420954.2_Intron|DAB1_ENST00000414851.2_Intron			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	211					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.R211H(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						TTCGGGATCACGGATTGGCTC	0.403													ENSG00000173406																																					1	Substitution - Missense(1)	central_nervous_system(1)											143.0	130.0	134.0					1																	57535064		2203	4300	6503	SO:0001583	missense	0			-	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.632G>A	1.37:g.57535064C>T	ENSP00000360275:p.Arg211His		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.R211H	ENST00000371231.1	37	c.632		1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.232315	0.58777	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000371231	T;T;T	0.48522	0.86;0.86;0.81	5.53	5.53	0.82687	.	0.118664	0.64402	D	0.000008	T	0.34600	0.0903	N	0.19112	0.55	0.80722	D	1	P;P	0.48998	0.918;0.584	B;B	0.37650	0.255;0.087	T	0.13818	-1.0495	10	0.35671	T	0.21	-37.0793	19.6556	0.95837	0.0:1.0:0.0:0.0	.	211;211	O75553;O75553-6	DAB1_HUMAN;.	H	211	ENSP00000360280:R211H;ENSP00000360278:R211H;ENSP00000360275:R211H	ENSP00000360275:R211H	R	-	2	0	DAB1	57307652	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.529000	0.60588	2.882000	0.98803	0.655000	0.94253	CGT	-	DAB1	-	NULL		0.403	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	0	0		46	46		0.00		C	NM_021080		57535064	-1	12		62		tier1	no_errors	ENST00000371231	ensembl	human	known	74_37	missense	16.22		SNP	1.000	T	12	62
FRRS1	391059	genome.wustl.edu	37	1	100176425	100176425	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:100176425C>T	ENST00000414213.1	-	15	2162	c.1561G>A	c.(1561-1563)Gta>Ata	p.V521I	FRRS1_ENST00000492943.1_5'Flank|FRRS1_ENST00000287474.5_Missense_Mutation_p.V521I			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	521	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)	p.V521I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		TGCCAGGCTACGAATCCGGTC	0.448													ENSG00000156869																																					1	Substitution - Missense(1)	large_intestine(1)											98.0	85.0	90.0					1																	100176425		2203	4300	6503	SO:0001583	missense	0			-	AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.1561G>A	1.37:g.100176425C>T	ENSP00000393884:p.Val521Ile		A6NLN7	Missense_Mutation	SNP	pfam_Reeler_dom,pfam_DOMON_domain,smart_DOMON_domain,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_DOMON_domain,pfscan_Reeler_dom,pfscan_Cyt_b561/ferric_Rdtase_TM	p.V521I	ENST00000414213.1	37	c.1561		1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698681	0.88830	.	.	ENSG00000156869	ENST00000414213;ENST00000287474	.	.	.	5.61	5.61	0.85477	.	0.302981	0.29587	N	0.011729	T	0.67702	0.2921	M	0.68593	2.085	0.80722	D	1	D	0.69078	0.997	P	0.59424	0.857	T	0.60520	-0.7247	9	0.17832	T	0.49	-26.8416	19.5966	0.95541	0.0:1.0:0.0:0.0	.	521	Q6ZNA5-2	.	I	521	.	ENSP00000287474:V521I	V	-	1	0	FRRS1	99949013	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	2.104000	0.41815	2.802000	0.96397	0.655000	0.94253	GTA	-	FRRS1	-	pfscan_Cyt_b561/ferric_Rdtase_TM		0.448	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	FRRS1	HGNC	protein_coding		0	0		71	71		0.00		C	NM_001013660		100176425	-1	17		122		tier1	no_errors	ENST00000287474	ensembl	human	known	74_37	missense	12.23		SNP	1.000	T	17	122
ZNF75D	7626	genome.wustl.edu	37	X	134427799	134427799	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chrX:134427799delC	ENST00000370766.3	-	3	2977	c.268delG	c.(268-270)gaafs	p.E90fs	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Frame_Shift_Del_p.E90fs	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	90	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						ACCAGCATTTCCAAGATCTGC	0.498													ENSG00000186376																																					0													84.0	74.0	77.0					X																	134427799		2203	4300	6503	SO:0001589	frameshift_variant	0				S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.268delG	X.37:g.134427799delC	ENSP00000359802:p.Glu90fs		A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Frame_Shift_Del	DEL	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E90fs	ENST00000370766.3	37	c.268	CCDS14648.1	X																																																																																				ZNF75D	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.498	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF75D	HGNC	protein_coding	OTTHUMT00000058415.1	0	0		37	37		0.00		C	NM_007131		134427799	-1	2		7		tier1	no_errors	ENST00000370766	ensembl	human	known	74_37	frame_shift_del	22.22		DEL	0.728	-	2	7
ZNF697	90874	genome.wustl.edu	37	1	120165569	120165569	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:120165569C>T	ENST00000421812.2	-	3	1516	c.1397G>A	c.(1396-1398)cGc>cAc	p.R466H		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		CTGGCCACAGCGGAAGGGCTT	0.677													ENSG00000143067																																					0													20.0	24.0	22.0					1																	120165569		2201	4299	6500	SO:0001583	missense	0			-	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1397G>A	1.37:g.120165569C>T	ENSP00000396857:p.Arg466His		Q96IT2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R466H	ENST00000421812.2	37	c.1397	CCDS44202.1	1	.	.	.	.	.	.	.	.	.	.	C	4.622	0.115676	0.08831	.	.	ENSG00000143067	ENST00000421812	T	0.18174	2.23	5.08	2.03	0.26663	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.452476	0.16555	N	0.209316	T	0.03095	0.0091	L	0.28608	0.87	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.41124	-0.9526	10	0.48119	T	0.1	-9.1066	1.7979	0.03065	0.1622:0.4896:0.1577:0.1905	.	466	Q5TEC3	ZN697_HUMAN	H	466	ENSP00000396857:R466H	ENSP00000396857:R466H	R	-	2	0	ZNF697	119967092	0.000000	0.05858	0.996000	0.52242	0.020000	0.10135	-0.698000	0.05092	0.212000	0.20703	-0.311000	0.09066	CGC	-	ZNF697	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.677	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF697	HGNC	protein_coding	OTTHUMT00000036349.3	0	0		32	32		0.00		C	XM_371286		120165569	-1	17		16		tier1	no_errors	ENST00000421812	ensembl	human	known	74_37	missense	51.52		SNP	0.313	T	17	16
RIMBP2	23504	genome.wustl.edu	37	12	130927121	130927121	+	Missense_Mutation	SNP	G	G	A	rs147881182	byFrequency	TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:130927121G>A	ENST00000261655.4	-	8	888	c.725C>T	c.(724-726)aCg>aTg	p.T242M	RIMBP2_ENST00000536002.1_Missense_Mutation_p.T150M|RIMBP2_ENST00000535703.1_Missense_Mutation_p.T150M	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	242					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GTTCCCCAGCGTGCTTGCCAA	0.592													ENSG00000060709																																					0								G	MET/THR	0,4406		0,0,2203	151.0	147.0	148.0		725	3.5	0.0	12	dbSNP_134	148	2,8598	2.2+/-6.3	0,2,4298	no	missense	RIMBP2	NM_015347.4	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	242/1053	130927121	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.725C>T	12.37:g.130927121G>A	ENSP00000261655:p.Thr242Met		Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.T242M	ENST00000261655.4	37	c.725	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733745	0.30684	0.0	2.33E-4	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.21191	2.02;2.85;2.85	4.42	3.52	0.40303	.	0.611371	0.18094	N	0.151888	T	0.27384	0.0672	M	0.68317	2.08	0.20074	N	0.999935	P;D	0.61080	0.742;0.989	P;P	0.47402	0.467;0.546	T	0.10590	-1.0623	10	0.51188	T	0.08	-11.8359	8.7052	0.34349	0.0846:0.1524:0.763:0.0	.	150;242	O15034-2;O15034	.;RIMB2_HUMAN	M	242;150;150;150	ENSP00000261655:T242M;ENSP00000440347:T150M;ENSP00000439159:T150M	ENSP00000261655:T242M	T	-	2	0	RIMBP2	129493074	0.261000	0.24063	0.008000	0.14137	0.305000	0.27757	1.406000	0.34646	0.835000	0.34877	0.561000	0.74099	ACG	rs147881182	RIMBP2	-	NULL		0.592	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	0	0		52	52		0.00		G	NM_015347		130927121	-1	15		57		tier1	no_errors	ENST00000261655	ensembl	human	known	74_37	missense	20.83		SNP	0.237	A	15	57
CCDC105	126402	genome.wustl.edu	37	19	15132310	15132310	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:15132310G>A	ENST00000292574.3	+	4	1102	c.1020G>A	c.(1018-1020)gcG>gcA	p.A340A		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	340						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CGCAGAAGGCGAGCGAGACCT	0.637													ENSG00000160994																																					0													90.0	63.0	72.0					19																	15132310		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1020G>A	19.37:g.15132310G>A			Q8N7T5|Q8NDL5	Silent	SNP	pfam_Tektin	p.A340	ENST00000292574.3	37	c.1020	CCDS12322.1	19																																																																																			-	CCDC105	-	pfam_Tektin		0.637	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC105	HGNC	protein_coding	OTTHUMT00000466293.1	0	0		41	41		0.00		G	NM_173482		15132310	+1	6		35		tier1	no_errors	ENST00000292574	ensembl	human	known	74_37	silent	14.63		SNP	0.945	A	6	35
CPT1B	1375	genome.wustl.edu	37	22	51007780	51007780	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr22:51007780T>A	ENST00000360719.2	-	19	2443	c.2306A>T	c.(2305-2307)aAg>aTg	p.K769M	CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000440709.1_Missense_Mutation_p.K688M|CPT1B_ENST00000312108.7_Missense_Mutation_p.K769M|CPT1B_ENST00000405237.3_Missense_Mutation_p.K769M|CPT1B_ENST00000395650.2_Missense_Mutation_p.K769M|CPT1B_ENST00000457250.1_Missense_Mutation_p.K735M|CPT1B_ENST00000434492.2_Missense_Mutation_p.K564M	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	769					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		GCTGTAGGCCTTGGGAACTTG	0.572													ENSG00000205560																									Esophageal Squamous(170;988 1933 25577 30295 48163)												0													134.0	129.0	131.0					22																	51007780		2203	4300	6503	SO:0001583	missense	0			-	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.2306A>T	22.37:g.51007780T>A	ENSP00000353945:p.Lys769Met		B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.K769M	ENST00000360719.2	37	c.2306	CCDS14098.1	22	.	.	.	.	.	.	.	.	.	.	T	14.62	2.588654	0.46110	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000440709;ENST00000434492;ENST00000395650	D;D;D;D;D;D;D	0.86097	-2.02;-2.02;-2.02;-1.94;-2.07;-1.79;-2.02	5.11	5.11	0.69529	.	1.324110	0.04547	N	0.389220	D	0.90484	0.7019	L	0.48986	1.54	0.50039	D	0.999845	D;D;D;D	0.76494	0.986;0.97;0.974;0.999	P;P;P;D	0.64042	0.65;0.811;0.598;0.921	T	0.80094	-0.1526	10	0.87932	D	0	-22.5681	11.3161	0.49392	0.0:0.0:0.0:1.0	.	688;735;564;769	E9PCP2;B7Z4U4;A2RRE8;Q92523	.;.;.;CPT1B_HUMAN	M	769;769;769;735;688;564;769	ENSP00000385486:K769M;ENSP00000312189:K769M;ENSP00000353945:K769M;ENSP00000409342:K735M;ENSP00000414713:K688M;ENSP00000410966:K564M;ENSP00000379011:K769M	ENSP00000312189:K769M	K	-	2	0	CPT1B	49354646	0.439000	0.25610	0.994000	0.49952	0.038000	0.13279	2.766000	0.47629	1.926000	0.55796	0.459000	0.35465	AAG	-	CPT1B	-	NULL		0.572	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	0	0		74	74		0.00		T	NM_152246		51007780	-1	5		53		tier1	no_errors	ENST00000312108	ensembl	human	known	74_37	missense	8.62		SNP	0.980	A	5	53
KIAA1841	84542	genome.wustl.edu	37	2	61315638	61315639	+	Intron	INS	-	-	TA	rs377349663|rs371063167		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr2:61315638_61315639insTA	ENST00000402291.1	+	10	1329				KIAA1841_ENST00000356719.2_Intron|KIAA1841_ENST00000453873.1_Intron|KIAA1841_ENST00000482513.1_3'UTR|KIAA1841_ENST00000295031.5_Intron	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841											breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			atgtatttttgtatatatatat	0.386													ENSG00000162929																																					0																																										SO:0001627	intron_variant	0				BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1088+35->TA	2.37:g.61315647_61315648dupTA			Q49AF0|Q6ZND0|Q96JI6	R	INS	-	NULL	ENST00000402291.1	37	NULL	CCDS46296.1	2																																																																																				KIAA1841	-	-		0.386	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1841	HGNC	protein_coding	OTTHUMT00000325477.1	0	0		22	22		0.00		-	NM_032506		61315639	+1	3		19		tier1	no_errors	ENST00000482513	ensembl	human	known	74_37	rna	13.64		INS	0.001:0.001	TA	3	19
SLC38A4	55089	genome.wustl.edu	37	12	47172381	47172381	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:47172381T>C	ENST00000447411.1	-	10	1102	c.896A>G	c.(895-897)gAg>gGg	p.E299G	SLC38A4_ENST00000266579.4_Missense_Mutation_p.E299G	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	299					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					GGCCTGGTTCTCATCCAGCCC	0.463													ENSG00000139209																																					0													107.0	95.0	99.0					12																	47172381		2203	4299	6502	SO:0001583	missense	0			-	AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.896A>G	12.37:g.47172381T>C	ENSP00000389843:p.Glu299Gly		A8K553	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.E299G	ENST00000447411.1	37	c.896	CCDS8750.1	12	.	.	.	.	.	.	.	.	.	.	T	11.30	1.596635	0.28445	.	.	ENSG00000139209	ENST00000447411;ENST00000266579	T;T	0.04275	3.66;3.66	4.91	3.76	0.43208	.	0.347136	0.29348	N	0.012420	T	0.02848	0.0085	N	0.08118	0	0.20926	N	0.99983	B	0.02656	0.0	B	0.04013	0.001	T	0.44128	-0.9348	10	0.29301	T	0.29	-7.8326	10.5395	0.45024	0.0:0.0763:0.0:0.9237	.	299	Q969I6	S38A4_HUMAN	G	299	ENSP00000389843:E299G;ENSP00000266579:E299G	ENSP00000266579:E299G	E	-	2	0	SLC38A4	45458648	0.005000	0.15991	0.050000	0.19076	0.959000	0.62525	0.902000	0.28459	1.007000	0.39238	0.397000	0.26171	GAG	-	SLC38A4	-	NULL		0.463	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A4	HGNC	protein_coding	OTTHUMT00000404574.1	0	0		34	34		0.00		T			47172381	-1	22		20		tier1	no_errors	ENST00000266579	ensembl	human	known	74_37	missense	52.38		SNP	0.319	C	22	20
JAKMIP3	282973	genome.wustl.edu	37	10	133930650	133930650	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:133930650G>A	ENST00000298622.4	+	2	343	c.205G>A	c.(205-207)Gcg>Acg	p.A69T		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	69						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		GCATAAGACCGCGGTCTTGCT	0.582													ENSG00000188385																																					0													47.0	53.0	51.0					10																	133930650		2181	4293	6474	SO:0001583	missense	0			-	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.205G>A	10.37:g.133930650G>A	ENSP00000298622:p.Ala69Thr		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.A69T	ENST00000298622.4	37	c.205	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.502193	0.00992	.	.	ENSG00000188385	ENST00000298622	T	0.07021	3.23	4.53	2.5	0.30297	.	0.320175	0.32093	N	0.006582	T	0.01627	0.0052	N	0.00621	-1.32	0.21290	N	0.999734	B	0.13145	0.007	B	0.04013	0.001	T	0.46190	-0.9209	10	0.02654	T	1	-20.8382	4.1123	0.10065	0.4847:0.0:0.5153:0.0	.	69	Q5VZ66	JKIP3_HUMAN	T	69	ENSP00000298622:A69T	ENSP00000298622:A69T	A	+	1	0	JAKMIP3	133780640	0.677000	0.27577	0.039000	0.18376	0.012000	0.07955	1.724000	0.38064	1.130000	0.42092	0.491000	0.48974	GCG	-	JAKMIP3	-	NULL		0.582	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	0	0		35	35		0.00		G	NM_194303		133930650	+1	12		13		tier1	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	48.00		SNP	0.811	A	12	13
ZNF610	162963	genome.wustl.edu	37	19	52869325	52869325	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:52869325T>C	ENST00000403906.3	+	6	1150	c.694T>C	c.(694-696)Tac>Cac	p.Y232H	ZNF610_ENST00000601151.1_Missense_Mutation_p.Y189H|ZNF610_ENST00000327920.8_Missense_Mutation_p.Y232H|ZNF610_ENST00000321287.8_Missense_Mutation_p.Y232H	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		AGAGAAACCTTACAAATGTAC	0.383													ENSG00000167554																																					0													68.0	68.0	68.0					19																	52869325		2203	4300	6503	SO:0001583	missense	0			-	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.694T>C	19.37:g.52869325T>C	ENSP00000383922:p.Tyr232His		A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y232H	ENST00000403906.3	37	c.694	CCDS12851.1	19	.	.	.	.	.	.	.	.	.	.	T	14.62	2.588361	0.46110	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.21734	1.99;1.99	1.82	1.82	0.25136	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38241	0.1033	M	0.66560	2.04	0.09310	N	1	D;D	0.59357	0.981;0.985	P;D	0.63703	0.864;0.917	T	0.08086	-1.0739	9	0.62326	D	0.03	.	8.4	0.32581	0.0:0.0:0.0:1.0	.	189;232	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	H	232;189;232	ENSP00000383922:Y232H;ENSP00000327597:Y232H	ENSP00000324441:Y189H	Y	+	1	0	ZNF610	57561137	0.031000	0.19500	0.001000	0.08648	0.017000	0.09413	2.447000	0.44917	0.815000	0.34398	0.383000	0.25322	TAC	-	ZNF610	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	HGNC	protein_coding	OTTHUMT00000462880.1	0	0		40	40		0.00		T	NM_173530		52869325	+1	4		37		tier1	no_errors	ENST00000321287	ensembl	human	known	74_37	missense	9.76		SNP	0.068	C	4	37
KLF5	688	genome.wustl.edu	37	13	73636861	73636861	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr13:73636861delG	ENST00000377687.4	+	2	1660	c.1124delG	c.(1123-1125)tgcfs	p.C375fs	KLF5_ENST00000539231.1_Frame_Shift_Del_p.C284fs	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	375					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		ATCCACTACTGCGATTACCCT	0.498													ENSG00000102554																																					0													139.0	142.0	141.0					13																	73636861		2203	4300	6503	SO:0001589	frameshift_variant	0				D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.1124delG	13.37:g.73636861delG	ENSP00000366915:p.Cys375fs		L0R3U5|L0R4T9|Q9UHP8	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C375fs	ENST00000377687.4	37	c.1124	CCDS9448.1	13																																																																																				KLF5	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.498	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF5	HGNC	protein_coding	OTTHUMT00000045263.1	0	0		43	43		0.00		G			73636861	+1	2		12		tier1	no_errors	ENST00000377687	ensembl	human	known	74_37	frame_shift_del	14.29		DEL	1.000	-	2	12
MYO5A	4644	genome.wustl.edu	37	15	52688573	52688573	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr15:52688573A>T	ENST00000399231.3	-	11	1584	c.1341T>A	c.(1339-1341)aaT>aaA	p.N447K	MYO5A_ENST00000399233.2_Missense_Mutation_p.N447K|MYO5A_ENST00000358212.6_Missense_Mutation_p.N447K|MYO5A_ENST00000356338.6_Missense_Mutation_p.N447K|MYO5A_ENST00000553916.1_Missense_Mutation_p.N447K	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	447	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GTTCAAAACTATTTATCTCAA	0.254													ENSG00000197535																																					0													47.0	44.0	44.0					15																	52688573		1765	4037	5802	SO:0001583	missense	0			-		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1341T>A	15.37:g.52688573A>T	ENSP00000382177:p.Asn447Lys		A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.N447K	ENST00000399231.3	37	c.1341	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	A	20.8	4.054998	0.75960	.	.	ENSG00000197535	ENST00000399231;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.91180	-2.8;-2.8;-2.8;-2.8;-2.8	5.45	4.33	0.51752	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.97065	0.9041	H	0.99752	4.75	0.80722	D	1	D;P	0.71674	0.998;0.894	D;B	0.77004	0.989;0.421	D	0.95218	0.8331	10	0.87932	D	0	.	6.3543	0.21393	0.7062:0.0:0.2938:0.0	.	447;447	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	K	447;447;447;447;77;447	ENSP00000382177:N447K;ENSP00000382179:N447K;ENSP00000348693:N447K;ENSP00000350945:N447K;ENSP00000451109:N447K	ENSP00000348693:N447K	N	-	3	2	MYO5A	50475865	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.229000	0.51278	1.008000	0.39264	0.528000	0.53228	AAT	-	MYO5A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom		0.254	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	0	0		67	67		0.00		A	NM_000259		52688573	-1	5		52		tier1	no_errors	ENST00000358212	ensembl	human	known	74_37	missense	8.77		SNP	1.000	T	5	52
CHD5	26038	genome.wustl.edu	37	1	6214848	6214848	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:6214848G>A	ENST00000262450.3	-	5	716	c.617C>T	c.(616-618)gCg>gTg	p.A206V	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		cgctgctgccgcGGAGCTGCC	0.662													ENSG00000116254																																					0													32.0	35.0	34.0					1																	6214848		2203	4300	6503	SO:0001583	missense	0			-	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.617C>T	1.37:g.6214848G>A	ENSP00000262450:p.Ala206Val		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A206V	ENST00000262450.3	37	c.617	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035996	0.54896	.	.	ENSG00000116254	ENST00000262450	D	0.90844	-2.74	3.84	3.84	0.44239	.	0.000000	0.64402	D	0.000003	D	0.93070	0.7794	L	0.55990	1.75	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	D	0.91745	0.5407	10	0.28530	T	0.3	-28.4329	15.7436	0.77920	0.0:0.0:1.0:0.0	.	206	Q8TDI0	CHD5_HUMAN	V	206	ENSP00000262450:A206V	ENSP00000262450:A206V	A	-	2	0	CHD5	6137435	1.000000	0.71417	0.616000	0.29078	0.782000	0.44232	9.307000	0.96226	1.876000	0.54355	0.313000	0.20887	GCG	-	CHD5	-	NULL		0.662	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	0	0		29	29		0.00		G	NM_015557		6214848	-1	6		43		tier1	no_errors	ENST00000262450	ensembl	human	known	74_37	missense	12.24		SNP	1.000	A	6	43
LMTK2	22853	genome.wustl.edu	37	7	97770732	97770732	+	Silent	SNP	T	T	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr7:97770732T>C	ENST00000297293.5	+	3	548	c.255T>C	c.(253-255)gaT>gaC	p.D85D	LMTK2_ENST00000493372.1_3'UTR	NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	85					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					ATTTTGATGATGAGATAGATT	0.383													ENSG00000164715																																					0													123.0	123.0	123.0					7																	97770732		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.255T>C	7.37:g.97770732T>C			A4D272|Q75MG7|Q9UPS3	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D85	ENST00000297293.5	37	c.255	CCDS5654.1	7																																																																																			-	LMTK2	-	NULL		0.383	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1	0	0		25	25		0.00		T	NM_014916		97770732	+1	4		33		tier1	no_errors	ENST00000297293	ensembl	human	known	74_37	silent	10.81		SNP	1.000	C	4	33
C20orf194	25943	genome.wustl.edu	37	20	3305587	3305587	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr20:3305587C>T	ENST00000252032.9	-	14	1284	c.1217G>A	c.(1216-1218)gGa>gAa	p.G406E	C20orf194_ENST00000453730.2_Missense_Mutation_p.G144E	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	406										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						TAACCCAGATCCCAGAGTTTG	0.408													ENSG00000088854																																					0													105.0	110.0	108.0					20																	3305587		1861	4105	5966	SO:0001583	missense	0			-	AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.1217G>A	20.37:g.3305587C>T	ENSP00000252032:p.Gly406Glu		Q66K86|Q6P2R9|Q9UFX9	Missense_Mutation	SNP	NULL	p.G406E	ENST00000252032.9	37	c.1217	CCDS42851.1	20	.	.	.	.	.	.	.	.	.	.	C	0.507	-0.868358	0.02590	.	.	ENSG00000088854	ENST00000252032;ENST00000453730	T;T	0.28255	2.3;1.62	5.34	-2.06	0.07298	.	1.030850	0.07619	N	0.926750	T	0.12178	0.0296	N	0.16478	0.41	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.30416	-0.9979	10	0.02654	T	1	.	2.1331	0.03754	0.2213:0.2986:0.3273:0.1527	.	145;406	Q0IIP3;Q5TEA3	.;CT194_HUMAN	E	406;144	ENSP00000252032:G406E;ENSP00000407229:G144E	ENSP00000252032:G406E	G	-	2	0	C20orf194	3253587	0.000000	0.05858	0.401000	0.26359	0.994000	0.84299	-0.094000	0.11094	-0.166000	0.10890	0.655000	0.94253	GGA	-	C20orf194	-	NULL		0.408	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf194	HGNC	protein_coding	OTTHUMT00000077734.1	0	0		58	58		0.00		C	NM_001009984		3305587	-1	6		69		tier1	no_errors	ENST00000252032	ensembl	human	known	74_37	missense	8.00		SNP	0.004	T	6	69
ASCC3	10973	genome.wustl.edu	37	6	101253758	101253758	+	Splice_Site	SNP	T	T	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr6:101253758T>A	ENST00000369162.2	-	5	1146		c.e5-2		ASCC3_ENST00000522650.1_Splice_Site	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3						cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTCAAATAGCTTATAAAAAGA	0.308													ENSG00000112249																																					0													41.0	42.0	42.0					6																	101253758		2200	4295	6495	SO:0001630	splice_region_variant	0			-	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.802-2A>T	6.37:g.101253758T>A			E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Splice_Site	SNP	-	e4-2	ENST00000369162.2	37	c.802-2	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508781	0.64410	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0295	0.71696	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASCC3	101360479	1.000000	0.71417	0.963000	0.40424	0.767000	0.43475	6.168000	0.71908	2.010000	0.58986	0.383000	0.25322	.	-	ASCC3	-	-		0.308	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2	0	0		34	34		0.00		T	NM_006828	Intron	101253758	-1	3		18		tier1	no_errors	ENST00000369162	ensembl	human	known	74_37	splice_site	14.29		SNP	0.999	A	3	18
WRN	7486	genome.wustl.edu	37	8	31014958	31014958	+	Silent	SNP	C	C	G			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr8:31014958C>G	ENST00000298139.5	+	33	4143	c.3894C>G	c.(3892-3894)ggC>ggG	p.G1298G		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1298					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TGAAAGCTGGCTGCCCCCTTG	0.507			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome				ENSG00000165392																									Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													79.0	71.0	74.0					8																	31014958		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	WS, Adult Progeria	-		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3894C>G	8.37:g.31014958C>G			A1KYY9	Silent	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_D/R_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_D_helicase_ATP-dep_RecQ	p.G1298	ENST00000298139.5	37	c.3894	CCDS6082.1	8																																																																																			-	WRN	-	NULL		0.507	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	0	0		30	30		0.00		C			31014958	+1	8		17		tier1	no_errors	ENST00000298139	ensembl	human	known	74_37	silent	32.00		SNP	1.000	G	8	17
GPR182	11318	genome.wustl.edu	37	12	57390107	57390107	+	Missense_Mutation	SNP	G	G	A	rs546209144		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:57390107G>A	ENST00000300098.1	+	2	1333	c.1114G>A	c.(1114-1116)Gca>Aca	p.A372T	HBCBP_ENST00000600202.1_5'Flank|RP11-474N8.5_ENST00000556850.1_RNA	NM_007264.3	NP_009195.1	O15218	GP182_HUMAN	G protein-coupled receptor 182	372					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	15						CCAGCCTGCTGCAGCAGCCCC	0.582													ENSG00000166856	G|||	1	0.000199681	0.0	0.0014	5008	,	,		20281	0.0		0.0	False		,,,				2504	0.0																0													84.0	79.0	81.0					12																	57390107		2203	4300	6503	SO:0001583	missense	0			-	Y13583	CCDS8927.1	12q13.3	2012-08-21	2007-09-24	2007-09-24		ENSG00000166856		"""GPCR / Class A : Orphans"""	13708	protein-coding gene	gene with protein product		605307	"""adrenomedullin receptor"""	ADMR		9367907, 9535752	Standard	NM_007264		Approved	hrhAMR, G10D, AM-R	uc001smk.3	O15218		ENST00000300098.1:c.1114G>A	12.37:g.57390107G>A	ENSP00000300098:p.Ala372Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_G10D_rcpt,prints_GPCR_Rhodpsn,prints_ATII_rcpt	p.A372T	ENST00000300098.1	37	c.1114	CCDS8927.1	12	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223097	0.39300	.	.	ENSG00000166856	ENST00000300098	T	0.70516	-0.49	4.68	-0.442	0.12253	.	0.162316	0.38058	N	0.001837	T	0.47967	0.1474	N	0.19112	0.55	0.09310	N	1	B	0.17667	0.023	B	0.15870	0.014	T	0.34625	-0.9821	10	0.62326	D	0.03	.	4.4234	0.11492	0.3669:0.1582:0.4749:0.0	.	372	O15218	GP182_HUMAN	T	372	ENSP00000300098:A372T	ENSP00000300098:A372T	A	+	1	0	GPR182	55676374	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	0.016000	0.13377	-0.175000	0.10725	-0.258000	0.10820	GCA	-	GPR182	-	NULL		0.582	GPR182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR182	HGNC	protein_coding	OTTHUMT00000411212.1	0	0		38	38		0.00		G	NM_007264		57390107	+1	11		21		tier1	no_errors	ENST00000300098	ensembl	human	known	74_37	missense	34.38		SNP	0.005	A	11	21
CDH20	28316	genome.wustl.edu	37	18	59166690	59166690	+	Missense_Mutation	SNP	C	C	A	rs565477850		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr18:59166690C>A	ENST00000262717.4	+	3	916	c.518C>A	c.(517-519)aCt>aAt	p.T173N	CDH20_ENST00000538374.1_Missense_Mutation_p.T173N|CDH20_ENST00000536675.2_Missense_Mutation_p.T173N			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	173	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TATGTGGCCACTGTGCCAGAA	0.488													ENSG00000101542																																					0													68.0	70.0	70.0					18																	59166690		2203	4300	6503	SO:0001583	missense	0			-	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.518C>A	18.37:g.59166690C>A	ENSP00000262717:p.Thr173Asn		Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T173N	ENST00000262717.4	37	c.518	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626418	0.46840	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.52983	0.64;0.64;0.64	6.06	5.19	0.71726	Cadherin (4);Cadherin-like (1);	0.212130	0.49305	N	0.000157	T	0.35307	0.0927	N	0.12961	0.28	0.40351	D	0.979132	B	0.14012	0.009	B	0.23275	0.045	T	0.11299	-1.0593	10	0.42905	T	0.14	.	16.7608	0.85511	0.1302:0.8698:0.0:0.0	.	173	Q9HBT6	CAD20_HUMAN	N	173	ENSP00000444767:T173N;ENSP00000442226:T173N;ENSP00000262717:T173N	ENSP00000262717:T173N	T	+	2	0	CDH20	57317670	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	3.650000	0.54424	1.542000	0.49330	0.650000	0.86243	ACT	-	CDH20	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.488	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	0	0		34	34		0.00		C	NM_031891		59166690	+1	26		46		tier1	no_errors	ENST00000262717	ensembl	human	known	74_37	missense	36.11		SNP	0.994	A	26	46
C2CD3	26005	genome.wustl.edu	37	11	73814461	73814461	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:73814461G>A	ENST00000334126.7	-	14	2521	c.2295C>T	c.(2293-2295)ctC>ctT	p.L765L	C2CD3_ENST00000313663.7_Silent_p.L765L			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	765					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TTCGGTTGGGGAGCACCAAGT	0.438													ENSG00000168014																																					0													214.0	210.0	211.0					11																	73814461		2200	4293	6493	SO:0001819	synonymous_variant	0			-	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.2295C>T	11.37:g.73814461G>A			C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.L765	ENST00000334126.7	37	c.2295		11																																																																																			-	C2CD3	-	NULL		0.438	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		0	0		85	85		0.00		G	NM_015531		73814461	-1	19		43		tier1	no_errors	ENST00000334126	ensembl	human	known	74_37	silent	30.65		SNP	0.000	A	19	43
TECTA	7007	genome.wustl.edu	37	11	121028808	121028808	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:121028808G>A	ENST00000392793.1	+	14	4835	c.4564G>A	c.(4564-4566)Gac>Aac	p.D1522N	TECTA_ENST00000264037.2_Missense_Mutation_p.D1522N			O75443	TECTA_HUMAN	tectorin alpha	1522	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GAAACTGCCCGACATCTCCTT	0.592													ENSG00000109927																																					0													92.0	72.0	79.0					11																	121028808		2203	4299	6502	SO:0001583	missense	0			-	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4564G>A	11.37:g.121028808G>A	ENSP00000376543:p.Asp1522Asn			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.D1522N	ENST00000392793.1	37	c.4564	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.231592	0.95207	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.60171	0.21;0.21	5.67	5.67	0.87782	von Willebrand factor, type D domain (3);	0.000000	0.85682	D	0.000000	T	0.62708	0.2450	N	0.25485	0.75	0.51233	D	0.999915	D	0.76494	0.999	D	0.64042	0.921	T	0.54497	-0.8285	10	0.14252	T	0.57	.	19.7763	0.96395	0.0:0.0:1.0:0.0	.	1522	O75443	TECTA_HUMAN	N	1522	ENSP00000376543:D1522N;ENSP00000264037:D1522N	ENSP00000264037:D1522N	D	+	1	0	TECTA	120534018	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.405000	0.97313	2.687000	0.91594	0.563000	0.77884	GAC	-	TECTA	-	pfam_VWF_type-D,smart_VWF_type-D		0.592	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	0	0		26	26		0.00		G	NM_005422		121028808	+1	4		17		tier1	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	19.05		SNP	1.000	A	4	17
ACAN	176	genome.wustl.edu	37	15	89390479	89390479	+	Missense_Mutation	SNP	G	G	A	rs369608360		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr15:89390479G>A	ENST00000561243.1	+	7	1435	c.1435G>A	c.(1435-1437)Gtc>Atc	p.V479I	ACAN_ENST00000558207.1_Missense_Mutation_p.V479I|ACAN_ENST00000352105.7_Missense_Mutation_p.V479I|ACAN_ENST00000559004.1_Missense_Mutation_p.V479I|ACAN_ENST00000439576.2_Missense_Mutation_p.V479I			P16112	PGCA_HUMAN	aggrecan	479	G2-B.|Link 3. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCCAGGGGTCGTCTTCCACTA	0.687													ENSG00000157766	G|||	1	0.000199681	0.0	0.0	5008	,	,		15525	0.001		0.0	False		,,,				2504	0.0																0								G	ILE/VAL,ILE/VAL	0,3896		0,0,1948	12.0	15.0	14.0		1435,1435	5.5	1.0	15		14	1,8169		0,1,4084	no	missense,missense	ACAN	NM_001135.3,NM_013227.3	29,29	0,1,6032	AA,AG,GG		0.0122,0.0,0.0083	probably-damaging,probably-damaging	479/2432,479/2531	89390479	1,12065	1948	4085	6033	SO:0001583	missense	0			-	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1435G>A	15.37:g.89390479G>A	ENSP00000453342:p.Val479Ile		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.V479I	ENST00000561243.1	37	c.1435	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101968	0.56183	0.0	1.22E-4	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.20598	2.06;2.06	5.54	5.54	0.83059	.	.	.	.	.	T	0.49423	0.1556	M	0.79011	2.435	0.45662	D	0.998589	D;D;D	0.89917	1.0;1.0;0.971	D;D;P	0.69824	0.966;0.954;0.544	T	0.49781	-0.8903	9	0.59425	D	0.04	-17.3566	18.477	0.90797	0.0:0.0:1.0:0.0	.	479;479;479	E7ENV9;E7EX88;Q6PID9	.;.;.	I	479	ENSP00000387356:V479I;ENSP00000341615:V479I	ENSP00000268134:V479I	V	+	1	0	ACAN	87191483	1.000000	0.71417	0.979000	0.43373	0.355000	0.29361	6.579000	0.74036	2.589000	0.87451	0.655000	0.94253	GTC	-	ACAN	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link		0.687	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	0	0		53	53		0.00		G	NM_001135		89390479	+1	11		40		tier1	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	21.57		SNP	1.000	A	11	40
ZNF268	10795	genome.wustl.edu	37	12	133779911	133779911	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:133779911C>G	ENST00000536435.2	+	6	1969	c.1639C>G	c.(1639-1641)Cag>Gag	p.Q547E	ZNF268_ENST00000228289.5_Missense_Mutation_p.Q547E|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000537565.1_Missense_Mutation_p.Q386E|ZNF268_ENST00000542986.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	547					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CATTATACATCAGAGGATTCA	0.403													ENSG00000090612																																					0													36.0	35.0	36.0					12																	133779911		692	1590	2282	SO:0001583	missense	0			-	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.1639C>G	12.37:g.133779911C>G	ENSP00000444412:p.Gln547Glu		Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q547E	ENST00000536435.2	37	c.1639	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741889	0.30865	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.17854	2.25;3.2	3.71	3.71	0.42584	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13200	0.0320	N	0.26162	0.8	0.21499	N	0.999669	P;P	0.49185	0.872;0.92	B;B	0.40066	0.318;0.213	T	0.12426	-1.0548	8	.	.	.	.	14.4043	0.67071	0.0:1.0:0.0:0.0	.	547;386	Q14587;Q14587-2	ZN268_HUMAN;.	E	547;547;386;386	ENSP00000228289:Q547E;ENSP00000445713:Q386E	.	Q	+	1	0	ZNF268	.	0.000000	0.05858	0.999000	0.59377	0.912000	0.54170	-0.894000	0.04123	1.899000	0.54978	0.655000	0.94253	CAG	-	ZNF268	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.403	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	0	0		30	30		0.00		C	NM_152943		133779911	+1	12		49		tier1	no_errors	ENST00000228289	ensembl	human	known	74_37	missense	19.67		SNP	1.000	G	12	49
ASB2	51676	genome.wustl.edu	37	14	94430829	94430829	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr14:94430829G>A	ENST00000555019.1	-	2	487	c.57C>T	c.(55-57)taC>taT	p.Y19Y	ASB2_ENST00000556337.1_Intron	NM_001202429.1	NP_001189358.1	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	0					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		TGTACAGGCTGTACTCCTCCT	0.622													ENSG00000100628																																					0																																										SO:0001819	synonymous_variant	0			-	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000555019.1:c.57C>T	14.37:g.94430829G>A			B2RDP9|B4E166|Q9NSU5|Q9Y567	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.Y19	ENST00000555019.1	37	c.57	CCDS55940.1	14																																																																																			-	ASB2	-	NULL		0.622	ASB2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	ASB2	HGNC	protein_coding	OTTHUMT00000412844.1	0	0		42	42		0.00		G			94430829	-1	4		41		tier1	no_errors	ENST00000555019	ensembl	human	novel	74_37	silent	8.89		SNP	1.000	A	4	41
KCNV2	169522	genome.wustl.edu	37	9	2717764	2717764	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr9:2717764C>T	ENST00000382082.3	+	1	263	c.25C>T	c.(25-27)Cgg>Tgg	p.R9W		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	9					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		TGAGAGGAGACGGTCCTGGAG	0.617													ENSG00000168263																																					0													69.0	72.0	71.0					9																	2717764		2203	4300	6503	SO:0001583	missense	0			-	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.25C>T	9.37:g.2717764C>T	ENSP00000371514:p.Arg9Trp		Q5T6X0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.R9W	ENST00000382082.3	37	c.25	CCDS6447.1	9	.	.	.	.	.	.	.	.	.	.	C	8.849	0.944201	0.18356	.	.	ENSG00000168263	ENST00000423608;ENST00000382082	D	0.97016	-4.21	4.92	-0.82	0.10826	.	0.515173	0.14541	N	0.313265	D	0.88742	0.6519	N	0.17082	0.46	0.09310	N	1	B	0.19935	0.04	B	0.12837	0.008	T	0.79607	-0.1733	10	0.42905	T	0.14	.	3.5863	0.07972	0.2855:0.3403:0.295:0.0791	.	9	Q8TDN2	KCNV2_HUMAN	W	9	ENSP00000371514:R9W	ENSP00000371514:R9W	R	+	1	2	KCNV2	2707764	0.000000	0.05858	0.787000	0.31911	0.822000	0.46500	-0.453000	0.06778	-0.019000	0.14055	0.467000	0.42956	CGG	-	KCNV2	-	NULL		0.617	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV2	HGNC	protein_coding	OTTHUMT00000051528.1	0	0		51	51		0.00		C	NM_133497		2717764	+1	30		41		tier1	no_errors	ENST00000382082	ensembl	human	known	74_37	missense	42.25		SNP	0.005	T	30	41
RNF167	26001	genome.wustl.edu	37	17	4844429	4844429	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:4844429A>T	ENST00000262482.6	+	3	798	c.142A>T	c.(142-144)Acc>Tcc	p.T48S	RNF167_ENST00000575111.1_Missense_Mutation_p.T48S|SLC25A11_ENST00000225665.7_5'Flank|RNF167_ENST00000572430.1_Missense_Mutation_p.T48S|RNF167_ENST00000570492.1_3'UTR|SLC25A11_ENST00000544061.2_5'Flank|RNF167_ENST00000576229.1_Missense_Mutation_p.T13S|RNF167_ENST00000571816.1_Missense_Mutation_p.T48S	NM_015528.1	NP_056343.1	Q9H6Y7	RN167_HUMAN	ring finger protein 167	48					negative regulation of cell cycle (GO:0045786)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)	4						GTTTGGGGCTACCTTGAGCCA	0.493													ENSG00000108523																																					0													67.0	59.0	62.0					17																	4844429		2203	4300	6503	SO:0001583	missense	0			-	AL050060	CCDS11060.1	17p13.3	2013-02-21			ENSG00000108523	ENSG00000108523		"""RING-type (C3HC4) zinc fingers"""	24544	protein-coding gene	gene with protein product		610431				23129617, 23353890	Standard	NM_015528		Approved	DKFZP566H073	uc002fzs.3	Q9H6Y7	OTTHUMG00000099397	ENST00000262482.6:c.142A>T	17.37:g.4844429A>T	ENSP00000262482:p.Thr48Ser		D3DTK8|Q6XYE0|Q8NDC1|Q9Y3V1	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.T48S	ENST00000262482.6	37	c.142	CCDS11060.1	17	.	.	.	.	.	.	.	.	.	.	A	4.892	0.165808	0.09339	.	.	ENSG00000108523	ENST00000262482	T	0.03358	3.96	5.46	-4.31	0.03698	.	0.752361	0.12321	N	0.479222	T	0.00906	0.0030	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46470	-0.9189	10	0.06891	T	0.86	-0.4244	4.9709	0.14115	0.3072:0.0:0.4368:0.256	.	48	Q9H6Y7	RN167_HUMAN	S	48	ENSP00000262482:T48S	ENSP00000262482:T48S	T	+	1	0	RNF167	4785174	0.000000	0.05858	0.021000	0.16686	0.994000	0.84299	-0.659000	0.05323	-0.318000	0.08665	0.459000	0.35465	ACC	-	RNF167	-	NULL		0.493	RNF167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF167	HGNC	protein_coding	OTTHUMT00000216854.3	0	0		35	35		0.00		A	NM_015528		4844429	+1	4		35		tier1	no_errors	ENST00000262482	ensembl	human	known	74_37	missense	10.26		SNP	0.003	T	4	35
SFMBT2	57713	genome.wustl.edu	37	10	7214483	7214483	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:7214483C>T	ENST00000361972.4	-	18	2215	c.2125G>A	c.(2125-2127)Gtg>Atg	p.V709M	SFMBT2_ENST00000397167.1_Missense_Mutation_p.V709M	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	709					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GTGAAGTCCACGGCAGAAGAC	0.632													ENSG00000198879																																					0													46.0	45.0	45.0					10																	7214483		2203	4300	6503	SO:0001583	missense	0			-	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2125G>A	10.37:g.7214483C>T	ENSP00000355109:p.Val709Met		A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.V709M	ENST00000361972.4	37	c.2125	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	C	12.52	1.962926	0.34659	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.18960	2.18;2.18	5.37	1.29	0.21616	.	0.404999	0.26753	N	0.022671	T	0.18964	0.0455	M	0.65498	2.005	0.28769	N	0.900481	B	0.19583	0.037	B	0.15870	0.014	T	0.13548	-1.0505	10	0.46703	T	0.11	.	5.0579	0.14542	0.1319:0.5123:0.0:0.3558	.	709	Q5VUG0	SMBT2_HUMAN	M	709	ENSP00000355109:V709M;ENSP00000380353:V709M	ENSP00000355109:V709M	V	-	1	0	SFMBT2	7254489	0.473000	0.25878	0.001000	0.08648	0.031000	0.12232	0.969000	0.29370	-0.025000	0.13918	-0.439000	0.05793	GTG	-	SFMBT2	-	superfamily_ARM-type_fold		0.632	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	0	0		70	70		0.00		C	NM_001029880		7214483	-1	8		37		tier1	no_errors	ENST00000361972	ensembl	human	known	74_37	missense	17.78		SNP	0.289	T	8	37
SLIT2	9353	genome.wustl.edu	37	4	20525452	20525452	+	Silent	SNP	T	T	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr4:20525452T>C	ENST00000504154.1	+	13	1452	c.1200T>C	c.(1198-1200)ctT>ctC	p.L400L	SLIT2_ENST00000503837.1_Silent_p.L404L|SLIT2_ENST00000273739.5_Silent_p.L404L|SLIT2_ENST00000503823.1_Silent_p.L400L	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	400					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ACTTGAACCTTCTCTCCCTAT	0.393													ENSG00000145147																																					0													170.0	160.0	164.0					4																	20525452		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1200T>C	4.37:g.20525452T>C			B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.L400	ENST00000504154.1	37	c.1200	CCDS3426.1	4																																																																																			-	SLIT2	-	smart_Leu-rich_rpt_typical-subtyp		0.393	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	0	0		57	57		0.00		T			20525452	+1	5		39		tier1	no_errors	ENST00000504154	ensembl	human	known	74_37	silent	11.36		SNP	0.992	C	5	39
RP11-79P5.3	0	genome.wustl.edu	37	5	72706300	72706300	+	RNA	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr5:72706300C>T	ENST00000505955.1	+	0	845																											GGTGACTGTACAGTTTGAAAT	0.363													ENSG00000249149																																					0																																												0			-																													5.37:g.72706300C>T				R	SNP	-	NULL	ENST00000505955.1	37	NULL		5																																																																																			-	RP11-79P5.3	-	-		0.363	RP11-79P5.3-002	KNOWN	basic	processed_transcript	ENSG00000249149	Clone_based_vega_gene	pseudogene	OTTHUMT00000471005.1	0	0		20	20		0.00		C			72706300	+1	11		4		tier1	no_errors	ENST00000505955	ensembl	human	known	74_37	rna	73.33		SNP	1.000	T	11	4
SHROOM3	57619	genome.wustl.edu	37	4	77662897	77662897	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr4:77662897G>A	ENST00000296043.6	+	5	4524	c.3571G>A	c.(3571-3573)Gga>Aga	p.G1191R		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1191					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCTGCTTAGCGGAGCAAACGG	0.697													ENSG00000138771																																					0													5.0	5.0	5.0					4																	77662897		2123	4134	6257	SO:0001583	missense	0			-	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.3571G>A	4.37:g.77662897G>A	ENSP00000296043:p.Gly1191Arg		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G1191R	ENST00000296043.6	37	c.3571	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	G	9.971	1.225606	0.22542	.	.	ENSG00000138771	ENST00000296043	T	0.20332	2.08	4.82	3.91	0.45181	.	1.135820	0.06690	N	0.769498	T	0.28433	0.0703	M	0.71581	2.175	0.09310	N	1	D;D;D	0.64830	0.994;0.994;0.994	B;P;B	0.46543	0.419;0.52;0.419	T	0.10800	-1.0614	10	0.11794	T	0.64	-5.2102	9.5112	0.39078	0.0:0.0:0.7897:0.2103	.	1015;1191;969	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	R	1191	ENSP00000296043:G1191R	ENSP00000296043:G1191R	G	+	1	0	SHROOM3	77881921	0.689000	0.27690	0.027000	0.17364	0.010000	0.07245	1.180000	0.32005	2.211000	0.71520	0.561000	0.74099	GGA	-	SHROOM3	-	NULL		0.697	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	0	0		14	14		0.00		G	NM_020859		77662897	+1	7		19		tier1	no_errors	ENST00000296043	ensembl	human	known	74_37	missense	26.92		SNP	0.002	A	7	19
CAPN13	92291	genome.wustl.edu	37	2	31000431	31000431	+	Splice_Site	SNP	A	A	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr2:31000431A>T	ENST00000295055.8	-	3	448		c.e3+1		CAPN13_ENST00000534090.2_Splice_Site|CAPN13_ENST00000465960.2_Splice_Site	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13						proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TTGCACTCTTACCTGCGCCTC	0.522													ENSG00000162949																																					0													66.0	67.0	67.0					2																	31000431		1964	4153	6117	SO:0001630	splice_region_variant	0			-		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.271+1T>A	2.37:g.31000431A>T			Q17RF0|Q580X1|Q8TE80	Splice_Site	SNP	-	e2+2	ENST00000295055.8	37	c.271+2	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	A	12.51	1.959973	0.34565	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1833	0.59668	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CAPN13	30853935	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	6.620000	0.74224	2.064000	0.61679	0.533000	0.62120	.	-	CAPN13	-	-		0.522	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	HGNC	protein_coding	OTTHUMT00000325101.2	0	0		61	61		0.00		A	NM_144575	Intron	31000431	-1	8		40		tier1	no_errors	ENST00000295055	ensembl	human	known	74_37	splice_site	16.67		SNP	1.000	T	8	40
CEP89	84902	genome.wustl.edu	37	19	33392250	33392250	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:33392250A>G	ENST00000305768.5	-	15	1722	c.1634T>C	c.(1633-1635)cTg>cCg	p.L545P		NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	545					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						CTGCGCTTGCAGGACTGTCAG	0.453													ENSG00000121289																																					0													202.0	191.0	195.0					19																	33392250		2203	4300	6503	SO:0001583	missense	0			-	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.1634T>C	19.37:g.33392250A>G	ENSP00000306105:p.Leu545Pro		B9EGA6|Q8N5J8	Missense_Mutation	SNP	NULL	p.L545P	ENST00000305768.5	37	c.1634	CCDS32987.1	19	.	.	.	.	.	.	.	.	.	.	A	14.22	2.471464	0.43942	.	.	ENSG00000121289	ENST00000305768	D	0.89875	-2.58	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.94195	0.8137	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94174	0.7426	10	0.46703	T	0.11	-10.7695	14.9292	0.70903	1.0:0.0:0.0:0.0	.	545	Q96ST8	CEP89_HUMAN	P	545	ENSP00000306105:L545P	ENSP00000306105:L545P	L	-	2	0	CEP89	38084090	0.997000	0.39634	0.856000	0.33681	0.042000	0.13812	4.962000	0.63687	2.059000	0.61396	0.528000	0.53228	CTG	-	CEP89	-	NULL		0.453	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	0	0		42	42		0.00		A	NM_032816		33392250	-1	4		37		tier1	no_errors	ENST00000305768	ensembl	human	known	74_37	missense	9.76		SNP	0.997	G	4	37
ZDHHC1	29800	genome.wustl.edu	37	16	67428948	67428948	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr16:67428948G>T	ENST00000348579.2	-	10	1528	c.1187C>A	c.(1186-1188)gCg>gAg	p.A396E	ZDHHC1_ENST00000566075.1_5'UTR|TPPP3_ENST00000562206.1_5'Flank|TPPP3_ENST00000290942.5_5'Flank|TPPP3_ENST00000393957.2_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	396					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		CTTTATACACGCGCCTCTTCC	0.617													ENSG00000159714																																					0													22.0	27.0	25.0					16																	67428948		2197	4300	6497	SO:0001583	missense	0			-	U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.1187C>A	16.37:g.67428948G>T	ENSP00000340299:p.Ala396Glu		O15461	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.A396E	ENST00000348579.2	37	c.1187	CCDS10836.1	16	.	.	.	.	.	.	.	.	.	.	G	14.15	2.450246	0.43531	.	.	ENSG00000159714	ENST00000348579	T	0.43294	0.95	3.9	-4.21	0.03812	.	3.630500	0.01214	U	0.007919	T	0.22551	0.0544	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.16041	-1.0416	10	0.59425	D	0.04	.	1.0536	0.01585	0.192:0.1374:0.2275:0.4431	.	396	Q8WTX9	ZDHC1_HUMAN	E	396	ENSP00000340299:A396E	ENSP00000340299:A396E	A	-	2	0	ZDHHC1	65986449	0.000000	0.05858	0.030000	0.17652	0.006000	0.05464	-1.069000	0.03444	-0.492000	0.06687	-0.264000	0.10439	GCG	-	ZDHHC1	-	NULL		0.617	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC1	HGNC	protein_coding	OTTHUMT00000268845.1	0	0		33	33		0.00		G	NM_013304		67428948	-1	4		30		tier1	no_errors	ENST00000348579	ensembl	human	known	74_37	missense	11.76		SNP	0.002	T	4	30
FBN3	84467	genome.wustl.edu	37	19	8131121	8131121	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:8131121G>A	ENST00000600128.1	-	64	8526	c.8112C>T	c.(8110-8112)tcC>tcT	p.S2704S	FBN3_ENST00000601739.1_Silent_p.S2704S|FBN3_ENST00000270509.2_Silent_p.S2704S			Q75N90	FBN3_HUMAN	fibrillin 3	2704						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GCAGGGCCTCGGAGTCAAGGG	0.662													ENSG00000142449																																					0																																										SO:0001819	synonymous_variant	0			-		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.8112C>T	19.37:g.8131121G>A			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.S2704	ENST00000600128.1	37	c.8112	CCDS12196.1	19																																																																																			-	FBN3	-	pirsf_FBN		0.662	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	0	0		76	76		0.00		G	NM_032447		8131121	-1	7		47		tier1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	12.96		SNP	0.000	A	7	47
INCENP	3619	genome.wustl.edu	37	11	61897827	61897827	+	Silent	SNP	A	A	G			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:61897827A>G	ENST00000394818.3	+	4	1030	c.828A>G	c.(826-828)ccA>ccG	p.P276P	INCENP_ENST00000278849.4_Silent_p.P276P	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	276					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CAGATTCTCCATGGCGGGAGC	0.672													ENSG00000149503																																					0													60.0	63.0	62.0					11																	61897827		2202	4299	6501	SO:0001819	synonymous_variant	0			-	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.828A>G	11.37:g.61897827A>G			A8MQD2|Q5Y192	Silent	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.P276	ENST00000394818.3	37	c.828	CCDS44624.1	11																																																																																			-	INCENP	-	NULL		0.672	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	HGNC	protein_coding	OTTHUMT00000394723.2	0	0		62	62		0.00		A	NM_020238		61897827	+1	24		44		tier1	no_errors	ENST00000394818	ensembl	human	known	74_37	silent	35.29		SNP	0.003	G	24	44
AGAP2	116986	genome.wustl.edu	37	12	58123509	58123509	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:58123509G>A	ENST00000547588.1	-	13	2469	c.2470C>T	c.(2470-2472)Ccc>Tcc	p.P824S	AGAP2_ENST00000257897.3_Missense_Mutation_p.P488S	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	824	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						GAAGGAGGGGGTTCCCGACTC	0.562													ENSG00000135439																																					0													132.0	140.0	137.0					12																	58123509		2203	4300	6503	SO:0001583	missense	0			-	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2470C>T	12.37:g.58123509G>A	ENSP00000449241:p.Pro824Ser		A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.P824S	ENST00000547588.1	37	c.2470	CCDS44932.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.67|14.67	2.605950|2.605950	0.46527|0.46527	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000257897;ENST00000547588|ENST00000328568	T;T|.	0.32753|.	1.52;1.44|.	4.39|4.39	4.39|4.39	0.52855|0.52855	Pleckstrin homology domain (3);|.	0.612188|.	0.16176|.	N|.	0.226080|.	T|T	0.59959|0.59959	0.2232|0.2232	L|L	0.39898|0.39898	1.24|1.24	0.43988|0.43988	D|D	0.996686|0.996686	B;B;B|.	0.31680|.	0.335;0.037;0.256|.	B;B;B|.	0.33960|.	0.084;0.032;0.173|.	T|T	0.56529|0.56529	-0.7964|-0.7964	10|5	0.51188|.	T|.	0.08|.	.|.	16.2564|16.2564	0.82519|0.82519	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	488;824;824|.	Q99490-2;F8VVT9;Q99490|.	.;.;AGAP2_HUMAN|.	S|I	488;824|687	ENSP00000257897:P488S;ENSP00000449241:P824S|.	ENSP00000257897:P488S|.	P|T	-|-	1|2	0|0	AGAP2|AGAP2	56409776|56409776	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	7.464000|7.464000	0.80887|0.80887	2.444000|2.444000	0.82710|0.82710	0.462000|0.462000	0.41574|0.41574	CCC|ACC	-	AGAP2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.562	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	HGNC	protein_coding	OTTHUMT00000408367.1	0	0		47	47		0.00		G	NM_014770		58123509	-1	7		48		tier1	no_errors	ENST00000547588	ensembl	human	known	74_37	missense	12.73		SNP	1.000	A	7	48
CHD9	80205	genome.wustl.edu	37	16	53321893	53321893	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr16:53321893A>C	ENST00000398510.3	+	26	5301	c.5214A>C	c.(5212-5214)aaA>aaC	p.K1738N	CHD9_ENST00000564845.1_Missense_Mutation_p.K1738N|CHD9_ENST00000447540.1_Missense_Mutation_p.K1738N|CHD9_ENST00000566029.1_Missense_Mutation_p.K1738N			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1738					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CAGAATACAAACCTGCCCCAG	0.333													ENSG00000177200																																					0													109.0	106.0	107.0					16																	53321893		1822	4082	5904	SO:0001583	missense	0			-	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.5214A>C	16.37:g.53321893A>C	ENSP00000381522:p.Lys1738Asn		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K1738N	ENST00000398510.3	37	c.5214		16	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055454	0.75960	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D;D	0.90324	-2.65;-2.65	5.73	2.29	0.28610	.	0.099352	0.43579	D	0.000550	D	0.92202	0.7527	M	0.71206	2.165	0.52099	D	0.999945	D;P;P;D	0.56035	0.974;0.928;0.931;0.959	P;P;P;P	0.57846	0.638;0.828;0.522;0.714	D	0.89307	0.3630	10	0.45353	T	0.12	-16.0465	8.9999	0.36074	0.7186:0.0:0.2814:0.0	.	106;1738;1738;1738	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	N	1738;1738;106	ENSP00000396345:K1738N;ENSP00000381522:K1738N	ENSP00000381522:K1738N	K	+	3	2	CHD9	51879394	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.517000	0.35867	0.127000	0.18452	0.533000	0.62120	AAA	-	CHD9	-	NULL		0.333	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	0	0		43	43		0.00		A	NM_025134		53321893	+1	22		11		tier1	no_errors	ENST00000398510	ensembl	human	known	74_37	missense	66.67		SNP	1.000	C	22	11
UNC5B	219699	genome.wustl.edu	37	10	73044578	73044578	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:73044578G>A	ENST00000335350.6	+	3	822	c.406G>A	c.(406-408)Gcg>Acg	p.A136T	UNC5B_ENST00000373192.4_Missense_Mutation_p.A136T	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	136	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						CTGGAGCTCCGCGGGCACCAC	0.672													ENSG00000107731																																					0													80.0	75.0	77.0					10																	73044578		2203	4300	6503	SO:0001583	missense	0			-	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.406G>A	10.37:g.73044578G>A	ENSP00000334329:p.Ala136Thr		Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Death_domain,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.A136T	ENST00000335350.6	37	c.406	CCDS7309.1	10	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402100	0.83230	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.23552	1.9;1.9	4.82	2.83	0.33086	Immunoglobulin-like fold (1);	0.170003	0.51477	D	0.000085	T	0.25827	0.0629	L	0.46741	1.465	0.58432	D	0.999998	D;P	0.54964	0.969;0.948	P;B	0.46320	0.512;0.434	T	0.01688	-1.1295	10	0.21540	T	0.41	-12.1871	13.0513	0.58957	0.0:0.0:0.6997:0.3003	.	136;136	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	T	136	ENSP00000334329:A136T;ENSP00000362288:A136T	ENSP00000334329:A136T	A	+	1	0	UNC5B	72714584	1.000000	0.71417	0.184000	0.23157	0.899000	0.52679	5.639000	0.67868	0.359000	0.24239	0.555000	0.69702	GCG	-	UNC5B	-	smart_Ig_sub		0.672	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5B	HGNC	protein_coding	OTTHUMT00000048541.1	0	0		25	25		0.00		G	NM_170744		73044578	+1	5		12		tier1	no_errors	ENST00000335350	ensembl	human	known	74_37	missense	29.41		SNP	0.987	A	5	12
TSC2	7249	genome.wustl.edu	37	16	2136285	2136285	+	Missense_Mutation	SNP	A	A	T	rs137854039		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr16:2136285A>T	ENST00000219476.3	+	37	5384	c.4754A>T	c.(4753-4755)aAg>aTg	p.K1585M	TSC2_ENST00000401874.2_Missense_Mutation_p.K1518M|TSC2_ENST00000568454.1_Missense_Mutation_p.K1529M|TSC2_ENST00000439673.2_Missense_Mutation_p.K1482M|TSC2_ENST00000350773.4_Missense_Mutation_p.K1562M|TSC2_ENST00000382538.6_Missense_Mutation_p.K1470M|TSC2_ENST00000353929.4_Missense_Mutation_p.K1542M	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1585	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				ATCGAGCTGAAGGACTGCCAG	0.612			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				ENSG00000103197																											yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													117.0	95.0	102.0					16																	2136285		2198	4299	6497	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	-	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4754A>T	16.37:g.2136285A>T	ENSP00000219476:p.Lys1585Met		A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	pfam_Tuberin-type_domain,pfam_Tuberin_N,pfam_Rap_GAP_dom,superfamily_ARM-type_fold,pfscan_Rap_GAP_dom,prints_Tuberin	p.K1585M	ENST00000219476.3	37	c.4754	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	A	19.05	3.751650	0.69533	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82	4.47	4.47	0.54385	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	M	0.80616	2.505	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.995;0.999;0.999;0.999	D	0.98169	1.0451	10	0.87932	D	0	-37.8633	13.9283	0.63978	1.0:0.0:0.0:0.0	.	1470;1482;1562;360;1541;1518;1585	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	M	1585;1519;1542;1482;1470;1562	ENSP00000219476:K1585M;ENSP00000248099:K1542M;ENSP00000399232:K1482M;ENSP00000371978:K1470M;ENSP00000344383:K1562M	ENSP00000219476:K1585M	K	+	2	0	TSC2	2076286	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	6.121000	0.71602	1.881000	0.54492	0.459000	0.35465	AAG	-	TSC2	-	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom		0.612	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	0	0		48	48		0.00		A	NM_000548		2136285	+1	4		43		tier1	no_errors	ENST00000219476	ensembl	human	known	74_37	missense	8.51		SNP	1.000	T	4	43
PATZ1	23598	genome.wustl.edu	37	22	31723052	31723052	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr22:31723052C>T	ENST00000266269.5	-	5	2518	c.1889G>A	c.(1888-1890)cGg>cAg	p.R630Q	PATZ1_ENST00000405309.3_3'UTR|PATZ1_ENST00000351933.4_Missense_Mutation_p.R584Q|RP3-400N23.6_ENST00000440456.1_RNA	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	630					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						CCCGAGAGCCCGGACATGCAC	0.562													ENSG00000100105																																					0													97.0	103.0	101.0					22																	31723052		2203	4300	6503	SO:0001583	missense	0			-	AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1889G>A	22.37:g.31723052C>T	ENSP00000266269:p.Arg630Gln		Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R630Q	ENST00000266269.5	37	c.1889	CCDS13894.1	22	.	.	.	.	.	.	.	.	.	.	C	22.4	4.289713	0.80914	.	.	ENSG00000100105	ENST00000266269;ENST00000351933	T;T	0.09073	3.02;3.06	5.58	5.58	0.84498	.	0.182069	0.37393	N	0.002113	T	0.06280	0.0162	N	0.14661	0.345	0.80722	D	1	B;P	0.51351	0.248;0.944	B;B	0.36808	0.007;0.233	T	0.30268	-0.9984	10	0.72032	D	0.01	-11.1428	18.555	0.91080	0.0:1.0:0.0:0.0	.	584;630	Q9HBE1-3;Q9HBE1	.;PATZ1_HUMAN	Q	630;584	ENSP00000266269:R630Q;ENSP00000337520:R584Q	ENSP00000266269:R630Q	R	-	2	0	PATZ1	30053052	0.997000	0.39634	1.000000	0.80357	0.991000	0.79684	2.251000	0.43187	2.616000	0.88540	0.650000	0.86243	CGG	-	PATZ1	-	NULL		0.562	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATZ1	HGNC	protein_coding	OTTHUMT00000321932.1	0	0		50	50		0.00		C	NM_032052		31723052	-1	5		43		tier1	no_errors	ENST00000266269	ensembl	human	known	74_37	missense	10.42		SNP	1.000	T	5	43
LGI1	9211	genome.wustl.edu	37	10	95537148	95537148	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:95537148G>A	ENST00000371418.4	+	3	560	c.300G>A	c.(298-300)tcG>tcA	p.S100S	LGI1_ENST00000371413.3_Silent_p.S100S|LGI1_ENST00000542308.1_Intron	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	100					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				TATTCACATCGAACTCCTTTG	0.358													ENSG00000108231																																					0													116.0	106.0	109.0					10																	95537148		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.300G>A	10.37:g.95537148G>A			A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Silent	SNP	pfam_EPTP,pfam_Leu-rich_rpt,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.S100	ENST00000371418.4	37	c.300	CCDS7431.1	10																																																																																			-	LGI1	-	smart_Leu-rich_rpt_typical-subtyp		0.358	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI1	HGNC	protein_coding	OTTHUMT00000049445.1	0	0		45	45		0.00		G	NM_005097		95537148	+1	5		49		tier1	no_errors	ENST00000371418	ensembl	human	known	74_37	silent	9.26		SNP	0.995	A	5	49
CAP1	10487	genome.wustl.edu	37	1	40535300	40535300	+	Intron	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:40535300G>A	ENST00000372797.3	+	9	1369				CAP1_ENST00000372798.1_Intron|CAP1_ENST00000479759.1_Intron|CAP1_ENST00000340450.3_Intron|CAP1_ENST00000372805.3_Intron|CAP1_ENST00000372802.1_Intron|CAP1_ENST00000372792.2_Intron	NM_001105530.1|NM_006367.3	NP_001099000|NP_006358	Q13114	TRAF3_HUMAN	CAP, adenylate cyclase-associated protein 1 (yeast)						apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12	Lung NSC(20;5.03e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;4.63e-18)|Epithelial(16;1.27e-16)|all cancers(16;2.3e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTTTAACATGACGATAGCAG	0.393													ENSG00000131236																																					0																																										SO:0001627	intron_variant	0			-	L12168	CCDS41309.1	1p34.3	2010-07-13			ENSG00000131236	ENSG00000131236			20040	protein-coding gene	gene with protein product						1406678, 8761950	Standard	NM_006367		Approved	CAP	uc001cey.4	Q01518	OTTHUMG00000004493	ENST00000372797.3:c.809-62G>A	1.37:g.40535300G>A			B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	R	SNP	-	NULL	ENST00000372797.3	37	NULL	CCDS41309.1	1																																																																																			-	CAP1	-	-		0.393	CAP1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CAP1	HGNC	protein_coding	OTTHUMT00000013109.1	0	0		57	57		0.00		G	NM_006367		40535300	+1	6		54		tier1	no_errors	ENST00000461993	ensembl	human	known	74_37	rna	10.00		SNP	0.000	A	6	54
DPY19L2	283417	genome.wustl.edu	37	12	63974526	63974526	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:63974526G>A	ENST00000324472.4	-	19	1999	c.1816C>T	c.(1816-1818)Cgt>Tgt	p.R606C	DPY19L2_ENST00000413230.2_Missense_Mutation_p.R53C	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	606					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		CATTGATTACGGAGGTTTGCA	0.383													ENSG00000177990																																					0													74.0	72.0	73.0					12																	63974526		2203	4300	6503	SO:0001583	missense	0			-		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.1816C>T	12.37:g.63974526G>A	ENSP00000315988:p.Arg606Cys		A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	pfam_Dpy-19	p.R606C	ENST00000324472.4	37	c.1816	CCDS31851.1	12	.	.	.	.	.	.	.	.	.	.	G	12.06	1.825002	0.32237	.	.	ENSG00000177990	ENST00000324472;ENST00000413230	T;T	0.57907	0.37;0.37	3.49	3.49	0.39957	.	0.292617	0.38897	N	0.001523	T	0.40791	0.1131	L	0.38175	1.15	0.42137	D	0.991494	B	0.16603	0.018	B	0.18561	0.022	T	0.27502	-1.0072	9	.	.	.	.	12.8541	0.57876	0.0:0.0:1.0:0.0	.	606	Q6NUT2	D19L2_HUMAN	C	606;53	ENSP00000315988:R606C;ENSP00000439794:R53C	.	R	-	1	0	DPY19L2	62260793	1.000000	0.71417	0.934000	0.37439	0.516000	0.34256	6.378000	0.73150	1.920000	0.55613	0.305000	0.20034	CGT	-	DPY19L2	-	pfam_Dpy-19		0.383	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	HGNC	protein_coding	OTTHUMT00000400689.2	0	0		78	78		0.00		G	NM_173812		63974526	-1	17		81		tier1	no_errors	ENST00000324472	ensembl	human	known	74_37	missense	17.35		SNP	1.000	A	17	81
WRNIP1	56897	genome.wustl.edu	37	6	2770457	2770457	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr6:2770457G>T	ENST00000380773.4	+	3	1327	c.1118G>T	c.(1117-1119)cGa>cTa	p.R373L	WRNIP1_ENST00000380764.1_5'UTR|WRNIP1_ENST00000380769.4_Missense_Mutation_p.R153L|WRNIP1_ENST00000380771.4_Missense_Mutation_p.R348L	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1											breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				AGCCGCTGTCGAGTGATTGTT	0.517													ENSG00000124535																																					0													141.0	123.0	129.0					6																	2770457		2203	4300	6503	SO:0001583	missense	0			-	AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.1118G>T	6.37:g.2770457G>T	ENSP00000370150:p.Arg373Leu			Missense_Mutation	SNP	pfam_MgsA_C,pfam_ATPase_AAA_core,pfam_D_helicase_Holl-junc_RuvB_N,pfam_ATPase_dyneun-rel_AAA,pfam_DUF815,pfam_IstB_ATP-bd,pfam_ATPase_AAA-2,superfamily_P-loop_NTPase,smart_Znf_Rad18_put,smart_AAA+_ATPase	p.R373L	ENST00000380773.4	37	c.1118	CCDS4475.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.790955	0.96945	.	.	ENSG00000124535	ENST00000380773;ENST00000380771;ENST00000380769	D;T;D	0.92805	-3.11;1.02;-3.11	6.06	6.06	0.98353	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.049773	0.85682	D	0.000000	D	0.93743	0.8000	L	0.48174	1.505	0.80722	D	1	D;P	0.63046	0.992;0.903	D;P	0.63033	0.91;0.836	D	0.93764	0.7069	10	0.87932	D	0	-17.4618	19.6125	0.95613	0.0:0.0:1.0:0.0	.	348;373	Q96S55-2;Q96S55	.;WRIP1_HUMAN	L	373;348;153	ENSP00000370150:R373L;ENSP00000370148:R348L;ENSP00000370146:R153L	ENSP00000370146:R153L	R	+	2	0	WRNIP1	2715456	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.794000	0.85869	2.879000	0.98667	0.650000	0.86243	CGA	-	WRNIP1	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.517	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRNIP1	HGNC	protein_coding	OTTHUMT00000039641.1	0	0		57	57		0.00		G	NM_130395		2770457	+1	4		25		tier1	no_errors	ENST00000380773	ensembl	human	known	74_37	missense	13.79		SNP	1.000	T	4	25
KCNT2	343450	genome.wustl.edu	37	1	196309693	196309693	+	Missense_Mutation	SNP	C	C	T	rs200217178		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:196309693C>T	ENST00000294725.9	-	16	2476	c.1561G>A	c.(1561-1563)Gtc>Atc	p.V521I	KCNT2_ENST00000367433.5_Missense_Mutation_p.V521I|KCNT2_ENST00000609185.1_Missense_Mutation_p.V471I|KCNT2_ENST00000451324.2_Missense_Mutation_p.V132I|KCNT2_ENST00000367431.4_Missense_Mutation_p.V471I|KCNT2_ENST00000498426.1_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	521	RCK N-terminal.				potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						ATCAAGCAGACGCCAAACCTT	0.294													ENSG00000162687																																					0								C	ILE/VAL	1,4399	2.1+/-5.4	0,1,2199	39.0	40.0	40.0		1561	5.9	1.0	1		40	0,8596		0,0,4298	yes	missense	KCNT2	NM_198503.2	29	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	benign	521/1136	196309693	1,12995	2200	4298	6498	SO:0001583	missense	0			-	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1561G>A	1.37:g.196309693C>T	ENSP00000294725:p.Val521Ile		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.V521I	ENST00000294725.9	37	c.1561	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.210989	0.58343	2.27E-4	0.0	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000451324;ENST00000294725	T;T;T;T	0.48201	0.82;1.6;0.82;0.82	5.95	5.95	0.96441	Potassium channel, calcium-activated, BK, alpha subunit (1);	0.000000	0.56097	D	0.000022	T	0.52141	0.1716	L	0.45581	1.43	0.80722	D	1	P;B;P;P;P	0.47106	0.89;0.347;0.752;0.531;0.89	P;B;B;B;P	0.48524	0.58;0.107;0.147;0.131;0.58	T	0.29761	-1.0001	10	0.20046	T	0.44	-18.9426	20.3812	0.98933	0.0:1.0:0.0:0.0	.	521;503;521;471;521	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	I	521;471;342;132;521	ENSP00000356403:V521I;ENSP00000356401:V471I;ENSP00000405474:V132I;ENSP00000294725:V521I	ENSP00000294725:V521I	V	-	1	0	KCNT2	194576316	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.773000	0.85462	2.821000	0.97095	0.650000	0.86243	GTC	rs200217178	KCNT2	-	pfam_K_chnl_Ca-activ_BK_asu		0.294	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	0	0		33	33		0.00		C	NM_198503		196309693	-1	7		19		tier1	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	26.92		SNP	1.000	T	7	19
ITGA3	3675	genome.wustl.edu	37	17	48154746	48154746	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:48154746delG	ENST00000320031.8	+	16	2404	c.2074delG	c.(2074-2076)gggfs	p.G692fs	ITGA3_ENST00000007722.7_Frame_Shift_Del_p.G692fs	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	692					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TCCTCAGCCCGGGGCCTGCCA	0.592													ENSG00000005884																																					0													97.0	90.0	92.0					17																	48154746		2203	4300	6503	SO:0001589	frameshift_variant	0				M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.2074delG	17.37:g.48154746delG	ENSP00000315190:p.Gly692fs		A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Frame_Shift_Del	DEL	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.A693fs	ENST00000320031.8	37	c.2074	CCDS11558.1	17																																																																																				ITGA3	-	pfam_Integrin_alpha-2		0.592	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA3	HGNC	protein_coding	OTTHUMT00000366298.1	0	0		49	49		0.00		G	NM_005501		48154746	+1	3		26		tier1	no_errors	ENST00000320031	ensembl	human	known	74_37	frame_shift_del	10.34		DEL	0.455	-	3	26
DPH1	1801	genome.wustl.edu	37	17	1933486	1933486	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:1933486G>T	ENST00000263083.6	+	1	83	c.38G>T	c.(37-39)gGg>gTg	p.G13V		NM_001383.3	NP_001374.3	Q9BZG8	DPH1_HUMAN	diphthamide biosynthesis 1	13					cell proliferation (GO:0008283)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	17						GTCGTATCCGGGGCAGCGGAG	0.672													ENSG00000108963																																					0													11.0	15.0	14.0					17																	1933486		2003	4156	6159	SO:0001583	missense	0			-	S81752	CCDS42228.1	17p13.3	2013-05-02	2013-05-02	2005-06-03	ENSG00000108963	ENSG00000108963			3003	protein-coding gene	gene with protein product	"""ovarian tumor suppressor candidate 1"""	603527	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 1 (S. cerevisiae)"", ""DPH-like 1 (S. cerevisiae)"", ""DPH1 homolog (S. cerevisiae)"""	DPH2L, DPH2L1		8603384, 15485916, 22869748	Standard	NM_001383		Approved	OVCA1	uc002fts.3	Q9BZG8	OTTHUMG00000177724	ENST00000263083.6:c.38G>T	17.37:g.1933486G>T	ENSP00000263083:p.Gly13Val		D3DTI3|Q16439|Q4VBA2|Q9BTW7|Q9UCY0	Missense_Mutation	SNP	pfam_DPH1/DPH2,pirsf_DPH1_eu/DPH2_arc,tigrfam_DPH1/DPH2	p.G13V	ENST00000263083.6	37	c.38	CCDS42228.1	17	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462133	0.26248	.	.	ENSG00000108963	ENST00000263083	T	0.30182	1.54	4.71	-1.72	0.08107	.	0.282812	0.33534	N	0.004804	T	0.10208	0.0250	N	0.08118	0	0.19945	N	0.999946	B	0.02656	0.0	B	0.01281	0.0	T	0.10222	-1.0639	10	0.30854	T	0.27	.	0.9167	0.01306	0.347:0.3132:0.1879:0.1519	.	13	Q9BZG8	DPH1_HUMAN	V	13	ENSP00000263083:G13V	ENSP00000263083:G13V	G	+	2	0	DPH1	1880236	0.024000	0.19004	0.000000	0.03702	0.945000	0.59286	0.141000	0.16076	-0.446000	0.07149	-0.312000	0.09012	GGG	-	DPH1	-	NULL		0.672	DPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPH1	HGNC	protein_coding	OTTHUMT00000438660.1	0	0		32	32		0.00		G	NM_001383		1933486	+1	4		35		tier1	no_errors	ENST00000263083	ensembl	human	known	74_37	missense	10.26		SNP	0.001	T	4	35
CFAP61	26074	genome.wustl.edu	37	20	20258030	20258030	+	Silent	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr20:20258030C>T	ENST00000245957.5	+	22	2800	c.2724C>T	c.(2722-2724)gaC>gaT	p.D908D	C20orf26_ENST00000377309.2_Silent_p.D264D	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		908										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		AGTGGAATGACGGCCTGCACC	0.612													ENSG00000089101																																					0													125.0	112.0	116.0					20																	20258030		2203	4300	6503	SO:0001819	synonymous_variant	0			-																												ENST00000245957.5:c.2724C>T	20.37:g.20258030C>T			A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	superfamily_Acyl_CoA_acyltransferase	p.D908	ENST00000245957.5	37	c.2724	CCDS33447.1	20																																																																																			-	C20orf26	-	NULL		0.612	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	0	0		44	44		0.00		C			20258030	+1	7		76		tier1	no_errors	ENST00000245957	ensembl	human	known	74_37	silent	8.43		SNP	0.000	T	7	76
FN3K	64122	genome.wustl.edu	37	17	80696429	80696429	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:80696429G>A	ENST00000300784.7	+	2	268	c.206G>A	c.(205-207)cGg>cAg	p.R69Q		NM_022158.3	NP_071441.1	Q9H479	FN3K_HUMAN	fructosamine 3 kinase	69					epithelial cell differentiation (GO:0030855)|fructoselysine metabolic process (GO:0030393)		fructosamine-3-kinase activity (GO:0030387)			central_nervous_system(1)|kidney(1)|lung(1)|urinary_tract(1)	4	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GGCCTGGTGCGGGTGCCGAGG	0.622													ENSG00000167363																									Melanoma(10;391 597 14592 32548 32749)												0													57.0	60.0	59.0					17																	80696429		2203	4299	6502	SO:0001583	missense	0			-	AJ404615	CCDS11818.1	17q25	2008-02-05				ENSG00000167363			24822	protein-coding gene	gene with protein product		608425				11522682, 14641062	Standard	NM_022158		Approved		uc010wvs.1	Q9H479		ENST00000300784.7:c.206G>A	17.37:g.80696429G>A	ENSP00000300784:p.Arg69Gln			Missense_Mutation	SNP	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase	p.R69Q	ENST00000300784.7	37	c.206	CCDS11818.1	17	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245919	0.39697	.	.	ENSG00000167363	ENST00000300784;ENST00000457624;ENST00000536165	T	0.52526	0.66	4.93	3.96	0.45880	Protein kinase-like domain (1);	0.060136	0.64402	D	0.000006	T	0.47116	0.1428	M	0.64080	1.96	0.33252	D	0.558701	P;P	0.52061	0.903;0.95	B;P	0.44921	0.41;0.464	T	0.62987	-0.6737	9	.	.	.	-18.2467	11.2551	0.49050	0.0911:0.0:0.9089:0.0	.	69;24	Q9H479;B3KNR9	FN3K_HUMAN;.	Q	69;69;24	ENSP00000300784:R69Q	.	R	+	2	0	FN3K	78289718	0.175000	0.23083	0.019000	0.16419	0.072000	0.16883	2.304000	0.43655	1.207000	0.43291	0.585000	0.79938	CGG	-	FN3K	-	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase		0.622	FN3K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FN3K	HGNC	protein_coding	OTTHUMT00000439229.1	0	0		39	39		0.00		G	NM_022158		80696429	+1	9		25		tier1	no_errors	ENST00000300784	ensembl	human	known	74_37	missense	26.47		SNP	0.840	A	9	25
PPM1B	5495	genome.wustl.edu	37	2	44429142	44429142	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr2:44429142G>A	ENST00000282412.4	+	2	1216	c.804G>A	c.(802-804)ctG>ctA	p.L268L	PPM1B_ENST00000378551.2_Silent_p.L268L|PPM1B_ENST00000345249.4_Intron|PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000409895.4_Silent_p.L268L|PPM1B_ENST00000409432.3_Silent_p.L268L	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	268					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGATGACCTGGAAAATGTGT	0.353													ENSG00000138032																																					0													106.0	103.0	104.0					2																	44429142		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.804G>A	2.37:g.44429142G>A			Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Silent	SNP	pfam_PP2C-like_dom,pfam_PP2C_C,superfamily_PP2C-like_dom,superfamily_PP2C_C,smart_PP2C-like_dom	p.L268	ENST00000282412.4	37	c.804	CCDS1817.1	2																																																																																			-	PPM1B	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom		0.353	PPM1B-001	KNOWN	basic|CCDS	protein_coding	PPM1B	HGNC	protein_coding	OTTHUMT00000250672.1	0	0		32	32		0.00		G	NM_002706		44429142	+1	4		44		tier1	no_errors	ENST00000282412	ensembl	human	known	74_37	silent	8.33		SNP	1.000	A	4	44
POPDC2	64091	genome.wustl.edu	37	3	119367292	119367292	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr3:119367292G>T	ENST00000264231.3	-	3	990	c.824C>A	c.(823-825)gCt>gAt	p.A275D	POPDC2_ENST00000468801.1_Missense_Mutation_p.A275D|POPDC2_ENST00000493094.1_Missense_Mutation_p.A275D|POPDC2_ENST00000474523.1_5'UTR|POPDC2_ENST00000538678.1_Missense_Mutation_p.A275D	NM_022135.2	NP_071418.2	Q9HBU9	POPD2_HUMAN	popeye domain containing 2	275					regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sinoatrial node cell development (GO:0060931)	integral component of membrane (GO:0016021)	cAMP binding (GO:0030552)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.242)		AGCATCTGCAGCAGTGGGACC	0.567													ENSG00000121577																																					0													107.0	102.0	104.0					3																	119367292		2203	4300	6503	SO:0001583	missense	0			-	AF204173	CCDS2992.1	3q13.33	2004-01-15			ENSG00000121577	ENSG00000121577			17648	protein-coding gene	gene with protein product		605823				10882522	Standard	NM_022135		Approved	POP2	uc031sbc.1	Q9HBU9	OTTHUMG00000159438	ENST00000264231.3:c.824C>A	3.37:g.119367292G>T	ENSP00000264231:p.Ala275Asp		Q86UE7	Missense_Mutation	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.A275D	ENST00000264231.3	37	c.824	CCDS2992.1	3	.	.	.	.	.	.	.	.	.	.	G	9.849	1.193204	0.22037	.	.	ENSG00000121577	ENST00000264231;ENST00000493094;ENST00000468801;ENST00000538678	T;T;T;T	0.18338	2.24;2.24;2.22;2.22	5.08	4.15	0.48705	.	0.343284	0.31381	N	0.007741	T	0.19167	0.0460	M	0.61703	1.905	0.27696	N	0.945964	P;P	0.39782	0.688;0.611	B;B	0.42692	0.395;0.196	T	0.06752	-1.0809	10	0.11794	T	0.64	.	9.7889	0.40692	0.0:0.1385:0.6671:0.1945	.	275;275	Q9HBU9-2;Q9HBU9	.;POPD2_HUMAN	D	275	ENSP00000264231:A275D;ENSP00000417250:A275D;ENSP00000420715:A275D;ENSP00000438271:A275D	ENSP00000264231:A275D	A	-	2	0	POPDC2	120849982	0.998000	0.40836	0.006000	0.13384	0.147000	0.21601	6.903000	0.75703	1.184000	0.42957	0.561000	0.74099	GCT	-	POPDC2	-	NULL		0.567	POPDC2-002	KNOWN	basic|CCDS	protein_coding	POPDC2	HGNC	protein_coding	OTTHUMT00000355378.1	0	0		28	28		0.00		G	NM_022135		119367292	-1	4		31		tier1	no_errors	ENST00000341124	ensembl	human	known	74_37	missense	11.43		SNP	0.714	T	4	31
RAI1	10743	genome.wustl.edu	37	17	17697094	17697096	+	In_Frame_Del	DEL	CAG	CAG	-	rs113303801|rs398124422|rs371983878|rs571229335|rs587780431	byFrequency	TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:17697094_17697096delCAG	ENST00000353383.1	+	3	1301_1303	c.832_834delCAG	c.(832-834)cagdel	p.Q291del	RAI1_ENST00000261641.6_In_Frame_Del_p.Q291del	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	291	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CAGCTATGACcagcagcagcagc	0.64													ENSG00000108557																																					0																																										SO:0001651	inframe_deletion	0				AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.832_834delCAG	17.37:g.17697103_17697105delCAG	ENSP00000323074:p.Gln291del		Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	In_Frame_Del	DEL	smart_Znf_PHD	p.Q281in_frame_del	ENST00000353383.1	37	c.832_834	CCDS11188.1	17																																																																																				RAI1	-	NULL		0.640	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1	0	0		49	49		0.00		CAG	NM_030665		17697096	+1	5		45		tier1	no_errors	ENST00000353383	ensembl	human	known	74_37	in_frame_del	10.00		DEL	0.831:0.157:0.050	-	5	45
GEN1	348654	genome.wustl.edu	37	2	17941359	17941359	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr2:17941359A>T	ENST00000381254.2	+	2	363	c.149A>T	c.(148-150)aAg>aTg	p.K50M	GEN1_ENST00000317402.7_Missense_Mutation_p.K50M|SMC6_ENST00000402989.1_Intron	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	50	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AGCGTCATGAAGCCCCACCTC	0.398								Homologous recombination					ENSG00000178295																																					0													85.0	83.0	84.0					2																	17941359		2203	4300	6503	SO:0001583	missense	0			-	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.149A>T	2.37:g.17941359A>T	ENSP00000370653:p.Lys50Met		Q17RS9|Q6ZN37	Missense_Mutation	SNP	pfam_XPG-I_dom,pfam_XPG_D_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_D_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.K50M	ENST00000381254.2	37	c.149	CCDS1691.1	2	.	.	.	.	.	.	.	.	.	.	A	19.29	3.798717	0.70567	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000524465;ENST00000532257	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.48	4.31	0.51392	XPG N-terminal (2);	0.000000	0.64402	D	0.000001	T	0.76011	0.3928	M	0.70595	2.14	0.42547	D	0.993097	D	0.89917	1.0	D	0.83275	0.996	T	0.78976	-0.1991	10	0.87932	D	0	-22.858	11.6726	0.51411	0.9299:0.0:0.0701:0.0	.	50	Q17RS7	GEN_HUMAN	M	50	ENSP00000318977:K50M;ENSP00000370653:K50M;ENSP00000435143:K50M;ENSP00000433180:K50M	ENSP00000318977:K50M	K	+	2	0	GEN1	17804840	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	6.900000	0.75687	2.307000	0.77673	0.528000	0.53228	AAG	-	GEN1	-	pfam_XPG_D_repair_N,smart_XPG_D_repair_N		0.398	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GEN1	HGNC	protein_coding	OTTHUMT00000241661.2	0	0		79	79		0.00		A	NM_182625		17941359	+1	4		39		tier1	no_errors	ENST00000317402	ensembl	human	known	74_37	missense	9.30		SNP	1.000	T	4	39
KRTAP24-1	643803	genome.wustl.edu	37	21	31654516	31654516	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr21:31654516G>A	ENST00000340345.4	-	1	760	c.735C>T	c.(733-735)tgC>tgT	p.C245C		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	245	6 X 10 AA repeats of Y-[ILR]-[SVPC]- [NRTS]-[SNTG]-X-[QHRP]-[PSY]-[QSL]-[SRK].					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						TGCTACCACTGCACAAATACC	0.453													ENSG00000188694																																					0													89.0	86.0	87.0					21																	31654516		1840	4096	5936	SO:0001819	synonymous_variant	0			-	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.735C>T	21.37:g.31654516G>A			Q1XDX0	Silent	SNP	pfam_KRTAP_PMG	p.C245	ENST00000340345.4	37	c.735	CCDS42915.1	21																																																																																			-	KRTAP24-1	-	NULL		0.453	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP24-1	HGNC	protein_coding	OTTHUMT00000246806.2	0	0		37	37		0.00		G	NM_001085455		31654516	-1	4		41		tier1	no_errors	ENST00000340345	ensembl	human	known	74_37	silent	8.89		SNP	0.979	A	4	41
MFSD6L	162387	genome.wustl.edu	37	17	8701913	8701913	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:8701913C>T	ENST00000329805.4	-	1	754	c.526G>A	c.(526-528)Gtt>Att	p.V176I		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	176						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						GCTCCTTCAACGGAGGGCGCT	0.532													ENSG00000185156																																					0													122.0	113.0	116.0					17																	8701913		2203	4300	6503	SO:0001583	missense	0			-	AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.526G>A	17.37:g.8701913C>T	ENSP00000330051:p.Val176Ile		Q6YL34|Q8NA76	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.V176I	ENST00000329805.4	37	c.526	CCDS11146.1	17	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577926	0.28180	.	.	ENSG00000185156	ENST00000329805	T	0.44482	0.92	4.75	-4.98	0.03019	.	1.974330	0.03366	N	0.198280	T	0.31358	0.0794	M	0.63428	1.95	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.12760	-1.0535	10	0.12430	T	0.62	-13.3045	1.3981	0.02265	0.1323:0.2176:0.2364:0.4137	.	176	Q8IWD5	MFS6L_HUMAN	I	176	ENSP00000330051:V176I	ENSP00000330051:V176I	V	-	1	0	MFSD6L	8642638	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.043000	0.12043	-0.593000	0.05844	-0.175000	0.13238	GTT	-	MFSD6L	-	NULL		0.532	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6L	HGNC	protein_coding	OTTHUMT00000442554.1	0	0		56	56		0.00		C	NM_152599		8701913	-1	9		63		tier1	no_errors	ENST00000329805	ensembl	human	known	74_37	missense	12.50		SNP	0.000	T	9	63
PTPRU	10076	genome.wustl.edu	37	1	29641954	29641954	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:29641954G>A	ENST00000345512.3	+	24	3457	c.3328G>A	c.(3328-3330)Gtc>Atc	p.V1110I	PTPRU_ENST00000373779.3_Missense_Mutation_p.V1100I|PTPRU_ENST00000428026.2_Missense_Mutation_p.V1097I|PTPRU_ENST00000356870.3_Missense_Mutation_p.V1106I|PTPRU_ENST00000460170.2_Missense_Mutation_p.V1106I|PTPRU_ENST00000323874.8_Missense_Mutation_p.V1106I	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1110	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V1110I(1)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GTGTGAGGGCGTCGTGGACAT	0.592													ENSG00000060656																																					1	Substitution - Missense(1)	large_intestine(1)											132.0	120.0	124.0					1																	29641954		2203	4300	6503	SO:0001583	missense	0			-	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3328G>A	1.37:g.29641954G>A	ENSP00000334941:p.Val1110Ile		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.V1110I	ENST00000345512.3	37	c.3328	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.142054	0.94560	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	4.66	4.66	0.58398	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000001	D	0.85703	0.5758	L	0.31371	0.925	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.80764	0.989;0.989;0.989;0.994;0.994	D	0.84377	0.0547	9	.	.	.	.	17.0877	0.86615	0.0:0.0:1.0:0.0	.	1097;1106;1100;1106;1110	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	I	1110;1100;1106;1106;1097;1106	ENSP00000334941:V1110I;ENSP00000362884:V1100I;ENSP00000349333:V1106I;ENSP00000314987:V1106I;ENSP00000392332:V1097I;ENSP00000432906:V1106I	.	V	+	1	0	PTPRU	29514541	1.000000	0.71417	0.927000	0.36925	0.996000	0.88848	9.657000	0.98554	2.579000	0.87056	0.561000	0.74099	GTC	-	PTPRU	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt		0.592	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	0	0		35	35		0.00		G			29641954	+1	4		43		tier1	no_errors	ENST00000345512	ensembl	human	known	74_37	missense	8.51		SNP	1.000	A	4	43
TP53	7157	genome.wustl.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	T	rs587782664		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:7577570C>T	ENST00000269305.4	-	7	900	c.711G>A	c.(709-711)atG>atA	p.M237I	TP53_ENST00000445888.2_Missense_Mutation_p.M237I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000413465.2_Missense_Mutation_p.M237I|TP53_ENST00000420246.2_Missense_Mutation_p.M237I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	GRCh37	CM011014	TP53	M							130.0	102.0	112.0					17																	7577570		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>A	17.37:g.7577570C>T	ENSP00000269305:p.Met237Ile		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.M237I	ENST00000269305.4	37	c.711	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343240	0.82022	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999983	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0		40	40		0.00		C	NM_000546		7577570	-1	28		8		tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	77.78		SNP	1.000	T	28	8
CDC42BPG	55561	genome.wustl.edu	37	11	64594547	64594547	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:64594547C>T	ENST00000342711.5	-	34	4363	c.4364G>A	c.(4363-4365)cGg>cAg	p.R1455Q		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						GGCGCCGGGCCGCCCGTTGGC	0.612													ENSG00000171219																																					0													77.0	73.0	74.0					11																	64594547		2201	4297	6498	SO:0001583	missense	0			-	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.4364G>A	11.37:g.64594547C>T	ENSP00000345133:p.Arg1455Gln			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.R1455Q	ENST00000342711.5	37	c.4364	CCDS31601.1	11	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452594	0.43531	.	.	ENSG00000171219	ENST00000342711	T	0.66815	-0.23	5.0	-5.78	0.02362	.	0.727675	0.11852	N	0.523267	T	0.54319	0.1851	L	0.57536	1.79	0.21604	N	0.999622	B	0.28605	0.217	B	0.22152	0.038	T	0.42732	-0.9434	10	0.52906	T	0.07	.	9.7063	0.40218	0.1022:0.2437:0.0:0.6541	.	1455	Q6DT37	MRCKG_HUMAN	Q	1455	ENSP00000345133:R1455Q	ENSP00000345133:R1455Q	R	-	2	0	CDC42BPG	64351123	0.820000	0.29190	0.000000	0.03702	0.108000	0.19459	-0.147000	0.10234	-1.216000	0.02607	0.561000	0.74099	CGG	-	CDC42BPG	-	NULL		0.612	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPG	HGNC	protein_coding	OTTHUMT00000105352.4	0	0		25	25		0.00		C	XM_290516		64594547	-1	5		26		tier1	no_errors	ENST00000342711	ensembl	human	known	74_37	missense	16.13		SNP	0.586	T	5	26
RP11-583F2.1	0	genome.wustl.edu	37	17	62927326	62927326	+	RNA	SNP	T	T	G			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr17:62927326T>G	ENST00000583052.1	+	0	359																											TATAGGCCCATAAGATGTCCC	0.378													ENSG00000264057																																					0																																												0			-																													17.37:g.62927326T>G				R	SNP	-	NULL	ENST00000583052.1	37	NULL		17																																																																																			-	RP11-583F2.1	-	-		0.378	RP11-583F2.1-003	KNOWN	basic	processed_transcript	ENSG00000264057	Clone_based_vega_gene	pseudogene	OTTHUMT00000445715.1	0	0		23	23		0.00		T			62927326	+1	8		11		tier1	no_errors	ENST00000583052	ensembl	human	known	74_37	rna	42.11		SNP	1.000	G	8	11
HOOK2	29911	genome.wustl.edu	37	19	12874393	12874393	+	Silent	SNP	T	T	C			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:12874393T>C	ENST00000397668.3	-	22	2032	c.1959A>G	c.(1957-1959)cgA>cgG	p.R653R	HOOK2_ENST00000264827.5_Silent_p.R651R|HOOK2_ENST00000589965.1_5'Flank	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	653	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with CNTRL.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						CCCGCTGACTTCGGCTTTTCT	0.527													ENSG00000095066																																					0													196.0	206.0	203.0					19																	12874393		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1959A>G	19.37:g.12874393T>C			O60562	Silent	SNP	pfam_Hook-related_fam,superfamily_UBA-like	p.R653	ENST00000397668.3	37	c.1959	CCDS42508.1	19																																																																																			-	HOOK2	-	pfam_Hook-related_fam		0.527	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	HGNC	protein_coding	OTTHUMT00000451008.1	0	0		40	40		0.00		T	NM_013312		12874393	-1	21		35		tier1	no_errors	ENST00000397668	ensembl	human	known	74_37	silent	37.50		SNP	0.020	C	21	35
ARSE	415	genome.wustl.edu	37	X	2864082	2864082	+	Silent	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chrX:2864082G>A	ENST00000381134.3	-	7	1014	c.948C>T	c.(946-948)caC>caT	p.H316H	ARSE_ENST00000545496.1_Silent_p.H341H|ARSE_ENST00000540563.1_Silent_p.H271H	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	316					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CATACAGCCCGTGGAGACTCT	0.483													ENSG00000157399																																					0													117.0	104.0	108.0					X																	2864082		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.948C>T	X.37:g.2864082G>A			Q53FT2|Q53FU8	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.H341	ENST00000381134.3	37	c.1023	CCDS14122.1	X																																																																																			-	ARSE	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core		0.483	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSE	HGNC	protein_coding	OTTHUMT00000055643.1	0	0		76	76		0.00		G	NM_000047		2864082	-1	13		47		tier1	no_errors	ENST00000545496	ensembl	human	known	74_37	silent	21.67		SNP	0.789	A	13	47
HELZ2	85441	genome.wustl.edu	37	20	62195106	62195106	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr20:62195106G>A	ENST00000467148.1	-	8	5138	c.5069C>T	c.(5068-5070)gCg>gTg	p.A1690V	HELZ2_ENST00000427522.2_Missense_Mutation_p.A1121V	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1690					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										ATGGCCCAGCGCCAGCAGGAT	0.672													ENSG00000130589																																					0													12.0	13.0	13.0					20																	62195106		2174	4279	6453	SO:0001583	missense	0			-	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5069C>T	20.37:g.62195106G>A	ENSP00000417401:p.Ala1690Val		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.A1690V	ENST00000467148.1	37	c.5069	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.139012	0.00335	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.35605	1.3;1.3	4.93	0.238	0.15480	Ribonuclease II/R (2);	0.495041	0.21881	N	0.067727	T	0.21227	0.0511	L	0.39326	1.205	0.18873	N	0.999985	B;B	0.25904	0.137;0.112	B;B	0.19946	0.027;0.024	T	0.33317	-0.9873	10	0.02654	T	1	-27.7587	10.0559	0.42244	0.4596:0.0:0.5404:0.0	.	1690;1121	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	V	1121;1690	ENSP00000393257:A1121V;ENSP00000417401:A1690V	ENSP00000393257:A1121V	A	-	2	0	RP4-697K14.7	61665550	0.076000	0.21285	0.037000	0.18230	0.023000	0.10783	1.205000	0.32308	0.070000	0.16634	-0.424000	0.05967	GCG	-	HELZ2	-	NULL		0.672	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	0	0		47	47		0.00		G	NM_001037335		62195106	-1	36		77		tier1	no_errors	ENST00000467148	ensembl	human	known	74_37	missense	31.86		SNP	0.008	A	36	77
RBMX	27316	genome.wustl.edu	37	X	135956028	135956028	+	3'UTR	DEL	G	G	-	rs377294279		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chrX:135956028delG	ENST00000320676.7	-	0	1603				RBMX_ENST00000496459.2_5'UTR|RBMX_ENST00000570135.1_3'UTR|RBMX_ENST00000431446.3_Intron	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked						cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GTGGCCTTTAGGGGATACTTT	0.348													ENSG00000147274																																					0																																										SO:0001624	3_prime_UTR_variant	0					CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.*273C>-	X.37:g.135956028delG			B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	R	DEL	-	NULL	ENST00000320676.7	37	NULL	CCDS14661.1	X																																																																																				RBMX	-	-		0.348	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	HGNC	protein_coding	OTTHUMT00000058507.1	0	0		26	26		0.00		G	NM_002139		135956028	-1	4		10		tier1	no_errors	ENST00000496459	ensembl	human	known	74_37	rna	28.57		DEL	1.000	-	4	10
CATSPER2P1	440278	genome.wustl.edu	37	15	44028967	44028967	+	RNA	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr15:44028967G>T	ENST00000381680.2	-	0	817				RNU6-354P_ENST00000383862.1_RNA	NR_002318.2				cation channel, sperm associated 2 pseudogene 1																		ATGTTAACTTGTTCTTTCGAT	0.343													ENSG00000205771																																					0																																												0			-	BC066967		15q15.3	2010-07-12			ENSG00000205771	ENSG00000205771			31054	pseudogene	pseudogene							Standard	NR_002318		Approved		uc001zss.3		OTTHUMG00000059938		15.37:g.44028967G>T				R	SNP	-	NULL	ENST00000381680.2	37	NULL		15																																																																																			-	CATSPER2P1	-	-		0.343	CATSPER2P1-002	KNOWN	basic	processed_transcript	CATSPER2P1	HGNC	pseudogene	OTTHUMT00000133242.1	0	0		33	33		0.00		G	NR_002318		44028967	-1	4		28		tier1	no_errors	ENST00000381680	ensembl	human	known	74_37	rna	12.50		SNP	0.001	T	4	28
NUGGC	389643	genome.wustl.edu	37	8	27884481	27884481	+	Missense_Mutation	SNP	G	G	A	rs368238162		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr8:27884481G>A	ENST00000413272.2	-	18	2385	c.2243C>T	c.(2242-2244)gCa>gTa	p.A748V	NUGGC_ENST00000341513.6_Missense_Mutation_p.A748V	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	748					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GTATTTACCTGCAAGCTCCTT	0.473													ENSG00000189233																																					0								G	VAL/ALA	1,3943		0,1,1971	148.0	148.0	148.0		2243	5.8	1.0	8		148	0,8298		0,0,4149	no	missense	C8orf80	NM_001010906.1	64	0,1,6120	AA,AG,GG		0.0,0.0254,0.0082	benign	748/797	27884481	1,12241	1972	4149	6121	SO:0001583	missense	0			-	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.2243C>T	8.37:g.27884481G>A	ENSP00000408697:p.Ala748Val		Q6ZP73	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.A748V	ENST00000413272.2	37	c.2243	CCDS47833.1	8	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710529	0.68730	2.54E-4	0.0	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.13901	2.55;2.55	5.8	5.8	0.92144	.	0.377447	0.25202	N	0.032379	T	0.11110	0.0271	N	0.24115	0.695	0.34669	D	0.723515	B	0.22346	0.068	B	0.15870	0.014	T	0.12941	-1.0528	10	0.36615	T	0.2	-19.1885	15.5707	0.76333	0.0:0.0:1.0:0.0	.	748	Q68CJ6	SLIP_HUMAN	V	748	ENSP00000408697:A748V;ENSP00000345031:A748V	ENSP00000345031:A748V	A	-	2	0	C8orf80	27940400	1.000000	0.71417	0.983000	0.44433	0.963000	0.63663	3.236000	0.51336	2.744000	0.94065	0.655000	0.94253	GCA	-	NUGGC	-	NULL		0.473	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	HGNC	protein_coding	OTTHUMT00000342494.1	0	0		42	42		0.00		G	NM_001010906		27884481	-1	4		42		tier1	no_errors	ENST00000341513	ensembl	human	known	74_37	missense	8.70		SNP	0.979	A	4	42
SHANK1	50944	genome.wustl.edu	37	19	51217492	51217492	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:51217492G>A	ENST00000293441.1	-	4	605	c.587C>T	c.(586-588)gCg>gTg	p.A196V	SHANK1_ENST00000391814.1_Missense_Mutation_p.A196V|SHANK1_ENST00000359082.3_Missense_Mutation_p.A196V	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	196					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CAGCAGCCGCGCCACCTTGTC	0.592													ENSG00000161681																																					0													66.0	54.0	58.0					19																	51217492		2203	4300	6503	SO:0001583	missense	0			-	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.587C>T	19.37:g.51217492G>A	ENSP00000293441:p.Ala196Val		A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.A196V	ENST00000293441.1	37	c.587	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239205	0.58995	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.64803	-0.12;-0.12;-0.12	3.86	3.86	0.44501	Ankyrin repeat-containing domain (4);	0.201872	0.28677	U	0.014512	T	0.41282	0.1152	N	0.13198	0.31	0.43183	D	0.995006	P	0.43519	0.809	B	0.34093	0.175	T	0.47209	-0.9135	10	0.35671	T	0.21	-8.8376	15.7532	0.78005	0.0:0.0:1.0:0.0	.	196	Q9Y566	SHAN1_HUMAN	V	196	ENSP00000293441:A196V;ENSP00000351984:A196V;ENSP00000375690:A196V	ENSP00000293441:A196V	A	-	2	0	SHANK1	55909304	0.982000	0.34865	0.950000	0.38849	0.968000	0.65278	2.603000	0.46266	2.459000	0.83118	0.561000	0.74099	GCG	-	SHANK1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.592	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	0	0		67	67		0.00		G	NM_016148		51217492	-1	5		34		tier1	no_errors	ENST00000391814	ensembl	human	known	74_37	missense	12.82		SNP	0.985	A	5	34
WDR45	11152	genome.wustl.edu	37	X	48932827	48932827	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chrX:48932827C>T	ENST00000376372.3	-	10	1122	c.941G>A	c.(940-942)cGc>cAc	p.R314H	WDR45_ENST00000553851.1_Intron|WDR45_ENST00000485908.1_Missense_Mutation_p.R279H|PRAF2_ENST00000376390.4_5'Flank|PRAF2_ENST00000491199.1_5'Flank|WDR45_ENST00000465431.1_5'Flank|WDR45_ENST00000322995.8_Missense_Mutation_p.R325H|PRAF2_ENST00000376386.3_5'Flank|WDR45_ENST00000376368.2_Missense_Mutation_p.R315H|AF196779.12_ENST00000376358.3_Intron|WDR45_ENST00000356463.3_Missense_Mutation_p.R315H|WDR45_ENST00000473974.1_Intron|WDR45_ENST00000396681.4_Missense_Mutation_p.R300H	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	314					autophagy (GO:0006914)|cell death (GO:0008219)			p.R315H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						GGAAGTATTGCGACCGAAGGC	0.577													ENSG00000196998																																					1	Substitution - Missense(1)	endometrium(1)											72.0	59.0	63.0					X																	48932827		2203	4300	6503	SO:0001583	missense	0			-	BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.941G>A	X.37:g.48932827C>T	ENSP00000365551:p.Arg314His		A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.R325H	ENST00000376372.3	37	c.974	CCDS35250.1	X	.	.	.	.	.	.	.	.	.	.	C	13.75	2.330599	0.41297	.	.	ENSG00000196998	ENST00000376372;ENST00000322995;ENST00000356463;ENST00000485908;ENST00000376368;ENST00000396681	T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	4.09	3.12	0.35913	.	0.157867	0.43260	D	0.000589	T	0.52933	0.1765	N	0.04508	-0.205	0.30259	N	0.793321	P;P;P;B	0.51057	0.941;0.628;0.862;0.002	B;B;B;B	0.43728	0.333;0.115;0.429;0.004	T	0.54077	-0.8347	10	0.30078	T	0.28	-12.9519	5.3767	0.16170	0.2032:0.6827:0.0:0.1141	.	325;279;315;314	Q9Y484-2;C9JYH8;Q9Y484-3;Q9Y484	.;.;.;WIPI4_HUMAN	H	314;325;315;279;315;300	ENSP00000365551:R314H;ENSP00000365543:R325H;ENSP00000348848:R315H;ENSP00000419897:R279H;ENSP00000365546:R315H;ENSP00000379913:R300H	ENSP00000365543:R325H	R	-	2	0	WDR45	48819771	0.998000	0.40836	0.999000	0.59377	0.994000	0.84299	3.158000	0.50723	1.968000	0.57251	0.409000	0.27619	CGC	-	WDR45	-	NULL		0.577	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR45	HGNC	protein_coding	OTTHUMT00000083418.2	0	0		33	33		0.00		C	NM_007075		48932827	-1	8		52		tier1	no_errors	ENST00000322995	ensembl	human	known	74_37	missense	13.33		SNP	0.998	T	8	52
COG2	22796	genome.wustl.edu	37	1	230807385	230807385	+	Splice_Site	SNP	A	A	G			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:230807385A>G	ENST00000366669.4	+	8	1013	c.898A>G	c.(898-900)Agt>Ggt	p.S300G	COG2_ENST00000534989.1_Splice_Site_p.S241G|COG2_ENST00000366668.3_Splice_Site_p.S300G|COG2_ENST00000535166.1_Splice_Site_p.S184G	NM_001145036.1|NM_007357.2	NP_001138508.1|NP_031383.1	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2	300					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|Golgi transport complex (GO:0017119)	protein transporter activity (GO:0008565)			NS(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|urinary_tract(3)	27	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TGCCATCTCCAGGTAATTTAA	0.498													ENSG00000135775																																					0													93.0	92.0	93.0					1																	230807385		2203	4300	6503	SO:0001630	splice_region_variant	0			-	Z34975	CCDS1584.1, CCDS44329.1	1q42.2	2008-02-05	2002-05-28	2002-05-31	ENSG00000135775	ENSG00000135775		"""Components of oligomeric golgi complex"""	6546	protein-coding gene	gene with protein product		606974	"""low density lipoprotein receptor defect C complementing"""	LDLC		7962052	Standard	NM_007357		Approved		uc001htw.3	Q14746	OTTHUMG00000037753	ENST00000366669.4:c.899+1A>G	1.37:g.230807385A>G			Q86U99	Missense_Mutation	SNP	pfam_COG_complex_COG2_C,pfam_COG_su2_N	p.S300G	ENST00000366669.4	37	c.898	CCDS1584.1	1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.913338	0.52439	.	.	ENSG00000135775	ENST00000366669;ENST00000535166;ENST00000366668;ENST00000534989	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.33030	0.0849	M	0.79258	2.445	0.80722	D	1	P;B	0.37688	0.605;0.263	B;B	0.30401	0.115;0.112	T	0.19289	-1.0310	10	0.26408	T	0.33	-13.5721	14.8802	0.70528	1.0:0.0:0.0:0.0	.	300;300	Q86U99;Q14746	.;COG2_HUMAN	G	300;184;300;241	ENSP00000355629:S300G;ENSP00000445724:S184G;ENSP00000355628:S300G;ENSP00000440349:S241G	ENSP00000355628:S300G	S	+	1	0	COG2	228874008	1.000000	0.71417	0.973000	0.42090	0.368000	0.29767	9.316000	0.96319	1.923000	0.55706	0.460000	0.39030	AGT	-	COG2	-	NULL		0.498	COG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COG2	HGNC	protein_coding	OTTHUMT00000092087.1	0	0		68	68		0.00		A	NM_007357	Missense_Mutation	230807385	+1	11		30		tier1	no_errors	ENST00000366669	ensembl	human	known	74_37	missense	26.83		SNP	1.000	G	11	30
YY1	7528	genome.wustl.edu	37	14	100742831	100742831	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr14:100742831G>T	ENST00000262238.4	+	4	1168	c.908G>T	c.(907-909)tGc>tTc	p.C303F		NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	303	Binding to DNA.|Involved in nuclear matrix association.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				TTTAAGGGCTGCACAAAGATG	0.428													ENSG00000100811																																					0													68.0	66.0	67.0					14																	100742831		2203	4300	6503	SO:0001583	missense	0			-	BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.908G>T	14.37:g.100742831G>T	ENSP00000262238:p.Cys303Phe		Q14935	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.C303F	ENST00000262238.4	37	c.908	CCDS9957.1	14	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276223	0.40294	.	.	ENSG00000100811	ENST00000262238;ENST00000553625	T	0.23348	1.91	5.57	5.57	0.84162	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.61800	0.2376	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68853	-0.5299	10	0.87932	D	0	.	19.9056	0.97006	0.0:0.0:1.0:0.0	.	303	P25490	TYY1_HUMAN	F	303;113	ENSP00000262238:C303F	ENSP00000262238:C303F	C	+	2	0	YY1	99812584	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.717000	0.98755	2.773000	0.95371	0.609000	0.83330	TGC	-	YY1	-	smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2		0.428	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY1	HGNC	protein_coding	OTTHUMT00000318277.1	0	0		35	35		0.00		G	NM_003403		100742831	+1	4		38		tier1	no_errors	ENST00000262238	ensembl	human	known	74_37	missense	9.52		SNP	1.000	T	4	38
SOX14	8403	genome.wustl.edu	37	3	137484304	137484304	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr3:137484304G>T	ENST00000306087.1	+	1	726	c.678G>T	c.(676-678)aaG>aaT	p.K226N		NM_004189.3	NP_004180.1	O95416	SOX14_HUMAN	SRY (sex determining region Y)-box 14	226					entrainment of circadian clock (GO:0009649)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|regulation of neuron migration (GO:2001222)|visual perception (GO:0007601)	nuclear transcription factor complex (GO:0044798)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(2)|lung(12)	14						GCATGACCAAGACTGGCATAG	0.642													ENSG00000168875																																					0													52.0	41.0	45.0					3																	137484304		2197	4286	6483	SO:0001583	missense	0			-	AJ006230	CCDS3094.1	3q22-q23	2008-07-18			ENSG00000168875	ENSG00000168875		"""SRY (sex determining region Y)-boxes"""	11193	protein-coding gene	gene with protein product	"""HMG box transcription factor SOX-14"", ""SRY-box 14"""	604747				9925951	Standard	NM_004189		Approved	SOX28	uc003erm.2	O95416	OTTHUMG00000159757	ENST00000306087.1:c.678G>T	3.37:g.137484304G>T	ENSP00000305343:p.Lys226Asn		B2RAC0|Q3KPH7	Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K226N	ENST00000306087.1	37	c.678	CCDS3094.1	3	.	.	.	.	.	.	.	.	.	.	G	17.08	3.297926	0.60086	.	.	ENSG00000168875	ENST00000306087	D	0.97642	-4.47	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.95774	0.8625	N	0.24115	0.695	0.48975	D	0.999731	D	0.67145	0.996	P	0.59487	0.858	D	0.95611	0.8672	10	0.87932	D	0	.	10.9624	0.47393	0.0861:0.0:0.9139:0.0	.	226	O95416	SOX14_HUMAN	N	226	ENSP00000305343:K226N	ENSP00000305343:K226N	K	+	3	2	SOX14	138966994	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.793000	0.85851	2.333000	0.79357	0.561000	0.74099	AAG	-	SOX14	-	NULL		0.642	SOX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX14	HGNC	protein_coding	OTTHUMT00000357182.1	0	0		51	51		0.00		G	NM_004189		137484304	+1	10		20		tier1	no_errors	ENST00000306087	ensembl	human	known	74_37	missense	33.33		SNP	1.000	T	10	20
PELI3	246330	genome.wustl.edu	37	11	66243493	66243493	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr11:66243493G>A	ENST00000320740.7	+	8	1425	c.1265G>A	c.(1264-1266)tGc>tAc	p.C422Y	PELI3_ENST00000349459.6_Missense_Mutation_p.C398Y|CTD-3074O7.5_ENST00000527092.1_RNA|CTD-3074O7.5_ENST00000527274.2_RNA|CTD-3074O7.5_ENST00000533502.1_RNA|CTD-3074O7.5_ENST00000602951.1_RNA|CTD-3074O7.5_ENST00000525142.1_RNA	NM_001243136.1|NM_145065.2	NP_001230065.1|NP_659502.2	Q8N2H9	PELI3_HUMAN	pellino E3 ubiquitin protein ligase family member 3	422					defense response to Gram-negative bacterium (GO:0050829)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Toll signaling pathway (GO:0045751)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon production (GO:0032480)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|protein K63-linked ubiquitination (GO:0070534)|regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070428)|Toll signaling pathway (GO:0008063)	cytosol (GO:0005829)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	15						GGCCACGTCTGCTCTGAGAAG	0.667													ENSG00000174516																																					0													25.0	23.0	24.0					11																	66243493		2175	4243	6418	SO:0001583	missense	0			-	AL834395	CCDS31615.1, CCDS41675.1, CCDS73328.1	11q13.2	2012-02-23	2012-02-23		ENSG00000174516	ENSG00000174516		"""Pellino homologs"""	30010	protein-coding gene	gene with protein product		609827	"""pellino homolog 3 (Drosophila)"""			12874243, 15917247	Standard	NM_145065		Approved	MGC35521	uc001oic.4	Q8N2H9	OTTHUMG00000167109	ENST00000320740.7:c.1265G>A	11.37:g.66243493G>A	ENSP00000322532:p.Cys422Tyr		Q8N3E1|Q8N9Q6|Q8TAW7|Q8TED5	Missense_Mutation	SNP	pfam_Pellino_fam	p.C422Y	ENST00000320740.7	37	c.1265	CCDS31615.1	11	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409469	0.83340	.	.	ENSG00000174516	ENST00000349459;ENST00000320740	T;T	0.50548	0.74;0.74	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	M	0.80616	2.505	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.79108	0.967;0.992	T	0.74760	-0.3556	10	0.87932	D	0	-25.9835	15.3026	0.73966	0.0:0.0:1.0:0.0	.	398;422	Q8N2H9-2;Q8N2H9	.;PELI3_HUMAN	Y	398;422	ENSP00000309848:C398Y;ENSP00000322532:C422Y	ENSP00000322532:C422Y	C	+	2	0	PELI3	66000069	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.657000	0.98554	2.471000	0.83476	0.655000	0.94253	TGC	-	PELI3	-	pfam_Pellino_fam		0.667	PELI3-001	KNOWN	basic|CCDS	protein_coding	PELI3	HGNC	protein_coding	OTTHUMT00000393226.1	0	0		12	12		0.00		G	NM_145065		66243493	+1	7		10		tier1	no_errors	ENST00000320740	ensembl	human	known	74_37	missense	41.18		SNP	1.000	A	7	10
USP18	11274	genome.wustl.edu	37	22	18652696	18652696	+	Missense_Mutation	SNP	G	G	A	rs373096161		TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr22:18652696G>A	ENST00000215794.7	+	7	1143	c.713G>A	c.(712-714)cGt>cAt	p.R238H		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	238	USP.				cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						AAGAAGACCCGTGGGAAACAG	0.522													ENSG00000184979																																					0													38.0	34.0	35.0					22																	18652696		2201	4296	6497	SO:0001583	missense	0			-	AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.713G>A	22.37:g.18652696G>A	ENSP00000215794:p.Arg238His		Q53Y90|Q6IAD9|Q9NY71	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.R238H	ENST00000215794.7	37	c.713	CCDS13752.1	22	.	.	.	.	.	.	.	.	.	.	.	11.94	1.789326	0.31685	.	.	ENSG00000184979	ENST00000215794;ENST00000441683	T	0.05786	3.39	5.22	-6.43	0.01926	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.281510	0.05094	N	0.485846	T	0.05547	0.0146	L	0.49778	1.585	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.47446	-0.9117	10	0.62326	D	0.03	.	2.0616	0.03593	0.3201:0.3524:0.2141:0.1134	.	238	Q9UMW8	UBP18_HUMAN	H	238;70	ENSP00000215794:R238H	ENSP00000215794:R238H	R	+	2	0	USP18	17032696	0.000000	0.05858	0.000000	0.03702	0.831000	0.47069	-1.724000	0.01865	-0.650000	0.05423	-0.254000	0.11334	CGT	-	USP18	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.522	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP18	HGNC	protein_coding	OTTHUMT00000316368.1	0	0		87	87		0.00		G			18652696	+1	14		91		tier1	no_errors	ENST00000215794	ensembl	human	known	74_37	missense	13.33		SNP	0.000	A	14	91
OGDHL	55753	genome.wustl.edu	37	10	50953842	50953842	+	Splice_Site	SNP	A	A	G			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr10:50953842A>G	ENST00000374103.4	-	11	1562		c.e11+1		OGDHL_ENST00000432695.1_Splice_Site|OGDHL_ENST00000419399.1_Splice_Site	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like						glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CCCCAGACCCACCAGGTCCAC	0.562													ENSG00000197444																																					0													104.0	80.0	88.0					10																	50953842		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1476+1T>C	10.37:g.50953842A>G			A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Splice_Site	SNP	-	e10+2	ENST00000374103.4	37	c.1476+2	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	A	21.3	4.136096	0.77662	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5531	0.76170	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	OGDHL	50623848	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.288000	0.96055	2.142000	0.66516	0.533000	0.62120	.	-	OGDHL	-	-		0.562	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	0	0		30	30		0.00		A	NM_018245	Intron	50953842	-1	4		25		tier1	no_errors	ENST00000374103	ensembl	human	known	74_37	splice_site	13.79		SNP	1.000	G	4	25
ELAVL3	1995	genome.wustl.edu	37	19	11565658	11565658	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr19:11565658C>T	ENST00000359227.3	-	7	1211	c.787G>A	c.(787-789)Gcc>Acc	p.A263T	ELAVL3_ENST00000438662.2_Missense_Mutation_p.A256T	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	263					cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						CCATCGATGGCGATCGGCGAG	0.682													ENSG00000196361																																					0													96.0	107.0	103.0					19																	11565658		2203	4298	6501	SO:0001583	missense	0			-		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.787G>A	19.37:g.11565658C>T	ENSP00000352162:p.Ala263Thr		Q16135|Q96CL8|Q96QS9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_R,tigrfam_ELAD_HUD_SF	p.A263T	ENST00000359227.3	37	c.787	CCDS32912.1	19	.	.	.	.	.	.	.	.	.	.	C	9.041	0.989614	0.18966	.	.	ENSG00000196361	ENST00000359227;ENST00000438662	T;T	0.08634	3.07;3.07	4.78	3.68	0.42216	.	0.050512	0.85682	D	0.000000	T	0.02193	0.0068	N	0.02665	-0.54	0.36000	D	0.837341	B;B	0.12013	0.001;0.005	B;B	0.06405	0.001;0.002	T	0.38845	-0.9642	10	0.02654	T	1	.	3.7517	0.08569	0.0:0.6373:0.0:0.3626	.	263;256	Q14576;Q14576-2	ELAV3_HUMAN;.	T	263;256	ENSP00000352162:A263T;ENSP00000390878:A256T	ENSP00000352162:A263T	A	-	1	0	ELAVL3	11426658	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.125000	0.50469	2.231000	0.72958	0.505000	0.49811	GCC	-	ELAVL3	-	tigrfam_ELAD_HUD_SF		0.682	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	HGNC	protein_coding	OTTHUMT00000458827.2	0	0		43	43		0.00		C	NM_001420		11565658	-1	8		35		tier1	no_errors	ENST00000359227	ensembl	human	known	74_37	missense	18.60		SNP	1.000	T	8	35
KHDRBS2	202559	genome.wustl.edu	37	6	62604721	62604721	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr6:62604721A>T	ENST00000281156.4	-	6	907	c.629T>A	c.(628-630)aTt>aAt	p.I210N		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	210					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		GGGAGGAGGAATGGCACCCCC	0.542													ENSG00000112232																																					0													32.0	35.0	34.0					6																	62604721		2203	4300	6503	SO:0001583	missense	0			-	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.629T>A	6.37:g.62604721A>T	ENSP00000281156:p.Ile210Asn		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.I210N	ENST00000281156.4	37	c.629	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	A	12.75	2.031654	0.35797	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.46451	0.87	5.52	5.52	0.82312	.	0.871864	0.10380	N	0.681665	T	0.12774	0.0310	N	0.08118	0	0.35683	D	0.814218	B	0.32160	0.358	B	0.26517	0.07	T	0.08289	-1.0729	10	0.28530	T	0.3	-2.3538	15.9239	0.79597	1.0:0.0:0.0:0.0	.	210	Q5VWX1	KHDR2_HUMAN	N	210	ENSP00000281156:I210N	ENSP00000281156:I210N	I	-	2	0	KHDRBS2	62662680	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.463000	0.60128	2.207000	0.71202	0.533000	0.62120	ATT	-	KHDRBS2	-	NULL		0.542	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2	0	0		55	55		0.00		A	NM_152688		62604721	-1	9		50		tier1	no_errors	ENST00000281156	ensembl	human	known	74_37	missense	15.25		SNP	1.000	T	9	50
NRD1	4898	genome.wustl.edu	37	1	52305981	52305981	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr1:52305981C>T	ENST00000354831.7	-	2	736	c.547G>A	c.(547-549)Gat>Aat	p.D183N	NRD1_ENST00000539524.1_Missense_Mutation_p.D51N|NRD1_ENST00000352171.7_Missense_Mutation_p.D183N|NRD1_ENST00000544028.1_Missense_Mutation_p.D51N|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						agatcatcatcatgttcatca	0.373													ENSG00000078618																																					0													238.0	199.0	212.0					1																	52305981		2203	4300	6503	SO:0001583	missense	0			-	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.547G>A	1.37:g.52305981C>T	ENSP00000346890:p.Asp183Asn		A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.D183N	ENST00000354831.7	37	c.547	CCDS559.1	1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093931	0.36952	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.46451	1.32;3.33;0.87;1.33	4.96	4.96	0.65561	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.608391	0.15383	N	0.265194	T	0.25306	0.0615	N	0.08118	0	0.21822	N	0.999525	B;P;P	0.34522	0.361;0.455;0.455	B;B;B	0.34242	0.178;0.135;0.086	T	0.13926	-1.0491	10	0.34782	T	0.22	-0.7399	13.5536	0.61747	0.0:1.0:0.0:0.0	.	183;182;183	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	N	183;183;51;183;51	ENSP00000262679:D183N;ENSP00000346890:D183N;ENSP00000444416:D51N;ENSP00000442262:D51N	ENSP00000262679:D183N	D	-	1	0	NRD1	52078569	0.806000	0.28996	1.000000	0.80357	0.963000	0.63663	0.930000	0.28858	2.558000	0.86282	0.555000	0.69702	GAT	-	NRD1	-	superfamily_Metalloenz_LuxS/M16		0.373	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	HGNC	protein_coding	OTTHUMT00000023045.1	0	0		31	31		0.00		C	NM_002525		52305981	-1	4		35		tier1	no_errors	ENST00000354831	ensembl	human	known	74_37	missense	10.26		SNP	1.000	T	4	35
DNAJC13	23317	genome.wustl.edu	37	3	132175605	132175605	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr3:132175605G>T	ENST00000260818.6	+	12	1526	c.1278G>T	c.(1276-1278)gaG>gaT	p.E426D	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	426					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CGGAACTTGAGAGTCAGTTCC	0.443													ENSG00000138246																																					0													100.0	96.0	98.0					3																	132175605		2203	4300	6503	SO:0001583	missense	0			-	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1278G>T	3.37:g.132175605G>T	ENSP00000260818:p.Glu426Asp		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.E426D	ENST00000260818.6	37	c.1278	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091065	0.76756	.	.	ENSG00000138246	ENST00000260818	T	0.41065	1.01	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.61515	0.2353	M	0.82923	2.615	0.58432	D	0.999991	D;D;P	0.69078	0.986;0.997;0.956	P;D;D	0.65010	0.873;0.921;0.931	T	0.65957	-0.6042	10	0.62326	D	0.03	.	7.6819	0.28518	0.1918:0.0:0.8082:0.0	.	426;93;426	A7E2Y5;Q8N7A5;O75165	.;.;DJC13_HUMAN	D	426	ENSP00000260818:E426D	ENSP00000260818:E426D	E	+	3	2	DNAJC13	133658295	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.822000	0.48073	2.778000	0.95560	0.655000	0.94253	GAG	-	DJC13	-	NULL		0.443	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DJC13	HGNC	protein_coding	OTTHUMT00000356807.2	0	0		29	29		0.00		G	NM_015268		132175605	+1	3		21		tier1	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	12.50		SNP	1.000	T	3	21
DTX1	1840	genome.wustl.edu	37	12	113496104	113496104	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A7EU-01A-22D-A36J-09	TCGA-DX-A7EU-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	3ace7f8c-f2d1-4d11-a831-3a6c4596b7cc	e53ef50a-f7fe-49d0-a177-771e1fad6e10	g.chr12:113496104G>A	ENST00000257600.3	+	1	610	c.107G>A	c.(106-108)cGc>cAc	p.R36H		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	36	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						GAGCACAGCCGCTGGCGGCCC	0.672													ENSG00000135144																																					0													71.0	62.0	65.0					12																	113496104		2203	4299	6502	SO:0001583	missense	0			-	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.107G>A	12.37:g.113496104G>A	ENSP00000257600:p.Arg36His		O60630|Q9BS04	Missense_Mutation	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.R36H	ENST00000257600.3	37	c.107	CCDS9164.1	12	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654946	0.88056	.	.	ENSG00000135144	ENST00000257600	T	0.45668	0.89	3.9	3.9	0.45041	WWE domain (2);WWE domain, subgroup (1);	0.000000	0.64402	U	0.000001	T	0.50786	0.1636	L	0.38175	1.15	0.53688	D	0.999975	D	0.89917	1.0	D	0.81914	0.995	T	0.38351	-0.9665	10	0.17369	T	0.5	-5.0661	14.8783	0.70513	0.0:0.0:1.0:0.0	.	36	Q86Y01	DTX1_HUMAN	H	36	ENSP00000257600:R36H	ENSP00000257600:R36H	R	+	2	0	DTX1	111980487	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.164000	0.77533	2.021000	0.59480	0.555000	0.69702	CGC	-	DTX1	-	pfam_WWE-dom,smart_WWE-dom_subgr,pfscan_WWE-dom		0.672	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX1	HGNC	protein_coding	OTTHUMT00000405045.2	0	0		49	49		0.00		G			113496104	+1	9		97		tier1	no_errors	ENST00000257600	ensembl	human	known	74_37	missense	8.49		SNP	1.000	A	9	97
